(12) United States Patent (10) Patent No.: US 9,029.413 B2 Munger Et Al

USOO902941.3B2

(12) United States Patent (10) Patent No.: US 9,029.413 B2 Munger et al. (45) Date of Patent: *May 12, 2015

(54) TREATMENT OF VIRAL INFECTIONS BY 31/405 (2013.01); A61 K3I/381 (2013.01); MODULATION OF HOST CELL METABOLC A6 IK3I/336 (2013.01); A61 K3I/341 PATHWAYS (2013.01) (58) Field of Classification Search (75) Inventors: Josh Munger, Rochester, NY (US); USPC ...... 514/.461, 445, 438,471, 451, 460, 47 Bryson Bennett, Metuchen, NJ (US); See application file for complete search history. Thomas Shenk, Princeton, NJ (US); Joshua Rabinowitz, Princeton, NJ (US) (56) References Cited (73) Assignee: The Trustees of Princeton University, Princeton, NJ (US) U.S. PATENT DOCUMENTS 3,983,140 A 9, 1976 Endo et al. (*) Notice: Subject to any disclaimer, the term of this 4,231,938 A 11/1980 Monaghan et al. patent is extended or adjusted under 35 4,334,913 A 6, 1982 Koerwer 4,346,227 A 8, 1982 Terahara et al. U.S.C. 154(b) by 0 days. 4,448,784. A 5/1984 Glamkowski et al. This patent is Subject to a terminal dis 4.450,171 A 5/1984 Hoffman et al. 4,499,289 A 2f1985 Baran et al. claimer. 4,598,089 A 7/1986 Hadvary et al. 4,602,099 A 7, 1986 Parker (21) Appl. No.: 13/438,616 4,613,610 A 9/1986 Wareing 4,647,576 A 3, 1987 Hoefleet al. (22) Filed: Apr. 3, 2012 4,681,893 A 7, 1987 Roth (Continued) (65) Prior Publication Data US 2013/OO65850 A1 Mar. 14, 2013 FOREIGN PATENT DOCUMENTS EP O374886 6, 1990 FR 2425432 12, 1979 Related U.S. Application Data (Continued) (63) Continuation of application No. 12/156.517, filed on Jun. 2, 2008, now Pat. No. 8,158,677. OTHER PUBLICATIONS (60) Provisional application No. 60/932,769, filed on Jun. Shen et al., “A Mechanism for the Potent Inhibition of Eukaryotic 1, 2007, provisional application No. 61/033,243, filed Acetyl-Coenzyme A Carboxylase by Soraphen A, a Macrocyclic on Mar. 3, 2008. Polyketide Natural Product”, Molecular Cell, 16(22):881-891. (Continued) (51) Int. Cl. A6 IK3I/38 (2006.01) A6 IK3I/34 (2006.01) A6 IK3I/335 (2006.01) Primary Examiner — Shengjun Wang A6 IK3I/405 (2006.01) (74) Attorney, Agent, or Firm — Kenyon & Kenyon LLP A6 IK3I/225 (2006.01) A6 IK3I/435 (2006.01) (57) ABSTRACT A6 IK3I/522 (2006.01) A6 IK3I/70 (2006.01) Alterations of certain metabolite concentrations and fluxes A6 IK3I/24 (2006.01) that occur in response to viral infection are described. Host A6 IK3I/35 (2006.01) cell enzymes in the involved metabolic pathways are selected A6 IK3I/365 (2006.01) as targets for intervention; i.e., to restore metabolic flux to A6 IK3I/38 (2006.01) disadvantage viral replication, or to further derange meta A6 IK3I/336 (2006.01) bolic flux resulting in "suicide' of viral-infected cells (but not A6 IK3I/34 (2006.01) uninfected cells) to limit viral propagation. While any of the A61 K3 1/351 (2006.01) enzymes in the relevant metabolic pathway can be selected, A61 K3I/675 (2006.01) pivotal enzymes at key control points in these metabolic A61 K3 L/706 (2006.01) pathways are preferred as candidate antiviral drug targets. A61 K3I/44 (2006.01) Inhibitors of these enzymes are used to reverse, or redirect, A61 K3 1/22 (2006.01) the effects of the viral infection. Drug candidates are tested A61 K3 1/221 (2006.01) for antiviral activity using screening assays in vitro and host A61 K3I/52 (2006.01) cells, and in animal models. Animal models are then used to (52) U.S. Cl. test efficacy of candidate compounds in preventing and treat CPC ...... A6 IK3I/365 (2013.01); A61 K31/351 ing viral infections. Antiviral activity of enzyme inhibitors is (2013.01); A61 K 3 1/675 (2013.01); A61 K demonstrated. 3 1/706 (2013.01); A61 K 3 1/44 (2013.01); A61 K 3 1/22 (2013.01); A61 K 31/221 (2013.01); A61 K 3 1/522 (2013.01); A61 K 3 1/52 (2013.01); A61 K 31 Claims, 26 Drawing Sheets US 9,029.413 B2 Page 2

(56) References Cited Parker et al. “5-(tetradecyloxy)-2-furancarboxylic acid and related hypolipidemic fatty acid-like alkoxyarylcarboxylic acids.” J. Med. U.S. PATENT DOCUMENTS Chem. 1977, vol. 20, No. 6, pp. 781-791. Munger, et al., “Systems-level metabolic flux profiling identifies fatty 4,686,237 A 8, 1987 Anderson acid synthesis as a target for antiviraltherapy'. Nature Biotechnology 5,006,530 A 4, 1991 Angerbauer et al. (2008) vol. 26: pp. 1179-1186. 5,011,930 A 4, 1991 Fujikawa et al. 5,026,878 A 6, 1991 Bohlendorf et al. Ikuta, et al., “Inhibition of Cleavage of Moloney Murine Leukemia 5,177,080 A 1/1993 Angerbauer et al. Virus gag and env Coded Precursor Polyproteins by Cerulenin”. 5,188,830 A 2, 1993 Atkinson et al. Virology (1986) vol. 154: pp. 195-206. 5, 190,969 A 3, 1993 Blumenstein Krieger, N. et al., Enhancement of Hepatitis C Virus RNA Replica 5,260,440 A 11/1993 Hirai et al. tion by Cell Culture-Adaptive Mutations, Journal of Virology 5,273,995 A 12, 1993 Roth (2001), vol. 75:10, pp. 4614-4624. 5,354,772 A 10, 1994 Kathawala Search Report dated Jul. 14, 2010 from related European Application 5,385,929 A 1/1995 Bjorge et al. No. 08827.478.2. 5.447,954 A 9, 1995 Gribble et al. Official Communication dated Jul. 27, 2010 from related European 5,491,123 A 2/1996 Hagen et al. Application No. 08827478.2. 5,506,219 A 4, 1996 Rob Freiberg et al., “Discovering the Mechanism of Action of Novel 5,614,551 A 3, 1997 Dick Antibacterial Agents Through Transcriptional Profiling of Condi 5,686,104 A 11, 1997 Mills et al. 5,691322 A 11, 1997 Rob tional Mutants, 2005'. Antimicrob. Agents Chemother, 49(2):749 5,753,675 A 5, 1998 Wattanasin 759. 6,103,664 A 8, 2000 Sievernich et al. Pohlmann et al., “Pyrrolidinedione Derivatives as Antibacterial 6,153,589 A 11/2000 Blumenstein et al. Agents with a Novel Mode of Action', 2005, Bioorg. Med. Chem. 6,383,987 B1 5/2002 von der Heyde et al. Lett. 15:1189-1192. 6,506,559 B1 1/2003 Fire et al. Clarket al., “Phenoxy Thiazole Derivatives as Potent and Selective 6,576,636 B2 6, 2003 Webb et al. Acetyl-CoA Carboxylase 2 Inhibitors: Modulation of Isozyme Selec 6,875,781 B2 4/2005 Hong et al. tivity by Incorporation of Phenyl Ring Substituents.” 2007, Bioorg. 7,078,543 B2 7/2006 Cernerud et al. Med. Chem. Lett. 17:1961-1965. 7,211,423 B2 5/2007 Cheng et al. Gu et al., “Synthesis and Structure-Activity Relationships of N-3- 8, 158,677 B2* 4/2012 Munger et al...... 514,473 2-(4-Alkoxyphenoxy) Thiazol-5-yl-1-Methylprop-2-ynyl 2002fO086356 A1 7/2002 TuSchlet al. 2002fO114784 A1 8, 2002 Li et al. Carboxy Derviatives as Selective Acetyl-CoA Carboxylase 2 Inhibi 2003/O15357O A1 8, 2003 Bhatt et al. tors,” 2006, J. Med. Chem. 49:3770-3773. 2003. O158156 A1 8/2003 Syverson et al. Camps et al., “Blockade of PI3K (Suppresses Joint Inflammation and 2005.000914.0 A1 1/2005 Mukerji et al. Damage in Mouse Models of Rheumatoid Arthritis.” 2005, Nat. Med. 2005.0089981 A1 4/2005 Napier et al. 11(9):936-943. 2005/01 19251 A1 6, 2005 Fu et al. Petiotet al., “Distinct Classes of Phosphatidylinositol 3p-Kinases are 2005/0239877 A1 10/2005 Gomez et al. Involved in Signaling Pathways That Control Macroautophagy in 2006/0241177 A1 10/2006 Kuhadja et al. H-29 Cells.” 2000, J. Biol. Chem. 275(2): 992-998. 2008, 0026363 A1 1/2008 Cheng et al. Couzin, “Small RNAs Make Big Splash.” 2002, Science 298:2296 2008.0161256 A1 7/2008 Morrisey et al. 22.97. McManus et al., “Gene Silencing in Mammals by Small Interfering FOREIGN PATENT DOCUMENTS RNAs. 2002, Nat. Rev. Genet. 3:737-747. Hannon, “RNA Interference. 2002, Nature 418:244-251. FR 2457864 12, 1980 Paddison et al., “RNA Interference: The New Somatic Cell Genet GB 22O5837 12, 1988 ics?, 2002, Cancer Cell 2:17-23. WO 86,03488 6, 1986 WO 86,07054 12, 1986 Elbashir et al., “Functional Anatomy of siRNAs for Mediating Effi WO 97, 18806 5, 1997 cient RNAi in Drosophila melanogaster Embryo Lysate.” 2001. The WO 02/16369 2, 2002 EMBO Journal, 20023):6877-6888. WO O2/44321 6, 2002 Tuschl et al., “Targeted mRNA Degradation by Double-Stranded WO O3,OO6477 1, 2003 RNA in Vitro, 1999, Genes Dev. 13:3191-3197. WO WOO3,O11867 2, 2003 Hutvagner et al., “A microRNA in a Multiple-turnover RNAi Enzyme WO O3 O72197 9, 2003 Complex,” Science 297:2056-2060. WO O3 O72557 9, 2003 Lee et al., “The C. elegans Heterochronic Gene lin-4 Encodes Small WO 2004/041 189 5, 2004 RNAs with Antisense Complementairty to lin-14, 1993, Cell WO 2004/078754 9, 2004 T5:843-854. WO 2004/096797 11, 2004 WO 2005/011655 2, 2005 Reinhart et al., The 21-Nucleotide let-7 RNA Regulates Develop WO 2005/O18534 3, 2005 mental Timing in Caenorhaditis elegans, 2000, Nature 403:901-906. WO 2005/021519 3, 2005 Lee et al., “An Extensive Class of Small RNAs in Caenorhabditis WO 2005/042708 5, 2005 elegans.” 2001 Science 294:862-864. WO 2005/051296 6, 2005 Lau et al., “An Abundant Class of Tiny RNAs with Probable Regu WO 2005/068444 7/2005 latory Roles in Caenorhabiditis elegans.” 2001, Science 294:858 WO 2007/099236 9, 2007 862. WO 2008/O14219 1, 2008 Hutvagner et al., “A Cellular Function for the RNA-Interference OTHER PUBLICATIONS Enzyme Dicer in the Maturation of the let-7 Small Temporal RNA.” 2001, Science 293:834-838. Office Action for U.S. Appl. No. 12/156.517, mailed Aug. 4, 2010, Zeng et al., “Both Natural and Designed MicroRNAs Can Inhibit the and response filed on Feb. 4, 2011. Expression of Cognate mRNAS When Expressed in Human Cells.” Office Action for U.S. Appl. No. 12/156,517, mailed Apr. 13, 2011, 2002, Molec. Cell 9:1327-1333. and response filed on Oct. 11, 2011. Wang et al., “Characterization of HSCD5, a Novel Human Stearoyl Stephenson “New HIV Prevention strategies urged.” JAMA, 2004, CoA Desaturase Unique to Primates.” 2005, Biochem. Biophys.Res. vol. 202, No. 1 0, pp. 1163-1164. Comm. 332:735-742. Nyholm et al. “Prevention of Maternal cytomegalovirus infection Pizer et al., Inhibition of Fatty Acid Synthesis Induces Programmed current status and future prospects, International J. Women's health.” Cell Death in Human Breast Cancer Cells, 1996, Cancer Res. 2010, pp. 23-35. 56:2745-2747. US 9,029.413 B2 Page 3

(56) References Cited Zecherle et al., “Purines are Required at the 5 Ends of Newly Initi ated RNAs for Optimal RNA Polymerase III Gene Expression.” OTHER PUBLICATIONS 1996, Mol. Cell. Biol. 16(10):5801-5810. Fruscoloniet al., “Mutational Analysis of the Transcription Start Site Pizer et al., “Pharmacological Inhibitors of Mammalian Fatty Acid Synthase Suppress DNA Replication and Induce Apoptosis in Tumor of the Yeast tRNA's Gene.” 1995, Nucleic Acids Research, Cell Lines. 1998, Cancer Res. 58:46 11-4615. 23(15):2914-2918. Pizer et al., “Malonyl-Coenzyme-A is a Potential Mediator of Mattaj et al., "Changing the RNA Polymerase Specificity of U. Cytotoxicity Induced by Fatty-Acid Synthase Inhibition in Human snRNA Gene Promoters.” 1988, Cell 55:435-442. Breast Cancer Cells and Xenografts,” 2000, Cancer Res.60:213-218. McCaffrey et al., “RNA Interference in Adult Mice.” 2002, Nature Rassmann et al., “The Human Fatty Acid Synthase: A New Thera 418:38-39. peutic Target for Coxsackievirus B3-Induced Diseases?,” 2007, Anti Xia et al., "siRNA-Mediated Gene Silencing in Vitro and in Vivo.” viral Res. 76:150-158. 2002, Nat. Biotech. 20:1006-1010. Gibson et al., "Toxicity and Teratogenicity Studies with the Lewis et al., “Efficient Delivery of siRNA for Inhibition of Gene Hypolipidemic Drug RMI 14,514 in Rats.” 1981, Fundamental Appl. Expression in Postnatal Mice.” 2002, Nat. Genetic 32: 107-108. Toxicol. 1:19-25. Rubinson et al., “A Lentivirus-Based Systems to Functionally Peschko et al., “First Total Synthesis of the Marine Alkaloids Silence Genes in Primary Mammalian Cells and Transgenic Mice by Purpurone and Ningalin C.” 2000, Tetrahedron Letters 41:9477 RNA Interference.” 2003, Nat. Genetic 33(3):401–406 (Abstract). 9481. Tiscornia et al., “A General Method for Gene Knockdown in Mice by Saxty et al., "Synthesis and Evaluation of (+) and (-)-2,2- Using Lentiviral Vectors Expressing Small Interfering RNA.” 2003, Difluorocitrate as Inhibitors of Rat-Liver ATP-Citrate Lyase and Por Proc. Natl. Acad. Sci. USA 100(4): 1844-1848. cine-Heart Aconitase.” 1992, Eur, J. Biochem. 202:889-896. Martinez et al., "Synthetic Small Inhibiting RNAs. Efficient Tools to Dolle et al., “Synthesis of Novel Thiol-Containing Citric Acid Ana Inactivate Oncogenic Mutations and Restore p53 Pathways.” 2002, logues. Kinetic Evaluation of These and Other Potential Active-Site Proc. Natl. Acad. Sci. USA99(23): 14849-14854. Directed and Mechanism-Based Inhibitors of APT Citrate Lyase.” Wilda et al., "Killing of Leukemic Cells with a BCR/ABL Fusion 1995, J. Med. Chem. 38:537-543. Gene by RNA Interference (RNAi).” 2002. Oncogene 21:5716-5724. Usher et al., "A Very Short Hydrogen Bond Provides Only Moderate Aza-Blanc et al., “Identification of Modulators of Trail-Induced Stabilization of an Enzyme-Inhibitor Complex of Citrate Synthase.” Apoptosis via RNAi-Based Phenotypic Screening.” 2003, Mol. Cell 1994, Biochemistry 33:7753-7759. 12:627-637. Charlier et al., “Inactivation of 3-Hydroxl-3-Methylglutaryl-CoA Munger et al., “Dynamics of the Cellular Metabolome During Synthase and Other Acyl-CoA-Utilizing Enzymes by Human Cytomegalovirus Infection.” 2006, PLoS Pathogens 3-Oxobutylsulfoxyl-CoA.” 1997, Biochemistry 36:1551-1558. 2(12): 1165-1175. Lawrence et al., "Structure-Activity Studies of Cerulenin Analogues Yuan et al., "Kinetic Flux Profiling of Nitrogen Assimilation in as Protein Palmitoylation Inhibitors.” 1999, J. Med. Chem, 42:4932 Escherichia coli,” 2006, Nat. Chem. Biol. 2(10):529-530. 4941. Sagan et al., “The Influence of Cholesterol and Lipid Metabolism on Parker et al., “5-(Tetradecyloxy)-2-Furancarboxylic Acid and Host Cell Structure and Hepatitis C Virus Replication.” 2006, Related Hypolipidemic Fatty Acid-Like Alkyloxyarylcarboxylic Biochem. Cell. Biol. 84:67-79. Acids.” 1977, J. Med. Chem. 20:(6):781-791. Kapadia et al., Hepatitis C Virus RNA Replication is Regulated by Liu et al., “Discovery of Potent, Selective, Orally Bioavailabe Host Geranylgeranylation and Fatty Acids, 2005, PNAS Stearoyl-CoA Desaturase 1 Inhibitors.” 2007, J. Med. Chem. 102(7):2561-2566. 50:3086-3100. Potenta et al., “Hydroxymethyl-Glutaryl Coenzyme A Reductase Freiberg et al., “Identification and Characterization of the First Class Inhibition Limits Cytomegalovirus Infection in Human Endothelial of Potent Bacterial Acetyl-CoA Carboxylase Inhibitors with Anti Cells.” 2004, Circulation 109:532-536. bacterial Activity,” 2004, J. Biol. Chem. 279(25): 26066-26073. Lin et al., "Cholesterol Requirement of Hepatitis B Surface Antigen Wightman et al., “Posttranscriptional Regulation of the (HBSAg) Secretion.” 2003, Virology 314:253-260. Heterochronic Gene lin-14 by lin-14 Mediates Temporal Pattern Hak et al., "16" European Congress of Clinical Microbiology and Formation in C. elegans.” 1993, Cell 75:855-862. Infectious Diseases.” Nice, France, Abstract, 2006, www. Grishok et al., “Genes and Mechanisms Related to RNA Interference blackwellpublishing.com/eccmid 16/abstract.asp?id=49073. Regulate Expression of the Small Temporal RNAs that Control C. Zhu et al., "Inhibition of Cyclooxygenase 2 Blocks Human elegans Development Timing.” 2001, Cell 106:23-34. Cytomegalovirus Replication.” 2002, PNAS 99(6):3932-3937. Ketting et al., “Dicer Functions in RNA Interference and in Synthesis Harwood et al., “Isozyme-Nonselective N-Substituted of Small RNA Involved in Development Timing in C. elegans.” 2001, Bipiperidylcarboxamide Acetyl-CoA Carboxylase Inhibitors Genes Dev. 15:2654-2659. Reduce Tissue Malonyl-CoA Concentrations, Inhibit Fatty Acid Syn Williams et al., "Argonautel is Required for Efficient RNA Interfer thesis, and Increase Fatty Acid Oxidation in Cultured Cells and in ence in Drosophila Embryos.” 2002, proc. Natl. Acad. Sci. USA Experimental Animals.” 2003, J. Biol. Chem. 278(39):37099-37111. 99(10):6889-6894. Kapadia et al., "Initiation of Hepatitis CVirus Infection is Dependent Hammond et al., "Argonaute2, a Link Between Genetic and Bio on Cholesterol and Cooperativity between CD81 and Scavenger chemical Analysis of RNAi.” 2001, Science 293: 1146-1150. Receptor B Type I.” Jan. 2007, Journal of Virology, 81(1): 374-383. Mourelatos et al., “miRNPs: A Novel Class of Ribonucleoproteins Kariya et al., “Inhibition of Fatty Acid Synthesis by RMI 14,514(5- Containing Numerous microRNAs.” 2002, Genes Dev. 16:720-728. tetradecyloxy-2-furoic acid).” Feb. 1978, Biochemical and Biophysi Chen et al., “Inhibition of Hepatitis B Virus Replication by Stably cal Research Communications, 80(4): 1022-1024. Expressed shRNA.” 2003, Biochem. Biophys. Res. Commun. Landini, "Early Enhanced Glucose Uptake in Human 3 11:398-404. Cytomegalovirus-Infected Cells.” 1984, Journal of General Virology, Yuan et al., “Mammalian Pol III Promoter H1 Can Transcribe shRNA 65:1229-1232. Inducing RNAi in Chicken Cells.” 2006, Mol. Bio. Rep. 33:33-41. Bacon, "Clinical Case: Management of Patients with Chronic Hepa Scherer et al., “RapidAssessment of Anti-HIV siRNA Efficacy Using titis C from the book Management of Patients with Viral Hepatitis.” PCR-Derived Pol III shRNA Cassettes.” 2004, Mol. Ther. 10(3):597 Marcellin ed., Nouvelle Imprimerie Laballery, Clamecy, France, Jan. 603. 2007, p. 143-7. Amarzguioui et al., "Approaches for Chemically Synthesized siRNA and Vector-Mediated RNAi.” 2005, FEBS Letters 579:5974-5981. * cited by examiner U.S. Patent May 12, 2015 Sheet 1 of 26 US 9,029.413 B2

Nucleic Acid DNA 3. lcOSohedral Complex

NakedEnveloped Or Noked Enveloped envelopedNaked/ (cytoplasmicco nvelope (cycoplasmic) Cenome SS linear SS ds ds ds ds ds ds ds () or () circular circulor circulo? linear circle linear linear COValently gopped joined ends Baltimore Class II II I I I I I I I

Family name Parvo Circo Polyoma Papilloma Adeno Hepadna Herpes Irido Virionpolymerose () () () () () () () () () Vrion 18-26 12-26 40 55 70-90 42 150-200 125-300 70-200 diameter (nm) X 300-450 Cenometo size 5 18–23 5 7-8 36-38 32 120-20 150-50 130-280 HSV W/V Woriol (bio defense) HCMV (Vaccinia EBV KSHV FIG. 1A U.S. Patent May 12, 2015 Sheet 2 of 26 US 9,029.413 B2

RNA lcOSOhedral h Naked Enveloped Enveloped

ds dis (+) SS (+) SS (+) SS () SS (+) ss (+) SS (-) SS (-) SS (-) SS (-) SS (-) SS (-) SS 10-18 2 2 Copies 3 8 2 segments segments segments seyents segments III III IW IW IW IW WI IW W W W W W W

(3 (3. & S 3. S. 88s.

Re0 Birna Calici Picorna Flavi Togo Retro Corona Filo Rhabdo Bunya Ortho-Poro- Arena | | | | | | | | | | | myxo myxo

60-80() ()60 55-40() 28-30() 40-50() 60-70() 80-150() 80-160() 80x() ()70- 90-120() 90-120() 150-300() 50-500() 790–14,000 85X 19:18) 22-27 7 8 7.2-8.4 10 12 55-9 16-21 12.7 13-16 13.5-21 13.6 16-20 10-14

Dengue HIV FLU HCW (lenti Vector) MeOsles SARS

Ebolo Marburg (bio-defense) FIG. 1B U.S. Patent May 12, 2015 Sheet 3 of 26 US 9,029.413 B2

Mitochondrion Cytosol Fatty Acid Biosynthesis

eas 5Ac. .A esessex's

N OxaloOCetote Cycle N s V N es S. East E ass 2 FIG. 2A

1.0 Citrote Molote 0.8 O Infected 6 0.6 O Mock infected

5 0.4 S 0.2 0.0 O 20 40 60 80 100 120 O 20 40 60 80 100 120 Duration of Labeling (min) Duration of Labeling (min) FIG. 2B U.S. Patent May 12, 2015 Sheet 4 of 26 US 9,029.413 B2

2000

1500

1000

500

O Fibroblasts CMV alone infection

FG. 3 U.S. Patent May 12, 2015 Sheet 5 of 26 US 9,029.413 B2

C75: HSV Viral Replication

Fatty Acid Synthase inhibitor

FG. 4 U.S. Patent May 12, 2015 Sheet 6 of 26 US 9,029.413 B2

C75: HCMV Viral Replication

Fatty Acid Synthase inhibitor

FGS U.S. Patent May 12, 2015 Sheet 7 of 26 US 9,029.413 B2

Etomoxir: HCMV Viral Replication

1.OOE-05 -

1.OOE-04 -

1.OOE-03

1.OOE-02 Etomoxir DMSO

F.G. 6 U.S. Patent May 12, 2015 Sheet 8 of 26 US 9,029.413 B2

to r n ve

Ox Suno uo O X Suno uo

to a r en q .0 x Sunoo uo O X Sunoo uo U.S. Patent May 12, 2015 Sheet 9 of 26 US 9,029.413 B2

0 x Sunoo uo

O X Sunoo uo

001, 08

O X SUO) uo U.S. Patent May 12, 2015 Sheet 10 of 26 US 9,029.413 B2

009 C 0 x Sunoo uo O X Sunoso uo o U.S. Patent US 9,029.413 B2

00; 00€ O X Sunoo uo O X SunOO uO U.S. Patent May 12, 2015 Sheet 12 of 26 US 9,029.413 B2

II‘5) U.S. Patent May 12, 2015 Sheet 13 of 26 US 9,029.413 B2

Integrated metabolimic and fluxomic analysis of cellular response to viral infection Gools: 1. Measure the metabolome of primary fibroblasts during human cytomegalovirus (HCMV) infection 2. Determine the major flux changes induced by the virus 3. Compore metabolic changes to transcriptional Ones 4. Use the data to identify new ways to treat viral infections

How do we meOSure metabolites? LC-ES-triple quadrupole MS/MS Step 1: Step 2: Step 5: Step 4: Separate by polarity lonize Separate and identify by Quantity molecular weight

Cell Extract 01 Colision Cell 03 Electrospray Triple quadtrupole ion HPLC ion Source mass spectrometer detector

FIG. 12A U.S. Patent May 12, 2015 Sheet 14 of 26 US 9,029.413 B2

Does the virus disrupt normal metabolic homeostasis? a. ed HCMV infected x 72h 35 & 5 O Actively Growing gése 30 d 2 %3 3. S.5 S. s:st 2520:335 a 3 B3. A 15332 % s sei5 s 10335 ? % &% "s 2A2.É. etabolite Does transcription play a key role? 6 IncreOSed SS HCMV DeCreosed transCription of 5 4. transcription of upstream of downstream enzyme i52 Control enzyme (enolase)eOIOSe Se (pyruvatepyruvote kinase)Kinase O 20 406080 100 hours post infection

How do we measure fluxes? Kinetic flux profiling with uniformly 'C-glucose Pull samples Measure labeled Grow Cells Pulse-switch Ofter Several "... in natural into some timepoints comp isotope Conditions 2 In Samples u-O- 2N

XX NN 2N Observed first-Order rote Constant -e- for loss of unlabeled metabolite T Metabolite flux IntroCellular Concentration of metabolite FIG. 12B U.S. Patent May 12, 2015 Sheet 15 of 26 US 9,029.413 B2

How does the virus impact glycolysis? Both concentrations and fluxes increase

E-o infected ---- Lobeled D-e Mock - Unlabeled

Fructose Bisphosphate Phosphoenopyruvate e e 5 4. 2 2 3 s s 3 3 2 5 3 1 O O 1 2 3 4 5 O 2 3 4. 5 Duration of labeling (min) Duration of labeling (min)

The pentose phosphate pathway? Overall flux unchanged, but more outflow to nucleotides

Ribose Phosphate PRPP

O 5 10 15 20 25 50 O 20 40 60 80 100 120 Duration of labeling (min) Duration of labeling (min)

FIG. 12C U.S. Patent May 12, 2015 Sheet 16 of 26 US 9,029.413 B2

Why does the virus up-regulate glycolysis? To drive lipid biosynthesis Mitochondrion CytosolSol

Fatty Acid Biosynthesis

s esselaarlalsre

eases

0xCloacetote

Eas s esre

Hs - Cycolysis Citrote Malote 10 0.8 0.6 0.4 0.2 0.0 O 20 40 60 80 100 120 O 20 40 60 80 100 120 Duration of labeling (min) Duration of labeling (min)

ls virally-induced lipid biosynthesis important? Yes! Its blockade prevents viral replication es s

Control Drug Control Drug (5u M C75) (5u M C75) FIG. 12D U.S. Patent May 12, 2015 Sheet 17 of 26 US 9,029.413 B2

Effect of C75 and TOFA on HCMV replication

E E 10

.S. .2 3. 10' s . >

1 OOO

1OO -5 O 5 10 15 20 25 30 35 Drug Concentration (ug/mL)

FG 13 U.S. Patent May 12, 2015 Sheet 18 of 26 US 9,029.413 B2

Effect of TOFA on HCMV Replication

10 -e-TOFA

5 1O

9 ' y . 4. S. 1O A1 s . > 1OOO

1 OO -2O O 2O 40 60 8O 1OO

Drug concentration (ug/mL)

F.G. 14 U.S. Patent May 12, 2015 Sheet 19 of 26 US 9,029.413 B2

FG 15 U.S. Patent May 12, 2015 Sheet 20 of 26 US 9,029.413 B2

Glucose (out) A A = 15.866 g/min (Mock) A+F-F+2F-F Gui () 45.283 nmol/min (Viral) to S -->F Pentose-P Glycogen (G1P)--> Hegose-PF, - 2F5R. FBP Fotty Add y 2F Synthesis'''-- F5 DHAP ATP UTP

42,378 9/min (Viral) LOctote PEP B y Fst-2F-F5 154 75X EyCyge Protein Ald Fs!2F-F5-Fs-B'/675------R-15 X F6 F7 Fatty Acid Acetyl-CA (mitochondrial)-H Degradation Protein Citrate... - 10sT --Molonyl-CoA-T05 FattyY Acid Asp/Asn 1. NF-F-10F Synthesis A F-F7 6t7 N 5 Protein 1.75%5X '%X-Fi / Gn Glutamine (out) belie -H 0x000Celte 1OF5 Ketoglutarote v675% C F12 Y F8 0. d 3.5M Y 10 C-D-Y.% X Glutamine- (in) "it'67,F11 N N 6T 7 to ..", 6.75 "a-Clutomote (per)C-V is - Malate %5X y 41 Glutamite (out) C = 8.535 g/min (Mock) Protein 16,533 gol/min (Viral) Gly/Pro D = 5.200 pg/min (Mock) 9.316 ruggl/min (Virol) FIG. 16 U.S. Patent May 12, 2015 Sheet 21 of 26 US 9,029.413 B2

N eleulo

-N4 CD O 2

+OWN

&88:

WOO-Auoleu

N CY) CN V O (XOOu O eneel) effueuo pIO U.S. Patent US 9,029.413 B2

?03443X09

U.S. Patent US 9,029.413 B2 U.S. Patent May 12, 2015 Sheet 24 of 26 US 9,029.413 B2

O-36

CO-36

'-o's

O-36

O-leg CC'Oreg '-leg E-eg s Oleg

OC "OCA C CE-G OC 3. uVinz OSNO epelu U.S. Patent May 12, 2015 Sheet 25 of 26 US 9,029.413 B2

Y O O D

O O OO N (O LO V (r) CN V - O V

(Ol. x) Asueueubs U.S. Patent May 12, 2015 Sheet 26 of 26 US 9,029.413 B2

s sal d ..

3s S s V x8

W T S. O. 9 M s

s C N

2. V V V Sun Snooeu 69 OW WIN3H emele US 9,029,413 B2 1. 2 TREATMENT OF VIRAL INFECTIONS BY Propagation of viruses during the process of viral infection MODULATION OF HOST CELL METABOLC requires energy and macromolecular precursors derived from PATHWAYS the metabolic network of the host cell. Viruses alter cellular metabolic activity through a variety of routes to meet the This application is a continuation of U.S. patent applica needs of the virus. Changes induced in metabolic flux are tion Ser. No. 12/156,517, filed Jun. 2, 2008, now U.S. Pat. No. likely to be critical to viral survival and propagation. Until 8,158,677, which claims priority benefit under 35 recently however, adequate technology for evaluating the U.S.C.S 119(e) to U.S. Provisional Application No. 60/932, effect of viral infection on host metabolism was not available. 769, filed Jun. 1, 2007, and to U.S. Provisional Application The invention is based, in part, on the applicants’ develop No. 61/033,243, filed Mar. 3, 2008, each of which is incor 10 ment of an integrated approach, referred to herein as "kinetic porated by reference herein in its entirety. flux profiling for profiling metabolic fluxes. Using this approach, the applicants discovered alterations of certain GOVERNMENT RIGHTS metabolite concentrations and fluxes in response to viral 15 infection. Based on these discoveries, the applicants selected This invention was made with government Support under host cell enzymes in the involved metabolic pathways as Grants #CA082396, CA085786, and GM071508 awarded by targets for intervention; i.e., to restore metabolic flux to dis the National Institutes of Health. The government has certain advantage viral replication, or to further derange metabolic rights in this invention. flux resulting in death, e.g., "suicide of viral-infected cells (but not uninfected cells) in order to limit viral propagation. 1. INTRODUCTION While any of the enzymes in the relevant metabolic pathway can be selected, pivotal enzymes at key control points in these This application relates to antiviral therapies and antiviral metabolic pathways are preferred as candidate antiviral drug drug design. targets. Inhibitors of these enzymes are used to reverse, or 25 redirect, the effects of the viral infection. Drug candidates are 2. BACKGROUND OF THE INVENTION tested for antiviral activity using screening assays in vitro and host cells, as well as in animal models. Animal models are Strategies for antiviral drug design have typically focused then used to test efficacy of candidate compounds in prevent on identifying compounds that attack the virus itself. As such, ing and treating viral infections. the most common antiviral targets have been viral proteins— 30 The kinetic flux profiling approach described herein has the structural components of the virion, as well as viral led to the unexpected discovery that enveloped viruses alter genome-encoded enzymes which are necessary for propaga metabolic flux profiles, Suggesting enveloped viruses may tion of the virus. Thus, antiviral compounds have been designed and developed to interfere with viral proteins use common mechanisms for redirecting host metabolic path involved in attachment of the virus to the host cell membrane 35 ways to achieve their energy needs. In the working examples and entry into the cell, replication, transcription and transla of the present invention, the Applicants have shown that, upon tion of the viral genes, propagation of the virion inside the infection of its host cells, human cytomegalovirus (HCMV) cell, and/or release of progeny virions from the cell. increases flux from glucose into the fatty acid biosynthesis Nevertheless, the approach of targeting viral proteins has pathway to produce fatty acids and/or from glucose to glyc several limitations: 1) the limited number of viral targets; 2) 40 erol by glucose-3 phosphate dehydrogenase. Thus, enzymes viral targets tend to be highly specific to a particular virus or in the fatty acid biosynthetic pathway constitute key antiviral even strain of virus; and 3) the ability of viruses to rapidly drug targets. In various embodiments, the virus may be envel alter their genetic composition to develop resistance to anti oped or naked (i.e., a non-enveloped virus). Proof of this viral drugs. principle is demonstrated in the working examples which Another approach in antiviral drug development is to 45 show that inhibitors of host enzymes in these metabolic path design drugs to strengthen the host's immune system to fight ways inhibit production of progeny virus by at least 2 logs. In the viral infection, rather than to fight the viral infection itself. particular, elongases and/or related enzymes of fatty acid Using this strategy, drugs are designed to boost the hosts elongation, fatty acid desaturation enzymes, and enzymes immune system to allow the host to better fight off infection that modulate cholesterol metabolism and/or lipid-related by the virus. 50 processes may also constitute key antiviral drug targets. On the other hand, cellular targets have traditionally been Without being bound by any particular theory, such candi considered less desirable candidates for antiviral therapy. date antiviral compounds identified by this approach may Relatively few antiviral drugs have been directed at host function by blocking the virus from using host enzymes to enzymes for several reasons, the most prominent being the achieve its own metabolic needs, and thereby restoring at high risk of toxicity to the host itself. Although host cell 55 least in part the normal metabolic activity of the host cell. factors play a key role in facilitating viral growth and propa Thus, the invention also relates to a method for redirecting gation, strategies for attacking Such host factors remain elu metabolic flux altered by viral infection in a human subject, sive. comprising administering an effective amount of a prese A major challenge to antiviral drug development is finding lected compound to a human Subject in need thereof, in which new strategies for combating viral infection. 60 said preselected compound is an inhibitor of a cellular enzyme, and reverses or redirects metabolic flux in cultured 3. SUMMARY OF THE INVENTION cells infected with the virus. The present invention relates to antiviral compounds, 3.1 Terminology methods of screening for Such compounds, methods for treat 65 ing viral infections using Such compounds, and antiviral As used herein, the term “metabolome' the total set of therapies directed at host cell enzymes. metabolites in a cell at a given time. US 9,029,413 B2 3 4 As used herein, the term “about' or “approximately' when -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl and used in conjunction with a number refers to any number -n-octyl, while saturated branched alkyls include -isopropyl. within 1, 5 or 10% of the referenced number. -Sec-butyl, -isobutyl, -tert-butyl, -isopentyl, 2-methylpentyl, As used herein, the term “Compound” refers to any agent 3-methylpentyl, 4-methylpenty1, 2,3-dimethylbutyl and the that is being tested for its ability to inhibit the activity of a like. A —(C1-Xalkyl) group can be substituted or unsubsti target enzyme or has been identified as inhibiting the activity tuted. of a target enzyme, including the particular structures pro The terms “halogen' and “halo' mean fluorine, chlorine, vided herein or incorporated by reference herein, and sol bromine and iodine. Vates, hydrates, prodrugs, Stereoisomers and pharmaceuti An “aryl group is an unsaturated aromatic carbocyclic cally acceptable salts thereof. Compounds include, but are 10 group of from 6 to 14 carbonatoms having a single ring (e.g., not limited to, proteinaceous molecules, including, but not phenyl) or multiple condensed rings (e.g., naphthyl or limited to, peptides (including dimers and multimers of Such anthryl). Particular aryls include phenyl, biphenyl, naphthyl peptides), polypeptides, proteins, including post-translation and the like. An aryl group can be substituted or unsubsti ally modified proteins, conjugates, antibodies, antibody frag tuted. ments etc.; Small molecules, including inorganic or organic 15 A "heteroaryl group is an aryl ring system having one to compounds; nucleic acid molecules including, but not limited four heteroatoms as ring atoms in a heteroaromatic ring sys to, double-stranded or single-stranded DNA, or double tem, wherein the remainder of the atoms are carbon atoms. stranded or single-stranded RNA, antisense RNA, RNA inter Suitable heteroatoms include oxygen, Sulfur and nitrogen. In ference (RNAi) molecules (e.g., small interfering RNA certain embodiments, the heterocyclic ring system is mono (siRNA), micro-RNA (miRNA), short hairpin RNA cyclic or bicyclic. Non-limiting examples include aromatic (shRNA), etc.), intron sequences, triple helix nucleic acid molecules and aptamers; carbohydrates; and lipids. In one groups selected from the following: embodiment, a Compound is of structure (I)-CXLIV). In one embodiment, a Compound is purified. As used herein, the term “purified.” in the context of a 25 Compound that is chemically synthesized, refers to a Com W \ pound that is Substantially free of chemical precursors or Q CA C C, C other chemicals when chemically synthesized. In a specific embodiment, the Compound is 60%, preferably 65%, 70%, 75%, 80%, 85%, 90%, or 99% free of other, different com 30 rrn O pounds. 4 N4 O l 2 An "isolated” or “purified', nucleic acid sequence or N N nucleotide sequence. Such as an RNAi molecule (e.g., siRNA, miRNA, shRNA, etc.) or a vector construct for producing an RNAi molecule, can be substantially free of other cellular 35 COOCN Q material or culture medium when produced by recombinant techniques, or Substantially free of chemical precursors when chemically synthesized. In certain embodiments, an "iso lated nucleic acid sequence or nucleotide sequence is a OCQ) OC)Q nucleic acid sequence or nucleotide sequence that is recom 40 binantly expressed in a heterologous cell. wherein Q is CH2, CH=CH, O, S or NH. Further repre As used herein, the terms “purified” and "isolated when sentative examples of heteroaryl groups include, but are not used in the context of a Compound (including proteinaceous limited to, benzofuranyl, benzothienyl, indolyl, benzopyra agents such as peptides) that can be obtained from a natural Zolyl, coumarinyl, furanyl, isothiazolyl, imidazolyl, isox Source, e.g., cells, refers to a compound or agent which is 45 azolyl, thiazolyl, triazolyl, tetrazolyl, thiophenyl, pyrimidi Substantially free of contaminating materials from the natural nyl, isoquinolinyl, quinolinyl, pyridinyl, pyrrolyl pyrazolyl, Source, e.g., Soil particles, minerals, chemicals from the envi 1H-indolyl, 1H-indazolyl, benzodthiazolyl and pyrazinyl. ronment, and/or cellular materials from the natural source, Heteroaryls can be bonded at any ring atom (i.e., at any such as but not limited to cell debris, cell wall materials, carbon atom or heteroatom of the heteroaryl ring) A het membranes, organelles, the bulk of the nucleic acids, carbo 50 eroaryl group can be substituted or unsubstituted. In one hydrates, proteins, and/or lipids present in cells. The phrase embodiment, the heteroaryl group is a C3-1Oheteroaryl. “substantially free of natural source materials' refers to A “cycloalkyl group is a Saturated or unsaturated non preparations of a compound or agent that has been separated aromatic carbocyclic ring. Representative cycloalkyl groups from the material (e.g., cellular components of the cells) from include, but are not limited to, cyclopropyl, cyclobutyl, cyclo which it is isolated. Thus, a Compound that is isolated 55 pentyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, 1.3-cy includes preparations of a compound or agent having less clohexadienyl, 1.4-cyclohexadienyl, cycloheptyl, 1.3-cyclo than about 30%, 20%, 10%, 5%,2%, or 1% (by dry weight) of heptadienyl, 1.3.5-cycloheptatrienyl, cyclooctyl, and cellular materials and/or contaminating materials. cyclooctadienyl. A cycloalkyl group can be substituted or Definitions of the more commonly recited chemical groups unsubstituted. In one embodiment, the cycloalkyl group is a are set forth below. Certain variables in classes of Compounds 60 C3-8cycloalkyl group. disclosed herein recite other chemical groups. Chemical A "heterocycloalkyl group is a non-aromatic cycloalkyl in groups recited herein, but not specifically defined, have their which one to four of the ring carbonatoms are independently ordinary meaning as would be known by a chemist skilled in replaced with a heteroatom from the group consisting of O.S the art. and N. Representative examples of a heterocycloalkyl group A “C1-Xalkyl group is a Saturated Straight chain or 65 include, but are not limited to, morpholinyl, pyrrolyl pyrro branched non-cyclic hydrocarbon having from 1 to X carbon lidinyl, thienyl, furanyl, thiazolyl, imidazolyl pyrazolyl, tria atoms. Representative —(C1-8alkyls) include -methyl, Zolyl, piperizinyl, isothiazolyl, isoxazolyl. (1,4)-dioxane, US 9,029,413 B2 5 6 (1,3)-dioxolane, 4,5-dihydro-1H-imidazolyl and tetrazolyl. vitro or in vivo) to provide Compound. Examples of prodrugs Heterocycloalkyls can also be bonded at any ring atom (i.e., at include, but are not limited to, derivatives and metabolites of any carbon atom or heteroatom of the Heteroaryl ring). A a Compound that include biohydrolyzable moieties such as heterocycloalkyl group can be substituted or unsubstituted. In biohydrolyzable amides, biohydrolyzable esters, biohydro one embodiment, the heterocycloalkyl is a 3-7 membered lyzable carbamates, biohydrolyzable carbonates, biohydro heterocycloalkyl. ly Zable ureides, and biohydrolyzable phosphate analogues. In In one embodiment, when groups described herein are said certain embodiments, prodrugs of Compounds with carboxyl to be “substituted they may be substituted with any suitable functional groups are the lower alkyl esters of the carboxylic substituent or substituents. Illustrative examples of substitu acid. The carboxylate esters are conveniently formed by ents include those found in the exemplary compounds and 10 esterifying any of the carboxylic acid moieties present on the embodiments disclosed herein, as well as halogen (chloro, molecule. Prodrugs can typically be prepared using well iodo, bromo, or fluoro); C alkyl, Calkenyl: C-alkynyl: known methods, such as those described by Burger's Medici hydroxyl: Calkoxyl; amino; nitro; thiol; thioether, imine; nal Chemistry and Drug Discovery 6th ed. (Donald J. Abra cyano; amido; phosphonato; phosphine; carboxyl; thiocarbo ham ed., 2001, Wiley) and Design and Application of nyl; Sulfonyl; Sulfonamide, ketone; aldehyde; ester; oxygen 15 Prodrugs (H. Bundgaard ed., 1985, Harwood Academic Pub (=O); haloalkyl (e.g., trifluoromethyl); carbocyclic lishers Gmfh.). cycloalkyl, which may be monocyclic or fused or non-fused As used herein and unless otherwise indicated, the term polycyclic (e.g., cyclopropyl, cyclobutyl, cyclopentyl, or “stereoisomer' or “stereomerically pure” means one stereoi cyclohexyl), or a heterocycloalkyl, which may be monocyclic Somer of a Compound, in the context of an organic or inor or fused or non-fused polycyclic (e.g., pyrrolidinyl, piperidi ganic molecule, that is Substantially free of other stereoiso nyl, piperazinyl, morpholinyl, or thiazinyl); carbocyclic or mers of that Compound. For example, a stereomerically pure heterocyclic, monocyclic or fused or non-fused polycyclic Compound having one chiral center will be substantially free aryl (e.g., phenyl, naphthyl, pyrrolyl, indolyl, furanyl. of the opposite enantiomer of the Compound. A stereomeri thiophenyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, triaz cally pure Compound having two chiral centers will be sub olyl, tetrazolyl pyrazolyl pyridinyl, quinolinyl, isoquinoli 25 stantially free of other diastereomers of the Compound. A nyl, acridinyl, pyrazinyl, pyridaZinyl, pyrimidinyl, benzimi typical stereomerically pure Compound comprises greater dazolyl, benzothiophenyl, or benzofuranyl); amino (primary, than about 80% by weight of one stereoisomer of the com secondary, or tertiary); o-lower alkyl; o-aryl, aryl; aryl-lower pound and less than about 20% by weight of other stereoiso alkyl: CO2CH3; CONH2; OCH2CONH2:NH2; SO2NH2: mers of the Compound, greater than about 90% by weight of OCHF2: CF3; OCF3. 30 one stereoisomer of the Compound and less than about 10% As used herein, the term “pharmaceutically acceptable by weight of the other stereoisomers of the Compound, salt(s) refers to a salt prepared from a pharmaceutically greater than about 95% by weight of one stereoisomer of the acceptable non-toxic acid or base including an inorganic acid Compound and less than about 5% by weight of the other and base and an organic acid and base. Suitable pharmaceu stereoisomers of the Compound, or greater than about 97% by tically acceptable base addition salts of the compounds 35 weight of one stereoisomer of the Compound and less than include, but are not limited to metallic salts made from alu about 3% by weight of the other stereoisomers of the Com minum, calcium, lithium, magnesium, potassium, sodium pound. The Compounds can have chiral centers and can occur and Zinc or organic salts made from lysine, N,N'-dibenzyl as racemates, individual enantiomers or diastereomers, and ethylenediamine, chloroprocaine, choline, diethanolamine, mixtures thereof. All such isomeric forms are included within ethylenediamine, meglumine (N-methylglucamine) and 40 the embodiments disclosed herein, including mixtures procaine. Suitable non-toxic acids include, but are not limited thereof. to, inorganic and organic acids such as acetic, alginic, anthra Various Compounds contain one or more chiral centers, nilic, benzenesulfonic, benzoic, camphorsulfonic, citric, and can exist as racemic mixtures ofenantiomers, mixtures of ethenesulfonic, formic, fumaric, furoic, galacturonic, glu diastereomers or enantiomerically or optically pure Com conic, glucuronic, glutamic, glycolic, hydrobromic, hydro 45 pounds. The use of stereomerically pure forms of such Com chloric, isethionic, lactic, maleic, malic, mandelic, methane pounds, as well as the use of mixtures of those forms are Sulfonic, mucic, nitric, pamoic, pantothenic, phenylacetic, encompassed by the embodiments disclosed herein. For phosphoric, propionic, salicylic, Stearic, succinic, Sulfanilic, example, mixtures comprising equal or unequal amounts of Sulfuric, tartaric acid, and p-toluenesulfonic acid. Specific the enantiomers of a particular Compound may be used in non-toxic acids include hydrochloric, hydrobromic, phos 50 methods and compositions disclosed herein. These isomers phoric, Sulfuric, and methanesulfonic acids. Examples of spe may be asymmetrically synthesized or resolved using stan cific salts thus include hydrochloride and mesylate salts. Oth dard techniques such as chiral columns or chiral resolving ers are well-known in the art, See for example, Remington's agents. See, e.g., Jacques, J., et al., Enantiomers, Racemates Pharmaceutical Sciences, 18th eds., Mack Publishing, Easton and Resolutions (Wiley-Interscience, New York, 1981); Pa. (1990) or Remington: The Science and Practice of Phar 55 Wilen, S. H., et al., Tetrahedron 33:2725 (1977); Eliel, E. L., macy, 19th eds., Mack Publishing, Easton Pa. (1995). Stereochemistry of Carbon Compounds (McGraw-Hill, N.Y., As used herein and unless otherwise indicated, the term 1962); and Wilen, S. H., Tables of Resolving Agents and “hydrate” means a compound, or a salt thereof, that further Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ. of Notre includes a stoichiometric or non-stoichiometric amount of Dame Press, Notre Dame, 1N, 1972). water bound by non-covalent intermolecular forces. 60 It should also be noted that Compounds, in the context of As used herein and unless otherwise indicated, the term organic and inorganic molecules, can include E and Z iso “solvate” means a Compound, or a salt thereof, that further mers, or a mixture thereof, and cis and trans isomers or a includes a stoichiometric or non-stoichiometric amount of a mixture thereof. In certain embodiments, Compounds are solvent bound by non-covalent intermolecular forces. isolated as either the E or Z isomer. In other embodiments, As used herein and unless otherwise indicated, the term 65 Compounds are a mixture of the E and Z isomers. “prodrug” means a Compound derivative that can hydrolyze, As used herein, the term “effective amount in the context oxidize, or otherwise react under biological conditions (in of administering a therapy to a subject refers to the amount of US 9,029,413 B2 7 8 a therapy which is sufficient to achieve one, two, three, four, MOI is determined by dividing the number of virus added (ml or more of the following effects: (i) reduce or ameliorate the addedxPFU) by the number of cells added (ml addedxcells/ severity of a viral infection or a symptom associated there ml). with; (ii) reduce the duration of a viral infection or a symptom As used herein, the term “premature human infant” refers associated therewith; (iii) prevent the progression of a viral to a human infant born at less than 37 weeks of gestational infection or a symptom associated therewith; (iv) cause age. regression of a viral infection or a symptom associated there As used herein, the term “human infant” refers to a new with; (v) prevent the development or onset of a viral infection born to 1 year old year human. or a symptom associated therewith; (vi) prevent the recur As used herein, the term “human child' refers to a human rence of a viral infection or a symptom associated therewith: 10 (vii) reduce or prevent the spread of a virus from one cell to that is 1 year to 18 years old. another cell, or one tissue to another tissue; (ix) prevent or As used herein, the term “human adult' refers to a human reduce the spread of a virus from one subject to another that is 18 years or older. Subject; (X) reduce organ failure associated with a viral infec As used herein, the term “elderly human refers to a human tion; (xi) reduce hospitalization of a Subject; (xii) reduce 15 65 years or older. hospitalization length; (xiii) increase the Survival of a subject As used herein, the terms “prevent,” “preventing and “pre with a viral infection; (xiv) eliminate a virus infection; and/or vention' in the context of the administration of a therapy(ies) (XV) enhance or improve the prophylactic or therapeutic to a subject to prevent a viral infection refer to one or more of effect(s) of another therapy. the following effects resulting from the administration of a As used herein, the term “effective amount” in the context therapy or a combination of therapies: (i) the inhibition of the of a Compound for use in cell culture-related products refers development or onset of a viral infection and/or a symptom to an amount of a Compound which is sufficient to reduce the associated therewith; and (ii) the inhibition of the recurrence viral titer in cell culture or prevent the replication of a virus in of a viral infection and/or a symptom associated therewith. cell culture. As used herein, the terms “prophylactic agent” and “pro As used herein, the term “incombination, in the context of 25 phylactic agents' refer to any agent(s) which can be used in the administration of two or more therapies to a subject, refers the prevention of a viral infection or a symptom associated to the use of more than one therapy (e.g., more than one therewith. Preferably, a prophylactic agent is an agent which prophylactic agent and/or therapeutic agent). The use of the is known to be useful to or has been or is currently being used term “in combination' does not restrict the order in which to prevent or impede the onset, development, progression therapies are administered to a subject with a viral infection. 30 A first therapy (e.g., a first prophylactic or therapeutic agent) and/or severity of a viral infection or a symptom associated can be administered prior to (e.g., 5 minutes, 15 minutes, 30 therewith. minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 As used herein, the term “prophylactically effective hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 amount refers to the amount of a therapy (e.g., prophylactic weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 35 agent) which is sufficient to prevent a viral infection or a weeks before), concomitantly with, or Subsequent to (e.g., 5 symptom thereof in a Subject. minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, As used herein, the term “small molecules' and analogous 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 terms include, but are not limited to, peptides, peptidomimet hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, ics, amino acids, amino acid analogs, polynucleotides, poly 8 weeks, or 12 weeks after) the administration of a second 40 nucleotide analogs, nucleotides, nucleotide analogs, other therapy to a subject with a viral infection. organic and inorganic compounds (i.e., including heteroor As used herein, the term “infection” means the invasion by, ganic and organometallic compounds) having a molecular multiplication and/or presence of a virus in a cellora Subject. weight less than about 10,000 grams per mole, organic or In one embodiment, an infection is an “active' infection, i.e., inorganic compounds having a molecular weight less than one in which the virus is replicating in a cellora Subject. Such 45 about 5,000 grams per mole, organic or inorganic compounds an infection is characterized by the spread of the virus to other having a molecular weight less than about 1,000 grams per cells, tissues, and/or organs, from the cells, tissues, and/or mole, organic or inorganic compounds having a molecular organs initially infected by the virus. An infection may also be weight less than about 500 grams per mole, organic or inor a latent infection, i.e., one in which the virus is not replicating. ganic compounds having a molecular weight less than about In one embodiment, an infection refers to the pathological 50 100 grams per mole, and salts, esters, and other pharmaceu state resulting from the presence of the virus in a cell or a tically acceptable forms of such compounds. Salts, esters, and subject, or by the invasion of a cell or subject by the virus. other pharmaceutically acceptable forms of such compounds As used herein, the term “library” refers to a plurality of are also encompassed. compounds. A library can be a combinatorial library, e.g., a As used herein, the terms “subject' or “patient are used collection of compounds synthesized using combinatorial 55 interchangeably. As used herein, the terms “subject' and chemistry techniques, or a collection of unique chemicals of “Subjects' refer to an animal (e.g., birds, reptiles, and mam low molecular weight (less than 1000 daltons). mals), preferably a mammal including a non-primate (e.g., a As used herein, the terms “manage.” “managing, and camel, donkey, Zebra, cow, pig, horse, goat, sheep, cat, dog. “management, in the context of the administration of a rat, and mouse) and a primate (e.g., a monkey, chimpanzee, therapy to a subject, refer to the beneficial effects that a 60 and a human), and most preferably a human. Subject derives from a therapy, which does not resultina cure As used herein, the terms “therapies” and “therapy” can of a viral infection. In certain embodiments, a subject is refer to any protocol(s), method(s), compositions, formula administered one or more therapies to “manage' a disease so tions, and/or agent(s) that can be used in the prevention, as to prevent the progression or worsening of the viral infec treatment, management, or amelioration of a viral infection or tion. 65 a symptom associated therewith. In certain embodiments, the As used herein, the phrase “multiplicity of infection” or terms “therapies” and “therapy” refer to biological therapy, “MOI is the average number of virus per infected cell. The Supportive therapy, and/or other therapies useful in treatment, US 9,029,413 B2 9 10 management, prevention, or amelioration of a viral infection from unlabeled into uniformly 13C-glucose. Compounds ora symptom associated therewith knownto one of skill in the found to be rapidly fully labeled are shown in dark gray, art. partially labeled in mixed dark gray/light gray, and unlabeled As used herein, the term “synergistic.” in the context of the in light gray alone. Labeling of Acetyl CoenzymeA (AcCoA) effect of therapies, refers to a combination of therapies which 5 was restricted to the acetyl moiety, and labeling of citrate was is more effective than the additive effects of any two or more limited to the two C-atoms coming directly from AcCoA. The single therapies. In a specific embodiment, a synergistic pathways consistent with the observed labeling pattern are effect of a combination of therapies permits the use of lower shown in Solid lines, and lead from pyruvate into fatty acid dosages of one or more of therapies and/or less frequent biosynthesis. The dashed lines indicate major metabolic path administration of said therapies to a subject with a viral infec 10 ways that appear to be largely inactive, as their activity would tion. In certain embodiments, the ability to utilize lower dos ages of therapies (e.g., prophylactic or therapeutic agents) result in substantially different labeling patterns from those and/or to administer said therapies less frequently reduces the observed. FIG. 2B shows exemplary kinetic data used to toxicity associated with the administration of said therapies to generate FIG. 2A. The kinetics of citrate versus malate label a subject without reducing the efficacy of said therapies in the 15 ing provide pivotal information, as they distinguish use of prevention or treatment of a viral infection. In some embodi citrate for lipid biosynthesis (which does not result in malate ments, a synergistic effect results in improved efficacy of labeling) from use of citrate to drive to the tricarboxylic acid therapies (e.g., prophylactic or therapeutic agents) in the pre (TCA) cycle (which would result in malate being labeled with vention, management and/or treatment of a viral infection. In similar kinetics to citrate, and eventually generation of more Some embodiments, a synergistic effect of a combination of thoroughly labeled citrate). See Example 2. therapies (e.g., prophylactic or therapeutic agents) avoids or FIG.3. CMV infection induces de novo synthesis of lipids reduces adverse or unwanted side effects associated with the from C-glucose. use of any single therapy. See Example 4. As used herein, the term “therapeutically effective FIG. 4. C75 Inhibits HSV Viral Replication. amount” refers to the amount of a therapy, which is sufficient 25 FIG. 4 shows that C75 effectively inhibited the replication to treat and/or manage a viral infection. As used herein, the of HSV following infection of primary fibroblasts MRC-5 terms “therapeutic agent” and “therapeutic agents’ refer to cells. C75 reduced HSV viral replication by more than 2 logs. any agent(s) which can be used in the prevention, treatment See Example 8. and/or management of a viral infection or a symptom associ FIG.5. C75 Inhibits HCMV Viral Replication. ated therewith. Preferably, a therapeutic agent is an agent 30 FIG. 5 shows that C75 effectively inhibited the replication which is known to be useful for, or has been or is currently of HCMV following infection of primary fibroblasts MRC-5 being used for the prevention, treatment, and/or management cells. C75 reduced HCMV viral replication by more than 3 of a viral infection or a symptom associated therewith. logs. See Example 8. As used herein, the terms “treat,” “treatment, and “treat FIG. 6. Etomoxir Inhibits HCMV Viral Replication. ing refer in the context of administration of a therapy(ies) to 35 FIG. 6 shows that Etomoxir effectively inhibited the repli a subject to treat a viral infection refer to one, two, three, four, cation of HCMV following infection of primary fibroblasts. five or more of the following effects resulting from the admin Etomoxir reduced HCMV viral replication by more than 1 istration of a therapy or a combination of therapies: (i) the log. See Example 8. reduction or amelioration of the severity of a viral infection FIGS. 7A and 7B. CMV infection directs metabolic flux of and/or a symptom associated therewith; (ii) the reduction in 40 glycolytic and related compounds. the duration of a viral infection and/or a symptom associated FIGS. 7A and 7B show the labeling kinetics of glycolytic therewith; (iii) the regression of a viral infection and/or a and related compounds in mock-infected and CMV-infected symptom associated therewith; (iv) the reduction of the titer human fibroblasts, respectively. See Example 9, Section of a virus, (v) the reduction in organ failure associated with a 6.91. viral infection; (vi) the reduction in hospitalization of a sub 45 FIG.8. CMV infection directs metabolic flux of nucleotide ject; (vii) the reduction in hospitalization length; (viii) the triphosphates and their precursor PRPP. increase in the survival of a subject; (ix) the elimination of a FIG. 8 shows the labeling kinetics of nucleotide triphos virus infection; (x) the inhibition of the progression of a viral phates and their precursor PRPP in mock-infected (labeled infection and/or a symptom associated therewith; (xi) the “2) and CMV-infected human fibroblasts (labeled “1”). See prevention of the spread of a virus from a cell, tissue or subject 50 Example 9, Section 6.9.2. to another cell, tissue or Subject; and/or (xii) the enhancement FIGS. 9A and 9B. CMV infection directs metabolic flux of or improvement the therapeutic effect of another therapy. TCA cycle compounds: glucose labeling. FIGS. 9A and 9B show the labeling kinetics of TCA cycle 4. DESCRIPTION OF THE FIGURES compounds and the fractional labeling of these compounds, 55 respectively. See Example 9, Section 6.9.3. FIG.1. Schematic Diagram of Virus Classification. FIGS. 10A and 10B. CMV infection directs metabolic flux FIG. 1 shows the classification of families of viruses and of TCA cycle compounds: Glutamine labeling. their structural characteristics. FIG. 1 is a modified figure FIGS. 10A and 10B show the labeling kinetics of TCA from Flint et al., Principles of Virology: Molecular Biology, cycle compounds and the fractional labeling of these com Pathogenesis and Control of Animal Virus. 2nd edition, ASM 60 pounds, respectively. See Example 9, Section 6.9.4. Press, 2003. A subset of viruses against which Compounds FIG. 11. Schematic of central carbon metabolic flows in can be assessed for antiviral activity are shown. CMV infected cells. FIG. 2. CMV infection directs glycolytic outflow into fatty FIG. 11 shows a schematic of central carbon metabolic acid biosynthesis. flows in virally infected cells. Glucose and metabolites FIG. 2A summarizes the results of kinetic flux profiling 65 formed from glucose are represented by shaded areas, and (KFP) experiments in which metabolite labeling patterns in glutamine and metabolites formed from glutamine are repre CMV infected cells were observed following their transfer sented by unshaded areas. See Example 9, Section 6.9.5. US 9,029,413 B2 11 12 FIG. 12. Integrated metabolomic and fluxomic analysis of full scan mode on an Orbitrap instrument. The graph plots the cellular response to viral infection. signal intensity versus time of extracts from cells mock FIG. 12 provides an overview of the integrated metabolo infected or infected with HCMV. The experiment identified mic and fluxomic analysis of cellular response to viral infec N-acetyl-aspartate (NAA) as a metabolite whose production tion described in further detail in section 6. 5 increased in HCMV-infected cells. See Example 24. FIG. 13. Dose Response of C75 and TOFA in Inhibition of FIG. 22. 3-Methyladenine Inhibits Viral Replication of HCMV Replication. HCMV. FIG. 13 shows that 10 ug/mL of both C75 and TOFA was FIG.22 shows a graph that plots the relative HCMV infec adequate to produce a roughly one-log decrease in viral rep tious units versus days post infection (dpi). The graph shows lication in primary fibroblasts infected with HCMV. Error 10 that 3-methyladenine, an inhibitor of class III PI(3) kinase, bars show the standard deviation of duplicate measurements. has antiviral activities. See Example 25. See Example 11. FIG. 14. Dose Response of TOFA in Inhibition of HCMV 5. DETAILED DESCRIPTION Replication. FIG. 14 shows that 20 ug/mL of TOFA produced a roughly 15 Viral replication requires energy and macromolecular pre two-log decrease in viral replication in primary fibroblasts cursors derived from the metabolic network of the host cell. infected with HCMV. Error bars show the standard deviation Using an integrated approach to profiling metabolic flux, the of duplicate measurements. See Example 12. inventors discovered alterations of certain metabolite concen FIGS. 15A-B. Effect of C75 and TOFA on HCMV and trations and fluxes in response to viral infection. Based on Influenza A Virus Replication. these discoveries, certain enzymes in the various metabolic FIG. 15A shows that 10 g/mL of both C75 and TOFA pathways, especially those which serve as key “switches.” produced a greater than 100-fold and 1000-fold decrease, were selected for intervention; i.e., as targets for redirecting respectively, in viral production (PFU/ml) of infectious the metabolic flux to disadvantage viral replication and HCMV virions 96 hours after infection (high multiplicity of restore normal metabolic flux profiles, thus serving as targets infection (MOI)=3.0). FIG.15B shows that 10 g/mL of C75 25 for antiviral therapies. Enzymes involved in initial steps in a and TOFA produced a greater than 10-fold and 1000-fold metabolic pathway are preferred enzyme targets. In addition, decrease, respectively, in viral replication of infectious influ enzymes that catalyze “irreversible' reactions or committed enza A virions 24 hours after infection (MOI-0.1). See steps in metabolic pathways can be advantageously used as Example 13. enzyme targets for antiviral therapy. FIG. 16. Network Diagram of Central Metabolism and its 30 For example, viral infections that direct glycolytic outflow connections to biosynthesis. into fatty acid biosynthesis can be treated by blockade offatty FIG. 16 shows a network diagram of central metabolism acid synthesis. While any enzyme involved in fatty acid bio and its connection to biosynthesis, which diagram was used synthesis can be used as the target, the enzymes involved in as the basis to construct an ordinary differential equation the committed steps for converting glucose into fatty acid are (ODE) model as described in Example 14. 35 preferred; e.g., these include, but are not limited to acetyl FIG. 17. Effect of TOFA on Metabolome of HCMV-in CoA carboxylase (ACC), its upstream regulator AMP-acti fected Fibroblasts. vated protein kinase (AMPK), or ATP citrate lyase. FIG. 17 shows the fold change (relative to mock) in malo Elongases and/or related enzymes offatty acid elongation, nyl-CoA, NADP", NADPH, and citrate in mock-infected fatty acid desaturation enzymes, including but not limited to, fibroblasts (gray bars), HCMV-infected fibroblasts (striped 40 stearoyl-CoA desaturases (SCDs), delta-6-desaturase, delta bars), and HCMV-infected fibroblasts cultured in medium 5-desaturase, and enzymes that modulate cholesterol metabo containing TOFA (solid black bars). The virus-induced eleva lism and/or lipid-related processes may also constitute key tion in malonyl-CoA and depletion of cellular NADPH (el antiviral drug targets. evation of NADP") are blocked by TOFA. See Example 22. As another example, viral infections may alter nitrogen FIG. 18. Dual ACC1/ACC2 Inhibitors Having Anti 45 fluxes that direct ammonia incorporation. Enzyme targets of HCMV Activity. this metabolic pathway, including, without limitation, FIG. 18 shows the structures of dual ACC1/ACC2 inhibitor glutamate dehydrogenase and glutaminase, may be used to compounds, their respective IC50 values in vitro and in redirect nitrogen flow in virally infected cells. rodents, and the anti-HCMV effect of each compound in The subsections below describe in more detail the target inhibiting viral replication. See Example 23. 50 enzymes of the invention, compounds that inhibit such target FIG. 19. Selective ACC2 Inhibitors Having Anti-HCMV enzymes and can thus be used as antiviral compounds, Activity. screening assays for identifying and characterizing new anti FIG. 19 shows the structures of Selective ACC2 inhibitor viral compounds, and methods for their use as antiviral thera compounds, their respective IC50 values in vitro for inhibi peutics to treat and prevent viral infections. tion of ACC2 and ACC1, and the anti-HCMV effect of each 55 compound in inhibiting viral replication. See Example 23. 5.1 Host Cell Target Enzymes FIG. 20. Antiviral Effect of ACC Inhibitors. FIG. 20 shows a bar graph plotting the effect of the indi Any enzyme of a cellular metabolic pathway in which cated ACC inhibitor compounds on viral yield (pfu/ml). The metabolite concentration and/or flux are modulated in bar graph corresponds to the raw data presented in Table 13. 60 response to viral infection is contemplated as a target for See Example 23. antiviral intervention. In particular embodiments, host FIG. 21. Using High Resolution Mass Spectrometry to enzymes involved in fatty acid biosynthesis and metabolism Identify.Metabolic Pathways Up-Regulated by Viral Infec are targets for antiviral intervention. Based on the discovery tion. that viruses modulate host metabolic fluxes and thereby inter FIG. 21 shows data from an experiment analyzing extracts 65 fere with the host cell's normal flow of energy, e.g., from from cells mock infected or infected with HCMV by liquid glucose to lipid, host enzymes involved in Such pathways chromatography-high mass-resolution mass spectrometry in have been identified as antiviral drug targets. Non-limiting US 9,029,413 B2 13 14 examples of Such enzymes which are targets for antiviral from the need for viruses to control cellular membrane com intervention are presented in Table 1. position and/or physical properties (i.e., of the plasma mem The observed increase in acetyl-CoA flux (especially flux brane or intracellular membranous structures like endoplas through cytosolic acetyl-CoA) and associated increase in de mic reticulum), and in part from the need for enveloped novo fatty acid biosynthesis, serve a number of functions for 5 viruses to control their envelope composition and/or physical viruses, especially for enveloped viruses. For example, de properties. The previously unrecognized importance of this novo fatty acid synthesis provides precursors for synthesis of control was revealed in part via the observation of dramati phospholipid, and phospholipid contributes to the formation cally increased flux through metabolites involved in choles of the viral envelope, among other functions. Importantly, terol biosynthesis, such as cytosolic acetyl-CoA, via the newly synthesized fatty acid and phospholipid may be 10 metabolomic and flux profiling experiments described required by the virus for purposes including control of enve herein. A key component of mammalian cell membranes is lope chemical composition and physical properties (e.g., cholesterol (and its derivatives). Cholesterol, like fatty acyl phospholipid fatty acyl chain length and/or desaturation, and chain length and desaturation, plays a key role in controlling associated envelope fluidity). Pre-existing cellular phospho membrane/envelope physical properties like fluidity, freezing lipid may be inadequate in absolute quantity, chemical com 15 point, etc. Cholesterol percentage, like the details of phos position, or physical properties to Support viral growth and pholipid composition, can also impact the properties of mem replication. brane proteins and/or the functioning of lipid signaling. As As such, inhibitors of any step of phospholipid biosynthe some or all of these events play a key role in viral infection, sis may constitute antiviral agents. This includes steps linking inhibitors or other modulators of cholesterol metabolism may initial fatty acid biosynthesis to the synthesis of fatty acyl serve as antiviral agents. For example, inhibitors of the CoA compounds appropriate for synthesis of viral phospho enzymes acetyl-CoA acetyltransferase, HMG-CoA synthase, lipids. These steps include, but are not limited to, fatty acid HMG-CoA reductase, mevalonate kinase, phosphomeva elongation and desaturation. Fatty acid elongation takes the lonate kinase, isopentyldiphosphate isomerase, geranyl terminal product offatty acid synthase (FAS), palmitoyl-CoA diphosphate synthase, farnesyl-diphosphate synthase, farne (a C16-fatty acid), and extends it further by additional two 25 syl-diphosphate farnesyltransferase, squalene carbon units (to form, e.g., C18 and longer fatty acids). The monooxigenase, lanosterol synthase, and associated dem enzyme involved is elongase. As formation of C18 and longer ethylases, oxidases, reductase, isomerases, and desaturases of fatty acids is required for control of viral envelope chemical the sterol family may serve as antiviral agents. HMG-CoA composition and physical properties, as well as for other viral reductase inhibitors and their structures are well known in the functions, inhibitors of elongase may serve as inhibitors of 30 art. Exemplary HMG-CoA reductase inhibitors are described viral growth and/or replication. Thus, in addition to Com in section 5.2. pounds for treatment of viral infection by inhibition of de While inhibitors offatty acid biosynthetic enzymes gener novo fatty acid biosynthesis enzymes (e.g., acetyl-CoA car ally have utility in the treatment of viral infection, acetyl-CoA boxylase and fatty acid synthase), the present invention also carboxylase (ACC) has specific properties that render it an includes Compounds for treatment of viral infection by inhi 35 especially valuable target for the treatment of viral infection. bition of elongase and/or related enzymes of fatty acid elon Notably, ACC is uniquely situated to control flux through gation. Elongases, including, but not limited to alpha-lino fatty acid biosynthesis. The upstream enzymes (e.g., pyruvate lenic acid specific elongase, have been described in the art, dehydrogenase, citrate synthase, ATP-citrate lyase, acetyl e.g., see U.S. Patent Application Publication Nos. US 2005/ CoA synthetase), while potential antiviral targets, generate 0089981 A1 and US 2005/0000914.0 A1, each of which is 40 products that are involved in multiple reaction pathways, incorporated by reference herein in its entirety. whereas ACC generates malonyl-CoA, which is a committed The principle pathway of production of monounsaturated substrate of the fatty acid pathway. Acetyl-CoA synthetase fatty acids in mammals uses as major Substrates palmitoyl and ATP-citrate lyase both have the potential to generate CoA (the product of FAS, whose production requires car cytosolic acetyl-CoA. Accordingly, one may, in some circum boxylation of cytosolic acetyl-CoA by acetyl-CoA carboxy 45 stances, partially Substitute for the other. In contrast, there is lase ACC) and stearoyl-CoA (the first product of elongase). no adequate alternative reaction pathway to malonyl-CoA The major enzymes are Stearoyl-CoA Desaturases (SCD) 1-5 other than carboxylation of acetyl-CoA (the ACC reaction). (also known generically as Fatty Acid Desaturase 1 or delta In this respect, targeting of ACC more completely and spe 9-desaturase). SCD isozymes 1 and 5 are expressed in pri cifically controls fatty acid biosynthesis than targeting of mates including humans (Wang et al., Biochem. BiophyS. 50 upstream reactions. Res. Comm. 332:735-42, 2005), and are accordingly targets As an alternative to or in addition to targeting ACC, target for treatment of viral infection in human patients in need ing FAS also enables adequate control of fatty acid de novo thereof. Other isozymes are expressed in other mammals and biosynthesis as a whole. A key difference between targeting are accordingly targets for treatment of viral infection in of ACC versus targeting of FAS, is that the substrate of ACC species in which they are expressed. Thus, in addition to 55 (acetyl-CoA) is used in numerous pathways. Accordingly, Compounds for treatment of viral infection by inhibition of targeting ACC does not necessarily lead to marked buildup of de novo fatty acid biosynthesis enzymes (e.g., acetyl-CoA acetyl-CoA because other pathways can consume it. In con carboxylase and fatty acid synthase), the present invention trast, the substrate of FAS (malonyl-CoA) is used largely by also includes Compounds for treatment of viral infection by FAS. Accordingly, targeting of FAS tends to lead to marked inhibition of fatty acid desaturation enzymes (e.g., SCD1, 60 buildup of malonyl-CoA. While such buildup may in some SCD5, as well as enzymes involved in formation of highly cases have utility in the treatment of viral infection, it may in unsaturated fatty acids, e.g., delta-6-desaturase, delta-5-de other cases contribute to side effects. Such side effects are of saturase). Exemplary inhibitors of SCD are described in sec particular concern given (1) the important signaling and tion 5.2. metabolism-modulating functions of malonyl-CoA and (2) As discussed above, control of lipid-related processes is 65 lack of current FAS inhibitors with minimal in vivo side essential to viral growth, replication, and/or other elements of effects in mammals. The inhibition of FAS with resulting infection. The importance of these processes derives in part elevation in intracellular malonyl-CoA can cause cell cycle US 9,029,413 B2 15 16 arrest with a block to cellular DNA replication and onset of enzyme is not methylmalonyl-CoA mutase. In some embodi apoptosis (Pizer et al., Cancer Res. 56:2745-7, 1996: Pizer et ments, the enzyme is not Glutamate Dehydrogenase. In some al., Cancer Res. 58:46.11-5, 1998; Pizer et al., Cancer Res. embodiments, the enzyme is not HMG-CoA synthase. In 60:213-8, 2000), and it has been suggested that this toxic Some embodiments, the enzyme to be targeted for antiviral response can potentially account for inhibition of virus rep intervention is not lysophosphatidic acid acetyltransferase or lication by FAS inhibitors (Rassmann et al., Antiviral Res. lysophosphatidic acid acyltransferase. In other embodiments, 76:150-8, 2007). In contrast, ACC inhibitors such as TOFA the enzyme is not a stearoyl-CoA desaturase (SCD). In cer are remarkably benign in mammals, see e.g., Gibson et al., tain embodiments, the enzyme is not delta-6-desaturase. In Toxicity and teratogenicity studies with the hypolipidemic Some embodiments, the enzyme is not delta-5-desaturase. drug RMI 14,514 in rats. Fundam. Appl. Toxicol. 1981 Jan 10 In certain embodiments, host enzymes involved in the pro urary-Feburary; 1(1):19-25. For example, in rats, the oral duction phopholipids and/or the regulation of phospholipid LD50 of TOFA can be greater than 5,000 mg/kg and no activities are targets for antiviral intervention. Phospholipid adverse effects are observed at 100 mg/kg/day for 6 months. species occur with a diversity of head groups (e.g., choline, In addition, TOFA is not teratogenic in rats at 150 mg/kg/day. serine, inositol, etc.). Production of these species depends on Non-limiting examples of ACC inhibitors are provided in 15 the availability of fatty acid, glycerol, and the head group. section 5.2. Accordingly, inhibition of assimilation or biosynthesis of any Of note, ACC exists as two isozymes in humans, ACC1 and of these chemical moieties in virally infected cells (or in cells ACC2. Compounds described herein include, but are not that serve to feed virally infected cells) can have antiviral limited to isozyme specific inhibitors of ACC. Compounds effects. Furthermore, inhibition of the condensation of these that are isozymes selective are described in section 5.2. components to produce phospholipid, or inhibition of Subse Depending on the specific viral infection and the specific quent metabolism of the resulting phospholipid product, can infection site (e.g., brain, peripheral nervous system, skin, also have antiviral effects. connective tissue, liver, heart, adipose, etc.), targeting of only Among the various phospholipid species, those withinosi a single isozymes of ACC may optimize the therapeutic anti tol-containing head groups are of particular importance dur viral benefit of ACC inhibitor therapy relative to its risk 25 ing viral infection. Metabolomic data indicate that inositol is (which will presumably be reduced by use of an isozymes specifically depleted by HCMV infection of human fibro specific agent). In general, the preferred isozyme to target will blasts. This depletion is particularly striking given that inosi be (1) the dominant isozymes in the particular infected tis tol is present in the media used to grow the fibroblasts. In light Sue(s) of greatest concern and/or (2) the isozyme whose activ of the other data contained herein, this depletion of inositol ity is more strongly upregulated by the particular virus of 30 likely indicates its virally-induced consumption for synthesis interest. of inositol-phospholipid species. The inventors have recently In particular embodiments, host enzymes involved in the found that certain inositol-containing species play an essen glycolysis pathway are targets for antiviral intervention. In tial role in the replication of HCMV. These include phosphati one embodiment, host enzymes of the tricarboxylic acid dylinositol and phosphatidylinositol (3)-phosphate. Accord (TCA) cycle are targeted for antiviral intervention. In one 35 ingly, in certain embodiments, Compounds described herein embodiment, host enzymes involved in fatty acid metabolism are inhibitors of viral replication that target one or more steps and biosynthesis are targets for antiviral intervention. In one of the assimilation or metabolism of inositol or inositol-con embodiment, host enzymes involved in fatty acid oxidation taining metabolites and/or phospholipids. See Example 25, are targets for antiviral intervention. In some embodiments, section 6.25.1. In some embodiments, methods of treating host enzymes involved in fatty acid biosynthesis are targets 40 viral infection described herein comprise administering a for antiviral intervention. In one embodiment, host enzymes Compound to a subject Suffering from a viral infection. In involved in cholesterol biosynthesis and metabolism are tar specific embodiments the methods of treating viral infection gets for antiviral intervention. In an embodiment, host in a Subject Suffering from a viral infection comprise inhib enzymes involved in glucose transportare targets for antiviral iting a class III PI(3)K with the Compound. In other embodi intervention. In one embodiment, cellular components that 45 ments, Compounds described herein are inhibitors of viral are involved in ion homeostasis and energy transport across replication that sequester inositol-containing chemical spe barriers, such as the proton ATPase, are viable targets for cies and thereby block their normal essential role during viral antiviral intervention in accordance with our discovery that infection. See Example 25, section 6.25.2. In certain embodi viruses modulate host metabolic fluxes. Exemplary target ments, the methods of treating viral infection in a subject enzymes of the invention are listed in Table 1. Other enzymes 50 suffering from a viral infection comprise sequestering PI(3)P in these or other pathways related to cellular metabolism are with the Compound. also potential targets of the compounds of the invention. In Phosphoinnositide 3-kinases (PI(3)Ks) are nonlimiting Some embodiments, the enzyme is not an enzyme offatty acid examples of targets of one or more steps of the assimilation or biosynthesis. In some embodiments of the invention, the tar metabolism of inositol or inositol-containing metabolites get enzyme is not an enzyme involved in fatty acid break 55 and/or phospholipids. PI(3)Ks are a family of kinases that down. In certain embodiments, the enzyme target is not phosphorylate the inositol ring of phosphoinositides (see, involved in cholesterol biosynthesis or metabolism. In some e.g., Toker and Cantley, Nature 387:673-676, 1997). PI3Ks embodiments, the enzyme to be targeted in not part of the are classified into three classes on the basis of their structural glycolysis pathway. In particular embodiments, the enzyme is characteristics and Substrate specificities. Class I enzymes are not part of the TCA cycle. In some embodiments, the enzyme 60 heterodimers comprising a p110 catalytic Subunit and a p85 target is not fatty acid synthase. In some embodiments, the or p101 regulatory Subunit, and are activated by tyrosine enzyme is not ATP citrate lyase. In some embodiments, the kinase-based signaling pathways or heterotrimeric G protein enzyme target is not acetyl-CoA carboxylase. In some based signaling pathways. Class II enzymes are large embodiments, the target is not AMP-activated protein kinase. enzymes (>200 kDa) characterized by a C2 domain in their C In some embodiments, the enzyme is not Carnitine Palmitoyl 65 terminus. Class III enzymes that are homologous to Vps34p transferase (CPTI). In some embodiments, the enzyme is not of Saccharomyces cerevisiae have a substrate specificity Malonyl-CoA decarboxylase. In some embodiments, the restricted to PtdIns and produce PtdIns(3)P (see, e.g., Schuet US 9,029,413 B2 17 18 al., Science 260:88-91, 1993). Class III PI(3)K, also known as TABLE 1-continued human Vaculolar protein sorting 34 hVps34, phosphory lates the 3'-hydroxyl group on the inositol ring of PI to pro Host Cell Pathways and Target Enzymes duce PI(3)P. In specific embodiments, the target is a class III Pathways Enzyme PI(3)K (also known as human vaculolar protein sorting 34 5 (hVps34)). putative acyl-CoA dehydrogenase Xenobiotic/medium-chain fatty acid:CoA ligase In some embodiments, the target is notaphosphoinnositide enoyl Coenzyme A hydratase domain containing 3 3-kinase. In other embodiments, the target is not a class III phospholipid scramblase 1 phospholipid scramblase 2 PI(3)K. 10 phospholipid scramblase 4 As discussed above, lipid-related processes are essential to fatty acid desaturase 1 viral growth, replication and/or other elements of infection. Carnitine Palmitoyl transferase (CPT) Consequently, it is likely that multiple cellular enzymes that fatty acid binding protein 5 (psoriasis-associated) fatty acid binding protein 5 (psoriasis-associated) function in lipid metabolism are needed for successful infec fatty acid binding protein 5 (psoriasis-associated) tion, and it is possible that simultaneous inhibition of multiple fatty acid binding protein 5 (psoriasis-associated) enzymes (e.g., two or more different enzymes) will produce a 15 fatty acid binding protein 3, muscle and heart (mammary synergistic inhibition of infection or allow the use of lower derived growth inhibitor) Glucose GLUT4 doses of each Compound to achieve a desirable therapeutic Transport effect. Accordingly, the present invention relates to the pre Glycolysis glucose phosphate isomerase vention and treatment of viral infection in a mammal in need triosephosphate isomerase 1 thereof, via administering to the mammal two or more Com phosphoglycerate kinase 1 enolase 1, (alpha) pounds described herein, wherein each Compound targets pyruvate kinase, muscle one or more different enzymes described herein. In some AMP-activated protein kinase (AMPK) embodiments, such combination therapy is sequential; in TCA aconitase other embodiments, it is simultaneous. In some embodi isocitrate dehy rogenase 25 Succinate-CoA ligase ments, the two or more agents are formulated together to Succinate dehydrogenase create a composition comprising two or more Compounds for malate dehydrogenase the prevention and/or treatment of viral infection via modu malic enzyme lation of host cell lipid and/or cholesterol metabolism. In Proton FO complex, subunit b, isoform 1 Some embodiments, the dose of one of the Compounds is ATPase FO complex, subunit c (subunit 9) isoform 3 30 FO complex, subunit c (subunit 9), isoform 1 substantially less, e.g., 1.5, 2, 3, 5, 7, or 10-fold less, than FO complex, subunite required when used independently for the prevention and/or FO complex, subunit F6 treatment of viral infection. In some embodiments, the dose FO complex, Subunitg F1 complex, alpha subunit, isoform 1 of both agents is reduced by 1.5, 2, 3, 5, 7, or 10-fold or more. F1 complex, beta polypeptide Exemplary pairs of enzymes to inhibit in combination FI complex, epsilon Subunit include, but are not limited to, ACC and citrate lyase: ACC 35 FI complex, O subunit and FAS: ACC and elongase: ACC and SCD: ACC and HMG Cholesterol acetyl-CoA acetyltransferase Synthesis, HMG-CoA Synthase CoA reductase; FAS and HMG-CoA reductase: elongase and Metabolism HMG-CoA Reductase HMG-CoA reductase; SCD and HMG-CoA reductase; elon isopentyldiphosphate isomerase gase and SCD; and acetyl-CoA synthetase and ATP-citrate mevalonate kinase lyase. 40 phosphomevalonate kinase geranyl-diphosphate synthase Exemplary host cell pathways and target enzymes are airnesyl-diphosphate synthase listed in Table 1. airnesyl-diphosphate farnesyltransferase squalene monooxigenase TABLE 1. anosterol synthase 45 Squalene epoxidase Host Cell Pathways and Target Enzymes Squalene Oxidocyclase Miscel actate dehydrogenase B Pathways Enzyme laneous dicarbonyl L-xylulose reductase hydroxyprostaglandin dehydrogenase 15-(NAD) Fatty Acid ATP citrate lyase ribulose-5-phosphate-3-epimerase Biosynthesis ATP citrate lyase I 50 glutamate dehydrogenase HMG-CoA synthase glutaminase Acetyl-CoA carboxylase (ACC) phospholipase A2 Fatty acid synthase cyclooxygenase 1 Fatty acid synthase keto-acyl synthase domain cyclooxygenase 2 Fatty acid synthase thioesterase domain phosphoinositide 3-kinases Lysophosphatidic acid acyltransferase-beta 55 Lysophosphatidic acid acetyltransferase-beta Lysophosphatidic acid acyltransferase Malonyl-CoA decarboxylase AMP-activated protein kinase (AMPK) Fatty acid elongases or ELOVL (elongation of very long 5.2 Compounds chain fatty acid) Stearoyl-CoA desaturases 1-5 60 Delta-6-desaturase Compounds that can be used in the methods described Delta-5-desaturase herein for treatment or prevention of a virus infection, Fatty Acid methylmalonyl Coenzyme A mutase include, but are not limited to, organic and inorganic mol Metabolism acetyl-Coenzyme A carboxylase beta acyl-Coenzyme A oxidase 2, branched chain ecules, peptides and peptide analogs, Small molecules, and putative acyl-CoA dehydrogenase 65 nucleic acid molecules (e.g., RNA interference (RNAi) mol acyl-Coenzyme A dehydrogenase, short branched chain ecules, including small interfering RNA (siRNA), micro RNA (miRNA), short hairpin RNA (shRNA), etc.). US 9,029,413 B2 19 20 Illustrative Compounds are set forth below. -continued In one embodiment, a Compound has the following struc ture (I) (Structure identifiers are also referred to herein alter natively as “Formulas): (I) 5

N O 10 H O O O O

1N1N1 ^n-Nw w 15

where A is —(CH), or

25 where X is from 0 to 6. Compounds of structure (I) can be made using organic synthesis techniques known to those skilled in the art, as well 30 as by the methods described by Hadvary et al. (U.S. Pat. No. 4.958,089), which is incorporated herein by reference in its entirety (particularly at column 8, line 1 to page 11, line 10). Further, specific examples of these compounds can be found 35 in this publication. In one embodiment, the Compound of structure (I) is not A specific example of a Compound of structure (I) is: Orlistat. In one embodiment, a Compound has the following struc ture (II): 40

N (II) H O O O w 45

50 which is also identified as orlistat. In another embodiment a Compound of structure (I) is: wherein the dotted line represents a bond, whereby a double bond is present, or the dotted line is absent, whereby a

55 single bond is present; R is hydrogen, halogen, an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety, or N(R), wherein each occurrence of R is independently hydrogen, a protecting group, or an aliphatic, heteroaliphatic, aryl, het 60 eroaryl, alkylaryl, or alkylheteroaryl moiety; R is hydrogen, halogen, cyano. —OR —N(R), —SR, —O(C=O)R. —N(R)(C=O) (R), —C(O)R. —C(O)CR, —CONCR), —OCOR or an aliphatic, het eroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl 65 moiety, wherein each occurrence of R is independently hydrogen, a protecting group or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety; US 9,029,413 B2 21 22 R is hydrogen, halogen, an aliphatic, heteroaliphatic, aryl, represent a 3 to 7 membered cyclic aliphatic, heteroaliphatic, heteroaryl, alkylaryl, or alkylheteroaryl moiety, or—N(R), aromatic or heteroaromatic moiety; whereby each of the fore wherein each occurrence of R is independently hydrogen, a going aliphatic and heteroaliphatic moieties may indepen protecting group, or an aliphatic, heteroaliphatic, aryl, het dently be substituted or unsubstituted, cyclic or acyclic, or eroaryl, alkylaryl, or alkylheteroaryl moiety; branched or unbranched, and each aryl, heteroaryl, alkylaryl, R is hydrogen, halogen, cyano. —OR —N(R), and alkylheteroaryl moiety may be substituted or unsubsti —SR —O(C=O)R —N(R)(C=O) (R), —C(O)R. tuted; wherein one or any two of R. R. R. R. R. R. R. —C(O)CR, —CONCR), —OCOR, oran aliphatic, het R. R. R. R. or R are optionally a linker covalently bonded eroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl to a compound selected from the group consisting of radici moiety, wherein each occurrence of RD is independently 10 col, monocillin, analogues of radicicol, monocillin, geldana hydrogen, a protecting group or an aliphatic, heteroaliphatic, mycin, analogues of geldanamycin, and steroids; and phar aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety; maceutically acceptable derivatives thereof. Z is O. S or NR, wherein R is hydrogen, a protecting group, an aliphatic, heteroaliphatic, aryl, heteroaryl, alky Compounds of structure (II) can be made using organic laryl, oralkylheteroaryl moiety, or OR, wherein R is hydro 15 synthesis techniques known to those skilled in the art, as well gen, a protecting group, an aliphatic, heteroaliphatic, aryl, as by the methods described in Danishefsky et. al. (Interna heteroaryl, alkylaryl, or alkylheteroaryl moiety; tional Publication No. WO 02/16369), which is incorporated X is O.S or NR, wherein R is hydrogen or lower alkyl: herein by reference in its entirety (particularly at page 69, line A and B together represent 25 to page 87, line 28). Further, specific examples of these compounds can be found in this publication. A specific example of a Compound of structure (II) is:

—CHRs CHR , —CRs=CR , wherein Rs and R. are each independently hydrogen, halogen, cyano, —OR, 30 N(R), SR - O(C=O)R - O(S=O)R - N(R) (C=O)(R), —C(=O)R. —C(=O)CR, —CONCR), —OCOR —OS(=O)CR, or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety, wherein each occurrence of R is independently hydrogen, a protect 35 ing group, or an aliphatic, heteroaliphatic, aryl, heteroaryl, which is identified as radicicol and monorden. alkylaryl, or alkylheteroaryl moiety, and wherein R, is hydro In another embodiment, the Compound of structure (II) is: gen, a protecting group, —OR —SR, —C(O)OR, —C(O)NR, S(O), R —O(C=O)R - N(R)(C=O) 40 (R), —C(O)R. —C(O)CR —CONCR), —OCOR, or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl moiety, wherein each occurrence of R is independently hydrogen, a protecting group or an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkylheteroaryl 45 moiety, or when A and B together represent-CHRs – CHR Rs and R taken together represent a substituted or unsubstituted 3-7 membered aliphatic, heteroaliphatic, aryl or heteroaryl ring, 50 D and E together represent-CHRs CHR , —CRs=CR , wherein Rs and Ro are each independently hydrogen or lower alkyl; G and J together represent —CHR CHR —, —CR-CR, wherein Ro and R are each independently 55 hydrogen or lower alkyl; K and L together represent C=O, C=S, CH-CH, CH-CH(R), C=C (R), —CH2—, —C( S(CH2). S )—, CH OR, CH SR, CH N(R), CH N(R) (C=O)(R), C=N O. R., CH N=O, 60 C=C(R) N(R), C=N R., C=N N (R), or, if the dotted line - - - represents a bond, whereby a double bond is present, then K and L together represent C N(R), wherein each occurrence of R is independently hydrogen, a protecting group, an ali 65 phatic, heteroaliphatic, aryl, heteroaryl, alkylaryl, or alkyl heteroaryl moiety, or two occurrences of R taken together US 9,029,413 B2 23 24 -continued A specific example of a Compound of structure III is: CH, O

(CH2)6

10 which is identified by the compound name SB-204990. In another embodiment the compound of structure (III) is:

15 O C O

O; HO C HO O C O 25

O; HO C HO 30 O C O

35 O; or In one embodiment, the Compound of structure (II) is not C HO O radicicol. OH In one embodiment, a Compound has the following struc C O ture (III): OH. 40 OH O (III) R2 R3 C Cia-Chi R4 45 In one embodiment, the Compound of structure (III) is not R5, SB-2O4990. C 21 O In one embodiment the compound has a structure (IV): R O

(IV) in which, each group R is independently a lipophilic and/ 50 R4 R5 or electron withdrawing group; R n is 5 to 8; and either R and R are both hydrogen, R is CH2) hydrogen or hydroxy and Rs is CH(R)R, in which R is X^n-(CH2) rx*so hydrogen or hydroxy and R, is a carboxyl group or a carboxy C 21 HC) R2 R3 lic acid ester group hydrolysable to a carboxyl group; or R is 55 hydrogen and Rs is hydrogen or hydroxy, R is hydroxy and R is a carboxyl group or a carboxylic acid ester group hydrolysable to a carboxyl group; or R and R are hydrogen in which each group R is independently a lipophilic and/or and Ra and Rs together form a group =C(R)R, in which Re electron withdrawing group; and R, are as defined above, and salts thereof. 60 where n is 5 to 8; and Compounds of structure (III) can be made using organic either R and R are both hydrogen, R is hydrogen or synthesis techniques known to those skilled in the art, as well hydroxy and Rs is CH(R)COOH in which R is hydrogen or as by the methods described in Gribble et. al. (U.S. Pat. No. hydroxy; or R is hydrogen and Rs is hydrogen or hydroxy, R 5.447,954), which is incorporated herein by reference in its is hydroxy and RCOOH, or RandR are hydrogen and R. entirety (particularly at column 10, line 37 to column 24, line 65 and Rs together form a group =C(R)COOH in which R is 50). Further, specific examples of these compounds can be as defined above, and pharmaceutically acceptable salts found in this publication. thereof. US 9,029,413 B2 25 26 Compounds of structure (IV) can be made using organic -continued synthesis techniques known to those skilled in the art, as well as by the methods described in Gribble et. al. (U.S. Pat. No. 5.447,954), which is incorporated herein by reference in its entirety (particularly at column 10, line 37 to column 24, line 5 50). Further, specific examples of these compounds can be found in this publication. A specific example of a Compound of structure (IV) is: 10

C O OH.

C C HO which is identified by the compound name SB-201076. In another embodiment a Compound of structure (IV) is: In one embodiment, the Compound of structure (IV) is not SB-201076. O OH: In one embodiment, a Compound has the following struc C HO HO 25 ture (V):

OH (V) N N C O 30 (R)s- - (R): O OH 2 2 Cl OH

N 35 wherein: Y is selected from the group consisting of CH, CH, C HO O; N. C=O, O, S, and NR, wherein R is selected from the OH group consisting of H. alkyl, alkenyl, alkynyl, aryl, alkoxyl, C O and Y can be present or absent; OH 40 X is O, S, and NR, wherein each R is independently OH: selected from the group consisting of H, alkyl, alkenyl, alky nyl, aryl, and alkoxyl. C HC HO O R is selected from the group consisting of alkyl, halo, OH 45 hydroxyl, alkoxy, aryloxyl, and alkoxy; C O R is selected from the group consisting of H, alkyl, halo, OH hydroxyl, alkoxy, aryloxyl, and alkoxy; OH: n is an integer from 0-3. 50 Compounds of structure (V) can be made using organic C HC HO O synthesis techniques known to those skilled in the art, as well F O OH: as by the methods described in (International Patent Publica tion WO 2005/051296), which is incorporated herein by ref F F HO HO erence in its entirety (particularly at page38, line 4 to page 49, 55 line 11). Further, specific examples of these compounds can be found in this publication. OH A specific example of a Compound of structure V is: C O O OH: 60 O HO CH3. HO HO

C OH 65 O OH O OH C US 9,029,413 B2 27 28 In another embodiment a Compound of structure (V) is: is N CH or mand nare each independently 2 or 3 when A-B HO is CH N; the dashed line represents the presence of an optional double bond; D is carbonyl or sulfonyl: Cl E is either a) a bicyclic ring consisting of two fused fully unsaturated five to seven membered rings, taken indepen OH O s dently, each of said rings optionally having one to four het HO CH3: eroatoms selected independently from oxygen, Sulfur and nitrogen, or b) a tricyclic ring consisting of two fused fully 10 unsaturated five to seven membered rings, taken indepen C dently, each of said rings optionally having one to four het eroatoms selected independently from oxygen, Sulfur and OH O OH nitrogen, said two fused rings fused to a third partially satu HO CH: rated, fully unsaturated or fully saturated five to seven mem 15 bered ring, said third ring optionally having one to four het eroatoms selected independently from oxygen, Sulfur and C nitrogen; or c) a tetracyclic ring comprising a bicyclic ring consisting of two fused fully unsaturated five to seven mem OH N NCH, OH bered rings, taken independently, each of said rings option ally having one to four heteroatoms selected independently l from oxygen, Sulfur and nitrogen, said bicyclic ring fused to HO N CH3: two fully saturated, partially saturated or fully unsaturated five to seven membered monocyclic rings taken indepen dently, each of said rings optionally having one to four het C 25 eroatoms selected independently from oxygen, Sulfur and nitrogen or said bicyclic ring fused to a second bicyclic ring OH O OH consisting of two fused fully saturated, partially Saturated or fully unsaturated five to seven membered rings, taken inde s CH; or pendently, each of said rings optionally having one to four 30 heteroatoms selected independently from oxygen, Sulfur and F nitrogen; or d) a teraryl ring comprising a fully unsaturated OH O OH five to seven membered ring, said ring optionally having one HCO CH. to four heteroatoms selected independently from oxygen, Sulfur and nitrogen, and said ring di-substituted indepen 35 dently with a fully unsaturated five to seven membered ring to form a teraryl nonfused ring system, each of said Substituent C rings optionally having one to four heteroatoms selected DCCCHO O OCH independently from oxygen, Sulfur and nitrogen, wherein said E bi-, tri- or tetra cyclic ring or teraryl ring is optionally 40 mono-, di- or tri-substituted independently on each ring used In one embodiment, the Compound of structure (V) is not: to form the bi-, tri- or tetra cyclic ring or teraryl ring with halo, HO CH3. hydroxy, amino, cyano, nitro, oxo, carboxy, (C-C) alkyl, (C-C) alkenyl, (C-C) alkynyl, (C-C) alkoxy, (C-C) alkylthio, (C-C) alkoxycarbonyl, C 45 wherein said E bi-, tri- or tetra-cyclic-ring or teraryl ring is optionally mono-substituted with a partially saturated, fully DCCOH O OH saturated or fully unsaturated three to eight membered ring Rio optionally having one to four heteroatoms selected inde In one embodiment, a Compound has the following struc pendently from oxygen, Sulfur and nitrogen or a bicyclic ring 50 R" consisting of two fused partially saturated, fully saturated ture (VI): or fully unsaturated three to eight membered rings, taken (VI) independently, each of said rings optionally having one to four heteroatoms selected independently from oxygen, Sulfur and nitrogen, said Ro and R" rings optionally additionally 55 bridged and said Ro and R" rings optionally linked through a fully Saturated, partially unsaturated or fully unsaturated one to four membered straight or branched carbon chain wherein the carbon (s) may optionally be replaced with one or two heteroatoms selected independently from oxygen, nitrogen (H2C) (CH2) 60 and Sulfur, provided said E. bicyclic ring has at least one substituent and the E bicyclic ring atom bonded to D is car bon; wherein said Rio or R"ring is optionally mono-, di- or D NE tri-Substituted independently with halo, hydroxy, amino, cyano, nitro, oxo, carboxy, (C-C) alkyl, (C-C) alkenyl, 65 (C-C) alkynyl, (C-C) alkoxy, (C-C)alkylthio, (C-C) wherein A-B is N CH or CH N; K is (CH) r wherein r is alkoxycarbonyl, (C-C) alkylcarbonyl, (C-C) alkylcarbo 2, 3 or 4 m and n are each independently 1, 2 or 3 when A-B nylamino, or mono-N- or di-N,N-(C-C) alkylamino or US 9,029,413 B2 29 30 mono-N- or di-N,N-(C-C) alkylaminocarbonyl wherein halo, hydroxy, amino, nitro, cyano, oxo, carboxy, (C-C) said (C-C) alkyl and (C-C) alkoxy substituents are also alkyl, (C-C) alkenyl, (C-C) alkynyl, (C-C) alkoxy, (C- optionally mono-, di- or tri-substituted independently with C) alkylthio, (C-C) alkylcarbonylamino or mono-N- or halo, hydroxy, (C-C) alkoxy, amino, mono-N- or di-N,N- di-N,N-(C-C) alkylamino, wherein said (C-C) alkyl (C-C) alkylamino or from one to nine fluorines; Substituent is optionally mono-, di- or tri-substituted indepen G is carbonyl, sulfonyl or CR-7Rs; wherein R, and Rs are dently with halo, hydroxy, amino, nitro, cyano, Oxo, carboxy, each independently H. (C-C) alkyl, (C-C) alkenyl or (C- (C-C) alkoxy, (C-C) alkylthio, (C-C) alkyloxycarbonyl, C) alkynyl or a five to seven membered partially Saturated, mono-N- or di-N,N-(C-C) alkylamino, said (C-C) alkyl fully saturated or fully unsaturated ring optionally having one substituent is also optionally substituted with from one to heteroatom selected from oxygen, Sulfur and nitrogen; J is 10 OR', NRR or CRRR, wherein R', R and R are each nine fluorines; independently H, Q, or a (C-Co) alkyl, (C-C) alkenyl or wherein three heteroatoms selected independently from (C-Co) alkynyl Substituent wherein said carbon(s) may oxygen, Sulfur and nitrogen wherein said ring is optionally optionally be replaced with one or two heteroatoms selected mono-, di- or tri-substituted with halo, hydroxy, amino, nitro, independently from oxygen, nitrogen and Sulfur and wherein 15 cyano, oxo, carboxy, (C-C) alkyl, (C-C) alkenyl, (C-C) said Sulfur is optionally mono- or di-substituted with oXo, alkynyl, (C-C)alkylthio, (C-C) alkoxy, (C-C)alkylcar said carbon (s) is optionally mono-Substituted with oxo, said bonylamino, mono-N- or di-N, N-(C-C) alkylamino; nitrogen is optionally di-substituted with oXo, said carbon (s) wherein said NR.R. ring is optionally substituted with a is optionally mono-, di- or tri-substituted independently with halo, hydroxy, amino, nitro, cyano, carboxy, (C-C) alky partially saturated, fully saturated or fully unsaturated three to lthio, (C-C)alkyloxycarbonyl, mono-N- or di-N,N-(C- eight membered ring optionally having one to three heteroa C) alkylamino or mono-N- or di-N,N-(C-C)alkylami toms selected independently from oxygen, Sulfur and nitro nocarbonyl; and said chain is optionally mono-Substituted gen or a bicyclic ring consisting of two fused partially satu with Q; wherein Q and Q are each independently a partially rated, fully saturated or fully unsaturated three to six saturated, fully saturated or fully unsaturated three to eight 25 membered rings, taken independently, said bicyclic ring membered ring optionally having one to three heteroatoms optionally having one to three heteroatoms selected indepen selected independently from oxygen, Sulfur and nitrogen or a dently from oxygen, Sulfur and nitrogen, said mono or bicy bicyclic ring consisting of two fused or spirocyclic partially clic ring optionally additionally bridged said ring optionally saturated, fully saturated or fully unsaturated three to six having one to three heteroatoms selected independently from membered rings, taken independently, said bicyclic ring 30 optionally having one to three heteroatoms selected indepen oxygen, Sulfur and nitrogen, wherein said (C-C) alkyl and dently from oxygen, sulfur and nitrogen, said mono or bicy said ring are optionally mono-, di- or tri-substituted with halo, clic ring optionally additionally bridged with (C-C) alkylen hydroxy, amino, nitro, cyano, oxo, carboxy, (C-C) alkenyl, wherein said (C-C) alkylen carbons are optionally replaced (C-C) alkynyl, (C-C) alkylcarbonylamino, hydroxy, (C- with one to two heteroatoms selected independently from 35 C) alkoxy, (C-C) alkylthio, (C-C) alkoxy, mono-N- or oxygen, Sulfur and nitrogen; wherein said Q and Q ring are di-N,N-(C-C) alkylamino; wherein R. Rs and R are each independently optionally mono-, di-, tri-, or tetra-Sub independently H, halo, hydroxy, (C-C) alkyl or R and Rs stituted independently with halo, hydroxy, amino, nitro, are taken together to form a partially Saturated, fully saturated cyano, Oxo, carboxy, (C-C)alkyl, (C-C) alkenyl, (C-C) or fully unsaturated three to eight membered ring, said ring alkynyl, (C-C) alkoxy, (C-C) alkylthio, (C-C) alkylcar 40 optionally having one to three heteroatoms selected indepen bonyl, (C-C) alkylcarbonylamino, (C-C)alkyloxycarbo nyl, mono-N- or di-N,N-(C-C) alkylamino, mono-N- or dently from oxygen, sulfur and nitrogen, wherein said (C- di-N,N-(C-C)alkylaminosulfonyl, mono-N- or di-N,N- C) alkyl and said ring are optionally mono-, di- or tri-Sub (C-C) alkylaminocarbonyl, wherein said (C-C) alkyl Sub stituted with halo, hydroxy, amino, nitro, cyano, OXo, stituent is optionally mono-, di- or tri-substituted indepen 45 carboxy, (C-C) alkenyl, (C-C) alkynyl, (C-C) alkylcar dently with halo, hydroxy, amino, nitro, cyano, OXO, carboxy, bonylamino, hydroxy, (C-C)alkoxy, (C-C)alkylthio, (C- (C-C)alkoxy, (C-C) alkylthio, (C-C)alkyloxycarbonyl C.)alkoxy, mono-N- or di-N,N-(C-C)alkylamino with the or mono-N- or di-N,N-(C-C)alkylamino wherein said proviso that 1'-(anthracene-9-carbonyl)-1.4 bipiperidinyl (C-C) alkyl substituent is also optionally substituted with 3-carboxylic acid diethylamide: 1'-(1-oxa-2,3-diaza-cyclo from one to nine fluorines; 50 pentaanaphthalene-5-sulfonyl)-1.4 bipiperidinyl-3 car or wherein R and R can be taken together with the nitro boxylic acid diethylamide: 1'-(5-dimethylamino gen atom to which they are attached to form a partially Satu naphthalene-1-sulfonyl)-1.4 bipiperidinyl-3-carboxylic rated, fully saturated or fully unsaturated three to eight mem acid diethylamide: 1'-(9,10,10-trioxo-9,10-dihydro-thioxan bered ring optionally having one to three additional thene-3-carbonyl)-1-4bipiperidinyl-3-carboxylic acid heteroatoms selected independently from oxygen, Sulfur and 55 nitrogen or a bicyclic ring consisting of two fused, bridged or diethylamide; and 1'-(2-OXO-2H-chromen-3-carbonyl)-1- spirocyclic partially saturated, fully saturated or fully unsat 4 bipiperidinyl-3-carboxylic acid diethylamide are not urated three to six membered rings, taken independently, said included. bicyclic ring optionally having one to three additional het Compounds of structure (VI) can be made using organic eroatoms selected independently from oxygen, Sulfur and 60 synthesis techniques known to those skilled in the art, as well nitrogen or a tricyclic ring consisting of three fused, bridged as by the methods described in (International Patent Publica or spirocyclic partially saturated, fully saturated or fully tion WO 03/072197), which is incorporated herein by refer unsaturated three to six membered rings, taken indepen ence in its entirety (particularly at page 103, line 14 to page dently, said tricyclic ring optionally having one to three addi 160, line 17). Further, specific examples of these compounds tional heteroatoms selected independently from oxygen, Sul 65 can be found in this publication. fur and nitrogen; wherein said NR.R. ring is optionally Other specific examples of Compounds of structure (VI) mono-, di-, tri- or tetra-substituted independently with R15, a. US 9,029,413 B2 31 32 In another embodiment a Compound of structure (VI) is:

NEt.

O HO

N 30

also known as CP-610431. N N Other specific examples of Compounds of structure (VI) () a.

also known as CP-640186. US 9,029,413 B2 33 34 -continued A specific example of a Compound of structure (VII) is: O O

N N(i-Pr).

N N- O N O O 10

which is also known as Pupurone. In a particular embodiment a Compound of structure (VII) is: In one embodiment, the Compound of structure (VI) is not CP-610431. 25

In another embodiment, the Compound of structure (VI) is not CP-64O186. In one embodiment, a Compound has the following struc ture (VII): 30

(VII)

45 which is also known as ningalin D. In a particular embodiment a Compound of structure (VII) is:

wherein each R is independently hydrogen, (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, phenyl, benzyl, or C(O)R. R is —H or OR; 55 R is (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, NR, or phenyl: R is (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, or phenyl. 60 Compounds of structure (VII) can be made using organic synthesis techniques known to those skilled in the art, as well as by the methods described in (Peschko et al., Tetrahedron Letters, 41: 9477-9481, 2000), which is incorporated herein 65 by reference in its entirety. Further, specific examples of these compounds can be found in this publication. US 9,029,413 B2 35 In one embodiment, the Compound of structure (VII) is not Puporone. In another embodiment, the Compound of structure (VII) is not ningalin D. 5 In one embodiment, a Compound has the following struc ture (VIII):

(VIII) 10

15 which is also known as Soraphen B. In another embodiment a Compound of structure (VIII) is:

In this formula, the dotted lines are independently a satu rated bond or a double bond, alternatively, while R is hydro gen, CH or —C(O)A, where A is hydrogen, (C-C)cy 25 cloalkyl or (C-C)alkyl which is unsubstituted or substituted by halogen or (C-C)alkoxy, and X is –OH if the bond is saturated, or—O, —N OY or =N N(R)(R) if there is an unsaturated bond, where Y is hydrogen, (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl or 30 an acyl group —C(O)—Z in which Zis phenyl, ora (C-C)alkyl group which is Substituted by halogen or (C-C)alkoxy, or is hydrogen, (C-C)alkyl, (C- C.)alkenyl or (C-C)alkynyl: 35 R is hydrogen or (C-C)alkyl and R is hydrogen, (C-C)alkyl, phenyl, carbamoyl (CONH2), —COA or —SO, R, where R is (C-C) alkyl, or is phenyl which is unsubstituted or 40 substituted by (C-C)alkyl. Compounds of structure (VIII) can be made using organic synthesis techniques known to those skilled in the art, as well as by the methods described in Böhlendorf et. al. (U.S. Pat. No. 5,026,878), which is incorporated herein by reference in 45 its entirety (particularly at column 10, line 25 to column 16, line 14). Further, specific examples of these compounds can be found in this publication. A specific example of a Compound of structure (VIII) is: 50

60 CH OCH

which is also known as Soraphen A. 65 In a particular embodimenta Compound of structure (VIII) is: US 9,029,413 B2 37 38 -continued In another embodiment a Compound of structure (IX) is:

OH O

FC O 5 NN O --> 2 O

C NOH, or 10

15 CF FC O 3 n N r NOH. 21 O

C O In one embodiment, the Compound of structure (VIII) is FC O CH: not Soraphen A. 25 NN N1 In one embodiment, the Compound of structure (VIII) is not Soraphen B. 2 O In one embodiment, a Compound has the following struc C ture (IX): O 30 FC O X O Z. n1s s n N N 21 O CH3 21 T 35 C Y In one embodiment, the Compound of structure (IX) is not wherein T is oxygen or Sulfur, haloxyflop. X is Cl, Br or CF; 40 In one embodiment, a Compound has the following struc Y is H, Cl, Br or CF, provided at least one of X and Y is ture (X): CF: Z is –C(O)OR –C(O)NRR –C(O)OM", C(O) (X) SR —CNR is H., (C-C)alkyl, benzyl, chlorobenzyl or R R2 C-C alkoxyalkyl, 45 HOC Rais (C-C)alkyl; HO te OH, Rs is H or (C-C) alkyl; R is (C-C) alkyl; O R3 O M is NHRRR, Na, K, Mg or Ca; 50 R and R are each independently selected from R, or wherein when the dashed line is a bond, RandR are not —OCH provided both R- and R cannot be simultaneously present; —OCH and neither is —OCH in —NHRRR,; and R is H, OR, NRRs, SR, halo, C(O)OR or 0 shared with R, is H. (C-C)alkyl or (C-C)hydroxyalkyl. R to form an epoxide ring: A specific example of a Compound of structure (IX) is: 55 R is H or halo: R is H, SR, or O shared with R to form an epoxide ring: R is H. (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, aryl, or benzyl; Rs is H. (C-C)alkyl, or OR; 60 R is H. (C-C)alkyl, SH, or S (C-C)alkyl; OH, Provided that when R is OR or 0 shared with Rs to form an epoxide ring, R can not be halo. Compounds of structure (X) can be made using organic synthesis techniques known to those skilled in the art, as well 65 as by the methods described in (Saxty et al. 1992 Eur. J. Biochem. 202:889-896. and Dolle et. al. 1995 Journal of which is also known as haloxyflop. Medicinal Chemistry 38(3):537-543), which are incorpo US 9,029,413 B2 39 40 rated herein by reference in their entirety. Further, specific In another embodiment a Compound of structure (X) is: examples of these compounds can be found in these publica tions. A specific example of a Compound of structure (X) is: "P"O OH O CO2H O HOC HO OH: O OH:

10 ^^ O COH O HO 21 O OH O

O CO2H also known as 2S-hydroxycitrate. C HOC In a particular embodiment a Compound of structure (X) 15 is: HO OH.

O OH O HOC HO OH, In one embodiment, a Compound has the following struc SX ture (XI): (XI) also known as 2.2-difluorocitrate. 25 NH2 In a particular embodiment a Compound of structure (X) is: (N n HOC 30 HO 7 Hm O O. N N2 t "rr" HO-PEO O SH O h HOPO OH 35 In a particular embodiment a Compound of structure (X) is: O H H w N N SM e - S. 40 HO N-r O O HOC HO OH. CoA

wherein X is S. S=O or —CH : 45 n is from 0 to 6; Z is (C-C)alkyl, (C-C)alkyl-COOH, OR, or NRR: In a particular embodiment a Compound of structure (X) R is H. (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, is: phenyl, or benzyl, R is H. (C-C)alkyl, (C-C)alkenyl, (C-C)alkynyl, 50 phenyl, or benzyl. Compounds of structure (XI) can be made using organic HOC HO OH. synthesis techniques known to those skilled in the art, as well as by the methods described in (Usher et. al. 1994 Biochem istry 33: 7753-7759. and Charlier et. al. 1997 Biochemistry s 55 36: 1551-1558), which are incorporated herein by reference in their entirety. Further, specific examples of these com pounds can be found in these publications. In a particular embodiment a Compound of structure (X) is: A specific example of a Compound of structure (XI) is:

60 O HOC "rr" CoA-S ~s. O S O O n SMe 65 which is also known as 3-Oxobutyl-CoA. US 9,029,413 B2 41 42 In another embodiment a Compound of structure (XI) is: from one to three radicals selected from the group consisting of C-C-alkyl, partially or completely halogenated C-C- alkyl, C-C-alkoxy and C-C-alkylthio, a 6-membered or O O 7-membered saturated heterocyclic structure or mono- or diunsaturated heterocyclic structure which contains one or ... -- NH2: co-st two oxygen or Sulfur atoms or one oxygen and one Sulfur O O atom as hetero atoms and which may furthermore carry from one to three radicals selected from the group consisting of hydroxyl, halogen, C-C-alkyl, partially or completely halo e-r-st e 10 genated C-C-alkyl, C-C-alkoxy and C-C-alkylthio, a O 5-membered heteroaromatic structure containing from one to COA-S COA-S three hetero atoms selected from the group consisting of one CH: CH: or two nitrogenatoms and one oxygen or Sulfur atom, where O O O O the heteroaromatic structure may furthermore carry from one 15 to three radicals selected from a group consisting of cyano, CoA Ns lul OH: CoA Ns OH, or halogen, C-C-alkyl, partially or completely halogenated C-C-alkyl, C-C-alkoxy, partially or completely haloge CH nated C-C-alkoxy, C-C-alkylthio, C-C-alkenyl, C-C- COa 1N1S alkenyloxy, C-C-alkynyloxy and C-C-alkoxy-C-C- Ns COOH. alkyl, phenyl or pyridyl, each of which may furthermore carry from one to three radicals selected from the group consisting In one embodiment, the Compound of structure (XI) is not of nitro, cyano, formyl, halogen, C-C-alkyl, partially or -Oxobutyl-CoA. completely halogenated C-C-alkyl, C-C-alkoxy, partially In one embodiment, a Compound has the following struc or completely halogenated C-C-alkoxy, C-C-alkylthio. ture (XII): 25 C-C-alkenyl, C-C-alkenyloxy, C-C-alkynyl, C-C- alkynyloxy and - NRSR", where R3 and R' have the above mentioned meanings; (XII) R" is hydrogen, hydroxyl or C-C-alkyl: OR R is hydrogen, halogen, cyano, a C-C-alkoxycarbonyl 30 or a C-C-alkylketoxime group: R W -o-w-R C W is a C-C-alkylene, C-C-alkenylene or C-C-alky Rd V nylene chain, each of which may furthermore carry from one Ra to three radicals selected from the group consisting of three Re O C-C-alkyl Substituents, three halogenatoms and one meth 35 ylene substituent; a C-C-alkylene or C-C-alkenylene wherein: chain, both of which may furthermore carry from one to three R" is C-C-alkyl: C-C-alkyl radicals, where in each case one methylene R’ is hydrogen, one equivalent of an agriculturally useful group of the chains may be replaced by an oxygen or Sulfur cation, C-C-alkylcarbonyloxy, C-Co-alkylsulfonyl, atom, a sulfoxyl or sulfonyl group or a group —N(R)—, C-Co-alkylphosphonyl or benzoyl, benzenesulfonyl or ben 40 where R is hydrogen, C-C-alkyl, C-C-alkenyl or C-C- Zenephosphonyl, where the three last-mentioned groups may alkynyl: furthermore each carry from one to five halogen atoms; R is hydrogen; C1-Co-alkyl; vinyl; a group -CH=CH R is hydrogen, cyano, formyl, C-C-alkyl, C-C-alkoxy Z, where Z is cyano, halogen, C-C-alkyl, partially or com C-C-alkyl or C-C-alkylthio-C-C-alkyl, phenoxy-C- pletely halogenated C-C-alkyl, C-C-cycloalkyl, which, if Co-alkyl, phenylthio-C-C-alkyl, pyridyloxy-C-C-alkyl or 45 desired, in turn may carry from one to three Substituents pyridylthio-C-C-alkyl, where the phenyl and pyridyl rings selected from the group consisting of hydroxyl, halogen, may each furthermore carry from one to three radicals C-C-alkyl, partially or completely halogenated C-C-alkyl selected from the group consisting of nitro, cyano, halogen, and C-C-alkoxy; carboxyl, C-Cs-alkoxycarbonyl, benzy C-C-alkyl, partially or completely halogenated C-C- loxycarbonyl, phenyl, thienyl or pyridyl, where these three alkyl, C-C-alkoxy, partially or completely halogenated 50 aromatic radicals may be unsubstituted or may carry from one C-C-alkoxy, C-C-alkylthio, C-C-alkenyl, C-C-alk to three substituents selected from the group consisting of enyloxy, Ca-Ca-alkynyl, Ca-Ca-alkynyloxy and NR'R'', nitro, cyano, halogen, C-C-alkyl, partially or completely where R is hydrogen, C-C-alkyl, C-C-alkenyl, C-C-alky halogenated C-C-alkyl, C-C-alkoxy, partially or com nyl, C-C-acyl or benzoyl which may carry from one to three pletely halogenated C-C-alkoxy, C-C-alkylthio and radicals selected from the group consisting of nitro, cyano, 55 C-C-cycloalkyl, where the cycloalkyl Substituent may be halogen, C-C-alkyl, partially or completely halogenated unsubstituted or in turn may furthermore carry from one to C-C-alkyl, C-C-alkoxy and C-C-alkylthio and three radicals selected from the group consisting of halogen, R" is hydrogen, C1-C4-alkyl, Cs-Co-alkenylor Cs-Co-alky C-C-alkyl, partially or completely halogenated C-C-alkyl nyl: C-C7-cycloalkyl or Cs-C7-cycloalkenyl, where these and C-C-alkoxy; ethynyl which may carry one of the fol groups may furthermore carry from one to three radicals 60 lowing radicals: C-C-alkyl, C-C-cycloalkyl, which, if selected from the group consisting of hydroxyl, halogen, desired, may carry from one to three Substituents selected C-C-alkyl, partially or completely halogenated C-C- from the group consisting of hydroxy, halogen, C-C-alkyl, alkyl, C-C-alkoxy, C-C-alkylthio, benzylthio, C-C- partially or completely halogenated C-C-alkyl and C-C- alkylsulfonyl, C-C-alkylsulfenyland C-C-alkylsulfinyl, a alkoxy, or phenyl, thienyl or pyridyl, where these aromatic 5-membered saturated heterocyclic structure which contains 65 radicals may be unsubstituted or may each furthermore carry one or two oxygen or Sulfur atoms or one oxygen and one from one to three Substituents selected from the group con Sulfur atom as hetero atoms and which may furthermore carry sisting of nitro, cyano, halogen, C-C-alkyl, partially or US 9,029,413 B2 43 44 completely halogenated C-C-alkyl, C-C-alkoxy, partially -continued or completely halogenated C-C-alkoxy and C-C-alky OH lthio; phenyl, halophenyl, dihalophenyl, a 5-membered het N-O eroaromatic group having from one to three hetero atoms, selected from the group consisting of from one to three nitro / \ . gen atoms and one oxygen or Sulfur atom, or a 6-membered S heteroaromatic group having from one to four nitrogen / O atoms, all of which may not be adjacent to one another at the OH same time, where the phenyl and hetaryl groups may, if desired, furthermore carry from one to three radicals selected N-O from the group consisting of nitro, C-C-alkoxy, C-C- / \ . alkylthio, partially or completely halogenated C-C-alkoxy, S radicals Zand-NR'R', where - / O R’ is hydrogen, C-Ca-alkyl, Cs-Co-alkenylor Cs-Co-alky 15 OH nyl; and N-O R is hydrogen, C1-C4-alkyl, Cs-Co-alkenyl, Cs-Co-alky / nyl, C-C-acyl or benzoyl which, if desired, may further more carry from one to three substituents selected from the group consisting of nitro, cyano, halogen, C-C-alkyl, par - / O tially or completely halogenated C-C-alkyl, C-C-alkoxy OH and C-C-alkylthio. N-O Compounds of structure (XII) can be made using organic synthesis techniques known to those skilled in the art, as well 25 as by the methods described in U.S. Pat. No. 5,491,123, S ( \v issued Feb. 13, 1996, which is incorporated herein by refer ence in its entirety (particularly at column 11, line 62 to OH column 13, line 5). Further, specific examples of these Com N-O pounds can be found in this patent. Additional examples of 30 Compounds of structure (XII) are found in U.S. Pat. No. / \ . 6,383,987, issued May 7, 2002; U.S. Pat. No. 6,103,664, S issued Aug. 15, 2000; and U.S. Pat. No. 4,334,913, issued - / O Jun. 15, 1982, each being incorporated herein by reference in its entirety. 35 OH A specific example of a Compound of structure (XII) is: /N-O \ . S OH 40 - / O N-O / \ , OH N-O S / \- O - / O 45 S - / O which is also identified as sethoxydim. In another embodiment, the Compound of structure (XII) OH 50 is: N-O / OH S N-O 55

OH 60 N-O W In one embodiment, the Compound of structure (XII) is not Sethoxydim. 65 In one embodiment, a Compound has the following struc ture (XIII): US 9,029,413 B2 45 46 -continued (XIII) O 21 21

wherein: 21 21 R is Coalkyl, Coalkenyl, aryl or aralkyl; 10 X is NHR' or OR; and R" and R are H or Calkyl. Compounds of structure (XIII) can be made using organic s synthesis techniques known to those skilled in the art, as well 15 O O as by the methods described in U.S. Pat. No. 5,188,830, issued Feb. 23, 1993, which is incorporated herein by refer ence in its entirety (particularly at column 5. line 1 to column s 6, line 62). Further, specific examples of these Compounds can be found in this patent. Additional examples of Com O O pounds of structure (XIII) are found in U.S. Patent Applica tion Publication No. 2003/0158156, published Aug. 21, 2005; H3C(HC), FR 2425432, published Jan. 11, 1980: FR 2457864, pub s lished Dec. 26, 1908; and Lawrence et al., 1999, J. Med. O O Chem. 42:4932-4941, each being incorporated herein by ref 25 erence in its entirety. In one embodiment, a Compound of structure (XIII) is that s wherein R is Coalkenyl. O O A specific example of a Compound of structure (XIII) is: 30 s O O 35 s O O which is also identified as cerulenin. In another embodiment, the Compound of structure (XIII) 40 is: s O O O NH2: 45 s O O O

O NH2: 50 s O O O O O

21 21 OH: 55 O N O O O O

21 21 1. 60 N H2. O YS Y Ya Y. YOYa O O O O 21 21 N1 H 65 O In one embodiment, the Compound of structure (XIII) is not cerulinin. US 9,029,413 B2 47 48 In one embodiment, a Compound has the following struc ture (XIV): (XV)

(XIV) 5

wherein: wherein: R'' is H, or C-Co alkyl, cycloalkyl, alkenyl, aryl, aryla R is selected from —CHOH, -COR, CONR'R' or 15 lkyl, or alkylaryl, —CHR', C(O)CR', C(O)R', COR, wherein R is hydrogen or a lower alkyl group, Rand CHC(O)OR, CHC(O)NHR', where R' is H or Rare each independently hydrogen or a lower alkyl group, C-Co alkyl, cycloalkyl, or alkenyl: R is an amino acid residue bound via a terminal nitrogen on R is C-Coalkyl, cycloalkyl, alkenyl, aryl, arylalkyl, or said amino acid or a peptide having at least two amino acid alkylaryl; residues; and X is OR' or NHR', where R is H, C-C alkyl, wherein R' is aralkyl, aralkyl(lower alkyl)ether or Cs-C, hydroxyalkyl, cycloalkyl, alkenyl, aryl, arylalkyl, or alky alkyl(lower alkyl)ether. laryl, the R'group optionally containing a carbonyl group, a carboxyl group, a carboxyamide group, an alcohol group, or Compounds of structure (XIV) can be made using organic an ether group, the R' group further optionally containing synthesis techniques known to those skilled in the art, as well 25 as by the methods described in U.S. Pat. No. 6,153,589, one or more halogen atoms. issued Nov. 28, 2000, which is incorporated herein by refer Compounds of structure (XV) can be made using organic ence in its entirety (particularly at column 4, line 21 to column synthesis techniques known to those skilled in the art, as well 17, line 24). Further, specific examples of these Compounds as by the methods described in U.S. Patent Application Pub can be found in this patent. 30 lication No. 2006/0241177, published Oct. 26, 2006, which is incorporated herein by reference in its entirety (particularly at In one embodiment, the Compounds of structure (XIV) do pages 7-10 and FIGS. 1 and 2). Further, specific examples of not have activity against a retrovirus. these Compounds can be found in this publication. Additional In another embodiment, the Compounds of structure (XIV) examples of Compounds of structure (XV) are found in Inter do not have activity against a virus which encodes for a 35 national Patent Publication No. WO 2004/041189, published protease. May 21, 2004; International Patent Publication No. WO In another embodiment, the Compounds of structure (XIV) 97/18806, published May 29, 1997; and U.S. Patent Applica do not have activity against Type C retroviruses. Type D tion Publication No. 2005/0239877, published Oct. 27, 2005, retroviruses, HTLV-1, HTLV-2, HIV-1, HIV-2, murine leuke each being incorporated herein by reference in its entirety. mia virus, murine mammary tumor virus, feline leukemia 40 A specific example of a Compound of structure (XV) is: virus, bovine leukemia virus, equine infectious anemia virus, or avian sarcoma viruses Such as rous sarcoma virus. In another embodiment, the Compound of structure (XIV) 1S 2R-cis-Nonyloxirane methanol. 2S-cis-Nonyloxirane 45 methanol. 2R-cis-Heptyloxirane methanol. 2S-cis-Heptylox irane methanol. 2R-cis-(Heptyloxymethyl) oxirane, metha nol. 2S-cis-(Heptyloxymethyl) oxirane, methanol, 2-cis-Un decyloxirane methanol. 2R-cis-(Benzyloxymethyl) oxirane, 50 methanol. 2S-cis-(Benzyloxymethyl) oxirane methanol, cis 2-Epoxydecene, 2R-trans-Nonyloxirane methanol. 2S-trans Nonyloxirane methanol. 2R-trans-Heptyloxirane methanol, which is also identified as C75 (trans-4-carboxy-5-octyl 2S-trans-Heptyloxirane methanol. 2R-trans-Undecyloxirane 3-methylene-butyrolactone). methanol. 2S-trans-Undecyloxirane methanol, 2-trans-Un 55 In another embodiment, the Compound of structure (XV) decyloxirane methanol. 2R-cis-Nonyloxiranecarboxylic is: acid. 2S-cis-Nonyloxiranecarboxylic acid. 2R-cis-Heptylox iranecarboxylic acid. 2S-cis-Heptyloxiranecarboxylic acid, 2-cis-Undecyloxiranecarboxylic acid. 2R-trans-Nonylox iranecarboxylic acid, 2S-trans-Nonyloxiranecarboxylic acid, CH 2R-trans-Undecyloxiranecarboxylic acid, 2S-trans-Undecy 60 loxirane carboxylic acid. 2R-cis-Nonyloxiranecarboxy amide, 2S-cis-Nonyloxiranecarboxy amide, N,N-Diethyl 2R-Cis-nonloxiranecarboxy amide, or N-(2R-cis-Nonylox iraneacyl)-L-proline methyl ester. 65 In one embodiment, a Compound has the following struc ture (XV): US 9,029,413 B2 49 50 -continued wherein: N- O CH R'-R are independently H, OH, alkyl, alkoxy, halogen, 2 NH, NHR, NR, or CR, where R at each occurrence inde N pendently H, halogen or alkyl; O; Q is a NH, O or S; s' NO and two of X, Y and Z are N with the third being Nor CH. --/ Compounds of structure (XVI) can be made using organic O synthesis techniques known to those skilled in the art, as well N- CH as by the methods described in U.S. Patent Application Pub N lication No. 2003/0153570, published Aug. 14, 2003, which is incorporated herein by reference in its entirety (particularly at pages 8-41, Examples 1-90). Further, specific examples of s' NO these Compounds can be found in this publication. Additional N/ 15 examples of Compounds of structure (XVI) are found in U.S. HO O Pat. No. 6,875,781, issued Apr. 5, 2005, incorporated herein N-\ CH by reference in its entirety. N A specific example of a Compound of structure (XVI) is: O; 2O NH2 CH, N11. SN Br, 25 als2 N N H

30 C

N- O CH3 which is also identified as CT-32228. N In another embodiment, the Compound of structure (XVI) H 35 is:

NH2

40 H3C nO 1.n N Cl;

Nals N H

C NH2 HC 50 No N1 NN In one embodiment, the Compound of structure (XV) is not 2. C75. N2 N In one embodiment, a Compound has the following struc- H ture (XVI): 55 (XVI) R3 C 1. R5 NH2 R1 x1 Ny H3C NO2: No N1 NN 60 2 Z O R4 2 N N H

R2 65 US 9,029,413 B2 51 52 -continued -continued NH2

n N1 NN Cl; CH3 1.NN N:

N N Nals N H H

10 C C NH NH HC Cl; 15 CH, N1 SN OH: * no N1 NN 2

N N C H 2O C

Cl; NH2 C N1 NN Br; 25 els2 C NN N N

Nals N H 30 Br NH C C N1 SN Cl; 35 NH2 2 HC C N N 3 No NN als 40 N N CF NH2 Cl; and On 45 F N1 NN CH als2 N1 N N N H 1. Br; CH3 NN 50 C Nals N NH2 H CN. C N1 NN 55 C 2 C N N 1. NO; CH3 NN 60 C Nals N H In one embodiment, the Compound of structure (XVI) is not CT32228. C In one embodiment, a Compound has the following struc ture (XVII): US 9,029,413 B2 53 54

OH (XVII) O H2N,- so R X- R6,

wherein:

R is a straight-chain or branched mono-, poly- or unsub 10 stituted alkyl group, a straight-chain or branched mono-, OH poly- or unsubstituted alkylene group, a straight-chain or branched mono-, poly- or unsubstituted aralkyl, alkylaryl or which is also referred to as oxfenicine. aryl group: In one embodiment, a Compound has the following struc R6 is selected from the group consisting of OH, O-M-, 15 ture (XX): O-M2+, where M is an alkali metal, an alkaline earth metal or N Cl, an earth metal or a cation of an organic nitrogen base, and OR, n where R is a substituted or unsubstituted alkyl or alkylene 2 radical having 1 to 15 carbon atoms. Compounds of structure (XVII) can be made using organic NH O synthesis techniques known to those skilled in the art, as well as by the methods described by Cernerudet. al. (U.S. Pat. No. Hos -OH 7,078,543), which is incorporated herein by reference in its O entirety. Further, specific examples of these compounds can 25 be found in this publication. A specific example of a Compound of structure (XVII) is:

30 which is also referred to as chloroquine. In one embodiment, a Compound has the following struc ture (XXI): C 35

i-K)-c. O HO which is also identified as Etomoxir. 40 In one embodiment, the Compound of structure (XVII) is not Etomoxir.

In one embodiment, a Compound has the following struc C ture (XVIII): 45 which is also referred to as triclosan. O In one embodiment, a Compound has the following struc ture (XXII): OH ? -N 50 N 4N HO N S. N O OH, HO 55 Y O

HO OH O 60 HO which has the chemical name 6-4-(2-Piperidin-1-yl ethoxy)-phenyl)-3-pyridin-4-yl-pyrrazolo 1.5-a-pyrimi OH dine. 65 which is also referred to as epigallocatechin-3-gallate. In one embodiment, a Compound has the following struc In one embodiment, a Compound is a naturally occurring ture (XIX): flavonoid. US 9,029,413 B2 55 56 In a particular embodiment, a Compound is one of the - C(O)NH-, - NRCH -, - NRC(O) , – NRC(O)– following naturally occurring flavonoids: O-, -NH N=CH-, -NRS(O) ,-O-, - OC(O)

—S(O)NH-; L is selected from the group consisting of —C(RR)—, (CH), , —NH , —O—, and —S—; n is 1, 2 or 3: Zis a member selected from the group consisting of alkoxy, hydroxy, hydroxyalkyl, R-O- and R. NH-; 10 R is hydrogen, (C-)haloalkyl or (Ce)alkyl; R and R, are each individually selected from the group consisting of hydrogen, alkyl, haloalkyl and hydroxy or R, and R, taken together with the atom to which they are 15 attached form R, N=; which is also referred to as luteolin; R is selected from the group consisting of hydrogen, alkyl, aryl, haloalkyl, and heteroaryl; R is selected from the group consisting of alkyl, haloalkyl, hydroxy and halo; R is selected from the group consisting of hydrogen, alkyl, haloalkyl, hydroxy and halo, or RandR taken together with the atom to which they are attached form oxo; R, is selected from the group consisting of alkoxy, aryloxy, heteroaryloxy and hydroxy: 25 R is H.N. C(O) or (Cl-)alkylHN C (O) ; and R, is a member selected from the group consisting of alkylcar bonyl, alkyl-NH COO)—, alkoxyalkyl, alkoxyalkylcarbo nyl, alkoxycarbonyl, alkoxycarbonyl-NH-alkyl-NHC(O)—, alkoxy-NH C(O)—, cyanoalkylcarbonyl, hydroxy, which is also referred to as quercetin; or 30 HONH CO) , HNC(O) , HNC(=NH) , HNC(O) alkyl-NHC(O)—, HN O C(O)—, heteroaryl, het eroarylcarbonyl, heterocycle, and heterocyclecarbonyl. An embodiment of structure (XXIV), is structure (XXIVa):

35 X

O S le N / 2- NH; 40 RO O which is also referred to as kaempferol. In one embodiment, a Compound is CBM-301 106. wherein In one embodiment, a Compound has the following struc R is (C)alkyl, (C)alkyl-cycloalkyl, (C)alkyl-het ture (XXIV): 45 eroaryl, (C) alkyl-heterocycloalkyl, and wherein X is -halo, —OH, - NO. NHC(O)—(C)alkyl, CHO, vinyl, allyl, (C)hydroxyalkyl, NH, NH(C)alkyl, N(C) alkyl, CH=NOH, CHNI (Cl)alkyl, or CN: Specific embodiments of structure (XXIVa) are presented 50 in the table below:

or therapeutically Suitable salt, ester or prodrug, thereof, XIVal wherein: X A is selected from the group consisting of alkenyl, alkoxy 55 alkyl, alkyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, O S le haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, and het 2- NH erocyclealkyl; N / B is selected from the group consisting of an aryl ring and RO O a heteroaryl ring, which may optionally be substituted with 60 halo, -halo. —OH, - NO. NHC(O)—(C)alkyl, CHO, vinyl, allyl, (C)hydroxyalkyl, NH, NH(C)alkyl, Compound R X XIVal1 i-Pir H N(C) alkyl). CH=NOH, CHNIC)alkyl or CN: XIVa2 i-Bu H D is selected from the group consisting of an aryl ring and XIVa3 Pr H a heteroaryl ring; 65 XIV.a4 CH2(cyclopropyl) H L is absent or is selected from the group consisting of XIVaS Cyclohexyl H hydroxyalkylene. —C(RR)— —C(O)— —C(O)C)—, US 9,029,413 B2 57 58 -continued

X XIVal

"Y- S 2-le NH 5 Oloro RO O 10 In specific embodiment, the compound of structure Compound R X (XXIV) is not: XIVal6 CH2(cyclohexyl) H XIVaf CH2(Tetrahydrofuran-3-yl) H XIVa3 i-Pir C XIV a i-Bu C 15 XIVa10 Pr C XIVa11 CH2(cyclopropyl) C XIVal12 Cyclohexyl C XIVa13 CH2(cyclohexyl) C XIVal14 CH2(Tetrahydrofuran-3-yl) C XIVa15 i-Bu F XIVa16 i-Bu Br XIVal17 i-Bu Me In one embodiment, a Compound has the following struc XIVal18 i-Bu NO, ture (XXV): XIVal19 i-Bu NH, XIVal2O i-Bu NHCOMe XIVa21 i-Bu CHO XIVa22 i-Bu CH-NOH 25 XIVal23 i-Bu CN XIVa24 i-Bu Vinyl XIVal2S i-Bu CHOH XIVa26 i-Bu CHNMe, 30 Another embodiment of structure (XXIV), is structure (XXIVb):

X X and y are each independently 1, 2 or 3: 35 W is C(O)N(R') C(O)NC(O)R’ N(R')C RO O S (O)N(R') or N(R')C(O) ; le V is C(O) , —C(S)-, -C(R')H, - O - or atte- NH; —CH2—, each R' is independently selected from the group consist O 40 ing of hydrogen; (C-C)alkyl optionally substituted with one or more substituents selected from the group consisting of wherein: halo, methyl or trifluoromethyl; and (C-C)alkyl optionally substituted with one or more substituents selected from the R is (C.)alkyl, (C)alkyl-cycloalkyl, (C)alkyl-het group consisting of methoxy and hydroxyl, eroaryl, (C) alkyl-heterocycloalkyl, and wherein X is R" is selected from the group consisting of hydrogen, -halo, —OH, - NO. NHC(O)—(C)alkyl, CHO, vinyl, (C-C)alkyl and cycloalkyl; allyl, (C)hydroxyalkyl, NH, NH(C)alkyl, NIC) R is selected from the group consisting of (C-C)alkyl, alkyl, CH=NOH, CHNI(C)alkyl or CN: (C-C)alkenyl, (C-C)hydroxyalkyl, (C-C)hydroxy In a specific embodiment, the compound of structure (XX alkenyl, (C-C)alkoxy, (C-C)alkoxyalkyl, (C-C)cy IVb) is: 50 cloalkyl, (C-C)cycloalkylalkyl, aryl, (C7-C)aralkyl, (C- C.)heterocyclyl, (C-C)heterocyclylalkyl, (C-C) heteroaryl, and (C-C)heteroarylalkyl, or R is a multi-ring structure having 2 to 4 rings wherein the i-BuO O S le rings are independently selected from the group consisting of 55 cycloalkyl, heterocyclyl, aryland heteroaryland where some Ory)-- or all of the rings may be fused to each other; - . R is selected from the group consisting of (C-C)alkyl, Me (C-C)alkenyl, (C-C)hydroxyalkyl, (C-C)hydroxy alkenyl, (C-C)alkoxy, (C-C)alkoxyalkyl, (C-C)cy i-BuO O S le 60 cloalkyl, (C-C)cycloalkylalkyl, Substituted aryl, Substi tuted (C7-C)aralkyl, (C-C)heterocyclyl, (C-C) O 2- - heterocyclylalkyl, (C-C)heteroaryl, and (C-C) O heteroarylalkyl: or R is a multi-ring structure having 2 to 4 rings wherein the rings are independently selected from the 65 group consisting of cycloalkyl, heterocyclyl, aryl and het In specific embodiment, the compound of structure eroaryl and where some or all of the rings may be fused to (XXIV) is: each other; US 9,029,413 B2 59 60 RandR are each independently selected from hydrogen, Another specific embodiment of structure (XXV) is: fluoro, chloro, methyl, methoxy, trifluoromethyl, cyano, nitro or - N(R'); R. R. R7, R7, R, R, R, and R are each indepen O CF3 dently selected from hydrogen or (C-C)alkyl, or RandR together, or R7 and R7 together, or Rand R' together, or R and R together are an oxo group, provided that when V is C(O) , R7 and R' together or Rand R' together do not form an oxo group, while the remaining R, --O R", R7, R', R. R. R. and R are each independently 10 selected from hydrogen or (C-C)alkyl; or one of R,R,R, and R7 together with one of R. R. R. and R' forman alkylenebridge, while the remaining R, R", O R7, R', R. R. R. and Rare each independently selected from hydrogen or (C-C)alkyl; 15 R" is hydrogen or (C-C)alkyl; and In one embodiment, a Compound has the following struc each R' is independently selected from hydrogen or (C-C) ture (XXVI): alkyl: a stereoisomer, enantiomer or tautomerthereof, a pharmaceu tically acceptable salt thereof, a pharmaceutical composition (R), (R), thereof or a prodrug thereof. In a specific embodiment, the compound of structure N1 s (XXV) is: R2-N) ()-ARN (C(R)H). V-R: M 25 R1

wherein: m is 1, 2 or 3: n is 1, 2, 3 or 4: 30 p is 2, 3 or 4: V is —C(O)— —S(O)—or—S(O), —O— or —CH2—, R" is hydrogen, alkyl, alkenyl, aryl, heteroaryl, aralkyl, N aralkenyl or cycloalkyl, S/ 35 R is selected from the group consisting of hydrogen, R7 OR, R7 N(R), R7 S(O).R' (wheret is 0,1 O or 2), alkyl, alkenyl, optionally Substituted aryl, optionally Substituted aralkyl, optionally Substituted aralkenyl, option 19-NA O ally substituted cycloalkyl, optionally substituted cycloalky 40 lalkyl, optionally substituted cycloalkylalkenyl, optionally r substituted heterocyclyl, optionally substituted heterocycly U lalkyl, optionally substituted heterocyclylalkenyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl / and optionally substituted heteroarylalkenyl: N 45 R is selected from the group consisting of hydrogen, sN —R OR, R N(R), alkyl, alkenyl, optionally sub stituted aryl, optionally Substituted aralkyl, optionally substi O tuted aralkenyl, optionally Substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted cycloalky /NAr; 50 lalkenyl, optionally substituted heterocyclyl, optionally sub stituted heterocyclylalkyl, optionally substituted heterocy r clylalkenyl, optionally substituted heteroaryl, optionally 2 substituted heteroarylalkyl and optionally substituted het 55 eroarylalkenyl: / N each R is independently hydrogen, alkyl, alkenyl, halo, S/ haloalkyl, aryl, cyano, nitro, R OR, R N(R), or —S(O) R' (where t is 0, 1 or 2); O each R and R is independently hydrogen, oxo, alkyl, 60 alkenyl, halo, haloalkyl or aryl; or one R and one R may together form an straight or branched alkylene bridge: wherein each R7 is independently a straight or branched alkylene or Ar is 2-trifluoromethylphenyl, phenyl, 2-fluorophenyl, alkenylene chain; 3-fluorophenyl, 4-fluorophenyl, 2,3-difluorophenyl, 2,4-dif 65 each R is independently hydrogen, alkyl, alkenyl, luorophenyl, 2,5-difluorophenyl, 2,6-difluorophenyl, 2-chlo haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, hetero rophenyl or 2,5-dichlorophenyl. cyclyl, heterocylylalkyl, heteroaryl or heteroarylalkyl; US 9,029,413 B2 61 62 each R is independently a direct bond or a straight or cycloalkyl, heterocyclyl, aryland heteroaryland where some branched alkylene or alkenylene chain; and or all of the rings may be fused to each other; R' is alkyl, alkenyl, haloalkyl, cycloalkyl, cycloalkyla Rand Rare each independently selected from hydrogen, lkyl, aryl, aralkyl, heterocyclyl, heterocylylalkyl, heteroaryl fluoro, chloro, methyl, methoxy, trifluoromethyl, cyano, nitro or heteroarylalkyl, as a single stereoisomer, a mixture of 5 or - N(R'); Stereoisomers, a racemic mixture thereof of stereoisomers, or R. R. R. R', R. R. R. and R' are each indepen as a tautomer; or as a, pharmaceutically acceptable salt, pro dently selected from hydrogen or (C-C)alkyl, or drug, Solvate or polymorph thereof. RandR together, or R7 and R7 together, or RandR A specific embodiment of structure (XXVI) is: 10 together, or R and R” together are an oxo group, provided that when V is C(O) , R7 and R7 together or RandR O Br together do not form an oxo group, while the remaining R, R. R. R7, R, R, R and R are each independently selected from hydrogen or (C-C)alkyl; or 15 one of R. R. R7, and R7 together with one of R, R, R --O and R' forman alkylenebridge, while the remaining R, R", R. R. R. R. R. and Rare each independently selected from hydrogen or (C-C)alkyl; R" is hydrogen or (C-C2)alkyl; and each R" is independently selected from hydrogen or (C- C.)alkyl, In one embodiment, a Compound has the following struc a stereo isomer, enantiomer or tautomer thereof, a pharma ture (XXVII): ceutically acceptable salt thereof, a pharmaceutical compo 25 sition thereof or a prodrug thereof. R4 RR5 a .6 R7 R7a One embodiment of structure (XXVII) is (XXVIIa): R2-W / \ N V-R; 30 NRN y R9a R9 Rsa8 R8

wherein: 35 X and y are each independently 1, 2 or 3; W is C(O)N(R') C(O)NC(O)R' N(R')C(O) N(R') or N(R')C(O) ; V is C(O) , —C(S) , —C(R')H, O— or —CH2—, each R" is independently selected from the group consist- 40 ing of hydrogen; (C-C)alkyl optionally substituted with one or more substituents selected from the group consisting of halo, methyl or trifluoromethyl; and (C-C)alkyl optionally substituted with one or more substituents selected from the group consisting of methoxy and hydroxyl; 45 R" is selected from the group consisting of hydrogen, (C- C.)alkyl and cycloalkyl, R is selected from the group consisting of (C-C)alkyl, (C-C2)alkenyl, (C-C2)hydroxyalkyl, (C-C2)hydroxy- so alkenyl, (C-C)alkoxy, (C-C)alkoxyalkyl, (C-C)cy cloalkyl, (C-C)cycloalkylalkyl, aryl, (C7-C)aralkyl, (C- C.)heterocyclyl (C-C)heterocyclylalkyl, (C-C) heteroaryl, and (C-C)heteroarylalkyl; or R is a multi-ring structure having 2 to 4 rings wherein 55 the rings are independently selected from the group consist ing of cycloalkyl, heterocyclyl, aryland heteroaryland where Some or all of the rings may be fused to each other; R is selected from the group consisting of (C-C)alkyl, (C-C)alkenyl, (C-C)hydroxyalkyl, (C-C)hydroxy- 60 alkenyl, (C-C)alkoxy, (C-C)alkoxyalkyl, (C-C)cy cloalkyl, (C-C)cycloalkylalkyl, Substituted aryl, Substi tuted (C7-C)aralkyl, (C-C)heterocyclyl, (C-C) heterocyclylalkyl, (C-C)heteroaryl, and (C-C) and wherein Ar is 2-fluorophenyl, 2-chlorophenyl, 2-bro heteroarylalkyl; or 65 mophenyl, 2-cyanophenyl or 2-chloro-5-fluorophenyl. R is a multi-ring structure having 2 to 4 rings wherein the In one embodiment, a Compound has the following struc rings are independently selected from the group consisting of ture (XXVIII): US 9,029,413 B2 64 In one embodiment, the Compound of structure (XVIII) is: 5 6 L 7 R R Ra R. R. R7a F R2 / \ N V-R; 5 NRN R9a R9 R 8. R8 e N N O Cl, or 10 NS N-N F wherein: X and y are each independently 1, 2 or 3; 15 V is –C(O)—, C(S)-, - C(R')H, - O - or N-N o —CH2—, each R" is independently selected from the group consist ing of hydrogen; (C-C)alkyl optionally substituted with one or more substituents selected from the group consisting of 20 halo, methyl or trifluoromethyl; and (C-C)alkyl optionally substituted with one or more substituents selected from the One specific embodiment of structure (XXVIII) is (XX group consisting of methoxy and hydroxyl; VIIIa) as follows: R" is selected from the group consisting of hydrogen, (C-C)alkyl and cycloalkyl; 25 29 Ar; R is selected from the group consisting of (C-C)alkyl, (C-C)alkenyl, (C-C)hydroxyalkyl, (C-C)hydroxy alkenyl, (C-C)alkoxy, (C-C)alkoxyalkyl, (C-C)cy r cloalkyl, (C-C)cycloalkylalkyl, aryl, (C7-C)aralkyl, (C- 2 C.)heterocyclyl, (C-C)heterocyclylalkyl, (C-C) 30 Z \ heteroaryl, and (C-C)heteroarylalkyl; or N R is a multi-ring structure having 2 to 4 rings wherein the SN rings are independently selected from the group consisting of cycloalkyl, heterocyclyl, aryland heteroaryland where some ( \, or all of the rings may be fused to each other; R is selected 35 --- from the group consisting of (C-C)alkyl, (C-C)alkenyl, (C-C)hydroxyalkyl, (C-C)hydroxyalkenyl, (C-C) alkoxy, (C-C)alkoxyalkyl, (C-C)cycloalkyl, (C-C) wherein cycloalkylalkyl, Substituted aryl, Substituted (C7-C)aralkyl, 40 R" is —CH, —CF, n-Pror —CHPh; and wherein (C-C)heterocyclyl (C-C)heterocyclylalkyl, (C-C) Ar is phenyl, 2-chlorophenyl, 2-fluorophenyl, 2-meth heteroaryl, and (C-C)heteroarylalkyl; or ylphenyl or 2-chloro-5-fluorophenyl. R is a multi-ring structure having 2 to 4 rings wherein the rings are independently selected from the group consisting of Another specific embodiment of structure (XXVIII) is cycloalkyl, heterocyclyl, aryland heteroaryland where some (XVIIIb) as follows: or all of the rings may be fused to each other; 45 RandR are each independently selected from hydrogen, fluoro, chloro, methyl, methoxy, trifluoromethyl, cyano, nitro or - N(R'); R. R. R. R. R. R. R. and R are each indepen dently selected from hydrogen or (C-C)alkyl, or RandR together, or R7 and R7 together, or Rand R' together, or R and R together are an oxo group, provided that when V is C(O) , R7 and R' together or Rand R' together do not form an oxo group, while the remaining R, 55 R", R7, R', R. R. R. and R are each independently selected from hydrogen or (C-C)alkyl; or one of R, R, R7, and R7 together with one of R, R, R and R' forman alkylenebridge, while the remaining R, R", R7, R',R,R,R, and Rare each independently selected 60 from hydrogen or (C-C)alkyl; R" is hydrogen or (C-C2)alkyl; and wherein R' is CH, -CF, n-Pror —CHPh; each R' is independently selected from hydrogen or (C- and wherein Aris phenyl, 2-chlorophenyl, 2-fluorophenyl, C.)alkyl, a stereoisomer, enantiomer or tautomer thereof, a is 2-methylphenyl or 2-chloro-5-fluorophenyl. pharmaceutically acceptable salt thereof, a pharmaceutical Another specific embodiment of structure (XXVIII) is composition thereof or a prodrug thereof. (XXVIIIc) as follows: US 9,029,413 B2 65 66 -continued 29 Ar;

r 5

/ N S-1 O N 10 le N R13 - N1 N wherein R' is —CH, -CF, n-Pror —CHPh; and wherein Aris phenyl, 2-chlorophenyl, 2-fluorophenyl, 15 and wherein Aris phenyl, 2-chlorophenyl, 2-fluorophenyl, 2-methylphenyl or 2-chloro-5-fluorophenyl. 2-methylphenyl or 2-chloro-5-fluorophenyl. Yet another specific embodiment of structure (XXVIII) is In one embodiment, a Compound has the following struc (XXVIIId) as follows: ture (XXIX): 29 Ar; s N COCHCOR; 2 25

SN N Het wherein: 30 X is —(Cs-Co.)alkyl, —O—(Cs-Co.)alkyl or —(C-C) wherein Het is: alkoxy; Ris—O—(C-C)alkyl, (C-C)alkoxy, O (C-C) alkyl-NHC(O)—(C-C)alkyl, -NH2 or NH (C-C) alkyl: 35 H s s a stereoisomer, enantiomer or tautomer thereof, a pharma N ceutically acceptable salt thereof, a metal chelate thereof, a N^ pharmaceutical composition thereof or a prodrug thereof. In a specific embodiment, a compound of structure (XXIX) is:

OCH:

O O

OCH:

O O

OCH:

O O

US 9,029,413 B2 71 72

COH: (N 1N1-1N1\-1N COH: (N S. O COH: (1 N S. O CO H; or $1 N S. O

In a specific embodiment, the compounds of structure 30 m is 1, 2 or 3: (XXXII) are the compounds disclosed in Parker et al., J. Med. each of R. R., at each occurrence, is independently Chem. 1977, 20, 781-791, which is herein incorporated by selected from the group consisting of hydrogen, alkyl, reference in its entirety. hydroxyalkyl, and haloalkyl when m is 1, 2 or 3: In one embodiment, a compound of structure (XXXIII) is: alternatively, Ra, and Ra, together with the carbon to which 35 they are attached form a monocyclic cycloalkyl or hetero cycle ring when m is 1: Ars is phenyl or monocyclic heteroaryl; wherein Ars is substituted with 1, 2 or 3 or 4 substituents independently selected from the group consisting of alkyl, alkenyl, —CN. 40 —NO, halogen, —ORs, —O N=CH(R), —OC(O)R. structure (XXIII), which is also referred to as TOFA and has —OC(O)N(R)(Rs), —OC(O)OR —OS(O).Rs —SR, the chemical name 5-(tetradecyloxy)-2-furoic acid. —S(O)R. —S(O),Rs, S(O)ORs, S(O)N(R)(Rs), In a specific embodiment, a compound of structure - C(O)Rs –C(O)N(R)(Rs), C(O)ORs –C(O)N(R) (XXXIII) is not TOFA, which is also depicted as the follow (Rs), —N(R)(Rs), —N(H)—N=CH(R), —N(R)C(O)R. ing structure: 45 - N(R)C(O)ORs, N(R)S(O).Rs, N(R)C(O)N(R) (Rs), —N(R)S(O)N(R)(Rs), —Rs, haloalkyl, cyanoalkyl, nitroalkyl, hydroxyalkyl, alkoxyalkyl, haloalkoxyalkyl, -alkylenyl-OC(O)R., -alkylenyl-OC(O)N(R)(Rs), -alkyle nyl-OC(O)OR, -alkylenyl-OS(O),Rs, -alkylenyl-SR, on 50 -alkylenyl-S(O)R., -alkylenyl-S(O).Rs, -alkylenyl-S(O) ORs, -alkylenyl-S(O)N(R)(Rs), -alkylenyl-C(O)Rs, -alky In one embodiment, a Compound has the following struc lenyl-C(O)N(R)(Rs), -alkylenyl-C(O)ORs, -alkylenyl-C(O) ture N(R)(Rs), -alkylenyl-N(R)(Rs), -alkylenyl-N(R)C(O)R. -alkylenyl-N(R)C(O)CRs, -alkylenyl-N(R)S(O),Rs, -alky 55 lenyl-N(R)C(O)N(R)(Rs), -alkylenyl-N(R)S(O)N(R) (XXXIV): (Rs), an alkylenyl-Rs: R, at each occurrence, is independently selected from the H. R. group consisting of alkyl, alkenyl, haloalkyl, alkoxyalkyl, Ar1 N.YAr-Ar; : X Z: haloalkoxyalkyl, -Rs, and -alkylenyl-Rs: 60 R, at each occurrence, is independently selected from the group consisting of hydrogen, alkyl, arylalkyl, haloalkyl, and wherein: heteroarylalkyl; R is selected from the group consisting of hydrogen, Rs, at each occurrence, is independently selected from the cycloalkyl, alkyl and haloalkyl; group consisting of hydrogen, alkyl, alkenyl, haloalkyl, Y is selected from the group consisting of —(CR, 65 alkoxyalkyl, haloalkoxyalkyl, -Rs, and -alkylenyl-Rs, Ra) , —C(O)— —O— —N(H)— —N(alkyl)- and Ar is selected from the group consisting of phenyl and a —S-; wherein monocyclic, five or six-membered heteroaryl;

US 9,029,413 B2 81 82 -continued -continued O O S 1. O NJ- O N 21 5

HO OH: Crs s O O

10 O O

O s No Crc 1 15 SSo O O N N C O O

F Crs ~c F. O On N 25 In a specific embodiment, a compound of structure (XXX VIII) is: In one embodiment, a Compound has the following struc CF3, ture (XXXVIII): 30

O 35 11. wherein R" is -H, -(C-C)alkyl, -(C-C)alkenyl, -(C-C) 40 alkynyl or —(C-C)alkoxy; R is -H, -(C-C)alkyl, -(C-C)alkenyl, -(C-C) alkynyl. —(C-C)cycloalkyl or a phenyl which may be optionally substituted with one or more halo. —(C-C)alkyl, 45 also referred to as flufenacet. —(C-C)alkenyl- and/or (C-C)alkynyl groups; In a specific embodiment, a compound of structure (XXX X is —CHO, —CHS. O. —S, NH, N(C-C)alkyl, VIII) is not flufenacet. In a specific embodiment, a compound of structure (XXX VIII) is: 50

S -N1-S 55 S 11. 60

65 C

also referred to as anilofos. US 9,029,413 B2 83 84 In a specific embodiment, a compound of structure (XXX VIII) is not anilofos. In a specific embodiment, a compound of structure (XXX VIII) is: n Cl, 5 ..

C s

10 also referred to as allidochlor. In a specific embodiment, a compound of structure (XXX VIII) is not allidochlor. 15 In a specific embodiment, a compound of structure (XXX VIII) is:

also referred to as fentraZamide. In a specific embodiment, a compound of structure (XXX VIII) is not fentraZamide. 25 In a specific embodiment, a compound of structure (XXX 11. VIII) is: -N 30 also referred to as triallate. In a specific embodiment, a compound of structure (XXX VIII) is not triallate. 35 In one embodiment, a Compound has the following struc ture (XXXIX):

R2a 40 R2b R1 1N O N --(Y): 2 also referred to as cafenstrole. 45 In a specific embodiment, a compound of structure (XXX wherein VIII) is not cafenstrole. R" is —C(halo), or In a specific embodiment, a compound of structure (XXX VIII) is: 50 O N (X), it 2 55 O

R" and R may combine to form an oxirane ring or 60 (=CH-); X is -halo: Y is halo; also referred to as alachlor. In a specific embodiment, a compound of structure (XXX m is 0, 1 or 2; and VIII) is not alachlor. 65 n is 0, 1 or 2. In a specific embodiment, a compound of structure (XXX In a specific embodiment, a compound of structure VIII) is: (XXXIX) is: US 9,029,413 B2 85 86

N I H (R)- 2 -N R2; O) S O O W O wherein 10 which is also referred to as indanofan. R is a hydrocarbon radical or hydrocarbonoxy radical, preferably a radical from the group consisting of alkyl, alk In a specific embodiment, a compound of Structure enyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, alkoxy, (XXXIX) is S-indanofan. alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, aryl In a specific embodiment, a compound of Structure and aryloxy, which is unsubstituted or Substituted and inclu (XXXIX) is R-indanofan. 15 sive of substituents has 1 to 30 carbon atoms, preferably 1 to In a specific embodiment, a compound of Structure 20 carbon atoms, or R is a heterocyclyl radical or heterocy clyloxy radical which is unsubstituted or substituted or R is a (XXXIX) is not indanofan. hydrogen atom, halogen or a radical C(O)R, OC(O)R. In a specific embodiment, a compound of Structure S(O),R, OS(O).R, OH, CN, NO, NH, SFs, NRR or (XXXIX) is not S-indanofan. Si(R), where n is 0, 1 or 2: In a specific embodiment, a compound of Structure R' independently at each occurrence is halogen, OH, SH, a (XXXIX) is not R-indanofan. carbon-free, nitrogen-containing radical or a carbon-contain In a specific embodiment, a compound of Structure ing radical having 1 to 30 carbon atoms, preferably 1 to 20 (XXXIX) is: 25 carbon atoms; 1 is 0, 1, 2 or 3, preferably 0, 1 or 2, more preferably 0 to 1, very preferably 0: R’ is a substituted or unsubstituted heterocyclyl radical having 5 ring members, of which preferably at least one is 30 oxygen, Sulfur or nitrogen and one to four further ring mem Cl; bers may be nitrogen; R is a hydrocarbon radical or hydrocarbonoxy radical, preferably a radical from the group consisting of alkyl, alk enyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, alkoxy, 35 alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, aryl and aryloxy, which is unsubstituted or Substituted and inclu sive of substituents has 1 to 30 carbon atoms, preferably 1 to 20 carbon atoms, or R is a heterocyclyl radical or heterocy clyloxy radical which is unsubstituted substituted, or R is a 40 hydrogen atom, CN or NRR: R" is a group of the formula R'-Q'-, in which R' is a hydrogen atom, an acyl radical, a hydrocarbon radical or a heterocyclyl radical, each of the last-mentioned two radicals 45 being unsubstituted or substituted and inclusive of substitu ents having 1 to 30 carbon atoms, preferably 1 to 20 carbon atoms, and Q is a direct bond or a divalent group of the formula—O— or -N(R") , R" being a hydrogen atom, an acyl radical or a hydrocarbon radical and the last-mentioned 50 radical being unsubstituted or substituted and inclusive of substituents having 1 to 30 carbon atoms, preferably 1 to 20 carbonatoms, or RandR" form with one another a nitrogen containing heterocyclic ring; R is a hydrogen atom, an acyl radical, a hydrocarbon 55 radical or a heterocyclyl radical, each of the last-mentioned two radicals being unsubstituted or substituted and inclusive of substituents having 1 to 30 carbonatoms, preferably 1 to 20 carbonatoms, or RandR form with one another a nitrogen containing heterocyclic ring; 60 R is a hydrocarbon radical which is unsubstituted or sub stituted and inclusive of substituents has 1 to 30 carbonatoms, preferably 1 to 20 carbon atoms, preferably (C-C)alkyl or (Co-Co)aryl; and

65 W is an oxygen atom or a Sulfur atom. In one embodiment, a Compound has the following struc In a specific embodiment, a compound of structure (XL) ture (XL): is: US 9,029,413 B2 87 88 enyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, alkoxy, O I alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, aryl and aryloxy, which is unsubstituted or Substituted and inclu Y sive of substituents has 1 to 30 carbon atoms, preferably 1 to 1 N n 2 20 carbon atoms, or R is a heterocyclyl radical or heterocy 7\ N OCH: clyloxy radical which is unsubstituted substituted, or R is a O O hydrogen atom, CN or NRR: R" is a group of the formula R'-Q", in which R is a hydrogen atom, an acyl radical, a hydrocarbon radical or a 10 heterocyclyl radical, each of the last-mentioned two radicals being unsubstituted or substituted and inclusive of substitu N N s1 Né OCH2CH: ents having 1 to 30 carbon atoms, preferably 1 to 20 carbon MV atoms, and Q is a direct bond or a divalent group of the CH3CH2O O O 15 formula—O— or—N(R")—, R" being a hydrogen atom, an O CH3 acyl radical or a hydrocarbon radical and the last-mentioned I M radical being unsubstituted or substituted and inclusive of NY substituents having 1 to 30 carbon atoms, preferably 1 to 20 s1 YN 2 OCH2CH2CH3 or carbonatoms, or RandR" form with one another a nitrogen MV containing heterocyclic ring; ÖF, O O Ö R is a hydrogen atom, an acyl radical, a hydrocarbon radical or a heterocyclyl radical, each of the last-mentioned two radicals being unsubstituted or substituted and inclusive HC I O D of substituents having 1 to 30 carbonatoms, preferably 1 to 20 N 25 carbonatoms, or RandR form with one another a nitrogen N containing heterocyclic ring; R is a hydrocarbon radical s1 YN2 OCH3. which is unsubstituted or substituted and inclusive of Sub MV stituents has 1 to 30 carbon atoms, preferably 1 to 20 carbon FHdi O O Ö atoms, preferably (C-C)alkyl or (C-C)aryl; W is an oxygen atom or a Sulfur atom; 30 X and Yindependently of one another are each a hydrogen In one embodiment, a Compound has the following struc atom, halogen, (C-C)alkyl, (C-C)alkoxy or (C-C)alky ture (XLI): lthio, each of the last-mentioned three radicals being unsub stituted or substituted by one or more radicals from the group consisting of halogen, (C-C)alkoxy, and (C-C)alkylthio. 35 or are mono- or di(C-C)alkylamino, (C-C)alkenyl, (C- C.)alkynyl, (C-C)alkenyloxy or (C-C)alkynyloxy; and V and Z independently of one another are each CH or N. In a specific embodiment, a compound of structure (XLI) 1S 40

I wherein OCH: R is a hydrocarbon radical or hydrocarbonoxy radical, 45 s1 n preferably a radical from the group consisting of alkyl, alk enyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, alkoxy, F O O 5 Na2 alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, aryl and aryloxy, which is unsubstituted or Substituted and inclu KricOCH sive of substituents has 1 to 30 carbon atoms, preferably 1 to 50 20 carbon atoms, or R is a heterocyclyl radical or heterocy I clyloxy radical which is unsubstituted or substituted or R is a hydrogen atom, halogen or a radical C(O)R, OC(O)R. N CH 3. S(O),R, OS(O),R, OH, CN, NO, NH, SF, NR,R or Si(R), where n is 0, 1 or 2: R' independently at each occur 55 M \, rence is halogen, OH, SH, a carbon-free, nitrogen-containing (CH)CHÖ O O Ö Na2 radical or a carbon-containing radical having 1 to 30 carbon atoms, preferably 1 to 20 carbon atoms; CH3 1 is 0, 1, 2 or 3, preferably 0, 1 or 2, more preferably 0 to 1, I very preferably 0: 60 R’ is a hydrogen atom or a hydrocarbon radical which is OCH3 or unsubstituted or substituted and inclusive of substituents has s1 N 1 to 20 carbon atoms, preferably 1 to 10 carbon atoms, e.g., unsubstituted or substituted (C-C)alkyl, preferably H or FCHO O 11Na2 CH: 65 R is a hydrocarbon radical or hydrocarbonoxy radical, C preferably a radical from the group consisting of alkyl, alk US 9,029,413 B2 89 90 -continued In one embodiment, a Compound has the following struc ture (XLIII):

OR RHN CHCH(CH3)CHO O O Ö N 2 X RO C

10 X iii. In one embodiment, a Compound has the following struc ture (XLII):

15 R1 R2 wherein: R is H or optionally substituted lower alkyl, aryl, aralkyl, 11 CH2)S-CH3), or alkyloxyalkyl; each R is independently H, protecting group, or - C(=O). CHR NHR, where: and pharmaceutically acceptable salts, Solvates, hydrates, R is selected from the group consisting of alkyl, aryl, acyl, clathrates, or prodrugs thereof, wherein: keto, azido, hydroxyl, hydrazine, cyano, halo, hydrazide, alk Z" and Z are independently -OH, -OPOH, enyl, alkynl, ether, thiol, seleno, Sulfonyl, borate, boronate, —OP.O.H. —OPO-(nucleotide), —OPO(H)-(nucle phospho, phosphono, phosphine, heterocyclic, enone, imine, otide); R" and Rare independently hydrogen, methyl, or phenyl: 25 aldehyde, ester, thioacid, hydroxylamine, amino group, and R and Rare independently methyl or phenyl: combinations thereof, and m and n are independently 0, 1, 2, 3, 4, 5, or 6: R, is Horamino protecting group; Y' and Y are independently —CH, each V and Z is independently (CRR), O, NR, S, Ar. CRR Ar, OAr, NRAr, SAr, or Ar where: 30 each R and R is independently H. lower alkyl, OH, H O-lower alkyl, or R and R taken together, is =O, —N OH, =N-O- Sr. - N'- lower alkyl, or—N—O CHCH O CH: OH O OH O 35 R is H. lower alkyl, or —CH2CH2—O CH; and n is 1 to 7: q is 0 to 3: and Ar is an optionally substituted aryl or heteroaryl; X is O, S, Se, C(O), C(H)F, CF, S(O), NH, O P(O)(OH)– u is 0 or 1; O, NH C(O) NH or NH C(S) NH. 40 In a specific embodiment, a Compound of structure (XLII) each X is independently H or halogen; and is: m is 4 to 12.

HO OH: rx-n- O --~-X- OH: O O

P O P HO1OH Srx-n- N-X- NOH:OH O | P P HO1OH N-X-r-n-X- NOH:OH O O

P P HO1OH Srx-n-r-n-X- NoH.OH US 9,029,413 B2 91 92 In a specific embodiment, the Compound of structure -continued (XLIII) is: O

OH 5 N1 N1 N.

HN2 O O HO HOOC1 N s N s O 10 O(CH2)6CH3: OH O

HN C s HO 15 N

O C O(CH2)5CH3: O OH 2O F N s HN n HO 21 O

O 25 HCO s O(CH2)5CH3: 3 OH N HN HOS-11-0 O 30 O O(CH2)CH3; or O N

NH 35 O X- (CH2)3CH3. O N y N O In one embodiment, a Compound has the following struc- 40 ( ture (XLIV): HN O

O 45 { N

O O . O

-Nulls so In a specific embodiment, the Compound of structure (XLIV) is: wherein: R" is -H, -(C-C)alkyl, -(C-C)cycloalkyl, -(C- 55 H3C H O C.)alkoxy, —O(C-C)alkyl, —N((C-C)alkyl) or —NH O O O 2. (C-C)alkyl, N-H, R’ is —H or —(C-C)alkyl; -a-a-N-N-N-- R is Hor—(C-C)alkyl; and H H R is 60 O

which is referred to as moiramide B. In a specific embodiment, the Compound of structure 65 (XLIV) is not moiramide B. In a specific embodiment, the Compound of structure (XLIV) is: US 9,029,413 B2 94

which is referred to as andrimid. 10 In a specific embodiment, the Compound of structure (XLIV) is not andrimid. In a specific embodiment, the Compound of structure (XLIV) is:

US 9,029,413 B2 95 96 In one embodiment, a Compound is an inhibitor of class III 995, 5,385,929 and 5,686,104); itavastatin (e.g., see U.S. Pat. Phosphoinositide 3-kinase (III PI3K). No. 5,011.930); Shionogi-Astra/Zeneca visastatin (ZD In a particular embodiment, the Compound of structure 4522) (e.g., see U.S. Pat. No. 5,260.440), related statin com (XLV) is: pounds (e.g., see U.S. Pat. No. 5,753,675); pyrazole analogs ofmevalonolactone derivatives (e.g., see U.S. Pat. No. 4,613, 610); indene analogs of mevalonolactone derivatives (e.g., see International Patent Application Publication No. WO 1986/03488), 6-2-(substituted-pyrrol-1-yl)-alkyl)pyran-2- N1 N N ones and derivatives thereof (e.g., see U.S. Pat. No. 4,647. 10 576): Searle's SC-45355 (a 3-substituted pentanedioic acid y derivative) dichloroacetate, imidazole analogs of mevalono lactone (e.g., see International Patent Application No. WO 1986/07054): 3-carboxy-2-hydroxy-propane-phosphonic CH acid derivatives; naphthyl analogs of mevalonolactone (e.g., 15 see U.S. Pat. No. 4,686.237); octahydronaphthalenes (e.g., which is also known as 3-methyladenine. see U.S. Pat. No. 4,499.289); keto analogs of mevinolin (lov In a particular embodiment, the Compound is a derivative astatin); phosphinic acid compounds (e.g., see GB 2205837): of 3-methyladenine. and quinoline and pyridine derivatives (e.g., see U.S. Pat. In a particular embodiment, the Compound of structure Nos. 5,506,219 and 5,691322). Each of the references above (XLVI) is: is incorporated by reference herein in its entirety. The struc tures of such exemplary HMG-CoA reductase inhibitors are well known in the art. In some embodiments, a Compound is not an HMG-CoA reductase inhibitor Exemplary inhibitors of SCD are provided in Liu et al., J. 25 Med. Chem.50:3086-3100, 2007: International Patent Appli cation Publication No. WO 2005/011655 A2; U.S. Applica tion Publication No. 2005/01 19251; and International Patent Application Publication No. WO 2007/0099236A1, each of which is incorporated by reference herein in its entirety. Such 30 inhibitors include, but are not limited to, pyridazine deriva tives and pyridazine heterozryl-based SCD1 inhibitors. In some embodiments, Compounds that target and inhibit ACC include, but are not limited to, pseudopeptide pyrroli dine dione antibiotics, e.g., moiramide B and synthetic ana which is also known as LY 294.002. 35 logs thereof, and andrimid and synthetic analogs thereof, and In a particular embodiment, the Compound is a derivative pyrrolidinedione derivatives. See Freiberg et al., J. Biol. of LY 2940O2. Chem. 279:26066-26073, 2004; Freiberg et al., Antimicrob. In a particular embodiment, the Compound of structure Agents Chemother. 49:749-759, 2005; and Pohlmann et al., (XLVII) is: Bioorg. Med. Chem. Lett. 15:1189-1192, 2005, which are 40 incorporated herein in their entirety. In other embodiments, a

Compound is not a pseudopeptide pyrrolidine dione antibi otic. In certain embodiments, a Compound is not moiramide B. In some embodiments, a Compound is a pyrrolidinedione 45 derivative. Non-limiting examples of pyrrolidinedione derivatives are disclosed in Pohlmann et al., Bioorg. Med. Chem. Lett. 2005 15:1189-1192. In other embodiments, a Compound is not a pyrrolidinedione derivative. Of note, ACC exists as two isozymes in humans, ACC1 and 50 ACC2. Compounds described herein include, but are not limited to isozyme specific inhibitors of ACC. Compounds that are isozymes selective are provided in, for example, Clarket al., Bioorg. Med. Chem. Lett. 2007 17:1961-1965; which is also known as wortmannin. and Gu et al., J. Med. Chem. 2006 49:3770-3773, each of In a particular embodiment, the Compound is a derivative 55 which is incorporated by reference herein in its entirety. In of wortmannin. Some embodiments, Compounds that are phenoxy thiazolyl In particular embodiments, a Compound is an HMG-CoA series of ACC inhibitors comprising a phenyl ring Substitu reductase inhibitor. Exemplary HMG-CoA reductase inhibi tion are selective inhibitors of ACC2. In specific embodi tors are well known in the art and include, but are not limited ments, a Compound is approximately at least 10 fold, 100 to, mevastatin and related molecules (e.g., see U.S. Pat. No. 60 fold, 1,000 fold, 2,000 fold, 3,000 fold, 4,000 fold, 5,000 fold, 3,983,140); lovastatin (mevinolin) and related molecules or 10,000 fold more selective for ACC2 inhibition than ACC1 (e.g., see U.S. Pat. No. 4.231.938); pravastatin and related inhibition. molecules (e.g., see U.S. Pat. No. 4.346,227); simvastatin and In certain embodiments, Compounds that target and inhibit related molecules (e.g., see U.S. Pat. Nos. 4,448,784 and phosphoinositide 3-kinases (PI(3)Ks) include, but are not 4.450,171); fluvastatin (e.g., see U.S. Pat. No. 5,354,772); 65 limited to, 2-methyadenine, wortmannin, LY294.002, 5-phe cerivastatin (e.g., see U.S. Pat. Nos. 5,006,530 and 5,177, nylthiazole derivatives (e.g., see International Patent Appli 080); atorvastatin (e.g., see U.S. Pat. Nos. 4,681,893, 5,273, cations WO 2003/072557, WO 2004/078754 and WO 2005/ US 9,029,413 B2 97 98 021519), certain 5-heteroaryl substituted thiazole derivatives with the siRNA sequence (Elbashir et al., 2001. EMBO J. (e.g., see, International Patent Application WO 2004/ 20:6877-6888; Tuschl et al., 1999, Genes Dev. 13:3191 096797), certain 2-acylamino-5-thiazol-4-ylthiazole deriva 3197; Hutvagner et al., Sciencexpress 297:2056-2060). One tives (e.g., see, International Patent Application WO 2005/ report suggests that perfect sequence complementarity is 068444), AS-605240 (see, e.g., Camp et al., Nat. Med. 2005, required for siRNA-targeted transcript cleavage, while partial 11 (9):936-43), and thiozolidinedione derivatives (e.g., see complementarity will lead to translational repression without International Patent Application No. WO 2008/014219). transcript degradation, in the manner of microRNAS (Hutvag 3-methyladenine inhibits class III PI(3)K (see, e.g., Petiot et ner et al., Sciencexpress 297:2056-2060). al., J. Biol. Chem. 275:992-998, 2000). In particular embodi miRNAs are regulatory RNAs expressed from the genome, ments, Compounds target and inhibit a class III PI(3)K. In 10 and are processed from precursor Stem-loop (short hairpin) specific embodiments, a Compound is 3-methyladenine. In structures (approximately 80 nucleotide in length) to produce other embodiments, a Compound is not 3-methyladenine. In single-stranded nucleic acids (approximately 22 nucleotide in some embodiments, a Compound is not an inhibitor of PI(3) length) that bind (or hybridizes) to complementary sequences K. in the 3' UTR of the target mRNA (Lee et al., 1993, Cell In certain embodiments, a Compound is a PI(3)P seques 15 75:843-854; Reinhart et al., 2000, Nature 403:901-906; Lee tering agent. Non-limiting examples of PI(3)P sequestering et al., 2001, Science 294:862-864; Lau et al., 2001, Science agents include peptides or chemically modified peptides con 294:858-862; Hutvagner et al., 2001, Science 293:834-838). taining one or more FYVE (SEQID NO: 55) motifs, includ miRNAs bind to transcript sequences with only partial ing peptides that containing the FYVE (SEQ ID NO: 55) complementarity (Zeng et al., 2002, Molec. Cell 9:1327 motif with a cell transduction domain such as the cell-mem 1333) and repress translation without affecting steady-state brane transduction domain of the human immunodeficiency RNA levels (Lee et al., 1993, Cell 75:843-854; Wightman et virus type 1 (HIV-1) Tat protein (amino acid sequence: al., 1993, Cell 75:855-862). Both miRNAs and siRNAs are YGRKKRRQRRR (SEQID NO:56) or a subset or extended processed by Dicer and associate with components of the version thereof). Other cell-membrane transduction domains RNA-induced silencing complex (Hutvagner et al., 2001, are well known in the art and can be combined with the FYVE 25 Science 293:834-838; Grishok et al., 2001, Cell 106: 23-34; (SEQ ID NO: 55) sequence (including multiple repeats or Ketting et al., 2001, Genes Dev. 15:2654-2659; Williams et variants thereof) or with other PI(3)P-sequestering se al., 2002, Proc. Natl. Acad. Sci. USA 99:6889-6894; Ham quence(s) in the design of antiviral therapeutics. In other mond et al., 2001, Science 293:1146-1150; Mourlatos et al., embodiments, the FYVE (SEQ ID NO: 55) motif (with or 2002, Genes Dev. 16:720-728). without a cell membrane transduction domain) can be com 30 Short hairpin RNA (shRNA) is a single-stranded RNA bined with other chemical moieties to increase the plasma molecule comprising at least two complementary portions half-life of the FYVE (SEQID NO: 55) motif (e.g., by pro hybridized or capable of hybridizing to form a double tecting the FYVE motif from hydrolysis by circulating and/or stranded (duplex) structure sufficiently long to mediate RNAi cellular proteases). upon processing into double-stranded RNA with overhangs, In one embodiment, when a Compound is described or 35 e.g., siRNAs and miRNAs. shRNA also contains at least one referred to herein, such description or reference includes noncomplementary portion that forms a loop structure upon pharmaceutically acceptable, salts, prodrugs, salts of pro hybridization of the complementary portions to form the drugs, Solvates, clathrates and stereoisomers thereof. double-stranded structure. shRNAs serve as precursors of RNAi Molecules miRNAs and siRNAs. In certain embodiments, a Compound is an RNA interfer 40 Usually, sequence encoding an shRNA is cloned into a ence (RNAi) molecule that can decrease the expression level vector and the vector is introduced into a cell and transcribed of a target enzyme. RNAi molecules include, but are not by the cell's transcription machinery (Chen et al., 2003, Bio limited to, small-interfering RNA (siRNA), short hairpin chem Biophy's Res Commun 311:398-404). The shRNAs can RNA (shRNA), microRNA (miRNA), and any molecule then be transcribed, for example, by RNA polymerase III (Pol capable of mediating sequence-specific RNAi. 45 III) in response to a Pol III-type promoter in the vector (Yuan RNA interference (RNAi) is a sequence specific post-tran et al., 2006, Mol Biol Rep. 33:33-41 and Scherer et al., 2004, Scriptional gene silencing mechanism triggered by double Mol Ther 10:597–603). The expressed shRNAs are then stranded RNA (dsRNA) that have homologous sequences to exported into the cytoplasm where they are processed by the target mRNA. RNAi is also called post-transcriptional proteins such as Dicer into siRNAs, which then trigger RNAi gene silencing or PTGS. See, e.g., Couzin, 2002, Science 50 (Amarzguioui et al., 2005, FEBS Letter 579:5974-5981). It 298:2296-2297; McManus et al., 2002, Nat. Rev. Genet. 3, has been reported that purines are required at the 5' end of a 737-747; Hannon, G. J., 2002, Nature 418, 244-251; Paddi newly initiated RNA for optimal RNA polymerase III tran son et al., 2002, Cancer Cell 2, 17-23. dsRNA is recognized scription. More detailed discussion can be found in Zecherle and targeted for cleavage by an RNaseIII-type enzyme et al., 1996, Mol. Cell. Biol. 16:5801-5810; Fruscoloni et al., termed Dicer. The Dicer enzyme “dices” the RNA into short 55 1995, Nucleic Acids Res, 23:2914-2918; and Mattai et al., duplexes of about 21 to 23 nucleotides, termed siRNAs or 1988, Cell, 55:435-442. The shRNAs core sequences can be short-interfering RNAs (siRNAs), composed of 19 nucle expressed stably in cells, allowing long-term gene silencing otides of perfectly paired ribonucleotides with about two in cells both in vitro and in Vivo, e.g., in animals (see, McCaf three unpaired nucleotides on the 3' end of each strand. These frey et al., 2002, Nature 418:38-39; Xia et al., 2002, Nat. short duplexes associate with a multiprotein complex termed 60 Biotech. 20:1006-1010; Lewis et al., 2002, Nat. Genetics RISC, and direct this complex to mRNA transcripts with 32: 107-108; Rubinson et al., 2003, Nat. Genetics 33:401 sequence similarity to the siRNA. As a result, nucleases 406; and Tiscornia et al., 2003, Proc. Natl. Acad. Sci. USA present in the RNA-induced silencing complex (RISC) cleave 100:1844-1848). and degrade the target mRNA transcript, thereby abolishing Martinez et al. reported that RNA interference can be used expression of the gene product. 65 to selectively target oncogenic mutations (Martinez et al., Numerous reports in the literature purport the specificity of 2002, Proc. Natl. Acad. Sci. USA99: 14849-14854). In this siRNAS, Suggesting a requirement for near-perfect identity report, an siRNA that targets the region of the R248W mutant US 9,029,413 B2 99 100 of p53 containing the point mutation was shown to silence the PCT publication teaches that siRNAs duplexes can be gener expression of the mutant p53 but not the wild-type p53. ated by an RNase III-like processing reaction from long dsR Wilda et al. reported that an siRNA targeting the M-BCR/ NAS or by chemically synthesized siRNA duplexes with over ABL fusion mRNA can be used to deplete the M-BCR/ABL hanging 3' ends mediating efficient target RNA cleavage in the lysate where the cleavage site is located near the center of mRNA and the M-BCR/ABL oncoprotein in leukemic cells the region spanned by the guiding siRNA. The PCT publica (Wilda et al., 2002. Oncogene 21:5716-5724). tion also provides evidence that the direction of dsRNA pro U.S. Pat. No. 6,506,559 discloses a RNA interference pro cessing determines whether sense or antisense-identical tar cess for inhibiting expression of a target gene in a cell. The get RNA can be cleaved by the produced siRNA complex. process comprises introducing partially or fully doubled Systematic analyses of the effects of length, secondary struc Stranded RNA having a sequence in the duplex region that is 10 ture, Sugar backbone and sequence specificity of siRNAS on identical to a sequence in the target gene into the cell or into RNA interference have been disclosed to aid siRNA design. the extracellular environment. In addition, silencing efficacy has been shown to correlate U.S. Patent Application Publication No. US 2002/0086356 with the GC content of the 5' and 3' regions of the 19 base pair discloses RNA interference in a Drosophila in vitro system target sequence. It was found that siRNAS targeting using RNA segments 21-23 nucleotides (nt) in length. The 15 sequences with a GC rich 5' and GC poor 3' perform the best. patent application publication teaches that when these 21-23 More detailed discussion may be found in Elbashir et al., nt fragments are purified and added back to Drosophila 2001, EMBO J. 20:6877-6888 and AZa-Blanc et al., 2003, extracts, they mediate sequence-specific RNA interference in Mol. Cell. 12:627-637; each of which is hereby incorporated the absence of long dsRNA. The patent application publica by reference herein in its entirety. tion also teaches that chemically synthesized oligonucle In addition, siRNA design algorithms are disclosed in PCT otides of the same or similar nature can also be used to target publications WO 2005/018534 A2 and WO 2005/042708 A2; specific mRNAS for degradation in mammalian cells. each of which is hereby incorporated by reference herein in its International Patent Application Publication No. WO entirety. Specifically, International Patent Application Publi 2002/44321 discloses that double-stranded RNA (dsRNA) cation No. WO 2005/018534 A2 discloses methods and com 19-23 nt in length induces sequence-specific post-transcrip 25 positions for gene silencing using siRNA having partial tional gene silencing in a Drosophila in vitro system. The sequence homology to its target gene. The application pro PCT publication teaches that short interfering RNAs (siR vides methods for identifying common and/or differential NAs) generated by an RNase III-like processing reaction responses to different siRNAS targeting a gene. The applica from long dsRNA or chemically synthesized siRNA duplexes tion also provides methods for evaluating the relative activity with overhanging 3' ends mediate efficient target RNA cleav 30 of the two strands of an siRNA. The application further pro age in the lysate, and the cleavage site is located near the vides methods of using siRNAs as therapeutics for treatment center of the region spanned by the guiding siRNA. of diseases. International Patent Application Publication No. U.S. Patent Application Publication No. US 2002/016216 WO 2005/042708 A2 provides a method for identifying discloses a method for attenuating expression of a target gene siRNA target motifs in a transcript using a position-specific in cultured cells by introducing double stranded RNA 35 score matrix approach. It also provides a method for identi (dsRNA) that comprises a nucleotide sequence that hybrid fying off-target genes of an siRNA using a position-specific izes understringent conditions to a nucleotide sequence of the score matrix approach. The application further provides a target gene into the cells in an amount Sufficient to attenuate method for designing siRNAs with improved silencing effi expression of the target gene. cacy and specificity as well as a library of exemplary siRNAs. International Patent Application Publication No. WO 40 Design softwares can be use to identify potential sequences 2003/006477 discloses engineered RNA precursors that within the target enzyme mRNA that can be targeted with when expressed in a cell are processed by the cell to produce siRNAs in the methods described herein. See, for example, targeted small interfering RNAs (siRNAs) that selectively http://www.ambion.com/techlib/misc/siRNA finder.html silence targeted genes (by cleaving specific mRNAS) using (Ambion siRNA Target Finder Software'). For example, the the cell’s own RNA interference (RNAi) pathway. The PCT 45 nucleotide sequence of ACC1, which is known in the art publication teaches that by introducing nucleic acid mol (GenBank Accession No. NM 198834) is entered into the ecules that encode these engineered RNA precursors into Ambion siRNA Target Finder Software (http://www.ambion. cells in vivo with appropriate regulatory sequences, expres com/techlib/misc/siRNA finder.html), and the software sion of the engineered RNA precursors can be selectively identifies potential ACC1 target sequences and corresponding controlled both temporally and spatially, i.e., at particular 50 siRNA sequences that can be used in assays to inhibit human times and/or in particular tissues, organs, or cells. ACC1 activity by downregulation of ACC1 expression. Using International Patent Application Publication No. WO this method, non-limiting examples of ACC1 target sequence 02/44321 discloses that double-stranded RNAs (dsRNAs) of (5' to 3') and corresponding sense and antisense strand siRNA 19-23 nt in length induce sequence-specific post-transcrip sequences (5' to 3') for inhibiting ACC1 are identified and tional gene silencing in a Drosophila in vitro system. The presented below:

ACC1 Target Sense AntiSense Sequence Strand siRNA Strand siRNA

AATCACTTTGCCCGTGTGGCG UCACUUUGCCCGUGUGGCGUU CGCCACACGGGCAAAGUGAUU (SEQ ID NO: 1) (SEQ ID NO: 2) (SEQ ID NO : 3)

AACGTTCCCATCTCCACCCCT CGUUCCCAUCUCCACCCCUUU AGGGGUGGAGAUGGGAACGUU (SEQ ID NO : 4) (SEO ID NO. 5) (SEQ ID NO : 6)

AAGGGAAATTGAGGCTGAGGG GGGAAAUUGAGGCUGAGGGUU CCCUCAGCCUCAAUUUCCCUU (SEO ID NO : 7) (SEQ ID NO: 8) (SEO ID NO: 9) US 9,029,413 B2 101 102 - Continued

ACC1 Target Sense AntiSense Sequence Strand siRNA Strand siRNA

4. AAATTGAGGCTGAGGGAACTG AUUGAGGCUGAGGGAACUGUU CAGUUCCCUCAGCCUCAAUUU (SEQ ID NO: 10) (SEQ ID NO: 11) (SEQ D NO : 12)

5. AACTGGGCCCAGGGACGGCGA CUGGGCCCAGGGACGGCGAUU UCGCCGUCCCUGGGCCCAGUU (SEQ ID NO: 13) (SEQ ID NO: 14) (SEQ D NO : 15)

6. AAGGGCTGCTCGTGGATGAAC GGGCUGCUCGUGGAUGAACUU GUUCAUCCACGAGCAGCCCUU (SEQ ID NO: 16) (SEO ID NO: 17) (SEQ D NO : 18)

7. AATCAGATGCTTCTGGAACGT UCAGAUGCUUCUGGAACGUUUACGUUCCAGAAGCAUCUGAUU (SEQ ID NO: 19) (SEQ ID NO: 2O) (SEQ D NO : 21)

8. AATAATGGATGAACCATCTCC UAAUGGAUGAACCAUCUCCUU GGAGAUGGUUCAUCCAUUAUU (SEQ ID NO: 22) (SEQ ID NO: 23) (SEQ D NO : 24)

9. AATGGATGAACCATCTCCCTT UGGAUGAACCAUCUCCCUUUU AAGGGAGAUGGUUCAUCCAUU (SEQ ID NO: 25) (SEQ ID NO: 26) (SEQ D NO : 27)

The same method can be applied to identify ACC2 target and complement sequences, respectively, of the target sequences (5' to 3') and the corresponding siRNA sequences enzyme mRNA that is about 17, 18, 19, or 20 nucleotides in (sense and antisense Strands, 5' to 3"). Non-limiting examples length. of siRNA sequences for inhibiting ACC2 are presented 25 The RNAi molecule (e.g., siRNA, shRNA, miRNA) can be below: both partially or completely double-stranded, and can encom

ACC2 Target Sense AntiSense Sequence Strand siRNA Strand siRNA

1. AATGGTCTTGCTTCTTTGTCT UGGUCUUGCUUCUUUGUCUUU AGACAAAGAAGCAAGACCAUU (SEO ID NO: 28) (SEO ID NO: 29) (SEQ D NO :

2. AAGCCGATCACCAAGAGTAAA GCCGAUCACCAAGAGUAAAUUUUUACUCUUGGUGAUCGGCUU (SEQ ID NO: 31) (SEQ ID NO: 32) (SEQ D NO : 33)

3. AAGAAACCCCCTTTCTTCCAG GAAACCCCCUUUCUUCCAGUU CUGGAAGAAAGGGGGUUUCUU (SEQ ID NO: 34) (SEO ID NO: 35) (SEQ D NO : 36)

4 AAAGAAGACAAGAAGCAGGCAAGAAGACAAGAAGCAGGCAUU UGCCUGCUUCUUGUCUUCUUU (SEO ID NO : 37) (SEQ ID NO: 38) (SEQ D NO : 39)

5. AAGGTGCTTATTGCCAACAAC GGUGCUUAUUGCCAACAACUU GUUGUUGGCAAUAAGCACCUU (SEQ ID NO: 40) (SEQ ID NO: 41) (SEQ D NO : 42)

6. AATCAGTGTCCCAGAAGATGT UCAGUGUCCCAGAAGAUGUUUACAUCUUCUGGGACACUGAUU (SEQ ID NO : 43) (SEQ ID NO: 44) (SEQ D NO : 45)

7. AATTTCCGGAGCAGCAAGAACUUUCCGGAGCAGCAAGAACUU GUUCUUGCUGCUCCGGAAAUU (SEQ ID NO: 46) (SEO ID NO: 47) (SEQ D NO : 48)

8. AATTTGGGCACTGCTTCTCCTUUUGGGCACUGCUUCUCCUUU AGGAGAAGCAGUGCCCAAAUU (SEQ ID NO: 49) (SEO ID NO: 5O) (SEQ D NO : 51)

9. AATAC CTCATTAACCTCCTGG UACCUCAUUAACCUCCUGGUU CCAGGAGGUUAAUGAGGUAUU (SEQ ID NO: 52) (SEO ID NO: 53) (SEQ D NO : 54)

The same method can be applied to identify target pass fragments of at least 18, at least 19, at least 20, at least 21, sequences of any enzyme and the corresponding siRNA 55 at least 22, at least 23, at least 24, at least 25, at least 30, at least sequences (sense and antisense Strands) to obtain RNAi mol 35, at least 40, at least 45, and at least 50 or more nucleotides ecules. per strand. The RNAi molecule (e.g., siRNA, shRNA, miRNA) can also comprise 3' overhangs of at least 1, at least In certain embodiments, a Compound is an siRNA effec 2, at least 3, or at least 4 nucleotides. The RNAi molecule tive to inhibit expression of a target enzyme, e.g., ACC or 60 (e.g., siRNA, shRNA, miRNA) can be of any length desired FAS, wherein the siRNA comprises a first strand comprising by the user as long as the ability to inhibit target gene expres a sense sequence of the target enzyme mRNA and a second sion is preserved. Strand comprising a complement of the sense sequence of the RNAi molecules that target ACC2 have been described, target enzyme, and wherein the first and second strands are 65 e.g., in U.S. Pat. No. 7,211,423 and U.S. Patent Application about 21 to 23 nucleotides in length. In some embodiments, Publication No. US 2008/0026363 A1, each of which is incor the siRNA comprises first and second strands comprise sense porated by reference herein in its entirety. US 9,029,413 B2 103 104 In some embodiments, methods for treatment or preven ceptable specificity or toxicity, can be screened against the tion of a virus infection in a human Subject, comprising enzyme targets of the invention. Antiviral compounds that administering an effective amount of an RNAi molecule (e.g., modulate the enzyme targets can be optimized for better siRNA, shRNA, miRNA) that inhibits the activity of a target activity profiles. enzyme (e.g., ACC, FAS, SCD) by decreasing the expression Any host cell enzyme, known in the art and/or described in level of the target enzyme. Exemplary target enzymes that can Section 5.1, is contemplated as a potential target for antiviral be inhibited by RNAi molecules are provided in section 5.1. intervention. Further, additional host cell enzymes that have a RNAi molecules can be obtained using any of a number of role, directly or indirectly, in regulating the cell's metabolism techniques known to those of ordinary skill in the art. Gener are contemplated as potential targets for antiviral interven ally, production of RNAi molecules can be carried out by 10 tion. Compounds, such as the compounds disclosed in Sec chemical synthetic methods or by recombinant nucleic acid tion 5.2 or any other compounds, e.g., a publicly available techniques. Methods of preparing a dsRNA are described, for library of compounds, can be tested for their ability to modu example, in Ausubel et al., Current Protocols in Molecular late (activate or inhibit) the activity of these host cell Biology (Supplement 56), John Wiley & Sons, New York enzymes. If a compound is found to modulate the activity of (2001); Sambrook et al., Molecular Cloning: A Laboratory 15 a particular enzyme, then a potential antiviral compound has Manual, 3.sup.rd ed., Cold Spring Harbor Press, Cold Spring been identified. Harbor (2001); and can be employed in the methods In one embodiment, an enzyme that affects or is involved in described herein. For example, RNA can be transcribed from fatty acid biosynthesis and/or metabolism is tested as a target PCR products, followed by gel purification. Standard proce for the compound, for example, ATP citrate lyase and its dures known in the art for in vitro transcription of RNA from isoforms, HMG-CoA synthase, acetyl-CoA carboxylase and PCR templates. For example, dsRNA can be synthesized its isozymes, fatty acid synthase and its subunits, lysophos using a PCR template and the Ambion T7 MEGASCRIPT, or phatidic acid acetyltransferase or lysophosphatidic acid acyl other similar, kit (Austin,Tex.); the RNA can be subsequently transferase and its isoforms, or malonyl-CoA decarboxylase. precipitated with LiCl and resuspended in a buffer solution. In one embodiment, enzymes of the glycolysis pathway are To assay for RNAi activity in cells, any of a number of 25 tested for modulation by the compound. In one embodiment, techniques known to those of ordinary skill in the art can be components of the tricarboxylic acid (TCA) cycle are tested. employed. For example, the RNAi molecules are introduced In one embodiment, cellular components that are involved in into cells, and the expression level of the target enzyme can be ion homeostasis and energy transport across barriers, such as assayed using assays known in the art, e.g., ELISA and immu the proton ATPase, are screened for modulation (inhibition or noblotting. Also, the mRNA transcript level of the target 30 activation) by the compounds of the invention. In some enzyme can be assayed using methods known in the art, e.g., embodiments, the activity of host enzymes involved in glu Northern blot assays and quantitative real-time PCR. Further cose transport are tested as a target of the compound. the activity of the target enzyme can be assayed using meth In preferred embodiments, a Compound is tested for its ods known in the art and/or described herein in section 5.3. In ability to modulate host metabolic enzymes by contacting a a specific embodiment, the RNAi molecule reduces the pro 35 composition comprising the compound with a composition tein expression level of the target enzyme by at least about comprising the enzyme and measuring the enzyme’s activity. 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. If the enzyme’s activity is altered in the presence of the In one embodiment, the RNAi molecule reduces the mRNA compound compared to a control, then the Compound modu transcript level of the target enzyme by at least about 10%, lates the enzyme’s activity. In some embodiments of the 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In a 40 invention, the Compound increases an enzyme’s activity (for particular embodiment, the RNAi molecule reduces the enzy example, an enzyme that is a negative regulator of fatty acid matic activity of the target enzyme by at least about 10%, biosynthesis might have its activity increased by a potential 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. antiviral compound). In specific embodiments, the Com pound increases an enzyme’s activity by at least approxi 5.3 Screening Assays to Identify Inhibitors of Host 45 mately 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, Cell Target Enzymes 80% or 90%. In some embodiments, the compound decreases an enzyme’s activity. In particular embodiments, the Com Compounds known to be inhibitors of the host cell target pound decreases an enzyme’s activity by at least approxi enzymes can be directly screened for antiviral activity using mately 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, assays known in the art and/or described infra (see, e.g., 50 80%, 90%, 95% or 100%. In certain embodiments, the com Section 5.4 et seq.). While optional, derivatives or congeners pound exclusively modulates a single enzyme. In some of Such enzyme inhibitors, or any other compound can be embodiments, the compound modulates multiple enzymes, tested for their ability to modulate the enzyme targets using although it might modulate one enzyme to a greater extent assays known to those of ordinary skill in the art and/or than another. Using the standard enzyme activity assays described below. Compounds found to modulate these targets 55 described herein, the activity of the compounds could be can be further tested for antiviral activity. Compounds found characterized. In one embodiment, a compound exhibits an to modulate these targets or to have antiviral activity (or both) irreversible inhibition or activation of a particular enzyme. In can also be tested in the metabolic flux assays described in Some embodiments, a compound reversibly inhibits or acti Example 1 in order to confirm the compound's effect on the Vates an enzyme. In some embodiments, a compound alters metabolic flux of the cell. This is particularly useful for deter 60 the kinetics of the enzyme. mining the effect of the Compound in blocking the ability of In one embodiment, for example, evaluating the interaction the virus to alter cellular metabolic flux, and to identify other between the test compound and host target enzyme includes possible metabolic pathways that may be targeted by the one or more of (i) evaluating binding of the test compound to compound. the enzyme; (ii) evaluating a biological activity of the Alternatively, Compounds can be tested directly for anti 65 enzyme; (iii) evaluating an enzymatic activity (e.g., kinase viral activity. Those Compounds which demonstrate anti activity) of the enzyme in the presence and absence of test viral activity, or that are known to be antiviral but have unac compound. The in vitro contacting can include forming a US 9,029,413 B2 105 106 reaction mixture that includes the test compound, enzyme, Target enzyme activity assays are preferably in vitro assays any required cofactor (e.g., biotin) or energy source (e.g., using the enzymes in solution or using cell or cell lysates that ATP or radiolabeled ATP), a substrate (e.g., acetyl-CoA, a express Such enzymes, but the invention is not to be so lim Sugar, a polypeptide, a nucleoside, or any other metabolite, ited. In certain embodiments, the enzyme is in Solution. In with or without label) and evaluating conversion of the sub other embodiments, the enzyme is associated with strate into a product. Evaluating product formation can microsomes or in detergent. In other embodiments, the include, for example, detecting the transfer of carbons or enzyme is immobilized to a solid or gel Support. In certain phosphate (e.g., chemically or using a label, e.g., a radiola embodiments, the enzyme is labeled to facilitate purification bel), detecting the reaction product, detecting a secondary and/or detection. In other embodiments, a substrate is labeled reaction dependent on the first reaction, or detecting a physi 10 cal property of the Substrate, e.g., a change in molecular to facilitate purification and or detection. Labels include weight, charge, or pl. polypeptide tags, biotin, radiolabels, fluorescent labels, or a Target enzymes for use in screening assays can be purified colorimetric label. Any art-accepted assay to test the activity from a natural Source, e.g., cells, tissues or organs comprising of metabolic enzymes can be used in the practice of this adipocytes (e.g., adipose tissue), liver, etc. Alternatively, tar 15 invention. Preferably, many compounds are screened against get enzymes can be expressed in any of a number of different multiple targets with high throughput Screening assays. recombinant DNA expression systems and can be obtained in Substrate and product levels can be evaluated in an in vitro large amounts and tested for biological activity. For expres system, e.g., in a biochemical extract, e.g., of proteins. For sion in recombinant bacterial cells, for example E. coli, cells example, the extract may include all soluble proteins or a are grown in any of a number of suitable media, for example subset of proteins (e.g., a 70% or 50% ammonium sulfate LB, and the expression of the recombinant polypeptide cut), the useful subset of proteins defined as the subset that induced by adding IPTG to the media or switching incubation includes the target enzyme. The effect of a test compound can to a higher temperature. After culturing the bacteria for a be evaluated, for example, by measuring Substrate and prod further period of between 2 and 24 hours, the cells are col uct levels at the beginning of a time course, and then compar lected by centrifugation and washed to remove residual 25 ing Such levels after a predetermined time (e.g., 0.5, 1, or 2 media. The bacterial cells are then lysed, for example, by hours) in a reaction that includes the test compound and in a disruption in a cell homogenizer and centrifuged to separate parallel control reaction that does not include the test com the dense inclusion bodies and cell membranes from the pound. This is one method for determining the effect of a test soluble cell components. This centrifugation can be per compound on the Substrate-to-product ratio in vitro. Reaction formed under conditions whereby the dense inclusion bodies 30 rates can obtained by linear regression analysis of radioactiv are selectively enriched by incorporation of Sugars such as ity or other label incorporated vs. reaction time for each sucrose into the buffer and centrifugation at a selective speed. incubation. K and V values can be determined by non If the recombinant polypeptide is expressed in the inclusion, linear regression analysis of initial Velocities, according to the these can be washed in any of several Solutions to remove standard Henri-Michaelis-Menten equation. k can be Some of the contaminating host proteins, then solubilized in 35 obtained by dividing V, values by reaction concentrations Solutions containing high concentrations of urea (e.g., 8 M) or of enzyme, e.g., derived by colorimetric protein determina chaotropic agents such as guanidine hydrochloride in the tions (e.g., Bio-RAD protein assay, Bradford assay, Lowry presence of reducing agents such as beta-mercaptoethanol or method). In one embodiment, the Compound irreversibly DTT (dithiothreitol). At this stage it may be advantageous to inactivates the target enzyme. In another embodiment, the incubate the polypeptide for several hours under conditions 40 Compound reversibly inhibits the target enzyme. In some Suitable for the polypeptide to undergo a refolding process embodiments, the Compound reversibly inhibits the target into a conformation which more closely resembles that of the enzyme by competitive inhibition. In some embodiments, the native polypeptide. Such conditions generally include low Compound reversibly inhibits the target enzyme by noncom polypeptide (concentrations less than 500 mg/ml), low levels petitive inhibition. In some embodiments, the Compound of reducing agent, concentrations of urea less than 2 M and 45 reversibly inhibits the target enzyme by uncompetitive inhi often the presence of reagents such as a mixture of reduced bition. In a further embodiment, the Compound inhibits the and oxidized glutathione which facilitate the interchange of target enzyme by mixed inhibition. The mechanism of inhi disulphide bonds within the protein molecule. The refolding bition by the Compound can be determined by standard process can be monitored, for example, by SDS-PAGE or assays known by those of ordinary skill in the art. with antibodies which are specific for the native molecule. 50 Methods for the quantitative measurement of enzyme Following refolding, the polypeptide can then be purified activity utilizing a phase partition system are described in further and separated from the refolding mixture by chroma U.S. Pat. No. 6,994.956, which is incorporated by reference tography on any of several Supports including ion exchange herein in its entirety. Specifically, a radiolabeled substrate and resins, gel permeation resins or on a variety of affinity col the product of the reaction are differentially partitioned into S. 55 an aqueous phase and an immiscible Scintillation fluid-con Isolation and purification of host cell expressed polypep taining organic phase, and enzyme activity is assessed either tide, or fragments thereof may be carried out by conventional by incorporation of a radiolabeled-containing organic means including, but not limited to, preparative chromatog soluble moiety into product molecules (gain of signal assay) raphy and immunological separations involving monoclonal or loss of a radiolabel-containing organic-soluble moiety or polyclonal antibodies. 60 from Substrate molecules (loss of signal assay). Scintillations These polypeptides may be produced in a variety of ways, are only detected when the radionuclide is in the organic, including via recombinant DNA techniques, to enable large Scintillant-containing phase. Such methods can be employed scale production of pure, biologically active target enzyme to test the ability of a Compound to inhibit the activity of a useful for screening compounds for the purposes of the inven target enzyme. tion. Alternatively, the target enzyme to be screened could be 65 Cellular assays may be employed. An exemplary cellular partially purified or tested in a cellular lysate or other solution assay includes contacting a test compound to a culture cell or mixture. (e.g., a mammalian culture cell, e.g., a human culture cell) US 9,029,413 B2 107 108 and then evaluating Substrate and product levels in the cell, In another example, the enzyme pathway component (e.g., e.g., using any method described herein, Such as Reverse GLUT4 in the case of AMPK) can reside in a membrane, e.g., Phase HPLC. a liposome or other vesicle. Substrate and product levels can be evaluated, e.g., by Cell-free assays involve preparing a reaction mixture of the NMR, HPLC (See, e.g., Bak, M.I., and Ingwall, J. S. (1994) target enzyme and the test compound under conditions and J. Clin. Invest. 93, 40-49), mass spectrometry, thin layer chro for a time sufficient to allow the two components to interact matography, or the use of radiolabeled components (e.g., and bind, thus forming a complex that can be removed and/or radiolabeled ATP for a kinase assay). For example, 'PNMR detected. can be used to evaluate ATP and AMP levels. In one imple The interaction between two molecules, e.g., target 10 enzyme and test compound, can also be detected, e.g., using mentation, cells and/or tissue can be placed in a 10-mm NMR a fluorescence assay in which at least one molecule is fluo sample tube and inserted into a 1H/31P double-tuned probe rescently labeled, e.g., to evaluate an interaction between a situated in a 9.4-Tesla Superconducting magnet with a bore of test compound and a target enzyme. One example of Such an 89 cm. If desired, cells can be contacted with a substance that assay includes fluorescence energy transfer (FET or FRET provides a distinctive peakin order to index the scans. Six P 15 for fluorescence resonance energy transfer) (See, for NMR spectra—each obtained by signal averaging of 104 free example, Lakowicz et al., U.S. Pat. No. 5,631, 169; Stavrian induction decays—can be collected using a 60 flip angle, opoulos, et al., U.S. Pat. No. 4,868,103). A fluorophore label 15-microsecond pulse, 2.14-second delay, 6,000 Hz, sweep on the first, “donor molecule is selected such that its emitted width, and 2048 data points using a GE-400 Omega NMR fluorescent energy will be absorbed by a fluorescent label on spectrometer (Bruker Instruments, Freemont, Calif., USA). a second, “acceptor molecule, which in turn is able to fluo Spectra are analyzed using 20-HZ exponential multiplication resce due to the absorbed energy. Alternately, a proteinaceous and Zero- and first-order phase corrections. The resonance “donor” molecule may simply utilize the natural fluorescent peak areas can be fitted by Lorentzian line shapes using energy of tryptophan residues. Labels are chosen that emit NMR1 software (New Methods Research Inc., Syracuse, different wavelengths of light, such that the “acceptor mol N.Y., USA). By comparing the peak areas of fully relaxed 25 ecule label may be differentiated from that of the “donor.” spectra (recycle time: 15 seconds) and partially saturated Since the efficiency of energy transfer between the labels is spectra (recycle time: 2.14 seconds), the correction factor for related to the distance separating the molecules, the spatial saturation can be calculated for the peaks. Peak areas can be relationship between the molecules can be assessed. In a normalized to cell and/or tissue weight or number and situation in which binding occurs between the molecules, the expressed in arbitrary area units. Another method for evalu 30 fluorescent emission of the “acceptor molecule label in the ating, e.g., ATP and AMP levels includes lysing cells in a assay should be maximal. A FET binding event can be con sample to form an extract, and separating the extract by veniently measured through standard fluorometric detection Reversed Phase HPLC, while monitoring absorbance at 260 means well known in the art (e.g., using a fluorimeter). . Another example of a fluorescence assay is fluorescence Another type of in vitro assay evaluates the ability of a test 35 polarization (FP). For FP, only one component needs to be compound to modulate interaction between a first enzyme labeled. A binding interaction is detected by a change in pathway component and a second enzyme pathway compo molecular size of the labeled component. The size change nent, e.g., between AMPK alpha and beta-gamma or the alters the tumbling rate of the component in Solution and is different enzyme activities offatty acid synthase. This type of detected as a change in FP. See, e.g., Nasir et al. (1999) Comb assay can be accomplished, for example, by coupling one of 40 Chem HTS 2:177-190; Jameson et al. (1995) Methods Enzy the components with a radioisotope or enzymatic label Such mol 246:283: See Anal Biochem. 255:257 (1998). Fluores that binding of the labeled component to the second pathway cence polarization can be monitored in multi-well plates. See, component can be determined by detecting the labeled com e.g., Parker et al. (2000) Journal of Biomolecular Screening pound in a complex. An enzyme pathway component can be 5:77-88; and Shoeman, et al. (1999) 38, 16802-16809. labeled with 'I, S, C, or H, either directly or indirectly, 45 In another embodiment, determining the ability of the tar and the radioisotope detected by direct counting of radio get enzyme to bind to a target molecule can be accomplished emission or by Scintillation counting. Alternatively, a compo using real-time Biomolecular Interaction Analysis (BIA) nent can be enzymatically labeled with, for example, horse (See, e.g., Solander, S, and Urbaniczky, C. (1991) Anal. radish peroxidase, alkaline phosphatase, or luciferase, and Chem. 63:2338-2345 and Szabo et al. (1995) Curr. Opin. the enzymatic label detected by determination of conversion 50 Struct. Biol. 5:699-705). "Surface plasmon resonance” or of an appropriate Substrate to product. Competition assays “BIA' detects biospecific interactions in real time, without can also be used to evaluate a physical interaction between a labeling any of the interactants (e.g., BIAcore). Changes in test compound and a target. the mass at the binding Surface (indicative of a binding event) Soluble and/or membrane-bound forms of isolated pro result in alterations of the refractive index of light near the teins (e.g., enzyme pathway components and their receptors 55 Surface (the optical phenomenon of Surface plasmon reso or biologically active portions thereof) can be used in the nance (SPR)), resulting in a detectable signal which can be cell-free assays of the invention. When membrane-bound used as an indication of real-time reactions between biologi forms of the enzyme are used, it may be desirable to utilize a cal molecules. solubilizing agent. Examples of Such solubilizing agents In one embodiment, the target enzyme is anchored onto a include non-ionic detergents such as n-octylglucoside, 60 Solid phase. The target enzyme?test compound complexes n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-meth anchored on the solid phase can be detected at the end of the ylglucamide, decanoyl-N-methylglucamide, Triton X-100, reaction, e.g., the binding reaction. For example, the target Triton X-114. Thesit, Isotridecypoly(ethylene glycol ether)n, enzyme can be anchored onto a solid Surface, and the test 3-(3-cholamidopropyl)dimethylamminio-1-propane Sul compound (which is not anchored), can be labeled, either fonate (CHAPS), 3-(3-cholamidopropyl)dimethylam 65 directly or indirectly, with detectable labels discussed herein. minio-2-hydroxy-1-propane sulfonate (CHAPSO), or It may be desirable to immobilize either the target enzyme N-dodecyl-N,N-dimethyl-3-ammonio-1-propane sulfonate. or an anti-target enzyme antibody to facilitate separation of US 9,029,413 B2 109 110 complexed from uncomplexed forms of one or both of the immunoprecipitation (See, for example, Ausubel, F. et al., proteins, as well as to accommodate automation of the assay. eds. (1999) Current Protocols in Molecular Biology, J. Wiley: Binding of a test compound to target enzyme, or interaction of New York). Such resins and chromatographic techniques are a target enzyme with a second component in the presence and known to one skilled in the art (See, e.g., Heegaard, N. H., absence of a candidate compound, can be accomplished in 5 (1998) J Mol Recognit 11:141-8; Hage, D.S., and Tweed, S. any vessel Suitable for containing the reactants. Examples of A. (1997) J Chromatogr B Biomed Sci Appl. 699:499-525). Such vessels include microtiter plates, test tubes, and micro Further, fluorescence energy transfer may also be conve centrifuge tubes. In one embodiment, a fusion protein can be niently utilized, as described herein, to detect binding without provided which adds a domain that allows one or both of the further purification of the complex from solution. proteins to be bound to a matrix. For example, glutathione 10 S-transferase/target enzyme fusion proteins can be adsorbed In a preferred embodiment, the assay includes contacting onto glutathione Sepharose beads (Sigma Chemical, St. the target enzyme or biologically active portion thereof with Louis, Mo., USA) or glutathione derivatized microtiter a known compound which binds the target enzyme to forman plates, which are then combined with the test compound or assay mixture, contacting the assay mixture with a test com the test compound and either the non-adsorbed target 15 pound, and determining the ability of the test compound to enzyme, and the mixture incubated under conditions condu interact with the target enzyme, wherein determining the cive to complex formation (e.g., at physiological conditions ability of the test compound to interact with the target enzyme for salt and pH). Following incubation, the beads or microtiter includes determining the ability of the test compound to pref plate wells are washed to remove any unbound components, erentially bind to the target enzyme, or to modulate the activ the matrix immobilized in the case of beads, and the complex ity of the target enzyme, as compared to the known compound determined either directly or indirectly, for example, as (e.g., a competition assay). In another embodiment, the abil described above. Alternatively, the complexes can be disso ity of a test compound to bind to and modulate the activity of ciated from the matrix, and the level of target enzyme binding the target enzyme is compared to that of a known activator or or activity is determined using standard techniques. inhibitor of Such target enzyme. Other techniques for immobilizing either a target enzyme 25 The target enzymes of the invention can, in Vivo, interact or a test compound on matrices include using conjugation of with one or more cellular or extracellular macromolecules, biotin and streptavidin. Biotinylated target enzyme or test Such as proteins, which are either heterologous to the host cell compounds can be prepared from biotin-NHS(N-hydroxy or endogenous to the host cell, and which may or may not be Succinimide) using techniques known in the art (e.g., bioti recombinantly expressed. For the purposes of this discussion, nylation kit, Pierce Chemicals, Rockford, Ill.), and immobi 30 such cellular and extracellular macromolecules are referred lized in the wells of streptavidin-coated 96 well plates (Pierce to herein as “binding partners. Compounds that disrupt Such Chemical). interactions can be useful in regulating the activity of the In order to conduct the assay, the non-immobilized com target enzyme. Such compounds can include, but are not ponent is added to the coated Surface containing the anchored limited to molecules Such as antibodies, peptides, and Small component. After the reaction is complete, unreacted compo 35 molecules. In an alternative embodiment, the invention pro nents are removed (e.g., by washing) under conditions such vides methods for determining the ability of the test com that any complexes formed will remain immobilized on the pound to modulate the activity of a target enzyme through solid surface. The detection of complexes anchored on the modulation of the activity of a downstream effector of such Solid Surface can be accomplished in a number of ways. target enzyme. For example, the activity of the effector mol Where the previously non-immobilized component is pre 40 ecule on an appropriate target can be determined, or the labeled, the detection of label immobilized on the surface binding of the effector to an appropriate target can be deter indicates that complexes were formed. Where the previously mined, as previously described. non-immobilized component is not pre-labeled, an indirect To identify compounds that interfere with the interaction label can be used to detect complexes anchored on the Sur between the target enzyme and its cellular or extracellular face, e.g., using a labeled antibody specific for the immobi 45 binding partner(s), a reaction mixture containing the target lized component (the antibody, in turn, can be directly labeled enzyme and the binding partner is prepared, under conditions or indirectly labeled with, e.g., a labeled anti-Ig antibody). and for a time sufficient, to allow the two products to form a In one embodiment, this assay is performed utilizing anti complex. In order to testan inhibitory compound, the reaction bodies reactive with a target enzyme but which do not inter mixture is provided in the presence and absence of the test fere with binding of the target enzyme to the test compound 50 compound. The test compound can be initially included in the and/or substrate. Such antibodies can be derivatized to the reaction mixture, or can be added at a time Subsequent to the wells of the plate, and unbound target enzyme trapped in the addition of the target and its cellular or extracellular binding wells by antibody conjugation. Methods for detecting Such partner. Control reaction mixtures are incubated without the complexes, in addition to those described above for the GST test compound or with a placebo. The formation of any com immobilized complexes, include immunodetection of com 55 plexes between the target product and the cellular or extra plexes using antibodies reactive with the target enzyme, as cellular binding partner is then detected. The formation of a well as enzyme-linked assays which rely on detecting an complex in the control reaction, but not in the reaction mix enzymatic activity associated with the target enzyme. ture containing the test compound, indicates that the com Alternatively, cell free assays can be conducted in a liquid pound interferes with the interaction of the target product and phase. In Such an assay, the reaction products are separated 60 the interactive binding partner. Additionally, complex forma from unreacted components, by any of a number of standard tion within reaction mixtures containing the test compound techniques, including but not limited to: differential centrifu and normal target enzyme can also be compared to complex gation (See, for example, Rivas, G., and Minton, A. P., (1993) formation within reaction mixtures containing the test com Trends Biochem Sci 18:284-7); chromatography (gel filtra pound and mutant target enzyme. This comparison can be tion chromatography, ion-exchange chromatography); elec 65 important in those cases wherein it is desirable to identify trophoresis (See, e.g., Ausubel, F. et al., eds. Current Proto compounds that disrupt interactions of mutant but not normal cols in Molecular Biology 1999, J. Wiley: New York); and target enzymes. US 9,029,413 B2 111 112 The assays described herein can be conducted in a hetero eration of a signal above background. In this way, test com geneous or homogeneous format. Heterogeneous assays pounds that disrupt target enzyme-binding partner or Sub involve anchoring either the target enzyme or the binding strate contact can be identified. partner, Substrate, or tests compound onto a solid phase, and In yet another aspect, the target enzyme can be used as "bait detecting complexes anchored on the Solid phase at the end of protein’ in a two-hybrid assay or three-hybrid assay (See, the reaction. In homogeneous assays, the entire reaction is e.g., U.S. Pat. No. 5.283,317; Zervos et al. (1993) Cell carried out in a liquid phase. In either approach, the order of 72:223-232; Madura et al. (1993).J. Biol. Chem. 268: 12046 addition of reactants can be varied to obtain different infor 12054: Bartel et al. (1993) Biotechniques 14:920-924; mation about the compounds being tested. For example, test Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent, compounds that interfere with the interaction between the 10 International patent application Publication No. WO94/ target enzyme and a binding partners or substrate, e.g., by 10300), to identify other proteins that bind to or interact with competition, can be identified by conducting the reaction in target enzyme (“target enzyme binding protein' or “target the presence of the test Substance. Alternatively, test com enzyme-bp') and are involved in target enzyme pathway pounds that disrupt preformed complexes, e.g., compounds 15 activity. Such target enzyme-bps can be activators or inhibi with higher binding constants that displace one of the com tors of the target enzyme or target enzyme targets as, for ponents from the complex, can be tested by adding the test example, downstream elements of the target enzyme path compound to the reaction mixture after complexes have been way. formed. The various formats are briefly described below. In another embodiment, modulators of a target enzyme’s In a heterogeneous assay system, either the target enzyme gene expression are identified. For example, a cell or cell free or the interactive cellular or extracellular binding partner or mixture is contacted with a candidate compound and the Substrate, is anchored onto a solid Surface (e.g., a microtiter expression of the target enzyme mRNA or protein evaluated plate), while the non-anchored species is labeled, either relative to the level of expression of target enzyme mRNA or directly or indirectly. The anchored species can be immobi protein in the absence of the candidate compound. When lized by non-covalent or covalent attachments. Alternatively, 25 expression of the target enzyme component mRNA or protein an immobilized antibody specific for the species to be is greater in the presence of the candidate compound than in anchored can be used to anchor the species to the Solid Sur its absence, the candidate compound is identified as a stimu face. lator of target enzyme mRNA or protein expression. Alterna tively, when expression of the target enzyme mRNA or pro In order to conduct the assay, the partner of the immobi 30 tein is less (statistically significantly less) in the presence of lized species is exposed to the coated surface with or without the candidate compound than in its absence, the candidate the test compound. After the reaction is complete, unreacted compound is identified as an inhibitor of the target enzyme components are removed (e.g., by washing) and any com mRNA or protein expression. The level of the target enzyme plexes formed will remain immobilized on the solid surface. mRNA or protein expression can be determined by methods Where the non-immobilized species is pre-labeled, the detec 35 for detecting target enzyme mRNA or protein, e.g., Westerns, tion of label immobilized on the surface indicates that com Northerns, PCR, mass spectroscopy, 2-D gel electrophoresis, plexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect com and so forth, all which are known to those of ordinary skill in plexes anchored on the Surface; e.g., using a labeled antibody the art. 40 Assays for producing enzyme targets, testing their activity, specific for the initially non-immobilized species (the anti and conducting screens for their inhibition or activation are body, in turn, can be directly labeled or indirectly labeled described below using examples of enzymes related to fatty with, e.g., a labeled anti-Ig antibody). Depending upon the acid biosynthesis. These assays can be adapted by one of order of addition of reaction components, test compounds ordinary skill in the art, or other assays known in the art can be that inhibit complex formation or that disrupt preformed 45 used, to test the activity of other targets of the invention. complexes can be detected. AMP-Activated Protein Kinase (AMPK) Alternatively, the reaction can be conducted in a liquid In one embodiment of the present invention, a virus that phase in the presence or absence of the test compound, the upregulates fatty acid biosynthesis would be inhibited by a reaction products separated from unreacted components, and compound that activates AMP-activated protein kinase complexes detected; e.g., using an immobilized antibody spe 50 (AMPK), as AMPK is an inhibitor of acetyl CoA carboxy cific for one of the binding components to anchor any com lase. In a preferred embodiment, AMPK inhibition is a pre plexes formed in solution, and a labeled antibody specific for ferred result, as viruses that depend on the upregulation of the other partner to detect anchored complexes. Again, glycolysis and depend on AMPK activity would be inhibited depending upon the order of addition of reactants to the liquid by an AMPK inhibitor. phase, test compounds that inhibit complex or that disrupt 55 AMPK can exemplarily be purified from porcine liver. preformed complexes can be identified. Liver (1 kg) is homogenized in 4,000 ml of buffer. A 2.5-7.0% In an alternate embodiment of the invention, a homoge (w/v) PEG 6000 fraction is prepared and the resultant fraction neous assay can be used. For example, a preformed complex batched onto 1,500 ml of DEAE cellulose (Whatman, Clifton, of the target enzyme and the interactive cellular or extracel 60 N.J.) and eluted with buffer containing 0.25 M NaCl. The lular binding partner product or Substrate is prepared in that eluate is chromatographed on, e.g., Blue Sepharose (Pharma either the target enzyme or their binding partners or Substrates cia, Uppsala, Sweden) and the AMPK eluted with buffer are labeled, but the signal generated by the label is quenched containing 1 M NaCl. The enzyme fraction is concentrated due to complex formation (See, e.g., U.S. Pat. No. 4,109,496 and desalted by 10% (w/v) PEG-6000 precipitation prior to that utilizes this approach for immunoassays). The addition of 65 chromatography by peptide Substrate affinity chromatogra a test Substance that competes with and displaces one of the phy. The peptide substrate affinity column is washed with the species from the preformed complex will result in the gen same buffer containing 0.1% (v/v) Triton X-100 and 0.5 M US 9,029,413 B2 113 114 NaCl and the AMPK eluted with this buffer containing 2 M values can be determined by non-linear regression analysis of NaCl and 30% (v/v) ethylene glycol. initial velocities, according to the standard Henri-Michaelis In addition to the general assays for enzyme activity and Menten equation. k can be obtained by dividing V, Val compound screening described above, assays for measuring ues by reaction concentrations of enzyme, derived by colori the activity of AMPK, which can be used to test the effect of 5 metric protein determinations. Variation in these values upon a potential antiviral compound, are taught in US Patent Pub titration of a particular compound indicates that the com lication No. 20060147947; U.S. Pat. No. 7,220,729; U.S. Pat. pound modulates ACC activity (See Cheng et al. 2007. Pro No. 6,124,125; and Feng et al. 2004. Antiviral Res.62, A43, tein Exp and Purif. 51:11-21, which is incorporated herein in which are incorporated by reference herein in their entirety. its entirety). Other assays for ACC activity are taught in U.S. An in vitro assay for AMPK activity can include forming a 10 Pat. No. 6,069,298; International Patent Application Publica reaction mixture that includes the test compound, AMPK, tion WO 2003/072602: European Patent Application AMP, a substrate (e.g., a protein), and ATP (e.g., radiolabeled EP1607477; Oizumi et al. 1990. J. Chromatogr 529: 55-63; ATP) and evaluating transfer of a phosphate from the ATP to Bijleveld et al. 1987. Biochim Biophys Acta 918:274-283: the Substrate. Evaluating transfer of the phosphate can and Haas A. 1994. Methods 126: 87-97, each of which is include, for example, detecting the phosphate (e.g., chemi 15 incorporated by reference herein in its entirety. cally or using a label, e.g., a radiolabel) or detecting a physical Assays to measure enzymatic activity of ACC described in property of the Substrate, e.g., a change in molecular weight, the art, e.g., as disclosed in U.S. Pat. No. 6,994,956 (which is charge, or pl. incorporated by reference herein in its entirety), can be used AMPK activity can be assayed in vitro. See, e.g., Hardie et to test the ability of Compounds to inhibit ACC enzymatic al. (1997) Eur. J. Biochem. 246: 259; Hardie et al., (1998) activity. Such assays may also be used in high throughput Annu Rev. Biochem. 67:851; Vavvas et al. (1997) J. Biol. screening assays. The methods described in U.S. Pat. No. Chem. 272:13.256; and Winder et al. (1996) Am. J. Physiol. 6,994.956 allow for radiometric detection of ACC activity via Endocrinol. Metab. 270:E299. The reaction mixture can again of signal assay using the 2-CImalonyl-CoA product include radiolabeled ATP, e.g., PATP and an artificial 25 of the reaction between NaHCO, and 1-''Clacetyl-CoA peptide Substrate, e.g., a 15-amino acid peptide called catalyzed by ACC, as a substrate for FAS. The radiometric “SAMS which is an amino acid sequence from the acetyl detection of ACC activity is mediated by partitioning the CoA carboxylase (ACC) enzyme. The SAMS peptide can radioactive products of the ACC-FAS coupled assay (''C- include the sequence: HMRSAMSGLHLVKRR. See, e.g., radiolabled oleic acid and palmitic acid) into the PPSF (Mi Davies et al. (1989) Eur. J. Biochem, 186:123. A peptide from 30 croscintTM-E) following acidification of the reaction mixture. glycogen synthase can also be used, e.g., a peptide that For example, a 96-well density reaction is partitioned in the includes the sequence PLSRTLSVAAKK. following manner: 100 uL enzyme assay inhibitor test mix An increase in AMPK activity will cause an increase in containing enzyme (ACC and FAS). Substrates, test com phosphorylation of the peptide. In some implementations, the 35 pounds, and buffer components is incubated at room tempera reaction mixture can include AMP or creatine phosphate. ture to generate the fatty acid products. The enzymatic reac Phosphorylation can be detected, e.g., using a Scintillation tion is stopped by the addition of 20 uL of 2N HCl, followed counter after separation of free ATP from the peptide. by addition of 150 uL MicroscintTM-E. Partitioning does not Acetyl-CoA Carboxylase (ACC) require a specific mixing step, but does require several hours Acetyl-CoA carboxylase (ACC) catalyzes the first com 40 for establishment and is stable for 24 hours. Neither the mitted step of fatty acid biosynthesis and is one of the rate radioactive substrate 1-Clacetyl-CoA nor the product of limiting steps offatty acid biosynthesis, which converts ATP, the ACC reaction 2-CImalonyl-CoA partitions into the bicarbonate and acetyl-CoA to malonyl-CoA, ADP and inor organic phase. ganic phosphate. ACC enzymatic assays can be carried out Enzyme activity is proportional to the radioactivity in the using recombinant, purified ACC1 and/or ACC2. The nucle 45 organic phase as determined by liquid Scintillation counting. otide and amino acid sequences of human and rat ACC2 have The amount of radioactivity detected in the PPSF (phase been described, e.g., see U.S. Pat. No. 7,211,423, which is partition Scintillation fluid) is dependent upon the amount of incorporated herein in its entirety. It is thus noted that in some FAS in the well and the amount of time the enzymatic reaction embodiments of this invention, it is generally desirable to is allowed to proceed, that is, CPMs are dose-dependent with determine the specificity of a particular compound for a par 50 respect to reaction time and concentration of ACC. The effec ticular isozyme or enzyme isoform. Recombinant ACC1 or tiveness of acidification and the PPSF in partitioning long ACC2 can be labeled with a tag, e.g., Myc, Glutathione chain fatty acids into the PPSF may be assessed using a S-transferase (GST), polyHis, HA, Flag, or Mannose binding known amount of authentic radiolabeled palmitic acid. The protein (MBP), expressed in any suitable host cell, e.g., bac theoretical signal to background of the assay may be estab teria, insect cells, yeast cells, or mammalian cells, and puri 55 lished by comparing CPMs in the PPSF using equimolar fied by affinity chromatography. In an exemplary assay, amounts and equal amounts of radioactivity of radiolabeled steady-state kinetic parameters are determined by monitoring Substrate and product. the ACC- and ATP-dependent incorporation of radioactivity A sample reaction as described below may be carried out in from acid-labile H''CIO into acetyl-CoA to form acid 60 the presence or absence of a Compound: ACC and FAS at stable malonyl-CoA product. Reactions are conducted at 37° varying concentrations are incubated for 75 minutes at room C., and can be carried out on a large scale, e.g., in 96-well temperature with 4 mM ATP, 400 uM NADPH, and 16 uM microplates. Reactions are quenched and unincorporated acetyl-CoA (0.015 uCi; acetyl-1-''C-CoA) in a buffer con label is removed. The amount of ''C present in the plates can taining 50 mM HEPES (pH 7.5), 20 mM NaHCO, 10 mM be measured by Scintilation counting, and reaction rates 65 citric acid, 5 mM DTT, 10 mM MgCl, 1 mM EDTA, and obtained by linear regression analysis of radioactivity incor 0.03% BSA in a total volume of 100 uL. The reaction is porated VS. reaction time for each incubation. K and V. terminated by the addition 10 LIL of 10 Nacetic acid, followed US 9,029,413 B2 115 116 by 150 uL MicroscintTM-CAT. The mix is allowed to incubate with phenylmethylsulfonylfluoride (PMSF) and N-p-tosyl-1- overnight prior to data acquisition. lysine chloromethyl ketone (TLCK) so that the final concen Other non-limiting example of assays to measure the enzy tration of each is 50 and 25 ug/ml, respectively. The homo matic activity of ACC are presented below. Spectrophotomet genate is first centrifuged at 700xg for 10 minutes, the ric assays can be used to measure the partial reaction of 5 supernatant decanted and re-centrifuged at 7,700xg for 20 ATP-dependent biotin, where the rate of ATP hydrolysis by minutes. This Supernatant is filtered through a fine nylon biotin carboxylase is measured spectrophotometrically at 340 screen to remove most of the fat layer and re-centrifuged at nm by coupling the production of ADP to pyruvate kinase and 100,000xg for 1 hour. This supernatant is removed and 1M lactate dehydrogenase (see Levert et al., Biochemistry potassium phosphate, dithiothreitol (DTT) and ethylene gly 39:4122-3128, 2000). Also, spectrophotometric assays can 10 colbis(beta-aminoethyl ether)-N.N.N',N'-tetraacetic acid be used to monitor the ACC-catalyzed decarboxylation of (EGTA) added to give a final concentration of 0.1M (pH 7.2). malonyl-CoA, where the acetyl-CoA produced in the ACC 0.5 mM and 0.1 mM, respectively. Solid ammonium sulfate is reaction is condensed with oxaloacetic acid produced by the added to 50% saturation to the protein solution, it is centri action of malate dehydrogenase on malate and NAD to pro fuged at 15,000xg and the supernatant discarded. This pre duce citrate in a citrate synthase catalyzed reaction, and 15 cipitated protein could be stored at -70° C. for at least one NADH production is measured as increase in absorbance at month with very little loss of activity. The ammonium sulfate 340 nm (see Winder et al., J. Appl. Physiol. 882219-2226, precipitate is dissolved in a minimal amount of 0.06M potas 2000). Radiolabeled assays can be used to measure the pro sium phosphate buffer (pH 7.2) containing 0.5 mM dithio duction of 3-''CImalonyl-CoA from NaHCO, and acetyl threitol and 0.1 mM EGTA (referred to as 0.06M phosphate CoA (see Herbert et al., Biochem. J. 318:997-1006, 1996). buffer) and dialyzed overnight against 2 liters of the same Lysonhosphatidic Acid Acyltransferase (Including Lyso buffer to remove the ammonium sulfate and to inactivate phosphatidic Acid Acetyltransferase) (LPAAT) Assays HMG-CoA lyase (Clinkenbeard, et al., J. Biol. Chem. 250, LPAAT polypeptides can be expressed in any of a number 3.108-3116 (1975)). of different recombinant DNA expression systems, e.g., The dialyzed extract is added to a column of DEAE-52 recombinant LPAAT can be expressed in and purified from E. 25 (Whatman) which has been equilibrated with 0.06M phos coli, to enable large scale production of pure, biologically phate buffer (10 mg of protein to 1 ml bed volume of the active hLPAAT-alpha, hLPAAT-beta, hLPAAT-gamma-1, resin). The DEAE-cellulose is eluted with 0.06M phosphate hLPAAT-gamma-2, and hLPAAT-delta useful for screening buffer until the optical density at 280 nm is essentially zero. compounds for the purposes of the invention. This fraction contains the beta-ketoacetyl-CoA thiolase Screening compounds for inhibition of LPAAT enzymes 30 activity. The HMG-CoA synthase is eluted from the column comprises, for example, contacting hLPAAT-alpha, hLPAAT with 0.1M KCl in 0.06M phosphate buffer (pH 7.2) contain beta, hPAAT-gammal, hPAAT-gamma2, and/or hPAAT ing 0.5 mM DTT and 0.1 mM EGTA, and was virtually free delta in the presence of compound and substrate for LPAAT, of all thiolase activity. The protein is precipitated by the namely LPA and fatty acyl-CoA. These hLPAAT proteins can addition of ammonium sulfate to give 50% saturation. This either be purified prior to incubation or can be contained in 35 solution was stirred for 10 minutes at 4°C. and the precipitate extracts from a cell line or cell lines (for example, SD, collected by centrifugation at 15,000 rpm for 10 minutes. The ECV304, A549) transfected with cDNA encoding these Supernatant is discarded and the precipitate dissolved in a polypeptides (West et al., DNA Cell Biol. 16:691, 1997). minimum of 0.06M phosphate buffer, pH 7.2 (about 10 ml) Alternatively, hPAAT protein can be purified from trans and the enzyme stored at -80° C. fected cells, and the protein, being a transmembrane protein, 40 Intrinsic activity of HMG-CoA synthase is measured in the can then be reconstituted in a lipid bilayer to form liposomes following in vitro assay. Enzyme protein (ca. 12.2 Lig) is for delivery into cells (Weiner, Immunomethods 4:201, added to a solution containing 117 mM Tris-HCl (pH 8.0), 1994). 11.7 mM MgCl, 1.17 mM Ethylenediaminetetraacetic acid The effect of a compound or composition on hLPAAT (EDTA), 0.58 mM dithiothreitol, in the presence or absence alpha, hPAAT-beta, hLPAAT-gammal, hLPAAT-gamma2. 45 of the test compound (added as, e.g., a 2 g/ml Solution in or hLPAAT-delta activity can be determined, for example, by dimethylsulfoxide). The incubation is in a volume of 0.085 ml measuring the generation of PA and CoA. PA can be mea at 30°C. in a shaking water bath. After 5 minutes, 15ul of a sured by, for example, TLC methods described in Examples 3 solution containing acetoacetyl-CoA and 0.1 uCi of 1'C- and 7, found below. Alternatively, LPAAT activity can be acetyl-CoA is added to give final concentrations of 0.1 and assayed by detecting the formation of free CoA in reaction. 50 0.4 mM, respectively. The incubation is continued for 2 more CoA, which contains a free sulfhydryl-group, can be mea minutes and the reaction stopped by the addition of 50 ul of sured either by, for example, colorimetric or fluorescenic the assay mixture to 0.2 ml of 6NHCl in a glass scintillation methods with Sulfhydryl-specific reagents, such as, 5.5'- vial. The vial is heated for 1 hour at 110° C. after which time dithiobis-(2-nitrobenzoic acid) (DTNB) or ThioGlo (Cova 0.2 ml more of 6N HCl is again added to each vial and the lent Associates, Woburn, Mass.). The observed effect on 55 heating continued for another hour. Following this, 1.0 ml of hLPAAT-alpha, hLPAAT-beta, hLPAAT-gammal, hLPAAT 0.9% saline is added to each vial and finally 10 ml of scintil gamma2, or hLPAAT-delta may be either inhibitory or stimu lation liquid. Radioactivity is determined in a Packard Tri latory. Carb liquid scintillation counter. Percent inhibition is calcu Exemplary assays for the activity of Lysophosphatidic acid lated a standard formula. ICso values are determined by acetyltransferase are found in US Patent Publication 60 plotting the log of the concentration of the test compound 2004.0043465; Bonham et al. 2003. Expert Opin. Ther. Tar verses the percentage inhibition and fitting a straight line to gets 7/5:643-661; and U.S. Pat. No. 6,136,964, each of which the resulting data by using the least squares method. is incorporated by reference herein in its entirety. Exemplary assays for measuring the activity of HMG-CoA HMG CoA Synthase synthase are provided in U.S. Pat. No. 5,064,856, European HMG-CoA synthase can be purified from liver. In an exem 65 Patent Application EP991.07413, and Omura S. 1992.J Indus plary protocol, livers from male Charles River CD rats (225 trial Microbiol 10:135-156, each of which is incorporated by 350 g) are homogenized in 0.25M sucrose which is adjusted reference herein in its entirety. US 9,029,413 B2 117 118 ATP Citrate Lyase trometer performs a selected reaction monitoring scan event Rat or human ATP citrate lyase can be purified and used in (SRM) that consists of three identifiers: accordance with the methods of this invention. Male Wistar 1) The metabolite's mass (the parent ion); 2) The energy required to fragment the parent ion in a rats are fasted for 24 h, then fed on a high carbohydrate diet collision with argon to yield a fragment with a specific mass; for 72 h prior to removal of the livers. ATP Citrate lyase is and prepared according to the method of Wraight et al. (Anal. 3) The mass of the specific fragmention. Biochem., 1985, 144, 604-609) with modifications for large Utilizing the above identifiers, the accumulation of a metabo scale purification according to Wells (Eur. J. Biochem., 1991, lite can be measured whose production depends on the activ 199, 163-168). Purity of protein can be determined by SDS ity of a metabolic enzyme of interest. By adding an excess of PAGE. Human ATP citrate lyase is prepared as described in 10 enzyme substrate to a cellularlysate, so as to make the activity European Journal of Biochemistry, 1992, 204, 491-99, with of the enzyme rate limiting, the accumulation of enzymatic modifications for large scale purification according to Wells product over time is then measured by LC-MS/MS as out as referred to above. Purity of protein obtained by this method lined above, and serves as a function of the metabolic is judged by SDS-PAGE. enzyme’s activity. An example of such an assay is reported in 15 Munger et al., 2006 PLoS Pathogens, 2: 1-11, incorporated ATP citrate lyase activity is assayed at 25°C. by reducing herein by reference in its entirety, in which the activity of the oxaloacetate produced with malate dehydrogenase and phosphofructokinase present in infected lysates was mea NADH while monitoring at 340 nm using a Beckman DU50 Sured by adding an excess of the phosphofructokinase Sub spectrophotometer (according to the method of Linn etal (J. strates ATP and fructose phosphate and measuring fructose Biol. Chem., 1979, 254, 1691-1698). Briefly, ATP citrate bisphosphate accumulation by LC-MS/MS. This approach lyase (human or rat) is added to a 1 ml cuvette containing 50 can be adopted to measure the activities of numerous host mM Tris/HCl, pH=8.0, 0.2 mM NADH, 10 mM MgCl, 10 target enzymes. mM KC1, 5 mM ATP, 200 uM coenzyme A, 10 mM dithio 5.3.2 Kinetic Flux Profiling (KFP) to Assess Potential threitol and malate dehydrogenase. An aqueous solution of Antiviral Compounds inhibitor is added (for inhibitors that are insoluble in water, a 25 In a further embodiment of the invention, cellular meta stock solution is prepared in DMSO. However the final bolic fluxes are profiled in the presence or absence of a virus DMSO concentration in the cuvette is not allowed to exceed using kinetic flux profiling (KFP) (See Section 6: Munger et 1%.). Finally, tripotassium citrate is added to 100 uM final. al. 2006 PLoS Pathogens, 2: 1-11) in the presence or absence This is K for citrate (Wells etal (Eur. J. Biochem., 1992, 204, of a compound found to inhibit a target enzyme in one of the 249-255) and Houston et al (Biochim. Biophys. Acta, 1985, 30 aforementioned assays. Such metabolic flux profiling pro 844, 233-239)). Data analysis is performed using the curve vides additional (i) guidance about which components of a fitting package Enzfitter (Elsevier Biosoft). host’s metabolism can be targeted for antiviral intervention; Assays, incorporated by reference herein by reference in (ii) guidance about the metabolic pathways targeted by dif their entirety, for the activity of ATP citrate lyase may be ferent viruses; and (iii) validation of compounds as potential found in U.S. Pat. No. 5,447,954; International Patent Appli 35 antiviral agents based on their ability to offset the metabolic cation Publication No. WO 2004/100885; and an assay in flux caused by a virus or trigger cell-lethal metabolic yeast found in Holdsworth et al. 1998. J Gen Microbiol 134: derangements specifically in virally infected cells. In one 2907-2915. embodiment, the kinetic flux profiling methods of the inven Fatty Acid Synthase tion can be used for screening to determine (i) the specific Exemplarily, Subcutaneous adipose tissue is disrupted, 40 alterations in metabolism caused by different viruses and (ii) cells are lysed, and the soluble lysate is used for enzyme the ability of a compound to offset (or specifically augment) assays. Assays are started by the addition of malonyl CoA and alterations in metabolic flux caused by different viruses. the rate of oxidation of NADPH is measured. Methods for Thus, in one embodiment of the invention, cells are isolating and testing the activity of fatty acid synthase are infected with a virus and metabolic flux is assayed at different provided in Wiesner et al. 1988 European J Biochemistry 45 time points after virus infection, such time points known to 177:69-79 and in A K Joshi and S Smith. 1993. Biochem J. one of skill in the art. For example, flux can be measured 24, 296: 143-149. 48, or 72 hours post-infection. If the metabolic flux is altered The activity of fatty acid synthase can be measured by a in the presence of the virus, then the virus alters cellular modification of the spectrophotometric method (Lowry et al. metabolism during infection. The type of metabolic flux alter 1951. “Protein measurement with the Folin phenol reagent.” 50 ation observed (See above and examples herein) will provide J Biol. Chem. 193(1):265-75). Detailed assays for fatty acid guidance as to the cellular pathways that the virus acts on. synthase activity may be found in U.S. Pat. No. 4,735,895: Assays well known to those of skill in the art and described International Patent Application Publication No. WO 2003/ herein below can then be employed to confirm the target of the 051307; and US Patent Application Publication No. virus. For example, if it appears that the virus modulates the US20070099230 and US20020151463, each of which is 55 activity of fatty acid synthase, cerulenin can be tested for its incorporated by reference herein in its entirety ability to interfere with the virus in the assays for antiviral 5.3.1 High Throughput Screening of Compounds and Tar activity described in Section 5.4 below. If it appears that the get Enzymes virus modulates ATP citrate lyase, radicicol and its deriva In one embodiment, high throughput screening using, e.g., tives can be tested for their antiviral effect. If these well mass spectrometry can be used to screen a number of com 60 characterized compounds are effective antivirals, a specific pounds and a number of potential target enzymes simulta virus metabolic target has been identified and other com neously. Mass spectrometry can be utilized for determination pounds that modulate these targets can similarly be assessed of metabolite levels and enzymatic activity. as potential antivirals. See Table 2 for examples of test com The levels of specific metabolites (e.g. AMP, ATP) can be pounds that can be used in the invention, compounds that may quantified by liquid chromatography-mass spectrometry 65 be used as antivirals, and compounds useful as test com (LC-MS/MS). A metabolite of interest will have a specific pounds for identifying metabolic targets of novel drugs or chromatographic retention time at which point the mass spec other viruses for antiviral intervention. US 9,029,413 B2 119 120 TABLE 2

Compounds and target enzymes related to host cell metabolism inhibitor (test compounds for validation of relevance of the enzyme target and/or potential antiviral compounds) enzyme target 4S-hydroxycitrate; compounds of structure (X) ATP citrate lyase - renal in rats Radicicol (monorden) and derivatives; ATP citrate lyase I in vitro rat liver compounds of structure (II) SB-204990 (compounds of structure (III)) + ATP citrate lyase I in vitro rat liver enzyme SB-201076 (compounds of structure (IV)) SB-204990; compounds of structure (III) ATP citrate lyase I in vitro rat liver enzyme 2,2-difluorocitrate; compounds of structure (X) ATP citrate lyase 2-chloro-1,3,8-trihydroxy-6-methyl-9- ATP citrate lyase - Rat Liver anthrone; compounds of structure (V) thiol-citrates; compounds of structure (X) ATP citrate lyase - Rat Liver Purpurone; compounds of structure (VII) ATP citrate lyase 3-oxobutylsulfoxyl-CoA: compounds of HMG-CoA synthase structure (XI) CP-610431, CP-640186; compounds of Acetyl-CoA Carboxylase (ACC) structure (VI) Soraphen-A; compounds of structure (VIII) Acetyl-CoA Carboxylase (ACC) Haloxyfop; compounds of structure (DX) Acetyl-CoA Carboxylase (ACC) Sethoxydim; compounds of structure (XII) Acetyl-CoA Carboxylase (ACC) Cerulenin; compounds of structure (XIII) and Fa y Acid Syn hase -keto-acyl synthase compounds of structure (XIV) domain C75; compounds of structure (XV) Fatty Acid Synthase -keto-acylsynthase domain Orlistat; compounds of structure (I) Fatty Acid Synthase: Fatty Acid Synthase - hioesterase domain Triclosan; compounds of structure (XXI) Fatty Acid Synthase epigallocatechin-3-gallate; compounds of Fatty Acid Synthase structure (XXII) naturally occurring flavonoids (e.g., luteolin, Fatty Acid Synthase quercetin, and kaempferol) CT32228; compounds of structure (XVI) Lysophosphatidic Acid Acyltransferase (8. oxfenicine; compounds of structure (XIX) Carnitine Palmitoyl transferase (CPTI) Etomoxir; compounds of structure (XVII) Carnitine Palmitoyl Transferase 1 (CPTI) CBM-301106 Malonyl-CoA ecarboxylase (downstream effect on CPT I) 3-Carboxypropyl-CoA methylmalonyl-CoA mutase Chloroquine; compounds of structure (XX) Glutamate Dehydrogenase Compound C (6-4-(2-Piperidin-1-yl-ethoxy)- AMP-activated protein Kinase (AMPK) phenyl)-3-pyridin-4-yl-pyrrazolo15-a- pyrimidine); compounds of structure (XVIII) TOFA (5-(tetradecyloxy)-2-furoic acid); Acetyl-CoA carboxylase (ACC) compounds of structure (XXIII)

In one embodiment of the invention, a virus infected cell is a compound or library of compounds offsets these changes. contacted with a compound and metabolic flux is measured. If See Munger et al. 2006. PLoS Pathogens, 2: 1-11. the metabolic flux in the presence of the compound is differ 55 5.3.3 Compounds ent from the metabolic flux in the absence of the compound, Using metabolome and fluxome-based analysis of virus in a manner wherein the metabolic effects of the virus have infected cells, the inventors discovered that the host cell target been inhibited or augmented, then a compound that modu enzymes listed in Table 1 (Section 5.1) are affected by virus lates the virus’ ability to alter the metabolic flux has been infection. Based on these findings, compounds that are struc identified. The type of metabolic flux alteration observed will 60 turally related to known inhibitors of these enzymes are iden provide guidance as to the cellular pathway that the com tified and screened for their specific modulation of the activity pound is acting on. Assays well known to those of skill in the of these enzymes. See Table 2 (Section 5.3.2 above). Further, art and described herein can then be employed to confirm the any compound of interest can be tested for its ability to target of the antiviral compound. modulate the activity of these enzymes. Alternatively, com In one embodiment, high throughput metabolome quanti 65 pounds can be tested for their ability to inhibit any other host tation mass spectrometry can be used to Screen for changes in cell enzyme related to metabolism. Once Such compounds are metabolism caused by infection of a virus and whether or not identified as having metabolic enzyme-modulating activity, US 9,029,413 B2 121 122 they can be further tested for their antiviral activity as 337; benzodiazepines, U.S. Pat. No. 5.288,514, and the like). described in Section 5.4. Alternatively, Compounds can be Additional examples of methods for the synthesis of molecu screened for antiviral activity and optionally characterized lar libraries can be found in the art, for example in: DeWittet using the metabolic screening assays described herein. al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. In one embodiment, high throughput screening methods (1994) Proc. Natl. Acad. Sci. USA91:11422: Zuckermannet are used to provide a combinatorial chemical or peptide al. (1994). J. Med. Chem. 37:2678; Cho et al. (1993) Science library (e.g., a publicly available library) containing a large 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. number of potential therapeutic compounds (potential modu 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. lators or ligand compounds). Such "combinatorial chemical 10 libraries” or “ligand libraries' are then screened in one or 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233. more assays, as described in Section 5.3 herein, to identify Some exemplary libraries are used to generate variants those library members (particular chemical species or sub from a particular lead compound. One method includes gen classes) that display a desired characteristic activity. The erating a combinatorial library in which one or more func compounds thus identified can serve as conventional “lead 15 tional groups of the lead compound are varied, e.g., by deriva compounds' or can themselves be used as potential or actual tization. Thus, the combinatorial library can include a class of therapeutics. compounds which have a common structural feature (e.g., A combinatorial chemical library is a collection of diverse scaffold or framework). Examples of lead compounds which chemical compounds generated by either chemical synthesis can be used as starting molecules for library generation or biological synthesis, by combining a number of chemical include, e.g., in the case of AMPK, biguanides such as met “building blocks” such as reagents. For example, a linear formin; thiazolidinediones, e.g., rosiglitazone and pioglita Zone; an AMP analog such as AICAR-5'-aminoimidazole-4- combinatorial chemical library such as a polypeptide library carboxyamide-ribosid: leptin and leptin-related molecules: is formed by combining a set of chemical building blocks adiponectin and Adiponectin-related molecules. (amino acids) in every possible way for a given compound 25 length (i.e., the number of amino acids in a polypeptide com Devices for the preparation of combinatorial libraries are pound). Millions of chemical compounds can be synthesized commercially available (See, e.g., 357 MPS. 390 MPS, through Such combinatorial mixing of chemical building Advanced Chem Tech, Louisville Ky., Symphony, Rainin, blocks. Woburn, Mass., 433A Applied Biosystems, Foster City, Preparation and screening of combinatorial chemical 30 Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, libraries is well known to those of skill in the art. Such numerous combinatorial libraries are themselves commer combinatorial chemical libraries include, but are not limited cially available (See, e.g., ComGenex, Princeton, N.J., to, peptide libraries (See, e.g., U.S. Pat. No. 5,010, 175, Furka, Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar, Int. J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., 35 Ltd. Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek Nature 354:84-88 (1991)). Other chemistries for generating Biosciences, Columbia, Md., etc.). The test compounds can chemical diversity libraries can also be used. Such chemis also be obtained from: biological libraries; peptoid libraries tries include, but are not limited to: peptoids (e.g., PCT Pub (libraries of molecules having the functionalities of peptides, lication No. WO 91/19735), encoded peptides (e.g., PCT but with a novel, non-peptide backbone which are resistant to Publication No. WO93/20242), random bio-oligomers (e.g., 40 enzymatic degradation but which nevertheless remain bioac PCT Publication No. WO92/00091), benzodiazepines (e.g., tive: See, e.g., Zuckermann, R.N. et al. (1994).J.Med. Chem. U.S. Pat. No. 5,288,514), diversomers such as hydantoins, 37:2678-85); spatially addressable parallel solid phase or benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Solution phase libraries; synthetic library methods requiring Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypep 45 deconvolution; the one-bead one-compound library tides (Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)), method; and synthetic library methods using affinity chroma nonpeptidal peptidomimetics with glucose scaffolding (Hir tography selection. The biological libraries include libraries schmann et al., J. Amer. Chem. Soc. 114:9217-9218 (1992)), of nucleic acids and libraries of proteins. Some nucleic acid analogous organic syntheses of small compound libraries 50 libraries encode a diverse set of proteins (e.g., natural and (Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligo artificial proteins; others provide, for example, functional carbamates (Cho et al., Science 261:1303 (1993)), and/or RNA and DNA molecules such as nucleic acid aptamers or peptidyl phosphonates (Campbellet al., J. Org. Chem.59:658 ribozymes. A peptoid library can be made to include struc (1994)), nucleic acid libraries (See Ausubel, Berger and Sam tures similar to a peptide library. (See also Lam (1997) Anti brook, all supra), peptide nucleic acid libraries (See, e.g., U.S. 55 cancer Drug Des. 12:145). A library of proteins may be pro Pat. No. 5,539,083), antibody libraries (See, e.g., Vaughn et duced by an expression library or a display library (e.g., a al., Nature Biotechnology, 14(3):309-314 (1996) and PCT/ phage display library). Libraries of compounds may be pre US96/10287), carbohydrate libraries (See, e.g., Liang et al., sented in solution (e.g., Houghten (1992) Biotechniques Science, 274: 1520-1522 (1996) and International Patent 60 13:412-421), or on beads (Lam (1991) Nature 354:82-84), Application Publication NO. WO 1997/000271), small chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner, organic molecule libraries (See, e.g., benzodiazepines, Baum U.S. Pat. No. 5,223.409), spores (Ladner U.S. Pat. No. 5,223, C&EN, January 18, page 33 (1993); isoprenoids, U.S. Pat. 409), plasmids (Cullet al. (1992) Proc Natl Acad Sci USA No. 5.569,588; thiazolidinones and metathiazanones, U.S. 65 89:1865-1869) or on phage (Scott and Smith (1990) Science Pat. No. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 249:386-390; Devlin (1990) Science 249:404–406; Cwirla et and 5.519,134; morpholino compounds, U.S. Pat. No. 5,506, al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382; Felici (1991) US 9,029,413 B2 123 124 J. Mol. Biol. 222:301-310; Ladner supra.). Enzymes can be 5.4 Characterization of Antiviral Activity of screened for identifying compounds which can be selected Compounds from a combinatorial chemical library or any other suitable 5.4.1 Viruses source (Hogan, Jr., Nat. Biotechnology 15:328, 1997). The present invention provides Compounds for use in the Any assay herein, e.g., an in vitro assay or an in vivo assay, prevention, management and/or treatment of viral infection. can be performed individually, e.g., just with the test com The antiviral activity of Compounds against any virus can be pound, or with appropriate controls. For example, a parallel tested using techniques described in Section 5.4.2 herein assay without the test compound, or other parallel assays below. The virus may be enveloped or naked, have a DNA or RNA genome, or have a double-stranded or single-stranded without other reaction components, e.g., without a target or 10 genome. See, e.g., FIG.1 modified from Flintet al., Principles without a substrate. Alternatively, it is possible to compare of Virology: Molecular Biology, Pathogenesis and Control of assay results to a reference, e.g., a reference value, e.g., Animal Viruses. 2nd edition, ASM Press, 2003, for a subset of obtained from the literature, a prior assay, and so forth. virus families and their classification, as well as a Subset of Appropriate correlations and art known statistical methods viruses against which Compounds can be assessed for anti can be used to evaluate an assay result. See Section 5.3.1 15 viral activity. In specific embodiments, the virus infects above. human. In other embodiments, the virus infects non-human Once a compound is identified as having a desired effect, animals. In a specific embodiment, the virus infects pigs, production quantities of the compound can be synthesized, fowl, other livestock, or pets. e.g., producing at least 50 mg, 500 mg, 5 g, or 500 g of the In certain embodiments, the virus is an enveloped virus. compound. Although a compound that is able to penetrate a Enveloped viruses include, but are not limited to viruses that host cell is preferable in the practice of the invention, a com are members of the hepadnavirus family, herpesvirus family, pound may be combined with solubilizing agents or admin iridovirus family, poxvirus family, flavivirus family, togavi istered in combination with another compound or compounds rus family, retrovirus family, coronavirus family, filovirus to maintain its solubility, or help it enter a host cell, e.g., by family, rhabdovirus family, bunyavirus family, orthomyxovii mixture with lipids. The compound can be formulated, e.g., 25 rus family, paramyxovirus family, and arenavirus family. for administration to a Subject, and may also be administered Non-limiting examples of viruses that belong to these fami to the subject. lies are included in Table 3. TABLE 3 Families of Enveloped Viruses Virus Family Members Hepadnavirus hepatitis B virus (HBV), woodchuck hepatitis virus, ground squirrel (Hepadnaviridae) hepatitis virus, duck hepatitis B virus, heron hepatitis B virus Herpesvirus herpes simplex virus (HSV) types 1 and 2, varicella-zoster virus, (Herpesviridae) cytomegalovirus (CMV), human cytomegalovirus (HCMV), Epstein Barr virus (EBV), human herpesvirus 6 (variants A and B), human herpesvirus 7, human herpesvirus 8, Kaposi's sarcoma - associated herpesvirus (KSHV), B virus Poxvirus vaccinia virus, variola virus, Smallpox virus, monkeypox virus, (Poxviridae) cowpox virus, camelpox virus, mousepox virus, raccoonpox viruses, molluscum contagiosum virus, orf virus, milker's nodes virus, bovin papular stomatitis virus, sheeppox virus, goatpox virus, lumpy skin disease virus, fowlpox virus, canarypox virus, pigeonpox virus, sparrowpox virus, myxoma virus, hare fibroma virus, rabbit fibroma virus, Squirrel fibroma viruses, Swinepox virus, tanapox virus, Yabapox virus Flavivirus dengue virus, hepatitis C virus (HCV), GB hepatitis viruses (GBV-A, (Flaviviridae) GBV-B and GBV-C), West Nile virus, yellow fever virus, St. Louis encephalitis virus, Japanese encephalitis virus, Powassan virus, tick borne encephalitis virus, Kyasanur Forest disease virus Togavirus Venezuelan equine encephalitis virus, chikungunya virus, Ross River (Togaviridae) virus, Mayaro virus, Sindbis virus, rubella virus Retrovirus human immunodeficiency virus (HIV) types 1 and 2, human T cell (Retroviridae) leukemia virus (HTLV) types 1, 2, and 5, mouse mammary tumor virus (MMTV), Roussarcoma virus (RSV), lentiviruses Coronavirus severe acute respiratory syndrome (SARS) virus (Coronaviridae) Filovirus Ebola virus, Marburg virus (Filoviridae) Rhabdovirus rabies virus, vesicular stomatitis virus (Rhabdoviridae) Bunyavirus Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, La (Bunyaviridae) Crosse virus, Hantaan virus Orthomyxovirus influenza virus (types A, B, and C) (Orthomyxoviridae) Paramyxovirus parainfluenza virus, respiratory syncytial virus (types A and B), (Paramyxoviridae) measles virus, mumps virus Arenavirus lymphocytic choriomeningitis virus, Junin virus, Machupo virus, (Arenaviridae) Guanarito virus, Lassa virus, Ampari virus, Flexal virus, Ippy virus, Mobala virus, Mopeia virus, Latino virus, Parana virus, Pichinde virus, Tacaribe virus, Tamiami virus US 9,029,413 B2 125 126 In some embodiments, the virus is a non-enveloped virus, a hepatitis C virus. In another specific embodiment, the virus i.e., the virus does not have an envelope and is naked. Non is an influenza virus. In an alternative embodiment, the virus limiting examples of Such viruses include viruses that are is not an influenza virus. In some embodiments, the virus is members of the parvovirus family, circovirus family, HIV. In other embodiments, the virus is not HIV. In certain polyoma virus family, papillomavirus family, adenovirus embodiments, the virus is a hepatitis B virus. In another family, iridovirus family, reovirus family, birnavirus family, alternative embodiment, the virus is not a hepatitis B virus. In calicivirus family, and picornavirus family. Examples of a specific embodiment, the virus is EBV. In a specific alter viruses that belong to these families include, but are not native embodiment, the virus is not EBV. In some embodi limited to, those set forth in Table 4. ments, the virus is Kaposi's sarcoma-associated herpesvirus TABLE 4 Families of Non-Enveloped (Naked) Viruses Virus Family Members Parvovirus canine parvovirus, parvovirus B19 (Parvoviridae) Circovirus porcine circovirus type 1 and 2, BFDV (Beak and Feather Disease (Circoviridae) Virus), chicken anaemia virus Polyomavirus simian virus 40 (SV40), JC virus, BK virus, Budgerigar fledgling (Polyomaviridae) disease virus Papillomavirus human papillomavirus, bovine papillomavirus (BPV) type 1 (Papillomaviridae) Adenovirus human adenovirus (HAdV-A, HAdV-B, HAdV-C, HAdV-D, HAdV-E, and (Adenoviridae) HAdV-F), fowl adenovirus A, Ovine adenovirus D, frog adenovirus Reovirus human orbivirus, human coltivirus, mammalian Orthoreovirus, (Reoviridae) bluetongue virus, rotavirus A, rotaviruses (groups B to G), Colorado ick fever virus, aquareovirus A, cypovirus 1, Fiji disease virus, rice dwarf virus, rice ragged stunt virus, idmoreovirus 1, mycoreovirus 1 Birnavirus bursal disease virus, pancreatic necrosis virus (Birnaviridae) Calicivirus Swine vesicular exanthema virus, rabbit hemorrhagic disease virus, (Caliciviridae) Norwalk virus, Sapporo virus Picornavirus human polioviruses (1-3), human coxsackieviruses A1-22, 24 (CA1 (Picornaviridae) 22 and CA24, CA23 = echovirus 9), human coxsackieviruses (B1-6 (CB1-6)), human echoviruses 1-7,9,11-27, 29-33, vilyuish virus, simian enteroviruses 1-18 (SEV1-18), porcine enteroviruses 1-11 (PEV1-11), bovine enteroviruses 1-2 (BEV1-2), hepatitis A virus, rhinoviruses, hepatoviruses, cardioviruses, aphthoviruses, echoviruses

In certain embodiments, the virus is a DNA virus. In other (KSHV). In some alternative embodiments, the virus is not embodiments, the virus is a RNA virus. In one embodiment, KSHV. In certain embodiments the virus is a variola virus. In the virus is a DNA or a RNA virus with a single-stranded 40 certain alternative embodiments, the virus is not variola virus. genome. In another embodiment, the virus is a DNA or a RNA In one embodiment, the virus is a Dengue virus. In one alter virus with a double-stranded genome. native embodiment, the virus is not a Dengue virus. In other In some embodiments, the virus has a linear genome. In embodiments, the virus is a SARS virus. In other alternative other embodiments, the virus has a circular genome. In some embodiments, the virus is not a SARS virus. In a specific embodiments, the virus has a segmented genome. In other 45 embodiment, the virus is an Ebola virus. In an alternative embodiments, the virus has a non-segmented genome. embodiment, the virus is not an Ebola virus. In some embodi In some embodiments, the virus is a positive-stranded ments the virus is a Marburg virus. In an alternative embodi RNA virus. In other embodiments, the virus is a negative ment, the virus is not a Margurg virus. In certain embodi stranded RNA virus. In one embodiment, the virus is a seg ments, the virus is a measles virus. In some alternative mented, negative-stranded RNA virus. In another embodi 50 embodiments, the virus is not a measles virus. In particular ment, the virus is a non-segmented negative-stranded RNA embodiments, the virus is a vaccinia virus. In alternative virus. embodiments, the virus is not a vaccinia virus. In some In some embodiments, the virus is an icosahedral virus. In embodiments, the virus is varicella-zoster virus (VZV). In an other embodiments, the virus is a helical virus. In yet other alternative embodiment the virus is not VZV. In some embodiments, the virus is a complex virus. 55 embodiments, the virus is a picornavirus. In alternative In certain embodiments, the virus is a herpes virus, e.g., embodiments, the virus is not a picornavirus. In certain HSV-1, HSV-2, and CMV. In other embodiments, the virus is embodiments the virus is not a rhinovirus. In certain embodi not a herpes virus (e.g., HSV-1, HSV-2, and CMV). In a ments, the virus is a poliovirus. In alternative embodiments, specific embodiment, the virus is HSV. In an alternative the virus is not a poliovirus. In some embodiments, the virus embodiment, the virus is not HSV. In another embodiment, 60 is an adenovirus. In alternative embodiments, the virus is not the virus is HCMV. In a further alternative embodiment, the adenovirus. In particular embodiments, the virus is a cox virus is not HCMV. In another embodiment, the virus is aliver sackievirus (e.g., coxsackievirus B3). In other embodiments, trophic virus. In an alternative embodiment, the virus is not a the virus is not a coxsackievirus (e.g., coxsackievirus B3). In liver trophic virus. In another embodiment, the virus is a some embodiments, the virus is a rhinovirus. In other embodi hepatitis virus. In an alternate embodiment, the virus is not a 65 ments, the virus is not a rhinovirus. In certain embodiments, hepatitis virus. In another embodiment, the virus is a hepatitis the virus is a human papillomavirus (HPV). In other embodi C virus. In a further alternative embodiment, the virus is not ments, the virus is not a human papillomavirus. In certain US 9,029,413 B2 127 128 embodiments, the virus is a virus selected from the group 5x10 pfu/ml or more, 10 pfu/ml or more, 2.5x10 pfu/ml or consisting of the viruses listed in Tables 3 and 4. In other more, 5x10 pfu/ml or more, or 10 pfu/ml or more in a embodiments, the virus is not a virus selected from the group subject within 48 hours, 72 hours, or 1 week. In accordance consisting of the viruses listed in Tables 3 and 4. In one with these embodiments, the viral yield may be measured in embodiment, the virus is not one or more viruses selected 5 the infected tissue or serum. In a specific embodiment, the from the group consisting of the viruses listed in Tables 3 and Subject is immunocompetent. In another embodiment, the 4. Subject is immunocompromised or immunosuppressed. The antiviral activities of Compounds against any type, In some embodiments, the virus achieves a viral yield of 1 Subtype or strain of virus can be assessed. For example, the pfu or more, 10 pfu or more, 5x10" pfu or more, 10 pfu or antiviral activity of Compounds against naturally occurring 10 more, 5x10 pfu or more, 10 pfu or more, 2.5x10 pfu or strains, variants or mutants, mutagenized viruses, reassor more, 5x10 pfu or more, 10 pfu or more, 2.5x10 pfu or tants and/or genetically engineered viruses can be assessed. more, 5x10 pfu or more, or 10 pfu or more in a subject. In The lethality of certain viruses, the safety issues concern certain embodiments, the virus achieves a viral yield of 1 pfu ing working with certain viruses and/or the difficulty in work or more, 10 pfu or more, 5x10" pfu or more, 10 pfu or more, ing with certain viruses may preclude (at least initially) the 15 5x10 pfu or more, 10 pfu or more, 2.5x10 pfu or more, characterization of the antiviral activity of Compounds on 5x10 pfu or more, 10 pfu or more, 2.5x10 pfu or more, Such viruses. Under Such circumstances, other animal viruses 5x10 pfu or more, or 10 pfu or more in a subject within 4 that are representative of such viruses may be utilized. For hours, 6 hours, 8 hours, 12 hours, 16 hours, 24 hours, or 48 example, SIV may be used initially to characterize the anti hours. In certain embodiments, the virus achieves a viral yield viral activity of Compounds against HIV. Further, Pichinde of 1 pfu or more, 10 pfu or more, 10' pfu or more, 5x10" pfu virus may be used initially to characterize the antiviral activ or more, 10 pfu or more, 5x10 pfu or more, 10 pfu or more, ity of Compounds against Lassa fever virus. 2.5x10 pfu or more, 5x10 pfu or more, 10 pfu or more, In some embodiments, the virus achieves peak titer in cell 2.5x10 pfu or more, 5x10 pfu or more, or 10 pfu or more in culture or a subject in 4 hours or less, 6 hours or less, 8 hours a subject within 48 hours, 72 hours, or 1 week. In accordance or less, 12 hours or less, 16 hours or less, or 24 hours or less. 25 with these embodiments, the viral yield may be measured in In other embodiments, the virus achieves peak titers in cell the infected tissue or serum. In a specific embodiment, the culture or a subject in 48 hours or less, 72 hours or less, or 1 Subject is immunocompetent. In another embodiment, the week or less. In other embodiments, the virus achieves peak Subject is immunocompromised or immunosuppressed. titers after about more than 1 week. In accordance with these In some embodiments, the virus achieves a viral yield of 1 embodiments, the viral titer may be measured in the infected 30 infectious unit or more, 10 infectious units or more, 5x10' tissue or serum. infectious units or more, 10 infectious units or more, 5x10° In some embodiments, the virus achieves in cell culture a infectious units or more, 10 infectious units or more, 2.5x10 viral titer of 10 pfu/ml or more, 5x10 pfu/ml or more, 10 infectious units or more, 5x10 infectious units or more, 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml or more, infectious units or more, 2.5x10' infectious units or more, 5x10 pfu/ml or more, 107 pfu/ml or more, 5x107 pfu/ml or 35 5x10" infectious units or more, or 10 infectious units or more more, 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml in a Subject. In certain embodiments, the virus achieves a viral or more, 5x10 pfu/ml or more, or 10"pfu/ml or more. In yield of 1 infectious unit or more, 10 infectious units or more, certain embodiments, the virus achieves in cell culture a viral 5x10' infectious units or more, 10° infectious units or more, titer of 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml 5x10° infectious units or more, 10 infectious units or more, or more, 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10 40 2.5x10 infectious units or more, 5x10 infectious units or pfu/ml or more, 10 pfu/ml or more, 5x10 pfu/ml or more, more, 10 infectious units or more, 2.5x10"infectious units or 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10" infectious units or more, or 10 infectious units more, 5x10 pfu/ml or more, or 10'pfu/ml or more within 4 or more in a subject within 4 hours, 6 hours, 8 hours, 12 hours, hours, 6 hours, 8 hours, 12 hours, 16 hours, or 24 hours or less. 16 hours, 24 hours, or 48 hours. In certain embodiments, the In other embodiments, the virus achieves in cell culture a viral 45 virus achieves a viral yield of 1 infectious unit or more, 10 titer of 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml infectious units or more, 10' infectious units or more, 5x10' or more, 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10 infectious units or more, 10° infectious units or more, 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10 pfu/ml or more, infectious units or more, 10 infectious units or more, 2.5x10 10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml or infectious units or more, 5x10 infectious units or more, 10 more, 5x10 pfu/ml or more, or 10"pfu/mlor more within 48 50 infectious units or more, 2.5x10' infectious units or more, hours, 72 hours, or 1 week. 5x10"infectious units or more, or 10 infectious units or more In some embodiments, the virus achieves a viral yield of 1 in a subject within 48 hours, 72 hours, or 1 week. In accor pfu/ml or more, 10 pfu/ml or more, 5x10'pfu/mlor more, 10° dance with these embodiments, the viral yield may be mea pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml or more, Sured in the infected tissue or serum. In a specific embodi 2.5x10 pfu/ml or more, 5x10 pfu/ml or more, 10 pfu/ml or 55 ment, the Subject is immunocompetent. In another more, 2.5x10 pfu/ml or more, 5x10 pfu/ml or more, or 10 embodiment, the Subject is immunocompromised or immu pfu/ml or more in a subject. In certain embodiments, the virus nosuppressed. In a specific embodiment, the virus achieves a achieves a viral yield of 1 pfu/ml or more, 10 pfu/ml or more, yield of less than 10 infectious units. In other embodiments 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10 pfu/ml or the virus achieves a yield of 10 or more infectious units. more, 10 pfu/ml or more, 2.5x10 pfu/ml or more, 5x10 60 In some embodiments, the virus achieves a viral titer of 1 pfu/ml or more, 10 pfu/ml or more, 2.5x10 pfu/ml or more, infectious unit per ml or more, 10 infectious units per ml or 5x10 pfu/ml or more, or 10 pfu/ml or more in a subject more, 5x10' infectious units per ml or more, 10 infectious within 4 hours, 6 hours, 8 hours, 12 hours, 16 hours, 24 hours, units per ml or more, 5x10° infectious units per ml or more, or 48 hours. In certain embodiments, the virus achieves a viral 10 infectious units per ml or more, 2.5x10 infectious units yield of 1 pfu/ml or more, 10 pfu/ml or more, 10" pfu/ml or 65 per ml or more, 5x10 infectious units per ml or more, 10 more, 5x10 pfu/ml or more, 10 pfu/ml or more, 5x10° infectious units per ml or more, 2.5x10" infectious units per pfu/ml or more, 10 pfu/ml or more, 2.5x10 pfu/ml or more, ml or more, 5x10' infectious units per ml or more, or 10 US 9,029,413 B2 129 130 infectious units per ml or more in a Subject. In certain embodi specific embodiments, Compounds exhibit an activity profile ments, the virus achieves a viral titer of 10 infectious units per that is consistent with their ability to inhibit viral replication ml or more, 5x10' infectious units per ml or more, 10° infec while maintaining low toxicity with respect to eukaryotic tious units per ml or more, 5x10 infectious units per ml or cells, preferably mammalian cells. For example, the effect of more, 10 infectious units per ml or more, 2.5x10 infectious a Compound on the replication of a virus may be determined units per ml or more, 5x10 infectious units per ml or more, by infecting cells with different dilutions of a virus in the 10 infectious units per ml or more, 2.5x10" infectious units presence or absence of various dilutions of a Compound, and per ml or more, 5x10" infectious units per ml or more, or 10 assessing the effect of the Compound on, e.g., viral replica infectious units per ml or more in a Subject within 4 hours, 6 tion, viral genome replication, and/or the synthesis of viral hours, 8 hours, 12 hours, 16 hours, 24 hours, or 48 hours. In 10 proteins. Alternatively, the effect of a Compound on the rep certain embodiments, the virus achieves a viral titer of 1 lication of a virus may be determined by contacting cells with infectious unit per mL or more, 10 infectious units per ml or various dilutions of a Compound or a placebo, infecting the more, 5x10' infectious units per ml or more, 10 infectious cells with different dilutions of a virus, and assessing the units per ml or more, 5x10° infectious units per ml or more, effect of the Compound on, e.g., viral replication, viral 10 infectious units per mL or more, 2.5x10 infectious units 15 genome replication, and/or the synthesis of viral proteins. per ml or more, 5x10 infectious units per ml or more, 10 Altered viral replication can be assessed by, e.g., plaque for infectious units per ml or more, 2.5x10" infectious units per mation. The production of viral proteins can be assessed by, ml or more, 5x10' infectious units per ml or more, or 10 e.g., ELISA, Western blot, or flow cytometry analysis. The infectious units per ml or more in a subject within 48 hours, 72 production of viral nucleic acids can be assessed by, e.g., hours, or 1 week. In accordance with these embodiments, the RT-PCR, PCR, Northern blot analysis, or Southern blot. viral titer may be measured in the infected tissue or serum. In In certain embodiments, Compounds reduce the replica a specific embodiment, the Subject is immunocompetent. In tion of a virus by approximately 10%, preferably 15%, 25%, another embodiment, the Subject is immunocompromised or 30%, 45%, 50%, 60%, 75%, 95% or more relative to a nega immunosuppressed. In a specific embodiment, the virus tive control (e.g., PBS, DMSO) in an assay described herein achieves a titer of less than 10 infectious units per ml. In 25 or others known to one of skill in the art. In some embodi some embodiments, the virus achieves 10 or more infectious ments, Compounds reduce the replication of a virus by about units per ml. at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 In some embodiments, the virus infects a cell and pro fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, duces, 10' or more, 2.5x10" or more, 5x10" or more, 7.5x10' 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, 500 fold, or 1000 or more, 10° or more, 2.5x10° or more, 5x10° or more, 7.5x 30 fold relative to a negative control (e.g., PBS, DMSO) in an 10° or more, 10 or more, 2.5x10 or more, 5x10 or more, assay described herein or others known to one of skill in the 7.5x10 or more, 10 or more, 2.5x10" or more, 5x10" or art. In other embodiments, Compounds reduce the replication more, 7.5x10" or more, or 10 or more viral particles per cell. of a virus by about at least 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, In certain embodiments, the virus infects a cell and produces 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 or more, 10" or more, 2.5x10" or more, 5x10" or more, 35 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 7.5x10" or more, 10° or more, 2.5x10° or more, 5x10° or to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 more, 7.5x10° or more, 10 or more, 2.5x10 or more, 5x10 fold relative to a negative control (e.g., PBS, DMSO) in an or more, 7.5x10 or more, 10 or more, 2.5x10" or more, assay described herein or others known to one of skill in the 5x10" or more, 7.5x10" or more, or 10 or more viral particles art. In other embodiments, Compounds reduce the replication per cell within 4 hours, 6 hours, 8 hours, 12 hours, 16 hours, 40 of a virus by about 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 or 24 hours. In other embodiments, the virus infects a cell and logs, 4 logs, 4.5 logs, 5 logs or more relative to a negative produces 10 or more, 10' or more, 2.5x10" or more, 5x10" or control (e.g., PBS, DMSO) in an assay described herein or more, 7.5x10" or more, 10° or more, 2.5x10° or more, 5x10 others known to one of skill in the art. In accordance with or more, 7.5x10° or more, 10 or more, 2.5x10 or more, these embodiments, such Compounds may be further 5x10 or more, 7.5x10 or more, 10 or more, 2.5x10" or 45 assessed for their safety and efficacy in assays such as those more, 5x10" or more, 7.5x10" or more, or 10 or more viral described in Section 5.4, infra. particles per cell within 48 hours, 72 hours, or 1 week. In certain embodiments, Compounds reduce the replica In other embodiments, the virus is latent for a period of tion of a viral genome by approximately 10%, preferably about at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 15%, 25%, 30%, 45%, 50%, 60%, 75%, 95% or more relative days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 50 to a negative control (e.g., PBS, DMSO) in an assay described days, or 15 days. In another embodiment, the virus is latent herein or others known to one of skill in the art. In some for a period of about at least 1 week, or 2 weeks, 3 weeks, 4 embodiments, Compounds reduce the replication of a viral weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, or 10 genome by about at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, weeks. In a further embodiment, the virus is latent for a period 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, of about at least 1 month, 2 months, 3 months, 4 months, 5 55 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, months, 6 months, 7 months, 8 months, 9 months, 10 months, 500 fold, or 1000 fold relative to a negative control (e.g., PBS, or 11 months. In yet another embodiment, the virus is latent DMSO) in an assay described herein or others known to one for a period of about at least 1 year, 2 years, 3 years, 4 years, of skill in the art. In other embodiments, Compounds reduce 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, the replication of a viral genome by about at least 1.5 to 3 fold, 12 years, 13 years, 14 years, or 15 years. In some embodi 60 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 ments, the virus is latent for a period of greater than 15 years. to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 5.4.2 In Vitro Assays to Detect Antiviral Activity fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to The antiviral activity of Compounds may be assessed in 1000 fold, or 10 to 1000 fold relative to a negative control various in vitro assays described herein or others known to (e.g., PBS, DMSO) in an assay described herein or others one of skill in the art. Non-limiting examples of the viruses 65 known to one of skill in the art. In other embodiments, Com that can be tested for Compounds with antiviral activities pounds reduce the replication of a viral genome by about 1 against Such viruses are provided in Section 5.4.1, Supra. In log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, US 9,029,413 B2 131 132 5 logs or more relative to a negative control (e.g., PBS, fold or more inhibition/reduction of viral yield per round of DMSO) in an assay described herein or others known to one viral replication. In certain embodiments, Compounds result in about a 2 fold or more reduction inhibition/reduction of of skill in theart. In accordance with these embodiments, such viral yield per round of viral replication. In specific embodi Compounds may be further assessed for their safety and ments, Compounds result in about a 10 fold or more inhibi efficacy in assays Such as those described in Section 5.4, infra. 5 tion/reduction of viral yield per round of viral replication. In certain embodiments, Compounds reduce the synthesis The in vitro antiviral assays can be conducted using any of viral proteins by approximately 10%, preferably 15%, eukaryotic cell, including primary cells and established cell 25%, 30%, 45%, 50%, 60%, 75%, 95% or more relative to a lines. The cell or cell lines selected should be susceptible to negative control (e.g., PBS, DMSO) in an assay described infection by a virus of interest. Non-limiting examples of herein or others known to one of skill in the art. In some 10 mammalian cell lines that can be used in standard in vitro embodiments, Compounds reduce the synthesis of viral pro antiviral assays (e.g., viral cytopathic effect assays, neutral teins by approximately at least 1.5 fold, 2, fold, 3 fold, 4 fold, red update assays, viral yield assay, plaque reduction assays) 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, for the respective viruses are set out in Table 5. TABLE 5 Examples of Mammalian Cell Lines in Antiviral Assays Virus cell line herpes simplex virus (HSV) primary fibroblasts (MRC-5 cells) Vero cells human cytomegalovirus (HCMV) primary fibroblasts (MRC-5 cells) Influenza Madin Darby canine kidney (MDCK) primary chick embryo chick kidney calf kidney African green monkey kidney (Vero) cells mink lung human respiratory epithelia cells hepatitis C virus Huh7 (or Huh7.7) primary human hepatocytes (PHH) immortalized human hepatocytes (IHH) HIV-1 MT-2 cells (T cells) Dengue virus Vero cells Measles virus African green monkey kidney (CV-1) cells SARS virus Wero 76 cells Respiratory syncytial virus African green monkey kidney (MA-104) cells Venezuelan equine encephalitis virus Vero cells West Nile virus Vero cells yellow fever virus Vero cells HHV-6 Cord Blood Lymphocytes (CBL) Human T cell lymphoblastoid cell lines (HSB-2 and SupT-1) B-cell lymphoma cell line (BCBL-1) umbilical cord blood lymphocytes

25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 Sections 5.4.2.1 to 5.4.2.7 below provide non-limiting fold, 500 fold, or 1000 fold relative to a negative control (e.g., examples of antiviral assays that can be used to characterize PBS, DMSO) in an assay described herein or others known to the antiviral activity of Compounds against the respective one of skill in the art. In other embodiments, Compounds 45 virus. One of skill in the art will know how to adapt the reduce the synthesis of viral proteins by approximately at methods described in Sections 5.4.2.1 to 5.4.2.7 to other least 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, viruses by, e.g., changing the cell system and viral pathogen, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 such as described in Table 5. fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 5.4.2.1 Viral Cytopathic Effect (CPE) Assay fold,500 to 1000 fold, or 10 to 1000 fold relative to a negative 50 CPE is the morphological changes that cultured cells control (e.g., PBS, DMSO) in an assay described herein or undergo upon being infected by most viruses. These morpho others known to one of skill in the art. In other embodiments, logical changes can be observed easily in unfixed, unstained Compounds reduce the synthesis of viral proteins by approxi cells by microscopy. Forms of CPE, which can vary depend mately 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 55 ing on the virus, include, but are not limited to, rounding of 4.5 logs, 5 logs or more relative to a negative control (e.g., the cells, appearance of inclusion bodies in the nucleus and/or PBS, DMSO) in an assay described herein or others known to cytoplasm of infected cells, and formation of syncytia, or one of skill in the art. In accordance with these embodiments, polykaryocytes (large cytoplasmic masses that contain many such Compounds may be further assessed for their safety and nuclei). For adenovirus infection, crystalline arrays of aden efficacy in assays such as those described in Section 5.5, infra. 60 ovirus capsids accumulate in the nucleus to form an inclusion In some embodiments, Compounds result in about a 1.5 body. fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 The CPE assay can provide a measure of the antiviral effect fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 of a Compound. In a non-limiting example of such an assay, fold or more, 10 fold or more, 15 fold or more, 20 fold or Compounds are serially diluted (e.g. 1000, 500, 100, 50, 10, more, 25 fold or more, 30 fold or more, 35 fold or more, 40 65 1 g/ml) and added to 3 wells containing a cell monolayer fold or more, 45 fold or more, 50 fold or more, 60 fold or (preferably mammalian cells at 80-100% confluent) of a more, 70 fold or more, 80 fold or more, 90 fold or more, or 100 96-well plate. Within 5 minutes, viruses are added and the US 9,029,413 B2 133 134 plate sealed, incubated at 37°C. for the standard time period Volume of each Compound dilution prepared in 2x concen required to induce near-maximal viral CPE (e.g., approxi tration. In certain embodiments, final Compound concentra mately 48 to 120 hours, depending on the virus and multi tions between 0.03 ug/ml to 100 g/ml can be tested with a plicity of infection). CPE is read microscopically after a final agarose overlay concentration of 0.5%. The drug agar known positive control drug is evaluated in parallel with ose mixture is applied to each well in 2 ml volume and the Compounds in each test. Non-limiting examples of positives plates are incubated for three days, after which the cells are controls are ribavirin for dengue, influenza, measles, respira stained with a 1.5% solution of neutral red. At the end of the tory syncytial, parainfluenza, Pichinde, Punta Toro and Ven 4-6 hour incubation period, the neutral red solution is aspi eZuelan equine encephalitis viruses; cidofovir for adenovirus; rated, and plaques counted using a stereomicroscope. Alter pirodovir for rhinovirus; 6-azauridine for West Nile and yel 10 natively, a final agarose concentration of 0.4% can be used. In low fever viruses; and alferon (interferon C.-n3) for SARS other embodiments, the plates are incubated for more than virus. The data are expressed as 50% effective concentrations three days with additional overlays being applied on day four or approximated virus-inhibitory concentration, 50% end and on day 8 when appropriate. In another embodiment, the point (EC50) and cell-inhibitory concentration, 50% end overlay medium is liquid rather than semi-solid. point (IC50). General selectivity index (“SI) is calculated as 15 5.4.2.5 Virus Titer Assay the IC50 divided by the EC50. These values can be calculated In this non-limiting example, a monolayer of the target using any method known in the art, e.g., the computer soft mammalian cell line is infected with different amounts (e.g., ware program MacSynergy II by M. N. Prichard, K. R. Asal multiplicity of 3 plaque forming units (pfu) or 5 pful) of virus tine, and C. Shipman, Jr., University of Michigan, Ann Arbor, (e.g., HCMV or HSV) and subsequently cultured in the pres Mich. ence or absence of various dilutions of Compounds (e.g., 0.1 In one embodiment, a Compound has an SI of greater than ug/ml, 1 g/ml, 5ug/ml, or 10 ug/ml). Infected cultures are 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or harvested 48 hours or 72 hours post infection and titered by 14, or 15, or 20, or 21, or 22, or 23, or 24, or 25, or 30, or 35, standard plaque assays known in the art on the appropriate or 40, or 45, or 50, or 60, or 70, or 80, or 90, or 100, or 200, or target cell line (e.g., Vero cells, MRC5 cells). In certain 300, or 400, or 500, 1,000, or 10,000. In some embodiments, 25 embodiments, culturing the infected cells in the presence of a Compound has an SI of greater than 10. In a specific Compounds reduces the yield of infectious virus by at least embodiment, Compounds with an SI of greater than 10 are 1.5 fold, 2, fold, 3, fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 further assessed in other in vitro and in vivo assays described fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, herein or others known in the art to characterize safety and 45 fold, 50 fold, 100 fold, 500 fold, or 1000 fold relative to efficacy. 30 culturing the infected cells in the absence of Compounds. In 5.4.2.2 Neutral Red (NR) Dye Uptake Assay a specific embodiment, culturing the infected cells in the The NRDye Uptake assay can be used to validate the CPE presence of Compounds reduces the PFU/ml by at least 10 inhibition assay (See Section 5.4.2.1). In a non-limiting fold relative to culturing the infected cells in the absence of example of such an assay, the same 96-well microplates used Compounds. for the CPE inhibition assay can be used. Neutral red is added 35 In certain embodiments, culturing the infected cells in the to the medium, and cells not damaged by virus take up a presence of Compounds reduces the yield of infectious virus greater amount of dye. The percentage of uptake indicating by at least 0.5 log 10, 1 log 10, 1.5 log 10, 2 log 10, 2.5 log 10, viable cells is read on a microplate autoreader at dual wave 3 log 10, 3.5 log 10, 4 log 10, 4.5 log 10, 5 log 10, 5.5 log 10, lengths of 405 and 540 nm, with the difference taken to 6 log 10, 6.5 log 10, 7 log 10, 7.5 log 10, 8 log 10, 8.5 log 10, eliminate background. (See McManus et al., Appl. Environ 40 or 9 log 10 relative to culturing the infected cells in the ment. Microbiol. 31:35-38, 1976). An EC50 is determined for absence of Compounds. In a specific embodiment, culturing samples with infected cells and contacted with Compounds, the infected cells in the presence of Compounds reduces the and an IC50 is determined for samples with uninfected cells yield of infectious virus by at least 1 log 10 or 2 log 10 relative contacted with Compounds. to culturing the infected cells in the absence of Compounds. 5.4.2.3 Virus Yield Assay 45 In another specific embodiment, culturing the infected cells in Lysed cells and Supernatants from infected cultures such as the presence of Compounds reduces the yield of infectious those in the CPE inhibition assay (See section 5.3.2.1) can be virus by at least 2 log 10 relative to culturing the infected cells used to assay for virus yield (production of viral particles after in the absence of Compounds. the primary infection). In a non-limiting example, these 5.4.2.6 Flow Cytometry Assay Supernatants are serial diluted and added onto monolayers of 50 Flow cytometry can be utilized to detect expression of susceptible cells (e.g., Vero cells). Development of CPE in virus antigens in infected target cells cultured in the presence these cells is an indication of the presence of infectious or absence of Compounds (See, e.g., McSharry et al., Clinical viruses in the supernatant. The 90% effective concentration Microbiology Rev., 1994, 7:576-604). Non-limiting (EC90), the test compound concentration that inhibits virus examples of viral antigens that can be detected on cell Sur yield by 1 logo, is determined from these data using known 55 faces by flow cytometry include, but are not limited to gB, gC, calculation methods in the art. In one embodiment, the EC90 gC, and gE of HSV: E protein of Japanese encephalitis; virus of Compound is at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, gp52 of mouse mammary tumor virus; gp of varicella-Zoster 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 30 fold, 40 fold, virus; gB of HCMV; gp160/120 of HIV: HA of influenza: or 50 fold less than the EC90 of the negative control sample. gp110/60 of HHV-6; and H and F of measles virus. In other 5.4.2.4 Plaque Reduction Assay 60 embodiments, intracellular viral antigens or viral nucleic acid In a non-limiting example of Such an assay, the virus is can be detected by flow cytometry with techniques known in diluted into various concentrations and added to each well the art. containing a monolayer of the target mammalian cells in 5.4.2.7 Genetically Engineered Cell Lines for Antiviral triplicate. The plates are then incubated for a period of time to Assays achieve effective infection of the control sample (e.g., 1 hour 65 Various cell lines for use in antiviral assays can be geneti with shaking every fifteen minutes). After the incubation cally engineered to render them more suitable hosts for viral period, an equal amount of 1% agarose is added to an equal infection or viral replication and more convenient Substrates US 9,029,413 B2 135 136 for rapidly detecting virus-infected cells (See, e.g., Olivo, P. VCA production without toxicity will be tested for their abil D., Clin. Microbiol. Rev., 1996, 9:321-334). In some aspects, ity to inhibit EBV DNA synthesis. these cell lines are available for testing the antiviral activity of For assays with HSV, the BHKICP6LacZ cell line, which Compound on blocking any step of viral replication, such as, was stably transformed with the E. coli lacz gene under the transcription, translation, pregenome encapsidation, reverse transcriptional control of the HSV-1 UL39 promoter, can be transcription, particle assembly and release. Nonlimiting used (See Stabellet al., 1992, Methods 38:195-204). Infected examples of genetically engineered cells lines for use in anti cells are detected using B-galactosidase assays known in the viral assays with the respective virus are discussed below. art, e.g., colorimetric assay. HepG2-2.2.15 is a stable cell line containing the hepatitis B Standard antiviral assays for influenza virus has been virus (HBV) ayw strain genome that is useful in identifying 10 described, See, e.g., Sidwell et al., Antiviral Research, 2000, and characterizing Compounds blocking any step of viral 48:1-16. These assays can also be adapted for use with other replication, such as, transcription, translation, pregenome viruses. encapsidation, reverse transcription, particle assembly and release. In one aspect, Compounds can be added to HepG2 5.5 Characterization of Safety and Efficacy of 2.2.15 culture to test whether Compound will reduce the 15 Compounds production of secreted HBV from cells utilizing real time quantitative PCR (TaqMan) assay to measure HBV DNA The safety and efficacy of Compounds can be assessed copies. Specifically, confluent cultures of HepG2-2.2.15 cells using technologies known to one of skill in the art. Sections cultured on 96-well flat-bottomed tissue culture plates and are 5.5.1 and 5.5.2 below provide non-limiting examples of cyto treated with various concentration of daily doses of Com toxicity assays and animal model assays, respectively, to pounds. HBV virion DNA in the culture medium can be characterize the safety and efficacy of Compounds. In certain assessed 24 hours after the last treatment by quantitative blot embodiments, the cytotoxicity assays described in Section hybridization or real time quantitative PCR (TaqMan) assay. 5.5.1 are conducted following the in vitro antiviral assays Uptake of neutral red dye (absorbance of internalized dye at described in Section 5.4, supra. In other embodiments, the 510 nM A510) can be used to determine the relative level of 25 cytotoxicity assays described in Section 5.5.1 are conducted toxicity 24 hours following the last treatment. Values are before or concurrently with the in vitro antiviral assays presented as a percentage of the average A510 values for described in Section 5.4, supra. separate cultures of untreated cells maintained on the same In some embodiments, Compounds differentially affect the plate. Intracellular HBV DNA replication intermediates can viability of uninfected cells and cells infected with virus. The be assessed by quantitative Southern blot hybridization. 30 differential effect of a Compound on the viability of virally Intracellular HBV particles can be isolated from the treated infected and uninfected cells may be assessed using tech HepG2-2.2.15 cells and the pregenomic RNA examined by niques such as those described in Section 5.5.1, infra, or other Southern blot analysis. ELISAs can be used to quantify the techniques known to one of skill in the art. In certain embodi amounts of the HBV envelope protein, surface antigen (HB ments, Compounds are more toxic to cells infected with a SAg), and secreted e-antigen (HBeAg) released from cul 35 virus than uninfected cells. In specific embodiments, Com tures. Lamivudine (3TC) can be used as a positive assay pounds preferentially affect the viability of cells infected with control. (See Korba & Gerin, Antivir. Res. 19:55-70, 1992). a virus. Without being bound by any particular concept, the In one aspect, the cell line Huh? ET (luc-ubi-neo/ET), differential effect of a Compound on the viability of unin which contains a new HCV RNA replicon with a stable fected and virally infected cells may be the result of the luciferase (LUC) reporter, can be used to assay Compounds 40 Compound targeting a particular enzyme or protein that is antiviral activity against hepatitis C viral replication (See differentially expressed or regulated or that has differential Krieger, N. V. Lohmann, and R. Bartenschlager J. Virol. activities in uninfected and virally infected cells. For 2001, 75:4614-4624). The activity of the LUC reporter is example, viral infection and/or viral replication in an infected directly proportional to HCV RNA levels and positive control host cells may alter the expression, regulation, and/or activi antiviral compounds behave comparably using either LUC or 45 ties of enzymes and/or proteins. Accordingly, in some RNA endpoints. Subconfluent cultures of Huh? ET cells are embodiments, other Compounds that target the same enzyme, plated onto 96-well plates, Compounds are added to the protein or metabolic pathway are examined for antiviral activ appropriate wells the next day, and the samples as well as the ity. In other embodiments, congeners of Compounds that positive (e.g., human interferon-alpha2b) and negative con differentially affect the viability of cells infected with virus trol samples are processed 72 hr later when the cells are still 50 are designed and examined for antiviral activity. Non-limiting subconfluent. The HCV RNA levels can also be assessed examples of antiviral assays that can be used to assess the using quantitative PCR (TaqMan). In some embodiments, antiviral activity of Compound are provided in Section 5.4, Compounds reduce the LUC signal (or HCV RNA levels) by Supra. 20%, 35%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 5.5.1 Cytotoxicity Studies 70%, 75%, 80%, 90%, or 95% or more relative to the 55 In a preferred embodiment, the cells are animal cells, untreated sample controls. In a preferred embodiment, Com including primary cells and cell lines. In some embodiments, pounds reduce the LUC signal (or HCV RNA levels) by 50% the cells are human cells. In certain embodiments, cytotoxic or more relative to the untreated cell controls. Other relevant ity is assessed in one or more of the following cell lines: cell culture models to study HCV have been described, e.g., U937, a human monocyte cell line; primary peripheral blood See Durantel et al., J. Hepatology, 2007, 46:1-5. 60 mononuclear cells (PBMC); Huh?, a human hepatoblastoma The antiviral effect of Compound can be assayed against cell line; 293T, a human embryonic kidney cell line; and EBV by measuring the level of viral capsid antigen (VCA) THP-1, monocytic cells. Other non-limiting examples of cell production in Daudi cells using an ELISA assay. Various lines that can be used to test the cytotoxicity of Compounds concentrations of Compounds are tested (e.g., 50 mg/ml to are provided in Table 5. 0.03 mg/ml), and the results obtained from untreated and 65 Many assays well-known in the art can be used to assess Compound treated cells are used to calculate an EC50 value. viability of cells (infected or uninfected) or cell lines follow Selected compounds that have good activity against EBV ing exposure to a Compound and, thus, determine the cyto US 9,029,413 B2 137 138 toxicity of the Compound. For example, cell proliferation can targets such agents to the site of affected tissue in order to be assayed by measuring Bromodeoxyuridine (BrdU) incor minimize potential damage to uninfected cells and, thereby, poration (See, e.g., Hoshino et al., 1986, Int. J. Cancer 38. reduce side effects. 369; Campana et al., 1988, J. Immunol. Meth. 107:79), (3H) The data obtained from the cell culture assays and animal thymidine incorporation (See, e.g., Chen, J., 1996. Oncogene 5 studies can be used in formulating a range of dosage of a 13:1395-403; Jeoung, J., 1995, J. Biol. Chem. 270: 1836773), Compound identified in accordance with the invention for use by direct cell count, or by detecting changes in transcription, in humans. The dosage of such agents lies preferably within a translation or activity of known genes Such as proto-onco range of circulating concentrations that include the ED50 genes (e.g., fos, myc) or cell cycle markers (Rb, cdc2, cyclin with little or no toxicity. The dosage may vary within this 10 range depending upon the dosage form employed and the A, D1, D2, D3, E, etc). The levels of such protein and mRNA route of administration utilized. For any agent used in the and activity can be determined by any method well known in method of the invention, the therapeutically effective dose the art. For example, protein can be quantitated by known can be estimated initially from cell culture assays. A dose may immunodiagnostic methods such as ELISA, Western blotting be formulated in animal models to achieve a circulating or immunoprecipitation using antibodies, including commer 15 plasma concentration range that includes the IC50 (i.e., the cially available antibodies. mRNA can be quantitated using concentration of the test compound that achieves a half-maxi methods that are well known and routine in the art, for mal inhibition of symptoms) as determined in cell culture. example, using northern analysis, RNase protection, or poly Such information can be used to more accurately determine merase chain reaction in connection with reverse transcrip useful doses in humans. Levels in plasma may be measured, tion. Cell viability can be assessed by using trypan-blue stain- 20 for example, by high-performance liquid chromatography. ing or other cell death or viability markers known in the art. In Additional information concerning dosage determination is a specific embodiment, the level of cellular ATP is measured provided in Section 5.7.4, infra. to determined cell viability. 5.5.2 Animal Models In specific embodiments, cell viability is measured in Compounds and compositions are preferably assayed in three-day and seven-day periods using an assay standard in 25 vivo for the desired therapeutic or prophylactic activity prior the art, such as the CelTiter-Glo Assay Kit (Promega) which to use in humans. For example, in vivo assays can be used to measures levels of intracellular ATP. A reduction in cellular determine whether it is preferable to administer a Compound ATP is indicative of a cytotoxic effect. In another specific and/or another therapeutic agent. For example, to assess the embodiment, cell viability can be measured in the neutral red use of a Compound to prevent a viral infection, the Com uptake assay. In other embodiments, visual observation for 30 pound can be administered before the animal is infected with morphological changes may include enlargement, granular the virus. In another embodiment, a Compound can be admin ity, cells with ragged edges, a filmy appearance, rounding, istered to the animal at the same time that the animal is infected with the virus. To assess the use of a Compound to detachment from the surface of the well, or other changes. treat or manage a viral infection, in one embodiment, the These changes are given a designation of T (100% toxic), 35 Compound is administered after a viral infection in the ani PVH (partially toxic very heavy 80%), PH (partially mal. In another embodiment, a Compound is administered to toxic heavy—60%), P (partially toxic-40%), Ps (partially the animal at the same time that the animal is infected with the toxic—slight—20%), or 0 (no toxicity—0%), conforming to virus to treat and/or manage the viral infection. In a specific the degree of cytotoxicity seen. A 50% cell inhibitory (cyto embodiment, the Compound is administered to the animal toxic) concentration (IC50) is determined by regression 40 more than one time. analysis of these data. Compounds can be tested for antiviral activity against virus Compounds can be tested for in vivo toxicity in animal in animal models systems including, but are not limited to, models. For example, animal models, described herein and/or rats, mice, chicken, cows, monkeys, pigs, goats, sheep, dogs, others known in the art, used to test the antiviral activities of rabbits, guinea pigs, etc. In a specific embodiment of the Compounds can also be used to determine the in vivo toxicity 45 invention, Compounds are tested in a mouse model system. of these Compounds. For example, animals are administered Such model systems are widely used and well-known to the a range of concentrations of Compounds. Subsequently, the skilled artisan. animals are monitored over time for lethality, weight loss or Animals are infected with virus and concurrently or sub failure to gain weight, and/or levels of serum markers that sequently treated with a Compound or placebo. Samples may be indicative of tissue damage (e.g., creatine phospho- 50 obtained from these animals (e.g., serum, urine, sputum, kinase level as an indicator of general tissue damage, level of semen, saliva, plasma, or tissue sample) can be tested for viral glutamic oxalic acid transaminase or pyruvic acid transami replication via well known methods in the art, e.g., those that nase as indicators for possible liver damage). These in vivo measure altered viral replication (as determined, e.g., by assays may also be adapted to test the toxicity of various plaque formation) or the production of viral proteins (as administration mode and/or regimen in addition to dosages. 55 determined, e.g., by Western blot, ELISA, or flow cytometry The toxicity and/or efficacy of a Compound in accordance analysis) or viral nucleic acids (as determined, e.g., by RT with the invention can be determined by standard pharmaceu PCR, northern blot analysis or southern blot). For quantita tical procedures in cell cultures or experimental animals, e.g., tion of virus in tissue samples, tissue samples are homog for determining the LD50 (the dose lethal to 50% of the enized in phosphate-buffered saline (PBS), and dilutions of population) and the ED50 (the dose therapeutically effective 60 clarified homogenates are adsorbed for 1 hour at 37°C. onto in 50% of the population). The dose ratio between toxic and monolayers of cells (e.g., Vero, CEF or MDCK cells). In other therapeutic effects is the therapeutic index and it can be assays, histopathologic evaluations are performed after infec expressed as the ratio LD50/ED50. A Compound identified in tion, preferably evaluations of the organ(s) the virus is known accordance with the invention that exhibits large therapeutic to target for infection. Virus immunohistochemistry can be indices is preferred. While a Compound identified in accor- 65 performed using a viral-specific monoclonal antibody. Non dance with the invention that exhibits toxic side effects may limiting exemplary animal models described below (Sections be used, care should be taken to design a delivery system that 5.5.2.1-5.5.2.5) can be adapted for other viral systems. US 9,029,413 B2 139 140 The effect of a Compound on the virulence of a virus can plaque assays with human foreskin fibroblasts (HFFs). Sta also be determined using in Vivo assays in which the titer of tistical analysis is then carried out to calculate significance the virus in an infected Subject administered a Compound, the (i.e., a P value of 0.05 or less). length of survival of an infected subject administered a Com Guinea pig models of CMV to study antiviral agents have pound, the immune response in an infected Subject adminis 5 also been described. See, e.g., Bourne et al., Antiviral Res., tered a Compound, the number, duration and/or severity of 2000, 47:103-109; Bravo et al., Antiviral Res., 2003, 60:41 the symptoms in an infected Subject administered a Com 49; and Bravo et al., J. Infectious Diseases, 2006, 193:591 pound, and/or the time period before onset of one or more 597. symptoms in an infected Subject administered a Compound is 5.5.2.3 Influenza assessed. Techniques known to one of skill in the art can be 10 Animal models, such as ferret, mouse and chicken, devel used to measure Such effects. oped for use to test antiviral agents against influenza virus 5.5.2.1 Herpes Simplex Virus (HSV) have been described, See, e.g., Sidwell et al., Antiviral Res., Mouse models of herpes simplex virus type 1 or type 2 2000, 48:1-16; and McCauley et al., Antiviral Res., 1995, (HSV-1 or HSV-2) can be employed to assess the antiviral 27:179-186. For mouse models of influenza, non-limiting activity of Compounds in vivo. BALB/c mice are commonly 15 examples of parameters that can be used to assay antiviral used, but other Suitable mouse Strains that are susceptible can activity of Compounds administered to the influenza-infected also be used. Mice are inoculated by various routes with an mice include pneumonia-associated death, serum C.1-acid appropriate multiplicity of infection of HSV (e.g., 10 pfu of glycoprotein increase, animal weight, lung virus assayed by HSV-1 strain E-377 or 4x10 pful of HSV-2 strain MS) fol hemagglutinin, lung virus assayed by plaque assays, and his lowed by administration of Compounds and placebo. For i.p. topathological change in the lung. Statistical analysis is car inoculation, HSV-1 replicates in the gut, liver, and spleen and ried out to calculate significance (e.g., a P value of 0.05 or spreads to the CNS. For i.n. inoculation, HSV-1 replicates in less). the nasaopharynx and spreads to the CNS. Any appropriate Nasal turbinates and trachea may be examined for epithe route of administration (e.g., oral, topical, systemic, nasal), lial changes and subepithelial inflammation. The lungs may frequency and dose of administration can be tested to deter 25 be examined for bronchiolar epithelial changes and peribron mine the optimal dosages and treatment regimens using Com chiolar inflammation in large, medium, and Small or terminal pounds, optionally in combination with other therapies. bronchioles. The alveoli are also evaluated for inflammatory In a mouse model of HSV-2 genital disease, intravaginal changes. The medium bronchioles are graded on a scale of 0 inoculation of female Swiss Webster mice with HSV-1 or to 3+ as follows: 0 (normal: lined by medium to tall columnar HSV-2 is carried out, and vaginal swabs are obtained to evalu 30 epithelial cells with ciliated apical borders and basal pseu ate the effect of therapy on viral replication (See, e.g., Crute dostratified nuclei; minimal inflammation); 1+(epithelial et al., Nature Medicine, 2002, 8:386-391). For example, viral layer columnar and even in outline with only slightly titers by plaque assays are determined from the vaginal increased proliferation; cilia still visible on many cells); swabs. A mouse model of HSV-1 using SKI-1-1 mice, a strain 2+(prominent changes in the epithelial layer ranging from of immunocompetent hairless mice, to study cutaneous 35 attenuation to marked proliferation; cells disorganized and lesions is also described in the art (See, e.g., Crute et al., layer outline irregular at the luminal border); 3+(epithelial Nature Medicine, 2002, 8:386-391 and Bolgeret al., Antiviral layer markedly disrupted and disorganized with necrotic cells Res., 1997, 35:157-165). Guinea pig models of HSV have visible in the lumen; some bronchioles attenuated and others also been described, See, e.g., Chen et al., Virol. J. 2004 Nov. in marked reactive proliferation). 23, 1:11. Statistical analysis is carried out to calculate signifi 40 The trachea is graded on a scale of 0 to 2.5+ as follows: 0 cance (e.g., a P value of 0.05 or less). (normal: Lined by medium to tall columnar epithelial cells 5.5.2.2 HCMV with ciliated apical border, nuclei basal and pseudostratified. Since HCMV does not generally infect laboratory animals, Cytoplasm evident between apical border and nucleus. Occa mouse models of infection with murine CMV (MCMV) can sional Small focus with squamous cells); 1+(focal squamous be used to assay antiviral activity Compounds in vivo. For 45 metaplasia of the epithelial layer); 2+(diffuse Squamous example, a MCMV mouse model with BALB/c mice can be metaplasia of much of the epithelial layer, cilia may be evi used to assay the antiviral activities of Compounds in vivo dent focally); 2.5+(diffuse squamous metaplasia with very when administered to infected mice (See, e.g., Kern et al., few cilia evident). Antimicrob. Agents Chemother, 2004, 48:4745-4753). Tis Virus immunohistochemistry is performed using a viral Sue homogenates isolated from infected mice treated or 50 specific monoclonal antibody (e.g. NP-, N- or HN-specific untreated with Compounds are tested using standard plaque monoclonal antibodies). Staining is graded 0 to 3+ as follows: assays with mouse embryonic fibroblasts (MEFs). Statistical 0 (no infected cells); 0.5+(few infected cells); 1+(few analysis is then carried out to calculate significance (e.g., a P infected cells, as widely separated individual cells); 1.5+(few value of 0.05 or less). infected cells, as widely separated singles and in Small clus Alternatively, human tissue (i.e., retinal tissue or fetal thy 55 ters); 2+(moderate numbers of infected cells, usually affect mus and liver tissue) is implanted into SCID mice, and the ing clusters of adjacent cells in portions of the epithelial layer mice are subsequently infected with HCMV, preferably at the lining bronchioles, or in small sublobular foci in alveoli); site of the tissue graft (See, e.g., Kern et al., Antimicrob. 3+(numerous infected cells, affecting most of the epithelial Agents Chemother, 2004, 48:4745-4753). The pfu of HCMV layer in bronchioles, or widespread in large sublobular foci in used for inoculation can vary depending on the experiment 60 alveoli). and virus strain. Any appropriate routes of administration 5.5.2.4 Hepatitis (e.g., oral, topical, Systemic, nasal), frequency and dose of A HBV transgenic mouse model, lineage 1.3.46 (official administration can be tested to determine the optimal dosages designation, Tg HBV 1.3 genome Chi46) has been and treatment regimens using Compounds, optionally in described previously and can be used to test the in vivo combination with other therapies. Implant tissue homoge 65 antiviral activities of Compounds as well as the dosing and nates isolated from infected mice treated or untreated with administration regimen (See, e.g., Cavanaugh et al., J. Virol. Compounds at various time points are tested using standard 1997, 71:3236-3243; and Guidotti et al., J. Virol., 1995, US 9,029,413 B2 141 142 69:6158-6169). In these HBV transgenic mice, a high level of COR(R) RT-PCR assay (Roche Diagnostics, Branchberg, N.J.) viral replication occurs in liver parenchymal cells and in the to determine plasma viral load (HIV-1 RNA copies/ml); proximal convoluted tubules in the kidneys of these trans active HIV-1 virus replication assay where human lympho genic mice at levels comparable to those observed in the cytes recovered from infected Trimera mice were cocultured infected liver of patients with chronic HBV hepatitis. HBV with target T cells (MT-2 cells) and HIV-dependent syncytia transgenic mice that have been matched for age (i.e., 6-10 formation was examined; and human lymphocytes recovered weeks), sex (i.e., male), and levels of hepatitis B Surface from infected Trimera mice were cocultured with cMAGI antigen (HBSAg) in serum can be treated with Compounds or indicator cells, where HIV-1 LTR driven trans-activation of placebo followed by antiviral activity analysis to assess the B-galactosidase was measured. Levels of anti-HIV-1 antibod antiviral activity of Compounds. Non-limiting examples of 10 ies produced in these mice can also be measured by ELISA. assays that can be performed on these mice treated and Other established mouse models described in the art can also untreated with Compounds include Southern analysis to mea be used to test the antiviral activity of Compounds in vivo sure HBV DNA in the liver, quantitative reverse transcriptase (See, Mosier et al., Semin. Immunol., 1996, 8:255-262: PCR (qRT-PCR) to measure HBV RNA in liver, immunoas Mosier et al., Hosp. Pract. (Off Ed)., 1996, 31:41-48, 53-55, says to measure hepatitise antigen (HBeAg) and HBV Sur 15 59-60; Bonyhadi et al., Mol. Med. Today, 1997, 3:246-253; face antigen (HBSAg) in the serum, immunohistochemistry Jolicoeur et al., Leukemia, 1999, 13:S78-S80; Browning et to measure HBV antigens in the liver, and quantitative PCR al., Proc. Natl. Acad. Sci. USA, 1997, 94: 14637-14641; and (qPCR) to measure serum HBV DNA. Gross and microscopic Sawada et al., J. Exp. Med., 1998, 187:1439-1449). A simian pathological examinations can be performed as needed. immunodeficiency virus (SIV) nonhuman primate model has Various hepatitis C virus (HCV) mouse models described also been described (See Schito et al., Curr. HIV Res., 2006, in the art can be used in assessing the antiviral activities of 4:379-386). Compounds against HCV infection (See Zhu et al., Antimi crobial Agents and Chemother, 2006, 50:3260-3268: Bright 5.6 Pharmaceutical Compositions et al., Nature, 2005, 436:973-978; Hsu et al., Nat. Biotech nol., 2003, 21:519–525; Ilan et al., J. Infect. Dis. 2002, 185: 25 Any Compound described or incorporated by referenced 153-161; Kneteman et al., Hepatology, 2006, 43:1346-1353; herein may optionally be in the form of a composition com Mercer et al., Nat. Med., 2001, 7:927-933; and Wu et al., prising the Compound. Gastroenterology, 2005, 128:1416-1423). For example, mice In certain embodiments provided herein, compositions (in with chimeric human livers are generated by transplanting cluding pharmaceutical compositions) comprise a Com normal human hepatocytes into SCID mice carrying a plas 30 pound and a pharmaceutically acceptable carrier, excipient, minogen activator transgene (Alb-uPA) (See Mercer et al., or diluent. Nat. Med., 2001, 7:927-933). These mice can develop pro In other embodiments, provided herein are pharmaceutical longed HCV infections with high viral titers after inoculation compositions comprising an effective amount of a Compound with HCV (e.g., from infected human serum). Thus, these and a pharmaceutically acceptable carrier, excipient, or dilu mice can be administered a Compound or placebo prior to, 35 ent. The pharmaceutical compositions are suitable for Veteri concurrently with, or subsequent to HCV infection, and rep nary and/or human administration. lication of the virus can be confirmed by detection of nega The pharmaceutical compositions provided herein can be tive-strand viral RNA in transplanted livers or expression of in any form that allows for the composition to be administered HCV viral proteins in the transplanted hepatocyte nodules. to a Subject, said Subject preferably being an animal, includ The statistical significance of the reductions in the viral rep 40 ing, but not limited to a human, mammal, or non-human lication levels are determined. animal. Such as a cow, horse, sheep, pig, fowl, cat, dog. Another example of a mouse model of HCV involves mouse, rat, rabbit, guinea pig, etc., and is more preferably a implantation of the HuH7 cell line expressing a luciferase mammal, and most preferably a human. reporter linked to the HCV subgenome into SCID mice, sub In a specific embodiment and in this context, the term cutaneously or directly into the liver (See Zhu et al., Antimi 45 “pharmaceutically acceptable carrier, excipient or diluent crobial Agents and Chemother, 2006, 50:3260-3268). The means a carrier, excipient or diluent approved by a regulatory mice are treated with a Compound or placebo, and whole agency of the Federal or a state government or listed in the body imaging is used to detect and quantify bioluminescence U.S. Pharmacopeia or other generally recognized pharma signal intensity. Mice treated with a Compound that is effec copeia for use in animals, and more particularly in humans. tive against HCV have less bioluminescence signal intensity 50 The term “carrier refers to a diluent, adjuvant (e.g., Freund's relative to mice treated with placebo or a negative control. adjuvant (complete and incomplete)), excipient, or vehicle 5.5.2.5 HIV with which the therapeutic is administered. Such pharmaceu The safety and efficacy of Compounds against HIV can be tical carriers can be sterile liquids, Such as water and oils, assessed in vivo with established animal models well known including those of petroleum, animal, vegetable or synthetic in the art. For example, a Trimera mouse model of HIV-1 55 origin, Such as peanut oil, soybean oil, mineral oil, Sesame oil infection has been developed by reconstituting irradiated nor and the like. Water is a preferred carrier when the pharma mal BALB/c mice with murine SCID bone marrow and ceutical composition is administered intravenously. Saline engrafted human peripheral blood mononuclear cells (See Solutions and aqueous dextrose and glycerol Solutions can Ayash-Rashkovsky et al., FASEB J., 2005, 19:1149-1151). also be employed as liquid carriers, particularly for injectable These mice are injected intraperitoneally with T- and 60 Solutions. Examples of Suitable pharmaceutical carriers are M-tropic HIV-1 laboratory strains. After HIV infection, rapid described in “Remington’s Pharmaceutical Sciences” by E. loss of human CD4 T cells, decrease in CD4/CD8 ratio, and W. Martin. increased T cell activation can be observed. A Compound can Typical compositions and dosage forms comprise one or be administered to these mice and standard assays known in more excipients. Suitable excipients are well-known to those the art can be used to determine the viral replication capacity 65 skilled in the art of pharmacy, and non limiting examples of in animals treated or untreated with a Compound. Non-lim Suitable excipients include starch, glucose, lactose. Sucrose, iting examples of such assays include the COBAS AMPLI gelatin, malt, rice, flour, chalk, silica gel, Sodium Stearate,