Cryptic Diversity in Rodents from Costa Rica

Home , Barva Volcano, Habromys, Nephelomys, Oligoryzomys destructor, Oligoryzomys fornesi, Oligoryzomys fulvescens

Cryptic diversity in rodents from Costa Rica.

Sara María Cáceres Valdés Master’s in Biodiversity, Genetics and Evolution Department of Biology 2018/2019

Supervisor Joana Maria Jorge Pereira de Castro Paupério, Postdoctoral Researcher, CIBIO-InBIO Co-supervisor Paulo Célio Pereira Martins Alves, Associate Professor, Faculty of Sciences, Univeristy of Porto, CIBIO-InBIO

Todas as correções determinadas pelo júri, e só essas, foram efetuadas. O Presidente do Júri,

Porto, ______/______/______

FCUP i Cryptic diversity in rodents from Costa Rica

Acknowledgements

I would like to thank my wonderful supervisors for making this project being possible. A huge thanks to Paulo Célio, for welcome me in Portugal with open arms from the very beginning and for giving me the chance to be part of this interesting project where he co- supervised me and gave me a lot of support throughout the process. A very special thanks goes also to my supervisor Joana Paupério, for being so patient, for giving me great guidance and helping me when I needed the most. I feel so grateful to have worked with both.

To the CTM laboratory team, Maria and Patrícia, a big thank for sharing their valued knowledge in the laboratory field, for all patience and help provided. And thanks to Sofía for not have ‘hanged’ me when an important sample flew out of the tube with alcohol because of me during my training.

To my extraordinary classmates, thank you for all the meetings, typical meals, trips on the outskirts of Porto and all the good times we shared together, that made worth it to crossing over the Atlantic Ocean to spend this last 2 years. To Alexander Lépiz, for your valuable friendship in the short time we interact and to Sara Sampaio, for your kindness, support and availability to help me.

A very emotional thanks to my beloved Panamanian friends, Darwin, Anette and Estibali, without whom this adventure would not have been so epic. Also, my dear Vítor and his wonderful family that make me feel at home and helped me feel a bit less homesick at times.

My main and deepest thank goes to my MOTHER, without her support I would never have gotten where I am. Also, to my big sister Vlasty that together with mum form an important pillar of love and strength in my life (not forgetting our Benji). I also want to thank my father, for always supporting me as much as possible. I love you all Family!

FCUP ii Cryptic diversity in rodents from Costa Rica

Abstract

Mesoamerica is one of the most important biodiversity hotspots, sheltering high levels of endemism and species diversity. This region holds about 6% of the World’s mammal diversity, of which, approximately 180 species are rodents.

Within Mesoamerica, Costa Rica, is considered one of the 25 most biodiverse countries on the planet with the highest number of species per unit area. This country serves as corridor for diverse groups of mammals from the north to the south of the American continent. Therefore, the exchange of species between both regions, in addition to its topogeographical features, may have favoured crypic genetic diversity in some rodent groups as recent molecular studies and records of new species suggest.

Considering the limited knownledge on the diversity of small mammals in Costa Rica and the importance of cryptic species for biodiversity conservation, this study aimed to analyse the spatial patterns of genetic variability in some rodent species, where high diversity was previously detected.

Hence, 221 tissue samples from four genera of Cricetidae and one genus of Echimyidae were analysed. Of these, 15 were museum samples from the National Museum of Costa Rica and the Zoology Museum of the National University of Costa Rica. The genetic diversity was determined by amplifying two mitochondrial (cytb and COI) and two nuclear (IRBP and RAG1) genes.

Our results show high genetic diversity in all the genera analysed, congruent with the geographic distribution of the species in Costa Rica. Some of the recognised lineages show deep divergence, and may even correspond to new cryptic species.

This study describes cryptic diversity in small mammals from Costa Rica, highlighting the importance of this country for the conservation of biodiversity in Mesoamerica.

FCUP iii Cryptic diversity in rodents from Costa Rica

Keywords

Small mammals, cryptic species, mitochondrial DNA, nuclear DNA, genetic diversity, Mesoamerica.

FCUP iv Cryptic diversity in rodents from Costa Rica

Resumo

A Mesoamérica é uma das regiões do mundo com maior biodiversidade, albergando elevados níveis de endemismo e diversidade de espécies. Esta região detém cerca de 6% da diversidade de mamíferos ao nível mundial, incluindo aproximadamente 180 espécies de roedores.

Dentro da Mesoamérica, a Costa Rica é considerada um dos 25 países com maior biodiversidade do planeta, com o maior número de espécies por unidade de área. Este país constitui um corredor para diversos grupos de mamíferos do norte ao sul do continente americano. Deste modo, o intercambio de espécies entre as duas regiões, assim como as suas características topogeográficas, pode ter favorecido a diversidade genética críptica em alguns grupos de roedores, como sugerem alguns estudos moleculares e descrições recentes de novas espécies.

Considerando a escassez de conhecimento relativo à diversidade de pequenos mamíferos na Costa Rica e a importância da detecção de espécies crípticas para a conservação da biodiversidade, este estudo teve como objetivo principal o estudo dos padrões espaciais da variabilidade genética de alguns géneros das famílias Cricetidae e Echimyidae, nos quais tinha sido detectada recentemente elevada diversidade.

Assim, neste estudo foram analisadas 221 amostras de tecido de quatro géneros de Cricetidae e de um género de Echimyidae. Destas, 15 eram do Museu Nacional da Costa Rica e do Museu de Zoologia da Universidade Nacional da Costa Rica. Foram amplificados e sequenciados dois genes mitocondriais (cytb e COI) e dois genes nucleares (IRBP e RAG1), com o objetivo de analisar a diversidade genética desses géneros na região.

Os resultados obtidos permitiram detectar uma elevada diversidade genética em todos os géneros analisados, concordantes com a distribuição geográfica das espécies na Costa Rica. Algumas das linhagens identificadas apresentam uma elevada divergência podendo eventualmente corresponder a espécies crípticas.

Este estudo descreve a ocorrência de diversidade críptica em pequenos mamíferos na Costa Rica, salientado a importância deste país para a preservação da biodiversidade na Mesoamérica.

FCUP v Cryptic diversity in rodents from Costa Rica

Palavras chave

Pequenos mamíferos, espécies crípticas, ADN mitocondrial, ADN nuclear, diversidade genética, Mesoamérica.

FCUP vi Cryptic diversity in rodents from Costa Rica

Table of Contents

Acknowledgements ...... i Abstract ...... ii Keywords ...... iii Resumo...... iv Palavras chave ...... v Table of Contents ...... vi List of Tables ...... vii List of Figures ...... x 1. Introduction ...... 1 1.1. Costa Rica, a biodiversity hotspot ...... 1 1.2. New World rodent cryptic speciation ...... 3 1.2.1. Genus Oligoryzomys ...... 5 1.2.2. Genus Nyctomys...... 6 1.2.3. Genus Scotinomys ...... 7 1.2.4. Genus Reithrodontomys ...... 8 1.2.5. Genus Proechimys ...... 10 1.3. Molecular markers ...... 11 1.4. Objectives...... 13 2. Material and Methods ...... 14 2.1. Study area and sampling ...... 14 2.2. DNA extraction, amplification and sequencing ...... 15 2.2.1. Cytochrome b (cytb) ...... 15 2.2.2. Cytochrome c oxidase subunit I (COI) ...... 16 2.2.3. IRBP and RAG1 nuclear genes ...... 18 2.3. Phylogenetic analyses...... 19 3. Results ...... 21 3.1. Phylogenetic analyses...... 21 3.1.1. Genus Oligoryzomys ...... 21 3.1.2. Genus Nyctomys...... 26 3.1.3. Genus Scotinomys ...... 30 3.1.4. Genus Reithrodontomys ...... 34 3.1.5. Genus Proechimys ...... 39 5. References ...... 46 6. Supplementary material ...... 60

FCUP vii Cryptic diversity in rodents from Costa Rica

List of Tables

Table 1. List of rodents of the families Cricetidae and Echimyidae that currently occur Pg.5 in Costa Rica and surrounding area, according to Rodríguez-Hernández et al. (2014). Table 2. Genera, number of species and analysed samples using mitochondrial (Cytb Pg.14 and COI) and nuclear (RAG1 and IRBP) genes, with reference to the sampling sites Table 3. Primers used for amplification and sequencing of Cytb gene. Pg.16

Table 4. Primers pair and annealing temperature optimized in each genus for Cytb Pg.16 gene amplification. Table 5. Primers used for amplification and sequencing COI fragments B2 and LCn. Pg.17

Table 6. Primers used for amplification and sequencing COI fragment SFF. Pg.17

Table 7. Primers used for amplification and sequencing of IRBP and RAG1 genes Pg.18 respectively. Table 8. Primers pair and annealing temperature optimized in each genus for IRBP and Pg.19 RAG1 genes amplification. Table 9. Genetic indices for intraspecific diversity of the genus Oligoryzomys with COI Pg.22 mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: number of haplotypes; S: polimorphic sites; Hd: Haplotype diversity; π: nucleotide diversity. Table 10. Estimates of interspecific diversity between clades of the genus Oligoryzomys Pg.22 in the lower triangle for COI (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 11. Genetic indices for intraspecific diversity of the genus Oligoryzomys with IRBP Pg.22 nDNA sequences (541 bp) for each clade identified according to the Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 12. Estimates of interspecific diversity between clades of the genus Oligoryzomys Pg.23 in the lower triangle for IRBP sequences (541bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 13. Genetic indices for intraspecific diversity of the genus Oligoryzomys with Pg.23 RAG1 nDNA sequences (952 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: haplotype diversity; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 14. Estimates of interspecific diversity between clades of the genus Oligoryzomys Pg.23 in the lower triangle for RAG1 sequences (952 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 15. Genetic indices for intraspecific diversity of the genus Nyctomys with cytb Pg.27 mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: haplotype diversity; S: polimorphic sites; Hd: Haplotype diversity; π: nucleotide diversity. FCUP viii Cryptic diversity in rodents from Costa Rica

Table 16. Estimates of interspecific diversity between clades of the genus Nyctomys and Pg.27 outgroups in the lower triangle for cytb sequences (1040 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 17. Genetic indices for intraspecific diversity of the genus Nyctomys with COI Pg.27 mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: haplotype diversity; S: polimorphic sites; Hd: Haplotype diversity; π: nucleotide diversity. Table 18. Estimates of interspecific diversity between clades of the genus Nyctomys and Pg.27 outgroups in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 19. Genetic indices for intraspecific diversity of the genus Nyctomys with IRBP Pg.28 nDNA sequences (912 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 20. Estimates of interspecific diversity between clades of the genus Nyctomys in Pg.28 the lower triangle for IRBP sequences (921 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 21. Genetic indices for intraspecific diversity of the genus Scotinomys with cytb Pg.31 mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: number of haplotypes; S: polimorphic sites; Hd: Haplotype diversity; π: nucleotide diversity. Table 22. Estimates of interspecific diversity between clades of the genus Scotinomys in Pg.31 the lower triangle for cytb sequences (1140 bp). Upper triangle shows the standard error from 500 bootstrap. Table 23. Genetic indices for intraspecific diversity of the genus Scotinomys with COI Pg. 31 mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: number of haplotypes; S: polimorphic sites; Hd: Haplotype diversity; π: nucleotide diversity. Table 24. Estimates of interspecific diversity between clades of the genus Scotinomys in Pg. 31 the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 25. Genetic indices for intraspecific diversity of the genus Scotinomys with RAG1 Pg. 31 nDNA sequences (779 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 26. Estimates of interspecific diversity between clades of the genus Scotinomys in Pg. 32 the lower triangle for RAG1 (779 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 27. Genetic indices for intraspecific diversity of the genus Reithrodontomys with Pg. 34 cytb mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. FCUP ix Cryptic diversity in rodents from Costa Rica

Table 28. Estimates of interspecific diversity between clades of the genus Pg. 35 Reithrodontomys in the lower triangle for cytb sequences (1140 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 29. Genetic indices for intraspecific diversity of the genus Reithrodontomys with Pg.35 COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 30. Estimates of interspecific diversity between clades of the genus Pg.35 Reithrodontomys in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 31. Genetic indices for intraspecific diversity of the genus Reithrodontomys with Pg.35 RAG1 mtDNA sequences (1253 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 32. Estimates of interspecific diversity between clades of the genus Pg.36 Reithrodontomys in the lower triangle for RAG1 sequences (1253 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 33. Genetic indices for intraspecific diversity of the genus Proechimys with cytb Pg.39 mtDNA sequences (1127 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 34. Estimates of interspecific diversity between clades of the genus Proechimys Pg.40 in the lower triangle for cytb sequences (1127 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Table 35. Genetic indices for intraspecific diversity of the genus Proechimys with COI Pg.40 mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 36. Estimates of interspecific diversity between clades of the genus Proechimys Pg.40 in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap. Table 37. Genetic indices for intraspecific diversity of the genus Proechimys with RAG1 Pg.40 mtDNA sequences (918 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity. Table 38. Estimates of interspecific diversity between clades of the genus Proechimys Pg.40 in the lower triangle for RAG1 sequences (918 bp). Upper triangle shows the standard error from 500 bootstrap. Table S1. Information of both mitochondrial and nuclear DNA sequences retrieved from Pg.60 GenBank and BOLD Systems for this research. Table S2. Information of small mammals sampled in Costa Rica. Pg.71

FCUP x Cryptic diversity in rodents from Costa Rica

List of Figures

Figure 1. Mesoamerican region according to Olguín-Monroy et al. (2013) pg.1 Figure 2. Distribution of the genus Oligoryzomys (obtained from https://www.gbif.org/) pg.6 Figure 3. Distribution of the genus Nyctomys, with a detailed view in Mesoamerica pg.7 (obtained from https://www.gbif.org/) Figure 4. Distribution of the genus Scotinomys, with a detailed view of Mesoamerica pg.8 (obtained from https://www.gbif.org/) Figure 5. Grouping of recognized species of the genus Reithrodontomys per subgenus; * = pg.9 Species found in Costa Rica Figure 6. Distribution of the genus Reithrodontomys (obtained from https://www.gbif.org/) pg.9 Figure 7. Distribution of the genus Proechimys (obtained from https://www.gbif.org/) pg.10 Figure 8. Map of Costa Rica depicting the collecting localities of different samples of pg.14 Cricetidae and Echimyidae available for analyses. Figure 9. COI Primer sets for DNA barcoding of small mammals from Costa Rica. pg.17 Figure 10. Bayesian inference tree for genus Oligoryzomys for COI gene (657 bp). Purple pg.24 branches represent our samples. Probabilities of major nodes are indicated. MX= Mexico; LAIP= La Amistad International Park, Costa Rica; GYVE= Guiana- Venezuela; BR= Brazil. Roman numbers represent the number of the clade. Outgroup: Oryzomys couesi. Figure 11. Bayesian inference tree for genus Oligoryzomys for COI gene (420 bp). Purple pg.25 branches represent our samples and museum samples are shown in red. Probabilities of major nodes are indicated. MX= Mexico; LAIP= La Amistad International Park, Costa Rica; GYVE= Guiana-Venezuela; BR= Brazil. Roman numbers represent the number of the clade. Outgroup: Oryzomys couesi. Figure 12. Gene haplotypes network from the genus Oligoryzomys. A) IRBP (541 bp), B) pg.25 IRBP (952 bp) and C) RAG1 (952bp). Squares represent different geographical regions. Figure 13. Bayesian inference tree for genus Nyctomys for cytb gene (1143 bp). Purple pg.28 branches represent our samples. Probabilities of major nodes are indicated. ESHN= El Salvador-Honduras; LAIP= La Amistad International Park, Costa Rica; SV= Selva Verde, Costa Rica; GU= Guatemala; MX= Mexico. Roman numbers represent the number of the clade. Outgroup: Tylomys nudicaudus Figure 14. Bayesian inference tree for genus Nyctomys for COI gene (657 bp). Purple pg.29 branches represent our samples and museum samples in red. Probabilities of major nodes are indicated. Were: ESGU= El Salvador-Guatemala; MVCR= Monteverde, Costa Rica; SV= Selva Verde, Costa Rica; GU= Guatemala. Roman numbers represent the number of the clade. Outgroup: Tylomys nudicaudus . Figure 15. IRBP (912 bp) haplotype network from the genus Nyctomys. pg.29 Figure 16. Bayesian inference tree for genus Scotinomys for cytb gene (1140 bp). Purple pg.33 branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. HN= Honduras; BCNP= Braulio Carrillo National Park, Costa Rica; LAIP= La Amistad International Park; CVI= Cartago Volcán Irazú, Costa Rica. Roman numbers represent the number of the clade. Outgroup: Reithrodontomys creper.

FCUP xi Cryptic diversity in rodents from Costa Rica

Figure 17. Bayesian inference tree for genus Scotinomys for COI gene (657 bp). Purple pg.33 branches represent our samples. Probabilities of major nodes are indicated. LAIP=La Amistad International Park, Costa Rica; CVI= Cartago, Volcán Irazú, Costa Rica; BCNP= Braulio Carrilo National Park; HN= Honduras; CR= Costa Rica; ESGUNIHN= El Salvador-Guatemala-Nicaragua-Honduras; SAES= Santa Ana, El Salvador; MX= Mexico. Roman numbers represent the number of clade. Outgroup: Reithrodontomys creper. Figure 18. RAG1 (779bp) haplotype network from the genus Scotinomys. pg.33 Figure 19. Bayesian inference tree for genus Reithrodontomys for cytb gene (1140 bp). pg.36 Purple branches represent our samples and museum samples are in red. LAIP= La Amistad International Park, Costa Rica; CVI= Cartago, Volcán Irazú, Costa Rica; BCNP= Braulio Carrilo National Park Probabilities of major nodes are indicated. Outgroup: Peromyscus mexicanus. Figure 20. Bayesian inference tree for genus Reithrodontomys for COI gene (658 bp). Purple pg.37 branches represent our samples and museum samples are in red. LAIP= La Amistad International Park, Costa Rica; CRNIES= Costa Rica-Nicaragua-El Salvador; CRMXGU= Costa Rica-Mexico-Guatemala; BCNP= Braulio Carrilo National Park; MXUSA= Mexico-United States; MX=Mexico; GU= Guatemala; USA= United States; NA= Not available. Probabilities of major nodes are indicated. Outgroup: Scotinomys teguina. Figure 21. A) RAG1 (1253 bp) and B) IRBP (894bp) haplotype networks from the genus pg.38 Reithrodontomys. Figure 22. Bayesian inference tree for genus Proechimys for COI gene (658 bp). Purple pg.41 branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. Outgroup: Hoplomys gymnurus. Figure 23. Bayesian inference tree for genus Proechimys for cytb gene (1127 bp). Purple pg.42 branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. Outgroup: Hoplomys gymnurus.

Figure 24. RAG1 (918 bp) haplotype network from the genus Proechimys. pg.42

FCUP xii Cryptic diversity in rodents from Costa Rica

List of Abbreviations

ALTMB Altamira, Amazonas, Brazil

AMV Amazonas, Venezuela

AR Argentina

ATH Atlántica, Lancetilla Botanical Garden, Honduras

BBWG Baramita, Barima-Waini, Guiana

BDC Base do Carmo, Sao Paulo, Brazil

BLP Boweron, La Lomita, Paraguay

BOLD Barcode of Life Data System

BPBC San Jose, Escazu, Base Of Pico Blanco, Costa Rica

BR Brazil

BVGU Baja Verapaz, Guatemala

CB Cerrado, Brazil

CCC Ciuddad Colón, Costa Rica

CCHR Cerro Chirripo, Costa Rica

CHM Chiapas, México

CJAB Cadeias do Jamari, Amazon, Brazil

CLCR Cartago, La Carpentera, Costa Rica

CMB Cochambamba, Bolivia

COI Cytochrome c Oxidase I

CPCM Campeche, Mexico

CPCR Estación Biológica Caño Palma, Tortuguero, Costa Rica

CR Costa Rica

CRT Cartago Proince, Costa Rica

CSAG Chimaltenango, Santa Apolonia, Guatemala

CSTC Cartago, Santa Cruz, Costa Rica

CVI Cartago, Volcán Irazú, Costa Rica

Cytb Cytochrome b

DNA Deoxyribonucleic Acid

EC Ecuador

ES El Salvador

ESNI Esteli, Nicaragua FCUP xiii Cryptic diversity in rodents from Costa Rica

FGY French Guiana

FVL Finca Vuelta Larga, Sucre, Venezuela

GBIF Global Biodiversity Information Facility

GDH Gracias a Dios, Honduras

GU Guatemala

GY Guiana

HCR 2 km N, 0.5 km E de Sacramento, Heredia, Costa Rica

HN Honduras

IRBP Interphotoreceptor Retinoid Binding Protein

JAB Jainu, Amazonas, Brazil

JCBNP Alajuela; Parque Nacionale Juan Castro Blanco, Costa Rica

LLCR Iintesección con La Lucha, Costa Rica

LNG Les Nouragues, French Guiana

MGB Minas Gerais, Brazil

MVCR Monteverde, Costa Rica

MX Mexico

NA Not available

Nam North America

NCBI National Center of Biotechnology Information

NI Nicaragua

OCH Olancho, Catacamas, Honduras

OICM Ometepe Island, Cerro Madera, NICARAGUA

OUS Oklahoma, USA

PACR Puntarenas, Costa Rica

PARF Pampa-Atlantic Rain Forest

PCD Portuguesa, Cano Delgadito, Venezuela

PCOA Chiriqui, Ojo De Agua, Panama

PCR Polymerase Chain Reaction

PGU Petén, Guatemala

PM Distrito Federal, Parres, Mexico

PMG Pic Matecho, French Guiana

PNAMH Comayagua, Parque Nacional Azul Meámbar, Honduras

PNMES National Park Montecristo, El Salvador

PSG Petit Saut, French Guiana FCUP xiv Cryptic diversity in rodents from Costa Rica

PTVE Pichincha, Tandayapa Valley, Ecuador

QRSM Quintana Roo, San Miguel, MEXICO

RAG1 Recombination Activating Gene 1

RN Río Negro, Argentina

RNI Rivas, Nicaragua

ROVC Reserva Oro Verde, San Josecito, Costa Rica

RVNP Quebrada Provición, Parque Nacional Rincón de la Vieja, Costa Rica

SAES Santa Ana, El Salvador

SCGU Sacatepequez, Guatemala

SEPA Santiago del Estero, Pellegrini, Argentina

SG Saül, French Guiana

SGCR San Gerardo, Costa Rica

SIGC San Isidro del General, Costa Rica

SJ San José, Costa Rica

SJMG Saint Jean du Maroni, French Guiana

SLMMG St-Laurent-du-Maroni, Maripasoula, French Guiana

SPCB Capao Bonito, Sao Paulo, Brazil

SPPB Pedreira, Sao Paulo, Brazil

SSES San Salvador, El Salvador

TBM Tabasco, Mexico

TDGB Terezina de Goias, Goias, Brazil

TLM Tamaulipas, Mexico

TMG Trinite Mountains, French Guiana

TTPB Tocantins, Tocantins,Parana, Brazil

USA United States of America

VBCR Varablanca, Costa Rica

VCM Veracruz, Mexico

VE Venezuela

VMC Villa Mills, Costa Rica

YLBM Yucatan, Laguna Becanchen, Mexico

YM Yucatan, Mexico

ZCGU Zacapa, Guatemala

FCUP 1 Cryptic diversity in rodents from Costa Rica

1. Introduction 1.1. Costa Rica, a biodiversity hotspot

Mesoamerica, extending from south-eastern Mexico to the countries of Central America (Figure 1), is a biodiversity hotspot (Myers et al. 2000) in which the levels of endemism and species diversity are most likely underestimated. Biologically, it is one of the most complex regions of the world (Almendra & Rogers 2012) occupying the second most important hotspot after the Tropical Andes (Myers et al. 2000). Its topography and biogeographic history involve relatively recent events of extensive diversification in situ due to climatic changes and geologic processes during the Great American Biotic Interchange (Stehli & Webb 1985; Cody et al. 2010) where Central America served as a species bridge between Nearctic and Neotropical biogeographic realms (Halffter 1987; Marshall & Liebherr 2000; Morrone 2010; Webb 2006).

Mesoamerica

Figure 1. Mesoamerican region according to Olguín-Monroy et al. (2013).

The Mesoamerican region has been considered to support more than 6% of the world’s mammalian diversity (Ceballos & Ehrlich 2006; Ceballos et al. 2002; Reid 2009). The environments ranging from low elevation savanna, semiarid scrub and humid tropical forests to montane systems that exceed 4000 m in elevation (Savage 1982) promote an area with high levels of diversification sheltering nearby 440 mammal species (León-Paniagua et al. 2007). The endemism of mammals in this region is mostly owing to the vast diversity of small mammals, encompassing 20 species of shrews and more than 180 species of rodents (León- Paniagua et al. 2007).

Furthermore, roughly 100 mammal species, approximately 30% of the total, are endemic to Central America (Jenkins & Giri 2008; Reid 2009), one of the youngest subregions FCUP 2 Cryptic diversity in rodents from Costa Rica

of the Neotropical realm founded by the formation of the Panamanian land bridge. At the specific level, Almendra and Rogers (2012) adduce Central America supports 69 endemic rodents, in 27 genera, including Isthmomys, Nyctomys, Otonyctomys, Ototylomys, Rheomys, Scotinomys, and Syntheosciurus. Besides, 14 bats (11 genera), 11 shrews (including 10 Cryptotis and one Sorex), four primates (two Alouatta, Ateles geoffroyi, and Saimiri oerstedii), four carnivores (two Bassaricyon, Bassariscus sumichrasti, and Procyon pygmaeus), three lagomorphs (two Sylvilagus and Lepus flavigularis), two marsupials (Marmosa mexicana and Marmosops invictus), and one sloth (Bradypus pygmaeus) are also endemic.

Relative to its land area, Costa Rica is internationally recognised for its abundant biodiversity (Gardner & Carleton 2009) supporting a high diversity of mammals compared to larger countries such as Mexico. This high richness is mostly attributable to its topogeographical features, the wide variety of habitats and ecosystems as well as the neotropical climate varying according to the altitudinal gradient (McCain 2004; Kluge et al. 2006), being considered the country with the highest density of biodiversity worldwide (Obando 2002). From the ecosystem point of view, cloud forests are the regions with the highest rate of endemism in Costa Rica (Obando 2002; Kohlmann et al. 2007), in this regard, endemic mammals are mostly found in this environments, mainly in the highlands. The number of rodent species herein are exceeded only by the order Chiroptera, being that, of the mammals in Costa Rica, 114 species are Chiroptera and 47 Rodentia (Rodríguez-Herrera et al. 2014).

Rodríguez-Herrera et al. (2014) recorded 11 new species within the political limits of Costa Rica, totalling 249 species in the national list of mammals, of which six are endemic, all rodents: Orthogeomys heterodus, O. cherriei, Heteromys oresterus, H. nubicolens, Reithrodontomys rodriguezi and R. musseri. Alongside with Panama, Costa Rica has served as a corridor and barrier for diverse groups of mammals from the north and south of the continent, giving rise to an assemblage with a mixture of species originating in both hemispheres (Cody et al. 2010; Wilson et al. 2014). Bearing in mind that fact and taking in consideration the geographical region composed by the highlands of the Talamanca mountain range in Costa Rica and the Chiriquí area of western Panama, the number of endemic mammals rises to 21 species. This number can further be increased to 23 regional endemic species if two shared species, Reithrodontomys brevirostris and R. paradoxus, in the far north of the country with Nicaragua, are considered.

FCUP 3 Cryptic diversity in rodents from Costa Rica

1.2. New World rodent cryptic speciation

The members of the order Rodentia constitute the most diverse group of mammals with an approximate number of 2277 species (Musser & Carleton 2005) and corresponding to nearly 40% of the known living mammal diversity. Rodents are worldwide distributed with the exception of Antarctica, inhabiting diverse ecosystems from forests, savannahs, grasslands, mountains, deserts, rivers to swamps, displaying terrestrial, arboreal, fossorial or semi-aquatic habits. Therefore, through presenting different ecological niches, they play key roles as seed and spore dispersers, pollinators, seed predators, contributors of energy and nutrient cycling, plant succession and species composition modifiers, and as a food source for many predators (Villa-Cornejo et al. 1998; Aplin & Singleton 2003; Brakes & Smith 2005).

Taking into account this group of animals are able to adapt and they have particular characteistics such as a high reprodutive potential, it is important to considere variability between species. All these facts may have favoured the appearance of cryptic species, as is the case of some members belonging to the Cricetidae family, a highly successful group within the large and complex rodents’ superfamily Muroidea (Musser & Carleton 2005), composed by five subfamilies: Sigmodontinae, Cricetinae, Arvicolinae, Tylomyinae and Neotominae. A debate regarding systematics in this group stil remains (Miller & Engstrom 2008). Moreover, Echimyidae family is an ancient family originated in South America whose fossils date from the mid-Eocene (Antoine et al. 2012). It is one of the most diverse southamerican rodent families and, like the Cricetidae family, it presents an unresolved taxonomy due to the great morphological similarity among its members (Antoine et al. 2012).

Cryptic species is a designation of those species that are, or have been, erroneously classified as a single nominal taxon due to their morphological similarity (Bickford et al. 2007; Beheregaray & Caccone 2007). Speciation is not always matched by morphological change, consequently, the accurate number of biological species is likely to be greater than the current estimate of nominal species, most of which were defined on purely morphological information. Cryptic lineage recognition can be severely impacted by morphological stasis (Pfenninger & Schwenk 2007). Therefore, is not surprising that most recent cryptic species studies rely largely on genetic data (Beheregaray & Caccone 2007; Bickford et al. 2007).

There are several hypotheses regarding to the origin of the family Cricetidae in Mesoamerica. On one hand, based on fossil evidence, some researchers hypothesize that the members of this rodent family entered South America preceding the formation of the Panamanian bridge (Marshall 1979; Woodburne & Swisher 1995). On the other hand, others suggest that cricetids diversified in southern Central America and once the Panamanian land bridge was completed in the Pliocene (3–2.7 Ma), one or several lineages of cricetids were FCUP 4 Cryptic diversity in rodents from Costa Rica among the first mammalian groups to enter South America (Pardiñas et al. 2002; Steppan et al. 2004). Recently, Verzi and Montalvo (2008) described late Miocene fossils belonging to the rodent subfamily Sigmodontinae and the carnivore family Mustelidae from the Cerro Azul Formation in Caleufú, Argentina, from an earlier time (5.8–5.7 Ma). However, Prevosti and Pardiñas (2009) argued that the age of this site is not well-established and proved that the alleged carnivore is actually a didelphimorph marsupial.

During the Pleistocene, when climatic fluctuations caused continual modifications in forest ranges and recurrent cycles of expansion and contraction of populations in a complex system of refugia, habitat-restriction among Neotropical species may have led to genetic structuring and accelerated speciation (Clare 2011). In fact, undersampled regions such as neotropical rainforests may contain a large amount of species thus far waiting to be discovered (Costello et al. 2013; Mora et al. 2011; Wheeler et al. 2012).

Nonetheless, it seems that vicariant events driven by climatic oscillations during the Pleistocene (or earlier) were enough to promote New World rodent speciation. Panama’s Darién region was likely isolated from South America until 13 to 7 Ma (Coates et al. 2004) and from Central America until the formation of the Panamanian∼ land bridge. Thereby, Marshall (2007) regards the Darién as a separate physiographic province. A series of species- level splits have been identified within several rodent taxa distributed in eastern Panama, compared with populations in western Panama and Costa Rica. Although narrow in geographic sampling, molecular phylogenetic studies have uncovered a series of species- level rodent taxa in lower Central America. These include Melanomys caliginosus (Hanson & Bradley 2008), Heteromys desmarestianus, and H. australis (Rogers & González 2010). A similar pattern was also recovered for other groups of mammals, like Alouatta pigra and A. palliate, species whose distributions are not restricted to Central America.

Among other examples, Bradley et al. (2008) determined that Sigmodon toltecus (generally distributed north of the Central American Highland Massif) and S. hirsutus (southern Central America and northern South America) were sister taxa. Hanson et al. (2010) evaluated genealogical relationships among samples of Oryzomys couesi from Mexico and Central America. Four species-level clades were identified, two from the Atlantic and Pacific versants in northern Central America respectivelly, a third from the Atlantic coast of Costa Rica, and a fourth from the Pacific coast of central Panama. Additionally, Rogers and González (2010) confirmed the species status of Heteromys nubicolens, a species known only from the Cordillera de Tilarán and Cordillera de Guanacaste, Costa Rica, and whose sister taxon, H. oresterus, occurs to the south in the Cordillera de Talamanca, Costa Rica (Anderson & Timm 2006). FCUP 5 Cryptic diversity in rodents from Costa Rica

Currentlly, 18 Cricetidae and 2 Echimyidae small mammal genera are documented from Costa Rica (Table 1, Rodríguez-Herrera et al. 2014). Several of these are arboreal, such as Tylomys, Otolomys and Nyctomys. Aquatic mice are represented by two species of Rheomys. Costa Rican Reithrodontomys (8 species) are mostly restricted to highland forms, as well as Peromyscus. Scotinomys are highland mice that are active during the day and make audible vocalizations. Moreover, Proechimys is one of the most specious genus of the rodent

family Echimyidae.

Table 1. List of rodents of the families Cricetidae and Echimyidae that currently occur in Costa Rica and surrounding area, according to Rodríguez-Herrera et al. (2014).

Family Subfamily Genus # of Restricted distribution species North Costa Rica Costa Rica and Costa Rica and Nicaragua Panamá highlands Sigmodontinae Rheomys 2 R. underwoodi Sigmodon 1 Handleyomys 1 Melanomys 1 Nephelomys 1 N. devius Oecomys 1 Oligoryzomys 2 O. vegetus Oryzomys 1 Sigmodontomys 1 Cricetidae Tanyuromys 1 Transandinomys 2 Zygodontomys 1 Tylominae Nyctomys 1 Ototylomys 1 Tylomys 1 Neotominae Scotinomys 2 S. xerampelinus Peromyscus 1 R. brevirostris, R. R. musseri, Reithrodontomys 8 R. creper paradoxus R. rodriguezi Echimyidae Proechimys 1 Hoplomys 1

1.2.1. Genus Oligoryzomys

Species of the cricetid genus Oligoryzomys, commonly known as pygmy rice rats or colilargos, are found across most Neotropical biomes, and represent a relatively diverse radiation of small Neotropical sigmodontine mice, occurring from Mexico throughout Central America southward into Tierra del Fuego (Figure 2; Hall 1981; Emmons 1997). It is one of the most complex and diverse genus of the subfamily Sigmodontinae and the tribe Oryzomyini. Among mammals, it is distinguished for presenting remarkable taxonomic inconsistences, since the number of species is not a consensus among the authors. Musser and Carleton (2005) recognised 18 Oligoryzomys species, initially divided amongst five species groups (Carleton & Musser 1989). Thus, it is likely that the number of described species underestimates the actual biodiversity in this group (Musser & Carleton 2005), especially given the amount of inter- and intraspecific diversity documented in the genus by Weksler and FCUP 6 Cryptic diversity in rodents from Costa Rica

Bonvicino (2005). Of the 18 Oligoryzomys species currently identified, most are found exclusively in South America (Musser & Carleton 2005); only O. fulvescens and O. vegetus spread in Central and North America (Hall 1981). Carleton and Musser (1995) documented several places of sympatry between the upland Oligoryzomys vegetus and lower-elevation O. fulvescens. Oligoryzomys vegetus is restricted to eastern Panama and Costa Rica highlands (Carleton & Musser 1995), a region which has formed a modest center for mammalian endemism in southern Central America, generally above 1000 m elevation and within lower montane and montane biotic zones. Whereas O. fulvescens occurs in the Sierra Madre Oriental and Occidental of Mexico south and east into Central America and northern South America (Carleton & Musser 1989; Musser & Carleton 2005) from sea level to 1000 meters in wet tropical and subtropical associations. Mexican and Mesoamerican populations of O. fulvescens are divided into 8 subspecies (Hall 1981; Carleton & Musser 1995). Fairly, not much is known regarding genetic variation within or among northern taxa relative to their South American correlatives.

Figure 2. Distribution of the genus Oligoryzomys (obtained from https://www.gbif.org/).

1.2.2. Genus Nyctomys

Sumichrast’s vesper mice of the genus Nyctomys, from the Greek nyx = night and mys = mouse, are unusual as they are arboreal rodents, endemic to Mesoamerica. Nyctomys sumichrasti (Cricetidae, Tylomyinae; Musser & Carleton 2005) is found from southern Jalisco and Veracruz in Mexico to eastern Panama excluding the Yucatán Peninsula (Figure 3; Hunt et al. 2004; Pérez-Lustre & Santos-Moreno 2010; Rodríguez-Herrera et al. 2014). It inhabits evergreen lowlands and lower montane regions including cloud, secondary, riparian, and semi-deciduous forests (Hall 1981; Sánchez-Hernández et al. 1999; Cervantes et al. 2004; Hunt et al. 2004) preferring middle and upper level forest strata, ranging elevations from sea level to 1800 m (Emmons 1997; Timm & LaVal 2000; Hunt et al. 2004; Reid 2009), rarely FCUP 7 Cryptic diversity in rodents from Costa Rica

descending to the ground. It is considered as sister taxa of two other mesoamerican endemics Tylomys and Otolomys but supposed to be closely related to Otonyctomys (Timm & LaVal 2000). These tylomyine genera are considered remnants of a clade that diverged relatively early in evolutionary history of sigmodontine rodents (Carleton 1980; Steppan 1995). Considering intraspecific variation, this diverse taxon encompasses approximately nine subspecies acknowledged by Hall (1981): colimensis, costaricensis, decolorus, florencei, nitellinus, pallidulus, salvini, sumichrasti, and venustulus. However, little has been reported about the taxonomy, geographic and genetic variation, or relationships between them. Musser and Carleton (2005) argue the existence of two groups corresponding to Nyctomys populations occurring north and west of the Isthmus of Tehuantepec (pallidulus and sumichrasti) versus those to the south and east (costaricensis, decolorus, florencei, nitellinus, and venustulus). Meanwhile, Corley et al. (2011) found substantial levels of genetic divergence among specimens of Nyctomys, suggesting a possible paraphyletic relationship between taxa and the likely recognition of a new genus.

Firgure 3. Distribution of the genus Nyctomys, with a detailed view in Mesoamerica (obtained from https://www.gbif.org/)

1.2.3. Genus Scotinomys

Neotropical singing mice of the genus Scotinomys are restricted to the Mesoamerican mountains at elevations above 1000 m. Two species, Scotinomys teguina and S. xerampelinus, are formally recognized based on the last revision of the genus (Hooper 1972). According to the literature, Alston's brown mouse (Scotinomys teguina; Alston 1877) is a widespread species inhabiting mid to high-altitude cloud forest, forest edge, and abandoned pastures from southeastern Mexico to western Panama (1000–2900 m). Whereas Chiriquí brown mouse (S. xerampelinus; Bangs 1902) is restricted to the highest forested summits and Páramo of Costa Rica and Panama (2000–3300 m; Wilson & Reeder 2005; Hooper & Carleton FCUP 8 Cryptic diversity in rodents from Costa Rica

1976). The two ecologically similar congeners have parapatric distributions in the Cordillera de Talamanca and Cordillera Central, where the upper distribution of S. teguina contacts the lower distribution of S. xerampelinus between 2200 and 2900 m (Figure 4; Enders & Pearson 1939; Hooper 1972; Hooper & Carleton 1976). In relation to behaviour and reproduction, both present substantial divergences. Interspecific competition and species differences in thermal tolerance are theorised to maintain this narrow contact zone (Hill & Hooper 1971; Hooper & Carleton 1976).

Figure 4. Distribution of the genus Scotinomys, with a detailed view of Mesoamerica (obtained from https://www.gbif.org/).

1.2.4. Genus Reithrodontomys

New World harvest mice belonging to the genus Reithrodontomys, are small long- tailed rodents and comprise about 24 species divided in two recognized subgenera (Figure 5): Reithrodontomys and Aporodon (Hooper 1952; Howell 1914; Arellano et al. 2003). Only after Peromyscus, Reithrodontomys is second in species richness within peromyscines. The biodiversity of this group reaches its highest point in Mesoamerica, despite of harvest mice being distributed in most habitats in North and Central America as well as in extreme northwestern of South America (Figure 6; Eisenberg 1989; Hall 1981; Hooper 1952). In the genus Reithrodontomys, 12 species are present in southern Mexico alone (Reid 1997): R. bakeri, R. chrysopsis, R. fulvescens, R. gracilis, R. hirsutus, R. megalotis, R. mexicanus, R. microdon, R. spectabilis, R. sumichrasti, R. tenuirostris, and R. zacatecae. Whereas species of mesoamerican Reithrodontomys usually have restricted geographic distributions, with the exceptions of R. mexicanus, which occurs from northeastern Mexico south to Ecuador and R. megalotis, which is found from southwestern Canada to the southern plateau of Mexico. Aside from R. fulvescens, R. gracilis and R. spectabilis, north and mesoamerican Reithrodontomys typically occupy moderate to high elevation habitats forming “mountain islands” throughout the region. Despite intense interest and rigorous effort, elucidating the relationships within this

FCUP 9 Cryptic diversity in rodents from Costa Rica

group has proven to be difficult, and classification within Neotominae has not always been consistent, with the monophyly and composition of lineages remaining unresolved.

Figure 5. Grouping of recognised species of the genus Reithrodontomys per subgenus; * = Species found in Costa Rica.

Arellano et al. (2003) recently evaluated phylogenetic relationships among some members of the subgenus Aporodon. In addition, Bradley et al. (2004) described a new species of Aporodon (R. bakeri). Arellano et al. (2005) recognised Reithrodontomys cherrii (formerly a subspecies of R. mexicanus) as a deeply divergent clade from the Cordillera de Talamanca, Costa Rica, with affinities to the R. tenuirostris species group. Miller and Engstrom (2008) identified two undescribed species of Reithrodontomys, one from the Cerro de la Carpintera and another from Volcán Poas in Costa Rica. The species-level status of R. cherrii was confirmed by Gardner and Carleton (2009), based on detailed examination of morphological evidence. Hence, the species diversity of Reithrodontomys in southern Central America is greater than what would be assumed from the literature as recent genetic studies have significantly uncovered highly divergent clades that are inconsistent with current understanding of species limits (Sullivan et al. 2000; Arellano et al. 2003; 2005; 2006).

Figure 6. Distribution of the genus Reithrodontomys (obtained from https://www.gbif.org/). FCUP 10 Cryptic diversity in rodents from Costa Rica

1.2.5. Genus Proechimys

Neotropical spiny rats of the family Echimyidae are considered the most ecologically, morphologically and taxonomically diverse group of all extant South American Hystricognathi rodents. It comprises an old family, with members documented from the Oligocene of Bolivia, approximately 25 million years ago (Patterson & Wood 1982). Among the extant forms, there are about 18 genera and 80 species (Eisenberg & Redford 1999; Emmons & Feer 1997; McKenna & Bell 1997; Woods 1993). They are generally the most abundant and widespread lowland forest small-bodied rats throughout much of their range in neotropical forests (Eisenberg 1989). Within this family, Proechimys is the most diverse genus (Miranda & da Silva 2015), with 25 recognised terrestrial species. The genus ranges from Honduras to Paraguay, and occurs throughout Amazonia (Figure 7), presenting extremely complex systematics, often with reports of four or five species sympatric at a single locality (Patton & Gardner 1972; da Silva 1998). Reconstructing the systematics and phylogeny of Proechimys species have been greatly challenging by extreme levels of intra- and inter-population character variability. Moreover, their interspecific differences in ecological traits and short life cycles allow for a high rate of recovery and diversification of the species in this group, especially in dynamic environments like most tropical ecosystems (Rocha et al. 2014). Proechimys semispinosus (Central American spiny rat) is the sole member of the genus within its geographical range in Central America and north-western South America. This species is the best-studied member of the genus and is found in lowland tropical forests ranging from dry to pluvial and from secondary to primary forests (Lambert & Adler 2000).

Figure 7. Distribution of the genus Proechimys (obtained from https://www.gbif.org/).

FCUP 11 Cryptic diversity in rodents from Costa Rica

1.3. Molecular markers

Rodents, as the most abundant and diversified order of living mammals, have always been a challenge for researchers attracted by their origins, ways of radiation, and times of diversification (Huchon et al. 2002). Historically, species boundaries and higher taxonomic categorizations within the class Mammalia were based on morphological characteristics (Shoshani & McKenna 1998; Asher 2007), but recent molecular studies led to a better comprehension over the lineages of related species, especially, at lower taxonomic levels, where derived morphological characteristics can be difficult to determine given recent divergences. Therefore, leading to often radically dissimilar phylogenies and species assemblages (Buckley-Beason et al. 2006; Tabuce et al. 2008).

Mitochondrial DNA (mtDNA) possesses a set of unique and valuable characteristics for understanding the evolutionary relationships between individuals, populations, and species (Avise et al. 1987). Among the reasons behind the preference of mtDNA over other genetic markers in animal population studies are its high level of variability, its uniparental (maternal) inheritance, and its practically neutral mode of evolution (Wright 1931). Moreover, the evolutionary rate of the mtDNA is 5 to 10 times faster than the nuclear DNA (nDNA) (Brown et al. 1979), hence being particularly adequate for studying taxa at low taxonomic levels like intra-generic or intra-specific relationships (Hillis et al. 1996). It presents a high level of transitions and transversions, as well as a high incidence of small length mutations (Cann & Wilson 1983) and it is assumed to reflect demographic effects, namely, variations in population size between species or populations, which makes it a popular tool for conservation purposes (Harrison 1989; Roman & Palumbi 2003).

The two most employed mitochondrial markers are Cytochrome b (cytb) and Cytochrome c oxidase I (COI) since these are considered helpful to detect genetic diversity and differentiation at the intra- and inter-specific level between closely related species (Low et al. 2014).

The cytochrome b (cytb) gene has been widely used in many studies for species identification in numerous animal taxa (Irwin et al. 1991; Parson et al. 2000; Hsieh et al. 2001; Rajapaksha et al. 2002; Ono et al. 2007; Tsai et al. 2007; Barbosa et al. 2013). It is probably the best-known mitochondrial gene in studies of phylogenetic relationships for its both slowly and rapidly evolving codon positions, as well as more conservative and more variable regions or domains (Esposti et al. 1993). Therefore, this gene is often used in phylogenetic and phylogeographic studies and several studies of mammalian orders have resulted in new classification structures and have served to assign newly described species to a genus as well FCUP 12 Cryptic diversity in rodents from Costa Rica

as to enhance the understanding of evolutionary relationships (Sturmbauer & Meyer 1992; Lydeard & Roe 1997; Kumazawa & Nishida 2000; Castresana 2001).

The cytochrome c oxidase subunit I (COI) mitochondrial region has emerged as the standard barcode region for animals proposed by Herbert et al. (2003). The choice of this gene fragment to distinguish known species is based on its high variability, inheritance mode and neutral evolution (Hebert et al. 2003; Ward et al. 2005). It is also widely used to identify new or cryptic species (e.g. Hebert et al. 2003; 2004; Hajibabaei et al. 2006; Smith et al. 2006; Witt et al. 2006), and to assess biodiversity (Janzen et al. 2005; Smith et al. 2005) in many animal groups, including mammals. The efficiency of DNA barcodes relies on the existence of a barcoding “gap” between intra- and interspecific variation. Interspecific divergences in COI sequences are significantly higher than intraspecific variation in many groups of animals, specifically, sequence divergence between most congeneric species is generally greater than 2% (Hebert et al. 2003), whereas intraspecific variation is often lower than 1% (Avise 2000).

Nevertheless, their application is not exempt of problems. The efficiency of using mtDNA in population-genetic studies has been significantly weakened by the presence of mitochondrial pseudogenes (NUMTs), and other factors as incomplete lineage sorting or mitochondrial introgression (Zhang & Hewitt 1996; Bensasson et al. 2001). Therefore, the combination of nuclear (nDNA) and mitochondrial DNA (mtDNA) markers has proven to be more effective to test phylogenetic and phylogeographic hypotheses and emphasized the limitations of studies using mtDNA markers only (Toews & Brelsford 2012).

Moreover, nuclear genes (nDNA) have been also used in vertebrate systematics. Nuclear loci can provide independent estimates of phylogenetic relationships to corroborate or refute phylogenies constructed using mtDNA sequence data (Gaines et al. 2005). Introns are a common source of nuclear sequence data because they evolve with fewer evolutionary constraints relative to coding sequence (Palumbi & Baker 1994; Prychitko & Moore 1997; Friesen et al. 1999; Hare & Palumbi 2003). Exons are also considerably efficient in resolving deep-level mammalian clades (Springer et al. 2001). The Interphotoreceptor Retinoid Binding Protein (IRBP) exon 1 has been used extensively in mammalian phylogeny inference (Springer et al. 1997; Stanhope et al. 1992, 1996), and appears to be useful for discerning relationships at lower taxonomic levels (Jansa & Voss 2000; Weksler et al. 1999). Whereas, the nuclear Recombination Activating Gene 1 (RAG1) has been used for phylogenetic inference at various taxonomic levels (Groth & Barrowclough 1999; Mathee et al. 2004). Several studies have focused on specific vertebrate groups (Hugall et al. 2007; Krenz et al. 2005; Meijden et al. 2004) and have highlighted the characteristics of this gene in relation to its phylogenetic utility. Some of these potentially useful characteristics of RAG1 include its FCUP 13 Cryptic diversity in rodents from Costa Rica

existence as a single copy gene (Evans et al. 2005), uninterrupted exon (Venkatesh et al. 1999). In addition, the conserved nature of certain regions of the gene, especially its second half (3' end), facilitates the design of degenerate "universal" primers for PCR, and the presence of numerous sequences from a variety of taxa in public databases, and an overall lack of saturation (Hugall et al. 2007) promotes its use in phylogenetic studies.

1.4. Objectives

Costa Rica shows an exceptional natural stage for studying the recent historical assembly and diversification of Neotropical rodent biota. This work is integrated in Alexander Gómez Lépiz phD research (“Small mammals distribution and genetic diversity along altitudinal gradients in Costa Rica”) and aims, with the application of molecular approaches, to contribute to the understanding of the genetic diversity and phylogeography of rodent taxa in this area. Namely, this study focuses on some genus of the Cricetidae (Oligoryzomys, Nyctomys, Scotinomys, Reithrodontomys) and Echimyidae (Proechimys) families, where high genetic diversity was detected, aiming to provide insights on the phylogenetic relationships and phylogeography of these taxa.

Hence, this study has the following specific goals:

I) Analyse genetic diversity of Cricetidae and Echimyidae rodents in Costa Rica and detect possible events of cryptic speciation;

II) Study the phylogeography of these species in Costa Rica;

Therefore, both mitochondrial (Cytb and COI) and the nuclear (IRBP and RAG1) genetic markers were used to assess the genetic variability as well as to understand the evolutionary history and current status of these species. Furthermore, this will contribute to the DNA barcode reference library of rodents in the region. We expect that the results can be of added value for conservation, as it will allow a better awareness of biodiversity richness in the region, that will be highly relevant for developing conservation strategies for this group.

FCUP 14 Cryptic diversity in rodents from Costa Rica

2. Material and Methods 2.1. Study area and sampling

The study area comprises five natural reserves located along Costa Rica (Figure 8), which encompass diverse habitats along altitudinal gradients that consist of rainforests, cloud forests, tropical dry forests and montane surroundings. A total of 624 tissues samples (from museum, ear and tail), in addition to one sample from Honduras, were previously collected within the frame of Alexander Gómez Lépiz PhD work. Due to the large number of samples available, a previous selection of the 221 samples of 11 species, belonging to 5 genera of Cricetidae and Echimyidae families was performed for the analyses of both mitochondrial and nuclear genes, summarised in Table 2.

Figure 8. Map of Costa Rica depicting the collecting localities of the samples of Cricetidae and Echimyidae available for analyses.

Table 2. Genera, number of species and analysed samples using mitochondrial (cytb and COI) and nuclear (RAG1 and IRBP) genes, with reference to the sampling sites.

Order Family Genus # of Number of Number of sequences Sampling site Species samples Cytb COI IRBP RAG1

Oligoryzomys 2 35 - 15 9 7 LAIP, SRNP Nyctomys 1 9 5 7 4 - LAIP, SV Cricetidae Scotinomys 2 57 29 21 - 4 LAIP, HN, BCNP Reithrodontomys 5 93 64 23 19 18 LAIP, BCNP Rodentia Echimyidae Proechimys 1 12 10 6 - 8 LAIP, MANP, SV (-) No representative samples for analyses; LAIP - La Amistad National Park; SRNP - Santa Rosa National Park; SV - Selva Verde; HN - Honduras; BCNP - Braulio Carrillo National Park; MANP - Manuel Antonio National Park. FCUP 15 Cryptic diversity in rodents from Costa Rica

2.2. DNA extraction, amplification and sequencing

DNA extraction of the selected tissue samples was performed by using EXTRACTME® Genomic DNA 96-Well Kit (DNA GDAŃSK) and eluted twice in 50 µL volume. Whereas DNA from museum samples was extracted following the previously optimized protocol of Dabney et al. (2013). Afterward, quality and quantity of the extracted DNA were evaluated by electrophoresis in TBE (Tris-Borate-EDTA buffer), in 0.8% agarose gel stained with GelRed™ (Biotum), allowing to visualize DNA bands through an ultra-violet (UV) transilluminator (Bio- Rad). The samples with high concentration of DNA were diluted with ultrapure water. Two mitochondrial genes, cytochrome b (cytb) and a fragment of cytochrome c oxidase subunit I (COI), as well as fragments of two nuclear genes, interphotoreceptor retinoid binding protein (IRBP) and recombination activating gene 1 (RAG1) were amplified in the extracted samples (Table 2).

2.2.1. Cytochrome b (cytb)

The cytochrome b (cytb, 1143 bp) fragment was amplified for 108 samples (5 Nyctomys, 29 Scotinomys, 64 Reithrodontomys and 10 Proechimys; see Table 2) using published primers (Table 3). Protocols were optimized for different taxa mainly adjusting annealing time and temperature. Each performed PCR contained a total volume of 10 µL, composed by 5 µL of Qiagen© PCR Multiplex Kit Master Mix (Qiagen, Hilden, Germany), 0.4

µL of each primer (from a 10 µM solution), 3.2 µL of pure H2O and 1 µL of DNA extraction product (~50 ng/µL). PCR thermal conditions were as follows: initial denaturation for 15 min at 95ºC, followed by 35 cycles of 45 sec at 95ºC for denaturation, 45 sec at the annealing temperature and 1 min at 72ºC, and a final extension for 5 min at 60 ºC. The annealing temperature varied according to the primer pairs used for each genus (Table 4).

Quantity and quality of PCR products were visually examined by 2% gel electrophoresis. Successful amplified PCR products were purified using ExoSAP-IT® PCR clean-up Kit (GE, Healthcare, Piscataway, NJ, USA) to remove excess primers and unincorporated nucleotides during PCR reaction. Sequencing reactions were performed using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) and subsenquently sequenced for both strands on a 3130XL automated sequencer (Applied Biosystems, USA), or sequenced by GeneWiz Sanger sequencing (USA). All the forward and reverse sequences obtained were aligned and verified manually with software GENEIOUS© v8.1.9 (Bioinformatics Software) using default settings. All sequences were inspected for the presence of stop codons or indels, that could indicate the presence of a potential nuclear mitochondrial FCUP 16 Cryptic diversity in rodents from Costa Rica

pseudogenes (NUMTs). The sequences suspected to be NUMTs, were not considered for further analyses.

Table 3. Primers used for amplification and sequencing of Cytb gene.

Primer name Primer (5'→3') sequence Direction References MVZ05M CGAAGCTTGATATGAAAAACCATCGTTG Forward Smith & Patton 1993 MVZ14M TCTTCATCTTTGACTTACAAGG Reverse Smith & Patton 1993 L14724 CGAAGCTTGATATGAAAAACCATCGTTG Forward Irwin et al. 1991 L14727-SP GACAGGAAAAATCATCGTTG Forward Jaarola & Searle 2002 H15915 TCTCCATTTCTGGTTTACAAGAC Reverse Jaarola & Searle 2002

Table 4. Primers pair and annealing temperature optimized in each genus for Cytb gene amplification.

Primers pair Genus Annealing temperature MVZ05M / H15915 Scotinomys 50 ºC Reithrodontomys 50 ºC Proechimys 50ºC L14727-SP / H15915 Nyctomys 52ºC Scotinomys 52ºC Reithrodontomys 52ºC

2.2.2. Cytochrome c oxidase subunit I (COI)

The cytochrome c oxidase subunit I gene (COI, 658 bp) was amplified for 72 samples (15 Oligoryzomys, 7 Nyctomys, 21 Scotinomys, 23 Reithrodontomys and 6 Proechimys; see Table 2), previously selected in order to include all species and sampling sites in the study area. The amplification was performed in two different fragments, using a high throughput sequencing approach, based on a double-indexing pipeline, with two step PCR (Figure 9). The fragments used were: B2 (421 bp) and LCn (325 bp) using published primers sets (Table 5). The first PCR contained a total volume of 10 μL, composed by 5 μL of Qiagen© PCR Multiplex Kit Master Mix (Qiagen, Hilden, Germany), 0.3 μL of each primer (from a 10 μM solution), 3.4 μL of distilled H2O and 1 μL of DNA extraction product (~50 ng/μL). B2 PCR was performed with BF2 / BR2 primer pair (Table 7) with thermal conditions as follows: initial denaturation for 15 min at 95ºC, followed by 40 cycles of 30 sec at 95ºC for denaturation, 45 sec at 51ºC for annealing and 45 sec at 72ºC, and 10 min at 60ºC for final extension. LCn PCR was performed with fwhF1 / Ill_C_R primer pair (Table 7) with thermal conditions as follows: initial denaturation for 15 min at 95ºC, followed by 35 cycles of 30 sec at 95ºC for denaturation, 90 sec at 45ºC for annealing and 45 sec at 72ºC, followed by a final extension of 10 min at 60ºC. FCUP 17 Cryptic diversity in rodents from Costa Rica

Figure 9. COI Primer sets for DNA barcoding of small mammals from Costa Rica.

Table 5. Primers used for amplification and sequencing COI fragments B2 and LCn. Primer name Primer (5'→3') sequence Direction References BF2 GCHCCHGAYATRGCHTTYCC Forward Elbrecht & Leese 2017 BR2 TCDGGRTGNCCRAARAAYCA Reverse Elbrecht & Leese 2017 fwhF1 YTCHACWAAYCAYAARGAYATYGG Forward Vamos et al. 2017 Ill_C_R GGIGGRTAIACIGTTCAICC Reverse Shokralla et al. 2015

For the museum samples, in which DNA was more degraded and failed to amplify B2 or LCn fragments, the SFF primer pair 145f / 351r (Table 6) was used to amplify a smaller fragment of 202 bp. The PCR thermal cycle was performed using the following protocol: initial denaturation for 10 min at 95ºC, followed by 45 cycles of 30 sec at 95ºC for denaturation, 30 sec at 52ºC for annealing and extension of 30 sec at 72ºC, with a final extension of 10 min at 72ºC.

Table 6. Primers used for amplification and sequencing COI fragment SFF. Primer name Primer (5'→3') sequence Direction References SFF_145f GTHACHGCYCAYGCHTTYGTAATAAT Forward Walker et al. 2016 SFF_351r CTCCWGCRTGDGCWAGRTTTCC Reverse Walker et al. 2016

The quantity and quality of PCR products were visually examined by 2% gel electrophoresis.

After this first PCR, the obtained products were purified using 0.8 μL Beckman Coulter™ Agencourt AMPure XP magnetic beads per 1 μL PCR product, in order to remove primer dimer and unincorporated reagents in the reaction, succeeding two cleaning steps with ethanol, lasting 30 sec each, and a final immersion of purified DNA in 10nM Tris at pH 8.5. Purified products were quantified by using NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific) and posteriorly normalized to 10 ng/μL. An indexing PCR was then performed to attach the barcodes in each sample to allow individual identification. PCR reaction was composed by 5 μL of KAPA ReadyMix, 1 μL of compatible Illumina index primers in each pool, 2 μL of H2O and 2 μL of DNA. PCR thermal conditions were: initial denaturation for 3 min at 95ºC, followed by 10 cycles of 30 sec at 95ºC for denaturation, 30 sec at 55ºC for annealing and for extension 30 sec at 72ºC, and a final extension of 5 min at 72ºC. To confirm the success of indexing in all samples, PCR products were visually examined by 2% gel FCUP 18 Cryptic diversity in rodents from Costa Rica

electrophoresis stained with GelRed™ (Biotum), with a 100-1000 NZYDNA ladder (NZYTech©, Portugal). Afterwards, a second purification was performed with AMPure XP magnetic beads, and samples were quantified with NanoDrop 1000 (Thermo Scientific). Indexed PCR products were then normalized to 15 nM concentration and pooled, being the final pool quantified by qPCR (KAPA Library Quant Kit qPCR Mix, Bio-Rad iCycler), diluted to 4 nM, and run using a MiSeq V2 Kit (2x250 cycles; Illumina).

The OBITools software package was used in the manipulation of the obtained sequence files. Forward and reverse reads were overlapped with illuminapairedend command and sequences with an alignment score lower than 50 were discarded. Sequence reads per sample and COI fragment were dereplicated into unique sequences with obiuniq command. Unique sequences with less than five reads were discarded from further analyses. Then, PCR and sequencing errors were filtered out with the command obiclean. The obtained sequences per fragment and sample were then aligned using GENEIOUS© v8.1.9 (Bioinformatics Software) and visually inspected. The obtained COI sequence was then kept for phylogenetic analyses. Sequences with less than 100 reads were discarded.

2.2.3. IRBP and RAG1 nuclear genes

The nuclear genes were amplified in a set of samples previousy selected considering the variability detected on the mitochondrial genes and the geographic distribution of the samples. The Interphotoreceptor Retinoid Binding Protein nuclear gene fragment (IRBP, 894 bp) was amplified for 32 samples (9 Oligoryzomys, 4 Nyctomys and 19 Reithrodontomys; see Table 2) using the primers pair F2S and R2S (Table 7). In addition, a fragment of the exon 1 of the nuclear gene (RAG1, 1251 bp) was amplified for 37 samples (7 Oligoryzomys, 4 Scotinomys, 18 Reithrodontomys and 8 Proechimys; see Table 2) using S70 and S73 primer pair (Table 5). Protocols were optimized for different taxa mainly adjusting annealing time and temperature.

Table 7. Primers used for amplification and sequencing of IRBP and RAG1 genes respectively.

Primer name Primer (5'→3') sequence Direction References F2S GCAGGCTAGAAGAGTCRTG Forward Barbosa et al. 2013 R2S AGCACGGAYACCTGAAACA Reverse Barbosa et al. 2013 S70 TCCGAGTGGAAATTTAAGMTGTT Forward Steppan et al. 2004 S73 GAGGAAGGTRTTGACACGGATG Reverse Steppan et al. 2004

Each PCR was performed with a total volume of 10 µL, composed by 5 µL of Qiagen© PCR Multiplex Kit Master Mix (Qiagen, Hilden, Germany), 0.4 µL of each primer (from a 10

µM solution), 3.2 µL of pure H2O and 1 µL of DNA extraction product (~50 ng/µL). The following thermal cycling profile was used: initial denaturation for 15 min at 95ºC, followed by 35 cycles FCUP 19 Cryptic diversity in rodents from Costa Rica

of 45 sec at 95ºC for denaturation, 45 sec at the annealing temperature and an extension of 1 min at 72ºC, and a final extension for 5 min at 60 ºC. The annealing temperature varied according to the genus analysed (Table 8).

Table 8. Primers pair and annealing temperature optimized in each genus for IRBP and RAG1 genes amplification. Primers pair Genus Annealing temperature F2S / R2S Oligoryzomys 54ºC, 60-57ºCꭞ Nyctomys 60-54ºCꭞ Reithrodontomys 60-54ºCꭞ S70 / S73 Oligoryzomys 55ºC, 57ºC Scotinomys 55ºC Reithrodontomys 57ºC Proechimys 55ºC

ꭞ = Touchdown (-0.5ºC per cycle). Quantity and quality of PCR products were visually inspected by 2% gel electrophoresis. Successful amplified PCR products were purified using ExoSAP-IT® PCR clean-up Kit (GE, Healthcare, Piscataway, NJ, USA) to remove excess primers and unincorporated nucleotides from PCR reaction. Sequencing reaction was performed using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) and subsenquently sequenced for both strands on a 3130XL automated sequencer (Applied Biosystems, USA), or sequenced by GeneWiz Sanger sequencing (USA).

The forward and reverse nuclear DNA loci sequences obtained were assembled and visually inspected using GENEIOUS© v8.1.9 (Bioinformatics Software) using default settings.

2.3. Phylogenetic analyses

The sequences obtained from the mitochondrial (cytb and COI) and nuclear (IRBP and RAG1) genes were analysed together with corresponding sequences available in GenBank, covering the largest number of species related to each genus of interest available from different geographical locations, usually within the Mesoamerican region (see Supplementary Table 1). After aligning our sequences together with those retrieved from GenBank using GENEIOUS© v8.1.9 (Bioinformatics Software), haplotypes were generated using DNASP v5.10.1 (Librado & Rozas 2009). Heterozygous sequences within both nuclear fragments were phased using the PHASE algorithm incorporated in DNASP v5.10.1 (Librado & Rozas 2009) using default settings.

Afterwards, small mammals’ phylogenetic relationships were assessed with both the mitochondrial, cytb and COI, dataset (see Supplementary Table 2). For Bayesian Inference approach, the nucleotide substitution HKY+G model, with two partitions, the first and second position linked and third position separated, as recommended for protein coding genes (Shapiro et al. 2006) was used. Bayesian inferences and phylogenetic trees were executed FCUP 20 Cryptic diversity in rodents from Costa Rica

using MrBayes 3.2 (Ronquist et al. 2012), and using different outgroups for each genus under study. Two runs were performed with five chains of one million generations, with a sampling frequency of 10 000 samples for each run, discarding the first 10% of the samples as burn-in.

Phylogenetic relationships at nuclear IRBP and RAG1 genes, were analysed using haplotype networks. To depict the evolutionary relationship among clades, median-joining haplotype networks (Bandelt et al. 1999) were constructed with software PopArt (Population Analysis with Reticulate Trees; Leigh & Bryant 2015) applying default settings.

Genetic diversity indices, namely nucleotide and haplotype diversity, polymorphic sites and parsimony informative sites, were estimated for all genes, using DNASP v5.10.1 (Librado & Rozas 2009) for each species, or clade as identified in the Bayesian analyses. Intraspecific and interspecific diversity were calculated for the same clades in MEGA X, using p-distances, and the standard deviation was estimated executing 500 bootstrap pseudoreplicates.

FCUP 21 Cryptic diversity in rodents from Costa Rica

3. Results 3.1. Phylogenetic analyses

A total of 205 small mammal samples were extracted, including tissues from museum samples, of which we were able to amplify successfully 108 for cytb, 72 for COI, 32 for IRBP and 37 for RAG1 respectively (for more information, see Table 2 and S2). For the genus Oligoryzomys, altough 16 samples amplified for cytb, these were not included in the analyses as they all presented stop codons, indicating that these were likely pseudogenes (NUMTs).

For the cytb gene, we used for analyses the 108 sequences obtained (see Table S2) together with 125 sequences retrieved from GenBank (see Table S1), giving a total of 233 cytb sequences, with a length between 1127bp and 1143bp. The Bayesian inference for this gene recovered well-supported clades with high probability (BBP>95%) for most of the five genera and two families. Most species formed monophyletic groups, with some exceptions as for example, Reithrodontomys mexicanus that forms a paraphyletic group.

For COI we used the 72 sequences obtained (see Table S2) together with 250 sequences retrieved from GenBank (see Table S1), totalising 322 COI sequences, with a length between 420bp and 657bp. Bayesian analyses of mtDNA sequences (COI) identified well-supported clades (over BBP>50%) for the five genera and two families under study.

For the nuclear genes we used for analyses 31 sequences of IRBP and 26 of RAG1 (see table S2). These were analysed together with 53 sequences retrieved from GenBank, namely, 44 IRBP and nine RAG1 sequences (see Table S1). The nuclear genes haplotype networks (IRBP and RAG1) were often congruent with the mitochondrial data, but sometimes revealed lack of genetic structure or geographic congruence. Moreover, we were able to amplify the first sequences of Proechimys semispinosus for RAG1 gene.

3.1.1. Genus Oligoryzomys

In total we obtained nine sequences of COI, seven of which with 657bp, and two additional sequences from museum samples, for which we were only able to sequence a smaller fragment with 420bp. Additionally, we retrived 41 COI sequences of 3 species of Oligoryzomys from GenBank (for further information, see Table S1), that were analysed together with the nine COI sequences obtained from our samples. This resulted in an aligment of 657bp including 56 sequences, that corresponded to 33 haplotypes, and an aligment with 420bp, including 58 sequences. FCUP 22 Cryptic diversity in rodents from Costa Rica

Both Bayesian inferences trees from COI based on different fragment sizes (420 bp and 657 bp) for Oligoryzomys genus presented well-supported clades with high posterior probability (>0.86) (Figure 10 and 11). O. fulvescens sequences group in four different clades congruent with geography. Furthermore, the two sequences of the specimens identified as O. vegetus cluster within two O. fulvescens clades, with published and new haplotypes of O. fulvescens. These two clades include only sequences from Costa Rica, and one of the clades was only detected in the current study.

All O. fulvescens clades identified have moderate values of genetic diversity (Table 9).

The distance between the four O. fulvescens clades varies between 7 and 10% (Table 10), being as large as the distance between O. fulvescens and the other Oligoryzomys species used in the analyses.

For the nuclear genes all information available for the genus Oligoryzomys in GenBank was included, resulting in final alignments with 41 sequences of 10 species for IRBP and 10 sequences of 5 species for RAG1 (see Table S1). In both genes, most species have unique haplotypes and form distinct clades, with the exception of O. vegetus and O. fulvescens that share haplotypes in IRBP (Figure 12).

Table 9. Genetic indices for intraspecific diversity of the genus Oligoryzomys with COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (sequences retrieved from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description COI N H S Hd ± SD π ± SD O. fulvescens (GYVE) Guiana-Venezuela 3 3 10 1.000 ± 0.272 0.01015 ± 0.00433 O. fulvescens (MX) Mexico 22 22 42 1.000 ± 0.014 0.00934 ± 0.00151 O. fulvescens (LAIP I) La Amistad INP 2 (3) 4 10 1.000 ± 0.177 0.00761 ± 0.00242 O. fulvescens (LAIP II) La Amistad INP 7 2 7 0.333 ± 0.215 0.00355 ± 0.00229

Table 10. Estimates of interspecific diversity between clades of the genus Oligoryzomys in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 4 5 6 1 O. fulvescens (GYVE) 0.01 0.01 0.01 0.01 0.01 2 O. flavescens (BR) 0.10 0.01 0.01 0.01 0.01 3 O. nigripes (BR) 0.09 0.10 0.01 0.01 0.01 4 O. fulvescens (MX) 0.10 0.10 0.09 0.01 0.01 5 O. fulvescens (LAIP I) 0.10 0.10 0.10 0.07 0.01 6 O. fulvescens (LAIP II) 0.09 0.10 0.09 0.08 0.09

Table 11. Genetic indices for intraspecific diversity of the genus Oligoryzomys with IRBP nDNA sequences (541 bp) for each clade identified according to the Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description IRBP N H S Hd ± SD π ± SD O. fulvescens (HN) Honduras (2) 2 1 1.000 ± 0.500 0.002 ± 0.002 O. fulvescens (CR) Costa Rica 16 (6) 5 5 0.740 ± 0.057 0.002 ± 0.001 FCUP 23 Cryptic diversity in rodents from Costa Rica

Table 12. Estimates of interspecific diversity between clades of the genus Oligoryzomys in the lower triangle for IRBP sequences (541 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 4 5 1 O. longicaudatus (AR) 0.003 0.003 0.003 0.007 2 O. fulvescens (CR) 0.011 0.002 0.002 0.006 3 O. flavescens (BR) 0.011 0.004 0.003 0.007 4 O. fulvescens (HN) 0.011 0.004 0.005 0.006 5 O. flavescens (AR) 0.035 0.030 0.030 0.028

Table 13. Genetic indices for intraspecific diversity of the genus Oligoryzomys with RAG1 nDNA sequences (952 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: haplotype diversity; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description RAG1 N H S Hd ± SD π ± SD O. fulvescens (CR) Costa Rica 8 (2) 7 6 0.933 ± 0.062 0.002 ± 0.0003

Table 14. Estimates of interspecific diversity between clades of the genus Oligoryzomys in the lower triangle for RAG1 sequences (952 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 4 1 O. eliurus (BR) 0.004 0.004 0.004 2 O. longicaudatus (AR) 0.010 0.003 0.002 3 O. microtis (BR) 0.014 0.006 0.003 4 O. fulvescens (CR) 0.010 0.003 0.006

FCUP 24 Cryptic diversity in rodents from Costa Rica

Figure 10. Bayesian inference tree for genus Oligoryzomys for COI gene (657 bp). Purple branches represent our samples. Probabilities of major nodes are indicated. MX= Mexico; LAIP= La Amistad International Park, Costa Rica; GYVE= Guiana-Venezuela; BR= Brazil. Roman numbers represent the number of the clade. Outgroup: Oryzomys couesi. FCUP 25 Cryptic diversity in rodents from Costa Rica

Figure 11. Bayesian inference tree for genus Oligoryzomys for COI gene (420 bp). Purple branches represent our samples and museum samples are shown in red. Probabilities of major nodes are indicated. MX= Mexico; LAIP= La Amistad International Park, Costa Rica; GYVE= Guiana-Venezuela; BR= Brazil. Roman numbers represent the number of the clade. Outgroup: Oryzomys couesi.

Figure 12. Gene haplotypes network from the genus Oligoryzomys. A) IRBP (541 bp), B) RAG1 (952 bp). Squares represent different clades. AR= Argentina; A BR= Brazil; EC= Ecuador; CR= Costa Rica; HN= Honduras; PGY= Paraguay. FCUP 26 Cryptic diversity in rodents from Costa Rica

3.1.2. Genus Nyctomys

For the analyses of the mitochondrial genes, we retrieved 14 COI and 10 cytb sequences from GenBank (for further information, see Table S1) from Nyctomys sumichrasti and closely related species. Those were analysed together with seven COI and five cytb sequences obtained from our samples. The obtained alignments included 21 COI (657 bp) and 15 cytb (1143 bp) sequences, that corresponded to nine haplotypes for both COI and cytb genes (Table 15 and 17).

Bayesian inference trees from cytb and COI for Nyctomys genus presented well- supported and divergent clades, recoverering six (Figure 13) and four lineages (Figure 14) respectively, with high posterior probability (>0.95). In cytb, Nyctomys sumichrasti is recovered as paraphyletic with Otonyctomys hatti forming a clade within Nyctomys sumichrasti main clade. Cytb phylogeny shows two different well supported clades present in Costa Rica (SV and LAIP). In this sense, SV clade is closer to the Guatemala and El Salvador clades than to the LAIP clade. Some clades present high intraspecific diversities, such as MX II with 9% diversity for cytb.

Regarding the values of interspecifc diversity obtained for cytb, the most similar sequences i.e. the ones which may have splitted from a common ancestor more recently are the ones from El Salvador and those from Selva Verde (4%). The most divergent clades are the clades from Mexico and El Salvador and Guatemala (16 to 17%; Table 16).

Unfortunately, for the COI gene it was not possible to obtain sequences from the samples from LAIP but, we were able to amplify museum samples. These museum samples also cluster in two different clades, two samples clustered with SV clade (samples RVNP and SGCR), while sample MVCR forms a different clade.

The haplotypes showing the higher number of polymorphic sites for COI are the ones from El Salvador and from Selva Verde. The clade from El Salvador (GUES) shows the higest value of nucleotide diversity (5%).

Regarding to the values of interspecific diversity between Nyctomys clades, all clades show high divergence for COI (11 to 16%), being the higest value found while comparing Nyctomys sumichrasti clades from Guatemala and El Salvador (GUES) with the other clade from Guatemala (GU) and the clade from Selva Verde (16%; Table 18).

For the analyses of the nuclear genes, three sequences of IRBP were retrieved from GenBank and were analysed together with four IRBP (912bp) sequences that we obtained. FCUP 27 Cryptic diversity in rodents from Costa Rica

The haplotype network obtained separates clearly the clades including Nyctomys sumichrasti from El Salvador and Honduras (ESNH) from those from Costa Rica, showing a divergence of 0.6% (Figure 15). However, the samples from the two localities within Costa Rica (SV and LAIP) share haplotypes.

Table 15. Genetic indices for intraspecific diversity of the genus Nyctomys with cytb mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description Cytb N H S Hd ± SD π ± SD N. sumichrasti (ES) El Salvador (3) 3 31 1.000 ± 0.272 0.01837 ± 0.00786 N. sumichrasti (GU) Guatemala (1) - - - - N. sumichrasti (MX II) México (2) 2 107 1.000 ± 0.500 0.09361 ± 0.04681 N. sumichrasti (MX I) México (1) - - - - N. sumichrasti (SV) Selva Verde 3 2 2 0.667 ± 0.314 0.00117 ± 0.00055 N. sumichrasti (LAIP) La Amistad INP 2 2 4 1.000 ± 0.500 0.00350 ± 0.00175

Table 16. Estimates of interspecific diversity between clades of the genus Nyctomys and outgroups in the lower triangle for cytb sequences (1140 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 7 8 9 1 Tylomys (GU) 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 2 Ototylomys (HN) 0.18 0.01 0.01 0.01 0.01 0.01 0.01 0.01 3 Otonyctomys (MX) 0.22 0.21 0.01 0.01 0.01 0.01 0.01 0.01 4 N. sumichrasti (ES) 0.23 0.23 0.16 0.01 0.01 0.01 0.01 0.01 5 N. sumichrasti (GU) 0.22 0.22 0.15 0.08 0.01 0.01 0.01 0.01 6 N. sumichrasti (MX I) 0.23 0.23 0.16 0.12 0.13 0.01 0.01 0.01 7 N. sumichrasti (MX II) 0.21 0.22 0.16 0.17 0.16 0.17 0.01 0.01 8 N. sumichrasti (SV) 0.22 0.23 0.15 0.04 0.08 0.12 0.16 0.01 9 N. sumichrasti (LAIP) 0.21 0.22 0.16 0.10 0.09 0.12 0.17 0.09

Table 17. Genetic indices for intraspecific diversity of the genus Nyctomys with COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description COI N H S Hd ± SD π ± SD N. sumichrasti (GUES) Guatemala- El Salvador (2) 2 33 1.000 ± 0.500 0.05023 ± 0.02511 N. sumichrasti (GU) Guatemala (2) 2 2 1.000 ± 0.500 0.00304 ± 0.00152 N. sumichrasti (SV) Selva Verde 6 (1) 5 28 0.857 ± 0.137 0.00143 ± 0.00443 N. sumichrasti (MVCR) Monteverde 1 - - - -

Table 18. Estimates of interspecific diversity between clades of the genus Nyctomys and outgroups in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 7 8 1 Tylomys (MX) 0.01 0.01 0.01 0.01 0.01 0.01 0.01 2 Tylomys (GU) 0.11 0.02 0.01 0,02 0.02 0.02 0.02 3 Ototylomys (MX) 0.17 0.16 0.02 0.01 0.02 0.01 0.01 4 Otonyctomys (MX) 0.18 0.18 0.16 0.01 0.01 0.01 0.01 5 N. sumichrasti (GUES) 0.18 0.19 0.18 0.16 0.01 0.01 0.01 6 N. sumichrasti (GU) 0.19 0.19 0.20 0.16 0.16 0.01 0.01 7 N. sumichrasti (SV) 0.18 0.18 0.18 0.15 0.11 0.16 0.01 8 N. sumichrasti (MVCR) 0.17 0.20 0.19 0.16 0.11 0.15 0.12

FCUP 28 Cryptic diversity in rodents from Costa Rica

Table 19. Genetic indices for intraspecific diversity of the genus Nyctomys with IRBP nDNA sequences (912 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description IRBP N H S Hd ± SD π ± SD N. sumichrasti (ESHN) El Salvador-Honduras (4) 2 6 0.667 ± 0.204 0.00440 ± 0.00135 N. sumichrasti (CR) Costa Rica 8 3 3 0.679 ± 0.122 0.00153 ± 0.00029

Table 20. Estimates of interspecific diversity between clades of the genus Nyctomys in the lower triangle for IRBP sequences (921 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 1 N. sumichrasti (ESHN) 0.003 0.003 2 N. sumichrasti (NA) 0.006 0.002 3 N. sumichrasti (CR) 0.007 0.003

Figure 13. Bayesian inference tree for genus Nyctomys for cytb gene (1143 bp). Purple branches represent our samples. Probabilities of major nodes are indicated. ES= El Salvador; LAIP= La Amistad International Park, Costa Rica; SV= Selva Verde, Costa Rica; GU= Guatemala; MX= Mexico; HN= Honduras. Roman numbers represent the number of the clade. Outgroup: Tylomys nudicaudus.

FCUP 29 Cryptic diversity in rodents from Costa Rica

Figure 14. Bayesian inference tree for genus Nyctomys for COI gene (657 bp). Purple branches represent our samples and museum samples in red. Probabilities of major nodes are indicated. GUES= Guatemala-El Salvador; MVCR= Monteverde, Costa Rica; SV= Selva Verde, Costa Rica; GU= Guatemala, MX= Mexico. Roman numbers represent the number of the clade. Outgroup: Tylomys nudicaudus.

Figure 15. IRBP (912 bp) haplotype network from the genus Nyctomys. FCUP 30 Cryptic diversity in rodents from Costa Rica

3.1.3. Genus Scotinomys

For analyses of mitochondrial genes, we retrieved 44 COI and four cytb sequences from GenBank (for further information, see Table S1). Those were analysed together with 21 COI and 29 cytb sequences obtained from our samples, totalling 65 COI (657 bp) and 25 cytb (1140 bp) sequences, including 19 haplotypes for COI and 18 for cytb genes (Tables 21 and 23).

For the analyses of the nuclear genes, two sequences of RAG1 were retrieved from GenBank and were analysed together with four RAG1 (779 bp) sequences that we obtained (Table 25).

Bayesian inference tree from cytb recovered Scotinomys teguina and Scotinomys xerampelinus as monophyletic clades (Figure 16). Both species hold high intraspecific diversity and form two and three clades respectively congruent with their geographic distribution. Scotinomys xerampelinus is grouped in two clades, being samples from LAIP separated from those from Cartago (CVI) retrieved from GenBank, with a divergence of 6% (Table 22). Scotinomys teguina forms three clades, two of those including samples from two regions in Costa Rica (BCNP and LAIP), showing a divergence of 5%, and the third corresponding to sequences from Honduras with a divergence of 6 to 7% to the other two clades (Table 22).

The Bayesian inference obtained with the COI gene retrieves Scotinomys teguina as paraphyletic, as the two clades of S. teguina from Costa Rica group with both clades of S xerampelinus, though with limited support (Figure 17). The clades within each species show a divergence of around 5% (Table 24). S. teguina from other Mesoamerican countries group in different clades, with moderate to high support. S. teguina from El Salvador seem to be the most divergente clade.

For the analyses of the nuclear gene, RAG1, two sequences were retrieved from GenBank and were analysed together with four sequences that we obtained. Therefore, the haplotype network based on RAG1 (779 bp) only includes sequences from Costa Rica and splits S. xerampelinus from LAIP from S. teguina from BCNP. However, the sequence obtained from S. xerampelinus from San Jose (Costa Rica), share haplotypes with S. teguina from the same region (Figure 18). The two groups detected in the network show a divergence of 1% (Table 26).

FCUP 31 Cryptic diversity in rodents from Costa Rica

Table 21. Genetic indices for intraspecific diversity of the genus Scotinomys with cytb mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description Cytb N H S Hd ± SD π ± SD S. teguina (HN) Honduras 1 (1) 2 41 1.000 ± 0.500 0.040 ± 0.010 S. xerampelinus (LAIP) La Amistad INP 17 10 10 0.825 ± 0.098 0.003 ± 0.000 S. teguina (LAIP) La Amistad INP 5 2 1 0.400 ± 0.237 0.000 ± 0.000 S. teguina (BCNP) Braulio Carrillo NP 6 5 7 0.933 ± 0.122 0.003 ± 0.004 S. teguina (CVI) Cartago Volcán Irazú (2) 1 0 0.000 ± 0.000 0.000 ± 0.000

Table 22. Estimates of interspecific diversity between clades of the genus Scotinomys in the lower triangle for cytb sequences (1140 bp). Upper triangle shows the standard error from 500 bootstrap. Clades 1 2 3 4 5 1 S.teguina (HN) 0.01 0.01 0.01 0.01 2 S. xerampelinus (LAIP) 0.09 0.01 0.01 0.01 3 S. teguina (LAIP) 0.07 0.08 0.01 0.01 4 S. teguina (BCNP) 0.06 0.08 0.05 0.01 5 S. xerampelinus (CVI) 0.09 0.06 0.09 0.09

Table 23. Genetic indices for intraspecific diversity of the genus Scotinomys with COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: haplotype diversity; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description COI N H S Hd ± SD π ± SD S. xerampelinus (CVI) Cartago Volcán Irazú (3) 3 2 1.000 ± 0.272 0.002 ± 0.001 S. xerampelinus (CR) Costa Rica (2) 2 1 1.000 ± 0.500 0.002 ± 0.000 S. teguina (BCNP) Braulio Carrillo NP 3 (7) 7 17 0.867 ± 0.107 0.008 ± 0.003 S. teguina (MX) Mexico (2) 2 1 1.000 ± 0.500 0.002 ± 0.001 S. teguina (ESGUNIHN) El Salvador-Guatemala-Nicaragua-Honduras 4 4 34 1.000 ± 0.177 0.030 ± 0.012 S. teguina (LAIP) La Amistad INP 5 1 0 0.000 ± 0.000 0.000 ± 0.000 S. xerampelinus (LAIP) La Amistad INP 3 2 5 0.667 ± 0.314 0.005 ± 0.002

Table 24. Estimates of interspecific diversity between clades of the genus Scotinomys in the lower triangle for COI sequences (657bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 7 8 9 1 S. xerampelinus (CVI) 0.01 0.01 0.01 0.01 0.01 0.01 0.01 2 S. xerampelinus (CR) 3 S. teguina (BCNP) 0.09 0.02 0.01 0.01 0.01 0.01 0.01 0.01 4 S. teguina (MX) 0.09 0.08 0.08 0.01 0.01 0.01 0.01 0.01 5 S. teguina (GU) 0.08 0.08 0.09 0.06 0.01 0.01 0.01 0.01 6 S. teguina (ESGUNIHN) 0.08 0.07 0.08 0.07 0.07 0.01 0.01 0.01 7 S. teguina (ES) 0.14 0.15 0.15 0.15 0.14 0.15 0.01 0.01 8 S. teguina (LAIP) 0.10 0.05 0.05 0.07 0.10 0.07 0.16 0.01 9 S. xerampelinus (LAIP) 0.05 0.08 0.08 0.09 0.08 0.08 0.15 0.09

Table 25. Genetic indices for intraspecific diversity of the genus Scotinomys with RAG1 nDNA sequences (779 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description RAG1 N H S Hd ± SD π ± SD S. xerampelinus (LAIP) La Amistad INP 4 4 6 1.000 ± 0.177 0.00449 ± 0.00119 S. teguina (BCNP) Braulio Carrillo NP 4 (4) 3 2 0.464 ± 0.200 0.00064 ± 0.00030

FCUP 32 Cryptic diversity in rodents from Costa Rica

Table 26. Estimates of interspecific diversity between clades of the genus Scotinomys in the lower triangle for RAG1 (779 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 1 S. teguina (BCNP) 0.004 2 S. xerampelinus (LAIP) 0.010

Figure 16. Bayesian inference tree for genus Scotinomys for cytb gene (1140 bp). Purple branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. HN= Honduras; BCNP= Braulio Carrillo National Park, Costa Rica; LAIP= La Amistad International Park; CVI= Cartago Volcán Irazú, Costa Rica. Roman numbers represent the number of the clade. Outgroup: Reithrodontomys creper.

FCUP 33 Cryptic diversity in rodents from Costa Rica

Figure 17. Bayesian inference tree for genus Scotinomys for COI gene (657 bp). Purple branches represent our samples. Probabilities of major nodes are indicated. LAIP=La Amistad International Park, Costa Rica; CVI= Cartago, Volcán Irazú, Costa Rica; BCNP= Braulio Carrilo National Park; HN= Honduras; CR= Costa Rica; ESGUNIHN= El Salvador-Guatemala-Nicaragua-Honduras; SAES= Santa Ana, El Salvador; MX= Mexico. Roman numbers represent the number of the clade. Outgroup: Reithrodontomys creper.

Figure 18. RAG1 (779bp) haplotype network from the genus Scotinomys.

FCUP 34 Cryptic diversity in rodents from Costa Rica

3.1.4. Genus Reithrodontomys

To study the genetic diversity of the genus Reithrodontomys, 23 COI (657 bp) and 64 cytb (1047 bp) sequences obtained were analysed together with 160 COI samples and 81 cytb samples retrieved from GenBank (including 6 species for both genes, of which one of them were classified as Reithrodontomys sp.) (Table S1 and Table S2). Summarizing, 137 sequences of cytb gene incluing 100 haplotypes (Table 27) and 183 sequences of cytb gene including 92 haplotypes were analysed (Table 29).

Bayesian inference show from both COI and cytb genes well supported clades for most species, including Reithrodontomys sumichrasti, Reithrodontomys gracilis and Reithrodontomys creper and two new species recently described as R. sp1 and R. sp.2, that cluster with samples from LAIP and BCNP respectively (Figure 19 and 20). However, Reithrodontomys mexicanus was paraphyletic, grouping in three different clades. Two of these clades included samples from México, while the third included samples from Costa Rica. Inter- specific genetic distance shows that most are well separated, being R. sumichrasti the most divergent (16%, Table 28) for cytb and R. mexicanus from Mexico for COI (20%, Table 30). Regarding intra-specific diversity, R. fulvescens (MX) and R. gracilis (MX) are the species showing the highest values (5%, Table 27) for cytb and R. mexicanus for COI (3%, Table 29).

For the nuclear genes analyses, 20 sequences of RAG1 (1026 bp) and 19 of IRBP (851 bp) were obtained from our samples and were analysed together with four sequences of RAG1 and six IRBP sequences retrieved from GenBank (Table 31). The haplotype networks obtained for the nuclear genes (Figure 21) show in general the species as well separated. For RAG1, the two clades corresponding to R. sp1 and R. sp2 are well differentiated, with a divergence of 1.1% (Table 32), while in IRBP they share haplotypes. For IRBP, R. mexicanus from Costa Rica groups with one R. brevisrostris from Nicaragua.

Table 27. Genetic indices for intraspecific diversity of the genus Reithrodontomys with cytb mtDNA sequences (1140 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description Cytb N H S Hd ± SD π ± SD R. sp. (LAIP) La Amistad INP 27 7 19 0.726 ± 0.073 0.007 ± 0.001 R. sp. (BCNP) Braulio Carrillo NP 7 (1) 4 6 0.810 ± 0.130 0.004 ± 0.001 R. mexicanus (MX I) Mexico 10 (9) 9 61 0.978 ± 0.054 0.040 ± 0.004 R. gracilis (MX) Mexico 4 (4) 3 7 0.833 ± 0.222 0.048 ± 0.021 R. microdon (MX I) Mexico 9 (9) 9 46 1.000 ± 0.052 0.036 ± 0.011 R. microdon (MX II) Braulio Carrillo NP 2 (2) 2 0 1.000 ± 0.500 0.005 ± 0.002 R. mexicanus (CR) La Amistad INP 2 (2) 2 0 1.000 ± 0.500 0.005 ± 0.002 R. creper (LAIP) La Amistad INP 25 (4) 17 23 0.937 ± 0.037 0.007 ± 0.001 R. mexicanus (MX II) La Amistad INP 15 (5) 11 32 0.952 ± 0.040 0.013 ± 0.002 R. sumichrasti (MX I) Mexico 14 (14) 14 77 1.000 ± 0.027 0.037 ± 0.005 R. sumichrasti (MX II) Mexico 6 (5) 6 24 1.000 ± 0.096 0.024 ± 0.004 R. fulvescens (MXUSA) Mexico-USA 13 (13) 13 28 1.000 ± 0.030 0.018 ± 0.004 R. fulvescens (MX) Mexico 3 (3) 3 0 1.000 ± 0.272 0.050 ± 0.016 FCUP 35 Cryptic diversity in rodents from Costa Rica

Table 28. Estimates of interspecific diversity between clades of the genus Reithrodontomys in the lower triangle for cytb sequences (1140 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 4 5 6 7 8 9 10 11 12 13 1 R. gracilis (MX) 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 2 R. fulvescens (MXUSA) 0.14 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 3 R. mexicanus (MX II) 0.13 0.14 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 4 R. microdon (MX II) 0.13 0.14 0.13 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 5 R. microdon (MX I) 0.13 0.15 0.13 0.10 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 6 R. mexicanus (CR) 0.13 0.14 0.13 0.11 0.11 0.01 0.01 0.01 0.01 0.01 0.01 0.01 7 R. mexicanus (MX I) 0.12 0.14 0.13 0.12 0.12 0.12 0.01 0.01 0.01 0.01 0.01 0.01 8 R. creper (LAIP) 0.13 0.13 0.14 0.12 0.13 0.12 0.12 0.01 0.01 0.01 0.01 0.01 9 R. fulvescens (MX) 0.14 0.09 0.14 0.14 0.14 0.14 0.14 0.13 0.01 0.01 0.01 0.01 10 R. sp. (BCNP) 0.13 0.15 0.14 0.12 0.14 0.14 0.12 0.14 0.15 0.01 0.01 0.01 11 R. sumichrasti (MX I) 0.15 0.13 0.14 0.13 0.14 0.13 0.14 0.14 0.16 0.15 0.01 0.01 12 R. sumichrasti (MX II) 0.15 0.12 0.14 0.13 0.14 0.13 0.14 0.15 0.10 0.16 0.07 0.01 13 R. sp. (LAIP) 0.14 0.15 0.15 0.13 0.14 0.14 0.12 0.14 0.15 0.10 0.15 0.15

Table 29. Genetic indices for intraspecific diversity of the genus Reithrodontomys with COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description COI N H S Hd ± SD π ± SD R. sumichrasti (CRMXGU) Costa Rica-Mexico-Guatemala 6 (1) 6 9 1.000 ± 0.096 0.00680 ± 0.00117 R. mexicanus (CRNIES) Costa Rica-Nicaragua-El Salvador 1 (18) 19 56 1.000 ± 0.017 0.02894 ± 0.00147 R. sp2 BCNP Braulio Carrillo NP 6 (2) 5 8 0.857 ± 0.108 0.00435 ± 0.00109 R. sp1 LAIP La Amistad INP 8 (1) 4 11 0.694 ± 0.147 0.00567 ± 0.00131 R. creper LAIP La Amistad INP 6 (16) 22 30 1.000 ± 0.014 0.00561 ± 0.00089

Table 30. Estimates of interspecific diversity between clades of the genus Reithrodontomys in the lower triangle for COI sequences (657 bp). Upper triangle shows the standard error from 500 bootstrap replicates.

Clades 1 2 3 4 5 6 7 8 9 10 11 12 1 R. sumichrasti (CRMXGU) 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 2 R. microdon (GU) 0.11 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 3 R. gracilis (MX) 0.14 0.10 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 4 R. mexicanus (CRNIES) 0.13 0.09 0.09 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 5 R. mexicanus (NA) 0.12 0.10 0.10 0.06 0.01 0.01 0.01 0.01 0.01 0.01 0.01 6 R. sp.2 BCNP 0.14 0.09 0.08 0.08 0.09 0.01 0.01 0.01 0.01 0.01 0.01 7 R. sp.1 LAIP 0.13 0.09 0.10 0.10 0.10 0.07 0.01 0.01 0.01 0.01 0.01 8 R. fulvescens (MXUSA) 0.12 0.13 0.14 0.13 0.12 0.13 0.13 0.01 0.01 0.01 0.01 9 R. fulvescens (USA) 0.12 0.12 0.13 0.12 0.13 0.14 0.15 0.12 0.01 0.01 0.01 10 R. creper (LAIP) 0.12 0.12 0.13 0.12 0.12 0.13 0.13 0.14 0.14 0.01 0.01 11 R. gracilis (MX II) 0.18 0.18 0.19 0.19 0.18 0.19 0.19 0.18 0.17 0.19 0.01 12 R. mexicanus (MX) 0.16 0.14 0.16 0.17 0.17 0.16 0.15 0.17 0.16 0.18 0.20

Table 31. Genetic indices for intraspecific diversity of the genus Reithrodontomys with RAG1 mtDNA sequences (1253 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description RAG1 N H S Hd ± SD π ± SD R. creper (CR) Costa Rica 6 (2) 6 8 0.893 ± 0.111 0.00188 ± 0.00057 R. sp. (BCNP) Braulio Carrillo National Park 8 5 8 0.857 ± 0.108 0.00268 ± 0.00038 R. sp. (LAIP I) La Amistad INP 14 6 7 0.835 ± 0.062 0.00213 ± 0.00021 R. sp. (LAIP II) La Amistad INP 4 2 1 0.500 ± 0.265 0.00040 ± 0.00021

FCUP 36 Cryptic diversity in rodents from Costa Rica

Table 32. Estimates of interspecific diversity between clades of the genus Reithrodontomys in the lower triangle for RAG1 sequences (1253 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 1 R. sp. (LAIP I) 0.003 0.002 0.001 0.004 0.003 2 R. sp. (LAIP II) 0.011 0.003 0.003 0.004 0.004 3 R. creper (CR) 0.009 0.010 0.003 0.004 0.003 4 R. sp. (BCNP) 0.003 0.012 0.010 0.004 0.003 5 R. megalotis (MX II) 0.019 0.019 0.016 0.020 0.004 6 R. gracilis (MX I) 0.014 0.017 0.013 0.014 0.022

Reithrodontomis tenuirostris Reithrodontomis tenuirostris

Figure 19. Bayesian inference tree for genus Reithrodontomys for cytb gene (1140 bp). Purple branches represent our samples and museum samples are in red. LAIP= La Amistad International Park, Costa Rica; CVI= Cartago, Volcán Irazú, Costa Rica; BCNP= Braulio Carrilo National Park Probabilities of major nodes are indicated. Outgroup: Peromyscus mexicanus.

FCUP 37 Cryptic diversity in rodents from Costa Rica

Figure 20. Bayesian inference tree for genus Reithrodontomys for COI gene (658 bp). Purple branches represent our samples and museum samples are in red. LAIP= La Amistad International Park, Costa Rica; CRNIES= Costa Rica-Nicaragua-El Salvador; CRMXGU= Costa Rica-Mexico-Guatemala; BCNP= Braulio Carrilo National Park; MXUSA= Mexico-United States; MX=Mexico; GU= Guatemala; USA= United States; NA= Not available. Probabilities of major nodes are indicated. Outgroup: Scotinomys teguina.

FCUP 38 Cryptic diversity in rodents from Costa Rica

A B

Figure 21. A) RAG1 (1253 bp) and B) IRBP (894bp) haplotype networks from the genus Reithrodontomys.

FCUP 39 Cryptic diversity in rodents from Costa Rica

3.1.5. Genus Proechimys

For the analyses of the mitochondrial genes, we retrived six COI and 34 cytb sequences from GenBank (for further information, see Table S1). Those were analysed together with six COI and 10 cytb sequences obtained from our samples, totalling 12 COI (658 bp) and 44 cytb (1127 bp) sequences, including nine haplotypes for both COI and cytb genes (Tables 33 and 35). In adition to Proechimys semispinosus, the species occurring in Costa Rica, sequences from other two species of Proechimys genus, Proechimys longicaudatus and Proechimys cuvieri were included in the analyses.

Bayesian inference trees from cytb and COI presented well-supported and divergent clades with most species forming monophyletic groups (posterior probability >0.95, Figure 22 and 23). The exception is in one of the clades of P. cuvieri in cytb, that clusters with P. longicaudatus (Figure 23).

Our samples presented a small number of polymorphic sites and therefore the lowest values of haplotype, nucleotide and intraspecific diversity (Tables 33 and 35). On the other hand, the samples retrieved from NCBI present several polymorphic sites, mainly in the case of Proechimys semispinosus I (15, Table 33) for cytb. Regarding the values of divergence between clades, the higest value for COI was found while comparing Proechimys cuvieri with Proechimys semispinosus MANP (10%) and the lowest value were registered when comparing the different samples of the species Proechimys semispinosus (COI: 4%; cytb: 4- 6%, Tables 34 and 36).

For the analyses of the nuclear genes, six sequences of RAG1 were retrieved from GenBank and were analysed together with four IRBP sequences that we obtained (Table 37).

The haplotype network based on RAG1 (918bp) shows moderate diversity within Proechimys semispinosus (0.4%), though there is some haplotype sharing between the

samples from the different regions in Costa Rica (Figure 24, Table 38).

Table 33. Genetic indices for intraspecific diversity of the genus Proechimys with cytb mtDNA sequences (1127 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description Cytb N H S Hd ± SD π ± SD P. semispinosus I NA (3) 3 15 1.000 ± 0.272 0.0087 ± 0.0038 P. semispinosus (SV) Selva Verde 4 1 0 0.000 ± 0.000 0.0000 ± 0.0000 P. semispinosus (MANP) Manuel Antonio NP 1 1 - - - P. semispinosus (LAIP) La Amistad INP 3 1 0 0.000 ± 0.000 0.0000 ± 0.0000

FCUP 40 Cryptic diversity in rodents from Costa Rica

Table 34. Estimates of interspecific diversity between clades of the genus Proechimys in the lower triangle for cytb sequences (1127 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 7 1 P. semispinosus (SV) 0.01 0.01 0.01 0.01 0.01 0.01 2 P. semispinosus (MANP) 0.05 0.01 0.01 0.01 0.01 0.01 3 P. semispinosus (LAIP) 0.04 0.06 0.01 0.01 0.01 0.01 4 P. longicaudatus 0.10 0.11 0.11 0.01 0.01 0.01 5 P. cuvieri 0.09 0.11 0.09 0.10 0.00 0.01 6 P. cuvieri (FGY) 0.10 0.11 0.10 0.11 0.03 0.01 7 P. semispinosus I 0.04 0.06 0.05 0.10 0.10 0.10

Table 35. Genetic indices for intraspecific diversity of the genus Proechimys with COI mtDNA sequences (657 bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description COI N H S Hd ± SD π ± SD P. semispinosus (SV) Selva Verde 3 2 1 1.000 ± 0.5000 0.0015 ± 0.0007 P. semispinosus (MANP) Manuel Antonio NP 2 1 0 0.000 ± 0.0000 0.0000 ± 0.0000 P. semispinosus (LAIP) La Amistad INP 2 1 0 - 0.0000 ± 0.0000 P. semispinosus I NA (3) 2 8 0.667 ± 0.314 0.0081 ± 0.0038

Table 36. Estimates of interspecific diversity between clades of the genus Proechimys in the lower triangle for COI sequences (657bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 3 4 5 6 1 P. longicaudatus 0.01 0.01 0.01 0.01 0.01 2 P. semispinosus I 0.08 0.01 0.01 0.01 0.01 3 P. cuvieri (GY) 0.09 0.08 0.01 0.01 0.01 4 P. semispinosus (MANP) 0.09 0.04 0.10 0.01 0.01 5 P. semispinosus (LAIP) 0.09 0.04 0.09 0.04 0.01 6 P. semispinosus (SV) 0.09 0.04 0.09 0.04 0.04

Table 37. Genetic indices for intraspecific diversity of the genus Proechimys with RAG1 nDNA sequences (918bp) for each clade identified according to Bayesian inference. N: Number of sequences obtained in this study (retrieved sequences from GenBank in parentheses); H: Number of haplotypes; S: Polymorphic sites; Hd: Haplotype diversity; π: Nucleotide diversity.

Clade Description RAG1 N H S Hd ± SD π ± SD P. semispinosus (SV) Selva Verde 8 2 2 0.536 ± 0.123 0.0011 ± 0.0002 P. semispinosus (MANP) Manuel Antonio NP 8 6 9 0.929 ± 0.084 0.0000 ± 0.0000

Table 38. Estimates of interspecific diversity between clades of the genus Proechimys in the lower triangle for RAG1 sequences (918 bp). Upper triangle shows the standard error from 500 bootstrap replicates. Clades 1 2 1 P. semispinosus (SV+LAIP) 0.002 2 P. semispinosus (MANP+LAIP) 0.004

FCUP 41 Cryptic diversity in rodents from Costa Rica

Figure 22. Bayesian inference tree for genus Proechimys for COI gene (658 bp). Purple branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. Outgroup: Hoplomys gymnurus. FCUP 42 Cryptic diversity in rodents from Costa Rica

Figure 23. Bayesian inference tree for genus Proechimys for cytb gene (1127 bp). Purple branches represent our samples and museum samples are in red. Probabilities of major nodes are indicated. Outgroup: Hoplomys gymnurus.

Figure 24. RAG1 (918 bp) haplotype network from the genus Proechimys. FCUP 43 Cryptic diversity in rodents from Costa Rica

4. Discussion

Our phylogenetic analyses based on mitochondrial DNA sequences (cytb and COI genes) and nuclear sequences (IRBP and RAG1 genes) showed a high genetic diversity in the five small mammal genus analysed from Costa Rica in congruence with previous studies conducted in the region. Morevover, several situations of divergent mitochondrial lineages were detected, in some cases congruent with nuclear data, that highlight the need of taxonomic revisions and further studies in the area.

Oligoryzomys Bayesian Inference for COI gene showed that O. fulvescens is grouped in four well-supported lineages, with high divergence rates (between 7 and 10%), similar to the distances estimated between O. fulvescens and the other Oligoryzomys species included in the analyses. These high levels of intra and inter-specific diversity were also documented by Weksler and Bonvicino (2005). Individuals identified as O. vegetus, cluster in two different clades together with new and published sequences of O. fulvescens. The two species also share haplotypes and/or cluster together in both haplotype networks obtained for the nuclear genes. These two species occur in Costa Rica, with an overlapping distribution (Carleton and Musser 1995), and according to Rogers et al. (2009) O. vegetus may present “fulvescens-like” morphology, whereas O. fulvescens may present “vegetus-like” morphology. The two clades identified from the samples in Costa Rica may represent these two species, however, further data and a morphological revision of the specimens analysed is needed. More laboratory effort is also needed to amplify correctly samples of this genus for cytb gene, as there is already some information available for this gene in these species in the public databases.

Nyctomys presents the highest levels of intraspecific diversity and divergence between clades followed by Reithrodontomys, which is in congruence with previous studies in these genus (e.g. Musser and Carleton, 2005). Bayesian inference trees for Nyctomys obtained from cytb sequences shows Nyctomys sumichrasti as paraphyletic, though this is not congruent with the results obtained for COI. This lack of congruence between genes, may be due to the fact that there is different amount of information available for both genes, being that data from Nyctomys from Mexico is only available for cytb. These results obtained for cytb are in accordance with those of Corley et al. (2011). Moreover, several clades were retrieved within Nyctomys sumichrasti, including within Costa Rica, where two different clades, with a consistent geographic distribution, were detected with high levels of divergence. At the nuclear level fewer information was available, and although the samples of the two sites in Costa Rica shared haplotypes, these were separated from those from Honduras and El Salvador. In sum, the divergence pattern of this species is still poorly known, so a reassessment of the taxonomy FCUP 44 Cryptic diversity in rodents from Costa Rica

regarding both Nyctomys and Otonyctomys is important as proposed by Timm and LaVal (2000).

For the genus Scotinomys, the two mitochondrial genes analysed provided different results. While in cytb Bayesian inference the two species S. teguina and S. xerampelinus are monophyletic and sister species (Hooper 1972), in COI Bayesian inference S. teguina is paraphyletic. For COI there is more data available for S. teguina from different regions within its distribution range, however, the support for the nodes is also lower in COI. Nevertheless, both genes are congruent in identifying, two or three clades within each species in Costa Rica, consistent with the geographic distribution of the samples. Despite the limited information available related for these species, Pino et al. (2009; 2011; 2012), using mitochondrial and nuclear markers, found evidence of cryptic speciation in these two species suggesting a demographic history of bottleneck in the southernmost of populations of S. teguina and recent expansion in northern populations, while S. xerampelinus probably presented disjunct populations that likely expanded from the previous distributional range. Although the information is limited for the nuclear gene RAG1 analysed, our results separate S. xerampelinus from southern Costa Rica from S. teguina and S. xerampelinus from central Costa Rica. In sum, these results highlight the importance of gathering additional molecular data and performing a systematic re-evaluation of the two species of singing mice within their distribution range as current data points to the possibility of cryptic divergence in these species.

For the genus Reithrodontomys we found high levels of intra and interspecific diversity, with most species forming monophyletic clades, with the exception of R. mexicanus. Morevoer, within Costa Rica, we provided information supporting the two recently detected species (R. sp1 and R. sp2), that corresponded to samples from BCNP, central Costa Rica and LAIP, southern Costa Rica, respectively. These two cryptic species are shown as well diferented in the nuclear gene RAG1, but they share haplotypes in the IRBP gene. This lack of congruence in the two nuclear genes analysed may be due to introgression of lineage sorting. The paraphyletic relationships found in Reithrodontomys mexicanus, had been already reported by Arellano et al. (2003) attributing them to physiogeographic characteristics of southern Mexico and Central America, as is also the case of R. sumichrasti, for which the Isthmus of Tehuantepec represents an effective vicariant physiogeographic barrier of gene flow. This and other previous studies show the taxonomic and phylogenetic complexity of the cricetids of the New World. Following Gardner & Carleton (2009), the subspecies of Reithrodontomys mexicanus are treated in this document: R. m. garichensis and R. m. cherrii at a specific level and as different from R. mexicanus, in addition to R. m. potrerograndei as a synonym for R. brevirostris. In fact, the samples of R. mexicanus from Costa Rica, sequenced FCUP 45 Cryptic diversity in rodents from Costa Rica

in the present study cluster, in the nuclear gene IRBP with R. brevirostri, which may indicate that these may correspond to this species. All these evidences indicate that additional information is needed including morphological data, as other external characteristics and cranial measures that will be very useful in the species discrimination process at detailed.

Proechimys semispinosus showed a clear separation of the clades corresponding to Costa Rica from those retrieved from GenBank from other regions within the distribution range, being that this intraspecific divergence has not been reported before. Morevover, within Costa Rica, different lineages were detected that showed similar divergences of around 4%. Despite this high diversity at the mitochondrial level, the nuclear DNA gene analysed showed lower diversites and sharing of haplotypes between the mitochondrial lineages detected. This high diversity in this species may be related to differences in ecological traits and to the short life cycles that allow for a high rate of recovery and diversification of the species in the Echimyidae group, especially in dynamic environments like most tropical ecosystems (Rocha et al. 2014).

In general, the results of this study highlight the high levels of genetic diversity in these five small mammal genera. This indicates that further information is needed, both at the molecular, morphological and ecological level for clarifying these patterns of cryptic diversity and understanding the mechanisms behind this differentiation. FCUP 46 Cryptic diversity in rodents from Costa Rica

5. References

Almendra AL, Rogers DS. 2012. Biogeography of Central American Mammals. Bones, Clones, and Biomes: The History and Geography of Recent Neotropical Mammals. 203p.

Alston. 1876. Hesperomys teguina ALSTON, Proceedings of the Zoological Society of London. 755p.

Anderson RP, Timm RM. 2006. A New Montane Species of Spiny Pocket Mouse (Rodentia: Heteromyidae: Heteromys) from Northwestern Costa Rica. American Museum Novitates. 3509: 1-38.

Antoine PO, Marivaux L, Croft DA, Billet G, Ganerød M, Jaramillo C, Martin T, Orliac MJ, Tejada J, Altamirano AJ, Duranthon F, Fanjat G, Rousse S, Gismondi RS. 2012. Middle Eocene rodents from Peruvian Amazonia reveal the pattern and timing of caviomorph origins and biogeography. Proceedings of the Royal Society B. 279: 1319-1326.

Aplin KN, Singleton GR. 2003. Balancing rodent management and small mammal conservation in agricultural landscapes: challenges for the present and the future. CSIRO Sustainable Ecosystems, GPO Box 284, Canberra, ACT 2601, AUSTRALIA.

Arellano E, Rogers DS, González-Cozátl FX. 2006. Sistemática molecular del género Reithrodontomys (Rodentia: Muridae). In Vázquez-Dominguez E, Hafner DJ (editors), Genética y mamíferos mexicanos: presente y futuro: 27-35. New Mexico Museum of Natural History and Science Bulletin 32.

Arellano E, González-Cozátl FX, Rogers DS. 2005. Molecular Systematics of Middle American Harvest Mice Reithrodontomys (Muridae), Estimated from Mitochondrial Cytochrome b Gene Sequences. Molecular Phylogenetics and Evolution. 37: 529-40.

Arellano E, Rogers DS, Cervantes FA. 2003. Genetic differentiation and phylogenetic relationships among tropical harvest mice (Reithrodontomys: subgenus Aporodon). Journal of Mammalogy. 84: 129-143.

Asher RJ. 2007. A web-database of mammalian morphology and a reanalysis of placental phylogeny. BMC Evolutionary Biology. 7(1): 108.

Avise JC. 2000. Phylogeography: the History and Formation of Species. Harvard University Press. FCUP 47 Cryptic diversity in rodents from Costa Rica

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel J, Reeb CA, Saunders NC. 1987. Intraspecific Phylogeography: The Mitochondrial DNA Bridge Between Population Genetics and Systematics. Annual Review of Ecology and Systematics. 18(1): 489–522.

Bandelt H, Forster P, Röhl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution. 16(1): 37-48.

Bangs O. 1902. Chiriqui mammalia. Bulletin of the Museum of Comparative Zoology. 39(24).

Barbosa S, Paupério J, Searle JB, Alves PC. 2013. Genetic identification of Iberian rodent species using both mitochondrial and nuclear loci: application to noninvasive sampling. Molecular Ecology Resources. 13(1): 43-56.

Beheregaray LB, Caccone A. 2007. Cryptic biodiversity in a changing world. Journal of Biology. 832(6): 9.

Bensasson D. 2001. Mitochondrial pseudogenes: evolution’s misplaced witnesses. Trends in Ecology & Evolution. 16(6): 314-321.

Bickford D, Lohman DJ, Sodhi NS, Ng PK, Meier R, Winker K, Ingram KK, Das I. 2007. Cryptic species as a window on diversity and conservation. Trends in Ecology & Evolution. 22: 148-155.

Bradley RD, Henson DD, Durish ND. 2008. Re-evaluation of the Geographic Distribution and Phylogeography of the Sigmodon hispidus Complex Based on Mitochondrial DNA Sequences. Southwestern Naturalist. 53: 301-10.

Brakes CR, Smith RH. 2005. Exposure of non-target small mammals to rodenticides: short- term effects, recovery and implications for secondary poisoning. Journal of Applied Ecology. 42: 118-128.

Brown WM, George M, Wilson AC. 1979. Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences. 76(4): 1967-1971.

Buckley-Beason VA, Johnson WE, Nash WG, Stanyon R, Menninger JC, Driscoll CA,... O’Brien SJ. 2006. Molecular Evidence for Species-Level Distinctions in Clouded Leopards. Current Biology. 16(23): 2371-2376.

Cann RL, Wilson AC. 1983.Length mutations in human mitochondrial DNA. Genetics. 104(4): 699-7.

Carleton MD, Musser GG. 1995. Systematic Studies of Oryzomyine Rodents (Muridae, Sigmodontinae) - Definition and Distribution of Oligoryzomys vegetus (Bangs 1902). Proceedings of the Biological Society of Washington. 108 (2): 338-369. FCUP 48 Cryptic diversity in rodents from Costa Rica

Carleton MD, Musser GG. 1989. Systematic Studies of Oryzomyine Rodents (Muridae, Sigmodontinae): A Ceballos G, Ehrlich PR. 2006. Global mammal distributions, biodiversity hotspots, and conservation. Proceedings of the National Academy of Sciences. 103(51): 19374-19379.

Carleton MD. 1980. Phylogenetic relationships in neotomine-peromyscine rodents (Muroidea) and a reappraisal of the dichotomy within New World Cricetinae. Miscellaneous Publications, Museum of Zoology, University of Michigan. 157: 1-146.

Castresana, J. (2001). Cytochrome b Phylogeny and the Taxonomy of Great Apes and Mammals. Molecular Biology and Evolution. 18(4): 465-471.

Ceballos G, Ehrlich PR. 2006. Global mammal distributions, biodiversity hotspots, and conservation. Proceedings of the National Academy of Sciences. 103(51): 19374- 19379.

Ceballos G, Arroyo-Cabrales J, Medellín RA, Domínguez-Castellanos Y. 2005. Lista actualizada de los mamíferos de México. Rev. Mex. Mastozoo. 9: 21-71.

Ceballos G, Arroyo-Cabrales J, Medellín RA. 2002. The mammals of Mexico: composition, distribution, and conservation status. Occasional Papers, Museum of Texas Tech University. 218: 1-27.

Cervantes FA, Ramírez-Vite FN, Ramírez-Vite S, Ballesteros C. 2004. New records of mammals from Hidalgo and Guerrero, Mexico. The Southwestern Naturalist. 49: 122- 124.

Clare EL. 2011. Cryptic Species? Patterns of Maternal and Paternal Gene Flow in Eight Neotropical Bats. PLoS ONE. 6(7), e21460.

Coates AG, Collins LS, Aubry MP, Berggren WA. 2004. The geology of the Darien, Panama, and the late Miocene-Pliocene collision of the Panama arc with northwestern South America. Geological Society of America Bulletin. 116(11-12): 1327-1344.

Cody S, Richardson JE, Rull V, Ellis C, Pennington RT. 2010. The Great American Biotic Interchange revisited. Ecography. 33: 326-332.

Corley MS, Ordóñez-Garza N, Rogers DS, Bradley RD. 2011. Molecular evidence for paraphyly in Nyctomys sumichrasti: support for a new genus of vesper mice? Occasional Papers Museum of Texas Tech University. 306: 1-10.

Costello MJ, May RM, Stork NE. 2013. Can we name Earth’s species before they go extinct? Science. 339: 413-416. FCUP 49 Cryptic diversity in rodents from Costa Rica

Dabney J, Knapp M, Glocke I, Gansauge MT, Weihmann A, Nickel B, Valdiosera C, García N, Pääbo S, Arsuaga JL, Meyer M. 2013. Complete Mitochondrial Genome Sequence of a Middle Pleistocene Cave Bear Reconstructed from Ultrashort DNA Fragments. Proceedings of the National Academy of Sciences. 110(39): 15758-63. da Silva MN. 1998. Four new species of spiny rats of the genus Proechimys (Rodentia: Echimyidae) from the western Amazon of Brazil. Proceeding of Biological Society of Washington. 111: 436-71.

Eisenberg JF, Redford KH. 1999. The contemporary mammalian fauna. Mammals of the Neotropics. In: The central Neotropics: Ecuador, Peru, Bolivia, Brazil. 3: 49-522.

Eisenberg JF. 1989. Mammals of the Neotropics (1). The northern Neotropics: Panama, Colombia, Venezuela, Guyana, Suriname, French Guiana. Chicago University Press, Chicago.

Elbrecht V, Leese F. 2017. Validation and Development of COI Metabarcoding Primers for Freshwater Macroinvertebrate Bioassessment. Frontiers in Environmental Science, 5.

Emmons LH. 1997. Neotropical rainforest mammals: a field guide. University of Chicago Press, Illinois.

Emmons L, Feer F. 1997. Neotropical rainforest mammals: a field guide. University of Chicago Press, Illinois.

Enders RK, Pearson OP. 1939. Three new rodent subspecies of Scotinomys from Chiriquí, Panama. Academy of Natural Sciences of Philadelphia. 34: 1-4.

Esposti DM, De Vries S, Crimi M, Ghelli A, Patarnello T, Meyer A. 1993. Mitochondrial cytochrome b: evolution and structure of the protein. Biochimica et Biophysica Acta (BBA)-Bioenergetics. 1143(3): 243-271.

Evans BJ, Kelley DB, Melnick DJ, Cannatella DC. 2005. Evolution of RAG-1 in polyploid clawed frogs. Molecular Biology and Evolution. 22(5): 1193-1207.

Friesen VL, Congdon BC, Kidd MG, Birt TP. 1999. Polymerase chain reaction (PCR) primers for the amplification of five nuclear introns in vertebrates. Molecular Ecology. 8(12): 2147-2149.

Gaines CA, Hare MP, Beck SE, Rosenbaum HC. 2005. Nuclear markers confirm taxonomic status and relationships among highly endangered and closely related right whale species. Proceedings of the Royal Society. 272: 533-542.

FCUP 50 Cryptic diversity in rodents from Costa Rica

Gardner AL, Carleton MD. 2009. A New Species of Reithrodontomys, Subgenus Aporodon (Cricetidae: Neotominae), from the Highlands of Costa Rica, with Comments on Costa Rican and Panamanian Reithrodontomys. In Systematic Mammalogy: Contributions in Honor of Guy G. Musser, edited by R. S. Voss and M. D. Carleton. 331: 157-82. New York: Bulletin of the American Museum of Natural History.

Groth JG, Barrowclough GF. 1999. Basal divergences in birds and the phylogenetic utility of the nuclear RAG-1 gene. Molecular phylogenetics and evolution. 12(2): 115-123.

Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PDN. 2006. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences. 103(4): 968-971.

Halffter G. 1987. Biogeography of the montane entomofauna of Mexico and Central America. Annual Review of Entomology. 32: 95-114.

Hall ER. 1981. The mammals of North America. 2nd ed. John Wiley & Sons, New York. 2: 601-1181 + 90.

Hanson JD, Bradley RD. 2008. Molecular diversity within Melanomys caliginosus (Rodentia: Oryzomyini): evidence for multiple species. Occasional Papers, Museum of Texas Tech University. 275:1-11.

Hare MP, Palumbi SR. 2003. High intron sequence conservation across three mammalian orders suggests functional constraints. Molecular Biology and Evolution. 20(6): 969-978.

Harrison RG. 1989. Animal mitochondrial DNA as a genetic marker in population and evolutionary biology. Trends Ecol. Evol. 4: 6-11.

Hebert PD, Ratnasingham S, De Waard JR. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London. Series B: Biological Sciences. 270(suppl_1): S96-S99.

Hill RW, Hooper ET. 1971. Temperature regulation in mice of the genus Scotinomys. Journal of Mammalogy. 52(4): 806-816.

Hillis DM. 1996. Applications of molecular systematics: The state of the field and a look to the future. In: Molecular Systematics. 515-543.

Hooper ET, Carleton MD. 1976. Reproduction, growth and development in two contiguously allopatric rodent species, genus Scotinomys. Miscellaneous Publications of the Museum of Zoology, University of Michigan. 151: 1-52. FCUP 51 Cryptic diversity in rodents from Costa Rica

Hooper ET. 1972. A synopsis of the rodent genus Scotinomys. Occasional Papers of the Museum of Zoology, University of Michigan. 665: 1-32.

Hooper ET. 1952. A systematic review of the harvest mice (genus Reithrodontomys) of Latin America. Miscellaneous Publications of the Museum of Zoology, University of Michigan. 77: 1-225.

Howell AH. 1914. Revision of the American harvest mice: (Genus Reithrodontomys). North American Fauna. 1-97.

Huchon D, Madsen O, Sibbald M, Ament K, Stanhope M, Catzeflis F, de Jong W, Douzery E. 2002. Rodent phylogeny and a timescale for the evolution of Glires: evidence from an extensive taxon sampling using three nuclear genes. Molecular Biology and Evolution. 19: 1053–1065.

Hugall AF, Foster R, Lee MS. 2007. Calibration choice, rate smoothing, and the pattern of tetrapod diversification according to the long nuclear gene RAG-1. Systematic biology. 56(4): 543-563.

Hunt JL, Morris JE, Best TL. 2004. Nyctomys sumichrasti. Mammalian Species. 754(1): 1.

Hsieh HM, Chiang HL, Tsai LC, Lai SY, Huang NE, Linacre A, Lee JCI. 2001. Cytochrome b gene for species identification of the conservation animals. Forensic Science International. 122(1): 7-18.

Irwin DM, Kocher TD, Wilson AC. 1991. Evolution of the cytochromeb gene of mammals. Journal of Molecular Evolution. 32(2): 128-144.

Jaarola M, Searle JB. 2002. Phylogeography of field voles (Microtus agrestis) in Eurasia inferred from mitochondrial DNA sequences. Molecular Ecology. 11(12): 2613-2621.

Jansa SA, Voss RS. 2000. Phylogenetic studies on didelphid marsupials I. Introduction and preliminary results from nuclear IRBP gene sequences. Journal of Mammalian Evolution. 7: 43-77.

Janzen DH, Hajibabaei M, Burns JM, Hallwachs W, Remigio E, Hebert PDN. 2005. Wedding biodiversity inventory of a large and complex Lepidoptera fauna with DNA barcoding. Philosophical Transactions of The Royal Society B. 360: 1835–1845.

Jenkins CN, Giri C. 2008. Protection of Mammal Diversity in Central America. Conservation Biology. 22(4): 1037-1044. FCUP 52 Cryptic diversity in rodents from Costa Rica

Kluge J, Kessler M, Dunn RR. 2006. What drives elevational patterns of diversity? A test of geometric constraints, climate and species pool effects for pteridophytes on an elevational gradient in Costa Rica. Global Ecology and Biogeography. 15(4): 358-371.

Kohlmann B, Solis A, Elle O, Soto X, Russo R. 2007. Biodiversity, conservation, and hotspot atlas of Costa Rica: a dung beetle perspective (Coleoptera: Scarabaeidae: Scarabaeinae). Zootaxa. 1457(1): 1-34.

Krenz JG, Naylor GJ, Shaffer HB, Janzen FJ. 2005. Molecular phylogenetics and evolution of turtles. Molecular phylogenetics and Evolution. 37(1): 178-191.

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547-1549.

Kumazawa Y, Nishida M. 2000. Molecular phylogeny of osteoglossoids: a new model for Gondwanian origin and plate tectonic transportation of the Asian arowana. Molecular Biology and Evolution. 17(12): 1869-1878.

Lambert TD, Adler GH. 2000. Microhabitat use by a tropical forest rodent, Proechimys semispinosus, in Central Panama. Journal of Mammalogy. 81: 70-76.

Leigh JW, Bryant D. 2015. PopART: Full-feature software for haplotype network construction. Methods in Ecology and Evolution. 6(9): 1110-1116.

León-Paniagua L, Navarro-Sigüenza AG, Hernández-Baños BE, Morales JC. 2007. Diversification of the arboreal mice of the genus Habromys (Rodentia: Cricetidae: Neotominae) in the Mesoamerican highlands. Molecular Phylogenetics and Evolution. 42(3): 653-664.

Librado P, Rozas J. 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 25(11): 1451-1452.

Low VL, Adler PH, Takaoka H, Ya’cob Z, Lim PE, Tan TK, Lim YA, Chen CD, Norma-Rashid Y, Sofian-Azirun M. 2014. Mitochondrial DNA markers reveal high genetic diversity but low genetic differentiation in the black fly Simulium tani Takaoka & Davies along an elevational gradient in Malaysia. PLoS One 9: e100512.

Lydeard C, Roe KJ. 1997. The phylogenetic utility of the mitochondrial cytochrome b gene for inferring relationships among actinopterygian fishes. Molecular Systematics of Fishes. 285-303. FCUP 53 Cryptic diversity in rodents from Costa Rica

Marshall JS. 2007. The geomorphology and physiographic provinces of Central America. Central America: geology, resources and hazards. 1: 75-121.

Marshall LG. 1979. A model for paleobiogeography of South American cricetine rodents. Paleobiology. 5(2): 126-132.

Marshall CJ, Liebherr JK. 2000. Cladistic biogeography of the Mexican transition zone. Journal of biogeography. 27(1): 203-216.

Matthee CA, Tilbury CR, Townsend T. 2004. A phylogenetic review of the African leaf chameleons: genus Rhampholeon (Chamaeleonidae): the role of vicariance and climate change in speciation. Proceedings of the Royal Society of London. Series B: Biological Sciences. 271(1551): 1967-1975.

McCain CM. 2004. The mid‐domain effect applied to elevational gradients: species richness of small mammals in Costa Rica. Journal of Biogeography. 31(1): 19-31.

McKenna M C, Bell SK. 1997. Classification of mammals: above the species level. Columbia University Press.

Meijden A, Vences M, Meyer A. 2004. Novel phylogenetic relationships of the enigmatic brevicipitine and scaphiophrynine toads as revealed by sequences from the nuclear RAG–1 gene. Proceedings of the Royal Society of London. Series B: Biological Sciences. 271(suppl_5): S378-S381.

Miller JR, Engstrom MD. 2008. The relationships of major lineages within peromyscine rodents: a molecular phylogenetic hypothesis and systematic reappraisal. Journal of Mammalogy. 89(5): 1279-1295.

Miranda CL, da Silva MN. 2015. Roedores equimídeos da Amazônia brasileira: composição, distribuição geográfica e diagnoses, in MendesOliveira AC, Miranda CL (eds): Pequenos mamíferos não voadores da Amazônia brasileira. Sociedade Brasileira de Mastozoologia, Serie Livros 2, Rio de Janeiro.

Myers N, Mittermeier RA, Mittermeier CG, Da Fonseca GA, Kent J. 2000. Biodiversity hotspots for conservation priorities. Nature. 403(6772): 853.Mora C, Tittensor DP, Adl S, Simpson AG, Worm B. 2011. How many species are there on Earth and in the ocean? PLoS biology. 9(8), e1001127.

Morrone JJ. 2010. Fundamental biogeographic patterns across the Mexican Transition Zone: an evolutionary approach. Ecography. 33(2): 355-361. FCUP 54 Cryptic diversity in rodents from Costa Rica

Musser GG, Carleton MD. 2005. Superfamily Muroidea. In Mammal species of the world: a taxonomic and geographic reference (Wilson DE, Reeder DM, eds.) 3rd ed. Johns Hopkins University Press. Baltimore, Maryland. 894-1531.

Obando V. 2002. Biodiversidad en Costa Rica: Estado del conocimiento y gestión (No. 333.95 O-96b). Heredia, CR: INBio.

Ono K, Satoh M, Yoshida T, Ozawa Y, Kohara A, Takeuchi M, Mizusawa H, Sawada H. 2007. Species identification of animal cells by nested PCR targeted to mitochondrial DNA. In Vitro Cell Dev Biol. 43:168-175.

Pardiñas UF, D’Elía G, Ortiz PE. 2002. Sigmodontinos fósiles (Rodentia, Muroidea, Sigmodontinae) de América del Sur: estado actual de su conocimiento y prospectiva. Mastozoología Neotropical. 9(2): 209-252.

Palumbi SR, Baker CS. 1994. Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales. Molecular Biology and Evolution. 11(3): 426-435.

Patton JL, Gardner AL. 1972. Notes on the Systematics of Proechimys (Rodentia: Echimyidae): With Emphasis on Peruvian Forms. Louisiana State University.

Patterson B, Wood AE. 1982. Rodents from the Deseadan Oligocene of Bolivia and the relationships of the Caviomorpha. Museum of comparative zoology. Harvard University.

Pérez-Lustre M, Santos-Moreno A. 2010. Movements and capture-recapture data analysis of the vesper rat (Nyctomys sumichrasti: Rodentia, Muridae) in a tropical forest in northeastern Oaxaca, Mexico. ACTA ZOOLÓGICA MEXICANA (N.S.). 26(3).

Pfenninger M, Schwenk K. 2007. Cryptic animal species are homogeneously distributed among taxa and biogeographical regions. BMC Evol. Biol. 7: 121.

Prevosti F, Pardiñas UFJ. 2009. Comment on ‘The Oldest South American Cricetidae (Rodentia) and Mustelidae (Carnivora): Late Miocene Faunal Turnover in Central Argentina and the Great American Biotic Interchange’, by Verzi DH Montalvo CI. Palaeogeography, Palaeoclimatology, Palaeoecology. 280: 543-47.

Prychitko TM, Moore WS. 1997. The utility of DNA sequences of an intron from the β- fibrinogen gene in phylogenetic analysis of woodpeckers (Aves: Picidae). Molecular phylogenetics and evolution. 8(2): 193-204.

Pino JL. 2012. Sistemática molecular de ratones cantadores (Scotinomys, Rodentia: Cricetidae) en Costa Rica y Panamá. Panama, Panama. Mesoamericana. Official Journal of the Sociedad Mesoamericana para la Biología y la Conservación. 16(2): 88. FCUP 55 Cryptic diversity in rodents from Costa Rica

Pino JL, Reed D, Phelps SM. 2011. Lineage divergence of singing mice (genus Scotinomys) in southern Central American highlands. 91st Meeting of the American Society of Mammalogists. Portland, USA.

Pino JL, Campbell P, Pasch B, Reed D, Phelps SM. 2009. Insights into the evolutionary history of singing mice, Genus Scotinomys. International Mammalogical Meeting. Mendoza, Argentina.

Rajapaksha WR, Thilakaratne ID, Chandrasiri AD, Niroshan TD. 2002. Development of PCR assay for differentiation of some important wild animal meat of Sri Lanka.Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health. 49:322-324.

Reid FA. 2009. Field Guide to the Mammals of Central America and Southeast Mexico, 2nd Edition. Oxford University Press, USA.

Reid FA, 1997. A Field Guide to the Mammals of Central America and Southeast Mexico. Oxford University Press, New York.

Rocha RG, Ferreira E, Fonseca C, Justino J, Leite YL, Costa LP. 2014. Seasonal flooding regime and ecological traits influence genetic structure of two small rodents. Ecology and Evolution. 4: 4598-4608.

Rodríguez-Herrera B, Ramírez-Fernández JD, Villalobos-Chaves D, Sánchez R. 2014. Actualización de la lista de especies de mamíferos vivientes de Costa Rica. Mastozoología Neotropical, en prensa, Mendoza. 21(2): 275-289.

Rogers DS, González MW. 2010. Phylogenetic relationships among Spiny Pocket Mice (Heteromys) inferred from Mitochondrial and Nuclear Sequence Data. Journal of Mammalogy. 91:914 –30.

Rogers, DS, Arenas EA, González-Cózatl FX, Hardy DK, Hanson JD, Lewis-Rogers N. 2009. Molecular phylogenetics of Oligoryzomys fulvescens based on cytochrome b gene sequences, with comments on the evolution of the genus Oligoryzomys. Cervantes, F, ed, 60: 1-14.

Roman J, Palumbi S. 2003. Whales before whaling in the north Atlantic. Science 301: 508- 510.

Ronquist F, Teslenko M, Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology. 61: 539-542. FCUP 56 Cryptic diversity in rodents from Costa Rica

Tsai LC, Huang MT, Hsiao CT, Lin AC, Chen SJ, Lee JC, Hsieh HM. 2007. Species identification of animal specimens by cytochrome b gene. Journal of Forensic Science. 6(1): 63-65.

Sánchez-Hernández C, Roméro-Almaraz MDL, Owen RD, Núñez-Garduño A, López-Wilchis R. 1999. Noteworthy records of mammals from Michoacán, México. The Southwestern Naturalist. 231-235.

Savage JM. 1982. The Enigma of the Central America Herpetofauna: Dispersals or Vicariance? Annals of the Missouri Botanical Garden. 69: 464-547.

Shapiro B, Rambaut A, Drummond AJ. 2006. Choosing appropriate susbstitution models for the phylogenetic analysis of protein-coding sequences. Molecular Biology and Evolution. 23(1): 7-9.

Shokralla S, Porter TM, Gibson JF, Dobosz R, Janzen DH, Hallwachs W.…Hajibabaei M. 2015. Massively parallel multiplex DNA sequencing for specimen identification using an Illumina MiSeq platform. Scientific Reports. 5: 9687.

Shoshani J, McKenna MC. 1998. Higher Taxonomic Relationships among Extant Mammals Based on Morphology, with Selected Comparisons of Results from Molecular Data. Molecular Phylogenetics and Evolution. 9(3): 572-584.

Smith MF, Patton JL. 1993. The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data for the akodontine tribe. Biological Journal of the Linnean Society. 50(3): 149-177.

Smith MA, Woodley NE, Janzen DH, Hallwachs W, Hebert PDN. 2006. DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences of the United States of America. 103: 3657-3662.

Springer MS, Burk A, Kavanagh JR, Waddell VG, Stanhope MJ. 1997. The interphotoreceptor retinoid binding protein gene in Eutherian mammals: Implications for higher level relationships and evidence for loss of function in the marsupial mole. Proceedings of the National Academy of Sciences. 94(25): 13754-13759.

Springer MS, DeBry RW, Douady C, Amrine HM, Madsen O, de Jong WW, Stanhope, MJ. 2001. Mitochondrial Versus Nuclear Gene Sequences in Deep-Level Mammalian Phylogeny Reconstruction. Molecular Biology and Evolution. 18(2): 132–143. FCUP 57 Cryptic diversity in rodents from Costa Rica

Stanhope MJ, Smith MR, Waddell VG, Porter CA, Shivji MS, Goodman M. 1996. Mammalian evolution and the interphotoreceptor retinoid binding protein (IRBP) gene: convincing evidence for several superordinal clades. Journal of Molecular Evolution. 43(2): 83-92.

Stanhope MJ, Czelusniak J, Si JS, Nickerson J, Goodman M. 1992. A molecular perspective on mammalian evolution from the gene encoding interphotoreceptor retinoid binding protein, with convincing evidence for bat monophyly. Molecular Phylogenetics and Evolution. 1(2): 148-160.

Stehli FG, Webb DS. 1985. The great American biotic interchange. Plenum Press. Steppan SJ, Adkins RM, Anderson J. 2004. Phylogeny and Divergence-Date Estimates of Rapid Radiations in Muroid Rodents Based on Multiple Nuclear Genes. Systematic Biology. 53: 533-53.

Steppan S J, Adkins RM, Anderson J. 2004. Phylogeny and divergence-date estimates of rapid radiations in muroid rodents based on multiple nuclear genes. Systematic Biology. 53(4): 533-553.

Steppan SJ. 1995. Revision of the tribe Phyllotini (Rodentia: Sigmondontinae), with a phylogenetic hypothesis for the Sigmodontinae. Revisión de la tribu Phyllotini (Rodentia: Sigmondontinae), con una hipótesis filogenética para los Sigmodontinae. Fieldiana Zoology. 1464: 1-112.

Sturmbauer C, Meyer A. 1992. Genetic divergence, speciation and morphological stasis in a lineage of African cichlid fishes. Nature. 358(6387): 578-581.

Sullivan J, Arellano E, Rogers DS. 2000. Comparative phylogeography of Mesoamerican highland rodents: concerted versus independent response to past climatic fluctuations. The American Naturalist. 155: 755-786.

Tabuce R, Asher RJ, Lehmann T. 2008. Afrotherian mammals: a review of current data.

Timm RM, LaVal RK. 2000. Mammals [of Monteverde]. Oxford University Press.

Toews DP, Brelsford A. 2012. The biogeography of mitochondrial and nuclear discordance in animals. Molecular Ecology. 21(16): 3907-3930.

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35:1547-1549.

Vamos E, Elbrecht V, Leese F. 2017. Short COI markers for freshwater macroinvertebrate metabarcoding. Metabarcoding Metagenomics. 1, e14625. FCUP 58 Cryptic diversity in rodents from Costa Rica

Venkatesh B, Ning Y, Brenner S. 1999. Late changes in spliceosomal introns define clades in vertebrate evolution. Proceedings of the National Academy of Sciences. 96(18): 10267- 10271.

Verzi DH, Montalvo CI. 2008. The Oldest South American Cricetidae (Rodentia) and Mustelidae (Carnivora): Late Miocene Faunal Turnover in Central Argentina and the Great American Biotic Interchange. Palaeogeography, Palaeoclimatology, Palaeoecology. 267: 284-91.

Villa-Cornejo B, Lopez-Forment W, Cornejo MV, Prescott CV. 1998. Not all Sigmodontine rodents in the sugarcane elds in coastal Veracruz, Mexico are pests. In R. O. Baker and A. C. Crabb (Eds.), Proceedings of the 18th Vertebrate Pest Conference (Pp. 236–241), Davis, California: University of California.

Walker FM, Williamson CHD, Sanchez DE, Sobek CJ, Chambers CL. 2016. Species From Feces: Order-Wide Identification of Chiroptera From Guano and Other Non-Invasive Genetic Samples. PLOS ONE. 11(9), e0162342.

Webb SD. 2006. The great American biotic interchange: Patterns and processes. Annals of the Missouri Botanical Garden. 93: 245-257.

Weksler M, Geise L, Cerqueira R. 1999. A new species of Oryzomys (Rodentia, Sigmondontinae) from southeast Brazil, with comments of the classification of the O. capito species group. Zoological Journal of the Linnean Society. 125:445-462.

Weksler M, Bonvicino CR. 2005. Taxonomy of pygmy rice rats genus Oligoryzomys Bangs, 1900 (Rodentia, Sigmodontinae) of the Brazilian Cerrado, with the description of two new species. Arquivos do Museu Nacional, Rio de Janeiro. 63(1): 113-130.

Wheeler S, Bjornlund H, Zuo A, Edwards J. 2012. Handing down the farm? The increasing uncertainty of irrigated farm succession in Australia. Journal of rural studies. 28(3): 266- 275.

Wilson DE, Reeder DM. 2005. Mammal species of the world: a taxonomic and geographic reference (1). Johns Hopkins University Press.

Wilson JS, Carril OM, Sipes SD. 2014. Revisiting the Great American Biotic Interchange through analyses of amphitropical bees. Ecography. 37: 001-006.

Witt JD, Threloff DL, Hebert PD. 2006. DNA barcoding reveals extraordinary cryptic diversity in an amphipod genus: implications for desert spring conservation. Molecular Ecology. 15(10): 3073-3082. FCUP 59 Cryptic diversity in rodents from Costa Rica

Woodburne MO, Swisher CC. 1995. Land Mammal High-Resolution Geochronology, Intercontinental Overland Dispersals, Sea Level, Climate, and Vicariance. In Geochronology, Time-Scales, and Global Stratigraphic Correlations: Unified Temporal Framework for an Historical Geology, edited by Berggren WA, Kent DV, Aubry MP, Hardenbol J. 335-64. Tulsa: Society for Sedimentary Geology Special Publication 54.

Woods CA. 1993. Suborder Hystricognathi. In Mammal species of the world. A taxonomic and geographic reference (Wilson DE, Reeder DM, eds.). Smithsonian Institution Press, Washington, D.C. 771-806.

Wright S. 1931. Evolution in Mendelian Populations. Genetics. 16: 97-159.

Zhang DX, Hewitt GM. 1996. Nuclear integrations: challenges for mitochondrial DNA markers. Trends in Ecology and Evolution.11(6): 247-251.

FCUP 60 Cryptic diversity in rodents from Costa Rica

6. Supplementary material

Table S1. Information of both mitochondrial and nuclear DNA sequences retrieved from GenBank and BOLD Systems for this research. Cytb gene Accession Species Locality NCBI BOLD number JQ183063 Nyctomys sumichrasti florencei El Salvador x JQ183064 Nyctomys sumichrasti florencei El Salvador x AY195801 Nyctomys sumichrasti Atlántica: Lacentilla Botanical Garden, Honduras x JN851816 Nyctomys sumichrasti decolours Petén: San José, Límite Oeste Biotopo Zotz, Guatemala x JQ183066 Nyctomys sumichrasti colimensis Mexico x JQ183065 Nyctomys sumichrasti salvini Mexico x JQ183067 Nyctomys sumichrasti sumichrasti Mexico x JN851815 Scotinomys teguina Comayagua, Parque Nacional Azul Meámbar, Honduras x KY754149 Scotinomys xerampelinus Cartago Province, Parque Nacional Volcan Irazu, Costa Rica x DQ861371 Scotinomys xerampelinus Cartago Province, Parque Nacional Volcan Irazu, Costa Rica x AY859428 Reithrodontomys creper Cartago, Costa Rica x AY859429 Reithrodontomys creper Heredia, Costa Rica x AY859430 Reithrodontomys creper Heredia, Costa Rica x DQ861372 Reithrodontomys creper Cartago, Costa Rica x AF176257 Reithrodontomys fulvescens Oklahoma (McIntosh County), USA x AY294626 Reithrodontomys fulvescens Jalisco, Mexico x HQ269729 Reithrodontomys sumichrasti Jalisco, Mexico x KF303326 Reithrodontomys fulvescens NA x KF303328 Reithrodontomys fulvescens NA x KF303329 Reithrodontomys fulvescens NA x KF303330 Reithrodontomys fulvescens NA x KF303331 Reithrodontomys fulvescens NA x KF303332 Reithrodontomys fulvescens NA x KF303333 Reithrodontomys fulvescens NA x KF303334 Reithrodontomys fulvescens NA x KF303335 Reithrodontomys fulvescens NA x KF303336 Reithrodontomys fulvescens NA x AY859465 Reithrodontomys fulvescens Chiapas, Mexico x HQ269730 Reithrodontomys fulvescens Oaxaca, Mexico x KF303327 Reithrodontomys fulvescens NA x AF176253 Reithrodontomys mexicanus NA x AY293817 Reithrodontomys gracilis Yucatán, Mexico x AY859431 Reithrodontomys gracilis Yucatán, Mexico x Cytb gene FCUP 61 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number AY859432 Reithrodontomys gracilis Campeche, Mexico x AY293809 Reithrodontomys mexicanus Oaxaca, Mexico x AY859433 Reithrodontomys mexicanus Hidalgo, Mexico x AY859434 Reithrodontomys mexicanus Oaxaca, Mexico x AY859435 Reithrodontomys mexicanus Oaxaca, Mexico x AY859436 Reithrodontomys mexicanus Oaxaca, Mexico x AY859437 Reithrodontomys mexicanus Oaxaca, Mexico x AY859438 Reithrodontomys mexicanus Oaxaca, Mexico x AY859439 Reithrodontomys mexicanus Oaxaca, Mexico x AY859440 Reithrodontomys mexicanus Oaxaca, Mexico x AY859441 Reithrodontomys mexicanus Oaxaca, Mexico x AY859442 Reithrodontomys mexicanus Oaxaca, Mexico x AY859443 Reithrodontomys mexicanus Oaxaca, Mexico x AY859444 Reithrodontomys mexicanus Oaxaca, Mexico x AY859445 Reithrodontomys mexicanus Oaxaca, Mexico x AY859446 Reithrodontomys mexicanus Oaxaca, Mexico x AY293822 Reithrodontomys mexicanus Veracruz, Mexico x AY859447 Reithrodontomys mexicanus Chiapas, Mexico x AY859448 Reithrodontomys mexicanus Oaxaca, Mexico x AY859449 Reithrodontomys mexicanus Oaxaca, Mexico x AY859450 Reithrodontomys mexicanus Chiapas, Mexico x AY859451 Reithrodontomys mexicanus Baja Verapaz, Guatemala x AY859452 Reithrodontomys mexicanus Zacapa, Guatemala x AY859453 Reithrodontomys mexicanus Santa Ana, El Salvador x HQ269733 Reithrodontomys mexicanus Chiapas, Mexico x AY293820 Reithrodontomys mexicanus San José, Costa Rica x AY293821 Reithrodontomys mexicanus San José, Costa Rica x AY293819 Reithrodontomys microdon Oaxaca, Mexico x AY859461 Reithrodontomys microdon Oaxaca, Mexico x AY293818 Reithrodontomys microdon Chiapas, Mexico x AY859454 Reithrodontomys microdon Chiapas, Mexico x AY859455 Reithrodontomys microdon Chiapas, Mexico x AY859456 Reithrodontomys microdon Chiapas, Mexico x AY859457 Reithrodontomys microdon Chiapas, Mexico x AY859458 Reithrodontomys microdon Huehuetenango, Guatemala x AY859459 Reithrodontomys microdon Chiapas, Mexico x AY859460 Reithrodontomys microdon Chiapas, Mexico x AY859463 Reithrodontomys tenuirostris Chiapas, Mexico x EF990019 Reithrodontomys sp. Alajuela, Costa Rica x HQ269706 Reithrodontomys sumichrasti Chiapas, Mexico x Cytb gene FCUP 62 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number HQ269710 Reithrodontomys sumichrasti Chiapas, Mexico x HQ269720 Reithrodontomys sumichrasti Cartago, Costa Rica x HQ269728 Reithrodontomys sumichrasti Chiriquí, Panama x HQ287797 Reithrodontomys sumichrasti Inticuba, Honduras x HQ269530 Reithrodontomys sumichrasti Oaxaca, Mexico x HQ269534 Reithrodontomys sumichrasti Oaxaca, Mexico x HQ269560 Reithrodontomys sumichrasti Oaxaca, Mexico x HQ269564 Reithrodontomys sumichrasti Guerrero, Mexico x HQ269575 Reithrodontomys sumichrasti Guerrero, Mexico x HQ269590 Reithrodontomys sumichrasti Guerrero, Mexico x HQ269597 Reithrodontomys sumichrasti Veracruz, Mexico x HQ269600 Reithrodontomys sumichrasti Veracruz, Mexico x HQ269602 Reithrodontomys sumichrasti Veracruz, Mexico x HQ269658 Reithrodontomys sumichrasti Puebla, Mexico x HQ269667 Reithrodontomys sumichrasti Michoacán, Mexico x HQ269674 Reithrodontomys sumichrasti Michoacán, Mexico x HQ269698 Reithrodontomys sumichrasti Hidalgo, Mexico x HQ269703 Reithrodontomys sumichrasti Estado de México, Mexico x KX688200 Proechimys cuvieri NA x KX688204 Proechimys cuvieri NA x KX688193 Proechimys cuvieri NA x KX688194 Proechimys cuvieri NA x KX688182 Proechimys cuvieri NA x NC039099 Proechimys cuvieri NA x KX688202 Proechimys cuvieri NA x KX688201 Proechimys cuvieri NA x KX688191 Proechimys cuvieri NA x KX688196 Proechimys cuvieri NA x KX688195 Proechimys cuvieri NA x KX688192 Proechimys cuvieri NA x AJ251403 Proechimys cuvieri Petit Saut, French Guiana x AJ251400 Proechimys cuvieri Saint Jean du Maroni, French Guiana x AJ251401 Proechimys cuvieri Trinite Mountains, French Guiana x AJ251402 Proechimys cuvieri Les Nouragues, French Guiana x AY206624 Proechimys cuvieri Petit Saut, French Guiana x AY206630 Proechimys cuvieri Petit Saut, French Guiana x AY206631 Proechimys cuvieri St Jean, French Guiana x AY206632 Proechimys cuvieri Trinité, French Guiana x AY206633 Proechimys cuvieri Les Nouragues, French Guiana x AY206625 Proechimys cuvieri Les Nouragues, French Guiana x AY206626 Proechimys cuvieri Les Nouragues, French Guiana x FCUP 63 Cryptic diversity in rodents from Costa Rica

AY206623 Proechimys cuvieri Baramita, French Guiana x AY206627 Proechimys cuvieri Pic Matecho, French Guiana x AY206622 Proechimys cuvieri Pic Matecho, French Guiana x AY206628 Proechimys cuvieri Saul, French Guiana x AY206629 Proechimys cuvieri Saul, French Guiana x KU892778 Proechimys cuvieri NA x KX688187 Proechimys semispinosus NA x NC_039102 Proechimys semispinosus NA x KX688188 Proechimys semispinosus NA x NC_039103 Proechimys semispinosus NA x KX688190 Proechimys semispinosus NA x COI gene Accession Species Locality NCBI BOLD number ABGYB60206 Oligoryzomys fulvescens Guiana x ABGYB60306 Oligoryzomys fulvescens Guiana x ABMXB50306 Oligoryzomys fulvescens Campeche, Mexico x ABMXB59706 Oligoryzomys fulvescens Campeche, Mexico x ABMXC18206 Oligoryzomys fulvescens Tamaulipas, Mexico x ABMXC11306 Oligoryzomys fulvescens Campeche, Mexico x ABMXC07806 Oligoryzomys fulvescens Campeche, Mexico x ABMXC18306 Oligoryzomys fulvescens Tamaulipas, Mexico x ABMXA45406 Oligoryzomys fulvescens Chiapas, México x ABMXC60606 Oligoryzomys fulvescens Chiapas, México x ABMXC60706 Oligoryzomys fulvescens Chiapas, México x ABMXC60806 Oligoryzomys fulvescens Chiapas, México x ABMXB84806 Oligoryzomys fulvescens Veracruz, Mexico x ABMXC61106 Oligoryzomys fulvescens Chiapas, México x ABMXA77806 Oligoryzomys fulvescens Yucatán, Mexico x ABMXB58606 Oligoryzomys fulvescens Campeche, Mexico x ABMXB51706 Oligoryzomys fulvescens Tabasco, Mexico x ABMXC31206 Oligoryzomys fulvescens Yucatán, Mexico x ABMXB52106 Oligoryzomys fulvescens Tabasco, Mexico x ABMXB62706 Oligoryzomys fulvescens Campeche, Mexico x ABMXA06306 Oligoryzomys fulvescens Chiapas, México x ABMXC07406 Oligoryzomys fulvescens Campeche, Mexico x ABMXC21506 Oligoryzomys fulvescens Tabasco, Mexico x ABMXC07506 Oligoryzomys fulvescens Campeche, Mexico x ABMXB59606 Oligoryzomys fulvescens Campeche, Mexico x ABMXC07606 Oligoryzomys fulvescens Campeche, Mexico x ABMXC28606 Oligoryzomys fulvescens Campeche, Mexico x ABMXB50806 Oligoryzomys fulvescens Campeche, Mexico x COI gene FCUP 64 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number ABMXA04806 Oligoryzomys fulvescens Chiapas, México x ABMXC58406 Oligoryzomys fulvescens Chiapas, México x ABMXA43406 Oligoryzomys fulvescens Chiapas, México x ABMXA75006 Oligoryzomys fulvescens Yucatán, Mexico x ABMXA75206 Oligoryzomys fulvescens Yucatán, Mexico x ABMXC16706 Oligoryzomys fulvescens Tamaulipas, Mexico x ABMXA75306 Oligoryzomys fulvescens Yucatán, Mexico x ABSA019060 Oligoryzomys fulvescens Amazonas, Venezuela x ABSCA17106 Oligoryzomys fulvescens Rivas, Nicaragua x ABRMM08807 Oligoryzomys fulvescens Cartago, Costa Rica x ABSMS58606 Oligoryzomys fulvescens Cartago, Costa Rica x ABSMS52706 Oligoryzomys fulvescens Campeche, Mexico x ABSMS57806 Oligoryzomys fulvescens Amazonas, Venezuela x JF444682 Nyctomys sumichrasti Sacatepequez, 5 Km W Of San Miguel Duanas, Guatemala x JF444680 Nyctomys sumichrasti Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala x JF444681 Nyctomys sumichrasti San Salvador, San Salvador, El Salvador x JF444679 Nyctomys sumichrasti Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador x JF444683 Nyctomys sumichrasti Baja Verapaz, 5 Km E Of Purulha, Guatemala x JF444451 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444452 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444453 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444454 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444455 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444456 Scotinomys teguina Cartago, Iztaru, La Carpentera, Costa Rica x JF444457 Scotinomys teguina Cartago, Iztaru, La Carpentera, Costa Rica x JF444458 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444459 Scotinomys teguina Cartago, La Carpentera, Iztaru Camp, Costa Rica x JF444460 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF444461 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF444462 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF444463 Scotinomys xerampelinus Volcan Irazu, Costa Rica x JF444464 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF444465 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF444741 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Bosque Nebuloso, El Salvador x JF444742 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Bosque Nebuloso, El Salvador x JF444743 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Bosque Nebuloso, El Salvador x JF444744 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador x JF444745 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador x JF444746 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador x JF444747 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador x COI gene FCUP 65 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number JF444748 Scotinomys teguina Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala x JF444749 Scotinomys teguina Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala x JF444750 Scotinomys teguina Santa Ana, Parque Nacional Montecristo, Bosque Nebuloso, El Salvador x JF444751 Scotinomys teguina Baja Verapaz, 5 Km E Of Puruhla, Guatemala x JF446274 Scotinomys teguina Chiapas, 12 Km N Of Berriozabal, Mexico x JF446275 Scotinomys teguina Chiapas, 12 Km N Of Berriozabal, Mexico x JF446276 Scotinomys teguina Chiapas, 12 Km N Of Berriozabal, Mexico x JF446277 Scotinomys teguina Chiapas, 12 Km N Of Berriozabal, Mexico x JF459544 Scotinomys teguina San Jose, Cerro La Muerte, San Gerardo De Dota, Costa Rica x JF459545 Scotinomys teguina Puntarenas, Monte Verde Biological Station, Costa Rica x JF459547 Scotinomys teguina Esteli, Nicaragua x JF459549 Scotinomys teguina Cartago, Iztaru, Cerros De La Carpintera, Costa Rica x JF459551 Scotinomys teguina Cartago, Iztaru, Cerros De La Carpintera, Costa Rica x JF459554 Scotinomys teguina Cartago, Santa Cruz, Costa Rica x JF459557 Scotinomys teguina Cartago, 6.5 Km NNE Of Capellades, Costa Rica x JF459558 Scotinomys teguina Chiriqui, Ojo De Agua, 2 Km N Of Santa Clara, Panama x JF459560 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF459561 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF459562 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF459563 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF459564 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x JF459565 Scotinomys xerampelinus Cartago, Volcan Irazu, Costa Rica x ABCSA145 Reithrodontomys sumichrasti 15 Km Nw of Santa Apolonia, By Road, Guatemala x ABSCA347 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABSCA346 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABSCA322 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABSCA320 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABMXA457 Reithrodontomys sumichrasti Chiapas, 9 Km S Of Rayon By Road, Mexico x ABMXA456 Reithrodontomys sumichrasti Chiapas, 9 Km S Of Rayon By Road, Mexico x ABRMM378 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABRMM377 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABRMM376 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABRMM375 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABRMM355 Reithrodontomys sumichrasti Cartago, Volcan Irazu, Costa Rica x ABRMM389 Reithrodontomys sp2 Cartago, Cerro De La Carpentera, Iztaru Camp, Costa Rica x ABRMM362 Reithrodontomys sp1 Alajuela, Parque Nacional Volcan Poas, Costa Rica x ABRMM287 Reithrodontomys sp1 Alajuela, Parque Nacional Volcan Poas, Costa Rica x ABCSA104 Reithrodontomys microdon Huehuetenango, 16 Km Nw Of Santa Eulalia, by road, Guatemala x ABCSA081 Reithrodontomys microdon Huehuetenango, 16 Km Nw Of Santa Eulalia, by road, Guatemala x ABCSA143 Reithrodontomys microdon Huehuetenango, 16 Km Nw Of Santa Eulalia, by road, Guatemala x COI gene FCUP 66 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number GBMA28258 Reithrodontomys mexicanus NA x GBMNA13054 Reithrodontomys mexicanus NA x ABSCA256 Reithrodontomys mexicanus Esteli, Nicaragua x ABSCA255 Reithrodontomys mexicanus Esteli, Nicaragua x ABSCA254 Reithrodontomys mexicanus Esteli, Nicaragua x ABSCA240 Reithrodontomys mexicanus Nicaragua x ABSCA239 Reithrodontomys mexicanus Nicaragua x ABSCA234 Reithrodontomys mexicanus Esteli, Nicaragua x ABSCA233 Reithrodontomys mexicanus Esteli, Nicaragua x ABMXC578 Reithrodontomys mexicanus Chiapas, 6 Km E Of Rayon, Mexico x ABMXC579 Reithrodontomys mexicanus Chiapas, 6 Km E Of Rayon, Mexico x ABMXC580 Reithrodontomys mexicanus Chiapas, 6 Km E Of Rayon, Mexico x ABMXC581 Reithrodontomys mexicanus Chiapas, 6 Km E Of Rayon, Mexico x ABMXC332 Reithrodontomys mexicanus Veracruz, Mexico x ABCSA239 Reithrodontomys mexicanus Baja Verapaz, 5 Km E Of Puruhla, Guatemala x ABCSA201 Reithrodontomys mexicanus Baja Verapaz, 5 Km E Of Puruhla, Guatemala x ABCSA200 Reithrodontomys mexicanus Baja Verapaz, 5 Km E Of Puruhla, Guatemala x ABCSA199 Reithrodontomys mexicanus Baja Verapaz, 5 Km E Of Puruhla, Guatemala x ABCSA198 Reithrodontomys mexicanus Baja Verapaz, 5 Km E Of Puruhla, Guatemala X ABCSA658 Reithrodontomys mexicanus Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala X ABCSA656 Reithrodontomys mexicanus Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala X ABCSA655 Reithrodontomys mexicanus Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala X ABCSA654 Reithrodontomys mexicanus Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala X ABCSA653 Reithrodontomys mexicanus Zacapa, 2 Km N Of San Lorenzo, Sierra De Las Minas, Guatemala X ABCSA900 Reithrodontomys mexicanus Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador X ABCSA899 Reithrodontomys mexicanus Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador X ABRMM399 Reithrodontomys mexicanus Costa Rica X ABRMM398 Reithrodontomys mexicanus San Jose, Escazu, Base Of Pico Blanco, Costa Rica X ABRMM395 Reithrodontomys mexicanus San Jose, Escazu, Base Of Pico Blanco, Costa Rica X ABRMM394 Reithrodontomys mexicanus San Jose, Escazu, Base Of Pico Blanco, Costa Rica X ABRMM391 Reithrodontomys mexicanus Cerro Madera, Ometepe Island, Nicaragua X ABRMM380 Reithrodontomys mexicanus Cerro Madera, Ometepe Island, Nicaragua X ABRMM361 Reithrodontomys mexicanus Alajuela, Juan Castro Blanco National Park, Costa Rica X ABCSA875 Reithrodontomys mexicanus Santa Ana, Parque Nacional Montecristo, Los Planes, El Salvador X ABMXC061 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXB528 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXB598 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXB599 Reithrodontomys gracilis Campeche, 9.5 Km S Of Constitucion, 9.5 Km S Of Escarcega, Mexico X ABMXB678 Reithrodontomys gracilis Campeche, 9.5 Km S Of Constitucion, 9.5 Km S Of Escarcega, Mexico X ABMXC019 Reithrodontomys gracilis Campeche, 47 Km Ne Of Ciudad Del Carmen, Mexico X COI gene FCUP 67 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number ABMXC055 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC056 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC057 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC060 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC062 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC063 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC070 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC071 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC073 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXC242 Reithrodontomys gracilis Campeche, 3.7 Km Se Of Chekubul, Mexico X ABMXA917 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA916 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA915 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA914 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA912 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA911 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA910 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA909 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA908 Reithrodontomys gracilis Campeche, 52 Km Sw Of Champoton, Mexico X ABMXA899 Reithrodontomys gracilis Campeche, 60 Km Se Of Dzibalchen, Mexico X ABMXA777 Reithrodontomys gracilis Yucatan, Laguna Becanchen, Mexico X ABMXA754 Reithrodontomys gracilis Yucatan, Laguna Becanchen, Mexico X ABMXA231 Reithrodontomys gracilis Campeche, Ciudad Del Carmen, 21.2 Km E Of Cuidad Del Carmen, Mexico X ABMXA230 Reithrodontomys gracilis Campeche, Ciudad Del Carmen, 21.2 Km E Of Cuidad Del Carmen, Mexico X ABMXA200 Reithrodontomys gracilis Campeche, 7.5 Km W Of Escarcega, Mexico X ABMXA058 Reithrodontomys gracilis Chiapas, 43 Km N Of Hopelchen By Road, Mexico X ABMXC294 Reithrodontomys gracilis Campeche, Mexico X ABMXB294 Reithrodontomys fulvescens Colima, 10 Km Nw Of Alzada, Mexico X ABMXB409 Reithrodontomys fulvescens Colima, 8 Km Nne Of Tecoman, Mexico X ABMXC165 Reithrodontomys fulvescens Tamaulipas, 5 Km N Of Soto La Marina, Mexico X ABMXC177 Reithrodontomys fulvescens Tamaulipas, 4 Km W Of La Carbonera, 46.5 Km Ese Of San Fernando, Mexico X MAMN4189 Reithrodontomys fulvescens Arizona, Domain 14, United States X MAMN4046 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN4025 Reithrodontomys fulvescens New Mexico, Domain 14, United States X MAMN3945 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN3934 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN3907 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN3892 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN3881 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN2721 Reithrodontomys fulvescens Arizona, Domain 14, United States X COI gene FCUP 68 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number MAMN556 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN550 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN536 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN527 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN526 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN517 Reithrodontomys fulvescens Oklahoma, Domain 11, United States X MAMN403 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN400 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN370 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN365 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN352 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN337 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN324 Reithrodontomys fulvescens Texas, Domain 11, United States X MAMN286 Reithrodontomys fulvescens Texas, Domain 11, United States X ABSCA536 Reithrodontomys darienensis Darien, Panama X ABSCA007 Reithrodontomys creper Cartago, Costa Rica X ABSCA006 Reithrodontomys creper Cartago, Costa Rica X ABSCA005 Reithrodontomys creper Cartago, Costa Rica X ABSCA344 Reithrodontomys creper Cartago, Costa Rica X ABSCA341 Reithrodontomys creper Cartago, Costa Rica X ABSCA340 Reithrodontomys creper Cartago, Costa Rica X ABSCA339 Reithrodontomys creper Cartago, Costa Rica X ABSCA327 Reithrodontomys creper Cartago, Costa Rica X ABSCA326 Reithrodontomys creper Cartago, Costa Rica X ABSCA325 Reithrodontomys creper Cartago, Costa Rica X ABSCA318 Reithrodontomys creper Cartago, Costa Rica X ABSCA317 Reithrodontomys creper Cartago, Costa Rica X ABSCA316 Reithrodontomys creper Cartago, Costa Rica X ABSCA315 Reithrodontomys creper Cartago, Costa Rica X ABSCA314 Reithrodontomys creper Cartago, Costa Rica X ABSCA313 Reithrodontomys creper Cartago, Costa Rica X ABSCA312 Reithrodontomys creper Cartago, Costa Rica X ABSCA513 Reithrodontomys creper Costa Rica X ABSCA512 Reithrodontomys creper Costa Rica X ABSCA511 Reithrodontomys creper Costa Rica X ABSCA510 Reithrodontomys creper Costa Rica X ABSCA509 Reithrodontomys creper Costa Rica X ABSCA508 Reithrodontomys creper Costa Rica X ABSCA506 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA505 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X COI gene FCUP 69 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number ABSCA504 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA503 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA502 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA501 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA500 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABSCA395 Reithrodontomys creper San Jose, Cerro La Muerte, San Gerardo De Dota, Costa Rica X ABSCA394 Reithrodontomys creper San Jose, Cerro La Muerte, San Gerardo De Dota, Costa Rica X ABSCA393 Reithrodontomys creper San Jose, Cerro La Muerte, San Gerardo De Dota, Costa Rica X ABSCA392 Reithrodontomys creper San Jose, Cerro La Muerte, San Gerardo De Dota, Costa Rica X ABRMM382 Reithrodontomys creper Cartago, Volcan Irazu, Costa Rica X ABRMM374 Reithrodontomys creper Cartago, Volcan Irazu, Costa Rica X ABRMM373 Reithrodontomys creper Cartago, Volcan Irazu, Costa Rica X ABRMM370 Reithrodontomys creper Cartago, Volcan Irazu, Costa Rica X ABRMM358 Reithrodontomys creper Alajuela, Parque Nacional Volcan Poas, Costa Rica X ABRMM357 Reithrodontomys creper Costa Rica X ABRMM356 Reithrodontomys creper Costa Rica X GBMNA17843 Proechimys semispinosus NA X GBMNA17844 Proechimys semispinosus NA X GBMNA17845 Proechimys semispinosus NA X GBMNA17846 Proechimys semispinosus NA X GBMNA18637 Proechimys semispinosus NA X GBMNA18638 Proechimys semispinosus NA X IRBP gene Accession Species Locality NCBI BOLD number EU649065 Oligoryzomys longicaudatus Cochambamba, 12 km W Comarapa, Bolivia x KY933601 Oligoryzomys flavescens NA (Argentina) x KC953426 Oligoryzomys longicaudatus Rio Negro, Depto. Bariloche, 12 km W Bariloche, Argentina x KY933606 Oligoryzomys longicaudatus NA (Argentina) x EU649064 Oligoryzomys longicaudatus Rio Negro, 19 km NNE El Bolson, Argentina x AY163611 Oligoryzomys fulvescens Sucre, Finca Vuelta Larga, Venezuela x EU649060 Oligoryzomys fulvescens Portugesa, Cano Delgadito, Venezuela x EU649067 Oligoryzomys vegetus Cartago, Volcan Irazu, Costa Rica x DQ826031 Oligoryzomys moojeni Cerrado, Brazil x DQ826032 Oligoryzomys messorius Cadeias do Jamari, Amazon, Brazil x EU649063 Oligoryzomys fulvescens Olancho, 4 km E Catacamas, Honduras x AY163613 Oligoryzomys stramineus Goias, Terezina de Goias, Brazil x DQ826034 Oryzomys russatus Pampa-Atlantic Rain Forest transition x EU649066 Oligoryzomys microtis Amazonas, Jainu, Brazil x MF097779 Oligoryzomys microtis Amazonas, Altamira, right bank Rio Jurua, Brazil x IRBP gene FCUP 70 Cryptic diversity in rodents from Costa Rica

Accession Species Locality NCBI BOLD number AY163610 Oligoryzomys fornesi Cerrado, Brazil x AY163612 Oligoryzomys nigripes Atlantic Rain Forest x MF097778 Oligoryzomys eliurus Sao Paulo, Base do Carmo, Fazenda Intervales, Municipio de Capao Bonito, Brazil x JQ966802 Oligoryzomys flavescens Brazil x JQ966804 Oligoryzomys nigripes Brazil x DQ826029 Oligoryzomys nigripes Pampa-Atlantic Rain Forest transition x EU649062 Oligoryzomys eliurus Sao Paulo, Capao Bonito, Brazil x EU649059 Oligoryzomys chacoensis Boweron, La Lomita, Paraguay x MF097777 Oligoryzomys chacoensis Santiago del Estero, Pellegrini, Santo Domingo, Argentina x EU649061 Oligoryzomys destructor Pichincha, Tandayapa Valley, Ecuador x KF815419 Oligoryzomys nigripes Minas Gerais, Pouso Alto, Brazil x KY933604 Oligoryzomys fornesi NA (Argentina) x KY933605 Oligoryzomys occidentalis NA (Argentina) x KY933603 Oligoryzomys fornesi NA (Argentina) x KY933602 Oligoryzomys flavescens NA (Argentina) x DQ826030 Oligoryzomys flavescens Pampa x KY933600 Oligoryzomys flavescens NA (Argentina) x AY163609 Oligoryzomys flavescens Atlantic Rain Forest x AY163603 Nyctomys sumichrasti Santa Ana, Parque Nacional Montecristo, El Salvador x KC953421 Nyctomys sumichrasti Cracias a Dios, Rio Mairin Tingni, 0.5 Km up from Rio Platano, Honduras x KT950926 Nyctomys sumichrasti NA x EF989922 Reithrodontomys spectabilis Quintana Roo, San Miguel, 30 km SE of San Miguel, Mexico x EF989913 Reithrodontomys sp. Cartago, Cerro de la Carpentera, Iztaru Scout Camp, Costa Rica x EF989917 Reithrodontomys mexicanus Ometepe Island, Cerro Madera, Nicaragua x EF989906 Reithrodontomys mexicanus Puntarenas, Monte Verde, and Monte Verde Biological Station, Costa Rica x EF989909 Reithrodontomys megalotis Distrito Federal; Parres, 3 km S of Parres, Mexico x MF097791 Reithrodontomys humulis Oklahoma, Osage Co., 21 km N, 8.3 km W Pawhuska, Tallgrass Prairie Preserve, USA x EF989899 Reithrodontomys creper Cartago, Parque Nacional Volcan Irazu, Costa Rica x EF989918 Reithrodontomys brevirostris Alajuela, Parque Nacionale Juan Castro Blanco, 10 km E of Sucre, Costa Rica x RAG1 gene Accession Species Locality NCBI BOLD number KC953549 Oligoryzomys microtis Amazonas, Altamira, right bank Rio Jurua, Brazil x MF097908 Oligoryzomys eliurus Sao Paulo, Base do Carmo, Fazenda Intervales, Municipio de Capao Bonito, Brazil x KC953548 Oligoryzomys longicaudatus Rio Negro, Depto. Bariloche, 12 km W Bariloche, Argentina x KC953547 Oligoryzomys fulvescens Cartago Province, 2 km NE. Cartago, Costa Rica x KC953578 Scotinomys teguina North America x MF097942 Scotinomys xerampelinus San Jose Province, 1 rd km SW Poas, Costa Rica x KC953572 Reithrodontomys megalotis Distrito Federal, Parres, Mexico x KC953571 Reithrodontomys gracilis Yucatan, Laguna Becanchen, Mexico x KC953570 Reithrodontomys creper Cartago, Parque Nacional Volcan Irazu, Costa Rica x FCUP 71 Cryptic diversity in rodents from Costa Rica

Table S2. Information of small mammals sampled in Costa Rica.

Accession number Species Locality Cytb COI IRBP RAG1

SM.2951 Oligoryzomys vegetus La Amistad International Park - Ranger Station Altamira, Costa Rica x x SM.2953 Oligoryzomys vegetus La Amistad International Park - Ranger Station Altamira, Costa Rica x x X SM.2955 Oligoryzomys vegetus La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.2957 Oligoryzomys vegetus La Amistad International Park - Ranger Station Pittier, Costa Rica x X SM.3142 Oligoryzomys fulvescens La Amistad International Park - Ranger Station Pittier, Costa Rica x x X SM.3155 Oligoryzomys fulvescens La Amistad International Park - Ranger Station Pittier, Costa Rica x x X SM.3161 Oligoryzomys fulvescens La Amistad International Park- Sansi Natural Reserve, Costa Rica x x X SM.3162 Oligoryzomys fulvescens La Amistad International Park- Sansi Natural Reserve, Costa Rica x x X SM.2589 Nyctomys sumichastry San Gerardo de Rivas, San José, Costa Rica x SM.2793 Nyctomys sumichastry La Amistad International Park - Ranger Station Altamira, Costa Rica x x SM.3500 Nyctomys sumichrasti La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3652 Nyctomys sumichastry Quebrada Provición, Parque Nacional Rincón de la Vieja, Costa Rica x SM.3653 Nyctomys sumichastry Monteverde, Costa Rica x SM.3669 Nyctomys sumichastry Selva Verde, Costa Rica x x x SM.3671 Nyctomys sumichastry Selva Verde, Costa Rica x x x SM.3677 Nyctomys sumichastry Selva Verde, Costa Rica x x SM.3679 Nyctomys sumichastry Selva Verde, Costa Rica x x SM.2560 Scotinomys teguina Varablanca, San José, Costa Rica x SM.2581 Scotinomys teguina Cartago, Iintesección con La Lucha, Costa Rica x SM.2775 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2778 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2779 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2786 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2790 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2898 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x x X SM.2902 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2908 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2910 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2920 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2954 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.2963 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.2972 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x X SM.2975 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x SM.2976 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x X SM.2984 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.2997 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.3005 Scotinomys teguina Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.3111 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3126 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x FCUP 72 Cryptic diversity in rodents from Costa Rica

Accession number Species Locality Cytb COI IRBP RAG1

SM.3137 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3152 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.3153 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.3159 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x SM.3219 Scotinomys teguina East of Cusuco National Park, Honduras x x SM.3369 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x x X SM.3386 Scotinomys xerampelinus La Amistad International Park - Sector Valle del Silencio, Costa Rica x x SM.3421 Scotinomys teguina La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3561 Scotinomys teguina La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.3655 Scotinomys teguina 2 km N, 0.5 km E de Sacramento, Costa Rica x SM.3656 Scotinomys teguina 5 km E, de Vara Blanca. Parque Nacional Braulio Carrillo x SM.2558 Reinthrodontomys creper Cerro de la Muerte, Costa Rica x SM.2782 Reinthrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2785 Reinthrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2897 Reinthrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2899 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.2903 Reinthrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2905 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2907 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.2928 Reithrodontomys sp. La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.2969 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2971 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2973 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2977 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2979 Reithrodontomys mexicanus Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2980 Reithrodontomys mexicanus Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2981 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.2986 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.2988 Reithrodontomys sp Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x SM.2996 Reithrodontomys sp Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.2999 Reithrodontomys sp Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.3011 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x x x X SM.3014 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.3015 Reithrodontomys sp. Braulio Carrillo National Park- Sector Barva Volcano, Costa Rica x SM.3121 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3129 Reithrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica SM.3141 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3143 Reithrodontomys sp. La Amistad International Park - Ranger Station Altamira, Costa Rica x x X SM.3149 Reithrodontomys creper La Amistad International Park - Ranger Station Altamira, Costa Rica x x x X SM.3363 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.3372 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x FCUP 73 Cryptic diversity in rodents from Costa Rica

Accession number Species Locality Cytb COI IRBP RAG1

SM.3377 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x x SM.3380 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3382 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3384 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3394 Reithrodontomys mexicanus La Amistad International Park - Ranger Station Pittier, Costa Rica x x SM.3411 Reithrodontomys sp. La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.3412 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3413 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3417 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3420 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.3427 Reithrodontomys sumichrasti La Amistad International Park - Ranger Station Pittier, Costa Rica x SM.3462 Reithrodontomys sp. La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.3463 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3465 Reithrodontomys sp. La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3470 Reithrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3471 Reithrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3473 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3486 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3488 Reithrodontomys sp. La Amistad International Park - Sector Valle del Silencio, Costa Rica x x x X SM.3511 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3512 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3513 Reithrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3514 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3516 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3535 Reithrodontomys mexicanus La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3546 Reithrodontomys creper La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3550 Reithrodontomys rodriguezi La Amistad International Park - Sector Valle del Silencio, Costa Rica x SM.3559 Reithrodontomys sp. La Amistad International Park - Ranger Station Pittier, Costa Rica x x x X SM.3574 Reithrodontomys sp. La Amistad International Park - Ranger Station Pittier, Costa Rica x x x X SM.2547 Proechimys semispinosus Ciuddad Colón, San José, Costa Rica x SM.2968 Proechimys semispinosus La Amistad International Park- Sansi Natural Reserve, Costa Rica x X SM.3335 Proechimys semispinosus Manuel Antonio National Park, Costa Rica x x X SM.3410 Proechimys semispinosus La Amistad International Park- Sansi Natural Reserve, Costa Rica x x X SM.3565 Proechimys semispinosus La Amistad International Park- Sansi Natural Reserve, Costa Rica x x X SM.3667 Proechimys semispinosus Estación Biológica Caño Palma, Tortuguero, Costa Rica x SM.3668 Proechimys semispinosus Reserva Oro Verde, San Josecito, Costa Rica x SM.3680 Proechimys semispinosus Selva Verde, Costa Rica x x X SM.3682 Proechimys semispinosus Selva Verde, Costa Rica x x X SM.3688 Proechimys semispinosus Selva Verde, Costa Rica x X SM.3692 Proechimys semispinosus Selva Verde, Costa Rica x X