Macrophages Eat Cancer Cells Using Their Own Calreticulin As a Guide: Roles of TLR and Btk

Macrophages eat cancer cells using their own calreticulin as a guide: Roles of TLR and Btk

Mingye Fenga,b,c, James Y. Chena,b,c,1, Rachel Weissman-Tsukamotoa,b,c,1, Jens-Peter Volkmera,b,c,1,PoYiHoa,b,c, Kelly M. McKennaa,b,c, Samuel Cheshiera, Michael Zhanga, Nan Guoa,b,c, Phung Gipa,b,c, Siddhartha S. Mitraa, and Irving L. Weissmana,b,c,d,2

aInstitute for Stem Cell Biology and Regenerative Medicine, bLudwig Center for Cancer Stem Cell Research and Medicine, cStanford Cancer Institute, and dDepartment of Pathology, Stanford University School of Medicine, Stanford, CA 94305

Contributed by Irving L. Weissman, December 30, 2014 (sent for review December 15, 2014) Macrophage-mediated programmed cell removal (PrCR) is an Btk results in its trafficking to the cell surface, where it can be important mechanism of eliminating diseased and damaged cells used to mediate PrCR of appropriate tumor cells. before programmed cell death. The induction of PrCR by eat-me signals on tumor cells is countered by don’t-eat-me signals such as Results CD47, which binds macrophage signal-regulatory protein α to in- We performed phagocytosis assays by coculturing mouse bone hibit phagocytosis. Blockade of CD47 on tumor cells leads to phago- marrow-derived macrophages (BMDMs) and target human can- cytosis by macrophages. Here we demonstrate that the activation cer cells to examine the efficacy of PrCR under different con- of Toll-like receptor (TLR) signaling pathways in macrophages syn- ditions. To induce phagocytosis, we blocked CD47 on a human ergizes with blocking CD47 on tumor cells to enhance PrCR. Bru- colon cancer cell line (SW620) either by treating tumor cells with ton’s tyrosine kinase (Btk) mediates TLR signaling in macrophages. CD47-blocking antibodies or by directly knocking out CD47. Calreticulin, previously shown to be an eat-me signal on cancer Phagocytosis was increased significantly by knocking out the self- cells, is activated in macrophages for secretion and cell-surface ex- protective signal CD47 (SW620CD47KO)(Fig. S1) resulting from posure by TLR and Btk to target cancer cells for phagocytosis, even an imbalance of eat-me over don’t-eat-me pathways (Fig. 1A). if the cancer cells themselves do not express calreticulin. WT

Treatment of SW620 cells with anti-CD47 antibody elicited INFLAMMATION stronger phagocytosis which was reversed by Fc-receptor blockers IMMUNOLOGY AND immunosurveillance | programmed cell removal | to the same level as that of SW620CD47KO cells, suggesting that Bruton’s tyrosine kinase | “eat me” signal | Toll-like receptor anti-CD47 antibody induced phagocytosis of SW620 cancer cells by both Fc-independent (blockade of CD47–SIRPα interactions) rogrammed cell removal (PrCR) is a process of macrophage- and Fc-dependent mechanisms (Fig. 1A). Pmediated immunosurveillance by which target cells are rec- To understand the molecular mechanisms of PrCR, we per- ognized and phagocytosed (1). PrCR previously was known to be formed screening experiments to identify signaling pathways that a key step concurrent with programmed cell death for the regulate the phagocytic ability of macrophages. TLR signaling clearance of apoptotic cells, but when apoptosis is blocked, PrCR plays a crucial role in the innate immune response against of neutrophils that are living (because of the enforced expression of bcl2) occurs precisely at the same time that PrCR removes Significance dying wild-type neutrophils (2). Recently a role for PrCR in eliminating living tumor cells has been revealed (1). Several studies have indicated a crucial function of CD47 as an antiphagocytic Macrophage-mediated programmed cell removal (PrCR) plays don’t-eat-me signal dominating over PrCR (3–10). During cancer an essential role in tumor surveillance and elimination. Blockade of the don’t-eat-me signal CD47 on tumor cells allows development, tumor cells up-regulate CD47, which protects them already expressed eat-me signals to induce PrCR to eliminate from PrCR (1, 3, 4, 6). Blockade of the interaction between CD47 tumor cells. To date the molecular mechanism by which mac- ontargetcellsanditsreceptor, signal-regulatory protein α (SIRPα), rophages recognize and phagocytose tumor cells remains un- on macrophages elicits efficient PrCR of cancer cells but not of A clear. This paper demonstrates that the activation of Toll-like most normal cells in vitro and in vivo (Fig. 1 ) (1, 3). When receptor (TLR) pathways in macrophages induces the phos- CD47 is blocked, cancer cells, but not normal cells, are phago- phorylation of Bruton’s tyrosine kinase (Btk), which catalyzes cytosed because prophagocytic eat-me signals such as calreticulin cell-surface exposure of calreticulin. Calreticulin on or secreted (CRT) are commonly expressed on many leukemias, lymphomas, by macrophages plays a critical role in mediating adjacent tu- and solid tumors (Fig. 1A) (11). CRT normally is an endoplasmic mor cell recognition and phagocytosis. These findings reveal reticulum (ER) protein possessing ER retention KDEL se- a strategy to enhance the efficacy of PrCR through a combina- quences but can be released to the cell surface in many instances tion of TLR/Btk activation and CD47 blockade, and advance our of cell damage by cytotoxic drugs or inflammation and is rec- understanding of the underlying mechanism of macrophage- ognized by macrophage LRP1/CD91 during phagocytosis of mediated PrCR of tumor cells. apoptotic cells (12, 13). Bruton’s tyrosine kinase (Btk) is a member of the Tec nonreceptor protein tyrosine kinase family, Author contributions: M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., S.C., M.Z., N.G., P.G., S.S.M., which plays a crucial role in the regulation of the innate immune and I.L.W. designed research; M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., M.Z., N.G., P.G., and S.S.M. performed research; M.F., J.Y.C., P.Y.H., K.M.M., M.Z., and N.G. contributed response (14, 15). A defect of Btk leads to immunodeficiencies new reagents/analytic tools; M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., S.C., M.Z., N.G., including X-linked hypo- or agammaglobulinemia (16–18), pre- P.G., S.S.M., and I.L.W. analyzed data; and M.F., J.-P.V., and I.L.W. wrote the paper. sumably caused by the blockade of B-cell development and The authors declare no conflict of interest. perhaps related to inefficient clearance of defective B-lineage Freely available online through the PNAS open access option. cells as well (19). Thus far, however, little is known about the 1J.Y.C., R.W.-T., and J.-P.V. contributed equally to this work. molecular mechanisms by which macrophages recognize and 2To whom correspondence should be addressed. Email: [email protected]. phagocytose living cancer cells. We show here that macrophages This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. express CRT and that Toll-like receptor (TLR) signaling through 1073/pnas.1424907112/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1424907112 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 Fig. 1. Activation of TLR signaling leads to enhanced PrCR of living cancer cells. (A, Left) Schematic showing PrCR of living tumor cells by macrophages. Blockade of CD47 leads to an imbalance of eat-me over don’t-eat-me pathways, which elicits phagocytosis of tumor cells, either Fc-dependent (elicited by Fc– FcR interaction) or Fc-independent (labeled in red, representing cancer-specific eat-me signals other than Fc). (Right) A phagocytosis assay showing blockade of CD47-induced phagocytosis, with SW620 cells [control IgG-treated, anti-CD47 antibody (B6H12)–treated, or CD47KO] as target cells and BMDMs from − − − − RAG2 / , γc / mice. Fc receptor blocker (FcRB) reversed phagocytosis of B6H12-treated cells to the same level as inf CD47KO cells. **P < 0.01, t test; ns, not significant. (B) A phagocytosis assay showing a screen of TLR agonists, with SW620 cells [PBS-treated, anti-CD47 antibody (Hu5F9-G4)–treated, or CD47KO]as target cells and BMDMs from BALB/c mice. TLR agonists used in the screen were Pam3CSK4 (Pam, TLR1/2), heat-killed Listeria monocytogenes (HKLM, TLR2), poly (I:C) HMW [poly (I:C), TLR3)], lipopolysaccharide (LPS, TLR4), flagellin from Salmonella typhimurium (FLA-ST, TLR5), Pam2CGDPKHPKSF (FSL-1, TLR6/2), imiquimod (Imi, TLR7), and class B CpG oligonucleotide (ODN 1826, TLR9). Dashed lines indicate twofold phagocytosis of each condition [PBS-treated, anti- CD47 antibody (Hu5F9-G4)-treated, or CD47KO] in the control macrophage group. Error bars represent SD.

pathogens (20, 21), and TLR agonists are listed as immunother- 2B). Notably, basal-level phagocytosis of cancer cells was regu- apeutic agents with anticancer potential (22). However, the role of lated by the Btk pathway, and ibrutinib showed an inhibitory TLR signaling in PrCR of living cancer cells remains unexplored. effect on both Fc-dependent and -independent phagocytosis Thus, we pretreated BMDMs with various TLR agonists and then (Fig. S6A). In sum, Btk is a crucial effector through which TLRs assayed their phagocytotic ability against cancer cells. We found mediate tumor cell phagocytosis. Interestingly, stimulation that the activation of multiple TLRs significantly enhanced and inhibition of Btk showed differential temporal effects on phagocytosis of cancer cells (Fig. 1B). We next focused on the phagocytosis. Maximal phagocytic ability of macrophages was TLR agonists that were most effective at enhancing phagocyto- achieved with 16 h of Btk activation (Fig. 2C); in contrast, blockade sis, assessing their effects on a wider range of macrophages and of Btk showed a prompt effect and reached the maximal inhibition tumor cells. We showed that treatment of macrophages with TLR3, within 1 h (Fig. 2D). -4, and -7 agonists, i.e., high-molecular-weight polyinosinic-poly- Upon activation, Btk phosphorylates transcription factors such cytidylic acid [poly (I:C) HMW], LPS, and imiquimod, dramatically as TFII-I and STAT5A (32, 33) in the nucleus and PLCγ2 (34) at enhanced their phagocytosis of multiple hematopoietic and solid the plasma membrane. Recent studies identified CRT as a sub- tumor cells (Figs. S2 and S3). Subsequent assessment in mice strate phosphorylated by Btk when TLR7 was activated in the lacking T, B, and natural killer (NK) cells showed that these TLR recognition of apoptotic cells (35). Phosphorylation of CRT by agonists significantly improved the efficacy of CD47-blocking anti- Btk in macrophages was important for CRT trafficking to the cell body in blocking tumor growth in vivo (Fig. S4). surface to function as a bridging molecule in the CRT/CD91/C1q To understand further the mechanism by which the activation complex, which initiates phagocytosis of apoptotic cells (13, 35, of TLR signaling in macrophages promoted tumor cell phago- 36). To investigate whether CRT is the critical downstream ef- cytosis, we treated macrophages by combining TLR agonists with fector of the TLR–Btk pathway to mediate PrCR of tumor cells, various inhibitors targeting key molecules that positively we then examined the expression and function of CRT in mac- (MAPK, Btk) (23–27) or negatively (PI3K, caspase-1) (28, 29) rophages. We found that CRT was expressed on the surface of regulate TLR signaling. Blockers of MAPK, PI3K, and caspase-1 macrophages, and its cell-surface exposure was regulated by the showed no effect on phagocytosis of cancer cells. In contrast, activation status of Btk (Fig. 3 A and B and Fig. S6B). CRT an- ibrutinib, a specific blocker of Btk, a tyrosine kinase expressed in tibody significantly inhibited phagocytosis of SW620 cells by the hematopoietic system (Fig. S5) (15, 30, 31), significantly at- mouse BMDMs or human peripheral blood mononuclear cells tenuated phagocytosis induced by TLR agonists (Fig. 2A). Treat- (PBMC)-derived macrophages (Fig. 3C and Fig. S6 C and D), ment of macrophages with poly (I:C) HMW, LPS, or imiquimod whereas overexpression of CRT in a mouse monocyte/macro- stimulated Btk to be phosphorylated, and this effect was coun- phage cell line, J774, led to enhanced phagocytosis (Fig. 3D). In teracted by ibrutinib, resulting in basal Btk phosphorylation (Fig. addition, we confirmed phosphorylation of CRT upon Btk

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al. Downloaded by guest on October 1, 2021 Fig. 2. Btk is the key signaling molecule regulating PrCR of cancer cells. (A) A phagocytosis assay showing a screen with combined TLR agonists and various − − − − inhibitors targeting downstream signaling molecules, with SW620 cells (control or CD47KO) as target cells and BMDMs from RAG2 / , γc / mice. Inhibitors used in the screen were PD98059 (PD, MEK inhibitor), LY294002 (LY, PI3K inhibitor), ibrutinib (Ibr, Btk inhibitor), and YVAD (vaspase-1 inhibitor). **P < 0.01 (t test; comparison between samples in control or CD47KO groups, Imi-ctrl vs. other conditions). (B) Immunoblots showing the phosphorylation of Btk induced by TLR agonists [Poly (I:C) HMW, LPS, imiquimod]. When cells were treated simultaneously with TLR agonists and ibrutinib, the induction of Btk phosphorylation was attenuated. Total Btk showed no change. (C and D) Temporal effects of Btk activator (imiquimod) (C) and inhibitor (ibrutinib) (D)on phagocytosis, with SW620 cellsCD47KO as target cells and BMDMs from NSG mice. Error bars in A, C, and D represent SD. INFLAMMATION IMMUNOLOGY AND

activation, which reached the maximal level after 30 min of imi- We further dissected the role of CRT in mediating PrCR of quimod treatment of macrophages (Fig. S6E). These results sug- cancer cells. Previous studies demonstrated cell-surface expres- gest that CRT is an essential component regulated by the TLR– sion of CRT on apoptotic cells and multiple viable human cancer Btk pathway to mediate phagocytosis of living cancer cells. cells (Fig. S7 B–D) (11, 12). Thus, we examined whether CRT

Fig. 3. Btk controls cell-surface exposure of CRT on macrophages to regulate PrCR of cancer cells. (A) The expression of CRT on macrophages was examined by a cell-surface biotinylation assay. Immunoblots showed that cell-surface CRT increased upon Btk activation and decreased upon Btk inhibition. Ibr, ibrutinib; Imi, imiquimod. (B) Increased cell-surface exposure of CRT on macrophages induced by TLR agonists [poly (I:C) HMW, LPS, imiquimod], as examined by flow cytometry analyses. (C) A phagocytosis assay showing CRT antibody inhibited phagocytosis of cancer cells, with SW620 cells [PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated or CD47KO] as target cells and BMDMs from RAG2−/−, γc−/− mice. Enhancement of phagocytosis induced by Poly (I:C) or imiquimod was reversed by CRT blockade. Dashed lines indicate normalized phagocytosis of each condition [PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated or CD47KO]in the control macrophage group. (D) Overexpression of CRT in J774 cells promoted phagocytosis. Expression of CRT was examined by immunoblotting. SW620 cells [control IgG- or anti-CD47 antibody (B6H12)–treated] were used as target cells. *P < 0.05, **P < 0.01 (t test). Error bars in C and D represent SD.

Feng et al. PNAS Early Edition | 3of6 Downloaded by guest on October 1, 2021 Fig. 4. CRT is a key effector on macrophages in mediating PrCR of cancer cells. (A) A phagocytosis assay showing the effects of blocking CRT on macrophages or cancer cells. (Left) A schematic showing the design of the experiments. Macrophages, target cells, or both were pretreated with CRT antibody and then subjected to the phagocytosis assay. (Right) A phagocytosis assay showing CRT on macrophages is necessary for phagocytosis of cancer cells, with SW620 cells − − − − (control or CD47KO) as target cells and BMDMs from RAG2 / , γc / mice. (B) Phagocytic ability of macrophages with differential surface CRT expression levels. Definitions of CRTLow, CRTMedium, and CRTHigh populations are given in Fig. S8 A and B.(C) Normalized tumor cell phagocytosis (y axis) was plotted against normalized cell-surface CRT expression (Log2; x axis) on macrophages with SW620 cells (CD47KO) as target cells and BMDMs from RAG2−/−, γc−/− or NSG mice. ■, BMDMs from NSG mice treated with imiquimod for 0, 1, 6, 16, or 24 h; ▲, BMDMs from RAG2−/−, γc−/− mice (CRTLow, CRTMedium, CRTHigh, and bulk populations); ●, BMDMs from NSG mice (CRTLow, CRTMedium, CRTHigh, and bulk populations). Error bars in A and B represent SD.

plays a critical role in mediating cancer cell phagocytosis on both elimination in mice deficient in lymphocytes, indicating that macrophages and target tumor cells (Fig. 4A). Interestingly, phagocytes are crucial to surveillance against cancer cells (40). blockade of CRT on macrophages diminished phagocytosis, but Phagocytosis of tumor cells mediated by anti-CD47 blockade can blocking CRT on cancer cells showed no effect, suggesting that result in cross-presentation of tumor antigens to CD8 T cells, so CRT has a specific role in mediating phagocytosis on macro- that CD47 blockade can result in both innate immune system phages (Fig. 4A). Importantly, cell-surface expression of CRT macrophage surveillance and stimulation of adaptive immune was enhanced by TLR agonists in macrophages but not in target system T-cell cytotoxicity (42). Here we show that cell-surface cancer cells, which lack Btk (Fig. S7), indicating distinct mech- expression of CRT on macrophages is controlled by the TLR– anisms regulating CRT exposure. Next, we examined macro- Btk pathway, which induces the phosphorylation of CRT for its phage subpopulations with different levels of cell-surface CRT cleavage from the ER retention signals and subsequent secretion and found that macrophages with a higher surface CRT showed and binding to CD91 on the cell surface. We show that this a stronger phagocytic ability (Fig. 4B and Fig. S8 A and B). mechanism of secretion is important for mediating PrCR of live Quantitative analysis of a panel of macrophages, including sub- cancer cells and also removes apoptotic cells (35). CRT on populations with differential surface CRT expression and mac- macrophages may function in detecting target cells through trans rophages at different time points after imiquimod treatment, interaction with as yet unidentified specific receptors on target revealed a significant correlation between CRT expression on cancer cells; thus blockade of surface CRT inhibits PrCR. macrophages and tumor cell phagocytosis (Fig. 4C and Fig. S8 C Moreover, CD47 mutant mice do not phagocytose self red cells and D). Additionally, both M1 and M2 human macrophages (37, or hematopoietic stem cells; however, these cells are phagocy- 38) derived from the peripheral blood expressed CRT on the tosed rapidly when transferred to wild-type congenic normal or surface, and an M1 subset expressed a somewhat higher level of irradiated mice (3, 43), even though neither cell type expresses CRT (Fig. S9). Taken together, these findings indicate that CRT CRT in microarrays, indicating that other eat-me signals may be is a key effector for macrophage-mediated surveillance of tumor used or that CRT can decorate target cells that do not express cells and that enhanced PrCR of cancer cells can be achieved by CRT genes. We show that multiple types of TLR agonists are up-regulating CRT on macrophages. able to stimulate macrophages and enhance PrCR of solid tumor cells, as is consistent with reports that the TLR4 agonist LPS and Discussion IFN-γ receptors are necessary for activating macrophages to Recent progress in cancer immunology has highlighted the phagocytose acute myeloid leukemia cells after the CD47– ability of cancer cells to evade immunosurveillance as one of the SIRPα interaction is disrupted (44). These studies suggest that essential hallmarks of cancer (1, 39, 40). Although lymphocytes TLR signaling can synergize with anti-CD47 blockade to en- (T, B, and NK cells) have been thought to mediate the bulk of hance tumor cell phagocytosis and therefore modulating TLR anticancer immunosurveillance (41), we have demonstrated that signaling could be a therapeutic approach to enhance tumor cell blockade of CD47 on tumor cells leads to in vivo immune rec- elimination. Notably, the impact of modulating TLR signaling in ognition, macrophage phagocytosis of tumor cells, and tumor normal cells in the context anti-CD47 blockade must be tested

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al. Downloaded by guest on October 1, 2021 first before the therapeutic potential of such synergy can be Preparation of Macrophages. BMDMs were generated as previously described − − judged. Further investigation of the interaction between mac- (3). Briefly, bone marrow cells were isolated from BALB/c, NSG, or RAG2 / , −/− rophages and target cancer cells should advance our under- γc mice at ∼6–10 wk of age. The cells were treated with ammonium- standing of the principles of cancer cell immune evasion. chloride-potassium (ACK) lysis buffer and then were cultured in IMDM medium supplemented with 10% (vol/vol) FBS and 10 ng/mL of macrophage Materials and Methods colony-stimulating factor (M-CSF). The cells were used for flow cytometry − − − − analysis or phagocytosis assay after 6–8 d of differentiation. Mice. BALB/c, RAG2 / γc / BALB/c and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice were bred in a pathogen-free facility in the Institute for Stem Cell Bi- ology and Regenerative Medicine at Stanford University. All animal proce- Flow Cytometry Analysis. Flow cytometry analyses were performed using a BD × 5– 6 dures were approved by the Administrative Panel on Laboratory Animal LSRFortessa. For staining, 2.5 10 10 cells were incubated with indicated – Care at Stanford University. antibodies (1:50 1:200) in FACS buffer [PBS with 2% (vol/vol) FBS] on ice for 30 min. Cells then were washed with FACS buffer and subjected to FACS Cell Culture. The human cancer-derived cell lines SW620 (colon cancer), analyses. For staining of macrophages, cells first were treated with Fc re- HL60 (leukemia), Raji (lymphoma), MDA-MB-231 (breast cancer), and PC3 ceptor blockers or a high concentration of isotype IgG control (5–10× in- (prostate cancer) and the murine macrophage/monocyte cell line J774 dicated antibodies) to block nonspecific binding of antibodies caused by the were obtained from ATCC and were cultured routinely in DMEM supple- interaction of the Fc domain and Fc receptors on macrophages. mented with 10% (vol/vol) FBS (SW620, MDA-MB-231, and J774 cells), Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 20% Phagocytosis Assay. FACS-based phagocytosis assays were performed to (vol/vol) FBS (HL60 cells), F-12K medium supplemented with 10% (vol/vol) evaluate the phagocytic abilities of macrophages. Macrophages were har- FBS (PC-3 cells), or RPMI-1640 medium supplemented with 10% (vol/vol) vested after 6–8 d of differentiation and were divided into FACS tubes or FBS (Raji cells). Tumor cells were transduced with lentiviruses which were low-attachment 96-well plates, with 1–5 × 104 cells per well or tube. Target generated with a pCDH-CMV-MCS-EF1 lentiviral vector expressing a lucif- cells were added and mixed with macrophages and were incubated at 37 °C erase–eGFP fusion protein and were sorted by flow cytometry with BD + for 2 h with the indicated conditions (antibody or drug treatment). FACSAria II cell sorters for GFP cells, as described previously (6). ACKNOWLEDGMENTS. We thank A. McCarty, S. Karten, T. Storm, L. Jerabek, CD47 Knockout with Transcription Activator-Like Effector Nucleases. Tran- S. Willingham, D. Corey, J. Seita, K. Loh, N. Fernhoff, R. Lu, A. Newman, scription activator-like effector nucleases (TALENs) were designed and as- H. Contreras-Trujillo, R. Sinha, T. Naik, M. Miyanishi, and S. Liu for scientific sembled as described (45). The genomic locus of human CD47 (NC_000003.12) discussions, technical assistance, and reagents; P. Lovelace and J. Ho for was scanned for putative TALEN-binding pairs. Exon 2 ultimately was selected assistance with FACS; and R. Majeti, J. Liu, and the CD47 Disease Team for for targeting, and the TALEN pairs TGTCGTCATTCCATGCTTTG and TATA- providing the anti-CD47 antibody Hu5F9-G4. Anti-Btk antibodies were gifts from Dr. Owen Witte (University of California, Los Angeles). This work was INFLAMMATION CTTCAGTAGTGTTTTG were cloned respectively into the pTALEN backbone. IMMUNOLOGY AND supported by National Cancer Institute of the National Institutes of Health SW620 cells were transfected with the CD47-TALEN constructs using Lipo- Grants R01 CA086017 (to I.L.W.) and P01 CA139490 (to I.L.W.) and The Vir- fectamine 2000. Three days after transfection, cells were stained with anti- − ginia and D. K. Ludwig Fund for Cancer Research. M.F. is a Damon Runyon CD47 or isotype antibodies. CD47 cells were sorted by flow cytometry with Cancer Research Fellow (DRG-2128-12). S.S.M. is a Seibel Scholar of the Seibel BD FACSAria II cell sorters. Stem Cell Institute.

1. Chao MP, Majeti R, Weissman IL (2012) Programmed cell removal: A new obstacle in 21. Kawai T, Akira S (2006) TLR signaling. Cell Death Differ 13(5):816–825. the road to developing cancer. Nat Rev Cancer 12(1):58–67. 22. Guha M (2012) Anticancer TLR agonists on the ropes. Nat Rev Drug Discov 11(7): 2. Lagasse E, Weissman IL (1994) bcl-2 inhibits apoptosis of neutrophils but not their 503–505. engulfment by macrophages. J Exp Med 179(3):1047–1052. 23. Ní Gabhann J, Jefferies CA (2011) TLR-induced activation of Btk — role for endosomal 3. Jaiswal S, et al. (2009) CD47 is upregulated on circulating hematopoietic stem cells MHC class II molecules revealed. Cell Res 21(7):998–1001. and leukemia cells to avoid phagocytosis. Cell 138(2):271–285. 24. Lim KH, Staudt LM (2013) Toll-like receptor signaling. Cold Spring Harb Perspect Biol 4. Majeti R, et al. (2009) CD47 is an adverse prognostic factor and therapeutic antibody 5(1):a011247. target on human acute myeloid leukemia stem cells. Cell 138(2):286–299. 25. Doyle SL, Jefferies CA, Feighery C, O’Neill LA (2007) Signaling by Toll-like receptors 8 5. Chao MP, et al. (2011) Extranodal dissemination of non-Hodgkin lymphoma requires and 9 requires Bruton’s tyrosine kinase. J Biol Chem 282(51):36953–36960. CD47 and is inhibited by anti-CD47 antibody therapy. Blood 118(18):4890–4901. 26. Schmidt NW, Thieu VT, Mann BA, Ahyi AN, Kaplan MH (2006) Bruton’s tyrosine kinase 6. Willingham SB, et al. (2012) The CD47-signal regulatory protein alpha (SIRPa) in- is required for TLR-induced IL-10 production. J Immunol 177(10):7203–7210. teraction is a therapeutic target for human solid tumors. Proc Natl Acad Sci USA 27. Lee KG, et al. (2012) Bruton’s tyrosine kinase phosphorylates Toll-like receptor 3 to – 109(17):6662 6667. initiate antiviral response. Proc Natl Acad Sci USA 109(15):5791–5796. 7. Chao MP, et al. (2011) Therapeutic antibody targeting of CD47 eliminates human 28. Fukao T, Koyasu S (2003) PI3K and negative regulation of TLR signaling. Trends Im- – acute lymphoblastic leukemia. Cancer Res 71(4):1374 1384. munol 24(7):358–363. 8. Chao MP, et al. (2010) Anti-CD47 antibody synergizes with rituximab to promote 29. Jabir MS, et al. (2014) Caspase-1 cleavage of the TLR adaptor TRIF inhibits autophagy – phagocytosis and eradicate non-Hodgkin lymphoma. Cell 142(5):699 713. and β-interferon production during Pseudomonas aeruginosa infection. Cell Host 9. Edris B, et al. (2012) Antibody therapy targeting the CD47 protein is effective in a model Microbe 15(2):214–227. of aggressive metastatic leiomyosarcoma. Proc Natl Acad Sci USA 109(17):6656–6661. 30. Burger JA, Buggy JJ (2013) Bruton tyrosine kinase inhibitor ibrutinib (PCI-32765). Leuk 10. Kim D, et al. (2012) Anti-CD47 antibodies promote phagocytosis and inhibit the Lymphoma 54(11):2385–2391. growth of human myeloma cells. Leukemia 26(12):2538–2545. 31. Brown JR (2013) Ibrutinib (PCI-32765), the first BTK (Bruton’s tyrosine kinase) inhibitor 11. Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple in clinical trials. Curr Hematol Malig Rep 8(1):1–6. human cancers and is counterbalanced by CD47. Sci Transl Med 2(63):63ra94. 32. Yang W, Desiderio S (1997) BAP-135, a target for Bruton’s tyrosine kinase in response 12. Gardai SJ, et al. (2005) Cell-surface calreticulin initiates clearance of viable or apo- to B cell receptor engagement. Proc Natl Acad Sci USA 94(2):604–609. ptotic cells through trans-activation of LRP on the phagocyte. Cell 123(2):321–334. 33. Mahajan S, et al. (2001) Transcription factor STAT5A is a substrate of Bruton’s tyrosine 13. Ogden CA, et al. (2001) C1q and mannose binding lectin engagement of cell surface kinase in B cells. J Biol Chem 276(33):31216–31228. calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp 34. Kurosaki T, et al. (2000) Regulation of the phospholipase C-gamma2 pathway in B Med 194(6):781–795. cells. Immunol Rev 176:19–29. 14. Rawlings DJ, Witte ON (1994) Bruton’s tyrosine kinase is a key regulator in B-cell 35. Byrne JC, et al. (2013) Bruton’s tyrosine kinase is required for apoptotic cell uptake via development. Immunol Rev 138:105–119. 15. Mohamed AJ, et al. (2009) Bruton’s tyrosine kinase (Btk): Function, regulation, and regulating the phosphorylation and localization of calreticulin. J Immunol 190(10): – transformation with special emphasis on the PH domain. Immunol Rev 228(1):58–73. 5207 5215. 16. Bruton OC (1952) Agammaglobulinemia. Pediatrics 9(6):722–728. 36. Vandivier RW, et al. (2002) Role of surfactant proteins A, D, and C1q in the clearance 17. Good RA, Varco RL (1955) A clinical and experimental study of agammaglobulinemia. of apoptotic cells in vivo and in vitro: Calreticulin and CD91 as a common collectin J Lancet 75(6):245–271. receptor complex. J Immunol 169(7):3978–3986. 18. Tsukada S, Witte ON (1994) X-linked agammaglobulinemia and Bruton’s tyrosine 37. Heusinkveld M, van der Burg SH (2011) Identification and manipulation of tumor kinase. Adv Exp Med Biol 365:233–238. associated macrophages in human cancers. J Transl Med 9:216. 19. Amoras AL, Kanegane H, Miyawaki T, Vilela MM (2003) Defective Fc-, CR1- and CR3-me- 38. Mori K, Hiroi M, Shimada J, Ohmori Y (2011) Infiltration of m2 tumor-associated diated monocyte phagocytosis and chemotaxis in common variable immunodeficiency and macrophages in oral squamous cell carcinoma correlates with tumor malignancy. X-linked agammaglobulinemia patients. J Investig Allergol Clin Immunol 13(3):181–188. Cancers (Basel) 3(4):3726–3739. 20. O’Neill LA, Golenbock D, Bowie AG (2013) The history of Toll-like receptors - redefining 39. Hanahan D, Weinberg RA (2011) Hallmarks of cancer: The next generation. Cell innate immunity. Nat Rev Immunol 13(6):453–460. 144(5):646–674.

Feng et al. PNAS Early Edition | 5of6 Downloaded by guest on October 1, 2021 40. Jaiswal S, Chao MP, Majeti R, Weissman IL (2010) Macrophages as mediators of tumor 43. Oldenborg PA, et al. (2000) Role of CD47 as a marker of self on red blood cells. Science immunosurveillance. Trends Immunol 31(6):212–219. 288(5473):2051–2054. 41. Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ (2011) Natural innate and adaptive 44. Theocharides AP, et al. (2012) Disruption of SIRPα signaling in macrophages eliminates immunity to cancer. Annu Rev Immunol 29:235–271. human acute myeloid leukemia stem cells in xenografts. JExpMed209(10):1883–1899. 42. Tseng D, et al. (2013) Anti-CD47 antibody-mediated phagocytosis of cancer by macrophages 45. Sanjana NE, et al. (2012) A transcription activator-like effector toolbox for genome primes an effective antitumor T-cell response. Proc Natl Acad Sci USA 110(27):11103–11108. engineering. Nat Protoc 7(1):171–192.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al. Downloaded by guest on October 1, 2021