Cellular Interleukin Enhancer-Binding Factor 2, ILF2, Inhibits Japanese Encephalitis Virus Replication in Vitro

viruses

Article Cellular Interleukin Enhancer-Binding Factor 2, ILF2, Inhibits Japanese Encephalitis Virus Replication In Vitro

Xiaofang Cui 1,2, Ping Qian 1,2,3,4,*, Tingting Rao 1,2, Yanming Wei 1,2, Fang Zhao 1,2, Huawei Zhang 1,2, Huanchun Chen 1,2,3,4 and Xiangmin Li 1,2,3,4,*

1 State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China; [email protected] (X.C.); [email protected] (T.R.); [email protected] (Y.W.); [email protected] (F.Z.); [email protected] (H.Z.); [email protected] (H.C.) 2 Laboratory of Animal Virology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China 3 Key Laboratory of Development of Veterinary Diagnostic Products, Ministry of Agriculture, Wuhan 430070, China 4 Key Laboratory of Preventive Veterinary Medicine in Hubei Province, The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070, China * Correspondence: [email protected] (P.Q.); [email protected] (X.L.); Tel.: +86-27-87282608 (X.L.) Received: 3 April 2019; Accepted: 16 June 2019; Published: 17 June 2019

Abstract: Japanese encephalitis virus (JEV) is a zoonotic mosquito-borne flavivirus which is the leading causative agent of viral encephalitis in endemic regions. JEV NS3 is a component of the viral replicase complex and is a multifunctional protein. In this study, interleukin enhancer-binding factor 2 (ILF2) is identified as a novel cellular protein interacting with NS3 through co-immunoprecipitation assay and LC-MS/MS. The expression of ILF2 is decreased in JEV-infected human embryonic kidney (293T) cells. The knockdown of endogenous ILF2 by special short hairpin RNA (shRNA) positively regulates JEV propagation, whereas the overexpression of ILF2 results in a significantly reduced JEV genome synthesis. Further analysis revealed that the knockdown of ILF2 positively regulates viral replication by JEV replicon system studies. These results suggest that ILF2 may act as a potential antiviral agent against JEV infection.

Keywords: Japanese encephalitis virus; cellular interleukin enhancer-binding factor 2 (ILF2); antiviral activity; viral RNA translation

1. Introduction Japanese encephalitis virus (JEV) belongs to the genus Flavivirus of the family Flaviviridae, which includes several critically important human pathogens such as West Nile virus (WNV), Dengue virus (DENV), and Zika virus [1–3]. The genome of JEV is a single-stranded and plus-sense RNA of approximately 11 kb in length. The genomic RNA carries the open reading frame (ORF) and encodes polyprotein cleaved by host and viral proteases to produce three structural proteins—capsid (C), pre-membrane (PrM), and envelope (E)—and seven nonstructural (NS) proteins—NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 [3]. The nonstructural proteins play an important role in viral replication, pathogenesis, and virus–host interactions. JEV NS3 is a multifunctional protein possessing helicase, protease, and nucleoside triphosphatase activities [4–6]. In addition, the 3’ NCR of JEV genomic RNA may form a replication complex together with NS3 and NS5 and participates in viral RNA replication [7,8].

Viruses 2019, 11, 559; doi:10.3390/v11060559 www.mdpi.com/journal/viruses Viruses 2019, 11, 559 2 of 16

JEV is recognized as the most significant cause of mosquito-borne viral encephalitis and a serious public health problem in Asia and the Pacific region, with over 3 billion persons at risk of infection [9–12]. The mortality is 20%–30% only among severe Japanese encephalitis (JE) cases; about 50% of patients develop neuropsychiatric or physiological sequelae. In spite of effective vaccine availability, there still are 68,000 reported cases of JEV annually [13–15]. Therefore, it is necessary to develop new strategies against JEV, especially broad-spectrum antiviral agents and small molecules that inhibit a critical step in the viral cycle [16,17]. Interleukin enhancer-binding factor 2 (ILF2), also known as nuclear factor 45 (NF45) in humans and mice, is a chromatin-interacting protein that is constitutively expressed and localized in the nucleus. ILF2 forms a stable heterodimer with interleukin enhancer-binding factor 3 (ILF3, also called NF90) and regulates the transcription of the IL-2 gene during T cell activation in the nucleus [18]. ILF2 contains an N-terminal arginine- and glycine-rich (RGG) domain, and a domain associated with zinc fingers (DZF) homologous to ILF3. ILF2 and the ILF2/ILF3 complex have been indicated to act as important regulatory factors involved in microRNA biogenesis, RNA transcription, splicing, mRNA translation, DNA break repair, cell proliferation, and apoptosis [19–26]. Recent studies revealed ILF2 to be considered as an important host cellular protein that is involved in the replication process of viruses, including hepatitis B virus, bovine viral diarrhea virus (BVDV), hepatitis C virus, infectious bursal disease virus (IBDV), human immunodeficiency virus type 1 (HIV-1), as well as porcine reproductive and respiratory syndrome virus (PRRSV) [27–33]. Meanwhile, ILF2 represses the ATP-induced activation of endogenous NLRP3 inflammasome in macrophages [34]. JEV NS3 is a multifunctional protein that participates in viral RNA replication. In this study, we aim to identify novel host factors interacting with JEV NS3 and evaluate their potential role in the infection of JEV. To this end, 293T cells were transduced with recombinant lentivirus expressing JEV NS3 and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was performed. ILF2 was shown to interact with JEV NS3. Moreover, ILF2 was found to be involved in the JEV life cycle and inhibit JEV replication.

2. Materials and Methods

2.1. Cells and Viruses Human embryonic kidney cells (293T) and baby hamster kidney BHK-21 cells (BHK-21) were grown in Dulbecco’s modiﬁed essential medium (DMEM; Invitrogen, USA) containing 10% fetal bovine serum (FBS; Gibco, NY, USA, 100 U/mL penicillin, and 10 µg/mL streptomycin sulfate at 37 ◦C in a humidiﬁed 5% CO2 incubator. JEV strain RP-9, which was a mutant of JEV Taiwanese isolate NT109 strain using irradiation, was kindly provided by Professor Yi-ling Lin (Institute of Biomedical Sciences, Academia Sinica, Taibei, Taiwan), and the titer assay was determined in BHK-21 cells [35].

2.2. Antibodies Mouse monoclonal antibodies against Flag-tag and HA-tag were purchased from Medical and Biological Laboratories Co., Ltd. (MBL, Tokyo, Japan). Rabbit anti-JEV NS3 polyclonal antibodies and EasyBlot mouse anti IgG (HRP) were obtained from GeneTex Inc (USA). Rabbit anti-ILF2 polyclonal antibodies, rabbit anti-Lamin A/C polyclonal antibodies, mouse anti-alpha tubulin monoclonal antibodies, and mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibodies were purchased from Proteintech Group Inc. (China). Horseradish peroxidase-conjugated (HRP) goat anti-mouse and goat anti-rabbit IgG (BA1054) (H + L) secondary antibodies were obtained from Boster Bioengineering Ltd. (China). Mouse Anti-JEV NS3 monoclonal antibodies (mAb) were kindly provided by Professor Sheng-bo Cao (Huazhong Agricultural University). Viruses 2019, 11, 559 3 of 16

2.3. Plasmids All primers used in this study are showed in Table1. Expression plasmid for wild-type human ILF2 was constructed by polymerase chain reaction (PCR) ampliﬁcation of cDNA from 293T cells. The ILF2 gene was cloned into pCAGGS-HA and pTRIP-3Flag-REP vector to generate HA and Flag-tagged expression plasmids pCAGGS-HA-ILF2 and pTRIP-3Flag-ILF2. JEV NS3 was also cloned into pTRIP-3Flag-REP to generate pTRIP-3Flag-NS3. All recombinant plasmids were further veriﬁed by DNA sequencing.

Table 1. List of primers used in this study.

Primers Oligonucleotide Sequence (50–30) pCAGGS-HA-ILF2-F GAATTCATGAGGGGTGACAGAGGC pCAGGS-HA-ILF2-R CTCGAGCTCCTGAGTTTCCATGC pTRIP-ILF2-3Flag-F ACTAGTATGAGGGGTGACAGAGGCCGTGG pTRIP-ILF2-3Flag-R GTCGACCTCCTGAGTTTCCATGCTTTC pCAGGS-HA-Firefly-F GAATTCATGGAAGATGCCAAAAACATTAAG pCAGGS-HA-Firefly-R CTCGAGCACGGCGATCTTGCCGCCCTTC qILF2-F AGTCGTGGAAAGCCTAAGAG qILF2-R GGTGGCACTGTTGTAATGAG qFirefiy-F GGCCCCAGCTAACGACATCTAC qFirefly-R GCAGCCCTTTCTTGCTCACG qGAPDH-F CACCCACTCCTCCACCTTTG qGAPDH-R CCACCACCCTGTTGCTGTAG qJEV-C-F GAGCTTGTTGGACGGCAGAG qJEV-C-R CACGGCGTCGATGAGTGTTC p: primer sequence for the construction of expression plasmids; q: primer sequence for quantitative real-time PCR analysis; F: forward; R: reverse.

pLKO.1 was purchased from Miaoling Bioscience and Technology Co., Ltd. (Wuhan, China) and used as a negative control, exhibiting no downregulation of any human gene. pLKO.1-shILF2, containing the short hairpin RNA (shRNA) corresponding to the ILF2 mRNA sequences (5’-CCAGCACCTGATGAAACTT-3’) (shILF2), was constructed and used to inhibit endogenous ILF2 protein expression. The plasmid carrying the JEV sub-genomic replicon fused with a Luciferase reporter with T7 promoter was kindly provided by Professor Bo Zhang (Wuhan Institute of Virology, Chinese Academy of Sciences). The plasmid carrying the JEV replication-deficient replicon with CMV promoter (a GDD-AAG mutation in NS5 of JEV replicon DNA) [36], pCR3.1-3Flag-NS1/NS5/E, and pmirGLO plasmids was kindly provided by Professor Yi-ling Lin. The firefly luciferase gene was amplified from pmirGLO and cloned into pCAGGS-HA.

2.4. Lentivirus Preparation Lentiviral vectors pTRIP-3Flag-NS3, pTRIP-3Flag-ILF2, or pLKO.1-shILF2 were co-transfected into 293T cells with two helper plasmids, pCMV-VSVG and pCMV-Gag-po1, by using Lipofectamine 2000 (Invitrogen, California, USA) according to the manufacturer’s instructions. The supernatants were harvested and centrifuged at 5000 rpm/min for 10 min at 4 ◦C to discard cell debris, and then stored at 80 C. Then, 293T cells were transduced with the recombinant lentiviruses in the presence − ◦ of 6.0 µg/mL of polybrene (Sigma, Missouri, USA).

2.5. MTS Assay At 36 h post-transduction of recombinant lentivirus carrying ILF2 or sh-ILF2, cells were seeded in 96-well plates. Cell viability following 1 day of culture was assayed using a CellTiter 96 Aqueous One Solution Cell Proliferation Assay kit (Promega, California, USA) and the optical density was measured at 490 nm. Viruses 2019, 11, 559 4 of 16

2.6. Co-Immunoprecipitation Analysis and LC-MS/MS First, 293T cells were transduced with recombinant lentivirus expressing JEV NS3. At 30 h post-transduction, cells were collected and lysed with NP40 lysis buffer containing protease inhibitor in ice for 30 min. Samples were subjected to centrifugation for 10 min at 4 ◦C to remove cellular debris. Cell lysates were incubated with anti-Flag M2 affinity gel in a rolling incubator at 4 ◦C overnight. Lysates were discarded after a brief centrifugation at 3000 g for 5 min at 4 C. The beads were washed × ◦ five times with cold lysis buffer prior to elution using Flag peptide. The purified products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by silver staining. The stained bands were excised and digested. The solution was subjected to direct nanoflow liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis to identify JEV NS3 interaction proteins by Shanghai Applied Protein Technology (Shanghai, China). When protein A/G plus-agarose (Santa Cruz, Dallas, Texas, USA) was used for co-immunoprecipitation (Co-IP), the cells lysates were first incubated with indicated antibodies at 4 C for 5 h. Five hours later, samples were subjected to centrifugation at 3000 g for 1 min at 4 C. ◦ × ◦ Then the supernatant was carefully transferred into Protein-A/G plus-agarose that had been washed with lysis buffer. Samples were incubated in a rolling incubator at 4 ◦C for 4 h. Supernatants were discarded after a brief centrifugation at 3000 g for 5 min at 4 C. The beads were washed five times × ◦ with cold lysis buffer prior to elution by incubation at 95 C in 1 sample buffer. The bound proteins ◦ × were boiled in loading buffer and further analyzed by Western blotting with the appropriate antibodies.

2.7. Indirect Immunofluorescence In order to observe the cellular localization of endogenous ILF2 with NS3 during JEV infection in 293T cells, 293T cells in 24-well plates were infected with JEV (5 MOI) for 24 h. The cells were washed with phosphate-buffered saline (PBS) followed by fixation with 4% ice-cold paraformaldehyde for 20 min. They were then permeabilized with PBS containing 0.1% Triton X-100 at room temperature (RT) for 10 min. The cells were washed three times with PBS, and then incubated in blocking solution (1% BSA in PBS) for 1 h. Viral and cellular proteins expression was detected with the appropriate primary antibodies for 2 h. After washing with PBS, the cells were incubated with florescence-conjugated secondary antibodies for 1 h. The cells were washed three times again with PBS before the nuclei were stained with 4’, 6’-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma) for 10 min. The cells were finally washed and fluorescent images were captured with a confocal laser scanning microscope (Carl Zeiss MicroImaging, Inc., Oberkochen, Germany).

2.8. Western Blot Assays Cells were harvested and treated with lysis buffer containing 1.19% HEPES, 0.88% NaCl, 0.04% EDTA, 1% NP40, and a protease inhibitor (Roche, Welwyn Garden, UK). The protein concentration of whole-cell lysates was determined with a bicinchoninic acid protein assay kit (Thermo Scientific). Equal amounts of proteins were loaded and separated using 12% sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Roche, UK). The membranes were blocked with 5% non-fat milk in 1 phosphate-buffered saline (PBS) with 5% × Tween-20 (DGBio, Beijing, China) for 4 h at room temperature (RT), and subsequently incubated with diluted primary antibodies against the indicated proteins at RT or at 4 ◦C for 2 h or overnight. Anti-rabbit or anti-mouse IgG antibodies conjugated to horseradish peroxidase (HRP) were used as secondary antibodies and developed using an enhanced chemiluminescence substrate (Thermo Scientific, USA). All immunoblot images were performed using a Bio-Rad ChemiDoc XRS+ instrument and image software. The expression of GAPDH was detected as the internal reference with anti-GAPDH monoclonal antibodies (Abclonal). Viruses 2019, 11, 559 5 of 16

2.9. Quantitative Real-Time PCR Cells were harvested at the indicated time points for total RNA extraction. Total RNA was extracted with TRIzol reagent (Invitrogen, Grand Island, NY, USA) in accordance with the manufacturer’s instructions. Then, 1.0 µg total RNA was used to reverse transcribed into cDNA using a First-Strand cDNA Synthesis Kit (Toyobo). The mRNA levels were determined by relative quantitative real-time PCR using SYBR Green Real-Time PCR Master Mix (TOYOBO) with specific primer pairs (listed in Table1). The relative RNA levels of specific RNA were normalized to that of the housekeeping gene ∆∆Ct GAPDH or firefly luciferase and the fold modulation in gene expression was analyzed with the 2− method. All reactions were performed in triplicate.

2.10. Plaque Assay First, 293T cells were transduced with recombinant lentivirus carrying ILF2 or sh-ILF2 and infected with JEV at an MOI of 1.0 at 48 h after transduction. The culture supernatant was harvested at diﬀerent points after infection, and the progeny virus titers were determined using a plaque-forming unit (PFU) assay. The viral culture supernatants with 10-fold dilutions were inoculated onto the monolayers of BHK-21 cells in 12-well plates. After 2 h of absorption, cells were washed with serum-free DMEM and incubated for 3 or 5 days in DMEM containing 2% FBS and 2% low melting-point agarose (GENVIEW). The cells were ﬁxed with 10% formalin and stained with 1% crystal violet for 2 h. Visible plaques were counted and statistically analyzed; all virus titers are expressed as PFU/milliliter (PFU/mL).

2.11. Luciferase Reporter Assay The plasmid carrying the JEV sub-genomic replicon fused with a Luciferase reporter gene was transcribed in vitro using the T7 MEGAscript kit (Ambion) following the manufacturer’s instructions. In brief, 293T cells were seeded in 24-well plates and transduced with sh-ILF2 expressing lentiviruses. At 36 h post-transduction, the cells were co-transfected with in vitro-transcribed JEV replicon RNA (0.5 µg) or the JEV replication-deficient replicon plasmid (0.5 µg) plus a firefly Luciferase plasmid (5 ng) as an internal control. At the indicated time points post-transfection, cell lysates were collected for the firefly and Renilla luciferase activities using a Dual-Luciferase Reporter Assay System (E1910, Promega, Madison, WI, USA).

2.12. Statistical Analysis All experiments were determined in triplicate. GraphPad Prism software Version 5 (GraphPad Prism Version 5, GraphPad Software, La Jolla, CA, USA, 2012) was used in this study. The various treatments were compared by an unpaired, two-tailed Student’s t-test while assuming unequal variance. p < 0.05 was considered statistically signiﬁcant. Meanwhile, p < 0.01 and p < 0.001 are marked with two (**) and three (***) asterisks, respectively.

3. Results

3.1. Identification of Host Cellular Proteins Interacting with JEV NS3 To identify novel host cellular proteins interacting with JEV NS3, 293T cells were transduced with recombinant lentivirus expressing JEV NS3 and LC-MS/MS analysis was successfully performed. The expression of JEV NS3 in 293T cells was confirmed by Western blot analysis (Figure1A). Cells were collected and cell lysates were analyzed by immunoprecipitation analysis with anti-Flag antibodies. The purified proteins were separated by SDS-PAGE and visualized using silver staining. A protein band with a molecular mass of about 72 kDa (consistent with NS3-3Flag) along with several co-purified protein bands were observed (Figure1B). The di fferential protein bands were then excised and analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS). LC-MS/MS analysis showed Viruses 2019, 11, 559 6 of 16

Viruses 2019, X 6 of 16 that several proteins (data not shown) with high hit scores such as ILF2, DnaJA1, DnaJA2, CKB, TUFM, DnaJA1, and DnaJA2 were co-precipitated with JEV NS3, while TUFM, PABPC1, and CKB were not and(Figures PABPC1 1C–F). were the candidate proteins interacting with JEV NS3.

Figure 1. Screening of host cellular proteins interacts with Japanese encephalitis virus (JEV) NS3. Figure 1. Screening of host cellular proteins interacts with Japanese encephalitis virus (JEV) NS3. Human embryonic kidney (293T) cells were transduced with recombinant lentivirus expressing JEV Human embryonic kidney (293T) cells were transduced with recombinant lentivirus expressing JEV NS3,NS3, the the immunoprecipitation immunoprecipitation withwith anti-Flaganti-Flag antibodies and and LC-MS/MS LC-MS/MS analysis analysis were were successfully successfully performed.performed. ( A(A)) The The expressionexpression ofof JEVJEV NS3NS3 in lentivir lentivirus-transducedus-transduced 293T 293T cells cells was was confirmed confirmed by by WesternWestern blot blot analysis. analysis. (B (B)) Cells Cells were were collectedcollected and cell cell lysates lysates were were analyzed analyzed by by immunoprecipitation immunoprecipitation analysisanalysis with with anti-Flag anti-Flag antibodies. antibodies. TheThe purifiedpurified proteins were were sepa separatedrated by by SDS-PAGE SDS-PAGE and and visualized visualized usingusing silver silver staining. staining. ( (CC––HH) )To To confirm confirm the the interaction interaction between between the candidate the candidate proteins proteins and JEV and NS3, JEV NS3,293T 293T cells cellswere wereco-transfected co-transfected with expression with expression plasmids encoding plasmids Flag-tagged encoding Flag-taggedNS3 and HA-tagged NS3 and HA-taggedinterleukin interleukin enhancer-binding enhancer-binding factor 2 (ILF2) factor/DnaJA1/DnaJA2/CKB/TUFM/PABPC1, 2 (ILF2)/DnaJA1/DnaJA2/CKB/TUFM and/PABPC1, then co- and thenimmunoprecipitation co-immunoprecipitation (Co-IP) (Co-IP)was performed was performed using anti-Flag using anti-Flag beads and beads anti-HA and anti-HAantibodies. antibodies. WCL, WCL,whole whole cell lysates. cell lysates.

3.2.Furthermore, The Special Interaction we conﬁrmed of ILF2 the and interaction NS3 was not between Mediated the by candidateDNA or RNA proteins and JEV NS3 through co-immunoprecipitation (Co-IP). First, 293T cells were co-transfected with expression plasmids ILF2 is an important host cellular protein involved in the replication process of various viruses. encoding Flag-tagged NS3 and HA-tagged ILF2/DnaJA1/DnaJA2/CKB/TUFM/PABPC1, and then Co-IP We focused on the role of ILF2 in the infection of JEV in this study. Previous studies have reported wasthat performed JEV NS3 is using associated anti-Flag with NS5 antibodies and forms and the anti-HA replicase antibodies. complex [8]. The In order results to ensure conﬁrm thethat special ILF2, DnaJA1,interaction and DnaJA2betweenwere ILF2 co-precipitated and NS3, we withperforme JEV NS3,d co-transfection while TUFM, experiments PABPC1, and to CKBdetect were the not (Figureinteraction1C–F). of ILF2 with the other JEV proteins, Flag-tagged NS3/NS5/NS1/E. The results of Co-IP and Western blot assay show that ILF2 does not co-precipitate with JEV NS5, NS1, and E proteins (Figure 3.2. The Special Interaction of ILF2 and NS3 was not Mediated by DNA or RNA 2A). Then the interaction between endogenous ILF2 and JEV NS3, as well as ILF2 with JEV infection, wasILF2 further is an confirmed important by host co-precipitation cellular protein with involved Flag-tagged in the NS3 replication in 293T cells process (Figures of various2B,C). viruses. We focusedILF2 onis capable the role of of binding ILF2 in theto nucleic infection acid of JEVand ininteracting this study. with Previous numerous studies proteins have reportedand RNAs that JEV[27,31]. NS3 isTo associated observe the with DNA NS5 or andRNA forms engaged the in replicase the interaction complex between [8]. In ILF2 order and to NS3, ensure RNaseA the special or interactionDnase I treatment between ILF2prior andto the NS3, co-immunoprecipitati we performed co-transfectionon assays was experiments conducted. to As detect shown the in interaction Figure of2D, ILF2 the with pre-treatment the other JEV did proteins,not decay Flag-tagged the interaction NS3 between/NS5/NS1 ILF2/E. and The JEV results NS3, of indicating Co-IP and that Western the blotinteraction assay show of ILF2 that ILF2and NS3 does was not not co-precipitate mediated by with DNA JEV or NS5,RNA. NS1, and E proteins (Figure2A). Then

Viruses 2019, 11, 559 7 of 16 the interaction between endogenous ILF2 and JEV NS3, as well as ILF2 with JEV infection, was further conﬁrmedViruses 2019 by, X co-precipitation with Flag-tagged NS3 in 293T cells (Figure2B,C). 7 of 16

FigureFigure 2. 2.RNA RNA oror DNADNA are not not involved involved in in the the interaction interaction between between ILF2 ILF2 and andJEV NS3. JEV NS3.(A) The (A co-) The co-transfectiontransfection of of HA-tagged HA-tagged ILF2 ILF2 with with Flag-tagge Flag-taggedd NS3/NS5/NS1/E NS3/NS5/NS1 /wasE was conducted conducted and and cell cell lysates lysates werewere analyzed analyzed by by immunoprecipitation immunoprecipitation analysisanalysis with anti-Flag anti-Flag bead beadss 24 24 h hpost-transfection. post-transfection. Western Western blotblot assay assay was was then then detected detected with with thethe indicatedindicated antibodies. (B (B) )The The interaction interaction between between endogenous endogenous ILF2ILF2 and and JEV JEV NS3 NS3 was was conﬁrmed confirmed by by co-precipitation. co-precipitation. 293T 293T cells cells were were transfected transfected with with pTRIP-3Flag-NS3 pTRIP-3Flag- orNS3 pTRIP-3Flag. or pTRIP-3Flag. Cell extracts Cell extracts were were subjected subjected to immunoprecipitation to immunoprecipitation (IP) (IP) using using anti-Flag anti-Flag beads beads and detectedand detected with anti-ILF2 with anti-ILF2 or anti-Flag or anti-Flag antibodies. antibodies. (C) The (C interaction) The interaction of ILF2 of with ILF2 NS3 with was NS3 examined was inexamined JEV-infected in JEV-infected 293T cells. 293T 293T cells. cells 293T were cells transduced were transduced with with lentiviruses lentiviruses expressing expressing 3Flag-ILF2 3Flag- forILF2 48 h.for Cells48 h. Cells were were infected infected with with JEV JEV at at an an MOI MOI of of 1.0 1.0 and and cellcell lysates were were harvested harvested at at24 24h h post-infectionpost-infection for for co-immunoprecipitation co-immunoprecipitation with with anti-Flag anti-Flag beads, beads, and and were were then then detected detected with with anti-NS3 anti- polyclonalNS3 polyclonal antibodies antibodies or anti-Flag or anti-Flag antibodies. antibodies. (D) 293T(D) 293T cells cells were were co-transfected co-transfected with with pCA-HA-ILF2 pCA-HA- andILF2 pTRIP-3Flag-NS3 and pTRIP-3Flag-NS3 plasmid plasmid for 24 h.for Then, 24 h. Then, cell lysates cell lysates treated treated with orwith without or without RNase RNase A and A Dnase and I wereDnase harvested I were forharvested co-immunoprecipitation for co-immunoprecipitation with anti-Flag with beads,anti-Flag and beads, then detectedand then with detected anti-HA with and anti-Flaganti-HA antibodies. and anti-Flag antibodies.

3.3.ILF2 ILF2 is Co-Localized capable of bindingwith JEV to NS3 nucleic during acid Virus and Infection interacting with numerous proteins and RNAs [27,31]. To observeTo verify the DNA the intracellular or RNA engaged co-localization in the interaction of ILF2 with between NS3 in JEV-infected ILF2 and NS3, cells, RNaseA 293T cells or Dnasewere I treatmentinfected with prior JEV to theat an co-immunoprecipitation MOI of 5, and confocal immunofluorescence assays was conducted. assay As was shown performed in Figure 24 h 2post-D, the pre-treatmentinfection (hpi). did As not shown decay in the Figure interaction 3A, ILF2 between was detected ILF2 and mainly JEV NS3, in the indicating nucleus in that mock-infected the interaction ofcells; ILF2 andhowever, NS3 wasILF2 not partly mediated translocated by DNA from or the RNA. nucleus to cytoplasm and co-located with NS3 in JEV-infected cells. Moreover, to examine the subcellular localization of ILF2, the cytoplasmic and 3.3.nuclear ILF2 Co-Localized fractions of withJEV-infected JEV NS3 293T during cells Virus (1.0 Infection MOI) were separated. The cell fractionation was analyzedTo verify by theimmunoblotting intracellular co-localizationand the results ofshow ILF2 that with ILF2 NS3 was in detected JEV-infected in both cells, the 293T nuclear cells and were infectedcytoplasmic with fractions, JEV at an while MOI the of amount 5, and of confocal ILF2 was immunoﬂuorescence increased in the cytoplasm assay and was decreased performed in the 24 h nucleus in JEV-infected cells (Figure 3B). post-infection (hpi). As shown in Figure3A, ILF2 was detected mainly in the nucleus in mock-infected cells; however, ILF2 partly translocated from the nucleus to cytoplasm and co-located with NS3 in JEV-infected cells. Moreover, to examine the subcellular localization of ILF2, the cytoplasmic and nuclear fractions of JEV-infected 293T cells (1.0 MOI) were separated. The cell fractionation was analyzed by immunoblotting and the results show that ILF2 was detected in both the nuclear and cytoplasmic fractions, while the amount of ILF2 was increased in the cytoplasm and decreased in the nucleus in JEV-infected cells (Figure3B).

Viruses 2019, 11, 559 8 of 16 Viruses 2019, X 8 of 16

Figure 3. Co-localization of ILF2 with JEV NS3 in virus-infected cells. (A) 293T cells were infected Figure 3. Co-localization of ILF2 with JEV NS3 in virus-infected cells. (A) 293T cells were infected with JEV at an MOI of 5 for 24 h, the cells were then fixed with 4% paraformaldehyde and subjected with JEV at an MOI of 5 for 24 h, the cells were then fixed with 4% paraformaldehyde and subjected to immunofluorescence assay using anti-ILF2 antibodies (green) and anti-NS3 antibodies (red). The to immunofluorescence assay using anti-ILF2 antibodies (green) and anti-NS3 antibodies (red). The nucleinuclei were were stained stained with with DAPI DAPI (blue). (blue). The The imagesimages ofof cellscells were acquired using using confocal confocal microscopy microscopy (Carl(Carl Zeiss Zeiss MicroImaging, MicroImaging, Inc.). Inc.). (B )(B Western) Western blot blot analysis analysis of theof the distribution distribution of of ILF2 ILF2 in thein the nuclear nuclear and cytoplasmicand cytoplasmic fractions fractions in 293T cellsin 293T infected cells withinfected JEV atwi anth MOIJEV at of 1.0.an MOI Cell extractsof 1.0. Cell were extracts fractionated were at 24 hfractionated post-infection at 24 (hpi), h post-infection and JEV NS3 (hpi), and ILF2 and in JEV the NS3 nuclear and and ILF2 cytoplasmic in the nuclear fractions and werecytoplasmic detected byfractions immunoblotting were detected with rabbit by immu anti-NS3noblotting antibodies with rabbit and rabbit anti-NS3 anti-ILF2 antibodies antibodies. and rabbit LaminA anti-ILF2/C and α-tubulinantibodies. were LaminA/C used as nuclear and α-tubulin and cytoplasmic were used markers,as nuclear respectively. and cytoplasmic markers, respectively. 3.4. Expression of ILF2 in 293T Cells Infected with JEV 3.4. Expression of ILF2 in 293T Cells Infected with JEV ToTo assess assess the the response response of of ILF2 ILF2 to to JEV JEV infection, infection, 293T293T cells were infected infected with with JEV JEV at at an an MOI MOI of of 1.01.0 and and collected collected at at indicated indicated time time points, points, and and ILF2ILF2 mRNAmRNA and protein levels levels of of ILF2 ILF2 were were evaluated evaluated byby qRT-PCR qRT-PCR and and Western Western blotting blotting analysis. analysis. AsAs shownshown in Figure 44A,A, the mRNA level level of of ILF2 ILF2 was was decreaseddecreased at 6at h 6 toh to 36 36 h h after after JEV JEV infection infection compared compared withwith the control group group in in 293T 293T cells. cells. The The protein protein levellevel of ILF2of ILF2 significantly significantly decreased decreased at at 24 24 h h and and 3636 hh post-infectionpost-infection with with JEV, JEV, which which was was correlated correlated withwith the the expression expression of of JEV JEV NS3 NS3 (Figure (Figure4B). 4B). These These data dataclearly clearly indicateindicate that JEV JEV infection infection significantly significantly decreaseddecreased the the expression expression of of ILF2 ILF2 at at both both the the mRNA mRNA andand proteinprotein levels.

VirusesViruses 20192019, X, 11 , 559 9 9of of 16 16

Figure 4. Expression of ILF2 in 293T cells infected with JEV. (A) 293T cells were uninfected or infected Figurewith JEV 4. Expression at an MOI of 1.0.ILF2 At in di293Tfferent cells times infected post-infection, with JEV. samples(A) 293Twere cells collectedwere uninfected and the or ILF2 infected mRNA withlevel JEV was at determined an MOI of by1.0. quantitative At different real-time times post-infection, PCR and normalized samples to were GAPDH. collected (B) Protein and the levels ILF2 of mRNAILF2 were level evaluated was determined through by Western quantitative blot analysis real-time and PCR GAPDH and normalized was used as to a GAPDH. normalizer (B) (left). Protein The levelsrelative of ILF2 protein were levels evaluated were analyzed through Western using Image blot Janalysis software and (right). GAPDH The was data used shown as area normalizer from three (left).independent The relative assays, protein with levels the error were bars analyzed representing using theImage standard J software deviations (right). (*** Thep < data0.001, shown Student’s are fromt-test). three independent assays, with the error bars representing the standard deviations (*** P < 0.001, Student’s t-test). 3.5. ILF2 Inhibits JEV Replication 3.5. ILF2To Inhibits explore JEV the Replication role of ILF2 in JEV replication, 293T cells were transduced with recombinant lentiviruses carrying shRNA corresponding to the ILF2 mRNA sequences (shILF2) or control lentiviruses To explore the role of ILF2 in JEV replication, 293T cells were transduced with recombinant (shNC, Negative Control (NC)). The interference effect was detected by Western blot and real-time PCR. lentiviruses carrying shRNA corresponding to the ILF2 mRNA sequences (shILF2) or control The results show that protein and mRNA levels of ILF2 were significantly decreased compared to the lentiviruses (shNC, Negative Control (NC)). The interference effect was detected by Western blot and control cells (Figure5A). MTS assays demonstrated that the knockdown of ILF2 does not a ffect 293T real-time PCR. The results show that protein and mRNA levels of ILF2 were significantly decreased cell proliferation (Figure5B). The control and ILF2-knockdown 293T cells were both infected with JEV compared to the control cells (Figure 5A). MTS assays demonstrated that the knockdown of ILF2 does at an MOI of 1. The culture supernatants were harvested; the NS3 protein level of JEV and gene copies not affect 293T cell proliferation (Figure 5B). The control and ILF2-knockdown 293T cells were both of the JEV C gene were detected by Western blot and qRT-PCR analysis. As shown in Figure5C,D, the infected with JEV at an MOI of 1. The culture supernatants were harvested; the NS3 protein level of NS3 protein levels were significantly increased in the knockdown of ILF2 compared with the control JEV and gene copies of the JEV C gene were detected by Western blot and qRT-PCR analysis. As cells. The C gene levels of JEV were also significantly increased in the ILF2-knockdown 293T cells. shown in Figures 5C,D, the NS3 protein levels were significantly increased in the knockdown of ILF2 Moreover, the titers of the progeny virus were determined using a plaque-forming unit assay, and the compared with the control cells. The C gene levels of JEV were also significantly increased in the results show that the knockdown of ILF2 significantly increased virus titers (Figure5E). ILF2-knockdown 293T cells. Moreover, the titers of the progeny virus were determined using a plaque-forming unit assay, and the results show that the knockdown of ILF2 significantly increased virus titers (Figure 5E).

Viruses 2019, 11, 559 10 of 16 Viruses 2019, X 10 of 16

Figure 5. Knockdown of ILF2 promotes JEV infection. (A–B) 293T cells were transduced with lentivirus Figureshort hairpin 5. Knockdown RNA (shRNA) of ILF2 targeting promotes ILF2 JEV (shILF2) infection. or non-target (A–B) 293T shRNA cells (NC) were for transduced 48 h. The silence with lentivirusefficiency short was measuredhairpin RNA by Western(shRNA) blot targeting and real-time ILF2 (shILF2) PCR analysisor non-target (A) and shRNA the proliferation (NC) for 48 h. of The293T-shILF2 silence cellsefficiency was analyzed was measured by MTS assayby Wester (B). 293T-shILF2n blot and andreal-time 293T-shNC PCR cellsanalysis were (A) infected and withthe proliferationJEV at an MOI of of293T-shILF2 1.0 for 12 h cells or 24 was h. Cellsanalyzed supernatants by MTS assay and total (B). RNA293T-shILF2 were harvested and 293T-shNC for indicated cells wereexperiments. infected with (C) The JEV protein at an MOI level of of 1.0 JEV for NS3 12 wash or conducted24 h. Cells throughsupernatants Western and blot total analysis RNA were with harvestedanti-NS3 antibodiesfor indicated and experiments. normalized to (C GAPDH.) The protein (D) The level relative of JEV quantification NS3 was conducted of intracellular through JEV WesternC gene copies blot analysis was detected with byanti-NS3 real-time an PCRtibodies analysis. and (normalizedE) The production to GAPDH. of progeny (D) The virus relative titer in quantificationculture supernatants of intracellular was measured JEV C by gene plaque copi assayes was in babydetected hamster by real-time kidney (BHK)-21 PCR analysis. cells. The(E) dataThe productionshown are fromof progeny three independent virus titer in assays, culture with supernatants the error bars was representing measured standardby plaque deviations assay in (*babyp < hamster0.05; ** p kidney< 0.01; ***(BHK)-21p < 0.001, cells. Student’s The datat-test). shown are from three independent assays, with the error bars representing standard deviations (* p < 0.05; ** p < 0.01; *** p < 0.001, Student’s t-test). We further investigated whether ectopic expression of ILF2 could inhibit JEV replication in 293TWe cells. further Cells investigated were transduced whether with ectopic recombinant expression lentiviruses of ILF2 could expressing inhibit ILF2JEV replication (Lenti-3Flag-ILF2) in 293T cells.and aCells control were (Lenti-3Flag). transduced with MTS recombinant assay showed lentiviruses that the overexpression expressing ILF2 of (Lenti-3Flag-ILF2) ILF2 does not affect and cell a controlproliferation (Lenti-3Flag). (Figure6 A).MTS As assay expected, showed JEV replicationthat the overexpression was significantly of inhibitedILF2 does at not di ff affecterent timecell proliferationpoints post-infection (Figure 6A). in 293T As expected, cells overexpressing JEV replicat ILF2,ion was determined significantly by Western inhibited blot, at qRT-PCR,different time and pointsPFU assays post-infection (Figure6B–D). in 293T All cells these overexpressing results indicate ILF2, that determined ILF2 is a host by restriction Western blot, factor qRT-PCR, for JEV. and PFU assays (Figure 6B–D). All these results indicate that ILF2 is a host restriction factor for JEV.

VirusesViruses 20192019,, X11 , 559 1111 of of 16 16

Figure 6. Overexpression of ILF2 inhibits JEV replication in 293T cells. 293T cells were transduced Figurewith lentiviruses 6. Overexpression expressing of ILF2 (Lenti-3Flag-ILF2)inhibits JEV replicatio or an control in 293T lentivirus cells. 293T (Lenti-3Flag) cells were fortransduced 48 h and withthe proliferation lentiviruses ofexpressing overexpressing ILF2 (Lenti-3Flag-ILF2) ILF2 293T cells was or analyzed a control by lentivirus MTS assay. (Lenti-3Flag) (A) Cells werefor 48 infected h and thewith proliferation JEV at an MOI of overexpressing of 1.0 for 12 h orILF2 24 293T h. Cells cells supernatants was analyzed and by total MTS RNA assay. were (A harvested) Cells were for infectedthe indicated with JEV experiments. at an MOI Theof 1.0 antiviral for 12 h activityor 24 h. ofCells ILF2 supernatants against JEV and infection total RNA was were evaluated harvested with fordiff theerent indicated experiments. experiments. (B) Western The antiviral blot analysis activity of the of ILF2 protein against level JEV of JEV infection NS3 was was performed evaluated usingwith differentthe indicated experiments. antibodies. (B) GAPDHWestern blot served analysis as the of loading the protein control level at anof JEV equal NS3 sample was performed loading. (C using) The therelative indicated quantification antibodies. of intracellularGAPDH served JEV Cas gene the loading copies by control real-time at an PCR equal analysis. sample (D loading.) The production (C) The relativeof progeny quantification virus in culture of intracellular supernatants JEV was measuredC gene copies by plaque by real-time assay. The PCR plaque analysis. formation (D) ability The productionwas observed of inprogeny BHK-21cells virus (left)in culture and virus supernatants titer was calculated was measured (right). by Three plaque asterisks assay. indicate The plaque that a formationstatistical diabilityfference was exists observed between in overexpressingBHK-21cells (lef ILF2t) and 293T virus cells titer and was control calculated cells at p(right).< 0.001. Three asterisks indicate that a statistical difference exists between overexpressing ILF2 293T cells and control 3.6. Knockdown of ILF2 Positively Regulates JEV Replication by Sub-Genomic Replicon System Assay cells at p < 0.001. Our previous study showed that part of ILF2 was translocated from the nucleus to cytoplasm 3.6.and Knockdown co-located of with ILF2 NS3 Positively in JEV-infected Regulates cells.JEV Replication We hypothesized by Sub-Genomi that ILF2c Replicon might beSystem involved Assay in viral translationOur previous and genome study replicationshowed that to inhibitpart of JEVILF2 replication. was translocated Then, wefrom used the a nucleus sub-genomic to cytoplasm replicon andsystem co-located to measure with NS3 viral in replication JEV-infected activity. cells. We ILF2-knockdown hypothesized that 293T ILF2 cells might by special be involved shRNA in wereviral translationtransfected and with genomein vitro replication-transcribed to JEVinhibit replicon JEV re RNAplication. and fireflyThen, we luciferase used a DNAsub-genomic was used replicon as the systeminternal to control. measure Cells viral were replication harvested activity. at 3, 6,ILF2-knockdown 9, 12, 24, and 36 293T h post-transfection cells by special (hpt). shRNA Western were transfectedblot analysis with showed in vitro-transcribed that the level of JEV NS3 replicon protein wasRNA extremely and firefly increased luciferase in DNA ILF2-knockdown was used as 293T the internalcells compared control. withCells the were control harvested cells atat 363, hpt6, 9, (Figure12, 24, 7andA). 36 qRT-PCR h post-transfection assay showed (hpt). that Western the replicon blot analysisRNA was showed also markedly that the level increased of NS3 in ILF2-knockdownprotein was extremely 293T cellsincreased compared in ILF2-knockdown with the control 293T cells cells at 3, compared6, 9, 12, 24, with and the 36 control hpt (Figure cells7 atB). 36 The hpt activity (Figure of7A). luciferase qRT-PCR in assay the replicon showed was that measured the replicon by RNA dual wasluciferase also markedly assays. As increased shown in FigureILF2-knockdown7C, the luciferase 293T cells activity compared was higher with the for control all of the cells time at points3, 6, 9, 12,in ILF2-knockdown24, and 36 hpt (Figure cells compared 7B). The with activity that of theluciferase control in cells. the Ourreplicon results was suggest measured that ILF2by dual may luciferaseparticipate assays. in viral As protein shown translation in Figure 7C, and the/or viruslucifera RNAse activity replication. was higher for all of the time points in ILF2-knockdown cells compared with that of the control cells. Our results suggest that ILF2 may participate in viral protein translation and/or virus RNA replication. JEV RNA replication depends on viral proteins, and JEV NS3 and NS5 proteins have been shown to play important roles in viral genome replication [6,37]. We further used a replication-deficient replicon containing a GDD-AAG mutation in NS5 to study the effect of ILF2 on viral translation. The

Viruses 2019, X 12 of 16

ILF2-knockdown 293T cells were transfected with JEV replication-deficient replicon plasmid and firefly luciferase DNA as above. Western blot analysis and the quantification of the JEV NS3 band's intensity were analyzed by ImageJ software and the results show that the protein products of JEV NS3 were increased compared with the control cells at 24 hpt, while they were decreased at 36 hpt (Figure 7D). The replicon RNA and luciferase activities were higher in the ILF2-knockdown 293T Virusescells (Figures2019, 11, 559 7E,F). These data demonstrate that the knockdown of ILF2 favored JEV genome12 of 16 replication.

Figure 7. Knockdown of ILF2 positively regulates JEV replication by sub-genomic replicon system Figure 7. Knockdown of ILF2 positively regulates JEV replication by sub-genomic replicon system assay. 293T-shILF2 cells and 293T-shNC cells were transfected with a Renilla luciferase JEV replicon RNAassay. or293T-shILF2 a Renilla luciferase cells and JEV293T-shNC replication-deficient cells were transfected replicon with DNA. a Renilla Firefly luciferaseluciferase wasJEV replicon used as theRNA internal or a Renilla control. luciferase Cells lysatesJEV replication-deficient were harvested at replicon 3, 6, 9, 12,DNA. 24, andFirefly 36 luciferase h post-transfection was used as (hpt). the (internalA,D) The control. protein Cells level lysates of JEV were NS3 harvested was determined at 3, 6, by 9, Western12, 24, and blot 36 analysis h post-transfection with antibodies (hpt). against (A,D) JEVThe NS3,protein ILF2, level and of GAPDH. JEV NS3 GAPDHwas determined served as by the We loadingstern blot control analysis at an with equal antibodies sample loading. against ( BJEV,E) TotalNS3, cellularILF2, and RNA GAPDH. was extracted GAPDH and served the as level the of loading JEV RNA control (NS3) at wasan equal detected sample through loading. real-time (B,E) Total PCR analysis.cellular RNA (C,F) was Cell extracted lysates were and collected the level at of the JEV indicated RNA (NS3) times was and weredetected subjected through to dual-luciferasereal-time PCR assay.analysis. Renilla (C,F) luciferaseCell lysates activity were collected was normalized at the indicated to firefly times luciferase. and were The subjected data shown to dual-luciferase are from three independentassay. Renilla assays,luciferase with activity the error was barsnormalized representing to firefly standard luciferase. deviations The data (* shownp < 0.05; are **fromp < three0.01; ***independentp < 0.001, Student’sassays, witht-test). the error bars representing standard deviations (* p < 0.05; ** p < 0.01; *** p < 0.001, Student’s t-test). JEV RNA replication depends on viral proteins, and JEV NS3 and NS5 proteins have been shown to4. Discussion play important roles in viral genome replication [6,37]. We further used a replication-deficient repliconHost containing antiviral arestriction GDD-AAG factors, mutation including in NS5 to interferon-stimulated study the effect of ILF2 genes on viral (ISGs) translation. and other The ILF2-knockdownantiviral factors, 293Tcan target cells were various transfected steps in with the JEVvirus replication-deficient life cycle. The interaction replicon plasmidof virus and and firefly host luciferasefactors is DNAa key as step above. for Westernthe virus blot infection analysis process and the quantificationand plays an ofimportant the JEV NS3 role band’s in viral intensity RNA werereplication, analyzed translation, by ImageJ and software post-translational and the results modification, show that theaiding protein in productsour understanding of JEV NS3 of were the increasedmolecular comparedmechanism with of theviral control pathogenesis cells at 24and hpt, the while development they were of decreased antiviral atdrugs 36 hpt [38]. (Figure In recent7D). Theyears, replicon several RNA studies and luciferasehave identified activities anti-JEV were higher host restriction in the ILF2-knockdown factors with 293Tdifferent cells (Figuremechanisms7E,F). These[17,39–45]. data demonstrateIn this study, that host the cellular knockdown protein of ILF2 favoredwas identified JEV genome to specifically replication. interact with JEV NS3. We demonstrate that the overexpression of ILF2 inhibits JEV infection and the knockdown of 4. Discussion Host antiviral restriction factors, including interferon-stimulated genes (ISGs) and other antiviral factors, can target various steps in the virus life cycle. The interaction of virus and host factors is a key step for the virus infection process and plays an important role in viral RNA replication, translation, and post-translational modification, aiding in our understanding of the molecular mechanism of viral pathogenesis and the development of antiviral drugs [38]. In recent years, several studies have identified anti-JEV host restriction factors with different mechanisms [17,39–45]. In this study, host Viruses 2019, 11, 559 13 of 16 cellular protein ILF2 was identified to specifically interact with JEV NS3. We demonstrate that the overexpression of ILF2 inhibits JEV infection and the knockdown of endogenous ILF2 enhances JEV replication. Furthermore, the knockdown of ILF2 favors JEV genome replication by positively regulating JEV protein translation. JEV NS3 is a multifunctional protein that functions as helicase, protease, and nucleoside triphosphatase by interacting with JEV NS2B and NS4A. Moreover, NS3 forms the viral replicase complex together with NS5 and dsRNA [4,8] and plays an important role in viral replication [12,46] and viral assembly [36]. In this study, IP combined with LC-MS/MS assays were performed to further explore new host proteins interacting with JEV NS3. It was demonstrated that JEV NS3 specifically interacts with cellular ILF2 (Figure1). ILF2 was originally identified to regulate interleukin-2 gene transcription via interaction with the antigen receptor response element and modulate interleukin-2 (IL-2) promoter as a sequence-specific DNA-binding protein. ILF2 was also considered as an important regulatory factor involved in the replication process of various types of viruses. We further confirmed the interaction of ILF2 with JEV NS3 by co-immunoprecipitation (Co-IP), Western blotting, and immunofluorescence assay. ILF2 did not co-precipitate with NS5 through co-transfection experiments of ILF2 with NS5 in our study (Figure2C). Meanwhile, the interaction between JEV NS3 and ILF2 was not mediated by RNA and DNA. ILF2 is abundant in many cell types and tissues, being primarily distributed in the nuclear fractions but also present in the cytoplasm of many different cell types [23,47]. The subcellular localization of cellular proteins can highlight their important biological functions. We found that cellular ILF2 could be translocated partly from the nucleus to the cytoplasm and co-localized with the NS3 of JEV in the cytoplasm of JEV-infected 293T cells, while ILF2 was mostly localized in the nucleus of mock-infected 293T cells. This finding is consistent with the previous reports that ILF2 could be translocated partly from the nucleus to the cytoplasm and co-localized with virus proteins in IBDV-, HCV-, and PRRSV-infected cells [27,28,33]. Moreover, the expression of ILF2 was significantly reduced after JEV infection. All data indicate that ILF2 may play a critical role in JEV replication. To explore the antiviral potential of ILF2 against JEV, we analyzed the effect of ILF2 knockdown by shRNA and ILF2 overexpression through lentiviral transduction. It was demonstrated that the downregulation of endogenous ILF2 enhanced JEV replication and the overexpression of ILF2 inhibited JEV infection (Figures5 and6). The antiviral properties of ILF2 with di fferent strategies have been reported. ILF2 participated in the regulation of BVDV translation and replication via binding to 3’NTR (Nontranslated region, NTR) of the BVDV genome [48]. It was also reported that ILF2 could specifically bind to replication signals in the HCV genomic RNA and was involved in HCV RNA replication [27]. In this report, we found that ILF2 was not involved in the entry process of JEV (data not shown). Furthermore, the JEV sub-genomic replicon system assay showed that a higher mRNA level of JEV replication-deficient replicon was observed in 293T-shILF2 as compared to 293T-shNC cells (Figure7), which could lead to a higher level of luciferase activities and NS3 protein at 24 hpt. The detailed mechanism remains uncertain in this study.

5. Conclusions In conclusion, we demonstrated that cellular ILF2 possesses antiviral activity against JEV in vitro. Thus, our study indicated that ILF2 exerted antiviral activity against JEV infection and could provide valuable protein targets for antiviral strategies in the future. However, further studies are warranted to more precisely elucidate the molecular mechanisms, such as the expression of ILF2 after JEV infection as well as the antiviral action of ILF2 against JEV in vivo.

Author Contributions: Designed the experiments: P.Q., H.C., and X.L.; Performed the experiments: X.C., T.R., and F.Z.; analyzed the data: Y.W., X.C., and H.Z.; wrote the paper: X.C. and X.L.; Proofed the manuscript: P.Q., H.C., and X.L. All authors read and approved the ﬁnal manuscript. Viruses 2019, 11, 559 14 of 16

Funding: This work was supported by the National Program on Key Research Project of China (2016YFD0500404), the National Special Foundation for Transgenic Species of China (2018ZX0800920B), and the National Natural Science Foundation of China (31472227, 31772713). Conﬂicts of Interest: The authors declare no conﬂict of interest.

References

1. Misra, U.K.; Kalita, J. Overview: Japanese encephalitis. Prog. Neurobiol. 2010, 91, 108–120. [CrossRef] [PubMed] 2. Neyts, J.; Leyssen, P.; De Clercq, E. Infections with ﬂaviviridae. Verh K Acad Geneeskd Belg 1999, 61, 661–697. [PubMed] 3. Unni, S.K.; R ˚užek,D.; Chhatbar, C.; Mishra, R.; Johri, M.K.; Singh, S.K. Japanese encephalitis virus: From genome to infectome. Microbes Infect. 2011, 13, 312–321. [CrossRef][PubMed] 4. Lu, G.; Gong, P. A structural view of the RNA-dependent RNA polymerases from the Flavivirus genus. Virus Res. 2017, 234, 34–43. [CrossRef][PubMed] 5. Yamashita, T.; Unno, H.; Mori, Y.; Tani, H.; Moriishi, K.; Takamizawa, A.; Agoh, M.; Tsukihara, T.; Matsuura, Y. Crystal structure of the catalytic domain of Japanese encephalitis virus NS3helicase/nucleoside triphosphatase at a resolution of 1.8 A. Virology 2008, 373, 426–436. [CrossRef][PubMed] 6. Yiang, G.T.; Chen, Y.H.; Chou, P.L.; Chang, W.J.; Wei, C.W.; Yu, Y.L. The NS3 protease and helicase domains of Japanese encephalitis virus trigger cell death via caspase-dependent and -independent pathways. Mol. Med. Rep. 2013, 7, 826–830. [CrossRef][PubMed] 7. Chen, C.J.; Kuo, M.D.; Chien, L.J.; Hsu, S.L.; Wang, Y.M.; Lin, J.H. RNA-protein interactions: Involvement of

NS3, NS5, and 30 noncoding regions of Japaneseencephalitis virus genomic RNA. J. Virol. Virol. 1997, 71, 3466–3473. 8. Uchil, P.D.; Satchidanandam, V. Architecture of the flaviviral replication complex. Protease, nuclease, and detergents revealencasement within double-layered membrane compartments. J. Biol. Chem. 2003, 278, 24388–24398. [CrossRef] 9. Ghosh, D.; Basu, A. Japanese encephalitis-a pathological and clinical perspective. PLoS Negl. Trop. Dis. 2009, 3, e437. [CrossRef] 10. van den Hurk, A.F.; Ritchie, S.A.; Mackenzie, J.S. Ecology and geographical expansion of Japanese encephalitis virus. Annu Rev. Entomol. 2009, 54, 17–35. [CrossRef] 11. Olsen, S.J.; Supawat, K.; Campbell, A.P.; Anantapreecha, S.; Liamsuwan, S.; Tunlayadechanont, S.; Visudtibhan, A.; Lupthikulthum, S.; Dhiravibulya, K.; Viriyavejakul, A.; et al. Japanese encephalitis virus remains an important cause of encephalitis in Thailand. Int. J. Infect. Dis. 2010, 14, e888-92. [CrossRef] [PubMed] 12. Wang, X.; Hou, L.; Du, J.; Zhou, L.; Ge, X.; Guo, X.; Yang, H. Capsid, membrane and NS3 are the major viral proteins involved in autophagy induced by Japanese encephalitis virus. Vet. Microbiol. 2015, 178, 217–229. [CrossRef][PubMed] 13. Campbell, G.L.; Hills, S.L.; Fischer, M.; Jacobson, J.A.; Hoke, C.H.; Hombach, J.M.; Marfin, A.A.; Solomon, T.; Tsai, T.F.; Tsu, V.D.; et al. Estimated global incidence of Japanese encephalitis: A systematic review. Bull. World Health Organ. 2011, 89, 766–774, 774A–774E. [CrossRef][PubMed] 14. Heffelfinger, J.D.; Li, X.; Batmunkh, N.; Grabovac, V.; Diorditsa, S.; Liyanage, J.B.; Pattamadilok, S.; Bahl, S.; Vannice, K.S.; Hyde, T.B.; et al. Japanese Encephalitis Surveillance and Immunization - Asia and Western Pacific Regions, 2016. MMWR Morb. Mortal. Wkly. Rep. 2017, 66, 579–583. [CrossRef][PubMed] 15. Hegde, N.R.; Gore, M.M. Japanese encephalitis vaccines: Immunogenicity, protective efficacy, effectiveness, and impact on the burden of disease. Hum. Vaccin. Immunother. 2017, 13, 1–18. [CrossRef] 16. Boldescu, V.; Behnam, M.A.M.; Vasilakis, N.; Klein, C.D. Broad-spectrum agents for flaviviral infections: Dengue, Zika and beyond. Nat. Rev. Drug Discov. 2017, 16, 565–586. [CrossRef][PubMed] 17. Kaczor, A.; Matosiuk, D. Structure-based virtual screening for novel inhibitors of Japanese encephalitis virus NS3helicase/nucleoside triphosphatase. FEMS Immunol. Med. Microbiol. 2010, 58, 91–101. [CrossRef] 18. Guan, D.; Altan-Bonnet, N.; Parrott, A.M.; Arrigo, C.J.; Li, Q.; Khaleduzzaman, M.; Li, H.; Lee, C.G.; Pe’ery, T.; Mathews, M.B. Nuclear factor 45 (NF45) is a regulatory subunit of complexes with NF90/110 involved in mitotic control. Mol. Cell. Biol. 2008, 28, 4629–4641. [CrossRef] Viruses 2019, 11, 559 15 of 16

19. Higuchi, T.; Todaka, H.; Sugiyama, Y.; Ono, M.; Tamaki, N.; Hatano, E.; Takezaki, Y.; Hanazaki, K.; Miwa, T.; Lai, S.; et al. Suppression of MicroRNA-7 (miR-7) Biogenesis by Nuclear Factor 90-Nuclear Factor 45Complex (NF90-NF45) Controls Cell Proliferation in Hepatocellular Carcinoma. J. Biol. Chem. 2016, 291, 21074–21084. [CrossRef] 20. Kiesler, P.; Haynes, P.A.; Shi, L.; Kao, P.N.; Wysocki, V.H.; Vercelli, D. NF45 and NF90 regulate HS4-dependent interleukin-13 transcription in T cells. J. Biol. Chem. 2010, 285, 8256–8267. [CrossRef] 21. Marchesini, M.; Ogoti, Y.; Fiorini, E.; Aktas Samur, A.; Nezi, L.; D’Anca, M.; Storti, P.; Samur, M.K.; Ganan-Gomez, I.; Fulciniti, M.T.; et al. ILF2 Is a Regulator of RNA Splicing and DNA Damage Response in 1q21-Amplified MultipleMyeloma. Cancer Cell 2017, 32, 88–100.e6. [CrossRef][PubMed] 22. Rigo, F.; Hua, Y.; Chun, S.J.; Prakash, T.P.; Krainer, A.R.; Bennett, C.F. Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing. Nat. Chem. Biol. 2012, 8, 555–561. [CrossRef][PubMed] 23. Shamanna, R.A.; Hoque, M.; Lewis-Antes, A.; Azzam, E.I.; Lagunoff, D.; Pe’ery, T.; Mathews, M.B. The NF90/NF45 complex participates in DNA break repair via nonhomologous end joining. Mol. Cell. Biol. 2011, 31, 4832–4843. [CrossRef][PubMed] 24. Ni, S.; Zhu, J.; Zhang, J.; Zhang, S.; Li, M.; Ni, R.; Liu, J.; Qiu, H.; Chen, W.; Wang, H.; et al. Expression and clinical role of NF45 as a novel cell cycle protein in esophageal squamouscell carcinoma (ESCC). Tumour Biol. 2015, 36, 747–756. [CrossRef][PubMed] 25. Cheng, S.; Jiang, X.; Ding, C.; Du, C.; Owusu-Ansah, K.G.; Weng, X.; Hu, W.; Peng, C.; Lv, Z.; Tong, R.; et al. Expression and Critical Role of Interleukin Enhancer Binding Factor 2 in HepatocellularCarcinoma. Int. J. Mol. Sci. 2016, 17, 1373. [CrossRef][PubMed] 26. Shi, C.; Yang, Y.; Yu, J.; Meng, F.; Zhang, T.; Gao, Y. The long noncoding RNA LINC00473, a target of microRNA 34a, promotes tumorigenesis by inhibiting ILF2 degradation in cervical cancer. Am. J. Cancer Res. 2017, 7, 2157–2168, eCollection 2017. [PubMed] 27. Isken, O.; Baroth, M.; Grassmann, C.W.; Weinlich, S.; Ostareck, D.H.; Ostareck-Lederer, A.; Behrens, S.E. Nuclear factors are involved in hepatitis C virus RNA replication. RNA 2007, 13, 1675–1692. [CrossRef] 28. Isken, O.; Grassmann, C.W.; Sarisky, R.T.; Kann, M.; Zhang, S.; Grosse, F.; Kao, P.N.; Behrens, S.E. Members of the NF90/NFAR protein group are involved in the life cycle of a positive-strandRNA virus. EMBO J. 2003, 22, 5655–5665. [CrossRef] 29. Lee, J.W.; Liao, P.C.; Young, K.C.; Chang, C.L.; Chen, S.S.; Chang, T.T.; Lai, M.D.; Wang, S.W. Identification of hnRNPH1, NF45, and C14orf166 as novel host interacting partners of the mature hepatitis C virus core protein. J. Proteome Res. 2011, 10, 4522–4534. [CrossRef] 30. Li, Y.; Belshan, M. NF45 and NF90 Bind HIV-1 RNA and Modulate HIV Gene Expression. Viruses 2016, 8, 47. [CrossRef] 31. Shin, H.J.; Kim, S.S.; Cho, Y.H.; Lee, S.G.; Rho, H.M. Host cell proteins binding to the encapsidation signal epsilon in hepatitis B virus RNA. Arch. Virol. Virol. 2002, 147, 471–491. [CrossRef] 32. Stricker, R.L.; Behrens, S.E.; Mundt, E. Nuclear factor NF45 interacts with viral proteins of infectious bursal disease virus and inhibits viral replication. J. Virol. Virol. 2010, 84, 10592–10605. [CrossRef][PubMed] 33. Wen, X.; Bian, T.; Zhang, Z.; Zhou, L.; Ge, X.; Han, J.; Guo, X.; Yang, H.; Yu, K. Interleukin-2 enhancer binding factor 2 interacts with the nsp9 or nsp2 of porcinereproductive and respiratory syndrome virus and exerts negatively regulatory effect on the viral replication. Virol. J. 2017, 14, 125. [CrossRef][PubMed] 34. Jin, J.; Li, A.; Wang, W.; Wu, J. Interleukin-enhanced binding factor 2 interacts with NLRP3 to inhibit the NLRP3 inflammasome activation. Biochem. Biophys. Res. Commun. 2018, 500, 398–404. [CrossRef][PubMed] 35. Chen, L.K.; Lin, Y.L.; Liao, C.L.; Lin, C.G.; Huang, Y.L.; Yeh, C.T.; Lai, S.C.; Jan, J.T.; Chin, C. Generation and characterization of organ-tropism mutants of Japanese encephalitis virus in vivo and in vitro. Virology 1996, 223, 79–88. [CrossRef][PubMed] 36. Chien, H.L.; Liao, C.L.; Lin, Y.L. FUSE binding protein 1 interacts with untranslated regions of Japanese encephalitis virus RNA and negatively regulates viral replication. J. Virol. 2011, 85, 4698–4706. [CrossRef] 37. Lin, C.W.; Huang, H.D.; Shiu, S.Y.; Chen, W.J.; Tsai, M.H.; Huang, S.H.; Wan, L.; Lin, Y.J. Functional determinants of NS2B for activation of Japanese encephalitis virus NS3 protease. Virus Res. 2007, 127, 88–94. [CrossRef] 38. Martins, N.; Imler, J.L.; Meignin, C. Discovery of novel targets for antivirals: Learning from flies. Curr. Opin Virol. 2016, 20, 64–70. [CrossRef] Viruses 2019, 11, 559 16 of 16

39. Chiou, C.T.; Hu, C.C.; Chen, P.H.; Liao, C.L.; Lin, Y.L.; Wang, J.J. Association of Japanese encephalitis virus NS3 protein with microtubules and tumoursusceptibility gene 101 (TSG101) protein. J. Gen. Virol. 2003, 84, 2795–2805. [CrossRef] 40. Chiu, H.P.; Chiu, H.; Yang, C.F.; Lee, Y.L.; Chiu, F.L.; Kuo, H.C.; Lin, R.J.; Lin, Y.L. Inhibition of Japanese encephalitis virus infection by the host zinc-ﬁnger antiviral protein. PLoS Pathog. 2018, 14, e1007166. [CrossRef] 41. Li, C.; Ge, L.L.; Li, P.P.; Wang, Y.; Sun, M.X.; Huang, L.; Ishag, H.; Di, D.D.; Shen, Z.Q.; Fan, W.X.; et al. The DEAD-box RNA helicase DDX5 acts as a positive regulator of Japanese encephalitisvirus replication by

binding to viral 30 UTR. Antiviral Res. 2013, 100, 487–499. [CrossRef][PubMed] 42. Li, C.; Ge, L.L.; Li, P.P.; Wang, Y.; Dai, J.J.; Sun, M.X.; Huang, L.; Shen, Z.Q.; Hu, X.C.; Ishag, H.; et al. Cellular DDX3 regulates Japanese encephalitis virus replication by interacting with viral un-translated regions. Virology 2014, 449, 70–81. [CrossRef][PubMed] 43. Ma, L.; Li, F.; Zhang, J.W.; Li, W.; Zhao, D.M.; Wang, H.; Hua, R.H.; Bu, Z.G. Host Factor SPCS1 Regulates the Replication of Japanese Encephalitis Virus through Interactions with Transmembrane Domains of NS2B. J. Virol. 2018, 92, e00197-18. [CrossRef][PubMed] 44. Zhang, L.K.; Chai, F.; Li, H.Y.; Xiao, G.; Guo, L. Identification of host proteins involved in Japanese encephalitis virus infection by quantitative proteomics analysis. J. Proteome Res. 2013, 12, 2666–2678. [CrossRef][PubMed] 45. Zhang, R.; Miner, J.J.; Gorman, M.J.; Rausch, K.; Ramage, H.; White, J.P.; Zuiani, A.; Zhang, P.; Fernandez, E.; Zhang, Q.; et al. A CRISPR screen defines a signal peptide processing pathway required by flaviviruses. Nature 2016, 535, 164–168. [CrossRef][PubMed] 46. Yuan, L.; Wu, R.; Liu, H.; Wen, X.; Huang, X.; Wen, Y.; Ma, X.; Yan, Q.; Huang, Y.; Zhao, Q.; et al. The NS3 and NS4A genes as the targets of RNA interference inhibit replication of Japaneseencephalitis virus in vitro and in vivo. Gene 2016, 594, 183–189. [CrossRef][PubMed] 47. Yaseen, N.R.; Maizel, A.L.; Wang, F.; Sharma, S. Comparative analysis of NFAT (nuclear factor of activated T cells) complex in human T and Blymphocytes. J. Biol. Chem. 1993, 268, 14285–14293.

48. Isken, O.; Grassmann, C.W.; Yu, H.; Behrens, S.E. Complex signals in the genomic 30 nontranslated region of bovine viral diarrhea viruscoordinate translation and replication of the viral RNA. RNA 2004, 10, 1637–1652. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).