Enhancement of Thermophilic Dark Fermentative Hydrogen Production and the Use of Molecular Biology Methods for Bioprocess Monitoring Onyinye Okonkwo

Enhancement of thermophilic dark fermentative hydrogen production and the use of molecular biology methods for bioprocess monitoring Onyinye Okonkwo

To cite this version:

Onyinye Okonkwo. Enhancement of thermophilic dark fermentative hydrogen production and the use of molecular biology methods for bioprocess monitoring. Environmental Engineering. Université Paris-Est; Tampereen yliopisto, 2019. English. NNT : 2019PESC2041. tel-03066327

HAL Id: tel-03066327 https://tel.archives-ouvertes.fr/tel-03066327 Submitted on 15 Dec 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

Joint PhD degree in Environmental Technology

Docteur de l’Université Paris-Est Specialité: Science et Technique de l’Environment

Dottore di Ricerca in Tecnologie Ambientali

Degree of Doctor in Environmental Technology

Degree of Doctor of Philosophy in Environmental Technology

Tesi di Dottorato ─ Thèse ─ PhD thesis ─ Väitöskirja

Onyinye Jeneth Okonkwo

Enhancement of thermophilic dark fermentative hydrogen production and the use of molecular biology methods for bioprocess monitoring 12.12.2019 In front of the PhD evaluation committee

Assoc. Prof. Gopalakrishnan Kumar Reviewer Asst. Prof. Maria-Alcina Pereira Reviewer Assoc. Prof. Cristiano Varrone Reviewer Asst. Prof. Aino-Maija Lakaniemi Promotor Prof. Piet N. L. Lens Co-Promotor Prof. Eric D. van Hullebush Co-Promotor Prof. Giovanni Esposito Co-Promotor Prof. Jukka Rintala Chair

Marie Sklodowska-Curie European Joint Doctorate, Advanced Biological Waste-to-Energy Technologies

Evaluation committee

Chair

Prof. Jukka Rintala Faculty of Engineering and Natural Sciences Tampere University Finland

Reviewers/Examiners

Assoc. Prof. Gopalakrishnan Kumar Department of Chemistry, Bioscience and Environmental Engineering University of Stavanger, Stavanger, Norway

Asst. Prof. Maria Alcina Pereira Environmental Biotechnology Laboratory Universidade do Minho, Braga, Portugal

Assoc. Prof. Cristiano Varrone Department of Chemistry and Bioscience Aalborg University Aalborg, Denmark

Thesis Promotor

Asst. Prof. Aino-Maija Lakaniemi Faculty of Engineering and Natural Sciences Tampere University Finland

Thesis Co-Promotor

Prof. Eric D. van Hullebusch Laboratoire Géomatériaux et Environnement Université Paris-Est Marne-la-Vallée, France

Prof. Piet N.L. Lens Department of Environmental Engineering and Water Technology IHE Delft Institute for Water Education Delft, The Netherlands

Prof. Giovanni Esposito Department of Civil and Mechanical Engineering University of Cassino and Southern Lazio Cassino, Italy

Supervisory team

Thesis Supervisor

Asst. Prof. Aino-Maija Lakaniemi Faculty of Engineering and Natural Sciences Tampere University Finland

Thesis Co-supervisors

Dr. Rahul Mangayil Faculty of Engineering and Natural Sciences Tampere University Finland

Dr. Renaud Escudie Montpellier de l’Institut National de la Recherche Agronomique Laboratoire de Biotechnologie de l'Environnement Narbonne, France

Dr. Eric Trably Montpellier de l’Institut National de la Recherche Agronomique Laboratoire de Biotechnologie de l'Environnement Narbonne, France

Prof. Giovanni Esposito Department of Civil, Architectural and Environmental Engineering, University of Naples Federico II Naples, Italy

Dr. Stefano Papirio Department of Civil, Architectural and Environmental Engineering, University of Naples Federico II Naples, Italy

This research was carried out within the framework of the Marie Sklowdowska-Curie European Joint Doctorate (EJD) in Advanced Biological Waste to Energy Technologies (ABWET) and supported by Horizon 2020 under grant agreement no. 643071

Abstract

Dark fermentation of organic waste materials such as organic fraction of municipal waste and agricultural wastes is a promising technology to produce renewable hydrogen. However, further research and development is required to improve the efficiency and stability of the process. The aim of this thesis was to enhance thermophilic dark fermentative hydrogen production by using microbial strategies (bioaugmentation and synthetic co-cultures) and by increasing the understanding on the microbial community dynamics especially during stress conditions such as fluctuating temperatures and elevated substrate concentrations.

To study the effects of sudden short-term temperature fluctuations, batch cultures initially incubated at 55°C (control) were subjected to downward (from 55°C to 35°C or 45°C) or upward (from 55°C to 65°C or 75°C) temperature shifts for 48 h after which they were incubated again at 55°C for two consecutive batch cycles. The results showed that sudden, temporal upward and downward temperature fluctuations had a direct impact on the hydrogen yield as well as the microbial community structure. Cultures exposed to downward temperature fluctuation recovered more rapidly enabling almost similar hydrogen yield (92-96%) as the control culture kept at 55 °C. On the contrary, upward temperature shifts from 55 to 65 or 75 °C had more significant negative effect on dark fermentative hydrogen production as the yield remained significantly lower (54- 79%) for the exposed cultures compared to the control culture.

To improve the stability of hydrogen production during temperature fluctuations and to speed up the recovery, mixed microbial consortium undergoing a period of either downward or upward temperature fluctuation was augmented with a synthetic mix culture containing well-known hydrogen producers (Thermotoga, Thermoanaerobacter, Thermoanaerobacterium, Caldicellulosiruptor and Thermocellum spp.) The addition of new species into the native consortium significantly improved hydrogen production both during and after the fluctuations. However, when the bioaugmentation was applied during the temperature fluctuation, hydrogen production was enhanced.

This study also investigated the dynamics between pure cultures and co-cultures of highly specialized hydrogen producers, Caldicellulosiruptor saccharolyticus and Thermotoga

-1 neapolitana. The highest hydrogen yield (2.8 ± 0.1 mol H2 mol glucose) was obtained with a synthetic co-culture which resulted in a 3.3 or 12% increase in hydrogen yield when compared to pure cultures of C. saccharolyticus or T. neapolitana, respectively. Furthermore, quantitative

iii

polymerase chain reaction (qPCR) based method for monitoring the growth and contribution of T. neapolitana in synthetic co-cultures was developed. With this method, it was verified that T. neapolitana was an active member of the synthetic co-culture.

The effect of different feed glucose concentrations (from 5.6 to 111.0 mmol L-1) on hydrogen production was investigated with and without augmenting the culture with T. neapolitana. Compared to the control (without T. neapolitana), bioaugmentated culture resulted in higher hydrogen yields in almost all the concentrations studied even though hydrogen yield decreased the feed glucose concentration was increased. The presence of T. neapolitana also had a significant impact on the metabolite distribution when compared to the control. The number gene copies of T. neapolitana measured with qPCR was higher at the highest initial glucose concentrations. Thus, the results demonstrated that the use of a single strain with the required properties needed in a biological system can be sufficient for improving dark fermentative hydrogen production.

In summary, this study showed that thermophilic dark fermentative hydrogen production can be enhanced by using synthetic co-cultures or bioaugmentation. The highest hydrogen yield in this study was obtained with the synthetic co-culture, although it should be considered that the incubation conditions differed from those used for the mixed cultures in this study. The use of molecular methods such as qPCR and high-throughput sequencing also helped to understand the role of certain species in the microbial consortia and improved the understanding of the microbial community dynamics during stress conditions. The use of molecular methods is thus important as it helps to create a link between the microbial community structure and observed hydrogen production.

Tiivistelmä

Pimeäfermentaation avulla orgaanisista jätemateriaaleista voidaan tuottaa biologisesti vetyä mahdollistaen samanaikainen jätteiden käsittely ja energiatuotanto. Pimeäfermentatiivisen vedyntuotannon mahdollistamiseksi teollisessa mittakaavassa prosessin tehokkuutta ja vedyntuotannon vakautta pitää kuitenkin vielä parantaa. Tämän työn tavoitteena oli tehostaa termofiilista vedyntuotantoa lisäämällä vetyä tuottaviin sekaviljelmiin tunnettuja vedyntuottajaorganismeja (bioaugmentointi) ja hyödyntämällä kahden vedyntuottajamikrobin muodostamia synteettisiä yhteisviljelmiä. Lisäksi pyrittiin lisäämään ymmärrystä vedyn tuotantoprosessin mikrobiyhteisöjen dynamiikasta erityisesti mahdollisissa häiriötilanteissa, jotka voivat johtaa nopeisiin lämpötilamuutoksiin tai kohonneeseen kuormitukseen.

Lyhytaikaisten lämpötilavaihtelujen vaikutusta vedyntuotantoon ja mikrobiyhteisön koostumukseen tutkittiin panoskokeissa, joissa 55 °C:ssa kasvatetun sekaviljelmän kasvatuslämpötilaa muutettiin äkillisesti joko kylmemmäksi (35 tai 45 °C) tai lämpimämmäksi (65 tai 75 °C) 48 tunnin ajaksi. Tämän jälkeen kaikki viljelmät palautettiin 55 °C:een ja niitä kasvatettiin vielä kahden peräkkäisen 48 tunnin panossyklin ajan. Tulokset osoittivat, että kaikki tutkitut äkilliset, lyhytaikaiset lämpötilamuutokset pienensivät vetysaantoja ja aiheuttivat muutoksia mikrobiyhteisön koostumuksessa verrattuna kontrolliviljelmään, jota kasvatettiin koko ajan panosviljelmänä 55 °C:ssa. Sekaviljelmissä, jotka altistettiin alhaisemmille lämpötiloille (35 ja 45 °C), palautuivat lämpötilamuutoksesta suhteellisen hyvin ja näiden viljelmien tuottama vetysaanto oli 55 °C:een palauttamisen jälkeen lähes yhtä korkea (92-96 %) kuin vakiolämpötilassa kasvatetun kontrolliviljelmän keskimääräinen vetysaanto. Altistuminen korkeammille lämpötiloille (65 ja 75 °C) vaikutti matalia lämpötiloja merkittävämmin vetysaantoihin, sillä näiden viljelmien tuottama vetysaanto oli 55 °C:een palauttamisen jälkeen vain 54-79% kontrolliviljelmän keskimääräisestä vetysaannosta.

Koska kasvatuslämpötilan äkillisen nousun osoitettiin johtavan mikrobiyhteisön moni- muotoisuuden vähenemiseen, tutkimuksen seuraavassa vaiheessa pyrittiin vedyntuottoa tehostamaan lämpötilavaihtelujen aikana ja nopeuttamaan vedyntuotannon palautumista lämpötilamuutosten jälkeen bioaugmentoinnin avulla. Sekaviljelmiin, joita altistettiin lämpötila- vaihteluille, lisättiin tunnettuja vedyntuottajamikrobeja (Thermotoga, Thermoanaerobacter, Thermoanaerobacterium, Caldicellulosiruptor ja Thermocellum spp.) joko lämpötilamuutoksen aikana tai sen jälkeen. Näiden mikrobien lisääminen sekaviljelmään tehosti vedyntuotantoa niin lämpötilamuutosten aikana kuin niiden jälkeenkin. Bioaugmentointi lämpötilamuutoksen aikana v

kuitenkin altisti myös bioaugmentoinnissa hyödynnetyt mikrobit lämpötilamuutoksille, mikä hiukan vähensi bioaugmentoinnin vedyntuottoa tehostavaa vaikutusta suhteessa lämpötilavaihtelun jälkeen tehtyyn bioaugmentointiin.

Seuraavissa panoskokeissa tutkittiin vedyntuotantoa hyödyntäen kahta erilaista vedyntuottajamikrobia, Caldicellulosiruptor saccharolyticus ja Thermotoga neapolitana, sekä niiden yhteisviljelmää. Yhteisviljelmällä saavutettiin suurin vetysaanto (2,8 ± 0,1 mol-H2/mol- glukoosia), joka oli 3,3 % korkeampi kuin C. saccharolyticus puhdasviljelmän vetysaanto ja 12 % korkeampi kuin T. neapolitana puhdasviljelmän vetysaanto. Lisäksi tämän kokeen yhteydessä kehitettiin kvantitatiiviseen polymeraasiketjureaktioon (qPCR) perustuva menetelmä T. neapolitana:n kasvun seuraamiseksi sekaviljelmissä. Menetelmän avulla varmistettiin, että T. neapolitana oli metabolisesti aktiivinen synteettisessä yhteisviljelmässä.

Kohonneen kuormituksen vaikutusta vedyntuottoon termofiilisellä sekaviljelmällä ja T. neapolitana:lla bioaugmentoidulla sekaviljelmällä tutkittiin nostamalla käytettävää glukoosi- pitoisuutta asteittain 5,5 mmol/L:sta 110 mmol/L:iin. Molemmilla viljelmillä glukoosipitoisuuden nostaminen laski vetysaantoa, mutta bioaugmentoidulla viljelmällä saavutettiin suuremmat vetysaannot lähes kaikilla tutkituilla glukoosipitoisuuksilla. T. neapolitana:n geenikopioiden määrä bioaugmentoidussa viljelmässä qPCR:llä mitattuna oli suurin korkeimmilla glukoosipitoisuuksilla. Tulokset siis osoittivat, että yhden mikrobin lisääminen viljelmään voi tehostaa sekaviljelmän vedyntuottoa.

Tässä työssä korkein vetysaanto saavutettiin synteettisellä yhteisviljelmällä (Caldicellulosiruptor saccharolyticus ja Thermotoga neapolitana). On kuitenkin syytä huomioida, että kasvatusolosuhteet tämän työn eri panoskokeissa poikkesivat toisistaan, eivätkä tulokset siis ole täysin vertailtavissa. Yhteenvetona voidaan kuitenkin todeta, että tämän työn perusteella synteettiset yhteisviljelmät ja bioaugmentointi ovat lupaavia tapoja tehostaa termofiilista pimeäfermentatiivista vedyntuotantoa. Molekyylibiologiset menetelmät kuten qPCR ja suurimittakaavainen DNA-luenta myös lisäsivät ymmärrystä eri mikrobilajien roolista sekaviljelmissä ja mikrobiyhteisöjen muutoksista simuloiduissa häiriötilanteissa. Molekyylibiologisten menetelmien hyödyntämien bioprosessien seurannassa onkin tärkeää, koska ne auttavat luomaan yhteyden mikrobiyhteisöjen koostumuksen ja mitatun vedyntuoton välille.

Résumé La fermentation à l'obscurité de déchets organiques comme la fraction organique des déchets municipaux et agricoles est une technologie prometteuse pour produire de l'hydrogène renouvelable. Toutefois, il faut poursuivre la recherche et le développement pour améliorer l'efficacité et la stabilité du processus. Le but de cette thèse était d'améliorer la production thermophile d'hydrogène noir fermenté en utilisant des stratégies microbiennes (bioaugmentation et co-cultures synthétiques) et en améliorant la compréhension de la dynamique de la communauté microbienne, particulièrement dans des conditions de stress telles que des températures fluctuantes et des concentrations élevées du substrat.

Afin d'étudier les effets des fluctuations soudaines et à court terme de la température, des cultures de lots incubées initialement à 55 °C (témoin) ont été soumises à des variations de température vers le bas (de 55 °C à 35 °C ou 45 °C) ou vers le haut (de 55 °C à 65 °C ou 75 °C) pendant 48 heures, puis à nouveau incubées à 55 °C pendant deux cycles consécutifs. Les résultats ont montré que des fluctuations soudaines et temporelles de la température à la hausse et à la baisse avaient un impact direct sur le rendement en hydrogène ainsi que sur la structure de la communauté microbienne. Les cultures exposées à des fluctuations de température à la baisse se sont rétablies plus rapidement, ce qui a permis d'obtenir un rendement en hydrogène presque similaire (92-96 %) puisque la culture témoin a été maintenue à 55 °C. Au contraire, les changements de température à la hausse de 55 à 65 ou 75 °C ont eu un effet négatif plus important sur la production d'hydrogène fermenté foncé car le rendement est resté significativement plus faible (54-79 %) pour les cultures exposées que pour la culture témoin.

Afin d'améliorer la stabilité de la production d'hydrogène pendant les fluctuations de température et d'accélérer la récupération, le consortium microbien mixte subissant une période de fluctuation de température à la baisse ou à la hausse a été complété par une culture de mélange synthétique contenant des producteurs d'hydrogène bien connus (Thermotoga, Thermoanaerobacter, Thermoanaerobacterium, Thermoanérobacterium, Caldicellulosiruptor et Thermocellum spp.) L'introduction de nouvelles espèces au consortium naturel a considérablement amélioré la production d'hydrogène tant pendant les variations qu'après celles-ci. Cependant, lorsque la bioaugmentation a été appliquée pendant la fluctuation de température, les micro-organismes utilisés pour l'augmentation ont été exposés à un stress thermique, ce qui a augmenté la capacité de production d'hydrogène.

vii

Cette étude a également étudié la dynamique entre les cultures pures et les co-cultures de producteurs d'hydrogène hautement spécialisés, Caldicellulosiruptor saccharolyticus et

Thermotoga neapolitana. Le rendement en hydrogène le plus élevé (2,8 ± 0,1 mol H2 mol-1 glucose) a été obtenu avec une co-culture synthétique constituée de Caldicellulosiruptor saccharolyticus et Thermotoga neapolitana, qui a entraîné une augmentation de 3,3 ou 12% du rendement en hydrogène par rapport aux cultures pures respectivement de C. saccharolyticus et T. neapolitana. En outre, une méthode quantitative basée sur l'amplification en chaîne par polymérase (qPCR) a été mise au point pour surveiller la croissance et l'apport de T. neapolitana dans les co-cultures synthétiques. Avec cette méthode, il a été vérifié que T. neapolitana était un membre actif de la co-culture synthétique.

L'effet de différentes concentrations de glucose alimentaire (de 5,6 à 111,0 mmol L-1) sur la production d'hydrogène a été étudié avec et sans augmentation de la culture avec T. neapolitana. Par rapport au témoin (sans T. neapolitana), la culture bioaugmentée a donné des rendements en hydrogène plus élevés dans presque toutes les concentrations étudiées, même si le rendement en hydrogène a diminué la concentration de glucose alimentaire a augmenté. La présence de T. neapolitana a également eu un impact significatif sur la distribution des métabolites par rapport au contrôle. Le nombre de copies du gène de T. neapolitana mesuré avec qPCR était plus élevé aux concentrations initiales les plus élevées de glucose. Ainsi, les résultats ont démontré que l'utilisation d'une seule souche ayant les propriétés requises dans un système biologique peut être suffisante pour améliorer la production d'hydrogène fermenté foncé.

En résumé, cette étude a montré que la production thermophile d'hydrogène foncé fermenté peut être améliorée en utilisant des co-cultures synthétiques ou la bioaugmentation. Le rendement en hydrogène le plus élevé dans cette étude a été obtenu avec la co-culture synthétique, bien qu'il faille considérer que les conditions d'incubation diffèrent de celles utilisées pour les cultures mixtes dans cette étude. L'utilisation de méthodes moléculaires telles que le qPCR et le séquençage à haut débit a également aidé à comprendre le rôle de certaines espèces dans les consortiums microbiens et a amélioré la compréhension de la dynamique des communautés microbiennes en situation de stress. L'utilisation de méthodes moléculaires est donc importante car elle permet de créer un lien entre la structure de la communauté microbienne et la production d'hydrogène observée.

viii

Samenvatting

Donkere gisting van organische afvalstoffen zoals de organische fractie van stedelijk afval en landbouwafval is een veelbelovende technologie voor de productie van hernieuwbare waterstof. Er is echter verder onderzoek en ontwikkeling nodig om de efficiëntie en stabiliteit van het proces te verbeteren. Het doel van dit proefschrift was om de thermofiele donkere fermentatieve waterstofproductie te verbeteren door microbiële strategieën (bioaugmentatie en synthetische co- culturen) te gebruiken en door het inzicht in de microbiële gemeenschapsdynamiek te vergroten, met name tijdens stressomstandigheden zoals fluctuerende temperatuur en verhoogde substraatconcentratie.

Om de effecten van plotselinge temperatuurschommelingen op korte termijn te bestuderen, werden batches, eerst geïncubeerd bij 55 °C (controle), gedurende 48 uur onderworpen aan neerwaartse (van 55 °C tot 35 °C of 45 °C) of stijgende (van 55 °C tot 65 °C of 75 °C) temperatuurverschuivingen waarna ze opnieuw werden geïncubeerd bij 55 °C gedurende twee opeenvolgende batchcycli. De resultaten toonden aan dat plotselinge, tijdelijke stijgende en neerwaartse temperatuurschommelingen een directe invloed hadden op de waterstofopbrengst en de microbiële gemeenschapsstructuur. Culturen die werden blootgesteld aan temperatuurschommelingen herstelden zich sneller waardoor een vrijwel vergelijkbare waterstofopbrengst (92-96%) mogelijk was als de controlecultuur op 55 °C werd gehouden. Integendeel, stijgende temperatuurverschuivingen van 55 naar 65 of 75 °C hadden meer significant negatief effect op de donkere fermentatieve waterstofproductie omdat de opbrengst aanzienlijk lager (54-79%) bleef voor de blootgestelde kweken in vergelijking met de controle incubatie.

Om de stabiliteit van de waterstofproductie tijdens temperatuurschommelingen te verbeteren en het herstel te versnellen, werd een gemengd microbieel consortium dat een periode van neerwaartse of stijgende temperatuurschommelingen onderging, uitgebreid met een synthetische mengcultuur met bekende waterstofproducenten (Thermotoga, Thermoanaerobacter, Thermoanaerobacterium, Caldicellulosiruptor en Thermocellum spp.) De toevoeging van nieuwe soorten aan het oorspronkelijke consortium verbeterde de waterstofproductie aanzienlijk, zowel tijdens als na de fluctuaties. Toen de bio-analyse werd toegepast tijdens de temperatuurfluctuatie, werd de waterstofproductie echter verbeterd.

Deze studie onderzocht ook de dynamiek tussen rein- en co-culturen van de gespecialiseerde waterstofproducenten Caldicellulosiruptor saccharolyticus en Thermotoga neapolitana. De

-1 hoogste waterstofopbrengst (2.8 ± 0.1 mol H2 mol glucose) werd verkregen met een synthetische co-cultuur die resulteerde in een toename van de waterstofopbrengst met 3.3 of 12% in vergelijking met reinculturen van, respectievelijk, C. saccharolyticus of T. neapolitana. Verder werd een op kwantitatieve polymerasekettingreactie (qPCR) gebaseerde methode ontwikkeld voor het volgen van de groei en bijdrage van T. neapolitana in synthetische co- culturen. Met deze methode werd geverifieerd of T. neapolitana een actief lid was van de synthetische co-cultuur.

Het effect van verschillende glucose concentraties (van 5.6 tot 111.0 mmol L-1) op de waterstofproductie werd onderzocht met en zonder T. neapolitana aan de cultuur toe te voegen. Vergeleken met de controle (zonder T. neapolitana) resulteerde de gebioaugmenteerde cultuur in hogere waterstofopbrengsten in bijna alle bestudeerde concentraties, hoewel de waterstofopbrengst daalde als de glucose concentratie in de voeding werd verhoogd. De aanwezigheid van T. neapolitana had ook een significante invloed op de metabolietverdeling in vergelijking met de controle. Het aantal genkopieën van T. neapolitana gemeten met qPCR was hoger bij de hoogste initiële glucose concentraties. Aldus toonden de resultaten aan dat het gebruik van een enkele stam met de vereiste eigenschappen die nodig zijn in een biologisch systeem voldoende kan zijn om de productie van donkere fermentatieve waterstof te verbeteren.

Samenvattend heeft deze studie aangetoond dat de productie van thermofiele donkere fermentatieve waterstof kan worden verbeterd door synthetische co-culturen of bio-analyse te gebruiken. De hoogste waterstofopbrengst in deze studie werd verkregen met de synthetische co-cultuur, hoewel er rekening mee moet worden gehouden dat in deze studie de incubatie- omstandigheden verschilden van die gebruikt voor de gemengde culturen. Het gebruik van moleculaire methoden zoals qPCR en high-throughput sequencing hielp ook bij het begrijpen van de rol van bepaalde soorten in de microbiële consortia en verbeterde het begrip van de dynamiek van de microbiële gemeenschap tijdens stressomstandigheden. Het gebruik van moleculaire methoden is dus belangrijk omdat het helpt een verband te leggen tussen de structuur van de microbiële gemeenschap en de waargenomen waterstofproductie.

Sommario

La fermentazione di rifiuti organici, tra i quali la frazione organica dei rifiuti solidi urbani e i rifiuti della filiera agro-industriale, è una tecnologia promettente per la produzione di idrogeno come fonte di energia rinnovabile. Tuttavia, ulteriori sforzi di ricerca sono necessari per migliorare l’efficienza e la stabilità del processo. Lo scopo di questo lavoro di tesi è stato quello di massimizzare la produzione di idrogeno in condizioni termofile usando differenti strategie (quali la bioaugmentation e co-colture sintetiche) e valutando l’evoluzione delle comunità microbiche in condizioni di stress, quali la variazione di temperatura e l’uso di elevate concentrazioni di substrato.

Per studiare l’effetto di improvvise e brevi fluttuazioni di temperatura, esperimenti in batch sono stati condotti con colture incubate a partire da 55°C (come controllo) e soggetti a decrementi (da 55 a 35 o 45°C) e incrementi (da 55 a 65 e 75°C) per 48 ore prima di essere nuovamente mantenuti a 55°C per altre 48 ore. I risultati hanno mostrato che queste improvvise e brevi variazioni di temperatura hanno influenzato direttamente le rese di produzione di idrogeno così come le struttura delle comunità microbiche. I batteri sottoposti a temperature decrescenti hanno mostrato capacità di recupero migliori, arrivando a mantenere rese di produzione di idrogeno pari a circa il 92-96% rispetto al valore ottenuto a 55°C. Invece, una netta riduzione in termini di resa di H2, nel range 54-79%, si è avuta quando i microrganismi sono stati sottoposti a temperature crescenti.

Per migliorare la stabilità del processo di produzione di idrogeno durante le fluttuazioni improvvise di temperatura e velocizzare il recupero delle colture microbiche, al consorzio di microrganismi precedentemente sottoposti a shock di temperatura decrescente e crescente è stato addizionato una coltura mista sintetica a base di risaputi microrganismi produttori di idrogeno (Thermotoga, Thermoanaerobacter, Thermoanaerobacterium, Caldicellulosiruptor and Thermocellum spp.). L’aggiunta delle nuove specie nel consorzio nativo ha migliorato la produzione di idrogeno sia durante che dopo le fluttuazioni di temperatura indotte. Tuttavia, quanto la strategia di bioaugmentation è stata utilizzata durante la variazione della temperatura, i microrganismi utilizzati hanno dimostrato un più elevato potenziale di produzione di idrogeno.

Questo studio ha permesso anche di valutare le dinamiche tra colture pure e co-colture of microrganismi altamente specializzati nel produrre idrogeno, quali Caldicellulosiruptor saccharolyticus e Thermotoga neapolitana. Il più elevato rendimento di idrogeno (pari a 2.8 ± 0.1

-1 mol H2 mol glucosio) è stato ottenuto con una co-coltura sintetica di Caldicellulosiruptor saccharolyticus e Thermotoga neapolitana, ed è risultato del 3,3 e 12%, rispettivamente, maggiore rispetto ai valori ottenuti con le due specie utilizzate singolarmente. Inoltre, l’analisi effettuata attraverso la tecnica qPCR ha confermato che il Thermotoga neapolitana è risultato essere un microrganismo attivo nella co-coltura sintetica.

L’effetto di differenti concentrazioni di glucosio (da 5,6 a 111,0 mmol L-1) nella soluzione di partenza sulla produzione di idrogeno è stato, altresì, valutato con e senza utilizzare l’augmentation di T. neapolitana. In presenza del T. neapolitana, è stata ottenuta una migliore resa di produzione di idrogeno con tutti i valori di glucosio iniziali, sebbene si sia osservato una generale diminuzione delle rese di H2 all’aumentare della concentrazione iniziale di glucosio. Inoltre, la presenza del T. neapolitana ha anche avuto un impatto notevole sulla composizione dei prodotti nel fermentato e Il numero di copie di geni del T. neapolitana, misurato con la qPCR, è risultato maggiore alla concentrazione più elevata di glucosio. Pertanto, è stato possibile dimostrare che l’uso di un solo ceppo microbico con le giuste caratteristiche “bioaugmentato” in un sistema biologico riesce a migliorare considerevolmente la produzione di idrogeno in un processo di dark fermentation.

xii

Acknowledgements

First and foremost, I thank God Almighty for giving me the strength, knowledge, ability and opportunity to undertake this research study and to persevere and complete it satisfactorily. This achievement would not have been possible without his grace.

The studies done for this thesis were performed at Tampere University, LBE, Univ. Montpellier, INRA, Narbonne, France and University of Cassino and Southern Lazio, Italy. This research work was supported by the Marie Sklowdowska-Curie European Joint Doctorate (EJD) in Advanced Biological Waste-To-Energy Technologies (ABWET) funded by European Union Horizon 2020 (grant number 643071). I wish to thank the funding bodies for enabling this thesis.

In my journey towards this degree, I have found a teacher, an inspiration and a role model and a pillar of support in my supervisor, Assistant Professor Aino-Maija Lakaniemi who has always been there providing her heartfelt support and guidance. She has always given me invaluable guidance, inspiration and suggestions in my quest for knowledge while ensuring that I stay on course and do not deviate from the core of my research. I am also very grateful to Dr. Rahul Mangayil, my co-supervisor who has always supported me and given me useful comments during the period of this thesis. I am also very thankful to my co-supervisors, Dr. Renaud Escudie, Dr. Eric Trably, Dr. Stefano Papirio and Professor Giovanni Esposito who supervised my research during my exchange periods.

I wish to thank my colleagues from ABWET European joint degree programme for the times spent together. I am also grateful to Gaelle Santa-Catalina (LBE, Univ. Montpellier, INRA, Narbonne, France) for her support with the microbial community analyses. I would like to thank the technicians, especially Tarja Ylijoki-Kaiste and Antti Nuottajärvi at Tampere University. I am very grateful to my Parents and Siblings for their support and encouragement during this programme. I am eternally grateful to Father Jude Ifeorah for his invaluable encouragement. Finally, I am most grateful to my husband and best friend, Francis Chukwujekwu Anajemba for being an amazing support system always and for being an important part of this journey.

xiii

Table of Contents

Evaluation committee ...... i Supervisory team ...... ii Abstract ...... iii Tiivistelmä ...... v Résumé ...... vii Samenvatting ...... ix Sommario ...... xi Acknowledgements ...... xiii List of publications ...... xviii Author’s contribution ...... xix List of Symbols and Abbreviations ...... xx CHAPTER 1: General introduction and thesis outline...... 1 1.1. Biohydrogen production: need and current state-of-the-art ...... 2 1.2. Research objectives ...... 5 1.3. Thesis structure ...... 6 References ...... 8

CHAPTER 2: Theoretical background on H2 production ...... 12

2.1. H2 utilization and production ...... 13

2.2. Biological H2 production mechanisms ...... 14 2.2.1. Biophotolysis of water by green algae and cyanobacteria ...... 14

2.2.2. Bioelectrochemical H2 production in microbial electrolysis cells...... 15 2.2.3. Photofermentation ...... 16 2.2.4. Dark fermentation ...... 17

2.3. Microbiology of dark fermentative H2 production ...... 19

2.4. Factors affecting dark fermentative H2 production ...... 24 2.4.1. Temperature ...... 24 2.4.2. pH ...... 24

2.4.3. H2 partial pressure...... 25 2.4.4. Substrate concentration ...... 26 2.5. Microbial strategies for optimizing dark fermentation ...... 27

2.5.1. Enrichment of H2-producers in mixed cultures ...... 27 2.5.2. Synthetic co-cultures ...... 28

xiv

2.5.3. Bioaugmentation ...... 29 2.5.4. Genetically engineered microorganisms ...... 30

2.5.5. Integration of different biological H2 production processes ...... 31 References ...... 32 CHAPTER 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities ...... 54 ABSTRACT ...... 54 3.1. INTRODUCTION ...... 55 3.2. MATERIALS AND METHODS ...... 56 3.2.1. Enrichment culture: medium composition and inoculum source ...... 56

3.2.2. H2 production batch experiments ...... 57

3.2.3. Analysis of H2 production ...... 58 3.2.4. Analysis of the liquid metabolites ...... 59 3.2.5. Microbial community analysis ...... 59 3.2.6. Calculations ...... 60 3.3. RESULTS AND DISCUSSION ...... 60

3.3.1. Thermophilic H2 production at constant temperature in CSTR and first batch test (55 °C) ...... 60

3.3.2. Sudden transient downward temperature shift and its effects on H2 metabolism ...... 62

3.3.3. Sudden transient upward temperature shift and its effects on H2 metabolism ...... 63 3.3.4. Microbial community composition during the altered temperature conditions ...... 65 3.3.5. Comparison between cultures exposed to temporal downward and upward temperatures ...... 69 3.4. CONCLUSIONS ...... 71 REFERENCES ...... 72 CHAPTER 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short-term temperature fluctuations ...... 78 ABSTRACT ...... 78 4.1. INTRODUCTION ...... 79 4.2. MATERIALS AND METHODS ...... 80 4.2.1. Enrichment culture and medium composition ...... 80 4.2.2. Synthetic mixed culture used for bioaugmentation ...... 81 4.2.3. Experimental procedure ...... 82 4.2.4. Analytical techniques and calculations conducted ...... 84

4.2.5. Microbial analysis for unaugmented and augmented samples during temperature fluctuation ...... 85 4.3. RESULTS ...... 86 4.3.1. Characterization of bacteria in the synthetic mixed culture ...... 86 4.3.2. Comparison between augmented and unaugmented cultures at constant temperature of 55 °C ...... 87 4.3.3. Process recovery after the downward temperature shift and the impact of bioaugmentation ...... 88 4.3.4. Process recovery after the upward temperature shift and impact of bioaugmentation ...... 90 4.4. DISCUSSION ...... 92 REFERENCES ...... 96 CHAPTER 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co-culture for biohydrogen production ...... 102 ABSTRACT ...... 102 5.1. INTRODUCTION ...... 103 5.2. MATERIALS AND METHODS ...... 105 5.2.1. Bacterial strains and growth conditions ...... 105 5.2.2. Analytical techniques ...... 106 5.2.3. Genomic DNA isolation ...... 106 5.2.4. 16S rRNA gene and hydA primer design ...... 107 5.2.5. Real-time quantitative PCR ...... 107 5.3. RESULTS AND DISCUSSION ...... 108 5.3.1. Comparing hydrogen production between individual cultures and co-cultures of T. neapolitana and C. saccharolyticus monocultures ...... 108 5.3.2. Specificity of in silico and experimental qPCR assays ...... 112 5.3.3. Real-time quantitative PCR ...... 114 5.4. CONCLUSIONS ...... 117 REFERENCES ...... 119 CHAPTER 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana ...... 126 ABSTRACT ...... 126 6.1. INTRODUCTION ...... 127 6.2. MATERIALS AND METHODS ...... 128

xvi

6.2.1. Experimental Setup ...... 128 6.2.2. Experimental procedure ...... 129 6.2.3. Analytical methods and calculation procedures ...... 130 6.2.4. Microbial analyses ...... 131 6.3. RESULTS AND DISCUSSION ...... 131

6.3.1. H2 production rates and yields at increasing glucose concentrations ...... 131 6.3.2. Effect of glucose concentration on the composition of soluble metabolites ...... 133 6.3.3. Quantity of T. neapolitana in the mixed microbial communities ...... 134 6.3.4. Microbial community profiles at different glucose concentrations ...... 135 6.4. CONCLUSIONS ...... 137 REFERENCES ...... 139 CHAPTER 7: General discussion and conclusions ...... 146 7.1. General discussion ...... 147

7.1.1. Microbial community stability during process disturbances and its implication for H2 production ...... 154 7.1.2. Practical implications and limitations of bioaugmentation ...... 157 7.2. Future research perspectives ...... 161 7.3. Conclusions ...... 162 REFERENCES ...... 164 Appendixes: supporting information for Chapters ...... 172

xvii

List of publications

Okonkwo, O., Escudie, R., Bernet, N., Mangayil, R., Lakaniemi, A. M., & Trably, E. (2019). Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities. International Journal of Hydrogen Energy, 44(16), 8028- 8037.

Okonkwo, O., Escudie, R., Bernet, N., Mangayil, R., Lakaniemi, A. M., & Trably, E. (2019). Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations. Applied Microbiology and Biotechnology, in press. https://doi.org/10.1007/s00253-019-10203-8

Okonkwo, O., Lakaniemi, A. M., Santala, V., Karp, M., & Mangayil, R. (2018). Quantitative real- time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co-culture for biohydrogen production. International Journal of Hydrogen Energy, 43(6), 3133-3141.

Okonkwo, O., Papirio, S., Trably, E., Escudie, R., Lakaniemi, A. M., Esposito, G. (2019). Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana. Submitted for publication.

xviii

Author’s contribution

Paper I: Onyinye Jeneth Okonkwo was involved in the design of this study and carried out the experimental work, the analyses, data interpretation and the drafting and completion of the manuscript. Aino-Maija Lakaniemi, Rahul Mangayil, Renaud Escudie and Eric Trably were involved in the design of the study, data interpretation, reviewing and completion of the manuscript.

Paper II: Onyinye Jeneth Okonkwo was involved in the design of this study and carried out the experimental work, the analyses, data interpretation and the drafting and completion of the manuscript. Aino-Maija Lakaniemi, Renaud Escudie and Eric Trably were involved in the design of the study and data interpretation. Aino-Maija Lakaniemi, Rahul Mangayil, Renaud Escudie and Eric Trably were involved in the reviewing and completion of the manuscript.

Paper III: Onyinye Jeneth Okonkwo was involved in the design of this study and carried out the experimental work, the analyses, data interpretation and the drafting and completion of the manuscript. Aino-Maija Lakaniemi, Rahul Mangayil, Ville Santala and Matti Karp were involved in the design of the study, data interpretation, reviewing and completion of the manuscript.

Paper IV: Onyinye Jeneth Okonkwo was involved in the design of this study and carried out the experimental work, the analyses, data interpretation and the drafting and completion of the manuscript. Aino-Maija Lakaniemi, Renaud Escudie, Eric Trably, Stefano Papirio and Giovanni Esposito were involved in the design of the study, data interpretation, reviewing and completion of the manuscript.

xix

List of Symbols and Abbreviations

H2 Hydrogen

MEC Microbial electrolysis cell

ATP Adenosine triphosphate

NAD Nicotinamide adenine dinucleotide

Fd Ferredoxin

F/M Food to microorganism ratio

N2 Nitrogen

CH4 Methane

CO2 Carbon dioxide

BHP Biohydrogen production

CSTR Continuously stirred tank reactor

VFAs Volatile fatty acids

ΔG0 Gibbs free energy

ΔH Enthalpy

T temperature

ΔS0 Enthropy

Tm Melting temperature

COD Chemical oxygen demand

OD Optical density

DNA Deoxyribonucleic acid qPCR Quantitative polymerase chain reaction

OTU Operational taxonomic unit

CHAPTER 1 General introduction and thesis outline

Chapter 1: Introduction

1.1. Biohydrogen production: need and current state-of- the-art

The increase in the global population and living standards especially in developing countries has led to an upsurge in the global energy consumption (Dudley, 2019; McKinsey Global Institute, 2019). Currently, approximately three-quarter of the total energy consumption is derived from fossil fuels (crude oil, coal and natural gas) as shown in Figure 1 (International Energy Agency, 2018). This has important impacts on energy security as fossil fuels are depleting non-renewable resources. Furthermore, carbon dioxide (CO2) emissions from energy production contribute to air pollution. Over the past 150 years, the concentration of greenhouse gases (GHG) in the atmosphere has been on a constant rise following human activities such as industrialization, and the global average temperature has risen by 0.88 °C since the late 19th century (National Oceanic and Atmospheric Administration, 2019). It has been generally agreed that if the global climate system warms up more than 2 °C above the pre-industrial levels (1850–1900), the implications would be severe (Masson-Delmotte et al., 2018; Myles et al., 2018). Thus, there is an increasing need to find renewable energy sources that provide sustainable energy and have lower carbon footprint compared to fossil fuels. Renewable energy (including solar, wind, hydro and bioenergy) is rapidly becoming a preferred solution to the world’s energy challenge. In 2018, 25% of energy consumption was from renewable energy sources (International Energy Agency, 2018), most of which is obtained from bioenergy sources (World Bioenergy Association, 2018). In some places, such as in developing countries, the traditional use of biomass which involves burning of wood, forest residues and agricultural waste biomass for cooking and heating is still prevalent (Bourguignon, 2015). As such, it is usually unsustainable and causes deforestation as well as health problems due to smoke pollution (International Energy Agency, 2018).

Chapter 1: Introduction

Figure 1.1 Global energy consumption in 2018. Data obtained from Global Energy and CO2 Status Report (International Energy Agency, 2018).

Wastes have also become a local and global challenge affecting the environment, wildlife as well as the society (World Bank, 2018). Similar to the consumption of energy, the generation of waste for example in developing countries has been increasing along with the growing population and economic growth (International Solid Waste Association, 2012; McAllister, 2015; Mondal and Sanaul, 2019). Without an effective and efficient waste management program, the wastes generated from various human activities, both industrial and domestic, can result in health and environmental hazards. According to the World Bank report (2012), the amount of municipal wastes of the cities around the world might reach 2.2 billion tons per year by 2025. Meanwhile the rates of waste generation in developing countries might double over the next two decades. In EU, a comprehensive legislation has been built with objectives and targets to improve waste management, as well as to lower the carbon footprint from GHG emissions and other environmental impacts as well as potential adverse health effects (European Commission, 2014; Liobikienė and Butkus, 2017). Developing countries such as Rwanda, Ethiopia and Mauritius have also sketched ambitious plans to decouple industrialization from environmental impacts to promote green economies (Liobikienė and Butkus, 2017). Biomasses and biodegradable wastes have been recognized as having the potential to at least partly replace energy production from fossil fuels (Ben-Iwo et al., 2016; Guo et al., 2015; Srirangan et al., 2012). Waste-to-energy conversion processes, as a source of renewable energy, are expected to play an increasingly important role in sustainable management of wastes at global level (Pandey and Teixeira, 2016). This is driving many industries towards valorizing the biorefinery concept of waste to energy conversion. Nowadays, anaerobic digestion is widely used in biological waste-to-energy

Chapter 1: Introduction

conversion (Angenent et al., 2004; Gunaseelan, 1997; Hejnfelt and Angelidaki, 2009; Jingura and Matengaifa, 2009; Parawira et al., 2008; Wilkie et al., 2000). It is a collection of processes by which microorganisms break down biodegradable material in the absence of oxygen to produce methane (CH4) and carbon dioxide (CO2) (Bouallagui et al., 2005; Holm-Nielsen et al., 2009;

Khalid et al., 2011). However, due to the global environmental considerations such as GHG CO2 emissions from the combustion of CH4, microbial H2 from renewable organic waste sources is a potentially cleaner source of bioenergy as it has high purity level upon combustion. H2 is a key intermediate in anaerobic reactions which are involved in the mineralization of organic matter (Nielsen et al., 2001). In a two-staged production process, the first optimized for dark fermentative

H2 production and the second for methane generation via anaerobic digestion, it’s possible to produce biohythane (mixture of H2 and CH4), which can be used as energy carrier. From an environmental point of view, hythane has potential in the reduction of the GHG emissions into atmosphere due to the presence of H2 which reduces the carbon content of this gaseous blend (Bolzonella et al., 2018; Liu et al., 2018; Pasupuleti and Venkata Mohan, 2015; Si et al., 2016).

Compared to conventional H2 production from natural gas by steam reforming, gasification and water electrolysis which use non-renewable energy sources to produce H2, biological hydrogen production is less energy intensive and a variety of waste-derived feedstocks can be utilized as carbon sources for dark fermentative H2 production to facilitate waste recycling. Compared to dark fermentation under mesophilic conditions (25 to 40 ℃), processes operated under thermophilic (55 to 80 ℃) conditions have garnered interest over the recent years due to several advantages. Thermophilic processes can often be operated at a slightly lower retention times than corresponding mesophilic processes, since microbiological activity and kinetics of chemical reactions increase with increased temperature (O-Thong et al., 2011). Thermophilic processes for H2 production have usually reduced presence of H2 consumers and other unwanted microorganisms and seem to enable more stable H2 production in long-term operation (Dong et al., 2011; Ferrer et al., 2010). Another important advantage of dark fermentation under thermophilic conditions is the natural sanitation it provides by getting rid of undesired pathogens in the system (Abreu et al., 2012). High temperatures may also increase availability of certain organic compounds because their solubility increases with increasing temperature (Meegoda et al., 2018).

The major challenges that have prevented the large-scale utilization of dark fermentative H2 production include: selection of suitable and efficient microorganisms or microbial communities,

Chapter 1: Introduction

low substrate conversion efficiency, low hydrogen yield, as well as mixture of hydrogen and carbon dioxide as products requiring separation (Stetson, 2013). The performance of microbial communities is often affected by factors such as pH, temperature, substrate and inoculum pretreatment (Cisneros-Pérez et al., 2015; Penteado et al., 2013). Changes in environmental conditions during dark fermentative H2 production cause change in the population dynamics, which in turn can lead to instability of H2 producing systems (Bakonyi et al., 2014; Koskinen et al.,

2007). Previous studies investigating the effects of temperature on fermentative H2 production have focused on comparing batch and reactor performances at different fixed operating temperatures (Dessì et al., 2018; Zhang and Shen, 2006). However, very little is known about the impact of short-term temperature fluctuations on H2 production and microbial community dynamics. Therefore, assessing the impact of such factors on the structure and composition of mixed microbial communities is important, as the detrimental effects of operational variations can only be delineated by understanding their effect on well-performing microbial community. This knowledge is also required for developing strategies to enable fast and efficient recovery of H2 production. This is the first study to demonstrate the influence transient downward temperature fluctuations on the stability of H2 production and the use of bioaugmentation strategy to ensure fast recovery of biological systems exposed to stress periods. Understanding microbial community composition, changes that occur during process disturbances and extreme conditions (such as high substrate concentration or temperature fluctuations) is required for enhancing the process stability. In-depth understanding of the microbial community dynamics requires fast and efficient microbial monitoring methods.

1.2. Research objectives The main objective of this study was to enhance thermophilic hydrogen production by using microbial strategies (bioaugmentation and synthetic co-cultures) and by increasing the understanding on the microbial community dynamics especially during stress conditions. The specific objectives were:

Chapter 1: Introduction

• To study the impact of sudden short-term temperature fluctuations on thermophilic dark

fermentative H2 production and microbial community composition with and without

augmenting a mixed culture with known H2 producers before and after the fluctuations (Chapters 3 and 4).

• To enhance H2 production by using a synthetic co-culture of two ecologically distant species, Thermatoga neapolitana and Caldicellulosiruptor saccharolyticus (Chapter 5). • To develop a quantitative polymerase chain reaction (qPCR) based method for monitoring the growth of T. neapolitana in synthetic co-cultures (Chapter 5) and after bioaugmenting mixed cultures with T. neapolitana (Chapter 6).

• To examine the effects of different feed glucose concentrations on H2 production and microbial community composition of a thermophilic mixed culture with and without bioaugmenting the culture with T. neapolitana (Chapter 6).

1.3. Thesis structure This thesis is composed of seven chapters (Figure 1.2). In Chapter 1, the rationale for this study is explained and an overview of the thesis is provided. The Chapter starts by presenting the importance of waste-to-energy conversion processes and description of current state-of-the-art of dark fermentative hydrogen production. This is followed by the problem statement and proceeds with explaining objectives of the study.

Chapter 2 provides a theoretical background on the existing knowledge on H2 production methods, and biological H2 production focusing on the microbiology and factors affecting dark fermentative H2 production and microbial strategies for enhancing H2 production.

Chapter 3 reports on the effects of short-term upward and downward temperature fluctuations on thermophilic dark fermentative H2 production and the dynamics of microbial communities in response to these changes. In Chapter 4, bioaugmentation was applied to cultures undergoing short-term temperature fluctuations as a strategy to enhance H2 production process during and after the temperature fluctuations.

Chapter 5 of this study focuses on the co-cultivation of two ecologically distant organisms

(Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana) to improve H2 production and the development of a quantitative PCR method for genus and species level monitoring of T. neapolitana. A 16S rRNA gene method was designed to target eight members of the Thermotoga genus. Given the high degree of similarity and absence of correlation that usually occur between 6

Chapter 1: Introduction

16S rRNA gene, a more specific method was further developed targeting the hydA gene for a more comprehensive evaluation of T. neapolitana in synthetic co-cultures and mixed cultures.

In Chapter 6 the effect of different feed glucose concentrations on H2 production in a thermophilic mixed culture with and without augmenting the culture with T. neapolitana is reported. A pre- adaptation strategy (incubation of T. neapolitana in a mixed culture for several batch cycles) was employed prior to the experiment to make T. neapolitana a stable member of the microbial community.

Chapter 7 summarizes the knowledge obtained in this thesis and further discusses the practical implications of the research work. Chapter 7 also provides recommendations for further studies and includes main conclusions drawn based on the work.

Figure 1.2 Overview of the structure of this PhD thesis.

Chapter 1: Introduction

References Abreu, A. a, Karakashev, D., Angelidaki, I., Sousa, D.Z., Alves, M., 2012. Biohydrogen production from arabinose and glucose using extreme thermophilic anaerobic mixed cultures. Biotechnol. Biofuels 5, 6. doi:10.1186/1754-6834-5-6

Angenent, L.T., Karim, K., Al-Dahhan, M.H., Wrenn, B.A., Domíguez-Espinosa, R., 2004. Production of bioenergy and biochemicals from industrial and agricultural wastewater. Trends Biotechnol. doi:10.1016/j.tibtech.2004.07.001

Bakonyi, P., Nemestóthy, N., Simon, V., Bélafi-Bakó, K., 2014. Review on the start-up experiences of continuous fermentative hydrogen producing bioreactors. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2014.08.014

Ben-Iwo, J., Manovic, V., Longhurst, P., 2016. Biomass resources and biofuels potential for the production of transportation fuels in Nigeria. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2016.05.050

Bolzonella, D., Battista, F., Cavinato, C., Gottardo, M., Micolucci, F., Lyberatos, G., Pavan, P., 2018. Recent developments in biohythane production from household food wastes: A review. Bioresour. Technol. doi:10.1016/j.biortech.2018.02.092

Bouallagui, H., Touhami, Y., Ben Cheikh, R., Hamdi, M., 2005. Bioreactor performance in anaerobic digestion of fruit and vegetable wastes. Process Biochem. doi:10.1016/j.procbio.2004.03.007

Bourguignon, D., 2015. Biomass for electricity and heating: opportunities and challenges. EPRS| Eur. Parliam. Res. Serv.

Cisneros-Pérez, C., Carrillo-Reyes, J., Celis, L.B., Alatriste-Mondragón, F., Etchebehere, C., Razo-Flores, E., 2015. Inoculum pretreatment promotes differences in hydrogen production performance in EGSB reactors. Int. J. Hydrogen Energy 40, 6329–6339. doi:10.1016/j.ijhydene.2015.03.048

Dessì, P., Porca, E., Lakaniemi, A.M., Collins, G., Lens, P.N.L., 2018. Temperature control as key factor for optimal biohydrogen production from thermomechanical pulping wastewater. Biochem. Eng. J. doi:10.1016/j.bej.2018.05.027

Dong, F., Li, W.W., Sheng, G.P., Tang, Y., Yu, H.Q., Harada, H., 2011. An online-monitored thermophilic hydrogen production UASB reactor for long-term stable operation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.08.010 8

Chapter 1: Introduction

Dudley, B., 2019. Energy Outlook 2019 Edition, BP.

European Commission, 2014. A policy framework for climate and energy in the period from 2020 to 2030, Communication from the Commission to the European Parliament, The Council, The European Economic and Social Committee and the Committe of the Regions.

Ferrer, I., Vázquez, F., Font, X., 2010. Long term operation of a thermophilic anaerobic reactor: Process stability and efficiency at decreasing sludge retention time. Bioresour. Technol. doi:10.1016/j.biortech.2009.12.006

Gunaseelan, V.N., 1997. Anaerobic digestion of biomass for methane production: A review. Biomass and Bioenergy. doi:10.1016/S0961-9534(97)00020-2

Guo, M., Song, W., Buhain, J., 2015. Bioenergy and biofuels: History, status, and perspective. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2014.10.013

Hejnfelt, A., Angelidaki, I., 2009. Anaerobic digestion of slaughterhouse by-products. Biomass and Bioenergy. doi:10.1016/j.biombioe.2009.03.004

Holm-Nielsen, J.B., Al Seadi, T., Oleskowicz-Popiel, P., 2009. The future of anaerobic digestion and biogas utilization. Bioresour. Technol. doi:10.1016/j.biortech.2008.12.046

International Energy Agency, 2018. Global Energy and CO2 Status Report, Oecd/Iea.

International Solid Waste Association, 2012. Globalization and Waste Management. Int. Solid Waste Assoc.

Jingura, R.M., Matengaifa, R., 2009. Optimization of biogas production by anaerobic digestion for sustainable energy development in Zimbabwe. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2007.06.015

Khalid, A., Arshad, M., Anjum, M., Mahmood, T., Dawson, L., 2011. The anaerobic digestion of solid organic waste. Waste Manag. doi:10.1016/j.wasman.2011.03.021

Koskinen, P.E.P., Kaksonen, A.H., Puhakka, J.A., 2007. The relationship between instability of H2 production and compositions of bacterial communities within a dark fermentation fluidized-bed bioreactor. Biotechnol. Bioeng. 97, 742–758. doi:10.1002/bit.21299

Liobikienė, G., Butkus, M., 2017. The European Union possibilities to achieve targets of Europe 2020 and Paris agreement climate policy. Renew. Energy. doi:10.1016/j.renene.2017.01.036

Chapter 1: Introduction

Liu, Z., Si, B., Li, J., He, J., Zhang, C., Lu, Y., Zhang, Y., Xing, X.H., 2018. Bioprocess engineering for biohythane production from low-grade waste biomass: technical challenges towards scale up. Curr. Opin. Biotechnol. doi:10.1016/j.copbio.2017.08.014

McAllister, J., 2015. Factors influencing solid-waste management in the developing world. All Grad. Plan B other Reports. doi:10.1016/j.jhydrol.2004.08.002

McKinsey Global Institute, 2019. Global Energy Perspective 2019 : Reference Case. Energy Insights.

Meegoda, J.N., Li, B., Patel, K., Wang, L.B., 2018. A review of the processes, parameters, and optimization of anaerobic digestion. Int. J. Environ. Res. Public Health. doi:10.3390/ijerph15102224

Mondal, M., Sanaul, H., 2019. The implications of population growth and climate change on sustainable development in Bangladesh. Jàmbá J. Disaster Risk Stud. 11, 1–10.

National Oceanic and Atmospheric Administration, 2019. Global Climate Report - January 2019.

Nielsen, A.T., Amandusson, H., Bjorklund, R., Dannetun, H., Ejlertsson, J., Ekedahl, L.G., Lundström, I., Svensson, B.H., 2001. Hydrogen production from organic waste. Int. J. Hydrogen Energy. doi:10.1016/S0360-3199(00)00125-7

O-Thong, S., Mamimin, C., Prasertsan, P., 2011. Effect of temperature and initial pH on biohydrogen production from palm oil mill effluent: Long-term evaluation and microbial community analysis. Electron. J. Biotechnol. 14. doi:10.2225/vol14-issue5-fulltext-9

Pandey, A., Teixeira, J.A.C., 2016. Current Developments in Biotechnology and Bioengineering: Foundations of Biotechnology and Bioengineering. Elsevier.

Parawira, W., Read, J.S., Mattiasson, B., Björnsson, L., 2008. Energy production from agricultural residues: High methane yields in pilot-scale two-stage anaerobic digestion. Biomass and Bioenergy. doi:10.1016/j.biombioe.2007.06.003

Pasupuleti, S.B., Venkata Mohan, S., 2015. Single-stage fermentation process for high-value biohythane production with the treatment of distillery spent-wash. Bioresour. Technol. doi:10.1016/j.biortech.2015.03.128

Penteado, E.D., Lazaro, C.Z., Sakamoto, I.K., Zaiat, M., 2013. Influence of seed sludge and pretreatment method on hydrogen production in packed-bed anaerobic reactors, in: Int. J. Hydrogen Energy. pp. 6137–6145. doi:10.1016/j.ijhydene.2013.01.067

Chapter 1: Introduction

Si, B., Liu, Z., Zhang, Y., Li, J., Shen, R., Zhu, Z., Xing, X., 2016. Towards biohythane production from biomass: Influence of operational stage on anaerobic fermentation and microbial community. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2015.06.045

Srirangan, K., Akawi, L., Moo-Young, M., Chou, C.P., 2012. Towards sustainable production of clean energy carriers from biomass resources. Appl. Energy. doi:10.1016/j.apenergy.2012.05.012

Stetson, N., 2013. Hydrogen Storage Technical Team Roadmap. U.S. Drive.

The World Bank, 2012. What a waste: a global review of solid waste management, Urban Development Series Knowledge Papers. doi:10.1111/febs.13058

Wilkie, A.C., Riedesel, K.J., Owens, J.M., 2000. Stillage characterization and anaerobic treatment of ethanol stillage from conventional and cellulosic feedstocks. Biomass and Bioenergy. doi:10.1016/S0961-9534(00)00017-9

World Bank, 2018. Global Waste to Grow by 70 Percent by 2050 Unless Urgent Action is Taken: World Bank Report [WWW Document]. World Bank.

World Bioenergy Association, 2018. Global Bioenergy Statistics 2018, World Bioenergy Association.

Zhang, Y., Shen, J., 2006. Effect of temperature and iron concentration on the growth and hydrogen production of mixed bacteria. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2005.05.006

CHAPTER 2

Theoretical background on H2 production

Chapter 2: Theoretical background on hydrogen production

2.1. H2 utilization and production

Currently, H2 is used in the chemical industry as a fundamental building block for the production of ammonia-fertilizers and methanol used for polymer manufacturing (Andrews and Shabani, 2012). It is also used for obtaining high grade petrol in a process called reforming and also to remove sulfur compounds, which otherwise would contaminate the catalytic converters in cars

(Cheremisinoff and Rosenfeld, 2009). H2 is currently being tested as a potential energy source in the transportation sector. For example, in aviation, H2-powered fuel cells are considered as a potential energy source for aircrafts where the fuel cell modules can supply electricity to the electrical system as emergency generator or as an auxiliary power unit (Alazemi and Andrews,

2015; Ball and Weeda, 2015; Hua et al., 2014). Similarly, the uses of H2-powered fuel cells are currently being tested as potential energy source for ships (Bicer and Dincer, 2018; Sharma and Ghoshal, 2015).

Hydrogen can be generated through several methods including thermochemical and biological processes. Approximately 95% of the hydrogen produced is derived primarily from non- renewable, fossil raw materials and thus generates GHG emissions (Demirbas, 2004). Thermal production process, in which steam reforming is used to produce H2 from natural gas or other light hydrocarbons, is most common with worldwide annual H2 production of approximately 50 million tons (Armaroli and Balzani 2011; US Department of Energy 2013). Steam reforming of natural gas is currently the least expensive method of producing H2. Hydrogen can be produced also by electrolysis of water, a process which uses electricity to split water into H2 and oxygen (Armaroli and Balzani, 2011; Holladay et al., 2009; Kapdan and Kargi, 2006). However, about 80% of the operation cost goes to electricity consumption. About to 50% of the global H2 demand is generated from steam reforming of natural gas, approximately 30% from oil and naphtha reforming from refinery or chemical industrial off-gases, 18% via coal gasification, about 3.9% from water electrolysis, and 0.1% from other sources (Kalamaras and Efstathiou, 2013; Muradov and Veziroǧlu, 2005). Hydrogen can be produced biologically from renewable feedstocks such as biomass and organic wastes, but the biological processes (described in detail in the next section) are still in research and development phase. However, compared to thermochemical and electrochemical H2 production, biological H2 production is preferable due to its low energy requirement. Most biological H2 production processes also involve the production of CO2 but it is worth noting that this CO2 released from biomass is consumed during photosynthesis unlike fossil fuels where the CO2 released has been built up over time (Vijayaraghavan and Mohd Soom, 2006).

Chapter 2: Theoretical background on hydrogen production

2.2. Biological H2 production mechanisms

Biological H2 production can occur via various microbial-driven processes such as direct or indirect biophotolysis, photofermentation, bioelectrochemical hydrogen production in microbial electrolysis cells, dark fermentation or a combination of some of these methods (Gómez et al.,

2011; Hallenbeck et al., 2012; Schütz et al., 2004; Zurrer and Bachofen, 1979). Biological H2 production methods have been widely studied and are considered preferable to the traditional H2 production methods mentioned in section 2.1 because of the possibility to use renewable feedstocks in the production process (Benemann and Benemann, 2000; Chen, 2006; Guwy et al.,

2011; Hallenbeck, 2013). For decades, biological H2 production from organic wastes has been considered as a sustainable means for energy production (Benemann, 1996; Harper and Pohland, 1986). Such wastes include for example the organic fraction of municipal solid waste, agricultural wastes and pulp and paper manufacturing waste streams (Benemann, 1997; Claassen et al., 1999; Sen et al., 2008).

2.2.1. Biophotolysis of water by green algae and cyanobacteria Biophotolysis can either be direct or indirect and is carried out by green microalgae or

+ + cyanobacteria utilizing sunlight to split water into oxygen (O2) and H ions. The H ions can then be combined through direct (Equation 1) or indirect routes (Equations 2 and 3) to produce H2 gas

(Azwar et al., 2014; Dasgupta et al., 2010; Yu and Takahashi, 2007). H2 production by direct photolysis utilizes energy from sunlight and microalgal photosynthetic systems to convert water into chemical energy (Equation 1).

2H2O + solar energy → 2H2 + O2 (1)

Apart from having the ability to fix CO2 via photosynthesis, many types of green algae and cyanobacteria also have the ability to fix nitrogen from the atmosphere and produce enzymes that can catalyze the H2 generating step via indirect biophotolysis (Rahman et al., 2016). Indirect biophotolysis consists of two stages that occur in series. The first step is the biomass production

(carbohydrate) through photosynthetic system (Equation 2). During this process, O2-evolving photosynthesis is used to fix and store carbon, thus producing reduced carbon compounds that can later be used in the second stage, which utilises the biomass rich-carbohydrate for H2- producing fermentation (Equation 3) (Yu and Takahashi, 2007).

6H2O + 6CO2 + light → C6H12O6 + 6O2 (2)

Chapter 2: Theoretical background on hydrogen production

C6H12O6 + 6H2O → 12H2 + 6CO2 (3)

Direct biophotolysis is an advantageous process because H2 is produced directly from water and sunlight. However, high light intensity is required and the rate of H2 production is typically low. Additionally, oxygen is inhibitory to the process, which the process difficult to optimize (Benemann and Benemann, 2000; Chandrasekhar et al., 2015; Yu and Takahashi, 2007). Similarly, H2 production by indirect biophotolysis is sensitive to oxygen as the oxygen produced photosynthetically tends to inactivate the key enzymes of biophotolysis (nitrogenase and hydrogenase), thereby causing instability in H2 production. Some cyanobacteria exhibit temporal separation mechanism by carrying out oxygenic photosynthesis in the day and nitrogen fixation at night time (Compaoré and Stal, 2010).

2.2.2. Bioelectrochemical H2 production in microbial electrolysis cells

H2 can be produced in a microbial electrolysis cell (MEC) in which exoelectrogenic microorganisms degrade organic materials (e.g. acetate) producing protons, electrons and CO2 (Figure 2.2) Protons migrate through a proton exchange membrane to the cathode and electrons are transported through an external circuit to the cathode to produce H2 with the help of small voltage applied between the electrodes (Liu et al., 2012; Wang et al., 2012). MECs should not be confused with microbial fuel cells as the latter is a fuel cell that generates electricity via the microbial activity on the anode and/or cathode (Logan et al., 2008). Equation 4 and 5 shows an example of the evolution of H2 in a MEC from acetate as the carbon source.

- + Anode: CH3COOH + 2H2O → 2CO2 + 8e + 8H (4)

+ - Cathode: 8H + 8e → 4H2 (5)

Some exoelectrogens capable of transferring electrons to the anode in a MEC include bacterial species belonging the genera Geobacter, Shewanella and Pseudomonas (Bond and Lovley, 2003; Call et al., 2009; Geelhoed and Stams, 2011; Liu et al., 2005; Moreno et al., 2015). The required applied voltage (typically 0.5 to 0.9 V) (Singh et al., 2015) in MECs for the formation of

H2 is low when compared to the theoretical minimum voltage of 1.23 V that is required for water electrolysis (Rozendal et al., 2006). While MEC is a potentially attractive green technology to tackle the global warming and energy crisis, there are existing challenges such low H2 production rate and expensive materials which hinders commercialization (Kadier et al., 2016; Zhang and

Chapter 2: Theoretical background on hydrogen production

Angelidaki, 2014). Therefore, new approaches are needed in biofilm engineering, materials for electrodes and reactor configuration to enable successful large scale applications.

Figure 2.1 Schematic representation of bioelectrochemical hydrogen production in a two- chamber bioelectrochemical system (adapted from Singh et al. 2015). Examples of reactions occurring at the anode and cathode are presented in Equation 4 and 5, respectively.

2.2.3. Photofermentation Photofermentation is carried out by purple non-sulfur (PNS) bacteria through a light-driven biochemical process, in which organic acids such as acetate, butyrate, lactate and/or propionate are converted to H2 and CO2 under anaerobic conditions as shown in Equations 6─9 (Adessi et al., 2012; Chen et al., 2008a).

Acetate (C2H4O2) + 2H2O + Light energy → 4H2 + 2CO2 (6)

Butyrate (C4H8O2) + 6H2O + Light energy → 10H2 + 4CO2 (7)

Lactate (C3H6O3) + 3H2O + Light energy → 6H2 + 3CO2 (8)

Propionate (C3H6O2) + 4H2O + Light energy → 7H2 + 3CO2 (9) 16

Chapter 2: Theoretical background on hydrogen production

As organic acids are present in many waste streams, photofermentative microorganisms could be utilized for simultaneous waste treatment and H2 production (Ghosh et al., 2017; Keskin et al.,

2011; Lee et al., 2017). The most widely known PNS bacteria that are able to produce H2 via photofermentation belong to the genera of Rhodospirillum, Rhodopseudomonas and Rhodobacter (Boran et al., 2012; Carlozzi and Lambardi, 2009; Zurrer and Bachofen, 1979). The advantage of this process over biophotolysis is that the process does not result in generation of inhibitory O2 and therefore the H2 production rates are typically higher than those obtained with direct or indirect biophotolysis (Holladay et al., 2009; Oh et al., 2004; Singh et al., 2015). However a major limitation is the low photochemical efficiencies since the process is light dependent (Hay et al., 2013; Levin et al., 2004; Özgür and Peksel, 2013). Furthermore, the H2 yield and rate of H2 production are too low for practical applications (Afsar et al., 2011; Androga et al., 2011; Özgür et al., 2010; Sabourin-Provost and Hallenbeck, 2009). Further research is therefore necessary to improve the H2 yield or production rate.

2.2.4. Dark fermentation During dark fermentation, microorganisms break down complex organic polymers such as cellulose to monomers which are then further utilized to produce H2 and other by-products. H2 is produced by fermentative microorganisms as a means of disposing electrons derived from the oxidation of organic compounds (Yang, 2007). H2 can be produced by facultative anaerobic or obligate anaerobic bacteria using different pathways. The most common pathway utilized by obligate anaerobic H2 producing microorganisms is the glycolytic or Embden-Meyerhoff pathway (Verhaart et al., 2010; Zhang et al., 2012). In this pathway, glucose is oxidized to pyruvate, leading to the generation of reduced nicotinamide adenine dinucleotide (NADH) and adenosine triphosphate (ATP). The pyruvate is further oxidized to acetyl-coA via the reduction of ferredoxin (Fd). If acetyl-CoA is converted to acetate, both the reduced Fd and NADH are then used to

+ convert H to H2. Alternatively, pyruvate from glucose may be converted by facultative microorganisms to formate by the catalysis of pyruvate formate lyase, and the produced formate can be further degraded into H2 and CO2 with formate hydrogen lyase (Chandrasekhar et al.,

2015; Vardar-Schara et al., 2008). The pathway utilized for H2 production depends on the microorganisms involved as well as the environmental conditions (Chandrasekhar et al., 2015;

Ramírez-Morales et al., 2015). H2 production rate in dark fermentation is typically higher than those observed for photofermentation and biophotolytis (Chandrasekhar et al., 2015).

Chapter 2: Theoretical background on hydrogen production

Although H2 can be produced from various organic materials (for a review, see e.g. Khanna and Das, 2013; Lin et al., 2012; Show et al., 2010), glucose is one of the most abundant sugars on earth and a building block of many organic compounds such starch, glycogen and cellulose. Therefore, the biochemical pathways of dark fermentation will be presented for glucose in this section (Figure 2.2). Due to thermodynamic constraints, the theoretical yield of H2 in dark fermentation is only 4 moles because a large part of the substrate is converted into various soluble metabolic products such as acetate, butyrate, propionate or ethanol (Tapia-Venegas et al., 2015).

-1 The maximum theoretical yield, also known as the Thauer limit (4 mol H2 mol glucose), can only be achieved through the acetate pathway (Equation 10), whereas H2 production from glucose via the butyrate pathway produces 2 moles of H2 (Equation 11). The production of other soluble metabolic products such as propionate, ethanol and lactate (Equation 12-14) (Wicher et al., 2012) reduces the maximum H2 yield obtainable via dark fermentation, because these pathways consume glucose and do not result in H2 generation or even consume H2 (Frascari et al., 2013; Masset et al., 2012). Thus, the energy that is stored chemically in the organic material is not fully recoverable in the form of gaseous H2 (Kumar et al., 2016).

- C6H12O6 + 2H2O → 2CH3COO + 2CO2 + 4H2 (Acetate pathway) (10)

- C6H12O6 → CH3CH2CH2COO + 2CO2 + 2H2 (Butyrate pathway) (11)

- C6H12O6 + 2H2 → 2CH3CH2COO + 2H2O (Propionate pathway) (12)

C6H12O6 → 2CH3CH2OH + 2CO2 (Ethanol pathway) (13)

C6H12O6 → 2CH3CHOHCOOH (Lactate pathway) (14)

In some cases, the metabolic pathways lead to ethanol and acetate production, lowering the stoichiometric H2 yield to 2 mol of H2 per mole of glucose (Equation 15). This is often dependent on the temperature condition and the microorganism involved (Li and Fang, 2007).

C6H12O6 + 2H2O → CH3CH2OH + CH3COOH + 2CO2 + 2H2 (15)

Chapter 2: Theoretical background on hydrogen production

Figure 2.2 The known biochemical pathways for the fermentation of glucose (adapted from Cabrol et al., 2017).

2.3. Microbiology of dark fermentative H2 production

Dark fermentative H2 production can be carried out at mesophilic (25–40 °C), thermophilic (40– 65 °C) or hyperthermophilic (>80 °C) conditions depending on the microbial inoculum used (Sinha and Pandey, 2011). H2-producers are quite diverse and widespread in nature. They have been found in environments such as animal manure (Yokoyama et al., 2007), sewage sludge (Kotay and Das, 2006) and hot springs (Koskinen et al., 2008). Fermentative microorganisms are either

Chapter 2: Theoretical background on hydrogen production

facultative anaerobes or obligate anaerobes (Cabrol et al., 2017; Ghimire et al., 2015; Rittmann and Herwig, 2012).

Facultative anaerobic H2 producers are attractive for their lower oxygen sensitivity and their presence in dark fermentative process is useful for rapidly depleting O2 possibly present in the culture (Khanna et al., 2011). However, their presence is often limited by harsh inoculum pretreatment methods (described in more detail in section 2.4) such as heat treatment and acid treatment used to inactivate H2 consuming organisms, which are typically found from the same environments as H2 producing microorganisms (Cabrol et al., 2017). Expect for Bacillales (phylum

Firmicutes, class Bacilli) all other known facultative H2-producers belong to the class gammaproteobacteria (phylum proteobacteria) and are able to thrive at mesophilic conditions. These include for example, Citrobacter spp., Klebsiella spp., Enterobacter spp. (Patel et al., 2014), Shewanella oneidensis (Meshulam-Simon et al., 2007) and Pseudomonas stutzeri (Goud et al.,

2014). An interesting characteristic of the H2 producing Bacillales is that some of the members of this group possess the ability to resist shock conditions (such as heat-shock) via sporulation (Kumar et al., 2013).

Obligate anaerobes constitute a diverse array of microorganisms which are either spore formers or non-spore formers (For review, see e.g. Cabrol et al., 2017). One of the most studied obligately anaerobic microorganisms able to produce H2 at mesophilic conditions is Clostridium butyricum, which belongs to the class Clostridia. Clostridia have been found to dominate mesophilic fermentative microbial communities irrespective of the source of inoculum or pre-treatment method (Cabrol et al., 2015; Das and Veziroglu, 2008; Ueno et al., 2001).

H2 producing microorganisms that can produce H2 at thermophilic conditions include both bacteria and archaea (Pawar and van Niel, 2013). Some thermophilic H2 producers, such as Caldicellulosiruptor saccharolyticus have the ability to effectively hydrolyze complex carbohydrates for their metabolism (Carver et al., 2011; Nissilä et al., 2011). Their ability to hydrolyze complex carbohydrates makes them valuable for H2 production as well as other industrial processes for enhancing the rate of hydrolysis (De Vrije et al., 2009; Islam et al., 2009).

Among the thermophilic H2 producers that have been reported in literature, Thermoanaerobacterium spp. have been the most often found from mixed cultures (Karadag and

Puhakka, 2010; Koskinen et al., 2008; O-Thong et al., 2011). Other genera of thermophilic H2 producing microorganisms include for example Caldicellulosiruptor (Willquist et al., 2010), Thermotoga (Nguyen et al., 2008), and Thermoanaerobacter (Koskinen et al., 2008). 20

Chapter 2: Theoretical background on hydrogen production

Thermophilic microorganisms typically produce higher H2 yields than H2 producers thriving at mesophilic conditions, because H2 yielding reactions are thermodynamically more favorable at higher temperatures (Foglia et al., 2011; Qiu et al., 2016; Verhaart et al., 2010). For example, H2

-1 yield of approximately 96% of the theoretical value (4 mol H2 mol glucose) has been reported with Thermotoga neapolitana at 80 °C (Ippolito et al., 2010), while about 90% of the theoretical yield has been obtained with Caldicellulosiruptor saccharolyticus at 72.5 °C (De Vrije et al., 2007).

Dark fermentative H2 production at both mesophilic and thermophilic conditions can be carried out using either mixed or pure cultures (Hung et al., 2011; Li and Fang, 2007; Zhang et al., 2007).

Pure microbial cultures have mainly been utilized at laboratory-scale for studying H2 production mechanisms, the effect of environmental conditions on dark fermentation and the ability of different species to utilize different carbon sources (Table 2.1). However, Van Groenestijn et al.

(2009) demonstrated pilot-scale H2 production (400 L cylindrical stainless steel trickle bed reactor of 1.2 m height filled with 190 L polyurethane foam) using sucrose for studying the performance of pure cultures of C. saccharolyticus at a temperature of 73 °C under non-aseptic conditions (Van

-1 Groenestijn et al., 2009). They obtained a yield of 2.8 mol H2 mol hexose and a volumetric

-1 -1 productivity of 22 mmol H2 L filter bed h . Even though pure cultures often generate H2 with very high efficiency, they are typically quite sensitive to contamination and can require aseptic conditions throughout the fermentation, which is not feasible for large scale production (Taherdanak et al., 2015). Conversely, mixed cultures do not require an aseptic environment for

H2 production (for a review, see e.g. Hallenbeck, 2009). Additionally, single microorganisms have less hydrolytic capacity when compared to a consortium of microorganism which offers the possibility to work on a wide spectrum of low-cost, easily available substrates. Therefore, mixed microbial cultures are preferred for H2 production especially when complex organic materials such as lignocellulosic biomass or wastewaters are used as substrates (Anh et al., 2011; Cappelletti et al., 2012; Kim et al., 2008; Kumar et al., 2015; Hiroshi Yokoyama et al., 2007).

The microbial diversity often observed in mixed cultures can sometimes be disadvantageous for dark fermentative H2 production due to the activity of H2 consuming microorganisms and/or microorganisms that compete with H2 producers for substrates without producing H2 (Cabrol et al., 2017). Microorganisms that contribute negatively towards H2 production in mixed cultures are phylogenetically diverse. Hydrogenotrophic methanogens and homoacetogens are the most common H2 consuming microorganisms (Cabrol et al., 2017). Examples of hydrogenotrophic methanogens, which use H2 as the major electron donor to reduce CO2 and produce methane, include methanoarchaea in the order Methanobacteriales and Methanomicrobiales (Chaganti et 21

Chapter 2: Theoretical background on hydrogen production

al., 2012). Homoacetogens are strict anaerobes, which can consume H2 and CO2 to form acetate and include e.g. certain Clostridium spp. such as C. aceticum, C. thermoautotrophicum, C. thermoaceticum and C. stercorarium (Guo et al., 2010; Ueno et al., 2006). Their growth is typically favored at acidic pH and long hydraulic retention time ( Guo et al., 2010; Ren et al., 2007).

Microorganisms that compete with the organic substrate and are not able to produce H2 include for example lactic acid bacteria and nitrate-reducing bacteria (Bundhoo and Mohee, 2016; Cabrol et al., 2017; Ghimire et al., 2015; Mizuno et al., 1998; Wang and Wan, 2009). The presence of such microorganisms in the mixed cultures can lead to low H2 yields and increase in the formation of soluble metabolites.

Chapter 2: Theoretical background on hydrogen production

Table 2.1 Dark fermentative H2 yields obtained with selected pure cultures under different growth conditions.

Substrate concentration H yield (mol H Microbial species Mode Substrate Temperature (°C) pH 2 2 Reference (g L-1) mol-1 glucose)

Mesophiles

Enterobacter aerogenes Batch Glucose 38 6.5 10 1.0 Yokoi et al., 1995

Kumar and Das, Enterobacter cloacae Batch Glucose 36 6 10 2.2 2000

Clostridium beijerinckii Batch Glucose 35 7.2 3 2.8 Lin et al., 2007

Clostridium butyricum Batch Glucose 36 7.2 3 2.3 Lin et al., 2007

Palm oil mill Clostridium butyricum Batch 37 5.5 15─100 0.22 Chong et al., 2009a effluent

Thermophiles

Batch Glucose 70 7 10 3.4 Budde et al., 2010 Caldicellulosiruptor saccharolyticus Miscanthus Batch 72 7 28 2.4 De Vrije et al., 2009 hydrolysate

Clostridium thermocellum Batch Cellulose 60 6.8 1 1.9 Islam et al., 2009

Glucose 60 6.5 10 2.4 O-Thong et al., 2008 Thermoanaerobacterium Batch thermosaccharolyticum Xylose 60 6.5 10 2.6 Ren et al., 2008

Xylose 75 7 5 3.4 Ngo et al., 2012

Batch Glucose 75 7 10 3.5 De Vrije et al., 2010 Thermotoga neapolitana

Carrot pulp 75 7 10 2.7 De Vrije et al., 2010 hydrolysate

Chapter 2: Theoretical background on hydrogen production

2.4. Factors affecting dark fermentative H2 production 2.4.1. Temperature Changes in operating temperature can influence the substrate degradation rate and the activity of the H2 producing microorganisms (Nazlina et al., 2009). Temperature changes can also result in shifts in the metabolic pathways in a mixed culture as different organisms might become predominant at different temperatures (Dessì et al., 2018c). Increasing the temperature in dark fermentative H2 production within a range in which the H2-producing organisms are still active might help to suppress the activity of certain H2 consuming microorganisms such as methanogens thereby enhancing H2 production (Ghimire et al., 2015; Luo et al., 2011). Even though dark fermentation can occur at a wide temperature range, it has been shown that small or sudden changes in the operating temperature can cause significant changes in microbial community composition and H2 yield (Dessì et al., 2018a, 2018b; Qiu et al., 2017b). Even temporal temperature fluctuations caused by e.g. technical failures or environmental changes can lead to changes in the enzymatic activities, growth rates and/or loss of microbial diversity (El-Mashad et al., 2004; Wu et al., 2006).

Dark fermentative H2 production at high temperatures accelerates the metabolic rates and growth rates of microorganisms compared to lower temperatures (Westerholm et al., 2018). Dark fermentative H2 production at relatively high temperatures is advantageous because of low viscosity and high gas stripping as a result of low solubility of H2 gas (Chandrasekhar et al., 2015).

Furthermore, high operational temperature can help to inactivate H2 consuming microorganisms naturally present in e.g. wastewaters (Karakashev and Angelidaki, 2011). One drawback of thermophilic processes is that the energy required for heating the bioreactors may be higher than the energy gained from the produced H2 (Ketheesan and Nirmalakhandan, 2011; Lin et al., 2012; Perera et al., 2012, 2010). Thus, it is not considered economically feasible due to the energy required to maintain the high temperatures. To make the operation at high temperatures feasible, either waste heat from some other process or a very hot substrate would be required. For example, some industrial wastewaters such as thermomechanical pulp and paper wastewater which are produced at elevated temperatures as high as 50 to 70 °C can be treated on site with minimum energy requirement (Hubbe et al., 2016).

2.4.2. pH The pH of the cultivation medium has direct influence on the metabolic activities of microorganisms and thereby on H2 production (Fang and Liu, 2002; Liu et al., 2011). The optimum 24

Chapter 2: Theoretical background on hydrogen production

pH range for dark fermentative H2 production varies from pH 4.5 to 9 (La Licata et al., 2011; Lee et al., 2009; Wongthanate and Chinnacotpong, 2015). However, Mota et al. (2018) recently reported H2 production from acidogenic reactors fed with sucrose at pH below 3.0. For dark fermentative H2 production at mesophilic conditions, pH below 6 has been widely used as it inhibits the activity of methanogens which consume H2 (La Licata et al., 2011; Lee et al., 2009;

Qiu et al., 2017a). Depending on the inoculum source, thermophilic H2 production processes have been carried out at pH below 6 (Dessì et al., 2018c) or at neutral pH (Table 2.1).

In several studies, acetate and butyrate are the major end products of favorable H2 production. A neutral operational pH has been observed to mostly favor the acetate pathway, while acidic pH conditions mostly favor the butyrate pathway (Abreu et al., 2013; Ciranna et al., 2012; Karlsson et al., 2008; Prakasham et al., 2009; Zhang et al., 2015, 2014). During dark fermentative H2 production test at 37 °C, Luo et al. (2011) showed acetate as the major metabolic product at operational pH of 7, while butyrate dominated at an operational pH 5.5. A study on dark fermentation of cheese whey at different pH ranges (5.5 to 7.7) and a temperature of 39 °C showed pH 6 as the optimal pH and acetate levels were higher in all the tests except at pH 6.5 where butyrate and propionate levels exceeded those of acetate (De Gioannis et al., 2014). Nonetheless, Khanal et al. (2004) studied the effects of pH and intermediate products and submitted that acetate and butyrate levels were independent of pH in the range studied (4.5 to 6.5). Furthermore, Luo et al. (2010) reported butyrate as the major VFA in the dark fermentation of cassava stillage in both H2 production test carried out at the initial pH 5 and 7. Example of optimal pH ranges for some H2 producing organisms include pH of 7 applied for H2 production by

Thermotoga neapolitana (Maru et al., 2012) and pH of 6.5 for H2 production by Thermoanaerobacterium thermosaccharolyticum (Saripan and Reungsang, 2013).

2.4.3. H2 partial pressure

Partial pressure of H2 is an important factor in dark fermentation, as it has been shown to affect the H2 yield. High H2 partial pressure of the headspace in a bioreactor leads to increased H2 concentrations in the liquid phase (Levin et al., 2004). If the concentration of H2 produced in the dark fermentation system is too high, it makes the thermodynamics of H2 production even less advantageous and as such, can be inhibitory to H2 production process (Chong et al., 2009b; Logan et al., 2002; Nath and Das, 2004). Continuous or intermittent removal of the produced biogas lowers the H2 partial pressure and the H2 concentration in the liquid phase which typically increases the obtainable H2 yield (Bundhoo and Mohee, 2016; Lee et al., 2012; Mandal et al.,

Chapter 2: Theoretical background on hydrogen production

2006; Nath and Das, 2004). Dreschke et al. (2019) reported that high dissolved H2 concentration can significantly reduce H2 production although H2 partial pressure would not be seemingly high and that H2-rich gas can be used for stripping dissolved H2 from the culture without causing any dilution of the produced gas. Thus, the recirculation of produced H2-rich gas back to the bioreactor can be used to enhance H2 yields although the gas recirculation does not necessarily reduce the

H2 partial pressure, but reduces the H2 concentration in the liquid phase. Other methods used for lowering H2 partial pressure include increase in headspace to culture volume ratio and sparging with external gas such as CO2 (Dreschke et al., 2019). Kim et al. (2006) showed that sparging a continuously stirred tank reactor with either N2 or CO2 improved H2 production. They further compared the effectiveness of using either N2 or CO2 and reported that using CO2 improved H2 yield better than N2 (Kim et al., 2006). The use of N2 or CO2 would however lead to dilution of the produced gas and likely to increased costs of H2 recovery. Additionally, the effectiveness of gas sparging also depends on a number of factors such as the gas flow rate and the reactor configuration.

2.4.4. Substrate concentration

For dark fermentative H2 production to be economically viable, high substrate loads should be converted efficiently to H2 (Ljunggren and Zacchi, 2010). The increase in substrate concentration to a certain extent can be beneficial for enhancing H2 production. However, the limitations of using high substrate concentrations for H2 production are imminent as increased accumulation of organic acids and alcohols have inhibitory effects on H2 production (Elbeshbishy et al., 2017) as illustrated in Figure 2.6. Inhibition resulting from high substrate concentrations may lead to growth inhibition, incomplete substrate utilization and/or unwanted changes in the metabolic products (Nicolaou et al., 2010). Even though several types of substrates have been studied for dark fermentative H2 production, a vast majority of the reports are based on hexose and pentose sugars, which are often used at initial concentrations ranging from 1 to 50 g COD L-1 (Elbeshbishy et al., 2017; Guo et al., 2010; Kargi et al., 2012; Kim et al., 2006; Wang and Wan, 2008a). While, most of these studies have suggested substrate concentrations above 20 g COD L-1 to be inhibitory to H2 production, the threshold is not consistent as it may vary as a result of other factors such as inoculum characteristics and reactor configuration. Optimizing substrate concentration or the food to microorganism ratio (F/M) and the organic loading rate is necessary for preventing substrate inhibition (Ghimire et al., 2015; Mohammadi et al., 2017, 2012; Wongthanate and Chinnacotpong, 2015).

Chapter 2: Theoretical background on hydrogen production

Figure 2.3 Inhibition mechanisms induced by high substrate concentration, low pH and undissociated acids during dark fermentative H2 production (modified from Elbeshbishy et al. 2017).

2.5. Microbial strategies for optimizing dark fermentation It has been stated that in order to maximize net energy gain via dark fermentation, appropriate

H2-producing cultures capable of high H2 yield have to be employed (Chandrasekhar et al., 2015; Kumar et al., 2016). The relatively low yield and production rate obtained and the often observed

H2 production instability of mixed culture fermentation especially at mesophilic conditions are common denominators that prevent biological H2 production from becoming a practical means for industrial-scale H2 production (Cabrol et al., 2017; Chandrasekhar et al., 2015). The following sections focus on the strategies that have been employed for optimizing H2 production via dark fermentation.

2.5.1. Enrichment of H2-producers in mixed cultures

In order to obtain higher H2 yields by inactivating H2 consuming and other competing microorganisms, different pretreatment methods such as heat-shock, acid treatment, base addition, aeration, freezing and thawing, and addition of specific chemicals such as chloroform, sodium 2-bromoethanesulfonate or 2-bromoethanesulfonic acid and iodopropane have been used (for a review, see e.g. Wang and Wan, 2008b). Some of these pretreatments, including the widely-used heat treatment, select for spore-forming H2-producers (Baghchehsaraee et al., 2008; Dessì et al., 2018a; Rafieenia et al., 2018). These pretreatments have been used as a strategy to enhance H2 production. However, the most efficient/optimal pretreatment seems to depend of

Chapter 2: Theoretical background on hydrogen production

the inoculum source and the H2 producing conditions (e.g. substrate and temperature). Cheong and Hansen (2006) evaluated the different pretreatment methods (acid, sodium 2- bromoethanesulfonate, dry heat-shock and freezing and thawing) for enriching H2-producing bacteria from cattle manure sludge. They showed that H2 production from the pre-treated inocula were 1.9–9.8 times greater when compared to the control sludge. Furthermore, they concluded that the acid pretreatment method was the best among the five methods studied (Cheong and Hansen, 2006). On the other hand, Zhu and Béland (2006) studied six different pretreatment methods (acid, base, heat-shock, aeration, 2-bromoethanesulfonic acid and iodopropane) for enriching H2 producers and concluded that the base pretreatment resulted in highest H2 production. Dessì et al. (2018a) reported that the most promising pretreatment method is different for mesophilic and thermophilic cultures. They reported that at mesophilic condition, acid shock was the most optimal pretreatment while alkaline shock was optimal for enrichment of H2 producers under thermophilic conditions (Dessì et al., 2018a). Therefore, more research is needed to understand the effects of pretreatments on different microbial communities. In addition, inoculum pretreatments are not typically efficient in removing all H2 consuming homoacetogens, as spore-forming Clostridium spp. include both H2-producing and homoacetogenic species (Diekert and Wohlfarth, 1994; Hugenholtz and Ljungdahl, 1990). Thus, it is very difficult to select conditions that would promote one and inactivate the other (Cabrol et al., 2017)

H2 production can also be enhanced by controlling the operational parameters at an optimum level for H2 producing organisms, but unsuitable for most typical H2 consumers. For example, since the growth of methanogens is inhibited at pH below 6, many studies have controlled pH <6 to optimize H2 production by inhibiting the growth of methanogenic microorganisms (Cabrol et al., 2017; Luo et al., 2011; Mohan, 2008). The use of low hydraulic retention time is another strategy that has been used to optimize H2 production due to washout of the slow-growing methanogens

(Liu et al., 2008). Furthermore, H2 consumption by homoacetogens has been shown to become more favorable at high H2 partial pressure (Kotsyurbenko et al., 2001; Peters et al., 1998). Homoacetogens have also been shown to be inhibited at pH of 5.5 at thermophilic conditions (Ghimire et al., 2015; Luo et al., 2011).

2.5.2. Synthetic co-cultures

Cultivation of two or more syntrophic H2 producing microorganisms together as a synthetic co- culture is also a potential strategy to enhance substrate degradation and conversion to H2 compared to pure cultures without introducing H2 consuming organisms to the culture (for a

Chapter 2: Theoretical background on hydrogen production

review, see Laxman Pachapur et al., 2015). Synthetic co-cultures appear to be advantageous over single microorganisms because of the potential synergy between the different metabolic pathways of the species involved, leading to increased H2 yield. For example, co-cultures have the ability to improve hydrolysis of complex substrates (Elsharnouby et al., 2013). Many studies have investigated the use of co-cultures of two bacterial species, one with the capability of hydrolyzing cellulose, and the other with the ability to produce H2 efficiently from simple sugars (Abreu et al., 2016; Chen et al., 2015; Kotay and Das, 2006; Vatsala et al., 2008). For example, co-cultures of Clostridium thermocellum and Thermoanaerobacterium thermosaccharolyticum were successfully used to convert cellulose directly to H2 at 60 °C and pH of 4.4. Alone, the H2

-1 yield obtained by C. thermocellum from cellulose was about 0.8 mol H2 mol glucose, with lactate as the main product. However, when used as a co-culture with T. thermosaccharolyticum, the H2

-1 production increased about 2-fold to 1.8 mol H2 mol glucose (Liu et al., 2008). In addition, a co- culture of Citrobacter freundii and Clostridium butyricum was shown to enhance H2 production by dark fermentation compared to the respective pure cultures (Beckers et al., 2010). Given the characteristics of C. freundii as a facultative anaerobe, such a culture would not require the addition of any reducing agents as C. freundii consumes oxygen and provides the anaerobic conditions required for C. butyricum growth (Beckers et al., 2010).

2.5.3. Bioaugmentation

Apart from the natural adaptation and selection of H2 producing microbial communities to specific operational conditions, bioaugmentation of mixed cultures with pure cultures with desired metabolic characteristics has been proposed as a strategy to increase microbial biomass and diversity of indigenous microbial populations (Chandrasekhar et al., 2015; Kumar et al., 2016). Over the years, bioaugmentation has been successfully used to reduce the start-up time of dark fermentation (Pandit et al., 2015) and to help regain stable operation of biological processes after process disturbances (Goud et al., 2014; Guo et al., 2010), to enable operation at shorter hydraulic retention time (Baek et al., 2016) and to decrease the recovery time of anaerobic digesters after organic overloading (Acharya et al., 2015; Goud et al., 2014).

Bioaugmentation with known H2 producers has been studied for the improvement of H2 production performance from complex organic materials such as vegetable waste, cellulosic waste and digested sludge (Guo et al., 2010; Marone et al., 2012; Martín-Hernández et al., 2012; Sompong O‐Thong, 2017; Wang et al., 2008). For example, Escherichia coli, Enterobacter aerogenes or Bacillus subtilis were added to municipal digester sludge to study the effect of bioaugmentation

Chapter 2: Theoretical background on hydrogen production

on H2 production from organic fraction of municipal solid waste (Sharma and Melkania, 2018).

The authors reported improvement of H2 production with bioaugmentation of each three different organisms, whilst bioaugmentation with B. subtilis resulted in higher H2 production than bioaugmentation with E. coli and E. aerogenes (Sharma and Melkania, 2018). Recently, Thermoanaerobacterium thermosaccharolyticum was added to three types of seed sludge: rotten corn stover, cow dung compost, and anaerobic digester sludge, to investigate the effect of bioaugmentation on thermophilic H2 production (Zhang et al., 2019). The bioaugmentation with

5% (volume) of T. thermosaccharolyticum increased the H2 yield by 12.8%, 2.9% and 7.1% in rotten corn stover, cow dung compost and sludge from anaerobic digestion, respectively (Zhang et al., 2019). Bioaugmentation has also been shown to protect the existing microbial community from organic loading shocks or reduce the susceptibility of the H2 producing bioreactors to process fluctuations (Ács et al., 2015; Goud et al., 2014; Kuo et al., 2012; Venkata Mohan et al., 2009).

Goud et al. (2014) used acidogenic bacteria for bioaugmentation to enhance H2 production at an elevated organic loading with food waste. Fermentative bacteria capable of producing H2 were added to a native mixed microflora by Marone et al. (2012) to improve its H2 yield from vegetable waste.

Establishing synthetic interactions between species is, thus, becoming quite common in laboratory studies. However, in some cases, bioaugmentation can be unsuccessful due to the inability of the added species to compete with the indigenous microbial population under the operational conditions of the process (Chandrasekhar et al., 2015; Ferguson et al., 2014; Herrero and Stuckey, 2015; Venkata Mohan, 2009). Different species possess different growth properties (e.g. growth rates and substrate preferences) as well as different capacities to cope with stress, which arise from variations in growth conditions such as temperature and pH. Therefore, the microorganisms chosen for bioaugmentation purposes should have the desirable properties needed to perform the required function under the planned operational conditions.

2.5.4. Genetically engineered microorganisms Metabolic engineering is another optimization strategy that has been considered for dark fermentation to improve H2 production (Hallenbeck, 2013; Hallenbeck et al., 2012; Kothari, 2017).

It has been used to increase H2 production in bacteria by the causing the overexpression of certain enzymes that are responsible for H2 production and/or to block pathways that might result in H2 consumption (Abo-Hashesh et al., 2011; Hallenbeck and Ghosh, 2012; Maeda et al., 2008; Vardar-Schara et al., 2008). Metabolic engineering has received increasing attention for

Chapter 2: Theoretical background on hydrogen production

improving H2 production and application of this technique can significantly improve H2 production rate and yields (Akhtar and Jones, 2009, 2008; Ma et al., 2009; Maeda et al., 2012). But the challenge might be that tools to engineer some of the species shown to produce high H2 yields do not exist yet. An example of metabolic engineering include the study by Maeda et al. (2007) where multiple, stable mutations were introduced into Escherichia coli which allowed for increase

-1 of H2 production from 0.65 to 1.3 mol H2 mol glucose. Further studies showed that genetically modified Escherichia coli produced 68.5% more H2 from of glucose fermentation compared to the wild-type strain (Maeda et al., 2012). At the moment, continuous large-scale production of H2 from organic waste materials with genetically engineered strain(s) is not feasible due to restraints such as possible contamination, competition with endogenous microorganisms and loss of the genetically engineered strain(s) (Cabrol et al., 2017).

2.5.5. Integration of different biological H2 production processes

The combinations some of the biological H2 production processes described in section 2.2 have been studied in order to improve the overall H2 production yield and to utilize the chemical energy present in the dark fermentation effluents (Chen et al., 2008b; Hallenbeck et al., 2012; Nath et al., 2008). For example, Li et al. (2014) integrated dark fermentation with microbial electrolysis cells and obtained a H2 yield of 130 mL H2 per gram of corn stalk from dark fermentation and a yield of

257 mL H2 per gram of corn stalk by employing the fermentation effluent as feedstock in microbial electrolysis cell, thereby obtaining an overall H2 yield of 387mL H2 per gram of corn stalk. Nath and Das (2004) reported coupling of dark fermentation with photofermentation in an overall process in which glucose was used as the substrate for dark fermentation and the fermentation effluent as a substrate for Rhodobacter sphaeroides to achieve higher overall H2 yield.

Another technology under consideration includes the co-production of a mixture of H2 and CH4 known as biohythane which is carried out through a two-stage anaerobic digestion reactor configuration (Monlau et al., 2015). This technology is gaining more attention as a renewable energy carrier in the transport sector due to its energetic and environmental advantages. The presence of H2 contributes to improving the engine combustion yield as well as reduce the CO2 emissions from the combustion (Bolzonella et al., 2018; Liu et al., 2018, 2013; Roy and Das, 2016; Si et al., 2016).

Chapter 2: Theoretical background on hydrogen production

References Abo-Hashesh, M., Wang, R., Hallenbeck, P.C., 2011. Metabolic engineering in dark fermentative hydrogen production; theory and practice. Bioresour. Technol. doi:10.1016/j.biortech.2011.03.016

Abreu, a a, Mota, M., Alves, M.M., 2013. Thermotoga maritima and Caldicellulosiruptor sacharolyticus co- culture for biohydrogen production. 13th World Congr. Anaerob. Dig. 1, 2–3.

Abreu, A.A., Tavares, F., Alves, M.M., Pereira, M.A., 2016. Boosting dark fermentation with co- cultures of extreme thermophiles for biohythane production from garden waste. Bioresour. Technol. 219, 132–138. doi:10.1016/j.biortech.2016.07.096

Acharya, S.M., Kundu, K., Sreekrishnan, T.R., 2015. Improved Stability of Anaerobic Digestion through the Use of Selective Acidogenic Culture. J. Environ. Eng. doi:10.1061/(ASCE)EE.1943-7870.0000932

Ács, N., Bagi, Z., Rákhely, G., Minárovics, J., Nagy, K., Kovács, K.L., 2015. Bioaugmentation of biogas production by a hydrogen-producing bacterium. Bioresour. Technol. 186, 286–293. doi:10.1016/j.biortech.2015.02.098

Adessi, A., Torzillo, G., Baccetti, E., De Philippis, R., 2012. Sustained outdoor H2 production with Rhodopseudomonas palustris cultures in a 50 L tubular photobioreactor. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2012.01.081

Afsar, N., Özgür, E., Gürgan, M., Akköse, S., Yücel, M., Gündüz, U., Eroglu, I., 2011. Hydrogen productivity of photosynthetic bacteria on dark fermenter effluent of potato steam peels hydrolysate. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.09.096

Akhtar, M.K., Jones, P.R., 2009. Construction of a synthetic YdbK-dependent pyruvate:H2 pathway in Escherichia coli BL21(DE3). Metab. Eng. doi:10.1080/14799855.2017.1361734

Akhtar, M.K., Jones, P.R., 2008. Deletion of iscR stimulates recombinant Clostridial Fe-Fe

hydrogenase activity and H2-accumulation in Escherichia coli BL21(DE3). Appl. Microbiol. Biotechnol. doi:10.1007/s00253-008-1377-6

Alazemi, J., Andrews, J., 2015. Automotive hydrogen fuelling stations: An international review. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2015.03.085

Chapter 2: Theoretical background on hydrogen production

Andrews, J., Shabani, B., 2012. Re-envisioning the role of hydrogen in a sustainable energy economy. Int. J. Hydrogen Energy 37, 1184–1203. doi:10.1016/j.ijhydene.2011.09.137

Androga, D.D., Ozgur, E., Gunduz, U., Yucel, M., Eroglu, I., 2011. Factors affecting the long-term stability of biomass and hydrogen productivity in outdoor photofermentation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.12.054

Anh, T., Kim, M., Jun, S., 2011. High-yield biohydrogen production from biodiesel manufacturing waste by Thermotoga neapolitana. Int. J. Hydrogen Energy 36, 5836–5842. doi:10.1016/j.ijhydene.2010.11.057

Armaroli, N., Balzani, V., 2011. The hydrogen issue. ChemSusChem. doi:10.1002/cssc.201000182

Azwar, M.Y., Hussain, M.A., Abdul-Wahab, A.K., 2014. Development of biohydrogen production by photobiological, fermentation and electrochemical processes: A review. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2013.11.022

Baek, G., Kim, J., Shin, S.G., Lee, C., 2016. Bioaugmentation of anaerobic sludge digestion with iron-reducing bacteria: process and microbial responses to variations in hydraulic retention time. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-015-7018-y

Baghchehsaraee, B., Nakhla, G., Karamanev, D., Margaritis, A., Reid, G., 2008. The effect of heat pretreatment temperature on fermentative hydrogen production using mixed cultures. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2008.05.069

Ball, M., Weeda, M., 2015. The hydrogen economy - Vision or reality? Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2015.04.032

Beckers, L., Hiligsmann, S., Hamilton, C., Masset, J., Thonart, P., 2010. B A Fermentative hydrogen production by Clostridium butyricum CWBI1009 and Citrobacter freundii CWBI952 in pure and mixed cultures, Biotechnol. Agron. Soc. Environ.

Benemann, J., 1996. Hydrogen biotechnology: Progress and prospects. Nat. Biotechnol. doi:10.1038/nbt0996-1101

Benemann, J.R., 1997. Feasibility analysis of photobiological production hydrogen. Int. J. Hydrogen Energy. doi:10.1016/S0360-3199(96)00189-9

Benemann, J.R., Benemann, J.R., 2000. Hydrogen production by microalgae. J. Appl. Phycol. doi:10.1023/A:1008175112704

Chapter 2: Theoretical background on hydrogen production

Bicer, Y., Dincer, I., 2018. Clean fuel options with hydrogen for sea transportation: A life cycle approach. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2017.10.157

Bond, D.R., Lovley, D.R., 2003. Electricity production by Geobacter sulfurreducens attached to electrodes. Appl. Environ. Microbiol. doi:10.1128/AEM.69.3.1548-1555.2003

Boran, E., Özgür, E., Yücel, M., Gündüz, U., Eroglu, I., 2012. Biohydrogen production by Rhodobacter capsulatus in solar tubular photobioreactor on thick juice dark fermenter effluent. J. Clean. Prod. doi:10.1016/j.jclepro.2012.03.020

Budde, M.A.W., Mars, A.E., Bakker, R.R., Lips, S.J., de Vrije, T., Veuskens, T., Claassen, P.A.M., van Doeveren, P.F.N.M., 2010. Biohydrogen production from untreated and hydrolyzed potato steam peels by the extreme thermophiles Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.05.063

Bundhoo, M.A.Z., Mohee, R., 2016. Inhibition of dark fermentative bio-hydrogen production: A review, in: Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2016.03.057

Cabrol, L., Brandhoff, B., Hamelin, J., Trably, E., Steyer, J.P., 2015. Adaptation of acidogenic sludge to increasing glycerol concentrations for biohydrogen production 8295–8308. doi:10.1007/s00253-015-6832-6

Cabrol, L., Marone, A., Tapia-Venegas, E., Steyer, J.P., Ruiz-Filippi, G., Trably, E., 2017. Microbial ecology of fermentative hydrogen producing bioprocesses: Useful insights for driving the ecosystem function. FEMS Microbiol. Rev. doi:10.1093/femsre/fuw043

Call, D.F., Wagner, R.C., Logan, B.E., 2009. Hydrogen production by Geobacter species and a mixed consortium in a microbial electrolysis cell. Appl. Environ. Microbiol. 75, 7579–7587. doi:10.1128/AEM.01760-09

Cappelletti, M., Bucchi, G., Mendes, D.S., Alberini, A., Fedi, S., Frascari, D., 2012. Biohydrogen production from glucose , molasses and cheese whey by suspended and attached cells of four hyperthermophilic Thermotoga strains. doi:10.1002/jctb.3782

Carlozzi, P., Lambardi, M., 2009. Fed-batch operation for bio-H2production by Rhodopseudomonas palustris (strain 42OL). Renew. Energy. doi:10.1016/j.renene.2009.04.016 34

Chapter 2: Theoretical background on hydrogen production

Carver, S.M., Hulatt, C.J., Thomas, D.N., Tuovinen, O.H., 2011. Thermophilic, anaerobic co-

digestion of microalgal biomass and cellulose for H2 production. Biodegradation. doi:10.1007/s10532-010-9419-z

Chaganti, S.R., Lalman, J.A., Heath, D.D., 2012. 16S rRNA gene based analysis of the microbial diversity and hydrogen production in three mixed anaerobic cultures. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2012.02.146

Chandrasekhar, K., Lee, Y.-J., Lee, D.-W., 2015. Biohydrogen production: strategies to improve process efficiency through microbial routes. Int. J. Mol. Sci. Int. J. Mol. Sci 16, 8266–8293. doi:10.3390/ijms16048266

Chen, C.Y., Saratale, G.D., Lee, C.M., Chen, P.C., Chang, J.S., 2008a. Phototrophic hydrogen production in photobioreactors coupled with solar-energy-excited optical fibers. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2008.09.014

Chen, C.Y., Yang, M.H., Yeh, K.L., Liu, C.H., Chang, J.S., 2008b. Biohydrogen production using sequential two-stage dark and photo fermentation processes. Int. J. Hydrogen Energy 33, 4755–4762. doi:10.1016/j.ijhydene.2008.06.055

Chen, P., Wang, Yuxia, Yan, L., Wang, Yiqing, Li, S., Yan, X., Wang, N., Liang, N., Li, H., 2015. Feasibility of biohydrogen production from industrial wastes using defined microbial co- culture. Biol. Res. doi:10.1186/s40659-015-0015-x

Chen, W.-H., 2006. Biological hydrogen production by anaerobic fermentation.

Cheong, D.Y., Hansen, C.L., 2006. Bacterial stress enrichment enhances anaerobic hydrogen production in cattle manure sludge. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-006- 0313-x

Cheremisinoff, N.P., Rosenfeld, P., 2009. Handbook of pollution prevention and cleaner production - best practices in the petroleum industry, handbook of pollution prevention and cleaner production - best practices in the petroleum industry. doi:10.1016/B978-0-8155- 2035-1.10006-5

Chong, M.L., Rahim, R.A., Shirai, Y., Hassan, M.A., 2009a. Biohydrogen production by Clostridium butyricum EB6 from palm oil mill effluent. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2008.10.095

Chapter 2: Theoretical background on hydrogen production

Chong, M.L., Sabaratnam, V., Shirai, Y., Hassan, M.A., 2009b. Biohydrogen production from biomass and industrial wastes by dark fermentation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.02.010

Ciranna, A., Santala, V., Karp, M., 2012. Enhancing biohydrogen production of the alkalithermophile Thermobrachium celere. Int. J. Hydrogen Energy 37, 5550–5558. doi:10.1016/j.ijhydene.2011.12.105

Compaoré, J., Stal, L.J., 2010. Oxygen and the light-dark cycle of nitrogenase activity in two unicellular Cyanobacteria. Environ. Microbiol. doi:10.1111/j.1462-2920.2009.02034.x

Das, D., Veziroglu, T.N., 2008. Advances in biological hydrogen production processes. Int. J. Hydrogen Energy 33, 6046–6057. doi:10.1016/j.ijhydene.2008.07.098

Dasgupta, C.N., Jose Gilbert, J., Lindblad, P., Heidorn, T., Borgvang, S.A., Skjanes, K., Das, D., 2010. Recent trends on the development of photobiological processes and photobioreactors for the improvement of hydrogen production. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.06.029

De Gioannis, G., Friargiu, M., Massi, E., Muntoni, A., Polettini, A., Pomi, R., Spiga, D., 2014. Biohydrogen production from dark fermentation of cheese whey: Influence of pH. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2014.10.046

De Vrije, T., Bakker, R.R., Budde, M.A.W., Lai, M.H., Mars, A.E., Claassen, P.A.M., 2009. Efficient hydrogen production from the lignocellulosic energy crop Miscanthus by the extreme thermophilic bacteria Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana. Biotechnol. Biofuels 2, 12.

De Vrije, T., Budde, M.A.W., Lips, S.J., Bakker, R.R., Mars, A.E., Claassen, P.A.M., 2010. Hydrogen production from carrot pulp by the extreme thermophiles Caldicellulosiruptor saccharolyticus and Thermotoga neapolitana. Int. J. Hydrogen Energy 35, 13206–13213.

De Vrije, T., Mars, A.E., Budde, M.A.W., Lai, M.H., Dijkema, C., De Waard, P., Claassen, P.A.M., 2007. Glycolytic pathway and hydrogen yield studies of the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl. Microbiol. Biotechnol. 74, 1358–1367. doi:10.1007/s00253-006-0783-x

Chapter 2: Theoretical background on hydrogen production

Demirbas, M.F., 2004. Producing hydrogen from biomass via non-conventional processes. Energy Explor. Exploit. doi:10.1260/0144598042886326

Dessì, P., Porca, E., Frunzo, L., Lakaniemi, A.M., Collins, G., Esposito, G., Lens, P.N.L., 2018a. Inoculum pretreatment differentially affects the active microbial community performing mesophilic and thermophilic dark fermentation of xylose. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2018.03.117

Dessì, P., Porca, E., Lakaniemi, A.M., Collins, G., Lens, P.N.L., 2018b. Temperature control as key factor for optimal biohydrogen production from thermomechanical pulping wastewater. Biochem. Eng. J. doi:10.1016/j.bej.2018.05.027

Dessì, P., Porca, E., Waters, N.R., Lakaniemi, A.M., Collins, G., Lens, P.N.L., 2018c. Thermophilic versus mesophilic dark fermentation in xylose-fed fluidised bed reactors: Biohydrogen production and active microbial community. Int. J. Hydrogen Energy 43, 5473–5485. doi:10.1016/j.ijhydene.2018.01.158

Diekert, G., Wohlfarth, G., 1994. Metabolism of homoacetogens. Antonie Van Leeuwenhoek. doi:10.1007/BF00871640

Dreschke, G., Papirio, S., Lens, P.N.L., Esposito, G., 2019. Influence of liquid-phase hydrogen on dark fermentation by Thermotoga neapolitana. Renew. Energy.

El-Mashad, H.M., Zeeman, G., Van Loon, W.K.P., Bot, G.P.A., Lettinga, G., 2004. Effect of temperature and temperature fluctuation on thermophilic anaerobic digestion of cattle manure. Bioresour. Technol. doi:10.1016/j.biortech.2003.07.013

Elbeshbishy, E., Dhar, B.R., Nakhla, G., Lee, H.S., 2017. A critical review on inhibition of dark biohydrogen fermentation. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2017.05.075

Elsharnouby, O., Hafez, H., Nakhla, G., El Naggar, M.H., 2013. A critical literature review on biohydrogen production by pure cultures. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2013.02.032

Fang, H.H.P., Liu, H., 2002. Effect of pH on hydrogen production from glucose by a mixed culture. Bioresour. Technol. doi:10.1016/S0960-8524(01)00110-9

Ferguson, R.M.W., Villa, R., Coulon, F., 2014. Bioengineering options and strategies for the optimization of anaerobic digestion processes. Environ. Technol. 2515, 1–14. doi:10.1080/09593330.2014.907362

Chapter 2: Theoretical background on hydrogen production

Foglia, D., Wukovits, W., Friedl, A., De Vrije, T., Claassen, P.A.M., 2011. Fermentative hydrogen production: Influence of application of mesophilic and thermophilic bacteria on mass and energy balances. Chem. Eng. Trans. doi:10.3303/CET1125136

Frascari, D., Cappelletti, M., Sousa, J. De, Alberini, A., Scimonelli, F., Manfreda, C., Longanesi, L., Zannoni, D., Pinelli, D., Fedi, S., 2013. A kinetic study of biohydrogen production from glucose , molasses and cheese whey by suspended and attached cells of Thermotoga neapolitana. Bioresour. Technol. 147, 553–561. doi:10.1016/j.biortech.2013.08.047

Geelhoed, J.S., Stams, A.J.M., 2011. Electricity-assisted biological hydrogen production from acetate by Geobacter sulfurreducens. Environ. Sci. Technol. doi:10.1021/es102842p

Ghimire, A., Frunzo, L., Pirozzi, F., Trably, E., Escudie, R., Lens, P.N.L., Esposito, G., 2015. A review on dark fermentative biohydrogen production from organic biomass: Process parameters and use of by-products. Appl. Energy. doi:10.1016/j.apenergy.2015.01.045

Ghosh, S., Dairkee, U.K., Chowdhury, R., Bhattacharya, P., 2017. Hydrogen from food processing wastes via photofermentation using Purple Non-sulfur Bacteria (PNSB) – A review. Energy Convers. Manag. doi:10.1016/j.enconman.2016.09.001

Gómez, X., Fernández, C., Fierro, J., Sánchez, M.E., Escapa, A., Morán, A., 2011. Hydrogen production: Two stage processes for waste degradation. Bioresour. Technol. 102, 8621– 8627. doi:10.1016/j.biortech.2011.03.055

Goud, R.K., Sarkar, O., Chiranjeevi, P., Venkata Mohan, S., 2014. Bioaugmentation of potent acidogenic isolates: A strategy for enhancing biohydrogen production at elevated organic load. Bioresour. Technol. doi:10.1016/j.biortech.2014.03.049

Guo, J., Wang, J., Cui, D., Wang, L., Ma, F., Chang, C.C., Yang, J., 2010. Application of bioaugmentation in the rapid start-up and stable operation of biological processes for municipal wastewater treatment at low temperatures. Bioresour. Technol. doi:10.1016/j.biortech.2010.03.093

Guo, X.M., Trably, E., Latrille, E., Carrre, H., Steyer, J.P., 2010. Hydrogen production from agricultural waste by dark fermentation: A review. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.03.008

Guwy, A.J., Dinsdale, R.M., Kim, J.R., Massanet-Nicolau, J., Premier, G., 2011. Fermentative biohydrogen production systems integration. Bioresour. Technol. 102, 8534–8542. doi:10.1016/j.biortech.2011.04.051

Chapter 2: Theoretical background on hydrogen production

Hallenbeck, P.C., 2013. Photofermentative Biohydrogen Production, in: Biohydrogen. doi:10.1016/B978-0-444-59555-3.00007-6

Hallenbeck, P.C., Abo-Hashesh, M., Ghosh, D., 2012. Strategies for improving biological hydrogen production. Bioresour. Technol. 110, 1–9. doi:10.1016/j.biortech.2012.01.103

Hallenbeck, P.C., Ghosh, D., 2012. Improvements in fermentative biological hydrogen production through metabolic engineering. J. Environ. Manage. doi:10.1016/j.jenvman.2010.07.021

Harper, S.R., Pohland, F.G., 1986. Recent developments in hydrogen management during anaerobic biological wastewater treatment. Biotechnol. Bioeng. doi:10.1002/bit.260280416

Hay, J.X.W., Wu, T.Y., Juan, J.C., Md. Jahim, J., 2013. Biohydrogen production through photo fermentation or dark fermentation using waste as a substrate: Overview, economics, and future prospects of hydrogen usage. Biofuels, Bioprod. Biorefining. doi:10.1002/bbb.1403

Herrero, M., Stuckey, D.C., 2015. Bioaugmentation and its application in wastewater treatment: A review. Chemosphere. doi:10.1016/j.chemosphere.2014.10.033

Holladay, J.D., Hu, J., King, D.L., Wang, Y., 2009. An overview of hydrogen production technologies. Catal. Today 139, 244–260. doi:10.1016/j.cattod.2008.08.039

Hua, T., Ahluwalia, R., Eudy, L., Singer, G., Jermer, B., Asselin-Miller, N., Wessel, S., Patterson, T., Marcinkoski, J., 2014. Status of hydrogen fuel cell electric buses worldwide. J. Power Sources. doi:10.1016/j.jpowsour.2014.06.055

Hubbe, M.A., Metts, J.R., Hermosilla, D., Blanco, M.A., Yerushalmi, L., Haghighat, F., Lindholm- Lehto, P., Khodaparast, Z., Kamali, M., Elliott, A., 2016. Wastewater treatment and reclamation: A review of pulp and paper industry practices and opportunities. BioResources. doi:10.1016/j.seppur.2011.07.002

Hugenholtz, J., Ljungdahl, L.G., 1990. Metabolism and energy generation in homoacetogenic Clostridia. FEMS Microbiol. Lett. doi:10.1016/0378-1097(90)90483-7

Hung, C.H., Chang, Y.T., Chang, Y.J., 2011. Roles of microorganisms other than Clostridium and Enterobacter in anaerobic fermentative biohydrogen production systems - A review. Bioresour. Technol. doi:10.1016/j.biortech.2011.02.084

Ippolito, G., Dipasquale, L., Vella, F.M., Romano, I., Gambacorta, A., Cutignano, A., Fontana, A., 2010. Hydrogen metabolism in the extreme thermophile Thermotoga neapolitana. Int. J. Hydrogen Energy 35, 2290–2295. doi:10.1016/j.ijhydene.2009.12.044 39

Chapter 2: Theoretical background on hydrogen production

Islam, R., Cicek, N., Sparling, R., Levin, D., 2009. Influence of initial cellulose concentration on the carbon flow distribution during batch fermentation by Clostridium thermocellum ATCC 27405. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-008-1763-0

Kadier, A., Kalil, M.S., Abdeshahian, P., Chandrasekhar, K., Mohamed, A., Azman, N.F., Logroño, W., Simayi, Y., Hamid, A.A., 2016. Recent advances and emerging challenges in microbial electrolysis cells (MECs) for microbial production of hydrogen and value-added chemicals. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2016.04.017

Kalamaras, C.M., Efstathiou, a. M., 2013. Hydrogen production technologies: current state and future developments. Conf. Pap. Energy. doi:10.1155/2013/690627

Kapdan, I.K., Kargi, F., 2006. Bio-hydrogen production from waste materials. Enzyme Microb. Technol. doi:10.1016/j.enzmictec.2005.09.015

Karadag, D., Puhakka, J.A., 2010. Effect of changing temperature on anaerobic hydrogen production and microbial community composition in an open-mixed culture bioreactor. Int. J. Hydrogen Energy 35, 10954–10959. doi:10.1016/j.ijhydene.2010.07.070

Karakashev, D., Angelidaki, I., 2011. Thermophilic biohydrogen production, in: Biofuels. doi:10.1016/B978-0-12-385099-7.00024-3

Kargi, F., Eren, N.S., Ozmihci, S., 2012. Bio-hydrogen production from cheese whey powder (CWP) solution: Comparison of thermophilic and mesophilic dark fermentations. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2012.02.162

Karlsson, A., Vallin, L., Ejlertsson, J., 2008. Effects of temperature, hydraulic retention time and hydrogen extraction rate on hydrogen production from the fermentation of food industry residues and manure. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2007.10.055

Keskin, T., Abo-Hashesh, M., Hallenbeck, P.C., 2011. Photofermentative hydrogen production from wastes. Bioresour. Technol. doi:10.1016/j.biortech.2011.04.004

Ketheesan, B., Nirmalakhandan, N., 2011. Improving net energy gain in fermentative biohydrogen production from glucose. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.06.074

Khanal, S.K., Chen, W.H., Li, L., Sung, S., 2004. Biological hydrogen production: Effects of pH and intermediate products. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2003.11.002

Khanna, N., Das, D., 2013. Biohydrogen production by dark fermentation. Wiley Interdiscip. Rev. Energy Environ. doi:10.1002/wene.15

Chapter 2: Theoretical background on hydrogen production

Khanna, N., Kotay, S.M., Gilbert, J.J., Das, D., 2011. Improvement of biohydrogen production by Enterobacter cloacae IIT-BT 08 under regulated pH. J. Biotechnol. doi:10.1016/j.jbiotec.2010.12.014

Kim, D.H., Han, S.K., Kim, S.H., Shin, H.S., 2006. Effect of gas sparging on continuous fermentative hydrogen production. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2006.02.012

Kim, J.K., Nhat, L., Chun, Y.N., Kim, S.W., 2008. Hydrogen production conditions from food waste by dark fermentation with Clostridium beijerinckii KCTC 1785. Biotechnol. Bioprocess Eng. 13, 499–504. doi:10.1007/s12257-008-0142-0

Kim, S.H., Han, S.K., Shin, H.S., 2006. Effect of substrate concentration on hydrogen production and 16S rDNA-based analysis of the microbial community in a continuous fermenter. Process Biochem. doi:10.1016/j.procbio.2005.06.013

Koskinen, P. E P, Beck, S.R., Örlygsson, J., Puhakka, J.A., 2008. Ethanol and hydrogen production by two thermophilic, anaerobic bacteria isolated from Icelandic geothermal areas. Biotechnol. Bioeng. 101, 679–690. doi:10.1002/bit.21942

Koskinen, Perttu E P, Lay, C.H., Beck, S.R., Tolvanen, K.E.S., Kaksonen, A.H., Örlygsson, J., Lin, C.Y., Puhakka, J.A., 2008. Bioprospecting thermophilic microorganisms from icelandic hot springs for hydrogen and ethanol production, in: Energy and Fuels. pp. 134– 140. doi:10.1021/ef700275w

Kotay, S.M., Das, D., 2006. Feasibility of biohydrogen production from sewage sludge using defined microbial consortium. Whec 16.

Kothari, R., 2017. A critical review on factors influencing fermentative hydrogen production. Front. Biosci. doi:10.2741/4542

Kotsyurbenko, O.R., Glagolev, M. V., Nozhevnikova, A.N., Conrad, R., 2001. Competition between homoacetogenic bacteria and methanogenic archaea for hydrogen at low temperature. FEMS Microbiol. Ecol. doi:10.1016/S0168-6496(01)00179-9

Kumar, G., Bakonyi, P., Kobayashi, T., Xu, K.Q., Sivagurunathan, P., Kim, S.H., Buitrón, G., Nemestóthy, N., Bélafi-Bakó, K., 2016. Enhancement of biofuel production via microbial augmentation: The case of dark fermentative hydrogen. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2015.12.107

Chapter 2: Theoretical background on hydrogen production

Kumar, G., Bakonyi, P., Sivagurunathan, P., Kim, S.H., Nemestóthy, N., Bélafi-Bakó, K., Lin, C.Y., 2015. Enhanced biohydrogen production from beverage industrial wastewater using external nitrogen sources and bioaugmentation with facultative anaerobic strains. J. Biosci. Bioeng. doi:10.1016/j.jbiosc.2014.12.011

Kumar, N., Das, D., 2000. Enhancement of hydrogen production by Enterobacter cloacae IIT-BT 08. Process Biochem. doi:10.1016/S0032-9592(99)00109-0

Kumar, P., Patel, S.K.S., Lee, J.K., Kalia, V.C., 2013. Extending the limits of Bacillus for novel biotechnological applications. Biotechnol. Adv. doi:10.1016/j.biotechadv.2013.08.007

Kuo, W.C., Chao, Y.C., Wang, Y.C., Cheng, S.S., 2012. Bioaugmentation strategies to improve cellulolytic and hydrogen producing characteristics in CSTR intermittent fed with vegetable kitchen waste and napiergrass, in: Energy Procedia. pp. 82–91. doi:10.1016/j.egypro.2012.09.011

La Licata, B., Sagnelli, F., Boulanger, A., Lanzini, A., Leone, P., Zitella, P., Santarelli, M., 2011. Bio-hydrogen production from organic wastes in a pilot plant reactor and its use in a SOFC. Int. J. Hydrogen Energy 36, 7861–7865. doi:10.1016/j.ijhydene.2011.01.096

Laxman Pachapur, V., Jyoti Sarma, S., Kaur Brar, S., Le Bihan, Y., Ricardo Soccol, C., Buelna, G., Verma, M., 2015. Co-culture strategies for increased biohydrogen production. Int. J. Energy Res. doi:10.1002/er.3364

Lee, D.J., Wang, Y., Zhang, Z., Lee, D.J., Zhou, X., Jing, Y., Jiang, D., Hu, J., He, C., 2017. Photo- fermentative hydrogen production from crop residue: A mini review. Bioresour. Technol. doi:10.1016/j.biortech.2017.01.008

Lee, K.S., Tseng, T.S., Liu, Y.W., Hsiao, Y.D., 2012. Enhancing the performance of dark fermentative hydrogen production using a reduced pressure fermentation strategy, in: International Journal of Hydrogen Energy. doi:10.1016/j.ijhydene.2012.04.039

Lee, M.-J., Song, J.-H., Hwang, S.-J., 2009. Effects of acid pre-treatment on bio-hydrogen production and microbial communities during dark fermentation. Bioresour. Technol. 100, 1491–3. doi:10.1016/j.biortech.2008.08.019

Levin, D.B., Pitt, L., Love, M., 2004. Biohydrogen production: Prospects and limitations to practical application. Int. J. Hydrogen Energy. doi:10.1016/S0360-3199(03)00094-6

Chapter 2: Theoretical background on hydrogen production

Li, C., Fang, H.H.P., 2007. Fermentative Hydrogen Production From Wastewater and Solid Wastes by Mixed Cultures. Crit. Rev. Environ. Sci. Technol. doi:10.1080/10643380600729071

Li, X.H., Liang, D.W., Bai, Y.X., Fan, Y.T., Hou, H.W., 2014. Enhanced H2 production from corn stalk by integrating dark fermentation and single chamber microbial electrolysis cells with double anode arrangement. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2014.03.065

Lin, C.Y., Lay, C.H., Sen, B., Chu, C.Y., Kumar, G., Chen, C.C., Chang, J.S., 2012. Fermentative hydrogen production from wastewaters: A review and prognosis, in: International Journal of Hydrogen Energy. doi:10.1016/j.ijhydene.2012.02.072

Lin, P.Y., Whang, L.M., Wu, Y.R., Ren, W.J., Hsiao, C.J., Li, S.L., Chang, J.S., 2007. Biological hydrogen production of the genus Clostridium: Metabolic study and mathematical model simulation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2006.12.009

Liu, D., Zeng, R.J., Angelidaki, I., 2008. Effects of pH and hydraulic retention time on hydrogen production versus methanogenesis during anaerobic fermentation of organic household solid waste under extreme-thermophilic temperature (70°C). Biotechnol. Bioeng. doi:10.1002/bit.21834

Liu, H., Grot, S., Logan, B.E., 2005. Electrochemically assisted microbial production of hydrogen from acetate. Environ. Sci. Technol. doi:10.1021/es050244p

Liu, I.C., Whang, L.M., Ren, W.J., Lin, P.Y., 2011. The effect of pH on the production of biohydrogen by Clostridia: thermodynamic and metabolic considerations. Int. J. Hydrogen Energy 36, 439–449. doi:10.1016/j.ijhydene.2010.10.045

Liu, W., Huang, S., Zhou, A., Zhou, G., Ren, N., Wang, A., Zhuang, G., 2012. Hydrogen generation in microbial electrolysis cell feeding with fermentation liquid of waste activated sludge, in: Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2012.04.090

Liu, Y., Yu, P., Song, X., Qu, Y., 2008. Hydrogen production from cellulose by co-culture of Clostridium thermocellum JN4 and Thermoanaerobacterium thermosaccharolyticum GD17. Int. J. Hydrogen Energy 33, 2927–2933. doi:10.1016/j.ijhydene.2008.04.004

Chapter 2: Theoretical background on hydrogen production

Liu, Z., Zhang, C., Lu, Y., Wu, X., Wang, Lang, Wang, Linjun, Han, B., Xing, X.H., 2013. States and challenges for high-value biohythane production from waste biomass by dark fermentation technology. Bioresour. Technol. doi:10.1016/j.biortech.2012.10.027

Ljunggren, M., Zacchi, G., 2010. Techno-economic analysis of a two-step biological process producing hydrogen and methane. Bioresour. Technol. doi:10.1016/j.biortech.2010.05.009

Logan, B.E., Call, D., Cheng, S., Hamelers, H.V.M., Sleutels, T.H.J.A., Jeremiasse, A.W., Rozendal, R.A., 2008. Microbial electrolysis cells for high yield hydrogen gas production from organic matter. Environ. Sci. Technol. doi:10.1021/es801553z

Logan, B.E., Oh, S.E., Kim, I.S., Van Ginkel, S., 2002. Biological hydrogen production measured in batch anaerobic respirometers. Environ. Sci. Technol. 36, 2530–2535. doi:10.1021/es015783i

Luo, G., Karakashev, D., Xie, L., Zhou, Q., Angelidaki, I., 2011. Long-term effect of inoculum pretreatment on fermentative hydrogen production by repeated batch cultivations: Homoacetogenesis and methanogenesis as competitors to hydrogen production. Biotechnol. Bioeng. doi:10.1002/bit.23122

Luo, G., Xie, L., Zou, Z., Zhou, Q., Wang, J.Y., 2010. Fermentative hydrogen production from cassava stillage by mixed anaerobic microflora: Effects of temperature and pH. Appl. Energy. doi:10.1016/j.apenergy.2010.07.004

Ma, F., Guo, J., Zhao, L., Chang, C., Cui, D., 2009. Application of bioaugmentation to improve the activated sludge system into the contact oxidation system treating petrochemical wastewater. Bioresour. Technol. 100, 597–602.

Maeda, T., Sanchez-Torres, V., Wood, T.K., 2012. Hydrogen production by recombinant Escherichia coli strains. Microb. Biotechnol. doi:10.1111/j.1751-7915.2011.00282.x

Maeda, T., Sanchez-Torres, V., Wood, T.K., 2008. Metabolic engineering to enhance bacterial hydrogen production. Microb. Biotechnol. 1, 30–39. doi:10.1111/j.1751- 7915.2007.00003.x

Maeda, T., Sanchez-Torres, V., Wood, T.K., 2007. Enhanced hydrogen production from glucose by metabolically engineered Escherichia coli. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-007-1217-0

Chapter 2: Theoretical background on hydrogen production

Mandal, B., Nath, K., Das, D., 2006. Improvement of biohydrogen production under decreased

partial pressure of H2 by Enterobacter cloacae. Biotechnol. Lett. doi:10.1007/s10529-006- 9008-8

Marone, A., Massini, G., Patriarca, C., Signorini, A., Varrone, C., Izzo, G., 2012. Hydrogen production from vegetable waste by bioaugmentation of indigenous fermentative communities. Int. J. Hydrogen Energy 37, 5612–5622. doi:10.1016/j.ijhydene.2011.12.159

Martín-Hernández, M., Suárez-Ojeda, M.E., Carrera, J., 2012. Bioaugmentation for treating transient or continuous p-nitrophenol shock loads in an aerobic sequencing batch reactor. Bioresour. Technol. 123, 150–156. doi:10.1016/j.biortech.2012.07.014

Maru, B.T., Bielen, A.A.M., Kengen, S.W.M., Constantí, M., Medinaa, F., 2012. Biohydrogen production from glycerol using Thermotoga spp, in: Energy Procedia. pp. 300–307. doi:10.1016/j.egypro.2012.09.036

Masset, J., Calusinska, M., Hamilton, C., Hiligsmann, S., Joris, B., Wilmotte, A., Thonart, P., 2012. Fermentative hydrogen production from glucose and starch using pure strains and artificial co-cultures of Clostridium spp . 1–15.

Meshulam-Simon, G., Behrens, S., Choo, A.D., Spormann, A.M., 2007. Hydrogen metabolism in Shewanella oneidensis MR-1. Appl. Environ. Microbiol. doi:10.1128/AEM.01588-06

Mizuno, O., Li, Y.Y., Noike, T., 1998. The behavior of sulfate-reducing bacteria in acidogenic phase of anaerobic digestion. Water Res. doi:10.1016/S0043-1354(97)00372-2

Mohammadi, P., Ibrahim, S., Annuar, M.S.M., Ghafari, S., Vikineswary, S., Zinatizadeh, A.A., 2012. Influences of Environmental and Operational Factors on Dark Fermentative Hydrogen Production: A Review. Clean - Soil, Air, Water. doi:10.1002/clen.201100007

Mohammadi, P., Ibrahim, S., Annuar, M.S.M., Khashij, M., Mousavi, S.A., Zinatizadeh, A., 2017. Optimization of fermentative hydrogen production from palm oil mill effluent in an up-flow anaerobic sludge blanket fixed film bioreactor. Sustain. Environ. Res. doi:10.1016/j.serj.2016.04.015

Mohan, S.V., 2008. Fermentative hydrogen production with simultaneous wastewater treatment: Influence of pretreatment and system operating conditions. J. Sci. Ind. Res. (India).

Monlau, F., Kaparaju, P., Trably, E., Steyer, J.-P., Carrere, H., 2015. Alkaline pretreatment to

enhance one-stage CH4 and two-stage H2/CH4 production from sunflower stalks: mass, energy and economical balances. Chem. Eng. J. 260, 377–385. 45

Chapter 2: Theoretical background on hydrogen production

Moreno, R., Escapa, A., Cara, J., Carracedo, B., Gómez, X., 2015. A two-stage process for hydrogen production from cheese whey: Integration of dark fermentation and biocatalyzed electrolysis. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2014.10.120

Mota, V.T., Ferraz Júnior, A.D.N., Trably, E., Zaiat, M., 2018. Biohydrogen production at pH below 3.0: Is it possible? Water Res. doi:10.1016/j.watres.2017.10.060

Muradov, N.Z., Veziroǧlu, T.N., 2005. From hydrocarbon to hydrogen-carbon to hydrogen economy. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2004.03.033

Nath, K., Das, D., 2004. Improvement of fermentative hydrogen production: Various approaches. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-004-1644-0

Nath, K., Muthukumar, M., Kumar, A., Das, D., 2008. Kinetics of two-stage fermentation process for the production of hydrogen. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2007.12.011

Nazlina, H.M.Y., Nor Aini, A.R., Ismail, F., Yusof, M.Z.M., Hassan, M.A., 2009. Effect of Different Temperature, Initial pH and Substrate Composition on Biohydrogen Production from Food Waste in Batch Fermentation. Asian J. Biotechnol. 1, 9. doi:10.3923/ajbkr.2009.42.50

Ngo, T.A., Nguyen, T.H., Bui, H.T.V., 2012. Thermophilic fermentative hydrogen production from xylose by Thermotoga neapolitana DSM 4359. Renew. Energy 37, 174–179. doi:10.1016/j.renene.2011.06.015

Nguyen, T.A.D., Pyo Kim, J., Sun Kim, M., Kwan Oh, Y., Sim, S.J., 2008. Optimization of hydrogen production by hyperthermophilic eubacteria, Thermotoga maritima and Thermotoga neapolitana in batch fermentation. Int. J. Hydrogen Energy 33, 1483–1488. doi:10.1016/j.ijhydene.2007.09.033

Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T., 2010. A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab. Eng. doi:10.1016/j.ymben.2010.03.004

Nissilä, M.E., Tähti, H.P., Rintala, J.A., Puhakka, J.A., 2011. Thermophilic hydrogen production from cellulose with rumen fluid enrichment cultures: Effects of different heat treatments. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.11.010

Chapter 2: Theoretical background on hydrogen production

O-Thong, S., Prasertsan, P., Karakashev, D., Angelidaki, I., 2008. Thermophilic fermentative hydrogen production by the newly isolated Thermoanaerobacterium thermosaccharolyticum PSU-2. Int. J. Hydrogen Energy 33, 1204–1214. doi:10.1016/j.ijhydene.2007.12.015

Oh, Y.K., Seol, E.H., Kim, M.S., Park, S., 2004. Photoproduction of hydrogen from acetate by a chemoheterotrophic bacterium Rhodopseudomonas palustris P4. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2003.11.008

Özgür, E., Mars, A.E., Peksel, B., Louwerse, A., Yücel, M., Gündüz, U., Claassen, P.A.M., Eroǧlu, I., 2010. Biohydrogen production from beet molasses by sequential dark and photofermentation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.10.094

Özgür, E., Peksel, B., 2013. Biohydrogen production from barley straw hydrolysate through sequential dark and photofermentation. J. Clean. Prod. doi:10.1016/j.jclepro.2013.02.035

Pandit, S., Khilari, S., Roy, S., Ghangrekar, M.M., Pradhan, D., Das, D., 2015. Reduction of start- up time through bioaugmentation process in microbial fuel cells using an isolate from dark fermentative spent media fed anode. Water Sci. Technol. doi:10.2166/wst.2015.174

Patel, S.K.S., Kumar, P., Mehariya, S., Purohit, H.J., Lee, J.K., Kalia, V.C., 2014. Enhancement in hydrogen production by co-cultures of Bacillus and Enterobacter. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2014.07.084

Pawar, S.S., van Niel, E.W.J., 2013. Thermophilic biohydrogen production: how far are we? Appl. Microbiol. Biotechnol. 97, 7999–8009. doi:10.1007/s00253-013-5141-1

Perera, K.R.J., Ketheesan, B., Arudchelvam, Y., Nirmalakhandan, N., 2012. Fermentative biohydrogen production II: Net energy gain from organic wastes. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.09.042

Perera, K.R.J., Ketheesan, B., Gadhamshetty, V., Nirmalakhandan, N., 2010. Fermentative biohydrogen production: Evaluation of net energy gain. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2010.08.037

Peters, V., Janssen, P.H., Conrad, R., 1998. Efficiency of hydrogen utilization during unitrophic and mixotrophic growth of Acetobacterium woodii on hydrogen and lactate in the chemostat. FEMS Microbiol. Ecol. doi:10.1016/S0168-6496(98)00047-6

Chapter 2: Theoretical background on hydrogen production

Prakasham, R.S., Brahmaiah, P., Sathish, T., Sambasiva Rao, K.R.S., 2009. Fermentative biohydrogen production by mixed anaerobic consortia: Impact of glucose to xylose ratio. Int. J. Hydrogen Energy 34, 9354–9361. doi:10.1016/j.ijhydene.2009.09.104

Qiu, C., Shi, P., Xiao, S., Sun, L., 2017a. Effects of pH and substrate concentrations on dark fermentative biohydrogen production from xylose by extreme thermophilic mixed culture. World J. Microbiol. Biotechnol. 33. doi:10.1007/s11274-016-2178-1

Qiu, C., Yuan, P., Sun, L., Wang, S., Lo, S., Zhang, D., 2017b. Effect of fermentation temperature on hydrogen production from xylose and the succession of hydrogen-producing microflora. J. Chem. Technol. Biotechnol. 92, 1990–1997. doi:10.1002/jctb.5190

Qiu, C., Zheng, Y., Zheng, J., Liu, Y., Xie, C., Sun, L., 2016. Mesophilic and Thermophilic Biohydrogen Production from Xylose at Various Initial pH and Substrate Concentrations with Microflora Community Analysis. Energy and Fuels 30, 1013–1019. doi:10.1021/acs.energyfuels.5b02143

Rafieenia, R., Lavagnolo, M.C., Pivato, A., 2018. Pre-treatment technologies for dark fermentative hydrogen production: Current advances and future directions. Waste Manag. doi:10.1016/j.wasman.2017.05.024

Rahman, S.N.A., Masdar, M.S., Rosli, M.I., Majlan, E.H., Husaini, T., Kamarudin, S.K., Daud, W.R.W., 2016. Overview biohydrogen technologies and application in fuel cell technology. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2016.07.047

Ramírez-Morales, J.E., Tapia-Venegas, E., Toledo-Alarcón, J., Ruiz-Filippi, G., 2015. Simultaneous production and separation of biohydrogen in mixed culture systems by continuous dark fermentation. Water Sci. Technol. doi:10.2166/wst.2015.104

Ren, N., Cao, G., Wang, A., Lee, D.J., Guo, W., Zhu, Y., 2008. Dark fermentation of xylose and glucose mix using isolated Thermoanaerobacterium thermosaccharolyticum W16. Int. J. Hydrogen Energy 33, 6124–6132. doi:10.1016/j.ijhydene.2008.07.107

Ren, N., Xing, D., Rittmann, B.E., Zhao, L., Xie, T., Zhao, X., 2007. Microbial community structure of ethanol type fermentation in bio-hydrogen production. Environ. Microbiol. doi:10.1111/j.1462-2920.2006.01234.x

Rittmann, S., Herwig, C., 2012. A comprehensive and quantitative review of dark fermentative biohydrogen production. Microb. Cell Fact. doi:10.1186/1475-2859-11-115

Chapter 2: Theoretical background on hydrogen production

Roy, S., Das, D., 2016. Biohythane production from organic wastes: present state of art. Environ. Sci. Pollut. Res. doi:10.1007/s11356-015-5469-4

Rozendal, R.A., Hamelers, H.V.M., Euverink, G.J.W., Metz, S.J., Buisman, C.J.N., 2006. Principle and perspectives of hydrogen production through biocatalyzed electrolysis. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2005.12.006

Sabourin-Provost, G., Hallenbeck, P.C., 2009. High yield conversion of a crude glycerol fraction from biodiesel production to hydrogen by photofermentation. Bioresour. Technol. doi:10.1016/j.biortech.2009.03.027

Saripan, A.F., Reungsang, A., 2013. Biohydrogen production by Thermoanaerobacterium thermosaccharolyticum KKU-ED1: Culture conditions optimization using mixed xylose/arabinose as substrate. Electron. J. Biotechnol. 16, 1.

Schütz, K., Happe, T., Troshina, O., Lindblad, P., Leitão, E., Oliveira, P., Tamagnini, P., 2004.

Cyanobacterial H2 production — a comparative analysis. Planta 218, 350–359. doi:10.2307/23388262

Sen, U., Shakdwipee, M., Banerjee, R., 2008. Status of Biological hydrogen production. Ind. Res. doi:10.1021/ie061307v

Sharma, P., Melkania, U., 2018. Effect of bioaugmentation on hydrogen production from organic fraction of municipal solid waste. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2018.03.031

Sharma, S., Ghoshal, S.K., 2015. Hydrogen the future transportation fuel: From production to applications. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2014.11.093

Show, K.Y., Zhang, Z.P., Tay, J.H., Liang, D.T., Lee, D.J., Ren, N., Wang, A., 2010. Critical assessment of anaerobic processes for continuous biohydrogen production from organic wastewater. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.11.110

Singh, A., Sevda, S., Abu Reesh, I.M., Vanbroekhoven, K., Rathore, D., Pant, D., 2015. Biohydrogen production from lignocellulosic biomass: Technology and sustainability. Energies. doi:10.3390/en81112358

Chapter 2: Theoretical background on hydrogen production

Sinha, P., Pandey, A., 2011. An evaluative report and challenges for fermentative biohydrogen production. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.03.077

Sompong O‐Thong, 2017. Microbial Population Optimization for Control and Improvement of Dark Hydrogen Fermentation, in: Fermentation Processes. p. 310. doi:10.5772/61924

Taherdanak, M., Zilouei, H., Karimi, K., 2015. Investigating the effects of iron and nickel nanoparticles on dark hydrogen fermentation from starch using central composite design. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2015.08.004

Tapia-Venegas, E., Ramirez-Morales, J.E., Silva-Illanes, F., Toledo-Alarcón, J., Paillet, F., Escudie, R., Lay, C.H., Chu, C.Y., Leu, H.J., Marone, A., Lin, C.Y., Kim, D.H., Trably, E., Ruiz-Filippi, G., 2015. Biohydrogen production by dark fermentation: scaling-up and technologies integration for a sustainable system. Rev. Environ. Sci. Biotechnol. doi:10.1007/s11157-015-9383-5

Tawfiki Hajji, K., Lépine, F., Bisaillon, J.G., Beaudet, R., Hawari, J., Guiot, S.R., 2000. Effects of bioaugmentation strategies in UASB reactors with a methanogenic consortium for removal of phenolic compounds. Biotechnol. Bioeng. 67, 417–423. doi:10.1002/(SICI)1097- 0290(20000220)67:4<417::AID-BIT5>3.0.CO;2-#

Ueno, Y., Haruta, S., Ishii, M., Igarashi, Y., 2001. Microbial community in anaerobic hydrogen- producing microflora enriched from sludge compost. Appl. Microbiol. Biotechnol. 57, 555– 562. doi:10.1007/s002530100806

Ueno, Y., Sasaki, D., Fukui, H., Haruta, S., Ishii, M., Igarashi, Y., 2006. Changes in bacterial community during fermentative hydrogen and acid production from organic waste by thermophilic anaerobic microflora. J. Appl. Microbiol. 101, 331–343.

US Department of Energy, 2013. Report of the Hydrogen Production Expert Panel : A Subcommittee of the Hydrogen & Fuel Cell Technical Advisory Committee. DoE Fuel Cell Technol. Off.

Van Groenestijn, J.W., Geelhoed, J.S., Goorissen, H.P., Meesters, K.P.M., Stams, A.J.M., Claassen, P.A.M., 2009. Performance and population analysis of a non-sterile trickle bed reactor inoculated with Caldicellulosiruptor saccharolyticus, a thermophilic hydrogen producer. Biotechnol. Bioeng. doi:10.1002/bit.22185

Vardar-Schara, G., Maeda, T., Wood, T.K., 2008. Metabolically engineered bacteria for producing hydrogen via fermentation. Microb. Biotechnol. doi:10.1111/j.1751-7915.2007.00009.x

Chapter 2: Theoretical background on hydrogen production

Vatsala, T.M., Raj, S.M., Manimaran, A., 2008. A pilot-scale study of biohydrogen production from distillery effluent using defined bacterial co-culture. Int. J. Hydrogen Energy 33, 5404– 5415. doi:10.1016/j.ijhydene.2008.07.015

Venkata Mohan, S., 2009. Harnessing of biohydrogen from wastewater treatment using mixed fermentative consortia: Process evaluation towards optimization. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.05.062

Venkata Mohan, S., Falkentoft, C., Venkata Nancharaiah, Y., Sturm, B.S.M., Wattiau, P., Wilderer, P.A., Wuertz, S., Hausner, M., 2009. Bioaugmentation of microbial communities in laboratory and pilot scale sequencing batch biofilm reactors using the TOL plasmid. Bioresour. Technol. 100, 1746–1753. doi:10.1016/j.biortech.2008.09.048

Verhaart, M.R. a, Bielen, A. a M., van der Oost, J., Stams, A.J.M., Kengen, S.W.M., 2010. Hydrogen production by hyperthermophilic and extremely thermophilic bacteria and archaea: mechanisms for reductant disposal. Environ. Technol. 31, 993–1003. doi:10.1080/09593331003710244

Vijayaraghavan, K., Mohd Soom, M.A., 2006. Trends in bio-hydrogen generation – A review. Environ. Sci. doi:10.1080/15693430601049660

Wang, A., Cao, G., Liu, W., Engineering/Biotechnology, A. in B., 2012. Biohydrogen Production from Anaerobic Fermentation. Biohydrogen Prod. from Anaerob. Ferment. China III Biofuels Bioenergy 128, 143–163. doi:10.1007/10_2011_123

Wang, A., Ren, N., Shi, Y., Lee, D.-J., 2008. Bioaugmented hydrogen production from microcrystalline cellulose using co-culture—Clostridium acetobutylicum X9 and Ethanoigenens harbinense B49. Int. J. Hydrogen Energy 33, 912–917. doi:10.1016/j.ijhydene.2007.10.017

Wang, J., Wan, W., 2009. Factors influencing fermentative hydrogen production: A review. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2008.11.015

Wang, J., Wan, W., 2008a. The effect of substrate concentration on biohydrogen production by using kinetic models. Sci. China, Ser. B Chem. doi:10.1007/s11426-008-0104-6

Wang, J., Wan, W., 2008b. Comparison of different pretreatment methods for enriching hydrogen- producing bacteria from digested sludge. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2008.03.048

Chapter 2: Theoretical background on hydrogen production

Westerholm, M., Isaksson, S., Karlsson Lindsjö, O., Schnürer, A., 2018. Microbial community adaptability to altered temperature conditions determines the potential for process optimisation in biogas production. Appl. Energy. doi:10.1016/j.apenergy.2018.06.045

Wicher, E., Wodarczak, M., aniecki, M., Thiel, M., Seifert, K., 2012. Microbiological Methods of Hydrogen Generation, in: Biogas. doi:10.5772/33563

Willquist, K., Zeidan, A.A., van Niel, E.W., 2010. Physiological characteristics of the extreme thermophile Caldicellulosiruptor saccharolyticus: an efficient hydrogen cell factory. Microb. Cell Fact. 9, 89. doi:10.1186/1475-2859-9-89

Wongthanate, J., Chinnacotpong, K., 2015. Optimal conditions for biological hydrogen production from food waste. Environ. Eng. Res. doi:10.4491/eer.2013.104

Wu, S.Y., Hung, C.H., Lin, C.N., Chen, H.W., Lee, A.S., Chang, J.S., 2006. Fermentative hydrogen production and bacterial community structure in high-rate anaerobic bioreactors containing silicone-immobilized and self-flocculated sludge. Biotechnol. Bioeng. 93, 934– 946. doi:10.1002/bit.20800

Yang, S.T., 2007. Bioprocessing for Value-Added Products from Renewable Resources, Bioprocessing for Value-Added Products from Renewable Resources. doi:10.1016/B978- 0-444-52114-9.X5000-2

Yang, Z., Guo, R., Shi, X., He, S., Wang, L., Dai, M., Qiu, Y., Dang, X., 2016. Bioaugmentation of Hydrogenispora ethanolica LX-B affects hydrogen production through altering indigenous bacterial community structure. Bioresour. Technol. 211, 319–326. doi:10.1016/j.biortech.2016.03.097

Yokoi, H., Ohkawara, T., Hirose, J., Hayashi, S., Takasaki, Y., 1995. Characteristics of hydrogen production by aciduric Enterobacter aerogenes strain HO-39. J. Ferment. Bioeng. doi:10.1016/0922-338X(96)87733-6

Yokoyama, Hiroshi, Waki, M., Moriya, N., Yasuda, T., Tanaka, Y., Haga, K., 2007. Effect of fermentation temperature on hydrogen production from cow waste slurry by using anaerobic microflora within the slurry. Appl. Microbiol. Biotechnol. doi:10.1007/s00253- 006-0647-4

Yokoyama, H, Waki, M., Ogino, A., Ohmori, H., Tanaka, Y., 2007. Hydrogen fermentation properties of undiluted cow dung. J. Biosci. Bioeng. doi:Doi 10.1263/Jbb.104.82

Chapter 2: Theoretical background on hydrogen production

Yu, J., Takahashi, P., 2007. Biophotolysis-based hydrogen production by Cyanobacteria and green microalgae. Commun. Curr. Res. Educ. Top. trends Appl. Microbiol. 1, 79–89.

Zhang, F., Chen, Y., Dai, K., Shen, N., Zeng, R.J., 2015. The glucose metabolic distribution in thermophilic (55 °c) mixed culture fermentation: A chemostat study. Int. J. Hydrogen Energy 40, 919–926. doi:10.1016/j.ijhydene.2014.11.098

Zhang, F., Chen, Y., Dai, K., Zeng, R.J., 2014. The chemostat study of metabolic distribution in extreme-thermophilic (70 °C) mixed culture fermentation. Appl. Microbiol. Biotechnol. 98, 10267–10273. doi:10.1007/s00253-014-6157-x

Zhang, K., Cao, G.-L., Ren, N.-Q., 2019. Bioaugmentation with Thermoanaerobacterium thermosaccharolyticum W16 to enhance thermophilic hydrogen production using corn stover hydrolysate. Int. J. Hydrogen Energy.

Zhang, L., Li, J., Ban, Q., He, J., Jha, A.K., 2012. Metabolic pathways of hydrogen production in fermentative acidogenic microflora. J. Microbiol. Biotechnol. doi:10.4014/jmb.1110.10076

Zhang, M.L., Fan, Y.T., Xing, Y., Pan, C.M., Zhang, G.S., Lay, J.J., 2007. Enhanced biohydrogen production from cornstalk wastes with acidification pretreatment by mixed anaerobic cultures. Biomass and Bioenergy. doi:10.1016/j.biombioe.2006.08.004

Zhang, Y., Angelidaki, I., 2014. Microbial electrolysis cells turning to be versatile technology: Recent advances and future challenges. Water Res. doi:10.1016/j.watres.2014.02.031

Zhu, H., Béland, M., 2006. Evaluation of alternative methods of preparing hydrogen producing seeds from digested wastewater sludge. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2006.01.019

Zurrer, H., Bachofen, R., 1979. Hydrogen production by the photosynthetic bacterium Rhodospirillum rubrum. Appl. Environ. Microbiol.

CHAPTER 3 Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

ABSTRACT

Anaerobic microflora enriched for dark fermentative H2 production from a mixture of glucose and xylose was used in batch cultivations to determine the effects of sudden short-term temperature fluctuations on H2 yield and microbial community composition. Batch cultures initially cultivated at 55°C (control) were subjected to downward (from 55°C to 35°C or 45°C) or upward (from 55°C to 65°C or 75°C) temperature shifts for 48 h after which, each culture was transferred to a fresh medium and cultivated again at 55°C for two consecutive batch cycles. The average H2 yield

-1 obtained during the first cultivation at 55°C was 2.1 ± 0.14 mol H2 mol hexose equivalent. During the temperature shifts, the obtained H2 yields were 1.8 ± 0.15, 1.6 ± 0.27 and 1.9 ± 0.00 mol H2 mol-1 hexose equivalent at 35°C, 45°C and 65°C, respectively, while no metabolic activity was observed at 75°C. The sugars were completely utilized during the 48 h temperature shift to 35°C but not at 65°C and 45°C. At the end of the second cycle after the different temperature shifts, the H2 yield obtained was 96.5, 91.6, 79.9 and 54.1% (second cycle after temperature shift to

35°C, 45°C, 65°C and 75°C, respectively) when compared to the average H2 yield produced in the control at 55°C. Characterization of the microbial communities present in the control culture at 55°C showed the predominance of Thermoanaerobacteriales, Clostridiales and Bacilliales. The microbial community composition differed based on the fluctuation temperature with Thermoanaerobacteriales being most dominant during the upward temperature fluctuations and Clostridiales being the most dominant during the downward temperature fluctuations.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities 3.1. INTRODUCTION The increasing global demand for energy and fuels, and the environmental hazards that fossil fuels contribute, strongly demand for alternative energy resources. H2 has been considered as a possible sustainable alternative (Hosseini and Wahid, 2016; Johnston et al., 2005). Although H2 is a very abundant element on earth, it does not typically exist as H2 in nature. H2 is usually found combined with other elements, whilst it can be produced locally from numerous sources. H2 is produced industrially via electrolysis, coal gasification, and fossil fuel reforming (Dincer, 2012;

Holladay et al., 2009). Known biological H2 production (BHP) methods include direct and indirect biophotolysis by green algae and cyanobacteria (Yu and Takahashi, 2007), photofermentation by phototrophic bacteria (Adessi et al., 2017) and dark fermentation by fermentative bacteria (Hu et al., 2013). BHP via dark and photofermentation has drawn increasing interest because of the ability to generate H2 from various organic resources, such as industrial waste streams and lignocellulosic materials (Li and Fang, 2007; Zhang et al., 2003). Photosynthetic H2 production on the other hand is of interest because it needs only light and water and does not produce any CO2 (Ghirardi, 2006; Melis, 2007).

However, H2 production by dark fermentation is advantageous over the other BHP processes because of higher H2 production rates and the possibility to use a wide variety of organic materials as substrates (Chong et al., 2009b). Dark fermentation can be carried out under different temperatures, i.e. mesophilic (35-40 ºC), thermophilic (52-60 ºC) and extremely thermophilic (>65 ºC) conditions by different groups of fermentative bacteria (Dessì et al., 2018c; Verhaart et al.,

2010). Given the faster rates and higher yields of H2, the use of thermophilic dark fermentation is often preferred over mesophilic processes (Pawar and van Niel, 2013). However, thermophilic operations can require higher energy input for heating and are prone to inhibition (Angelidaki and Ahring, 1994) and sudden environmental changes (Biey et al., 2003) which can eventually result in reduced process stability or productivity (Pawar and van Niel, 2013; M. Wu et al., 2006).

Studies on anaerobic biological processes have shown that even small changes in the operating temperature can cause significant changes in microbial community composition and H2 yields (Dessì et al., 2018c, 2018b; Qiu et al., 2017b). Temporal temperature fluctuations can also lead to changes in the enzymatic activities, growth rates and/or loss of microbial diversity, which directly affect H2 production (Gadow et al., 2013b). Temperature is therefore a key parameter to be controlled in dark fermentative processes. Previous studies investigating the effects of temperature on fermentative H2 production have focused on comparing batch incubations and

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities reactor performances at different fixed operating temperatures (Dessì et al., 2018b; Zhang and Shen, 2006). However, short-term temperature fluctuations can occur e.g., due to technical failures and therefore it is important to study the effects of short-term temperature fluctuations because they might lead to unwanted changes of the microbial growth and activities. Several studies focusing on anaerobic digestion have been carried out to establish the relationship between sudden temperature fluctuations and biogas production (Chae et al., 2008; Gao et al., 2012; Kundu et al., 2014). However, to our knowledge only one study has been conducted to evaluate the influence of transient downward temperature fluctuations on the stability of H2 production (Gadow et al., 2013b). To date, no study has been done to correlate the outcome of temperature fluctuations in dark fermentation to the resilience and stability of the microbial populations involved.

The present study therefore aims to evaluate the effects of sudden short-term downward and upward temperature fluctuations during thermophilic dark fermentative H2 production and reveal connections between effect of temperature changes and the microbial community structure. Chemical and molecular methods were used to monitor and characterize the microbial responses to transient temperature fluctuations (two different upward and two different downward temperature fluctuations). Understanding the resilience and stability as well as the dynamics of microbial communities to transient temperature fluctuations will help in developing strategies for optimization of dark fermentation processes, especially after possible process disturbances.

3.2. MATERIALS AND METHODS 3.2.1. Enrichment culture: medium composition and inoculum source

The enrichment of H2 producing microbial community for this study was carried out in a continuous stirred tank reactor (CSTR) after which the enriched culture was used in batch bottle experiments to study the effects of sudden short-term temperature fluctuations on H2 production and microbial community composition. An anaerobically digested sludge was used as inoculum for the CSTR after heat shock pretreatment at 90°C for 20 min. Two hundred milliliters of the pretreated sludge (10% v/v, final concentration, 40 mg L-1 of volatile solids) was inoculated to 1800 mL of the following culture medium (mg/L): K2HPO4, 500; NH4Cl, 100; MgCl2 · 6H2O, 120; H8FeN2O8S2 ·

6H2O, 55.3; ZnCl2, 1.0; MnCl2 · 4H2O, 2.0; CuSO4, 000.4; (NH4)6Mo7O24, 1.2; COSO4, 1.3; H3BO3,

0.1; NiCl2 · 6H2O, 0.1; Na2O3Se, 0.01; CaCl2 · 2H2O, 80; yeast extract, 500 and 0.055 mL HCl (37%). The culture was fed with glucose (800 mg L-1) and xylose (1200 mg L-1 xylose). Xylose was used as substrate because it is a major component of hemicellulose and therefore commonly

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities present in lignocellulosic biomass, lignocellulose hydrolysates, and pulp and paper wastewaters. Utilizing both glucose and xylose is a practical way to move towards efficient bioconversion of lignocellulosic wastes to H2. The total working volume of the CSTR was two liters. The reactor was flushed with nitrogen for 5 min and then operated in continuous mode at hydraulic retention time of 6 h and at 55 °C for 21 days. The pH was maintained at 6.5.

3.2.2. H2 production batch experiments

Prior to exposing the cultures to temporal temperature fluctuations, the H2-producing enrichment culture (step 1 in Figure 1) was acclimatized to batch growth conditions at 55°C using the same cultivation medium as in the CSTR (step 2 in Figure 1). The acclimatized culture was then divided into ten anaerobic cultivation bottles containing fresh medium and subjected to a one-time temperature shock. This was done by placing duplicate bottes to 35 and 45 °C (downward temperature shocks), to 55 °C (control) as well as to 65 and 75 °C (upward temperature shocks) for 48 h (Figure 1, step 3). At the end of the 48 h incubation period, the cultures were centrifuged for 5 minutes, transferred to fresh medium and incubated at the original temperature of 55 °C for 48 h (step 4 in Figure 1). This step was repeated one more time (step 5 in Figure 1).

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Figure 1 Experimental setup to study the effects of different temperature fluctuations during dark fermentation. First, H2 producers were enriched in a continuous stirred tank reactor (CSTR) at 55 °C for 21 days (step 1). This was followed by the acclimatization of the enriched mixed culture to batch conditions (step 2) and then, specific temperature shock described as the downward temperature fluctuation (35 °C or 45 °C) and the upward temperature fluctuation (65 °C or 75 °C) were imposed (step 3). Cultures incubated at 55 °C (C) were used as control. After the temperature shocks, the H2 production was followed for two more batch cycles at 55 °C (step 4 and step 5) to delineate how the culture can recover from the different temperature fluctuations.

3.2.3. Analysis of H2 production The biogas volume and composition measurement was carried out at the respective incubation temperatures mentioned in section 2.2 while keeping the culture bottles in water baths to maintain a constant temperature. Gas production was monitored was periodically measured with a digital manometer to determine the volume of gas produced. H2 partial pressure can have a significant effect on fermentation as some thermophilic microorganisms may change their metabolism to the production of more reduced substrates such as lactate when the H2 partial pressure increases. The biogas volume was therefore measured before and after releasing the pressure in each culture bottle. The total volume of produced H2 was calculated at standard temperature using Equation 1 (Logan et al., 2002).

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

V퐻2,t = V퐻2,t−1 + C퐻2,t(VG,t − VG,t−1) + 푉퐻(C퐻2,t − C퐻2,t−1) (1)

Where V퐻2,t is the cumulative H2 gas produced at time t, V퐻2,t−1 is the cumulative H2 gas produced at t-1, VG,t is the total gas volume at time t, VG,t−1 is the total gas volume at time t-1, C퐻2,t is the H2 gas fraction in the headspace at time t, C퐻2,t−1 is the H2 gas fraction in the headspace at time t-1 and 푉퐻 is the total headspace volume in the culture bottle. H2 production in moles was calculated on the basis that one mole of an ideal gas will occupy a volume of 22.4 L at standard temperature and pressure according to the ideal gas law. Therefore, the volume of H2 gas produced was divided by 22.4 L in order to obtain H2 produced in moles. The gas composition was analyzed using a gas chromatograph (Clarus 580, Perkin Elmer) with a thermal conductivity detector. The columns used were a RtQbond column for H2, O2, N2 and CH4 quantification and a RtMolsieve column for CO2 quantification. The carrier gas was argon under a pressure of 3.5 bars. A gas tight Hamilton syringe was used for gas sampling.

3.2.4. Analysis of the liquid metabolites Culture suspension samples were collected before and after each experimental step for chemical analysis of the metabolic products. The samples were centrifuged at 13000 rpm for 15 min and the supernatant was filtered with 0.2 μm filter before the analyses. Glucose, xylose, organic acid and alcohol concentrations were measured by high performance liquid chromatography (HPLC) using a refractive index detector (Waters R410) as described previously by (Monlau et al., 2013).

3.2.5. Microbial community analysis Genomic DNA was extracted using the PowerSoil™ DNA Isolation Sample Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. The following primers; 515_532U and 909_928U (Wang and Qian, 2009) including their respective linkers, were used to amplify the V4_V5 region of the 16S rRNA gene over 30 amplification cycles at an annealing temperature of 65 °C. The resulting products were purified and loaded onto the Illumina MiSeq cartridge prior to sequencing. Sequencing and library preparation were performed at the Genotoul Lifescience Network Genome and Transcriptome Core Facility in Toulouse, France (get.genotoul.fr). The sequences analysis was done as described by Venkiteshwaran et al. (2016).

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

3.2.6. Calculations

H2 yield was calculated by dividing the mol H2 per mole of hexose equivalent using the conversion factor of 5/6 for converting xylose to its hexose equivalent. The theoretical H2 produced was calculated based on the measured acetate and butyrate concentrations (mM) using the Equation

2 (Luo et al., 2010) in order to determine the ratio of experimental to theoretical H2 yield (Akinbomi and Taherzadeh, 2015). If the calculated ratio is above 100%, the H2 is produced also via other pathways than acetate and butyrate while a ratio below 100% indicates homoacetogenic activity.

Theoretical H2 produced = 2 × ∑(acetate concentration + butyrate concentration) (2)

The relative H2 yield compared to the control was calculated for each culture by comparing the H2 yields obtained during or after the temperature fluctuation period to the average yield (steps 3 - 5) obtained from the control cultures kept at 55 °C (Equation 3).

퐻2 푦𝑖푒푙푑 표푏푡푎𝑖푛푒푑 푑푢푟𝑖푛푔/푎푓푡푒푟 푡푒푚푝푒푟푎푡푢푟푒 푠ℎ𝑖푓푡 Relative 퐻2 yield compared to the control (%) = × average 퐻2 yield obtained from the control 100 (3)

Total COD of soluble compounds was calculated based on the sum of acids, ethanol and residual sugars by using the following conversion factors: 1 mM glucose = 192 mg COD L-1, 1 mM xylose = 160 mg COD L-1, 1 mM acetate = 64 mg COD L-1, 1 mM propionate = 112 mg COD L-1, 1 mM lactate = 96 mg COD L-1, 1 mM butyrate = 160 mg COD L-1 and 1 mM ethanol = 96 mg COD L-1 (Gonzales and Kim, 2017; Sivagurunathan and Lin, 2016). The COD mass balance was calculated using the endpoint concentrations of the residual sugars and soluble metabolites.

3.3. RESULTS AND DISCUSSION

3.3.1. Thermophilic H2 production at constant temperature in CSTR and first batch test (55 °C) Methane was not detected in any of the incubations performed in this study, which indicates that the initial heat-shock pretreatment was sufficient to totally suppress the activity of methanogens

(Cai et al., 2004; Venkata Mohan et al., 2008). The maximum H2 yield obtained during the

-1 enrichment in the CSTR was 1.9 mol H2 mol hexose equivalent. The H2 yield obtained in the

-1 batch cultivation at 55°C (control) was 2.2 ± 0.07, 2.1 ± 0.06 and 1.9 ± 0.14 mol H2 mol hexose equivalent (in steps 3, 4 and 5 respectively). The H2 yield was seen to decrease in steps 4 and 5.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

During the cultivation in the different steps (3, 4 and 5) at 55 °C, the concentration of ethanol and acetate increased in step 4 compared to steps 3 and 5 (Table 1). The increase in these metabolites coincided with a decrease in butyrate concentration. The butyrate to acetate ratio (HBu/HAc, mM:mM) has been used in previous studies as an indicator of relative contribution of these two pathways to H2 production (Lin et al., 2006; Sangyoka et al., 2016). In the cultures incubated at 55 °C, it was 1.2, 0.5 and 1.5 in steps 3, 4 and 5, respectively. The values from step 3 and 5 are in line with previous studies which have reported HBu/HAc ratios ranging between

1.5 and 4.0 (Lin et al., 2006; Sangyoka et al., 2016). The ratio of experimental to theoretical H2 yield was 99, 91 and 83% in steps 3, 4 and 5, respectively. Based on the H2 yields, HBu/HAc ratios and the ratios of experimental to theoretical H2 yield, there might have been a slight shift in the metabolic pathway towards acetate production during the thermophilic dark fermentative H2 production in step 4 and an increasing homoacetogenic activity from step 3 to 5.

In a dark fermentation, the maximum theoretical H2 that can be obtained from glucose under standard temperature and pressure is 4 mol H2 per mol glucose with acetate as the only metabolite while 2 mol H2 per mol of glucose is produced with when butyrate is the only metabolite

(Vardar-Schara et al., 2008). However, during dark fermentation, H2 is produced along with other metabolites such as alcohols, lactate and propionate, the production of which are either consume substrate without production of any H2 or even consume H2 and therefore lead to low H2 yields (Buyukkamaci and Filibeli, 2004; Hawkes et al., 2007). The metabolites produced by a bacterium or mixed cultures depend on the environmental conditions.

Table 1 Concentration of soluble metabolites and their contribution to end-point COD in the control cultures incubated at 55 °C including results from the incubations steps 3, 4 and 5.

Parameters Concentration (mmol L-1) Percentage of end-pointCOD

Step 3 Step 4 Step 5 Step 3 Step 4 Step 5

Residual sugars n.d n.d n.d n.d n.d n.d

Lactate n.d n.d 0.11 ± 0.0 n.d n.d 0.5 ± 0.2

Acetate 5.01 ± 0.4 7.63 ± 0.0 4.54 ± 0.4 15.3 ± 1.1 22.89 ± 0.1 13.6 ± 1.3

Ethanol 1.22 ± 0.3 3.85 ± 0.1 1.54 ± 0.2 5.5 ± 1.4 17.34 ± 0.3 6.9 ± 0.9

Butyrate 5.96 ± 0.4 4.00 ± 0.1 6.61 ± 0.2 44.7 ± 2.7 30.01 ± 0.4 49.5 ± 1.4

Propionate 0.73 ± 0.0 0.63 ± 0.0 0.73 ± 0.0 3.8 ± 0.1 3.3 ± 0.0 3.3 ± 0.1 n.d: Not detected

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

3.3.2. Sudden transient downward temperature shift and its effects on H2 metabolism

During the downward temperature shifts, the H2 yield slightly decreased compared to the control

-1 (55 °C), being 1.8 ± 0.15 and 1.6 ± 0.27 mol H2 mol hexose equivalent at 35 and 45 °C, respectively. However, H2 production recovered rapidly when the cultures were transferred to a fresh medium and incubated at the original temperature of 55 °C. H2 yield of 2.2 ± 0.07 and 2.0 ±

-1 0.01 mol H2 mol hexose equivalent (steps 4 and 5, respectively) were obtained for cultures

-1 exposed to 35°C shift, and 2.0 ± 0.08 and 1.9 ± 0.00 mol H2 mol hexose equivalent (steps 4 and 5, respectively) for cultures exposed to 45°C shift. The substrates were fully consumed during and after the temperature shift to 35°C. Meanwhile during the temperature shift to 45°C, 6.4 ± 0.5% of the substrate was not consumed (Table 2) but all substrates given were completely depleted after the cultures were returned to 55 °C. During the downward temperature fluctuation, similar metabolic patterns were observed at 35 and 45 °C shifts except that the concentration of lactate and butyrate was higher at the 35 °C than 45 °C shift (Figure 2, Table 2). Meanwhile, the concentration of acetate was higher at 45 °C than 35 °C. When cultures after both fluctuating temperatures where returned to 55 °C, they both showed similar patterns in their metabolite distribution with only slight variations in their frequencies (Figure 2, Table 2).

The proportion of experimental to theoretical H2 yield (calculated based on acetate and butyrate concentrations) during and after the temperature fluctuation to 35 °C was 79, 99 and 90% in steps 3, 4 and 5, respectively. For cultures exposed to 45 °C, the ratio was 71, 88 and 89% in steps 3,

4 and 5, respectively. Lactate and propionate, have been reported to be involved in H2 consuming pathways, which leads to H2 yields which are significantly lower than the theoretical values calculated using only the concentrations of acetate and butyrate (Buyukkamaci and Filibeli, 2004;

Hawkes et al., 2007). However, it is also possible that the decrease in H2 production during the downward temperature fluctuation was influenced by homoacetogenic activity and to minor extent lactate production. This lead to a reduction in the H2 yield compared to the controls incubated at 55 °C.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Figure 2. Metabolites and H2 produced during the downward temperature fluctuations. H2 and soluble metabolite production during temperature fluctuation at A) 35 °C (step 3) and B) 45 °C and after returning the cultures back to 55 °C (steps 4 and 5).

Table 2 Contribution of each metabolite and the residual sugars to end-point COD during and after the downward temperature fluctuations.

Parameters Fluctuation to 35 °C Fluctuation to 45 °C (% COD) Step 3 Step 4 Step 5 Step 3 Step 4 Step 5

Residual sugars n.d 0.2 ± 0.2 n.d 6.4 ± 0.5 0.3 ± 0.3 n.d Lactate 3.2 ± 1.7 0.1 ± 0.1 0.4 ± 0.3 2.3 ± 0.7 n.d 0.4 ± 0.2 Acetate 14.0 ± 0.2 22.1 ± 0.0 19.2 ± 2.4 16.1 ± 0.2 22.4 ± 1.1 17.8± 3.7 Ethanol n.d 18.5 ± 0.4 13.3 ± 4.6 n.d 18.5 ± 1.5 14.1 ± 4.4 Butyrate 48.8 ± 1.0 30.6 ± 0.5 36.3 ± 6.7 44.1 ± 0.3 30.1 ± 1.7 36.0 ± 7.6 Propionate n.d 2.9 ± 0.0 3.6 ± 0.1 n.d 3.5 ± 0.3 3.3 ± 0.0 Sum 66.0 74.4 72.8 68.9 74.8 71.6 n.d: Not detected

3.3.3. Sudden transient upward temperature shift and its effects on H2 metabolism -1 During the upward temperature shift at 65 °C, the H2 yield was 1.9 ± 0.0 mol H2 mol hexose equivalent which corresponded 10.5% decrease compared to the average H2 yield in the controls.

-1 The H2 yield in the subsequent cultivation steps at 55°C was 12.1% (1.9 ± 0.05 mol H2 mol

-1 hexose equivalent) and 21.3% (1.7 ± 0.27 mol H2 mol hexose equivalent) lower in steps 4 and

5, respectively, compared to the average H2 yield in the control. Temperature shift to 75 °C resulted in a complete stop of the dark fermentative microbial activity. Hence, no substrate 63

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities consumption was observed. H2 production recovered as soon as the cultures were transferred to a fresh medium and incubated again at 55°C. However, the H2 yield was only 0.7 ± 0.26 mol H2

-1 -1 mol hexose equivalent (67.3% decrease) and 1.13 ± 0.17 mol H2 mol hexose equivalent (44.9%

H2 decrease) in steps 4 and 5, respectively.

During the temporal temperature shift to 65°C, 25.5 ± 2.4% of the substrates was not consumed at the end of the 48 h period (Table 3). However, all the substrates added were consumed when the cultures were returned to 55°C. Upon the shift to 65°C, the share of acetate and ethanol increased while that of butyrate and lactate reduced (Figure 3). This was different compared to the metabolite formation obtained in the control at 55 °C where butyrate was the most abundant metabolite, followed by acetate. The ratio of experimental to theoretical H2 yield calculated from the sum of acetate and butyrate was higher than expected (145%) for the acetate‒butyrate pathway. When the temperature was returned to 55 °C, butyrate and acetate once again became the major liquid metabolites (Table 3). The ratio of experimental to theoretical H2 yield calculated from the sum of acetate and butyrate were 82 and 74% in steps 4 and 5, respectively. Due to the higher percentage of acetate and ethanol than butyrate, it is possible that the temperature fluctuation to 65 °C induced a metabolic shift towards ethanol–acetate pathway. The ethanol‒

-1 acetate pathway have a theoretical maximum of 2 mol of H2 mol glucose (Hwang et al., 2004; Ren et al., 2007)

C6H12O6 + H2O → C2H5OH + 퐶H3COOH + 2CO2 + 2H2 (4)

Similar findings where butyrate and acetate were the major liquid metabolites at 35–60°C while at 65°C the main by‐product was ethanol have been reported by Qiu et al. (Qiu et al., 2017b).

Some members of the order Clostridiales such as Ruminococcus albus are capable of H2 production via the ethanol-acetate pathway. Additionally, Thermoanaerobacterium spp. has been reported to produce ethanol and acetate as the major by-products at 65 °C from xylose (Qiu et al., 2017b).

As mentioned earlier, H2 production came to a complete stop during the temperature shift to 75°C with no substrate consumption. However, only 95% of the total substrate given was detected in the end of the incubation, indicating that the existing microbial population used 5% of the substrates for their survival mechanisms or other metabolic pathways. When the cultures were returned to 55°C after the high rise in temperature to 75°C, the substrate removal was again complete at the end of the incubation period in steps 4 and 5. After the fluctuation period at 75 °C,

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

H2 producing activity commenced with varying concentrations of the metabolites (Figure 3, Table

3). The ratios of experimental to theoretical H2 yield calculated from the sum of acetate and butyrate were 40 and 51% in steps 4 and 5, respectively.

Figure 3 Metabolites and H2 produced during the upward temperature fluctuations at A) 65 °C (step 3) and B) 75 °C and after returning the cultures back to 55 °C (steps 4 and 5).

Table 3 Contribution of each metabolite and the residual sugars to the end-point COD during and after upward temperature fluctuations. Parameters Fluctuation to 65 °C Fluctuation to 75 °C (% COD) Step 3 Step 4 Step 5 Step 3 Step 4 Step 5 Residual sugars 22.5 ± 2.4 0.0 ± 0.0 0.0 ± 0.0 95.85 ± 0.2 10.1 ± 10.1 3.0 ± 2.8 Lactate 3.6 ± 0.4 1.0 ± 0.0 0.5 ± 0.3 n.d 10.6 ± 7.5 0.2 ± 0.1 Acetate 16.4 ± 0.7 21.4 ± 0.0 17.5 ± 4.1 n.d 9.7 ± 1.3 21.1 ± 0.6 Ethanol 21.9 ± 1.2 19.1 ± 0.1 12.3 ± 6.2 n.d 5.5 ± 2.1 18.3 ± 1.2 Butyrate 8.0 ± 0.4 31.2 ± 0.1 40.8 ± 10.7 n.d 38.1 ± 1.0 30.2 ± 0.2 Propionate 2.8 ± 0.0 2.9 ± 0.2 3.7 ± 0.4 n.d 3.8 ± 0.2 3.6 ± 0.2 Sum 75.2 75.6 74.8 95.85 77.8 76.4 n.d.: Not detected

3.3.4. Microbial community composition during the altered temperature conditions The microbial community in the thermophilic control cultures incubated at 55°C was dominated by three major orders: Thermoanaerobacterales (94, 98 and 77% in steps 3, 4 and 5, respectively) > Clostridiales (3, 1 and <1%) > Bacillales (2, <1 and 22%). The sudden increase in Bacillales in 65

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities step 5 was concomitant with the decreased H2 yield. The dominant member of this order was Tumebacillus spp., which corresponded up to 20% of relative abundance of all microorganisms detected in step 5. Tumebacillus spp. are gram positive, aerobic, rod shaped, and spore forming bacteria, which are able to degrade carbohydrates and have been detected from anaerobic processes (Gagliano et al., 2015). However, their role in the consortium is not known and it is not certain whether its presence was the reason of the lower yield observed in step 5, during incubation at 55°C.

Downward temperature shifts

Decreasing the temperature to 35°C or to 45°C for 48 h considerably influenced the microbial community composition. Clostridiales became the dominant order in the community (relative abundance of 84% and 74% at 35 °C and 45 °C, respectively) as seen in Figure 4. During both downward shifts, Thermoanaerobacteriales was present in lower abundance (10% and 25% at 35 °C and 45 °C, respectively) compared to the control cultures. Bacillales (6% and <1% at 35 °C and 45 °C, respectively) was also present at low relative abundance at this point. The members of the order of Clostridiales identified belonged to Clostridium spp. The increase in temperature back to 55 °C lowered the relative abundance of Clostridiales, and Thermoanaerobacteriales became again the dominant order (Figure 4). The share of other members of the consortium, some of which were known homoacetogens, was below 1%. Though in very low abundance, the metabolic capacities of this group of bacteria might have had noticeable influence on the dark fermentative metabolism (Rafrafi et al., 2013). When compared to the control cultures (incubated constantly at 55 °C), Thermoanaerobacteriales quickly became the most dominant species in steps 4 and 5 after downward temperature fluctuations which means that short-term downward temperature fluctuation leads to the suppression of thermophilic microorganisms but due to their resilient nature, are able quickly re-adapt when the temperature becomes again favorable for their growth.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Figure 4. Microbial community composition as relative abundance of different microbial orders (>1%) during (step 3) and after (steps 4 and 5) the downward temperature shifts.

Upward temperature shifts

In contrast to the downward temperature shifts, temporal upward temperature shifts did not cause a significant alteration in the microbial community. Thermoanarobacteriales remained the dominant order during and after the temperature shifts. Thermoanaerobacteriales (97%) and Clostridiales (3%) were the main orders during the temperature shift at 65°C. Interestingly, during this step, it was observed that H2 might have also been produced via the acetate–ethanol pathway due to the high amount of ethanol produced and on the fact that the ratio of experimental to theoretical H2 produced was greater than 100%. Members of the group Thermoanaerobacterium, which were the most dominant group of the order Thermoanaerobacteriales, are known to produce H2 via the acetate and butyrate pathway. However, the ratio of experimental to theoretical

H2 yield (calculated based on acetate and butyrate) reported in the previous section, indicated

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities that H2 production could not have been achieved only via the acetate and butyrate pathways. A fraction of the H2 produced might have come from some members of the order Clostridiales via the acetate–ethanol pathway (Ren et al., 2007), despite their low abundance. It has been shown that sub-dominant bacteria can influence the global microbial metabolic network in mixed cultures (Cabrol et al., 2017; Rafrafi et al., 2013). It would be important to identify bacteria, which are able to utilize this pathway for H2 production in order to optimize of H2 production efficiency even under unstable conditions.

After the cultures were taken back from 65°C to 55°C, the relative abundance of Thermoanaerobacteriales was 97%, Clostridiales was 1% and Baciallales was 2% (step 4). In step 5, proportion of Thermoanaerobacteriales decreased to 79%, Clostridiales seemed to disappear from the microbial consortium, and Bacilliales increased to 21% (Figure 5).

No activity was observed during the temperature shift to 75°C suggesting that the bacteria present, did not have enough time to initiate H2 production activity and perhaps, needed more time to adapt to such a high temperature. However, H2 production started as soon as the culture was returned to 55 °C. In the first cycle after the fluctuation (step 4), the microbial community consisted of Thermoanerobacteriales (91%) and Bacillales (9%). In the second cycle after the temperature shift to 75°C (step 5), Thermoanaerobacteriales dominated the microbial community with 99.9% abundance. While Clostridiales are able to withstand temperatures up to 55° C (Chen et al., 2012; Y. Liu et al., 2008), a further increase in the temperature to 65° C led to the decrease in their relative abundance and even to complete disappearance after the 75°C fluctuation. The decrease in the H2 yield after the 65°C and 75°C shift can be linked to the disappearance of

Clostridiales from the consortium. Although most of the studies on dark fermentative H2 production have focused on key-stone species as having the most significant impact on biological processes, it has been shown that sub-dominant bacteria can also have a signiﬁcant effect despite their low abundance (Rafrafi et al., 2013). Therefore, it is suggested that the presence of Clostridiales in the consortium had a significant role in H2 productivity, hence the low yield obtained following its disappearance from the microbial consortium. When compared to the control cultures (incubated constantly at 55 °C), Thermoanaerobacteriales remained the most abundant species in steps 4 and 5 after upward temperature fluctuations. However, the relative abundance was higher, compared to the control cultures (especially after the 75 °C fluctuation) while Clostridiales disappeared from the consortium.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Figure 5 Microbial community composition as relative abundance of different microbial orders (>1%) during (step 3) and after (steps 4 and 5) the upward temperature shifts.

3.3.5. Comparison between cultures exposed to temporal downward and upward temperatures

H2 production recovered faster after the downward temperature fluctuations than after of the upward temperature fluctuations. This is in line with results of Huang et al. (2004) (Huang et al., 2004) who suggested that for thermophilic systems, a longer adaptation time is often required for new temperature conditions (see Table 4).

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Table 4. Percentage maximum relative H2 yield (compared to H2 yield obtained in the controls) obtained during the temperature fluctuations and after the fluctuation periods.

Culture conditions Temperature Fluctuation Step 4 (55 °C) Step 5 (55 °C)

Shift to 35 °C 84.3 107.6 96.5

Shift to 45 °C 75.9 96.8 91.6

Shift to 65 °C 90.9 89.3 79.9

Shift to 75 °C 0 30.9 54.1

The resilience of a microbial consortium is the capacity of the microorganisms in the consortium to recover quickly from process disturbances. Resilience and functional redundancy are the basic mechanisms via which microbial communities are able to maintain community function when disturbance is introduced into a biological system (Konopka et al., 2015; Werner et al., 2011). The current result suggests that the performance during and after the temperature fluctuations was a consequence of a microbial community with higher resilience to the downward temperature shifts than to the upward temperature shifts. Change in the relative abundance of Clostridiales and Thermoanaerobacteriales due to the transient changes in the incubation temperature illustrates the robustness and adaptability of the mixed microbial community to the new incubation conditions. The presence of members of these orders helped to maintain continuous H2 production process during the fluctuating conditions, despite the lower H2 yield observed. The species belonging to Thermoanaerobacteriales are known for their abilities to survive in environments of extremely high temperature (O-Thong et al., 2011a; Qiu et al., 2017a). Thermoanaerobacterium spp. belonging to the Thermoanaerobacterales was the most abundant genus in the consortium and demonstrated the ability to function at all the studied temperature. Clostridiales was the most abundant order at 35 °C. Its level of relative abundance decreased with increasing temperatures up to 65 °C and disappearance at 75 °C. Clostridiales differ in their optimal growth conditions compared to Thermoanaerobacteriales (Bader and Simon, 1980; Mtimet et al., 2016). However, both groups are metabolically similar which allows for flexibility in

H2 production performance when process disturbances occur. Other bacteria present in the consortium enabled higher microbial diversity and increase of the system robustness. Nonetheless, the presence of homoacetogens, though in very low abundance, created a negative impact on the H2 production. The results obtained in this study showed that H2 production due to temperature disturbances is a result of changes occurring in the metabolic networks and the

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities microbial community composition. Temperature therefore plays an important role in microbial community stability and resilience.

Additionally, as observed in this study, the effects of short-term temperature fluctuations on the microbial communities depend on the extent of the temperature fluctuation. For example, after the downward temperature fluctuations, the thermophilic microorganisms were able to re-adapt to their original conditions without any identifiable loss in microbial diversity in the community. On the contrary, after the upward temperature fluctuations, the microbial community was different from that observed in the control incubated constantly at 55 °C. In the control, Clostridiales were present, although in low abundance and were considered to play a role in H2 production, as their disappearance after the temperature fluctuations led to reduced H2 production in steps 4 and 5.

This might lead to reduced H2 production also in the long term due to loss of microbial diversity.

Therefore, recovery strategies such as bioaugmentation to optimize the H2 production could be required after unexpected upward temperature fluctuations. However, this subject requires further studies.

3.4. CONCLUSIONS Sudden, even temporal upward and downward temperature fluctuations had a direct impact on microbial community structure, the soluble metabolites produced and the H2 production. A mixed microbial culture enriched for H2 production at 55 °C recovered more rapidly enabling similar H2 yield (92-108%) after returning to original temperature of 55 °C as the control culture kept at constant temperature (55 °C). Upward temperature shifts from 55 to 65 or 75 °C had more significant negative effect on dark fermentative H2 production than downward temperature shifts and H2 yield remained lower than the control (55 °C) after the temperature was returned to 55 °C (31-89%). The likely reason for this was that upward temperature shifts resulted in more significant loss of microbial diversity. Based on the observations made in this study, attention should be paid towards optimizing operational parameters during bioreactor operations, especially with regards to factors that may lead to unexpected increase in temperature such as high organic loading rate. Thus, cooling systems are recommended. Alternatively, adding known

H2 producers (i.e. bioaugmentation) characterized by wide temperature ranges might help to improve the robustness of the system by making up for the loss in microbial diversity enhancing the stability and resilience of the microbial consortium to adverse environmental changes and consequently improve the performance of the H2 production process.

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities REFERENCES Adessi, A., Corneli, E., Philippis, R. De, 2017. Photosynthetic purple non sulfur bacteria in hydrogen producing systems: New approaches in the use of well known and innovative substrates, in: Modern Topics in the Phototrophic Prokaryotes: Environmental and Applied Aspects. doi:10.1007/978-3-319-46261-5_10

Akinbomi, J., Taherzadeh, M.J., 2015. Evaluation of fermentative hydrogen production from single and mixed fruit wastes. Energies. doi:10.3390/en8054253

Angelidaki, I., Ahring, B.K., 1994. Anaerobic thermophilic digestion of manure at different ammonia loads: Effect of temperature. Water Res. doi:10.1016/0043-1354(94)90153-8

Bader, J., Simon, H., 1980. The activities of hydrogenase and enoate reductase in two Clostridium species, their interrelationship and dependence on growth conditions. Arch. Microbiol. doi:10.1007/BF00427205

Biey, E.M., Musibono, E.D., Verstraete, W., 2003. Start-up of a multi-stage system for biogas production and solid waste treatment in low-tech countries, in: Water Science and Technology.

Buyukkamaci, N., Filibeli, A., 2004. Volatile fatty acid formation in an anaerobic hybrid reactor. Process Biochem. doi:10.1016/S0032-9592(03)00295-4

Cai, M., Liu, J., Wei, Y., 2004. Enhanced biohydrogen production from sewage sludge with alkaline pretreatment. Environ. Sci. Technol. 38, 3195–3202. doi:10.1021/es0349204

Chae, K.J., Jang, A., Yim, S.K., Kim, I.S., 2008. The effects of digestion temperature and temperature shock on the biogas yields from the mesophilic anaerobic digestion of swine manure. Bioresour. Technol. 99, 1–6. doi:10.1016/j.biortech.2006.11.063

Chen, C.C., Chuang, Y.S., Lin, C.Y., Lay, C.H., Sen, B., 2012. Thermophilic dark fermentation of untreated rice straw using mixed cultures for hydrogen production, in: International Journal of Hydrogen Energy. pp. 15540–15546. doi:10.1016/j.ijhydene.2012.01.036

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Chong, M.L., Sabaratnam, V., Shirai, Y., Hassan, M.A., 2009. Biohydrogen production from biomass and industrial wastes by dark fermentation. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.02.010

Dessì, P., Porca, E., Lakaniemi, A.M., Collins, G., Lens, P.N.L., 2018a. Temperature control as key factor for optimal biohydrogen production from thermomechanical pulping wastewater. Biochem. Eng. J. doi:10.1016/j.bej.2018.05.027

Dessì, P., Porca, E., Waters, N.R., Lakaniemi, A.M., Collins, G., Lens, P.N.L., 2018b. Thermophilic versus mesophilic dark fermentation in xylose-fed fluidised bed reactors: Biohydrogen production and active microbial community. Int. J. Hydrogen Energy 43, 5473–5485. doi:10.1016/j.ijhydene.2018.01.158

Dincer, I., 2012. Green methods for hydrogen production, in: Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.03.173

Gadow, S.I., Jiang, H., Watanabe, R., Li, Y.Y., 2013. Effect of temperature and temperature shock on the stability of continuous cellulosic-hydrogen fermentation. Bioresour. Technol. 142, 304–311. doi:10.1016/j.biortech.2013.04.102

Gagliano, M.C., Braguglia, C.M., Gianico, A., Mininni, G., Nakamura, K., Rossetti, S., 2015. Thermophilic anaerobic digestion of thermal pretreated sludge: Role of microbial community structure and correlation with process performances. Water Res. doi:10.1016/j.watres.2014.10.031

Gao, W.J., Qu, X., Leung, K.T., Liao, B.Q., 2012. Influence of temperature and temperature shock on sludge properties, cake layer structure, and membrane fouling in a submerged anaerobic membrane bioreactor. J. Memb. Sci. 421–422, 131–144. doi:10.1016/j.memsci.2012.07.003

Ghirardi, M.L., 2006. Hydrogen production by photosynthetic green algae. Indian J. Biochem. Biophys.

Gonzales, R.R., Kim, S.-H., 2017. Dark fermentative hydrogen production following the sequential dilute acid pretreatment and enzymatic saccharification of rice husk. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2017.08.185

Hawkes, F.R., Hussy, I., Kyazze, G., Dinsdale, R., Hawkes, D.L., 2007. Continuous dark fermentative hydrogen production by mesophilic microflora: Principles and progress. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2006.08.014

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Holladay, J.D., Hu, J., King, D.L., Wang, Y., 2009. An overview of hydrogen production technologies. Catal. Today 139, 244–260. doi:10.1016/j.cattod.2008.08.039

Hosseini, S.E., Wahid, M.A., 2016. Hydrogen production from renewable and sustainable energy resources: Promising green energy carrier for clean development. Renew. Sustain. Energy Rev. doi:10.1016/j.rser.2015.12.112

Hu, C.C., Giannis, A., Chen, C.L., Qi, W., Wang, J.Y., 2013. Comparative study of biohydrogen production by four dark fermentative bacteria, in: International Journal of Hydrogen Energy. doi:10.1016/j.ijhydene.2013.03.131

Huang, G.H., Hsu, S.F., Liang, T.M., Huang, Y.H., 2004. Study on hydrogen production with hysteresis in UASB. Chemosphere. doi:10.1016/j.chemosphere.2003.09.038

Hwang, M.H., Jang, N.J., Hyun, S.H., Kim, I.S., 2004. Anaerobic bio-hydrogen production from ethanol fermentation: The role of pH. J. Biotechnol. doi:10.1016/j.jbiotec.2004.04.024

Johnston, B., Mayo, M.C., Khare, A., 2005. Hydrogen: The energy source for the 21st century. Technovation. doi:10.1016/j.technovation.2003.11.005

Konopka, A., Lindemann, S., Fredrickson, J., 2015. Dynamics in microbial communities: Unraveling mechanisms to identify principles. ISME J. doi:10.1038/ismej.2014.251

Kundu, K., Bergmann, I., Klocke, M., Sharma, S., Sreekrishnan, T.R., 2014. Impact of abrupt temperature increase on the performance of an anaerobic hybrid bioreactor and its intrinsic microbial community. Bioresour. Technol. 168, 72–79. doi:10.1016/j.biortech.2014.01.093

Li, C., Fang, H.H.P., 2007. Fermentative Hydrogen Production From Wastewater and Solid Wastes by Mixed Cultures. Crit. Rev. Environ. Sci. Technol. doi:10.1080/10643380600729071

Lin, C.Y., Hung, C.H., Chen, C.H., Chung, W.T., Cheng, L.H., 2006. Effects of initial cultivation pH on fermentative hydrogen production from xylose using natural mixed cultures. Process Biochem. doi:10.1016/j.procbio.2006.01.021

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Logan, B.E., Oh, S.E., Kim, I.S., Van Ginkel, S., 2002. Biological hydrogen production measured in batch anaerobic respirometers. Environ. Sci. Technol. 36, 2530–2535. doi:10.1021/es015783i

Melis, A., 2007. Photosynthetic H2 metabolism in Chlamydomonas reinhardtii (unicellular green algae). Planta. doi:10.1007/s00425-007-0609-9

Monlau, F., Trably, E., Barakat, A., Hamelin, J., Steyer, J.P., Carrere, H., 2013. Two-stage alkaline-enzymatic pretreatments to enhance biohydrogen production from sunflower stalks. Environ. Sci. Technol. doi:10.1021/es402863v

Mtimet, N., Guégan, S., Durand, L., Mathot, A.G., Venaille, L., Leguérinel, I., Coroller, L., Couvert, O., 2016. Effect of pH on Thermoanaerobacterium thermosaccharolyticum DSM 571 growth, spore heat resistance and recovery. Food Microbiol. doi:10.1016/j.fm.2015.11.015

O-Thong, S., Hniman, A., Prasertsan, P., Imai, T., 2011. Biohydrogen production from cassava starch processing wastewater by thermophilic mixed cultures. Int. J. Hydrogen Energy 36, 3409–3416. doi:10.1016/j.ijhydene.2010.12.053

Pawar, S.S., van Niel, E.W.J., 2013. Thermophilic biohydrogen production: how far are we? Appl. Microbiol. Biotechnol. 97, 7999–8009. doi:10.1007/s00253-013-5141-1

Rafrafi, Y., Trably, E., Hamelin, J., Latrille, E., Meynial-Salles, I., Benomar, S., Giudici-Orticoni, M.T., Steyer, J.P., 2013. Sub-dominant bacteria as keystone species in microbial communities producing bio-hydrogen. Int. J. Hydrogen Energy 38, 4975–4985. doi:10.1016/j.ijhydene.2013.02.008

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Sangyoka, S., Reungsang, A., Lin, C.-Y., 2016. Optimization of biohydrogen production from sugarcane bagasse by mixed cultures using a statistical method. Sustain. Environ. Res. doi:10.1016/j.serj.2016.05.001

Vardar-Schara, G., Maeda, T., Wood, T.K., 2008. Metabolically engineered bacteria for producing hydrogen via fermentation. Microb. Biotechnol. doi:10.1111/j.1751-7915.2007.00009.x

Venkata Mohan, S., Lalit Babu, V., Sarma, P.N., 2008. Effect of various pretreatment methods on anaerobic mixed microflora to enhance biohydrogen production utilizing dairy wastewater as substrate. Bioresour. Technol. 99, 59–67. doi:10.1016/j.biortech.2006.12.004

Werner, J.J., Knights, D., Garcia, M.L., Scalfone, N.B., Smith, S., Yarasheski, K., Cummings, T.A., Beers, A.R., Knight, R., Angenent, L.T., 2011. Bacterial community structures are unique and resilient in full-scale bioenergy systems. Proc. Natl. Acad. Sci. doi:10.1073/pnas.1015676108

Wu, M., Sun, K., Zhang, Y., 2006. Influence of temperature fluctuation on thermophilic anaerobic digestion of municipal organic solid waste. J. Zhejiang Univ. Sci. B. doi:10.1631/jzus.2006.B0180

Yu, J., Takahashi, P., 2007. Biophotolysis-based hydrogen production by Cyanobacteria and green microalgae. Commun. Curr. Res. Educ. Top. trends Appl. Microbiol. 1, 79–89.

Zhang, T., Liu, H., Fang, H.H.P., 2003. Biohydrogen production from starch in wastewater under thermophilic condition. J. Environ. Manage. doi:10.1016/S0301-4797(03)00141-5

Chapter 3: Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities

Zhang, Y., Shen, J., 2006. Effect of temperature and iron concentration on the growth and hydrogen production of mixed bacteria. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2005.05.006

CHAPTER 4 Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short-term temperature fluctuations

ABSTRACT Hydrogen-producing mixed cultures were subjected to a 48-hours (h) downward or upward temperature fluctuation from 55 to 35 or 75 °C. Hydrogen production was monitored during the fluctuations and for three consecutive batch cultivations at 55 °C to evaluate the impact of temperature fluctuations and bioaugmentation with synthetic mixed culture of known H2- producers either during or after the fluctuation. Without augmentation, H2 production was significantly reduced during the downward temperature fluctuation and no H2 was produced during the upward fluctuation. H2 production improved significantly during temperature fluctuation when bioaugmentation was applied to cultures exposed to downward or upward temperatures. However, when bioaugmentation was applied after the fluctuation, i.e., when the cultures were returned to 55 °C, the H2 yields obtained was between 1.6 to 5% higher than when bioaugmentation was applied during the fluctuation. Thus, the results indicate the usefulness of bioaugmentation in process recovery, especially if bioaugmentation time is optimized.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

4.1. INTRODUCTION

Biological methods for H2 production, including biophotolysis, photo fermentation, dark fermentation and biocatalyzed electrolysis, have received increasing attention due to their ability to utilize renewable feedstocks such as organic wastes, plant biomass residues or sunlight for H2 generation (Dincer, 2012; Hallenbeck and Benemann, 2002). Among the above stated biological

H2 production methods, dark fermentation offers several advantages, such as no requirement for light, higher H2 production rates, simple bioreactor setup and wide versatility in the choice of the substrate (Chong et al., 2009; Kargi et al., 2012).

Dark fermentative H2 production can be carried out at mesophilic, thermophilic and hyperthermophilic conditions (Kargi et al., 2012; Shin et al., 2004) but is thermodynamically more favourable at higher temperatures (Zhang et al., 2014; Zheng et al., 2015). In addition, thermophilic bioprocesses typically result in higher H2 production rates as well as inhibition of pathogens (Sahlström, 2003) and H2 consumers such as methanogens and homoacetogens (Dessì et al., 2018b, 2018a). However, decreased bacterial diversity at higher temperatures can lead to instability of the bioprocess (Westerholm et al., 2018). Thermophilic processes are typically more sensitive to temperature fluctuations and require more consistent organic loading rate than mesophilic dark fermentation processes (Angelidaki and Ahring, 1994). At high loading rates, temperature of anaerobic processes can also increase due to high microbial activity (Daverio et al., 2003; Lindorfer et al., 2006). Possible upsets might also occur much faster at high temperatures due to faster microbial metabolism. However, the extent of the impact of varying bioreactor temperatures depend on the microbial communities present and the magnitude and duration of the temperature change (Okonkwo et al., 2019). A sudden, even transient temperature changes can produce varying responses in microbial populations resulting in an imbalanced metabolism and low process performance (Jiang and Morin, 2007; Okonkwo et al., 2019).

In the event of unwanted temperature fluctuation, restoring the activity of the microorganisms catalysing the biological processes can be time-consuming and cost intensive. One way to stabilise performance of a bioreactor during process disturbances, is to augment the bioreactor with H2 producing microorganisms (Ren et al., 2010; Wang et al., 2008). Over the years, bioaugmentation has been successfully applied for example to reduce the start-up time of dark fermentation (Pandit et al., 2015). Bioaugmentation was shown to protect the existing microbial community from organic loading shocks and reduce the susceptibility of the H2-producing bioreactors to process disturbances (Ács et al., 2015; Goud et al., 2014; Venkata Mohan et al.,

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

2009). In a study by Guo et al. (2010), Escherichia coli, Enterobacter aerogenes, and Bacillus subtilis were separately used under mesophilic conditions to improve H2 production from organic fraction of municipal solid waste (Guo et al., 2010). In another study, Goud et al. (2014) used acidogenic bacteria to enhance the H2 production from food waste at an elevated organic load of 50 g L-1 of the waste. Bioaugmentation strategy has also been applied as a means to decrease the recovery time of anaerobic digesters stressed by organic overloading (Acharya et al., 2015; Goud et al., 2014).

Different bacterial species possess varied optimal growth requirements and capacities to cope with stress related to changes in cultivation conditions such as changes in temperature or high H2 partial pressures (Pawar and van Niel, 2013). Therefore, the microorganisms chosen for bioaugmentation purposes should have the desirable properties needed to perform the required function under the specific operational conditions. In our previous study, we showed that effects of temporal temperature fluctuations on dark fermentative H2 production were more severe during and after upward temperature fluctuations (from 55 °C to 65 °C or 75 °C) than during and after downward temperature fluctuations (from 55 °C to 35 °C and from 55 °C to 45 °C) (Okonkwo et al., 2019). The aim of this study was to investigate the effects of augmenting thermophilic mixed cultures during and after periods of temperature shock, with a synthetic mixture of well-known H2 producers and the importance of bioaugmentation time on dark fermentative H2 production. To our knowledge, bioaugmentation with known H2 producing bacteria has not been previously studied as a means to resolve the adverse effects caused by sudden temperature fluctuations.

4.2. MATERIALS AND METHODS 4.2.1. Enrichment culture and medium composition

The inoculum used in this study was obtained from a H2 producing thermophilic (55 °C) continuous stirred tank reactor (CSTR) and the medium composition used is as described by Okonkwo et al. (2019). For the enrichment, anaerobically digested sludge heat treated at 90°C for 20 min was used for inoculation of the CSTR by adding 10% of the sludge to a final working volume of two litres. The reactor was flushed with nitrogen for 5 min and then operated in continuous mode at hydraulic retention time of 6 h and at 55 °C for a period of 21 days maintaining the pH at 6.5. The enriched microbial community consisted of members belonging to the genus Thermoanaerobacterium, Clostridium and Bacillus (Okonkwo et al., 2019). The medium

-1 contained the following compounds in mg L : K2HPO4, 500; NH4Cl, 100; MgCl2 · 6H2O, 120;

H8FeN2O8S2 · 6H2O, 55.3; ZnCl2, 1.0; MnCl2 · 4H2O, 2.0; CuSO4, 000.4; (NH4)6Mo7O24, 1.2; 80

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

COSO4, 1.3; H3BO3, 0.1; NiCl2 · 6H2O, 0.1; Na2O3Se, 0.01; CaCl2 · 2H2O, 80; yeast extract, 500 and 0.055 mL 37% HCl. The culture was fed with glucose (800 mg L-1) and xylose (1200 mg L- 1). Utilizing both glucose and xylose is a practical way to move towards efficient bioconversion of lignocellulosic wastes to H2.

4.2.2. Synthetic mixed culture used for bioaugmentation The following bacterial strains from DSMZ, Germany were selected for bioaugmentation: Thermoanaerobacter thermohydrosulfuricus (DSM-567), Caldicellulosiruptor saccharolyticus (DSM-8903), Clostridium thermocellum (DSM-1237), Thermoanaerobacterium thermosaccharolyticum (DSM-571) and Thermotoga neapolitana (DSM-4359). All the species are strictly anaerobic thermophiles except for T. neapolitana which can tolerate low oxygen concentration (Van Ooteghem et al., 2004). Together these bacteria form a synthetic consortium that has the following properties: Thermophilic with broad range of temperatures, not auxotrophic to any amino acids, and able to degrade wide range of organic substrates (Pawar and van Niel, 2013). Table 1 further shows the properties of the bacteria inoculated to the synthetic mixed culture used for bioaugmentation. The bacterial strains were cultivated individually at 65 °C using the medium previously described above and were then mixed together in a 1:1 ratio based on optical density to obtain the synthetic mixed culture. As individual cultures, the selected microorganisms are efficient H2 producers and are able to proliferate in the medium provided for this study. The synthetic culture was cultivated in batch (for 4 days) at 65 °C for three consecutive transfers to a final OD600 of 1.1 (on day 4 of the third batch cultivation cycle). The final synthetic culture was then used to study the effect of bioaugmentation during and after the temperature fluctuation periods as described in the next section. Since the bacteria in the consortium have growth temperatures ranging between 55 and 80 °C, 65 °C was considered as suitable temperature for the pre-cultivation. In addition, as our previous study showed that upward temperature fluctuations had more severe impacts on H2 production than downward temperature fluctuations (Okonkwo et al., 2019), incubation of the synthetic mixed culture at a temperature higher than 55 °C was hypothesized to provide the needed enhacement of H2 production especially in the cultures exposed to upward temperature fluctuations.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Table 1 Properties (growth temperature, pH range and oxygen sensitivity) of bacteria inoculated to the synthetic mixed culture used for bioaugmentation.

Bacterial species Temperature (°C) pH ranges Oxygen sensitivity References

Thermoanaerobacter 55-75 5.8-8.5 Obligate anaerobe Vos et al. 2011 thermohydrosulfuricus

Caldicellulosiruptor 65-75 5.2- 9 Obligate anaerobe Vos et al. 2011 saccharolyticus

Clostridium thermocellum 60-64 5.6-5.8 Obligate anaerobe Vos et al. 2011

Thermoanaerobacter 50-80 5.5-9 Obligate anaerobe Vos et al. 2011 thermosaccharolyticum

Obligate anaerobe but Jannasch et al. 1988; Van Thermotoga neapolitana 55-95 5.5-9 tolerates low oxygen Ooteghem et al. 2004

4.2.3. Experimental procedure The batch experiments were carried out in gas-tight 500 mL polypropylene centrifuge tubes (69 x 160 mm, Beckman Coulter) designed for gas and liquid sampling as well as centrifugation and cultivation. The microbial inoculum used in each batch corresponded to 10% of the total working volume (200 mL). Each cultivation tube was flushed with nitrogen for 5 min before starting the incubation.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Figure 1 Experimental setup to study the effects of bioaugmentation with a synthetic mixed culture on H2 production during and after temperature stress periods. All cultures were first incubated in batch at 55 °C for 48 h. Then some of the cultures were subjected to a 48-h temperature fluctuation at 35 or 75 °C (step 1) and subsequently incubated at 55 °C for three consecutive 48-h batch cultivation steps (steps 2, 3 and 4) (a). The experiment included also control cultures, which were incubated after the acclimatization period at 55 °C for four consecutive batch cultivation steps with and without bioaugmentation in step1 (b).

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Prior to exposing the cultures to temporal temperature fluctuations, the mixed culture inoculum was first acclimatized to batch growth conditions by incubating at 55°C for 48 h as shown in Figure 1. At 55 °C, the substrates were completely consumed by the end of the 48 h period. After the acclimatization, the cultures were subjected to either downward (from 55 to 35 °C) or upward temperature fluctuation (from 55 to 75 °C) of 48 h (referred to as step 1 in Figure 1) to evaluate the impact of temperature fluctuation on H2 production. After the stress period, each culture was centrifuged for 5 minutes; the spent medium was decanted and replaced with fresh medium, and the culture was then incubated again at 55 °C for 48 h. This was carried out for altogether three consecutive batch cultivations (steps 2, 3 and 4) to estimate the H2 production recovery after the temperature fluctuations. To determine the impact of bioaugmentation, cultures exposed to similar conditions (downward or upward temperature fluctuation) were augmented with the synthetic mixed cultures described in the previous section, either during or after the temperature fluctuation period (in the beginning of step 1 or in the beginning of step 2). The reason for the different bioaugmentation times was to monitor the effect of bioaugmentation time on H2 production. As a control, batch cultivations were also carried out at 55 °C for four consecutive cycles (step 1 to 4). The cultures were either unaugmented or augmented with the synthetic mixed culture in the beginning of step 1, to study the effect of bioaugmentation under stable incubation temperature. The synthetic mixed culture / inoculum (volume of synthetic mixed culture to volume of mixed culture inoculum) ratio that was used for enhancing H2 production during or after temperature fluctuation was 0.2. This bioaugmentation ratio was chosen, because according to Sharma and

Melkania (2018), the highest cumulative H2 production and volumetric H2 production was obtained with the bacteria/sludge ratio of 0.2 and 0.25, when they studied the effect of bioaugmentation on

H2 production from organic fraction of municipal solid waste.

The pH during the experiments was adjusted to 6.5 and the incubation temperatures were attained using temperature-controlled water baths. The experimental design described is similar to that employed by Okonkwo et al. (2019) to study the impact of temperature fluctuations on dark fermentative H2 production.

4.2.4. Analytical techniques and calculations conducted Glucose, xylose, organic acid and alcohol concentrations were measured by high performance liquid chromatography (HPLC) using a refractive index detector (Waters R410) as described previously by Monlau et al. (2013). The gas composition was analysed by a gas chromatograph (Clarus580, Perkin Elmer, Waltham, USA) equipped with a thermal conductivity detector (399152,

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Linde, Munich, Germany) and two columns: RtQBond to split H2, O2, N2, CH4 and RtMolsieve (5Å)

to quantify CO2. The carrier gas was argon at a pressure of 3.5 bar. The temperatures of the oven, injector and detector were 60 °C, 250 °C and 150 °C, respectively. The gas volume and composition measurements were conducted at the respective incubation temperatures mentioned in section 2.3 by retaining the cultivation bottles in the water baths during the sampling. The total

volume of produced H2 was calculated at standard temperature using Equation 1 (Logan et al., 2002).

V퐻2,t = V퐻2,t−1 + C퐻2,t(VG,t − VG,t−1) + 푉퐻(C퐻2,t − C퐻2,t−1) (1)

Where V퐻2,t is the cumulative H2 gas produced at time t, V퐻2,t−1 is the cumulative H2 gas produced

at t-1, VG,t is the total gas volume at time t, VG,t−1 is the total gas volume at time t-1, C퐻2,t is the H2

gas fraction in the headspace at time t, C퐻2,t−1 is the H2 gas fraction in the headspace at time t-1

and 푉퐻 is the total headspace volume in the culture bottle. H2 production in moles was calculated on the basis that one mole of an ideal gas will occupy a volume of 22.4 L at standard temperature

and pressure according to the ideal gas law. H2 yield was calculated by dividing the mol H2 per mole of hexose equivalent using the conversion factor of 5/6 for converting xylose to its hexose equivalent. Total chemical oxygen demand (COD) of soluble compounds was calculated based on the sum of acids, ethanol and residual sugars by using the following conversion factors: 1 mM glucose = 192 mg COD L-1, 1 mM xylose = 160 mg COD L-1, 1 mM acetate = 64 mg COD L-1, 1 mM propionate = 112 mg COD L-1, 1 mM lactate = 96 mg COD L-1, 1 mM butyrate = 160 mg COD L-1 and 1 mM ethanol = 96 mg COD L-1 (Gonzales and Kim, 2017; Sivagurunathan and Lin, 2016).

The relative H2 yield obtained during and after the temperature fluctuations was calculated using the results obtained in the unaugmented control using Equation 2:

H2 yield obtained during/after temperature shift Relative 퐻2 yield (%) = × 100 (2) average H2 yield obtained from the unaugmented control

4.2.5. Microbial analysis for unaugmented and augmented samples during temperature fluctuation Genomic DNA was extracted using the PowerSoil™ DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. Primers 515_532U and 909_928U (Wang and Qian, 2009) including their respective linkers were used to amplify the V4_V5 region of the 16S rRNA gene. The resulting products were purified and sequenced using Illumina MiSeq. Sequencing and library preparation were performed at the Genotoul Lifescience 85

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Network Genome and Transcriptome Core Facility in Toulouse, France. Sequence analysis was performed as previously described by Venkiteshwaran et al. (2016). The 16S rRNA sequences used to support the findings of this study have been deposited in the NCBI Sequence Read Archive under project file SUB6057113: MN203768 - MN203978.

4.3. RESULTS 4.3.1. Characterization of bacteria in the synthetic mixed culture Bacteria belonging to the genera Thermoanaerobacter, Caldicellulosiruptor, Clostridium, Thermoanaerobacterium and Thermotoga were added to the synthetic mixed culture that was used for bioaugmentation in this study. After incubation of the synthetic mixed culture for three consecutive 4-day batch cultivations at 65 °C, the microbial characterization revealed that the community included all the added bacterial genera with the exception of Clostridium (Figure 2). Compared to all the other bacteria in the culture, Thermoanaerobacter was seen to have the highest relative abundance (60%), followed by Thermoanaerobactium (25%). Thermotoga and Caldicellulosiruptor had an abundance of 8 and 7%, respectively.

Figure 2 Relative abundance (%) of each genera in the synthetic mixed culture used for bioaugmentation of the native mixed culture during and after the temperature fluctuations.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

4.3.2. Comparison between augmented and unaugmented cultures at constant temperature of 55 °C All the substrates (800 mg L-1 glucose and 1200 mg L-1 xylose) added to the unaugmented control cultures incubated at constant temperature of 55 °C were consumed within the 48 h period. The

H2 yield obtained from the unaugmented cultures was 1.85 ± 0.01, 1.80 ± 0.03, 1.86 ± 0.06 and

-1 1.89 ± 0.10 mol H2 mol hexose equivalent in steps 1, 2, 3 and 4, respectively, resulting in an

-1 average H2 yield of 1.85 ± 0.04 mol H2 mol hexose equivalent.

To determine the influence of bioaugmentation without any temperature stress, cultures incubated at constant temperature of 55 °C were augmented with the synthetic mixed culture in the beginning of step 1. The H2 yield obtained in the bioaugmented control cultures was 2.19 ± 0.08,

-1 2.07 ± 0.06, 2.07 ± 0.16 and 1.94 ± 0.01 mol H2 mol hexose equivalent in step 1, 2, 3 and 4,

-1 respectively. Thus, the average H2 yield was 2.07 ± 0.09 mol H2 mol hexose equivalent. The average H2 yield obtained with bioaugmentation was significantly higher than the average yield obtained from the unaugmented control cultures. A one-way ANOVA between the unaugmented and the augmented control cultures showed that the difference in H2 yield was statistically significant (p < 0.05).

Bioaugmentation had also a clear impact on the distribution of the soluble metabolites. The metabolites observed in all conditions included acetate, butyrate, ethanol and traces of lactate and propionate. The unaugmented cultures had a higher percentage of butyrate in all steps (Figure 3a), while bioaugmentation altered the metabolic profile by increasing the share of acetate production (Figure 3b). Propionate was also detected in steps 2 and 4 in the bioaugmented cultures.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Figure 3 Hydrogen yield and the contribution of the residual sugars and soluble metabolites to the endpoint COD at 55 °C in (a) the unaugmented control cultures and (b) in the augmented control cultures. Data represents mean values and standard deviation from duplicate cultivations. The red rectangle indicate the point at which bioaugmentation was applied.

4.3.3. Process recovery after the downward temperature shift and the impact of bioaugmentation A downward temperature fluctuation during dark fermentation was shown to have a negative impact on H2 production in the unaugmented cultures. The temperature shift from 55 to 35 °C in

-1 step 1 resulted in a H2 yield of 1.35 ± 0.13 mol H2 mol hexose equivalent (Figure 4a), which is

27% lower than the average H2 yield obtained under stable conditions with the unaugmented control (Figure 3a). After the temperature fluctuation period, the H2 yield increased gradually from step 2 to step 3 (Figure 4a). The H2 yields obtained in steps 2, 3 and 4 (after temperature

-1 fluctuation) were 1.52 ± 0.13, 1.75 ± 0.04, 1.66 ± 0.09 mol H2 mol hexose equivalent, respectively.

Cultures to which the bioaugmentation was applied at the beginning of temperature fluctuation

-1 (step 1) gave a H2 yield of 1.84 ± 0.04 mol H2 mol hexose equivalent during the fluctuation. The obtained H2 yield was similar to that observed with unaugmented control cultures incubated at

-1 55 °C (1.85 ± 0.04 mol H2 mol hexose equivalent), which indicated that the negative impact 88

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations caused by the downward temperature fluctuation could be compensated by bioaugmentation with the synthetic mixed culture. The H2 yield further increased to a maximum of 1.87 ± 0.01 mol H2 mol-1 hexose equivalent in step 3 when the temperature was returned to 55 °C (Figure 4b).

In cultures to which the bioaugmentation was applied after the temperature fluctuation (step 2),

H2 yield was higher than in the cultures to which the bioaugmentation was applied at the beginning

-1 of the temperature fluctuation, being 1.91 ± 0.05, 1.92 ± 0.02 and 1.92 ± 0.01 mol H2 mol hexose equivalent in steps 2, 3 and 4, respectively (Figure 4c).

Figure 4 Hydrogen yield and the contribution of the residual sugars and soluble metabolites to the endpoint COD during and after the downward temperature fluctuation from 55 to 35 °C (a) without bioaugmentation, (b) with bioaugmentation applied in the beginning the temperature fluctuation (step 1) and (c) with bioaugmentation applied after the temperature fluctuation in the beginning of step 2. Data represents mean values and standard deviation from duplicate cultivations. The red rectangles indicate the point at which bioaugmentation was applied.

The total soluble metabolic end-products calculated based on their COD was between 74 and 90% of the initial COD added as xylose and glucose (Figure 4). In the unaugmented cultures, the metabolites produced during the temperature fluctuation (step 1) were acetate, butyrate, ethanol, lactate and propionate (Figure 4a). The shift in temperature back to 55 °C caused a shift in the

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations distribution of the soluble metabolic products as acetate and ethanol showed a slight increase while the concentration of lactate reduced significantly and was not at all detected in steps 3 or 4 (Figure 4a). In cultures to which the bioaugmentation was applied during the temperature fluctuation, the share of acetate and ethanol increased significantly compared to the unaugmented cultures. Lactate slightly increased from step 1 to step 2 but was not detected in steps 3 and 4. Meanwhile, very low concentrations of propionate were also detected in steps 3 and 4 (Figure 4b). When the bioaugmentation was applied after the temperature fluctuation, acetate and ethanol share also increased compared to the unaugmented culture. Lactate was detected in step 2 but was not detected in steps 3 and 4 (Figure 4c), similarly to the cultures to which bioaugmentation was conducted during the fluctuation (Figure 4b).

During the downward temperature shift, Thermoanaerobacterium spp. was less dominant in the unaugmented cultures compared to incubation at 55 °C with a share of 27%, while Clostridium and Bacillus had a relative abundance of 22% and 31%, respectively. Other genera accounted for 18% of the community. Bioaugmentation in the beginning of the temperature fluctuation caused an increase in the relative abundance of Thermoanaerobacterium spp. from 27% in the unaugmented culture to 72%, which suggests that the Thermoanaerobacterium added was involved in H2 production during the downward temperature fluctuation despite the low temperature.

4.3.4. Process recovery after the upward temperature shift and impact of bioaugmentation Upward temperature fluctuation from 55 to 75°C was shown to have a severe impact on microbial metabolism as no H2 production was observed within the 48 h incubation period in the unaugmented culture or in the cultures to which bioaugmentation was done in the beginning of the temperature fluctuation (step 1). In the unaugmented cultures, when the temperature was

-1 taken back to 55 °C (step 2), H2 production occurred (1.27 ± 0.06 mol H2 mol hexose equivalent)

-1 and gradually increased to 1.43 ± 0.08 and 1.45 ± 0.01 mol H2 mol hexose equivalent in steps 3 and 4, respectively (Figure 5a). However, the highest H2 yield which was obtained in step 4 was still significantly lower (approximately 21%) than the average H2 yield obtained under stable temperature conditions (unaugmented control at 55 °C).

In the cultures augmented in the beginning of the temperature fluctuation period, H2 yield was

-1 1.45 ± 0.05, 1.74 ± 0.13, 1.89 ± 0.08 mol H2 mol hexose equivalent in steps 2, 3 and 4,

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

respectively (Figure 5b). The H2 production was higher than in the unaugmented culture exposed to upward temperature fluctuation and the highest H2 yield obtained (in step 4) was comparable to the H2 yield in the unaugmented control kept at 55 °C. In the cultures augmented after the temperature fluctuation period (in step 2), H2 yield was 1.53 ± 0.06, 1.76 ± 0.08, and 1.93 ± 0.04

-1 mol H2 mol hexose equivalent in steps 2, 3 and 4, respectively (Figure 5c).

Figure 5 H2 yield and the contribution of the residual sugars and soluble metabolites to the endpoint COD during and after the downward temperature fluctuation from 55 to 75 °C (a) without bioaugmentation, (b) with bioaugmentation applied during temperature fluctuation (step 1) and (c) with bioaugmentation applied after temperature fluctuation in the beginning of step 2. Data represents mean values and standard deviation from duplicate cultivations. The red rectangles indicate the point at which the bioaugmentation was applied.

During the upward temperature fluctuation, no VFAs and alcohols were formed in the unaugmented or in the cultures augmented in the beginning of the fluctuation, which further verified the absence of microbial activity. In the unaugmented cultures, the metabolites produced were acetate, butyrate, ethanol and lactate, when the temperature was shifted back to 55 °C (Figure 5a). Butyrate had the highest share of produced soluble metabolites, followed by ethanol and acetate. Lactate, which contributed 12% in step 2, reduced to 4% in step 4, while the share

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations of acetate and ethanol increased slightly. However, the contribution of butyrate remained relatively constant (Figure 5a). In the cultures to which the bioaugmentation was applied in the beginning of the temperature fluctuation, butyrate remained the most abundant soluble metabolite (Figure 5b). In the cultures to which the bioaugmentation was applied after the temperature fluctuation, there was also increased acetate and ethanol production observed and the share of lactate reduced gradually with each incubation step (Figure 5c), similar to the cultures augmented in the beginning of the fluctuation (Figure 5b).

4.4. DISCUSSION In this study, it was observed that bioaugmenting native microbial communities with synthetic mixed cultures during and after upward or downward temperature fluctuation enhanced H2 production and thus limited the negative impact observed in the control cultures. Prior to the augmentation, microbial data of the synthetic mixed culture used showed differences in the microbial distribution with Thermoanaerobacter having a higher relative abundance (60%) than the other species added, followed by Thermoanaerobacterium, Thermotoga and Caldicellulosiruptor (Figure 2). The difference in the relative distribution observed in the synthetic mixed culture was likely a result of the different growth rates of the different bacteria at the selected growth conditions (Akinosho et al., 2014; Vanfossen et al., 2009; Yu and Drapcho, 2011). Of all the species added to the synthetic culture, only C. thermocellum was not detected in the final synthetic mixed culture used for bioaugmenting. This was likely because the ability of the other bacteria to utilize xylose gave them a competitive advantage over C. thermocellum, since it does not metabolize xylose (Wilson et al., 2013) and has been shown to grow poorly on glucose (Ng and Zeikus, 1982). The preferred soluble sugars of C. thermocellulum are cellulose, cellobiose or cellodextrins (Stevenson and Weimer, 2005; Zhang and Lynd, 2005). Therefore, C. thermocellulum was already lost before the bioaugmentation of the synthetic cultures (Figure 2).

Compared to the unaugmented control culture incubated at constant temperature of 55 °C, the bioaugmented control cultures demonstrated an increase in H2 production compared to the unaugmented cultures. Additionally, the relative abundance of Thermoanaerobacterium spp., increased in the augmented cultures compared to the unaugmented cultures. Relating this observation to H2 production, suggests that Thermoanaerobacterium spp. had the most significant impact on the H2 production and might have influenced the increase in acetate concentration since it is capable of producing large amounts of acetate (Cao et al., 2010; O-Thong et al., 2008). The relative abundance of the other genera representing the added species was quite low

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

(Caldicellulosiruptor had a relative abundance of 0.02%, Thermoanaerobacter, 0.3% and Thermotoga, 0.04%).

For the cultures exposed to the downward temperature fluctuation, the relative H2 yield (H2 yield compared to the unaugmented control) after the temperature fluctuation period was 5 to 10% lower than the H2 yield obtained the unaugmented control at 55 °C. This implied that the downward temperature fluctuation caused a reduction in H2 yield even after three consecutive batch incubations at 55 °C. Gadow et al. (2013) reported similar observations when a H2 producing stirred tank reactor operated in a continuous mode with hydraulic retention time of 10 days was exposed to 24-h temperature fluctuation from 52 to 32 °C. They demonstrated a decrease of 27% in the H2 content during the temperature shock. Furthermore, the maximum H2 content they achieved after 10 days of recovery (at 55 °C) was 9% lower than the value before the temperature fluctuation. As shown in Figure 4c, H2 production was enhanced when bioaugmentation was applied in the beginning of the temperature fluctuation (in step 1). However, based on the differences in H2 production observed with the different bioaugmentation times, the short-term temperature fluctuation also caused stress on the microorganisms used in the bioaugmentation even though the differences were not statistically significant (p > 0.05). Thus, in order to maximize the recovery of H2 production after downward temperature fluctuations, it seems advisable to conduct the bioaugmentation after the fluctuation period. Alternatively, repeated bioaugmentation applied as soon as an unwanted temperature fluctuation is observed and after the temperature has been restored to a desired level, might also enable maximal process recovery after a temperature fluctuation period. For example, Yang et al. (2016) showed improved performance of anaerobic digestion with the application of repeated bioaugmentation.

The addition of synthetic mixed cultures during or after downward temperature fluctuation showed a positive impact in the enhancement of H2 production and improved the recovery time of bacterial activity when compared to the unaugmented cultures. Comparison between the unaugmented and the augmented cultures exposed to the downward temperature fluctuation showed that Thermoanaerobacterium spp. added into the microbial consortium played a significant role in the

H2 production observed during the downward temperature fluctuation. Other species present in the synthetic mixed culture used for bioaugmentation had a much lower relative abundance during the downward temperature fluctuation, as Thermoanaerobacter had a relative abundance of 0.8%, Caldicellulosiruptor 0.02% and Thermotoga 0.2%. Thus, they might have had little or no influence on the enhancement of H2 production, although Rafrafi et al. (2013) have reported that,

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations despite low levels of abundance, subdominant species are able to influence the global microbial metabolic network in mixed cultures.

Cultures exposed to the upward temperature fluctuation had a completely different response to

H2 production when compared to the cultures exposed to the downward temperature fluctuation. During the upward temperature fluctuation (75 °C), no metabolic activity was observed for the 48 h period. However, this did not imply complete deterioration of the culture, as microbial activity was observed when the temperature was brought back to the original incubation temperature of

55 °C. Nonetheless, H2 production observed was significantly lower compared to the control cultures maintained at 55 °C. It was unexpected that no H2 production was observed in the cultures augmented in the beginning of the upward temperature fluctuation as the synthetic mixed culture used for the bioaugmentation contained Caldicellulosiruptor and Thermotoga capable of producing H2 at extremely high temperatures of 70 and 80 °C, respectively (Abreu et al., 2016). Additionally, based on the wide temperature and pH range of T. neapolitana, it was expected that it would have been an excellent member of the microbial community during the temperature fluctuation at 75 °C. Nonetheless, it is possible that the 48 h fluctuation period was too short for the bacteria to get adapted to the high temperature, which is why there was no sign of microbial activity observed. When comparing the cultures which were augmented at different times, higher

H2 yields were obtained when the bioaugmentation was applied after the upward temperature fluctuation than when the augmentation was applied in the beginning of the temperature fluctuation. Although the differences in H2 yield obtained from the different bioaugmentation times were not statistically significant (P > 0.05), it is likely that also the bacteria used for bioaugmentation were negatively affected by the upward temperature stress. Nonetheless, bioaugmentation proved to be an effective strategy for enhancing H2 production after the temperature stress. Furthermore, the bioaugmentation is also considered important for boosting the microbial diversity especially after upward temperature fluctuations, as even short-term upward temperature fluctuations have been demonstrated to result in loss of microbial diversity (Gadow et al., 2013; Okonkwo et al., 2019).

It was expected that Thermoanaerobacter thermohydrosulfuricus would be an active participant in the consortium during the downward or upward temperature fluctuation due to its relatively high abundance (60%) observed in the synthetic mixed culture (Figure 2). Furthermore, Thermoanaerobacter has been shown to grow in conditions, which are similar to the cultivation conditions used in this study (Table 1). Even though Thermoanaerobacter was the dominant

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations genus in the synthetic mixed cultures prior to augmentation, while the results obtained from the augmented cultures showed that Thermoanaerobacterium became the most dominant species during or after bioaugmentation under all studied conditions except in unaugmented cultures undergoing downward temperature fluctuation. It is possible that the pre-existence and dominance of Thermoanaerobacterium spp. prior to augmentation ensured optimal growth/survival of the specie and better metabolic adaptation compared to the other species added in the consortium. It has been reported that Thermoanaerobacterium thermosaccharolyticum (which was among of the bacteria in the synthetic mixed culture) is able to grow at 35-37 °C if spores are first germinated at a higher temperature (Ashton, 1981). Hence, the dominance of Thermoanaerobacterium spp. might have been as a result of its ability to better cope with temperature stress as opposed to the other species. As seen in Figures 4 and 5 between unaugmented and augmented cultures, stress factors such as temperature slows adaptation time and might have prevented the activity of the other species or their proliferation. Chen et al. (2015) demonstrated that the successful application of bioaugmentation relied upon the adaptation or coexistence of the bioaugmented bacteria to indigenous microorganisms. The increase in the abundance of Thermoanaerobacterium in the augmented cultures caused a relative decrease in abundance of the other microbial genera in the consortium.

The addition of bacteria into a native consortium has been shown in previous studies to affect the metabolic distribution and depending on the metabolic pathways utilized by the bacteria added, an additional pathway might be observed (Yang et al., 2016a). It is therefore important to choose bacteria, which are directly involved with H2 production, for bioaugmentation. Furthermore, it is likely that during the heat shock, some of the microorganisms formed spores as a mechanism to overcome the heat shock, which would explain the gradual increase in H2 yield from step 2 to 4 after the upward temperature fluctuation. For example, Thermoanaerobacterium has been reported to form spores, which are heat resistant (Lee et al., 1993; Mtimet et al., 2016). Thus, the strengthening of a microbial consortium by bioaugmentation improves recovered activity during or after stress periods. This study demonstrated that bioaugmenting a H2 producing mixed culture with a synthetic mixed culture consisting of known H2-producing bacteria can be used as an effective approach for enhancing H2 production performance during temperature fluctuations. However, the positive effects of bioaugmentation were even higher, when it was applied after the temperature fluctuation. Thus, bioaugmentation both during and after the temperature fluctuation could also be a valid option.

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

REFERENCES Abreu, A.A., Tavares, F., Alves, M.M., Pereira, M.A., 2016. Boosting dark fermentation with co- cultures of extreme thermophiles for biohythane production from garden waste. Bioresour. Technol. 219, 132–138. doi:10.1016/j.biortech.2016.07.096

Acharya, S.M., Kundu, K., Sreekrishnan, T.R., 2015. Improved Stability of Anaerobic Digestion through the Use of Selective Acidogenic Culture. J. Environ. Eng. doi:10.1061/(ASCE)EE.1943-7870.0000932

Akinosho, H., Yee, K., Close, D., Ragauskas, A., 2014. The emergence of Clostridium thermocellum as a high utility candidate for consolidated bioprocessing applications. Front. Chem. 2, 66. doi:10.3389/fchem.2014.00066

Angelidaki, I., Ahring, B.K., 1994. Anaerobic thermophilic digestion of manure at different ammonia loads: Effect of temperature. Water Res. doi:10.1016/0043-1354(94)90153-8

Ashton, D.H., 1981. Thermophilic Organisms Involved in Food Spoilage: Thermophilic Anaerobes not Producing Hydrogen Sulfide. J. Food Prot. doi:10.4315/0362-028x-44.2.146

Cao, G.L., Ren, N.Q., Wang, A.J., Guo, W.Q., Xu, J.F., Liu, B.F., 2010. Effect of lignocellulose- derived inhibitors on growth and hydrogen production by Thermoanaerobacterium thermosaccharolyticum W16. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.11.127

Chen, Q., Ni, J., Ma, T., Liu, T., Zheng, M., 2015. Bioaugmentation treatment of municipal wastewater with heterotrophic-aerobic nitrogen removal bacteria in a pilot-scale SBR. Bioresour. Technol. doi:10.1016/j.biortech.2015.02.022

Daverio, E., Spanjers, H., Bassani, C., Ligthart, J., Nieman, H., 2003. Calorimetric investigation of anaerobic digestion: Biomass adaptation and temperature effect. Biotechnol. Bioeng. doi:10.1002/bit.10595

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Dincer, I., 2012. Green methods for hydrogen production, in: Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2011.03.173

Hallenbeck, P.C., Benemann, J.R., 2002. Biological hydrogen production; Fundamentals and limiting processes, in: Int. J. Hydrogen Energy. pp. 1185–1193. doi:10.1016/S0360- 3199(02)00131-3

Jannasch, H.W., Huber, R., Belkin, S., Stetter, K.O., 1988. Thermotoga neapolitana sp. nov. of the extremely thermophilic, eubacterial genus Thermotoga. Arch. Microbiol. 150, 103– 104.

Jiang, L., Morin, P.J., 2007. Temperature fluctuation facilitates coexistence of competing species in experimental microbial communities. J. Anim. Ecol. 76, 660–668. doi:10.1111/j.1365- 2656.2007.01252.x 97

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Lee, Y.E., Jain, M.K., Lee, C., Zeikus, J.G., 1993. Taxonomic Distinction of Saccharolytic Thermophilic Anaerobes. Int. J. Syst. Bacteriol. doi:10.1099/00207713-43-1-41

Lindorfer, H., Braun, R., Kirchmayr, R., 2006. Self-heating of anaerobic digesters using energy crops. Water Sci. Technol. doi:10.2166/wst.2006.246

Logan, B.E., Oh, S.E., Kim, I.S., Van Ginkel, S., 2002. Biological hydrogen production measured in batch anaerobic respirometers. Environ. Sci. Technol. 36, 2530–2535. doi:10.1021/es015783i

Ng, T.K., Zeikus, J.G., 1982. Differential metabolism of cellobiose and glucose by Clostridium thermocellum and Clostridium thermohydrosulfuricum. J. Bacteriol.

Okonkwo, O., Escudie, R., Bernet, N., Mangayil, R., Lakaniemi, A.-M., Trably, E., 2019. Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities. Int. J. Hydrogen Energy.

Pawar, S.S., van Niel, E.W.J., 2013. Thermophilic biohydrogen production: how far are we? Appl. Microbiol. Biotechnol. 97, 7999–8009. doi:10.1007/s00253-013-5141-1

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Ren, N.Q., Wang, D.Y., Yang, C.P., Wang, L., Xu, J.L., Li, Y.F., 2010. Selection and isolation of hydrogen-producing fermentative bacteria with high yield and rate and its bioaugmentation process. Int. J. Hydrogen Energy 35, 2877–2882. doi:10.1016/j.ijhydene.2009.05.040

Sahlström, L., 2003. A review of survival of pathogenic bacteria in organic waste used in biogas plants. Bioresour. Technol. doi:10.1016/S0960-8524(02)00168-2

Sharma, P., Melkania, U., 2018. Effect of bioaugmentation on hydrogen production from organic fraction of municipal solid waste. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2018.03.031

Shin, H.S., Youn, J.H., Kim, S.H., 2004. Hydrogen production from food waste in anaerobic mesophilic and thermophilic acidogenesis. Int. J. Hydrogen Energy 29, 1355–1363. doi:10.1016/j.ijhydene.2003.09.011

Stevenson, D.M., Weimer, P.J., 2005. Expression of 17 genes in Clostridium thermocellum ATCC 27405 during fermentation of cellulose or cellobiose in continuous culture. Appl. Environ. Microbiol. doi:10.1128/AEM.71.8.4672-4678.2005

Van Ooteghem, S.A., Jones, A., van der Lelie, D., Dong, B., Mahajan, D., 2004. H2 production and carbon utilization by Thermotoga neapolitana under anaerobic and microaerobic growth conditions. Biotechnol. Lett. 26, 1223–1232.

Vanfossen, A.L., Verhaart, M.R.A., Kengen, M.W., Kelly, R.M., 2009. Carbohydrate Utilization Patterns for the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus Reveal Broad Growth Substrate Preferences ᰔ † 75, 7718–7724. doi:10.1128/AEM.01959-09

Venkata Mohan, S., Falkentoft, C., Venkata Nancharaiah, Y., Sturm, B.S.M., Wattiau, P., Wilderer, P.A., Wuertz, S., Hausner, M., 2009. Bioaugmentation of microbial communities

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

in laboratory and pilot scale sequencing batch biofilm reactors using the TOL plasmid. Bioresour. Technol. 100, 1746–1753. doi:10.1016/j.biortech.2008.09.048

Venkiteshwaran, K., Milferstedt, K., Hamelin, J., Zitomer, D.H., 2016. Anaerobic digester bioaugmentation influences quasi steady state performance and microbial community. Water Res. 104, 128–136. doi:10.1016/j.watres.2016.08.012

Vos, P., Garrity, G., Jones, D., Krieg, N.R., Ludwig, W., Rainey, F.A., Schleifer, K.-H., Whitman, W.B., 2011. Bergey’s manual of systematic bacteriology: Volume 3: The Firmicutes. Springer Science & Business Media.

Wang, A., Ren, N., Shi, Y., Lee, D.J., 2008. Bioaugmented hydrogen production from microcrystalline cellulose using co-culture-Clostridium acetobutylicum X9 and Ethanoigenens harbinense B49. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2007.10.017

Wang, Y., Qian, P.Y., 2009. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies. PLoS One 4. doi:10.1371/journal.pone.0007401

Wilson, C.M., Rodriguez, M., Johnson, C.M., Martin, S.L., Chu, T.M., Wolfinger, R.D., Hauser, L.J., Land, M.L., Klingeman, D.M., Syed, M.H., Ragauskas, A.J., Tschaplinski, T.J., Mielenz, J.R., Brown, S.D., 2013. Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass. Biotechnol. Biofuels. doi:10.1186/1754-6834-6-179

Yang, Z., Guo, R., Shi, X., He, S., Wang, L., Dai, M., Qiu, Y., Dang, X., 2016a. Bioaugmentation of Hydrogenispora ethanolica LX-B affects hydrogen production through altering indigenous bacterial community structure. Bioresour. Technol. 211, 319–326. doi:10.1016/j.biortech.2016.03.097

Yang, Z., Guo, R., Xu, X., Wang, L., Dai, M., 2016b. Enhanced methane production via repeated batch bioaugmentation pattern of enriched microbial consortia. Bioresour. Technol. doi:10.1016/j.biortech.2016.05.062

100

Chapter 4: Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short- term temperature fluctuations

Yu, X., Drapcho, C.M., 2011. Hydrogen production by the hyperthermophilic bacterium Thermotoga neapolitana using agricultural-based carbon and nitrogen sources. Biol. Eng. Trans.

Zhang, Y.H.P., Lynd, L.R., 2005. Cellulose utilization by Clostridium thermocellum: Bioenergetics and hydrolysis product assimilation. Proc. Natl. Acad. Sci. U. S. A. doi:10.1073/pnas.0408734102

Zheng, H., Zeng, R.J., Duke, M.C., O’Sullivan, C.A., Clarke, W.P., 2015. Changes in glucose fermentation pathways by an enriched bacterial culture in response to regulated dissolved

H2 concentrations. Biotechnol. Bioeng. doi:10.1002/bit.25525

101

CHAPTER 5 Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

ABSTRACT This study demonstrates the potential for biohydrogen production in a co-culture of two ecologically distant species, Thermatoga neapolitana and Caldicellulosiruptor saccharolyticus, and the development of a quantitative real-time PCR (qPCR) method for quantifying the hyperthermophilic bacterium of the genus Thermotoga. Substrate utilization and H2 production performance was compared to those of their individual cultures. The highest H2 yields obtained

-1 were 2.7 ± 0.05, 2.5 ± 0.07 and 2.8 ± 0.09 mol H2 mol glucose for C. saccharolyticus, T. neapolitana, and their co-culture respectively. Statistical analysis comparing the H2 production rate of the co-culture to either C. saccahrolyticus or T. neapolitana pure cultures indicated a significant difference in the H2 production rate (p<0.05: t-test), with the highest rate of H2 production (36.02 mL L-1 h-1) observed from the co-culture fermentations. In order to monitor the presence of T. neapolitana in the bioprocess, we developed a qPCR method using 16S rRNA gene and hydrogenase (hydA) gene targets. The qPCR data using hydA primers specific to T. neapolitana showed an increase in hydA gene copies from 3.32 × 107 to 4.4 × 108 hydA gene copies per mL confirming the influence of T. neapolitana in the synthetic consortium.

102

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production 5.1. INTRODUCTION The global trends of fossil fuel depletion and impact on climate change due to over-exploitation of natural resources have led to a search for alternative measures to produce renewable energy

(Fino, 2014; International Energy Agency, 2006). Today, H2 is used in the chemical industry as a fundamental building block e.g. for the production of ammonia-fertilizers and methanol used for manufacturing of many polymers (Andrews and Shabani, 2012). H2 is presently produced from natural gas, heavy oils, naphtha and coal (Nath and Das, 2003; Suzuki, 1982) which are not sustainable feedstocks. Hence, there is a need for alternative H2 production routes. One of the means that have been highly considered for sustainable energy is biological H2 production (Hallenbeck, 2012, 2009; Hallenbeck et al., 2012; Hallenbeck and Benemann, 2002).

Research on biological H2 production has increased over the years leading to several reports on methods such as: direct and indirect photolysis, water-gas shift reaction, photofermentation, biocatalysed electrolysis and dark fermentation (Hemschemeier et al., 2009; Melis et al., 2000). Dark fermentation has garnered interest due to the ability to utilize a wide variety of waste streams and energy crops as substrate for H2 production, and high H2 production rates (10–15 × 103 ml

-1 -1 H2 L h ) (Hallenbeck et al., 2012; Zeidan and van Niel, 2010). Dark fermentative H2 production can occur under mesophilic (typically between 30-45 °C), thermophilic (50-60 °C) or hyperthermophilic conditions (from 60 °C upwards). Compared to mesophilic conditions, higher temperatures favor H2 production (De Vrije et al., 2007; Kádár et al., 2004), because the temperature at which the reaction takes place affects the thermodynamic process according to ΔG0 = ΔH – TΔS0 and increases the kinetics of chemical reactions thereby speeding up the reactions (Stams, 1994; Verhaart et al., 2010).

Several bacterial species have been identified for their ability to produce high volumes of H2 at hyperthermophilic conditions. An example is the bacterium Thermotoga neapolitana. Substantial efforts in research have been carried out by studying the interactivity of co-culture systems to increase H2 production. The use of co-cultures in H2 production has been studied extensively and has been shown to offer various advantages such as the reduction in lag phase, resistance to environmental fluctuations as well improvement in H2 production (Chang et al., 2008; Cheng and Zhu, 2013; Laxman Pachapur et al., 2015; Li and Liu, 2012; Y. Liu et al., 2008; Pachapur et al., 2015). Recently, there has been a renewed interest in using designed co-culture microorganisms for improving yields of various products and improving the range of substrate utilization (Chang et al., 2008; Cheng and Zhu, 2013; Li and Liu, 2012; Vatsala et al., 2008). Using defined

103

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production mesophilic microorganisms, the elaboration of a co-culture system was studied in a pilot scale, treating distillery effluent. The results showed the potential of H2 production with viable application towards industrialization (Vatsala et al., 2008). However, only few studies, have reported the use of designed thermophilic co-cultures for H2 production (Li and Liu, 2012; Pawar et al., 2015; Zeidan et al., 2010; Zeidan and Van Niel, 2009).

A variety of interesting interactions can be expected by combining microorganisms from different habitats, some of which might be potentially useful for H2 production such as, tolerance to higher

H2 partial pressure, high substrate concentration. Being potentially more robust to environmental changes, microbial co-cultures are also better able to withstand periods of nutrient limitation (Li and Liu, 2012; Y. Liu et al., 2008; Zeidan et al., 2010; Zeidan and Van Niel, 2009). Until now, the creation of a stable microbial community consisting of two or more members has been quite challenging due to the diverse growth rates of different members and the subsequent imbalance between the consumption and production metabolites.

In recent years, there has been a significant increase in the studies on T. neapolitana, as it has

-1 enabled one of the best H2 yields (3.8 mol H2 mol glucose) that have been reported in literature

(Laxman Pachapur et al., 2015) (Li and Liu, 2012). Combined with its ability to produce high H2 yields at elevated temperatures (55 - 85 °C), T. neapolitana, is capable of metabolizing a wide range of simple and complex carbohydrates such as hexoses, pentoses, disaccharides, glucan and amorphous cellulose (D’Ippolito et al., 2010; Frascari et al., 2013; Maru et al., 2012; Van Ooteghem et al., 2004). Previous studies on T. neapolitana have focused on optimizing growth and H2 production conditions for pure cultures of members of Thermotoga sp. (Han et al., 2014; Van Ooteghem et al., 2004). However, molecular methods are still needed to better understand and answer questions relating to T. neapolitana’s physiological, ecological and metabolic features. A deeper understanding of the bacterium will allow for its metabolic engineering and use in biotechnological applications. Developing molecular methods for monitoring the activity of T. neapolitana in various systems require a more accurate representation that would take into account their dynamics and interactions in a mixed consortium while carrying out individual metabolic processes. Reports on biohydrogen production from hyperthermophilic microorganisms have mostly utilized conventional methods for monitoring the growth of the microbial population such as dry cell weight, optical density (OD) (biased in the case of floc formers like T. neapolitana) or microscopy (Eriksen et al., 2008; Han et al., 2014; Ngo et al., 2012, 2011; Van Ooteghem et al., 2004, 2002). Some of these methods are only suitable for monocultures and fail to differentiate between different species. Furthermore, members of the genus Thermotoga undergo floc 104

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production formation which often causes ambiguities in cell enumeration (Lakhal et al., 2011). With the continued increase in the number of sequenced microbial genomes, unveiling the different mechanisms of interspecies relationships can be facilitated by use of molecular and metabolic modeling based approaches (Bouchez et al., 2000; Herrero and Stuckey, 2015; Vanwonterghem et al., 2014).

In the present work, co-cultivation of two ecologically distant organisms for improved H2 evolution and the development of a quantitative PCR assay for genus and species-level monitoring of Thermatoga was carried out. The 16S rRNA gene method was designed to target eight members of the group Themotoga. Given the high degree of similarity and absence of correlation that may occur between 16S rRNA gene and H2 producing activity in T. neapolitana, we further developed a qPCR approach targeting the hydA gene for a more comprehensive evaluation of T neapolitana in a synthetic culture. To our knowledge, studies targeting the hydrogenase gene for specie-level monitoring of hyperthermophiles have not been previously published.

5.2. MATERIALS AND METHODS 5.2.1. Bacterial strains and growth conditions Bacterial strains Thermotoga neapolitana DSM-4359, Thermotoga maritima DSM-3109 and Caldicellulosiruptor saccharolyticus DSM-8903 (DSMZ, Germany) were used in this study. T. neapolitana was cultivated either as a pure culture or with C. saccharolyticus as a synthetic co- culture. The medium used for cultivation of T. neapolitana contained the following components

(g/L): NH4Cl, 1.0; K2HPO4, 0.3; KH2PO4, 0.3; MgCl2 x 6 H2O, 0.2; CaCl2 x 2H2O, 0.1; NaCl, 5.0; KCl, 0.1; cysteine-HCl, 1.0; yeast extract, 2.0; 10.0 ml L-1 of vitamin and trace element (DSMZ 141, Germany) solution. C. saccharolyticus pure culture was initially maintained in DSMZ 641 medium. The initial medium pH was adjusted to 7.5 (20 °C) for all cultures with 5 M NaOH. Thirty milliliters of the prepared media was dispensed anaerobically into 120 ml serum bottles. The bottles were sealed with butyl rubber stoppers, capped with aluminum crimps and autoclaved for 15 min at 121 °C. Unless otherwise mentioned, glucose (20mM) was added after sterilization and the bottles containing the growth medium were inoculated with 10 % (v/v) inoculum under anoxic conditions. Triplicate cultivations of T. neapolitana and C. saccharolyticus as a pure culture and as a synthetic co-culture were carried out. For the inocula, 3 mL of pre-cultivated T. neapolitana and C. saccharolyticus having OD600nm of 0.2 and 0.1 respectively (10% of the total culture volume) was used in the pure culture incubations. In case of the co-culture, 1.5 mL of the pre- cultivated T. neapolitana and C.saccharolyticus were used (total inoculum accounted for 10% of

105

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production the culture volume). The cultures were incubated at 75°C and 150 rpm. To validate the specificity of the primers developed in this study, microbial community from a H2 producing fluidized bed bioreactor without Thermotoga was used (Dessì et al., 2017) as well as pure cultures of T. neapolitana and C. saccharolyticus.

5.2.2. Analytical techniques The cell concentration of the culture suspension containing bacterial cells was determined by measuring the absorbance spectrometrically with an Ultraspec 200 Pro spectrophotometer

(Amersham Biosciences, Munich, Germany) at 600 nm. H2 and carbon dioxide levels in the gas phase were measured at regular intervals to monitor the activity of the microbial consortium. The total gas volume was first measured by releasing the pressure in the culture bottle using a syringe method (Owen et al., 1979). The headspace of each culture bottle was sampled using a gas tight syringe with 0.2 mL injection volume. The gas composition was then analyzed with a Shimadzu gas chromatograph GC–2014 equipped with a Porapak N column (80/100 mesh) and a thermal conductivity detector. Nitrogen was used as the carrier gas and the injector, column and detector temperatures were 110 °C, 80 °C and 110 °C respectively. The total volume of the gas produced at each time point was calculated using equation 1 (Dessì et al., 2017; Logan et al., 2002):

푉퐻2,푡 = 푉퐻2,푡−1 + 퐶퐻2,푡(푉퐺,푡 − 푉퐺,푡−1) + 푉퐻(퐶퐻2,푡 − 퐶퐻2,푡−1) (1)

Where 푉퐻2,푡 is the cumulative H2 gas produced at time t, 푉퐻2,푡−1 is the cumulative H2 gas produced at time t-1, 푉퐺,푡 is the total gas volume at time t, 푉퐺,푡−1 is the total gas volume at time t-1, 퐶퐻2,푡 is the H2 gas fraction in the headspace at time t, 퐶퐻2,푡−1 is the H2 gas fraction in the headspace at time t-1 and 푉퐻 is the total headspace volume in the culture bottle. H2 production was calculated and 75 °C this temperature was used for the gas law calculations. Glucose, lactate and acetate and ethanol were measured using a high performance liquid chromatograph (HPLC) equipped with a Rezex RHM-monosaccharide H+ (8%) column (Phenomenex, USA) and a refractive index detector (Shimadzu, Kyoto, Japan). The mobile phase used was 0.01 N H2SO4 at a flow rate of 0.6 mL min-1. At the end of 100 h period of incubation, samples from the co-cultures were harvested, centrifuged and stored at -20 °C for genomic isolation and molecular analyses.

5.2.3. Genomic DNA isolation Genomic DNA of both pure (T. neapolitana, T. maritima and C. saccharolyticus) and synthetic co- cultures of T. neapolitana and C. saccharolyticus were isolated with Blood and tissue genomic

106

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

DNA extraction miniprep system (Viogen, USA) according to the manufacturer’s instructions. The protocol was optimized by including three freeze and thaw cycles to enhance genomic DNA recovery.

5.2.4. 16S rRNA gene and hydA primer design In this study 16S rRNA and hydA genes were targeted for genus and species level monitoring of Thermotoga sp. The 16S rRNA primers for the members of Thermotoga sp. was designed with Clustal Omega software (http://www.ebi.ac.uk/Tools/msa/clustalo/). The multiple sequence alignments were designed to contain four different bacterial species from three genera: T. neapolitana, T. maritima, C. saccharolyticus, Thermoanaerobacterium thermosaccharolyticum. The region, conserved only for Thermotoga sp. were selected and employed in the primer designing using the Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer specificities towards 16S rRNA gene of Thermotoga sp. were evaluated using arb-silva (https://www.arb-silva.de/search/testprime/), an in silico PCR analysis tool which uses 16S/18S rRNA non-redundant reference dataset, SSURef 108 NR (Klindworth et al., 2013).

The primers were designed to have an amplicon length of 100 to 150 bp and primer melting temperature of 55 °C to 60 °C. The G+C content was between 50 - 60% with not more than three consecutive G or C bases in the primer sequence. The specificity of the primers was manually verified using nucleotide BLAST. Based on the nucleotide sequences, a primer set was designed to amplify the 16S rRNA gene of Thermotoga sp. (Fwd, 5’-TACCCCATACGCTCCATCAA-3’; Rev, 5’-CCGTTACCCCACCAACTAC-3’) and T. neapolitana hydA (hydA_F, AGTACACGGCATGAAGGAGA; hydA_R, CGCAGAACACAACTATCCAC-3’). The applicability and specificity of the developed primers was tested using the H2-producing cultures of T. neapolitana, T. maritima, C. saccharolyticus and mixed cultures from fluidized bed bioreactor, known to contain members of the genus Thermoanaerobacterium (Dessì et al., 2017). Melt curve analysis was conducted simultaneously with the real-time quantitative PCR (qPCR) and the success of the assays (qPCR products) was evaluated on agarose gel electrophoresis (1 % agarose, 0.2 V for 20 min).

5.2.5. Real-time quantitative PCR Optimization of primer annealing temperatures for 16S rRNA and hydA genes were performed by testing six annealing temperatures for 16S rRNA and hydA amplifications (48 °C, 53 °C, 55 °C, 58 °C, 60 °C and 65 °C) separately for both primer pairs. T. neapolitana genomic DNA was used

107

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production as the template to generate the standard curve and the assays were conducted using 10-fold serial dilutions of the template DNA. Genomic standards were subsequently run simultaneously with unknown samples to determine the gene copy number (gene copies per mL) and the copy number of T. neapolitana was calculated based on the genome size (1.88 Mb). The amplifications were carried out in triplicates with the Applied biosystems StepOnePlus real-time PCR (ThermoFisher Scientfic, USA). Each 20 µL qPCR reaction mixture contained 10 µL of Maxima SybrGreen/ROX qPCR master mix (Thermo Scientific, USA), 0.4 µL each of 10 µM forward and reverse primers, 7.2 µL of nuclease free water and 2 µL of genomic DNA as template. The qPCR conditions were as follows: 10 min at 95 °C followed by an extension step of 40 cycles of 15s at 95 °C and 1 min at 60 °C. To determine primer specificity, melt curve analysis was done under the following conditions: 15 s at 95 °C, 1 min at 65 °C and 15 s at 95 °C. The slope and y-intercept of the standard curves were evaluated using a linear regression analysis (Tolvanen et al., 2008). Gene copies per ng of DNA extracted and the gene copies per sample were evaluated according to equation 2 and 3, respectively (Ritalahti et al., 2006). The amplification efficiencies were calculated using equation 4.

1g 1 mol bp DNA 6.023×1023bp 1 copy Gene copies = DNA[ng/µL] × 3 × × × × vol. DNA usedµL(2) 1000 ng 660 g DNA mol bp genome sizebp

(gene copies per rxn mix)×(volume of DNA in µL) 퐺푒푛푒 푐표푝푖푒푠 푝푒푟 푠푎푚푝푙푒 푣표푙푢푚푒 = (3) (volume of DNA template per rxn mix)×(volume of sample used)

1 (− ) 퐸푓푓푖푐푖푒푛푐푦 = [−1 + 10 푠푙표푝푒 ] (4)

5.3. RESULTS AND DISCUSSION 5.3.1. Comparing hydrogen production between individual cultures and co-cultures of T. neapolitana and C. saccharolyticus monocultures

The H2 production by the hyperthermophiles T. neapolitana and C. saccharolyticus was evaluated both as pure cultures and as a synthetic co-culture. For the pure culture of C. saccharolyticus, a

-1 -1 lag phase of 9 h was observed. The maximum H2 production rate obtained was 24.65 mL L h .

The growth obtained from OD measurements reached a maximum OD600nm of 0.66 ± 0.03 (Figure 1). A decrease in the OD was observed after glucose was completely consumed at 100 h suggesting that the cultures entered death phase upon depletion of the carbon source. The H2

-1 yield obtained was 2.7 ± 0.05 mol H2 mol glucose. Glucose consumption resulted in acetate

108

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production production with the absence of lactate formation (Figure 1). The absence of lactate in the pure culture of C. saccharolyticus was likely as a result of a low partial H2 pressure (PH2) during the cultivations. A high PH2 during dark fermentation is known to cause a shift in the metabolic pathway (Chandrasekhar et al., 2015; Nualsri et al., 2017; Sharma and Arya, 2017).

Figure 1 H2 production, glucose consumption, OD600nm of the culture suspensions and soluble metabolites produced by C. saccharolyticus (●) H2 production, (■) Glucose consumption, (∆) Lactate, (◆) Acetate and (▲) OD. The error bars represent the standard deviation from triplicate cultures. In some cases, the error bars are smaller than the symbol.

Compared to C. saccharolyticus, T. neapolitana pure cultures had a longer lag phase of 19 h and

-1 -1 the maximum H2 production rate obtained was lower (15.51 mL L h ) than in the synthetic co-

-1 culture or pure culture of C. saccharolyticus. The H2 yield achieved was 2.5 (±0.07) mol H2 mol glucose and compared to C. saccharolyticus, the consumption of glucose was slower (Figure 2). Similar to C. saccharolyticus, the major metabolite formed was acetate. Lactate was also produced between incubation time 60 h and 100 h. The OD values obtained for T. neapolitana were low (0.44 ± 0.05) but this was expected due to the floc formation by the bacterium (Lakhal et al., 2011). Prior to OD measurements, vigorously shaking of the culture to disentangle the floc had little impact on the cell density measurements. Though the growth pattern as measured by

109

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production the OD was similar to that obtained in C. saccharolyticus, the OD obtained was not accurate enough to be considered in this study. Hence, an alternative molecular biology-based method was developed for accurate enumeration of T. neapolitana.

Figure 2 H2 production, glucose consumption, OD600nm of the culture suspensions and soluble metabolites produced by Thermotoga neapolitana (●) H2 production, (■) Glucose consumption, (∆) Lactate, (◆) Acetate and (▲) OD. The error bars represent the standard deviation from triplicate cultures. In some cases, the error bars are smaller than the symbol.

Results obtained for the synthetic co-cultures of T. neapolitana and C. saccharolyticus showed that glucose was rapidly consumed compared to the pure cultures (Figure 3). Similar to the pure cultures of C. saccharolyticus, a lag phase of 9 h was observed and a maximum OD600nm of 0.9

-1 (±0.04) was obtained during the cultivation. The H2 yield was 2.8 (±0.09) mol H2 mol glucose. Compared to the performance of the pure cultures, the synthetic co-cultures showed a clear improvement in the H2 production (Figure 3). The maximum H2 production rate obtained was 36.02

-1 -1 mL L h . Statistical analysis to compare the H2 production rate of the synthetic co-culture with either of the pure cultures gave a probability value of 0.15 (p<0.05: t-test) with C. saccharolyticus and 0.014 (p<0.05: t-test) with T. neapolitana showing a significant difference in the H2 production rate.

110

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Overall, the highest H2 content in the pure cultures and the synthetic co-culture was between 63% and 67%. Though T. neapolitana is able to form biofilm as was observed in the pure culture, there was no biofilm formation observed when it was cultivated with C. saccharolyticus as a synthetic co-culture. Cultivation of both organisms also did not induce a shift in the metabolic pathway as the major metabolite produced was acetate. This therefore, did not give a prediction on the interspecies relationship that exists between both organisms. However, a more comprehensive study to determine the relationship between both organisms will take into account the differences in protein expression of the pure cultures and synthetic co-cultures.

Figure 3 H2 production by co-culture of T. neapolitana and C. saccharolyticus (●) H2 production, (■) Glucose consumption, (∆) Lactate, (◆) Acetate and (▲) OD. The error bars represent the standard deviation from triplicate cultures. In some cases, the error bars are smaller than the symbol.

Several co-culture methods have been assessed for biohydrogen production under hyperthermophilic conditions and have been shown to be a promising strategy for improved H2 production (Cheng and Zhu, 2013; Laxman Pachapur et al., 2015; Li and Liu, 2012). Some extreme thermophilic bacteria such as Thermotoga maritima and C. saccharolyticus are capable to hydrolyze polysaccharides and utilize the reducing equivalents formed during the glycolytic process for H2 production (Abreu et al., 2016; De Vrije et al., 2009). Additionally, C.

111

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production saccharolyticus has been recognized as being relatively insensitive to H2 partial pressure (Willquist et al., 2010). Due to the faster initialization of growth of C. saccharolyticus (Pradhan et al., 2016; Vanfossen et al., 2009), a higher OD of T. neapolitana was used in the co-culture as mentioned in section 3.1. Pradhan et al. (2016) reported a doubling time of 4 h for T. neapolitana while Vanfossen et al. (2009) reported a doubling time of 95 minutes for C. saccharolyticus.

Results in Figure 3 indicate that the synthetic co-culture demonstrated a positive effect to both H2 production rate and H2 yield compared to the pure cultivations grown under similar conditions. This therefore, suggests a synergistic effect between T. neapolitana and C. saccharolyticus. Compared to the pure strains, the co-cultures demonstrated a rapid glucose utilization and higher

H2 production rate. The results obtained from this study is in line with the literature reporting enhanced H2 production using synthetic co-cultures (Abreu et al., 2016; Ács et al., 2015; Kovács et al., 2013; Mohan et al., 2005; Seppälä et al., 2011; Vatsala et al., 2008; Wang, 2008; Yang et al., 2016a).

Table 1. Comparison of biohydrogen production in hyperthermophilic co-cultures from different feedstocks and inoculum

Maximum H yield (mol H /mol of Strain/co-culture Substrate Temperature (°C) 2 2 Reference glucose)

C. saccharolyticus and T. Xylose (Abreu et al., 70 2.7 ± 0.1 maritima Cellobiose 2016)

C.Thermocellum JN4 and T. Microcrystalline cellulose, (Y. Liu et al., 60 1.8 ± 0.09 thermosaccharolyticum GD17 cellobiose or filter paper 2008)

C. saccharolyticus and T. Glucose 75 2.81 ± 0.09 This study neapolitana

5.3.2. Specificity of in silico and experimental qPCR assays In this study, quantitative monitoring of Thermotoga sp. was performed using real-time PCR and primers targeting the variable regions in Thermotoga 16S rRNA and hydA genes. The hydA gene has been used in the quantitative monitoring of Clostridium butyricum in mesophilic H2 producing bioprocess systems (Tolvanen et al., 2010, 2008). The specificities of the newly designed primers were evaluated by in silico PCR of 16S rRNA gene primer and Primer-BLAST for both 16S rRNA and hydA primers. The in silico PCR analysis was conducted to include coverage of 613789 sequences that gave an output specific for members of the genus Thermotoga (Table 2).

112

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Table 2 16S rRNA gene primer specificity towards Thermotoga sp. identified from in silico PCR using arb-silva database. Primary Organism name Start position Stop position Specificity (%) accession CP000702 Thermotoga petrophila 753682 755234 100 CP000916 Thermotoga neapolitana 505958 507506 100 CP000969 Thermotoga sp. RQ2 788689 790242 100 CP001839 Thermotoga naphthophila 839610 841157 100 CP003408 Thermotoga sp. 2812B 793453 795015 100 CP003409 Thermotoga sp. Cell2 738805 740367 100 CP007633 Thermotoga sp. RQ7 783074 784640 100 CP010967 Thermotoga maritima 188967 190530 100

The overall sequence coverage by the primer obtained for the in silico PCR was 79.3%. Experimental evaluations for primer specificities were performed by qPCR with melt curve analysis using target and non-target bacterial species as reference (T. neapolitana, T. maritima and C. saccharolyticus, co-cultures of T. neapolitana and C. saccharolyticus and mixed cultures from fluidized bed bioreactor). Since the 16S rRNA amplicons had different lengths, the melt curve analysis for T. neapolitana and T. maritima showed a slightly different melting temperature (Tm). However, the 16S rRNA primers were specific towards Thermotoga sp. corroborating with the results predicted by the in silico PCR. The hydA primers did not show any amplification with the reference strains except with T. neapolitana which was the target organism (Figure 4). This indicated the hydA primer’s specificity towards T. neapolitana.

113

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Figure 4 qPCR profile of Thermotoga sp. 16S rRNA and T. neapolitana hydA amplicons on agarose gel. (Lanes: 1 and 12= 1 kb GeneRuler DNA Ladder (Thermo Scientific, USA), lanes 2,4,6,8, and 10 were amplicons from 16S rRNA qPCR assay and lanes 3,5,7,9 and 11 were amplicons from hydA qPCR assay). a, T. neapolitana. b, C. saccharolyticus. c, T. maritima. d, fluidized bed bioreactor sample. e, Negative control without template.

5.3.3. Real-time quantitative PCR The number of gene copies calculated from the constructed T. neapolitana 16S rRNA standard curve did not go beyond the defined value of 106 gene copies. The absolute cell number was calculated using equations 2 and 3, assuming that the genes of interest exist as a single copy in the genome (Nicolet and Fontecilla-Camps, 2012; Pei et al., 2010). The regression coefficients showed strong linear correlations for all targets during qPCR analysis (Figure 5).

114

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Figure 5 Standard curve for Thermotoga 16S rRNA and hydA amplicons shown are: a) Thermotoga sp. specific 16S rRNA amplicons and b) T. neapolitana hydA amplicons with T. neapolitana genomic DNA as the template.

The amplification efficiencies of the designed real-time qPCR primers were evaluated using genomic DNA extracted from T. neapolitana. The reproducibility of both primer pairs was determined with the cultivation of T. neapolitana and the synthetic co-culture (T. neapolitana and C. saccharolyticus). The standard curve from T. neapolitana pure culture indicated amplifications efficiencies of 75% – 85% for 16S rRNA and 99% for hydA (Figure 5) for each qPCR assay. Similar results on the primer specificities and efficiencies were obtained when standards were run together with the synthetic co-cultures. The qPCR data from the synthetic co-culture showed an increase in hydA gene copies from 3.32×107 to 4.4×108 hydA gene copies per mL of sample during cultivation. This result proved that T. neapolitana in the synthetic co-culture had an influence in the dark fermentation process. The 16S rRNA qPCR approach with the same samples, under the same conditions, showed a much lower number of gene copies per mL of sample (Figure 6). This was suggested to be as a result of non-optimal thermocycling condition. An in silico approach to optimize the 16S rRNA amplification showed that increasing the annealing temperature from 60 °C to 72 °C had a significant effect on the amplification efficiency.

115

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Figure 5 Comparison of quantification results obtained from 16S rRNA and hydA based approaches of T. neapolitana in synthetic co-culture. The error bars represent the standard deviation from triplicate cultures. In some cases, the error bars are smaller than the symbol.

Though the hydA primers demonstrated a considerably higher amplification efficiency and sensitivity towards the target gene, both primers showed a similar amplification pattern, confirming the specificity to their various targets. The molecular method applied to this study facilitated to quantify and confirm the influence of T. neapolitana in the H2 production process. To the best of our knowledge, this is the first report to demonstrate the application of hydA gene for species- specific quantitative monitoring of hyperthermophiles. Reports on biohydrogen production from hyperthermophilic microorganisms have mostly utilized conventional methods for monitoring the activity of the microbial population. Therefore, the molecular method developed could be used as an alternative method in the cultivation of Thermotoga sp. The quantitative analysis of T. neapolitana hydA in the synthetic co-culture showed an increased number of hydA gene copies simultaneous to the H2 production suggesting the growth of T. neapolitana in the co-culture culture. In a similar study, co-cultivation of C. saccharolyticus and T. maritima (Abreu et al., 2016) improved the H2 production performance from simple sugars and complex substrates suggesting a relationship of mutualism or commensalism. However, the kind of relationship that exists in these systems and how beneficial it is for H2 production or metabolite formation or the long-term cultivation is still unknown and should be studied further.

116

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

One of the deterring factors for successful qPCR reaction is often tagged on the efficiency of the designed primers. Studies on primer design, validation and usage in microbial monitoring have used efficiencies ranging between 78% to 100% (Ritalahti et al., 2006; Tolvanen et al., 2010, 2008). Factors such as amplicon length, melting temperature, annealing temperature and the ∆G of the amplicon should always be taken into account. Using Mfold web server DNA folding form prediction tool (http://unafold.rna.albany.edu/?q=mfold/dna-folding-form), the ∆G value obtained for Thermotoga 16S rRNA and hydA amplicons at the qPCR annealing temperature (60 °C) used in the experiment was calculated. There was a significant variation in the 16S rRNA and the hydA (-14.69 kcal/mol and -0.09 to -0.7 kcal/mol, respectively). Given the values obtained for both target genes, it is probable that the reason for the low efficiency obtained in 16S rRNA amplification was due to the low ∆G value. The ∆G represents the quantity of energy needed to fully break a secondary DNA structure and the lower the ∆G, the higher the quantity of energy that is required to separate the DNA strands if self-dimers or hetero-dimers are formed. In essence, higher temperatures are needed to break the dimer. When the folding temperature of Thermotoga 16S rRNA amplicon sequence was increased to 72 °C in silico (using the Mfold web server DNA folding form), a ∆G value of -8.80 kcal mol-1 was obtained. With this value, the structure formed can be irrelevant in the qPCR reaction, which means the efficiency could be improved by altering the annealing temperature. Hence optimizing the thermocycling conditions can significantly influence the amplification efficiency with the developed 16S rRNA primers. The high R-squared values obtained in the 16S rRNA amplifications confirm that the reactions were consistent with an absence of any non-specific product or primer dimer formation. Overall, 16S rRNA and hydA based quantitative methods established were specific for the genus Thermotoga and T. neapolitana respectively.

5.4. CONCLUSIONS

This study demonstrates that ecologically distant H2-producing organisms with different cultivation conditions such as T. neapolitana and C. saccharolyticus can be used for the improvement of H2 production yield and rate when cultivated as a synthetic co-culture under optimized conditions.

The co-cultures showed synergy such that there was rapid substrate consumption and higher H2 production rate compared to the respective monocultures. Additionally, qPCR methods were successfully developed for genus and specie-specific quantitative monitoring of Thermotoga sp. in H2 producing systems. The hydA provided a promising target to complement with the existing 16S rRNA gene-based methods for accurate monitoring growth and activity of T. neapolitana. This study, therefore, offers a new avenue for research on simultaneous utilization of pentose and

117

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production hexose from various lignocellulosic waste materials for H2 production by the co-culture. Furthermore, the work presents an alternative quantification method for genus-level monitoring of Thermotoga spp. and specie-specific monitoring of T. neapolitana which can be further explored for its ability to form biofilm and retain biomass for improved H2 production under different cultivation conditions.

118

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production REFERENCES Abreu, A.A., Tavares, F., Alves, M.M., Pereira, M.A., 2016. Boosting dark fermentation with co- cultures of extreme thermophiles for biohythane production from garden waste. Bioresour. Technol. 219, 132–138. doi:10.1016/j.biortech.2016.07.096

Andrews, J., Shabani, B., 2012. Re-envisioning the role of hydrogen in a sustainable energy economy. Int. J. Hydrogen Energy 37, 1184–1203. doi:10.1016/j.ijhydene.2011.09.137

Bouchez, T., Patureau, D., Dabert, P., Juretschko, S., Doré, J., Delgenès, P., Moletta, R., Wagner, M., 2000. Ecological study of a bioaugmentation failure. Environ. Microbiol. 2, 179–190. doi:10.1046/j.1462-2920.2000.00091.x

Chandrasekhar, K., Lee, Y.-J., Lee, D.-W., 2015. Biohydrogen Production: Strategies to Improve Process Efficiency through Microbial Routes. Int. J. Mol. Sci. Int. J. Mol. Sci 16, 8266– 8293. doi:10.3390/ijms16048266

Chang, J.J., Chou, C.H., Ho, C.Y., Chen, W.E., Lay, J.J., Huang, C.C., 2008. Syntrophic co- culture of aerobic Bacillus and anaerobic Clostridium for bio-fuels and bio-hydrogen production. Int. J. Hydrogen Energy 33, 5137–5146. doi:10.1016/j.ijhydene.2008.05.021

Cheng, J., Zhu, M., 2013. A novel anaerobic co-culture system for bio-hydrogen production from sugarcane bagasse. Bioresour. Technol. 144, 623–631. doi:10.1016/j.biortech.2013.07.018

D’Ippolito, G., Dipasquale, L., Vella, F.M., Romano, I., Gambacorta, A., Cutignano, A., Fontana, A., 2010. Hydrogen metabolism in the extreme thermophile Thermotoga neapolitana. Int. J. Hydrogen Energy 35, 2290–2295.

De Vrije, T., Mars, A.E., Budde, M.A.W., Lai, M.H., Dijkema, C., De Waard, P., Claassen, P.A.M., 2007. Glycolytic pathway and hydrogen yield studies of the extreme thermophile

119

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Caldicellulosiruptor saccharolyticus. Appl. Microbiol. Biotechnol. 74, 1358–1367. doi:10.1007/s00253-006-0783-x

Dessì, P., Lakaniemi, A.-M., Lens, P.N.L., 2017. Biohydrogen production from xylose by fresh and digested activated sludge at 37, 55 and 70° C. Water Res. 115, 120–129.

Eriksen, N.T., Nielsen, T.M., Iversen, N., 2008. Hydrogen production in anaerobic and microaerobic Thermotoga neapolitana. Biotechnol. Lett. 30, 103–109.

Fino, D., 2014. Advances in Hydrogen Production, Storage and Distribution, Advances in Hydrogen Production, Storage and Distribution. doi:10.1533/9780857097736.1.85

Hallenbeck, P.C., 2012. Hydrogen production by Cyanobacteria, in: Microbial Technologies in Advanced Biofuels Production. pp. 15–28. doi:10.1007/978-1-4614-1208-3_2

Hallenbeck, P.C., 2009. Fermentative hydrogen production: Principles, progress, and prognosis. Int. J. Hydrogen Energy 34, 7379–7389. doi:10.1016/j.ijhydene.2008.12.080

Hallenbeck, P.C., Abo-Hashesh, M., Ghosh, D., 2012. Strategies for improving biological hydrogen production. Bioresour. Technol. 110, 1–9. doi:10.1016/j.biortech.2012.01.103

Hallenbeck, P.C., Benemann, J.R., 2002. Biological hydrogen production; Fundamentals and limiting processes, in: Int. J. Hydrogen Energy. pp. 1185–1193. doi:10.1016/S0360- 3199(02)00131-3

Han, D., Xu, H., Puranik, R., Xu, Z., 2014. Natural transformation of Thermotoga sp. strain RQ7. BMC Biotechnol. 14, 39. doi:10.1186/1472-6750-14-39

Hemschemeier, A., Melis, A., Happe, T., 2009. Analytical approaches to photobiological hydrogen production in unicellular green algae. Photosynth. Res. doi:10.1007/s11120-009-9415-5

Herrero, M., Stuckey, D.C., 2015. Bioaugmentation and its application in wastewater treatment: A review. Chemosphere. doi:10.1016/j.chemosphere.2014.10.033

International Energy Agency, 2006. Hydrogen Production and Storage. R&D Priorities and Gaps. Hydrog. Implement. Agreem. 13, 392–392. doi:10.1016/0360-3199(88)90106-1

120

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Kádár, Z., de Vrije, T., van Noorden, G.E., Budde, M. a W., Szengyel, Z., Réczey, K., Claassen, P. a M., 2004. Yields from glucose, xylose, and paper sludge hydrolysate during hydrogen production by the extreme thermophile Caldicellulosiruptor saccharolyticus. Appl. Biochem. Biotechnol. 113–116, 497–508. doi:10.1385/ABAB:114:1-3:497

Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, C., Horn, M., Glöckner, F.O., 2013. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next- generation sequencing-based diversity studies. Nucleic Acids Res. 41. doi:10.1093/nar/gks808

Kovács, K.L., Ács, N., Kovács, E., Wirth, R., Rákhely, G., Strang, O., Herbel, Z., Bagi, Z., 2013. Improvement of biogas production by bioaugmentation. Biomed Res. Int. 2013. doi:10.1155/2013/482653

Lakhal, R., Auria, R., Davidson, S., Ollivier, B., Dolla, A., Hamdi, M., Combet-Blanc, Y., 2011. Effect of oxygen and redox potential on glucose fermentation in Thermotoga maritima under controlled physicochemical conditions. Int. J. Microbiol. 2010.

Li, Q., Liu, C.Z., 2012. Co-culture of Clostridium thermocellum and Clostridium thermosaccharolyticum for enhancing hydrogen production via thermophilic fermentation of cornstalk waste. Int. J. Hydrogen Energy 37, 10648–10654. doi:10.1016/j.ijhydene.2012.04.115

Logan, B.E., Oh, S.E., Kim, I.S., Van Ginkel, S., 2002. Biological hydrogen production measured in batch anaerobic respirometers. Environ. Sci. Technol. 36, 2530–2535. doi:10.1021/es015783i

121

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Melis, a, Zhang, L., Forestier, M., Ghirardi, M.L., Seibert, M., 2000. Sustained photobiological hydrogen gas production upon reversible inactivation of oxygen evolution in the green alga Chlamydomonas reinhardtii. Plant Physiol. 122, 127–36. doi:10.1104/pp.122.1.127

Mohan, S.V., Rao, N.C., Prasad, K.K., Sarma, P.N., 2005. Bioaugmentation of an anaerobic sequencing batch biofilm reactor (AnSBBR) with immobilized sulphate reducing bacteria (SRB) for the treatment of sulphate bearing chemical wastewater. Process Biochem. 40, 2849–2857. doi:10.1016/j.procbio.2004.12.027

Nath, K., Das, D., 2003. Hydrogen from biomass. Curr. Sci. doi:10.1021/ef990034w

Ngo, T.A., Kim, M.S., Sim, S.J., 2011. Thermophilic hydrogen fermentation using Thermotoga neapolitana DSM 4359 by fed-batch culture. Int. J. Hydrogen Energy 36, 14014–14023. doi:10.1016/j.ijhydene.2011.04.058

Ngo, T.A., Nguyen, T.H., Bui, H.T.V., 2012. Thermophilic fermentative hydrogen production from xylose by Thermotoga neapolitana DSM 4359. Renew. Energy 37, 174–179. doi:10.1016/j.renene.2011.06.015

Nicolet, Y., Fontecilla-Camps, J.C., 2012. Structure-function relationships in [FeFe]-hydrogenase active site maturation. J. Biol. Chem. doi:10.1074/jbc.R111.310797

Nualsri, C., Kongjan, P., Reungsang, A., Imai, T., 2017. Effect of biogas sparging on the performance of bio-hydrogen reactor over a long-term operation. PLoS One 12. doi:10.1371/journal.pone.0171248

Owen, W.F., Stuckey, D.C., Healy, J.B., Young, L.Y., McCarty, P.L., 1979. Bioassay for monitoring biochemical methane potential and anaerobic toxicity. Water Res. 13, 485– 492. doi:10.1016/0043-1354(79)90043-5

Pachapur, V.L., Sarma, S.J., Brar, S.K., Le Bihan, Y., Buelna, G., Verma, M., 2015. Biological hydrogen production using co-culture versus mono-culture system. Environ. Technol. Rev. 4, 55–70. doi:10.1080/21622515.2015.1068381

Pawar, S.S., Vongkumpeang, T., Grey, C., van Niel, E., 2015. Biofilm formation by designed co- cultures of Caldicellulosiruptor species as a means to improve hydrogen productivity. Biotechnol. Biofuels 8, 19. doi:10.1186/s13068-015-0201-7

Pei, A.Y., Oberdorf, W.E., Nossa, C.W., Agarwal, A., Chokshi, P., Gerz, E.A., Jin, Z., Lee, P., Yang, L., Poles, M., Brown, S.M., Sotero, S., DeSantis, T., Brodie, E., Nelson, K., Pei, Z.,

122

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

2010. Diversity of 16S rRNA genes within individual prokaryotic genomes. Appl. Environ. Microbiol. 76, 3886–3897. doi:10.1128/AEM.02953-09

Pradhan, N., Dipasquale, L., D’Ippolito, G., Fontana, A., Panico, A., Lens, P.N.L., Pirozzi, F., Esposito, G., 2016. Kinetic modeling of fermentative hydrogen production by Thermotoga neapolitana. Int. J. Hydrogen Energy 41, 4931–4940. doi:10.1016/j.ijhydene.2016.01.107

Ritalahti, K.M., Amos, B.K., Sung, Y., Wu, Q., Koenigsberg, S.S., Löffler, F.E., 2006. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl. Environ. Microbiol. 72, 2765–2774. doi:10.1128/AEM.72.4.2765-2774.2006

Seppälä, J.J., Puhakka, J.A., Yli-Harja, O., Karp, M.T., Santala, V., 2011. Fermentative hydrogen production by Clostridium butyricum and Escherichia coli in pure and cocultures. Int. J. Hydrogen Energy 36, 10701–10708. doi:10.1016/j.ijhydene.2011.05.189

Sharma, A., Arya, S.K., 2017. Hydrogen from algal biomass: A review of production process. Biotechnol. Reports. doi:10.1016/j.btre.2017.06.001

Stams, A.J.M., 1994. Metabolic interactions between anaerobic bacteria in methanogenic environments. Antonie van Leeuwenhoek, Int. J. Gen. Mol. Microbiol. doi:10.1007/BF00871644

Suzuki, Y., 1982. On hydrogen as fuel gas. Int. J. Hydrogen Energy 7, 227–230. doi:10.1016/0360-3199(82)90085-4

Tolvanen, K.E.S., Koskinen, P.E.P., Raussi, H.M., Ylikoski, A.I., Hemmilä, I.A., Santala, V.P., Karp, M.T., 2008. Profiling the hydA gene and hydA gene transcript levels of Clostridium butyricum during continuous, mixed-culture hydrogen fermentation. Int. J. Hydrogen Energy 33, 5416–5421. doi:10.1016/j.ijhydene.2008.07.009

Tolvanen, K.E.S., Santala, V.P., Karp, M.T., 2010. [FeFe]-hydrogenase gene quantification and melting curve analysis from hydrogen-fermenting bioreactor samples. Int. J. Hydrogen Energy 35, 3433–3439. doi:10.1016/j.ijhydene.2010.01.132

Van Ooteghem, S.A., Beer, S.K., Yue, P.C., 2002. Hydrogen production by the thermophilic bacterium Thermotoga neapolitana, in: Biotechnology for Fuels and Chemicals. Springer, pp. 177–189.

123

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Vanwonterghem, I., Jensen, P.D., Ho, D.P., Batstone, D.J., Tyson, G.W., 2014. Linking microbial community structure, interactions and function in anaerobic digesters using new molecular techniques. Curr. Opin. Biotechnol. 27, 55–64. doi:10.1016/j.copbio.2013.11.004

Wang, a, 2008. Bioaugmented hydrogen production from microcrystalline cellulose using co- culture—Clostridium acetobutylicum X9X9 and Ethanoigenens harbinense B49B49. Int. J. Hydrogen Energy 33, 912–917. doi:10.1016/j.ijhydene.2007.10.017

Zeidan, A. a, Rådström, P., van Niel, E.W.J., 2010. Stable coexistence of two Caldicellulosiruptor species in a de novo constructed hydrogen-producing co-culture. Microb. Cell Fact. 9, 102. doi:10.1186/1475-2859-9-102

124

Chapter 5: Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co- culture for biohydrogen production

Zeidan, A.A., van Niel, E.W.J., 2010. A quantitative analysis of hydrogen production efficiency of the extreme thermophile Caldicellulosiruptor owensensis OLT. Int. J. Hydrogen Energy 35, 1128–1137. doi:10.1016/j.ijhydene.2009.11.082

Zeidan, A.A., Van Niel, E.W.J., 2009. Developing a thermophilic hydrogen-producing co-culture for efficient utilization of mixed sugars. Int. J. Hydrogen Energy 34, 4524–4528. doi:10.1016/j.ijhydene.2008.07.092

125

CHAPTER 6 Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

ABSTRACT The aim of the present study was to investigate the effect of gradually increasing glucose

-1 concentrations (from 5.6 to 111 mmol L ) on the fermentative H2 production with and without bioaugmentation. A stirred tank reactor was operated at 70 °C and inoculated with a hyperthermophilic mixed culture or a hyperthermophilic mixed culture bioaugmented with

Thermotoga neapolitana. With both the unaugmented (control) and augmented cultures, the H2 production rate was improved when the initial glucose concentration was increased. In contrast,

-1 the highest H2 yield (1.68 mol H2 mol glucose consumed) was obtained with the augmented culture at the lowest glucose concentration of 5.6 mmol L-1 and was 37.5% higher than that obtained with the unaugmented culture at the same feed glucose concentration. Overall, H2 production rates and yields were higher in the bioaugmented cultures than in the unaugmented cultures whatever the glucose concentration. Quantitative polymerase chain reaction targeting T. neapolitana hydA gene and MiSeq sequencing proved that Thermotoga was not only present in the augmented cultures but also the most abundant at the highest glucose concentrations.

126

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

6.1. INTRODUCTION

Fermentative hydrogen (H2) production is possible with both pure and mixed microbial cultures originated from natural or engineered environments (Barca et al., 2015; Bundhoo et al., 2015;

Hallenbeck, 2009). Typically, the use of mixed cultures is the only option for H2 generation from non-sterile organic waste and biomass residues unless selective conditions, such as extremely high temperatures, are used during the bioprocess (Call et al., 2009; Li and Fang, 2007; Valdez- Vazquez and Poggi-Varaldo, 2009; Wang and Wan, 2008; Yu et al., 2002; Zhang et al., 2007). In addition to the microbial culture, the H2 production performance depends on the operating conditions such as temperature, pH, substrate type and concentration, as well as hydraulic retention time (Boboescu et al., 2014; Dreschke et al., 2019b; Hallenbeck, 2009; Kothari, 2017; Yue et al., 2011).

Substrate concentration can have a significant effect on the rate, yield and stability of H2 production. Increasing substrate concentrations have been shown to result in higher production rates but lower H2 yields with, for example, a mesophilic H2-producing mixed culture (Goud et al., 2014) and a hyperthermophilic Thermotoga neapolitana pure culture (Dreschke et al., 2019c). Increasing the substrate concentration and, thus, the organic load of the system allows to save the energy required for heating of H2-producing bioreactors, as high substrate concentrations lead to increased microbial activity and heat generation by microbial metabolism (Kyazze et al., 2006). However, the use of extremely high substrate concentrations can cause substrate and/or product inhibition and result in sub-optimal pH for the H2-producers due to volatile fatty acid accumulation

(Argun and Kargi, 2011; Gadhamshetty et al., 2010). In addition, the low H2 yields observed at increasing organic loads can be due to a shift in metabolic flux towards solventogenesis (e.g. formation of butanol, acetone and ethanol) and other reduced end-products, the generation of which is not accompanied by H2 production (Cai et al., 2011).

Bioaugmentation has been proposed in several studies as a potential strategy for enhancing dark fermentation under stress conditions (Goud et al., 2014; Kumar et al., 2016; Okonkwo et al., 2019a). Bioaugmentation can be defined as the addition of pre-grown highly specialized microorganisms or populations of several microorganisms to improve the capacity of a treatment system (da Silva and Alvarez, 2009; Han et al., 2010; Herrero and Stuckey, 2015). Bioaugmentation is an emerging strategy for industrial wastewater treatment (Nzila et al., 2016) and has been used to shorten the lag phase and improve the chemical oxygen demand (COD) removal during dark fermentation from the organic fraction of municipal solid waste (Sharma and

127

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Melkania, 2018). It has also been used to enhance thermophilic H2 production from corn stover hydrolysate (Zhang et al., 2019) and beverage wastewater (Sivagurunathan et al., 2014).

Okonkwo et al., (2019b) applied bioaugmentation with a synthetic co-culture to enhance the H2 production during or after temporal temperature fluctuation. Given the success of bioaugmentation strategy in several previous studies, bioaugmentation might be a useful tool for enhancing H2 production also at high substrate concentrations (Cabrol et al., 2017). However, one of the most difficult issues in bioaugmentation is to ensure the survival of the microorganisms introduced in the established mixed culture as the number of exogenous microorganisms has been reported to shortly decrease after inoculation either as a result of abiotic or biotic influence (Chandrasekhar et al., 2015). Some studies have used strategies such as repeated bioaugmentation to promote the persistence of the added bacterium in the system (Yang et al., 2016a, 2016b). This strategy might be effective for a transient system recovery but might not ensure long-term process enhancement, if the added bacterium or bacteria are not able to compete with the existing microbial consortium. Furthermore, sudden process disturbances such as increased operation temperature can lead to reduced microbial diversity in the mixed culture and lead to a lower process efficiency, requiring bioaugmentation with bacteria that can stably coexist with the existing microbial consortium.

The aim of this study was to study the dynamics of Thermotoga neapolitana in a mixed microbial consortium after a period of pre-adaptation as a strategy to make T. neapolitana a stable member of the native microbial community. This study further examined the effects of different feed glucose concentrations on H2 production in a thermophilic mixed culture with and without T. neapolitana, which is a hyperthermophilic bacterium capable of utilizing a wide range of organic substrates as carbon source and able to produce high hydrogen yields (Eriksen et al., 2008; Ngo et al., 2011a). To the best of our knowledge, this is the first study to use pre-adaptation as a strategy for making T. neapolitana a stable member of a native H2-producing microbial community and for enhancing H2 production.

6.2. MATERIALS AND METHODS 6.2.1. Experimental Setup

The medium used for the cultivation consisted of the following components (g/L): NH4Cl, 1.0;

K2HPO4, 0.3; KH2PO4, 0.3; MgCl2 x 6 H2O, 0.2; CaCl2 x 2H2O, 0.1; NaCl, 5.0; KCl, 0.1; cysteine- HCl, 1.0; yeast extract, 2.0; 10.0 ml L-1 of vitamin and trace element solution (DSMZ 141, Germany). Nitrogen gas was used to sparge the fermentation medium and create an anaerobic 128

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana environment. Dark fermentation experiments were carried out in batch mode in a double jacketed glass stirred tank reactor (STR) with a working volume of 2 L (Figure 1). The reactor temperature was kept constant at 70 °C using a heated water bath. The reactor was equipped with a pH electrode and temperature probe connected to a programmable controller (Bluelab pH Controller, New Zealand) to maintain the pH of the cultures at 6.5 by automatic dosing of potassium hydroxide (2 molar). The fermentation broth inside the reactor was mixed by a magnetic stirrer (Argolab, Italy) at 150 rpm.

Figure 1 Experimental design to study the effects of bioaugmentation at various feed glucose concentrations during dark fermentation with a thermophilic mixed culture without augmentation (a) and with a thermophilic mixed culture augmented with Thermotoga neapolitana (b).

6.2.2. Experimental procedure The inoculum used in this study was obtained from a laboratory scale continuously stirred tank bioreactor producing H2 at 55 °C (Okonkwo et al., 2019). The cultivation was initiated at 70 °C in 250 mL batch bottles with a working volume of 200 mL at an initial pH of 6.5 with 27.8 mmol L-1 glucose as substrate. Twenty milliliters of the inoculum (10% v/v) was transferred to 180 mL of

129

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana the culture medium (mg/L). The cultivation was carried out in batch for three transfers prior to the start of the experiment to acclimatize the culture to the higher incubation temperature (Figure 1a).

To determine the influence of bioaugmentation at increasing substrate concentrations, T. neapolitana DSM 4359 (DSMZ, Germany) was added to the mixed culture in a 1:1 ratio (based on optical density measurements, OD600). The bioaugmented culture was then cultivated with glucose in batch mode in 250 mL anaerobic serum bottles with a working volume of 200 mL for three successive transfers at 70 °C (Figure 1b) to adapt T. neapolitana to growing alongside the native microbial community. For each successive transfer, 20 mL of the inoculum (10% v/v) was transferred to 180 mL of the culture medium (mg/L) to a final volume of 200 mL.

H2 production with the unaugmented and the bioaugmented mixed culture was separately investigated in batch mode in the STR described in section 2.1 and each experiment lasted for a period of 48 h. The initial glucose concentration was stepwise increased from 5.6, 27.8 and 55.5

-1 to 111.0 mmol L in order to determine the impact of increasing substrate concentration on H2 production, biomass concentration and metabolic patterns.

6.2.3. Analytical methods and calculation procedures The gas produced in the STR was quantified using a water displacement method with 500 mL glass containers. The H2 containing gas produced was sampled from the gas sampling port using a gas-tight syringe (Hamilton, USA) and the H2 concentration of the biogas was measured using a 3400 gas chromatograph (GC) (Varian, USA) equipped with a thermal conductivity detector (TCD) and a Restek packed column using argon as the carrier gas. The total volume of the produced H2 at each time point was calculated using Equation 1 (Logan et al., 2002):

푉퐻2,푡 = 푉퐻2,푡−1 + 퐶퐻2,푡(푉퐺,푡 − 푉퐺,푡−1) + 푉퐻(퐶퐻2,푡 − 퐶퐻2,푡−1) (1)

where 푉퐻2,푡 is the cumulative H2 produced at time t, 푉퐻2,푡−1 is the cumulative H2 produced at time t-1, 푉퐺,푡 is the total gas volume at time t, 푉퐺,푡−1 is the total gas volume at time t-1, 퐶퐻2,푡 is the H2 fraction in the headspace at time t, 퐶퐻2,푡−1 is the H2 fraction in the headspace at time t-1 and 푉퐻 is the total headspace volume in the bioreactor.

H2 production was converted into moles on the basis that one mole of an ideal gas occupies a volume of 22.4 L at standard temperature and pressure according to the ideal gas law. Therefore,

130

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

the volume of H2 gas produced was divided by 22.4 L in order to obtain H2 produced in moles.

The H2 yield and productivity were calculated using Equations 2 and 3, respectively.

푚표푙 퐻 퐻 푦푖푒푙푑 = 2 (2) 2 푚표푙 푔푙푢푐표푠푒 푐표푛푠푢푚푒푑

푚푚표푙 퐻 퐻 푝푟표푑푢푐푡푖푣푖푡푦 = 2 (3) 2 푟푒푎푐푡𝑖표푛 푣표푙푢푚푒 ×푓푒푟푚푒푛푡푎푡𝑖표푛 푡𝑖푚푒 (ℎ표푢푟)

6.2.4. Microbial analyses Genomic DNA was extracted using the PowerSoil™ DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. Primers 515_532U and 909_928U (Wang and Qian, 2009) including their respective linkers were used to amplify the V4_V5 region of the 16S rRNA gene. The resulting products were purified and loaded onto Illumina MiSeq cartridge for sequencing. Sequencing and library preparation were performed at the Genotoul Lifescience Network Genome and Transcriptome Core Facility in Toulouse, France (get.genotoul.fr). The sequence analysis was done as described by Venkiteshwaran et al. (2016). Real-time quantitative polymerase chain reaction (qPCR) monitoring of T. neapolitana was carried out using HydA primers following the method described by Okonkwo et al. (2018). The 16S rRNA sequences used to support the findings of this study have been deposited in the NCBI Sequence Read Archive under project file SUB6057042: MN203737 - MN203763.

6.3. RESULTS AND DISCUSSION

6.3.1. H2 production rates and yields at increasing glucose concentrations -1 In the unaugmented cultures, the highest H2 yield was 1.42 mol H2 mol of glucose consumed at

-1 -1 an initial concentration of 27.8 mmol L of glucose. The H2 yield dropped to 1.17 mol H2 mol of

-1 glucose consumed at 111 mmol L of feed glucose concentration (Figure 2a). The H2 yield obtained in the augmented cultures was higher than that obtained in the unaugmented cultures.

Nonetheless, similar to the unaugmented cultures, the H2 yield decreased by increasing the substrate concentration. With bioaugmentation, H2 yield increased by 37, 16 and 12% at 5.6, 55.5 and 111 mmol L-1 of feed glucose, respectively, compared to the unaugmented cultures. The highest H2 yield (1.68 mol H2 per mol of consumed glucose) was obtained at the feed glucose concentration of 5.6 mmol L-1. Qiu et al., (2017) studied the effect of xylose concentrations

-1 (ranging from 16.7 to 100.0 mmol L ) on dark fermentative H2 production by an extreme

131

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

thermophilic culture, and reported that the fermentation reached the highest H2 yield of 1.29 mol

-1 -1 H2 mol xylose consumed at initial pH 7.0 and 50.0 mmol L of feed xylose. However, based on other literature reports, it seems that the optimal initial substrate concentration depends on the inoculum, substrate type, reactor configuration, temperature and pH range (Lee et al., 2008; Zheng et al., 2008).

In this study, the H2 production rate increased with increased feed glucose concentration and reached the highest value of 0.92 mmol-L-1h-1 at 111 mmol L-1 of feed glucose in the unaugmented

-1 -1 culture. In the augmented culture, the H2 production rate increased from 0.41 mmol L h at feed glucose concentration of 5.6 mmol L-1 up to 1.44 mmol L-1 h-1 at 55.5 mmol L-1 and then decreased

-1 -1 -1 to 1.13 mmol L h at 111 mmol L of feed glucose (Figure 2b). Higher H2 production rates than observed in this study have been observed with mixed cultures under different operating conditions (Azbar et al., 2009; Chong et al., 2009). The obtained H2 production rate and yield was generally higher in the culture augmented with T. neapolitana than in the unaugmented culture at the various glucose concentrations studied. This indicates that T. neapolitana was able to survive alongside the native microbial communities.

Figure 2 H2 yield and H2 production rate obtained with the unaugmented (a) and the augmented (b) culture at different initial glucose concentrations.

132

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

6.3.2. Effect of glucose concentration on the composition of soluble metabolites The main soluble microbial products associated with glucose degradation were ethanol, acetate and lactate (Figure 3). In the unaugmented cultures, ethanol was the main soluble metabolite produced and corresponded to 67–77% COD of the total soluble metabolites produced. The share of acetate decreased with increasing glucose concentration (from 18 to 12%), while that of lactate increased from 4.5 to 18% (Figure 3a). In the augmented cultures, the share of ethanol decreased with increasing glucose concentration (from 58% at 5.6 mmol L-1 glucose to 27% at 111 mmol L- 1 glucose). Thus, the share of ethanol was lower in the augmented culture compared to the unaugmented culture at all studied glucose concentrations. The percentage of acetate decreased in the augmented culture from 29% at 5.6 mmol L-1 of feed glucose to 16% at 111 mmol L-1 of feed glucose, while the share of lactate significantly increased from 13% at initial concentration of 5.6 mmol L-1 glucose to 57% at 111 mmol L-1 of feed glucose (Figure 3b).

Figure 3 The distribution of soluble metabolites as chemical oxygen demand (COD) equivalents at the endpoint of fermentation the different initial glucose concentrations in the unaugmented (a) and augmented (b).

In many previous studies, dark fermentation of glucose has resulted in the production of mainly butyrate and acetate as soluble metabolites under mesophilic, thermophilic and hyperthermophilic

133

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana conditions (Abreu et al., 2016; Gadow et al., 2013; Ngo et al., 2011b; Reilly et al., 2014; Zhao et al., 2010). However, it seems that ethanol-based fermentation was the major pathway leading to

H2 production in this study due to the high ethanol yields obtained especially with the unaugmented cultures. The ethanol-type fermentation (Equation 4) has a theoretical maximum of

2 mol of H2 per mol of glucose and has been reported to occur under mesophilic conditions (Hwang et al., 2004; Ren et al., 2007) but not for mixed cultures at temperatures as high as 70 °C.

C6H12O6 + H2O → C2H5OH + 퐶H3COOH + 2CO2 + 2H2 (4)

Previous studies have reported yields of 1.8 mol ethanol mol-1 glucose with pure culture of T. ethanolicus (Wiegel and Ljungdahl, 1981) and 1.5 mol ethanol mol-1 glucose from T. hydrosulfuricus (Lacis and Lawford, 1991) at 72 and 69 °C respectively. The highest ethanol yield

-1 obtained with the unaugmented culture in this study was 1.4 mol H2 mol of glucose. Meanwhile, the highest ethanol yield in the augmented culture was 1.2 mol ethanol mol-1 of glucose and was obtained at initial glucose concentration of 27.8 mmol L-1.

In addition to the increased H2 yield obtained by bioaugmentation, a shift in the metabolic networks was observed with the T. neapolitana-augmented culture when compared to the unaugmented culture. Indeed, the T. neapolitana-augmented culture produced a lower share of ethanol and a higher share of acetate and lactate to the fermentation broth (Figure 3). Thus, the bioaugmentation with T. neapolitana directed the metabolic pathway towards acetate and lactate production. Previous reports on pure cultures of T. neapolitana have shown that acetate, lactate and alanine are the major soluble metabolites produced by T. neapolitana (Dreschke et al., 2019a; Ippolito et al., 2010; Okonkwo et al., 2018). The direction of the metabolic pathway towards acetate production allows producing more H2 and seemed to be the case with the bioaugmented culture in this study. Nonetheless, as T. neapolitana is also capable of producing high concentrations of lactate at increased substrate concentrations (Dreschke et al., 2019c), the increase in the share of lactate observed in the augmented culture was at least partly attributed to presence of T. neapolitana. Lactate as an electron sink takes a large amount of reducing power away from H2 production thereby reducing the H2 yield (Kim et al., 2014; Mishra et al., 2019).

6.3.3. Quantity of T. neapolitana in the mixed microbial communities The qPCR method applied in this study to quantify and confirm the presence of T. neapolitana in the bioaugmented mixed cultures has previously been successfully used in quantitation of T. neapolitana from pure and mixed cultures (Okonkwo et al., 2018). The quantitative analysis of T. 134

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana neapolitana hydA gene from the bioaugmented cultures showed an increase of the hydA gene copies per mL of culture as the initial glucose concentration was increased (Figure 4). Thus, the qPCR results indicated that after bioaugmentation, T. neapolitana became an active member of the microbial consortium and likely responsible for the shift in the soluble metabolites and enhancement of H2 production compared to the unaugmented culture. The qPCR carried out on the unaugmented culture confirmed that T. neapolitana was not present in the culture.

Figure 4 Real-time qPCR monitoring of hydA gene copy numbers of T. neapolitana in the augmented culture at different initial glucose concentrations.

6.3.4. Microbial community profiles at different glucose concentrations The MiSeq data obtained from the cultures assessed in this study covered over 33000 effective sequences with the lowest number of sequences being 24967. The number of operational taxonomic units (OTUs) was relatively low, indicating that the microbial communities in both the unaugmented and the augmented culture were rather simple because high temperature environments are extremely selective (Zhang et al., 2016). The unaugmented culture was dominated by Thermoanaerobacter spp. at all initial glucose concentrations. The share of Thermoanaerobacter in the microbial community was 99.9% at all other glucose concentrations than 55.5 mol L-1, when Bacillus was detected at an abundance of 8%.

135

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Figure 5 Microbial community composition and relative abundance of genera identified at different feed glucose concentrations in the unaugmented (a) and the augmented (b) culture.

At the lowest initial glucose concentration of 5.6 mmol L-1, the augmented cultures had 75, 23 and 2% abundance of Thermoanaerobacter, Thermotoga and Bacillus spp., respectively. However, at the higher initial glucose concentrations, Bacillus spp. were not detected anymore from the microbial community and the shares of Thermoanaerobacter and Thermotoga spp. were 62-80% and 20-37%, respectively (Figure 5). The abundance of Thermotoga in the community was higher at the two highest initial glucose concentrations, which is accordance with the qPCR results (Figure 4).

The bioaugmentation of a Thermoanaerobacter-dominated mixed culture with T. neapolitana improved both the H2 production yield and rate. Thermoanaerobacter species are well known thermophilic bacteria capable of producing H2, ethanol and acetate (Claassen et al., 1999; Koskinen et al., 2008; Lin and Tanaka, 2006). Thus, their presence explains also the high ethanol production observed. Bacteria within this genus have also been reported to use the Embden– Meyerhof–Parnas pathway for sugar degradation and produce ethanol, acetate and lactate as major volatile end products (Lee et al., 1993), which is in accordance with the metabolite profiles observed in this study. In the bioaugmented culture, the presence of T. neapolitana resulted in lower ethanol production, while the shares of aceate and lactate increased compared to the 136

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana unugmented cultures. Thus, the differences observed in the abundance of different soluble metabolites in the unaugmented and augmented cultures can be explained with the observed differences in the microbial community composition.

The pre-adaptation as a strategy to make T. neapolitana a stable member of the native microbial community was successful based on the molecular monitoring methods used this study, as both the T. neapolitana hydA gene copy numbers and relative abundance of Thermotoga were shown to increase towards the end of the study. The pre-adaptation of a bacteria to a mixed culture prior to its application to a large scale process could thus be beneficial for enhancing microbial activity levels, treating complex waste materials and driving the metabolic pathway towards the desired products. Bioaugmentation also has the potential to improve the microbial community structure and enhance resistance and resilience in case of unforeseen disturbances (Okonkwo et al., 2019b). However, pre-adaptation may not be feasible in the case of sudden transient disturbances due to the fact that it is time consuming.

Except for the switch in the metabolic pathways and an enhanced H2 production, it is not known what kind of interactions occurred between T. neapolitana and the native microbial community. It would be useful to further investigate the characteristics of T. neapolitana in the augmented culture at a functional level by studying the protein expression to identify the mechanisms responsible for its adaptation and survival within the native microbial community (Bastida et al., 2009; Lacerda and Reardon, 2009; Wang et al., 2016), as this could enable further process optimization.

6.4. CONCLUSIONS The bioaugmentation of a Thermoanaerobacter-dominated mixed culture with Thermotoga neapolitana improved both the H2 production yield and rate. Thus, the results of this study indicate that the use of a single strain with required characteristics can be enough for improving the performance of a biological process. The H2 production rate of the augmented cultures increased

-1 when initial glucose concentration was increased from 5.6 to 55.5 mmol L , while the highest H2 production yield, 1.68 mol H2 per mol of consumed glucose, was obtained at the lowest initial glucose concentration of 5.6 mmol L-1. The pre-adaptation of T. neapolitana to the mixed culture during three successive batch incubations prior to the reactor experiments was demonstrated to be a successful strategy to ensure that T. neapolitana was able to co-exist within the mixed

137

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana microbial consortium. However, further experiments utilizing continuously-fed bioreactor systems are recommended to evaluate the long-term effects of the selected bioaugmentation strategy

138

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Argun, H., Kargi, F., 2011. Bio-hydrogen production by different operational modes of dark and photo-fermentation: An overview. Int. J. Hydrogen Energy. https://doi.org/10.1016/j.ijhydene.2011.03.116

Azbar, N., Çetinkaya Dokgöz, F.T., Keskin, T., Korkmaz, K.S., Syed, H.M., 2009. Continuous fermentative hydrogen production from cheese whey wastewater under thermophilic anaerobic conditions. Int. J. Hydrogen Energy 34, 7441–7447. https://doi.org/10.1016/j.ijhydene.2009.04.032

Barca, C., Soric, A., Ranava, D., Giudici-Orticoni, M.T., Ferrasse, J.H., 2015. Anaerobic biofilm reactors for dark fermentative hydrogen production from wastewater: A review. Bioresour. Technol. https://doi.org/10.1016/j.biortech.2015.02.063

Bastida, F., Moreno, J.L., Nicolás, C., Hernández, T., García, C., 2009. Soil metaproteomics: A review of an emerging environmental science. Significance, methodology and perspectives. Eur. J. Soil Sci. https://doi.org/10.1111/j.1365-2389.2009.01184.x

Boboescu, I.Z., Ilie, M., Gherman, V.D., Mirel, I., Pap, B., Negrea, A., Kondorosi, É., Bíró, T., Maróti, G., 2014. Revealing the factors influencing a fermentative biohydrogen production process using industrial wastewater as fermentation substrate. Biotechnol. Biofuels. https://doi.org/10.1186/s13068-014-0139-1

Bundhoo, M.A.Z., Mohee, R., Hassan, M.A., 2015. Effects of pre-treatment technologies on dark fermentative biohydrogen production: A review. J. Environ. Manage. https://doi.org/10.1016/j.jenvman.2015.04.006

Cai, G., Jin, B., Saint, C., Monis, P., 2011. Genetic manipulation of butyrate formation pathways in Clostridium butyricum. J. Biotechnol. https://doi.org/10.1016/j.jbiotec.2011.07.004

139

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Chong, M.L., Rahim, R.A., Shirai, Y., Hassan, M.A., 2009. Biohydrogen production by Clostridium butyricum EB6 from palm oil mill effluent. Int. J. Hydrogen Energy. https://doi.org/10.1016/j.ijhydene.2008.10.095

Claassen, P.A.M., Lopez Contreras, A.M., Sijtsma, L., Weusthuis, R.A., Van Lier, J.B., Van Niel, E.W.J., Stams, A.J.M., De Vries, S.S., 1999. Utilisation of biomass for the supply of energy carriers. Appl. Microbiol. Biotechnol. https://doi.org/10.1007/s002530051586 da Silva, M.L.B., Alvarez, P.J.J., 2009. Bioaugmentation, in: Handbook of Hydrocarbon and Lipid Microbiology. https://doi.org/10.1007/978-3-540-77587-4_356

Dreschke, G., Papirio, S., Lens, P.N.L., Esposito, G., 2019a. Influence of liquid-phase hydrogen on dark fermentation by Thermotoga neapolitana. Renew. Energy.

Dreschke, G., Papirio, S., Scala, A., Lens, P.N.L., Esposito, G., 2019b. High rate continuous biohydrogen production by hyperthermophilic Thermotoga neapolitana. Bioresour. Technol. 122033.

Dreschke, G., Papirio, S., Sisinni, D.M.G., Lens, P.N.L., Esposito, G., 2019c. Effect of feed glucose and acetic acid on continuous biohydrogen production by Thermotoga neapolitana. Bioresour. Technol.

Eriksen, N.T., Nielsen, T.M., Iversen, N., 2008. Hydrogen production in anaerobic and microaerobic Thermotoga neapolitana. Biotechnol. Lett. 30, 103–109.

Gadhamshetty, V., Arudchelvam, Y., Nirmalakhandan, N., Johnson, D.C., 2010. Modeling dark fermentation for biohydrogen production: ADM1-based model vs. Gompertz model. Int. J. Hydrogen Energy. https://doi.org/10.1016/j.ijhydene.2009.11.007

Gadow, S.I., Jiang, H., Hojo, T., Li, Y.Y., 2013. Cellulosic hydrogen production and microbial community characterization in hyper-thermophilic continuous bioreactor. Int. J. Hydrogen Energy 38, 7259–7267. https://doi.org/10.1016/j.ijhydene.2013.04.041

140

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Hallenbeck, P.C., 2009. Fermentative hydrogen production: Principles, progress, and prognosis. Int. J. Hydrogen Energy 34, 7379–7389. https://doi.org/10.1016/j.ijhydene.2008.12.080

Han, W., Li, Y.F., Yue, L.R., 2010. Biohydrogen production: microbiological aspects and bioaugmentation, in: 2010 international conference on mechanic automation and control engineering, MACE2010. https://doi.org/10.1109/MACE.2010.5535490

Herrero, M., Stuckey, D.C., 2015. Bioaugmentation and its application in wastewater treatment: A review. Chemosphere. https://doi.org/10.1016/j.chemosphere.2014.10.033

Hwang, M.H., Jang, N.J., Hyun, S.H., Kim, I.S., 2004. Anaerobic bio-hydrogen production from ethanol fermentation: The role of pH. J. Biotechnol. https://doi.org/10.1016/j.jbiotec.2004.04.024

Kim, D.H., Lee, J.H., Kang, S., Hallenbeck, P.C., Kim, E.J., Lee, J.K., Kim, M.S., 2014. Enhanced

photo-fermentative H2 production using Rhodobacter sphaeroides by ethanol addition and analysis of soluble microbial products. Biotechnol. Biofuels. https://doi.org/10.1186/1754- 6834-7-79

Koskinen, P.E.P., Lay, C.H., Beck, S.R., Tolvanen, K.E.S., Kaksonen, A.H., Örlygsson, J., Lin, C.Y., Puhakka, J.A., 2008. Bioprospecting thermophilic microorganisms from icelandic hot springs for hydrogen and ethanol production, in: Energy and Fuels. pp. 134–140. https://doi.org/10.1021/ef700275w

Kothari, R., 2017. A critical review on factors influencing fermentative hydrogen production. Front. Biosci. https://doi.org/10.2741/4542

141

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Kyazze, G., Martinez-Perez, N., Dinsdale, R., Premier, G.C., Hawkes, F.R., Guwy, A.J., Hawkes, D.L., 2006. Influence of substrate concentration on the stability and yield of continuous biohydrogen production. Biotechnol. Bioeng. https://doi.org/10.1002/bit.20802

Lacerda, C.M.R., Reardon, K.F., 2009. Environmental proteomics: Applications of proteome profiling in environmental microbiology and biotechnology. Briefings Funct. Genomics Proteomics. https://doi.org/10.1093/bfgp/elp005

Lacis, L.S., Lawford, H.G., 1991. Thermoanaerobacter ethanolicus growth and product yield from elevated levels of xylose or glucose in continuous cultures. Appl. Environ. Microbiol.

Lee, K.S., Hsu, Y.F., Lo, Y.C., Lin, P.J., Lin, C.Y., Chang, J.S., 2008. Exploring optimal environmental factors for fermentative hydrogen production from starch using mixed anaerobic microflora. Int. J. Hydrogen Energy. https://doi.org/10.1016/j.ijhydene.2007.10.019

Lee, Y.E., Jain, M.K., Lee, C., Zeikus, J.G., 1993. Taxonomic Distinction of Saccharolytic Thermophilic Anaerobes. Int. J. Syst. Bacteriol. https://doi.org/10.1099/00207713-43-1-41

Li, C., Fang, H.H.P., 2007. Fermentative Hydrogen Production From Wastewater and Solid Wastes by Mixed Cultures. Crit. Rev. Environ. Sci. Technol. https://doi.org/10.1080/10643380600729071

Lin, Y., Tanaka, S., 2006. Ethanol fermentation from biomass resources: Current state and prospects. Appl. Microbiol. Biotechnol. https://doi.org/10.1007/s00253-005-0229-x

Logan, B.E., Oh, S.E., Kim, I.S., Van Ginkel, S., 2002. Biological hydrogen production measured in batch anaerobic respirometers. Environ. Sci. Technol. 36, 2530–2535. https://doi.org/10.1021/es015783i

Mishra, P., Krishnan, S., Rana, S., Singh, L., Sakinah, M., Ab Wahid, Z., 2019. Outlook of fermentative hydrogen production techniques: An overview of dark, photo and integrated dark-photo fermentative approach to biomass. Energy Strateg. Rev. https://doi.org/10.1016/j.esr.2019.01.001

Ngo, T.A., Kim, M.S., Sim, S.J., 2011a. High-yield biohydrogen production from biodiesel manufacturing waste by Thermotoga neapolitana. Int. J. Hydrogen Energy 36, 5836– 5842. https://doi.org/10.1016/j.ijhydene.2010.11.057

142

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Ngo, T.A., Kim, M.S., Sim, S.J., 2011b. Thermophilic hydrogen fermentation using Thermotoga neapolitana DSM 4359 by fed-batch culture. Int. J. Hydrogen Energy 36, 14014–14023. https://doi.org/10.1016/j.ijhydene.2011.04.058

Nzila, A., Razzak, S.A., Zhu, J., 2016. Bioaugmentation: An emerging strategy of industrial wastewater treatment for reuse and discharge. Int. J. Environ. Res. Public Health. https://doi.org/10.3390/ijerph13090846

Okonkwo, O., Escudie, R., Bernet, N., Mangayil, R., Lakaniemi, A.-M., Trably, E., 2019a. Impacts of short-term temperature fluctuations on biohydrogen production and resilience of thermophilic microbial communities. Int. J. Hydrogen Energy.

Okonkwo, O., Escudie, R., Bernet, N., Mangayil, R., Lakaniemi, A.-M., Trably, E., 2019b. Bioaugmentation enhances dark fermentative hydrogen production in cultures exposed to short-term temperature fluctuations. Appl. Microbiol. Biotechnol. 1–11.

Okonkwo, O., Lakaniemi, A.M., Santala, V., Karp, M., Mangayil, R., 2018. Quantitative real-time PCR monitoring dynamics of Thermotoga neapolitana in synthetic co-culture for biohydrogen production. Int. J. Hydrogen Energy 43, 3133–3141. https://doi.org/10.1016/j.ijhydene.2017.12.002

Qiu, C., Shi, P., Xiao, S., Sun, L., 2017. Effects of pH and substrate concentrations on dark fermentative biohydrogen production from xylose by extreme thermophilic mixed culture. World J. Microbiol. Biotechnol. 33. https://doi.org/10.1007/s11274-016-2178-1

Reilly, M., Dinsdale, R., Guwy, A., 2014. Mesophilic biohydrogen production from calcium hydroxide treated wheat straw. Int. J. Hydrogen Energy 39, 16891–16901. https://doi.org/10.1016/j.ijhydene.2014.08.069

Sharma, P., Melkania, U., 2018. Effect of bioaugmentation on hydrogen production from organic fraction of municipal solid waste. Int. J. Hydrogen Energy. https://doi.org/10.1016/j.ijhydene.2018.03.031

Sivagurunathan, P., Gopalakrishnan, K., Lin, C.-Y., 2014. Enhancement of fermentative hydrogen production from beverage wastewater via bioaugmentation and statistical optimization. Curr. Biochem. Eng. https://doi.org/10.2174/2212711901999140516122032 143

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Valdez-Vazquez, I., Poggi-Varaldo, H.M., 2009. Hydrogen production by fermentative consortia. Renew. Sustain. Energy Rev. https://doi.org/10.1016/j.rser.2008.03.003

Wang, D.Z., Kong, L.F., Li, Y.Y., Xie, Z.X., 2016. Environmental microbial community proteomics: Status, challenges and perspectives. Int. J. Mol. Sci. https://doi.org/10.3390/ijms17081275

Wang, J., Wan, W., 2008. Effect of temperature on fermentative hydrogen production by mixed cultures. Int. J. Hydrogen Energy 33, 5392–5397. https://doi.org/10.1016/j.ijhydene.2008.07.010

Wang, Y., Qian, P.Y., 2009. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies. PLoS One 4. https://doi.org/10.1371/journal.pone.0007401

Wiegel, J., Ljungdahl, L.G., 1981. Thermoanaerobacter ethanolicus gen. nov., spec. nov., a new, extreme thermophilic, anaerobic bacterium. Arch. Microbiol. https://doi.org/10.1007/BF00405910

Yu, H., Zhu, Z., Hu, W., Zhang, H., 2002. Hydrogen production from rice winery wastewater in an upflow anaerobic reactor by using mixed anaerobic cultures, in: Int. J. Hydrogen Energy. https://doi.org/10.1016/S0360-3199(02)00073-3

Yue, Y., Zhang, L.S., Ding, J., 2011. Factors Influenced Continuous Dark Fermentative Hydrogen- Producing Reactor. Adv. Mater. Res. https://doi.org/10.4028/www.scientific.net/amr.183- 185.457

144

Chapter 6: Enhancing thermophilic dark fermentative hydrogen production at high glucose concentrations via bioaugmentation with Thermotoga neapolitana

Zhang, F., Yang, J.H., Dai, K., Ding, Z.W., Wang, L.G., Li, Q.R., Gao, F.M., Zeng, R.J., 2016. Microbial dynamics of the extreme-thermophilic (70 °C) mixed culture for hydrogen production in a chemostat. Int. J. Hydrogen Energy 41, 11072–11080. https://doi.org/10.1016/j.ijhydene.2016.04.085

Zhao, C., Karakashev, D., Lu, W., Wang, H., Angelidaki, I., 2010. Xylose fermentation to biofuels (hydrogen and ethanol) by extreme thermophilic (70 °C) mixed culture. Int. J. Hydrogen Energy 35, 3415–3422. https://doi.org/10.1016/j.ijhydene.2010.01.082

Zheng, H., Zeng, R.J., Angelidaki, I., 2008. Biohydrogen production from glucose in upflow biofilm reactors with plastic carriers under extreme thermophilic conditions (700 °C). Biotechnol. Bioeng. https://doi.org/10.1002/bit.21826

145

CHAPTER 7 General discussion and conclusions

146

Chapter 7: General discussion and conclusion

7.1. General discussion

In this work, thermophilic dark fermentative H2 production was studied using different biological cultivation systems and under varying conditions. As can be seen from Table 7.1, the H2 yield obtained with the synthetic co-culture of T. neapolitana and C. saccharolyticus (chapter 5) was higher than those obtained in any of the mixed cultures used in this study with or without bioaugmentation (chapters 3, 4 and 6). Analysis of mass balance in COD equivalents of substrates added to the incubations and the soluble metabolites present in the end of the incubations as described by Gonzales and Kim (2017) and Sivagurunathan and Lin (2016), enabled comparison of substrate conversion efficiencies of the different experiments (Table 7.2). The results showed that the COD removal efficiency was higher in the pure cultures and in the synthetic co-culture compared to mixed cultures, with pure culture of T. neapolitana having the highest COD removal efficiency. However, it should be noted that the cultivation conditions were different in the different experiments of this study as shown in Table 7.1.

In chapters 3 and 4, where cultures were exposed to either upward or downward temperature fluctuation, it was observed that a larger share of the substrate was converted to butyrate compared to either acetate or lactate. In the experiments conducted at 75 °C with initial pH and glucose concentration of 7.5 and 20 mM (chapter 5), acetate was the major metabolite produced in both pure cultures and in the synthetic co-culture. Meanwhile in chapter 6 where cultures were exposed to increased substrate concentration and bioaugmentation applied, a higher share of ethanol was observed compared to ethanol or lactate. However, at increasing substrate concentrations, the share of lactate increased especially in the bioaugmented cultures. The differences observed in the distribution of the metabolites across the different studies was a result of the difference in metabolic pathways due to the differences in incubation conditions and the existing microbial community. For example, in chapters 3 and 4 where cultures were exposed to temperature fluctuation and the impact of bioaugmentation on the full recovery of H2 produced, the main player in the microbial community was Thermoanaerobacterium spp. while Thermoanaerobacter spp. was the major player in chapter 6 where cultures were exposed to increased substrate concentration and bioaugmentation applied.

147

Chapter 7: General discussion and conclusion

Table 7.1 Comparison of H2 production obtained under thermophilic conditions in different experiments conducted at constant temperature. It should be noted that these results have been obtained using different pH, substrates and inoculum source. Maximum Maximum H Substrate Substrate H H 2 Temperature 2 2 yield (mol H Major Inoculum Mode pH concentration degradation production production 2 Reference (°C) mol-1 glucose metabolites (mM) rate (mM h-1) (mmol L-1) rate (mmol consumed) L-1 h-1)

Unaugmented mixed NA NA NA 1.85 Butyrate, culture acetate, Batch 6.0 55 Chapter 4 Augmented mixed 4.4 glua + 8.0 NA NA NA 2.07 lactate, culture xylb ethanol

Acetate, T. neapolitana 0.45 42.06 0.69 2.53 lactate C. saccharolyticus 0.59 50.78 1.09 2.69 Acetate Batch 7.5 75 20.0 glua Chapter 5 Co-culture of T. neapolitana + C. 1.27 53.73 1.61 2.77 Acetate saccharolyticus 5.6 glua 0.3 6.87 0.31 1.22

a Enriched 27.8 glu 0.9 27.14 0.62 1.42 hydrogenogenic culture 55.5 glua 1.0 23.14 0.75 1.24 111.0 glua 1.1 29.45 0.92 1.17 Acetate, Batch 6.5 70 ethanol, 5.6 glua 0.3 9.54 0.41 1.68 lactate Chapter 6

Enriched a hydrogenogenic culture 27.8 glu 0.9 23.11 0.53 1.04 augmented with T. 55.5 glua 1.0 29.92 1.20 1.44 neapolitana 111.0 glua 1.2 35.99 1.06 1.31 glua = glucose, xylb = xylose, NA = data not available

148

Chapter 7: General discussion and conclusion

Table 7.1 Continued Maximum H Maximum H yield Temperature Substrate H production 2 2 Major Inoculum Mode pH 2 production rate (mol H mol-1 glucose Reference (°C) (mM) (mmol L-1) 2 metabolites (mmol L-1 h-1) equivalent consumed) Acetate, C. thermocellum + C. Geng et al., Batch 7.0 55 Cellulose 61.89 NA 1.36 butyrate, thermopalmarium 2010 ethanol C. saccharolyticus + C. 27.8 glua + Zeidan et Continuous 6.7 70 NA 4.8 3.70 Acetate kristjanssonii 33.3 xylb al., 2010 Acetate, (Dessì et al., Activated sludge Continuous 5.5 55, 70 50 - xylose NA NA 1.2 butyrate, 2018b) ethanol Acetate, butyrate, (Guo et al., Activated sludge Continuous NA 35 Glucose NA 3.7 1.9 ethanol, 2013) propionate (Hernández- Acetate, Mendoza Anaerobicgranular sludge Continuous 4.5 35 Glucose NA 3.19 2.6 butyrate and Buitrón, 2014) Palm oil mill wastewater Palm oil mill Acetate, O-Thong et Batch 5.5 60 NA 2.60 1.08 treatment plant effluent butyrate al., 2008 Acetate, O-Thong et Anaerobic digested sludge Batch 5.5. 60 Sucrose 53.99 4.4 1.96 butyrate al., 2009 glua = glucose, xylb = xylose, NA = data not available

149

Chapter 7: General discussion and conclusion

Table 7.2 A fraction of COD (%) from the substrate presented by each soluble metabolite in the end of batch incubation calculated for each experiment conducted in this study. COD Substrate Residual Lactate Acetate Ethanol Butyrate Propionate Culture/Temperature pH removal References (mM) sugars (%) (%) (%) (%) (%) (%) (%)

55 ℃ (control-average) ND 0.2 17.3 9.9 41.4 3.6 24.5

Fluctuation to 35 ℃ (step 3) ND 3.2 14.0 ND 48.8 ND 31.3

55 ℃ after fluctuation (step 5) ND 0.35 19.21 13.3 36.3 3.6 24.2

Fluctuation to 45 ℃ (step 3) 4.4 glua + 6.4 2.3 16.2 ND 44.0 ND 28.6 6.0 Chapter 3 55 ℃ after fluctuation (step 5) 8.0 xylb ND 0.4 17.8 14.1 36.0 3.3 25.5 Fluctuation to 65 ℃ (step 3) 22.5 3.6 16.4 21.9 8.0 2.8 21.9

55 ℃ after fluctuation (step 5) ND 0.5 17.45 12.2 40.8 3.6 22.9

Fluctuation to 75 ℃ (step 3) NA NA NA NA NA NA NA 55 ℃ after fluctuation (step 5) 3.0 0.2 21.1 18.3 30.1 3.6 22.1

55 ℃ (control-average) 0.6 4.6 15.6 26.0 38.9 ND 13.4 55 ℃ (augmented step 1) ND ND 27.1 30.8 24.3 ND 14.6 55 ℃ (control-step 4) 1.78 ND 21.3 30.5 28.3 3.9 11.4 Fluctuation to 35 ℃ (step 1) 0.4 11.4 9.2 16.6 33.8 3.7 23.0 55 ℃ after fluctuation (step 4) ND ND 13.1 22.5 36.9 4.3 20.7 4.4 glua + Fluctuation to 35 ℃ (augmented step 1) 6.0 1.5 4.5 21.1 28.3 24.8 ND 17.2 Chapter 4 8.0 xylb 55 ℃ after fluctuation (step 4) ND ND 20.5 32.8 26.4 3.3 14.2 Fluctuation to 35 ℃ (step 1) 1.3 11.0 10.3 14.5 33.1 ND 27.8 55 ℃ after fluctuation (step 4) ND ND 21.6 32.5 26.8 ND 16.2 Fluctuation to 75 ℃ (step 1) NA NA NA NA NA NA NA 55 ℃ after fluctuation (step 4) ND 4.2 11.9 31.0 31.1 ND 19.6 glua = glucose, xylb = xylose, ND = not detected, NA = data not available 150

Chapter 7: General discussion and conclusion

Table 7.2 Continued Residual COD Substrate Lactate Acetate Ethanol Butyrate Propionate Culture/Temperature pH sugars removal References (mM) (%) (%) (%) (%) (%) (%) (%) Fluctuation to 75 ℃ (step 1) NA NA NA NA NA NA NA

55 ℃ after fluctuation (step 4) ND 4.2 11.94 31.01 31.1 ND 19.6

Fluctuation to 75 ℃ (augmented step 1) 4.4 glua + NA NA NA NA NA NA NA 6.0 Chapter4 8.0 xylb 55 ℃ after fluctuation (step 4) ND 6.1 21.2 30.2 26.6 ND 13.2

Fluctuation to 75 ℃ (step 1) NA NA NA NA NA NA NA

55 ℃ after fluctuation (step 4) ND 4.6 20.3 30.6 30.1 ND 11.5

T. neapolitana (75 ℃) ND 0.8 47.1 ND ND ND 41.4

C. saccharolyticus (75 ℃) 7.5 20 glua ND 6.0 53.9 ND ND ND 27.4 Chapter 5

Co-culture of T. neapolitana + C. ND ND 50.5 ND ND ND 38.0 saccharolyticus (75 ℃) 5.6 glua ND 3.4 9.3 58.5 ND ND 28.8 Enriched hydrogenogenic culture 27.8 glua 17.2 3.5 5.5 39.6 ND ND 26.5 (70 ℃) 55.5 glua 67.8 4.6 2.5 17.6 ND ND 3.9 111.0 glua 77.2 3.6 1.38 11.5 ND ND 6.4 6.5 Chapter 6 5.6 glua NA 9.9 14.2 43.5 ND ND 18.4 Enriched hydrogenogenic culture 27.8 glua 24.7 32.1 4.1 27.3 ND ND 11.8 augmented with T. neapolitana. (70 ℃) 55.5 glua 56.9 15.3 3.9 10.5 ND ND 8.9 111.0 glua 75.5 10.6 2.0 5.0 ND ND 4.2 glua = glucose, xylb = xylose, ND = not detected, NA = data not available

151

Chapter 7: General discussion and conclusion

H2-producing inoculum enriched at 55 °C was used to evaluate the impact of short-term temperature fluctuations on H2 production and the impact of adding known H2 producers belonging to five different genera into the existing microbial community during or after the temperature fluctuation periods (chapters 3 and 4). From the results obtained, it is evident that

H2 production was affected by sudden short-term temperature changes. The effects of the fluctuations included decrease in H2 yield, shifts in the metabolic product quantity and distribution, and changes in the microbial community composition. The major metabolic products observed in these studies were butyrate, acetate, ethanol and lactate and traces of propionate (chapters 3 and 4). Short-term temperature fluctuations did not trigger the formation of new metabolites although bacteria often function during changes in environmental conditions by expressing a range of metabolic capabilities leading to diversion in the metabolic pathway (Ergal et al., 2018; Meyer et al., 2004; Palomo-Briones et al., 2017). Different species possess different growth properties as well as different abilities to cope with stress that occurs as a result of variations in growth conditions (Braga et al., 2016; Melbinger and Vergassola, 2015). The shifts in the share of the different metabolites can therefore be largely attributed to the dominance of different microorganisms under the different temperature conditions.

Bioaugmentation played a significant role in enhancing H2 production during and after the temperature fluctuations (chapter 4). Choosing bacteria from different genera with different growth rates and wide temperature ranges was considered as an effective strategy to overcome the negative effects of temperature fluctuations. However, there were limitations observed from adding five different species in the consortium. Amongst the species added, only the abundance of T. thermosaccharolyticum seemed to correlate with enhanced H2 production. This could have been a result of the used cultivation pH since optimum H2 production by Thermoanaerobacterium thermosaccharolyticum has been reported at pH of 6.5 (Saripan and Reungsang, 2013). Nonetheless, it was demonstrated that bioaugmentation helps to improve the diversity of the microbial community by making up for the loss in microbial diversity occurring during especially upward temperature fluctuations and this seemed to be crucial for optimum performance. Previous studies on the effects of temperature fluctuations on mesophilic and thermophilic conditions have shown that temperature fluctuations tend to result in unstable bioreactor performance, and in some cases in complete failure of the system (El-Mashad et al., 2004; Gadow et al., 2013; Wu et al., 2006). It is important that operators of bioreactors have strategies to cope with unexpected interruptions or technical failures that can arise during bioreactor operation and based on the results of this study, bioaugmentation with carefully selected microorganisms could

152

Chapter 7: General discussion and conclusion

be a viable option. The stability of a bacterial community depends on its structure, which can change due to environmental disturbances such as changes in operational conditions or ecological interactions (Shade et al., 2012). This study demonstrated that having specialized microorganisms such as Thermoanaerobacterium in the consortium can combat the negative effects of sudden disturbances.

In chapter 5, H2 production of pure cultures of Thermotoga neapolitana and Caldicellulosiruptor saccharolyticus and their synthetic co-culture was compared. Both microorganisms were selected for their ability to efficiently utilize hexose and pentose sugars to obtain high H2 yields. T.

-1 neapolitana can produce up to 3.8 mol H2 mol glucose (Munro et al., 2009) and

-1 Caldicellulosiruptor saccharolyticus has been reported to produce up to 3.6 mol H2 mol glucose

(De Vrije et al., 2007). The H2 production by co-culture of T. neapolitana and C. saccharolyticus, showed a 29 and 13% increase in H2 production compared to pure cultures of T. neapolitana and C. saccharolyticus, respectively. The synthetic co-culture of these two ecologically distant species could also be used for treating complex carbohydrates as C. saccharolyticus has the ability to hydrolyze complex carbohydrates such as cellulose to glucose (van de Werken et al., 2008; Zurawski et al., 2015) which can also be utilized by both microorganisms (C. saccharolyticus and

T. neapolitana) to produce H2.

-1 The effect of different feed glucose concentrations (from 5.6 to 111.0 mmol L ) on H2 production with and without augmenting the culture with T. neapolitana further illustrated that bioaugmentation enhances H2 production. The unaugmented mixed culture was dominated by

Thermoanaerobacter spp., which are well known thermophilic bacteria capable to produce H2, ethanol and acetate (Claassen et al., 1999; Koskinen et al., 2008; Lin and Tanaka, 2006). Thus, their presence explains also the high ethanol production that was observed during the incubations. In the batch studies, bioaugmentation increased the H2 production at the different substrate concentrations. H2 production in the bioaugmented cultures increased by 38% at 5.6 mmol-1 glucose compared to the unaugmented culture with the same initial concentration of glucose. Even though there was an overall decreased in H2 yield with the increase in glucose concentration in both unaugmented and augmented cultures, bioaugmented cultures showed higher yields compared to the unaugmented cultures.

Bioaugmentation also caused a shift in the metabolic networks towards when compared to the unaugmented culture, resulting in a lower share of ethanol and a higher share of acetate and lactate in the fermentation broth. Lactate as an electron sink was responsible for the lower H2 153

Chapter 7: General discussion and conclusion

yield observed at higher glucose concentrations, as lactate production takes a large amount of reducing power away from H2 production (Kim et al., 2014; Mishra et al., 2019). Previous studies have shown high concentrations of lactate by T. neapolitana at increased substrate concentrations (Dreschke et al., 2019b), which explains the increased share of lactate observed in the augmented culture compared to the unaugmented culture. This study demonstrated that the augmented cells were able to adapt to their new environment and co-existed with the native consortium. The persistence of T. neapolitana in the native microbial consortium is also attributed to the pre-adaptation method that was used in the study.

Even though bioaugmentation has been shown to enhance H2 yield in dark fermentative H2 production (Goud et al., 2014; Kumar et al., 2015; Ma et al., 2009; Wang et al., 2008; Zhang et al., 2019), only very few studies have used molecular methods to validate the effect of bioaugmentation. QPCR technique developed in chapter 5 was used to validate the growth of T. neapolitana in the synthetic co-culture and to quantify T. neapolitana from the mixed cultures bioaugmented with T. neapolitana (chapter 6) at different substrate concentrations. The qPCR data showed that the gene copies of T. neapolitana increased in the bioaugmented mixed culture with increase in glucose concentration. High-throughput sequencing was used to characterize the bacteria and investigate whether the added cells could be linked to H2 production performance. The data obtained from high-throughput sequencing showed that Thermoanaerobacter was the major player in dark fermentation in both unaugmented and augmented cultures. However, with the augmented cultures, it was observed that Thermotoga was also an active participant and its relative abundance increased with increase in substrate concentration. The application of qPCR technique indicated the significant increase in the population of T. neapolitana added with respect to increase in substrate concentration. Combined with qPCR, high-throughput sequencing served as a useful tool for monitoring the survival and activity of bioaugmented strains (chapter 6).

7.1.1. Microbial community stability during process disturbances and its implication for H2 production

Understanding of the resistance (insensitivity to disturbance) and resilience (the rate of recovery after disturbance) is important for predicting community response to a disturbance. In chapters 3 and 4, Thermoanaerobacterium was dominant genus in the mixed cultures at 55 °C with an average of 90% relative abundance. Other genera observed from the culture included Clostridium and Bacillus and their relative abundance changed with respect to temporal fluctuations. All of these bacterial genera have been widely observed during thermophilic dark fermentative H2

154

Chapter 7: General discussion and conclusion

production (Cabrol et al., 2017; Pawar and van Niel, 2013). However, different H2 producing bacteria become dominant at different operating conditions (Dessì et al., 2018; Gómez et al., 2009; Kothari, 2017). A look into the microbial communities showed that Thermoanaerobacterium was more resistant to upward or downward temperature fluctuations. Nonetheless, Clostridium spp. became dominant during the downward temperature fluctuations (45 and 35 °C) especially at 35 °C. The distribution of Clostridium during the downward temperature fluctuations was significantly higher as opposed to their share at 55 °C. This shows that in the event of a sudden downward temperature fluctuation, Clostridium had a competitive advantage over the other microorganisms and thus preventing complete loss in H2 metabolism or minimizing the negative effect of temperature fluctuation on H2 metabolism. Thermoanaerobacterium remained dominant during and after the upward temperature fluctuations (65 and 75 °C). However, a significant amount of the microbial diversity, e.g. Clostridium spp., was lost as a result of the high degree of temperature fluctuation. Despite the high temperature fluctuation at 75 °C,

Thermoanaerobacterium spp. were able to restore the H2 metabolism after the fluctuation period. Therefore, the greater the range of species that are capable of responding differently to diverse environmental fluctuations (either by resisting the fluctuation or being able to recover from it), the more likely it is that the microbiome will stabilize in response to the applied fluctuation (Allison and Martiny, 2008; Elmqvist et al., 2003; Holling, 2013). Our results indicate that microbial communities were more resilient to downward temperature fluctuations compared to upward temperature fluctuations due to the thermotolerant Clostridium spp. present in the culture. Table 7.3 provides a summary of the effects of sudden temperature fluctuations on the hydrogen yield during and after temperature fluctuation and the effect of bioaugmentation on the obtained hydrogen yield in batch conditions

155

Chapter 7: General discussion and conclusion

Table 7.3 Summary of the effects of sudden temperature fluctuations on the hydrogen yield during and after temperature fluctuation and the effect of bioaugmentation on the obtained hydrogen yield in batch conditions. Percentage Substrate Maximum H yield (mol 2 increase in H Major Inoculum pH concentration Temperature (°C) H mol-1 glucose 2 Reference 2 yield from metabolites (mM) equivalent) augmentation Enriched hydrogenogenic 55 2.1 NA culture

35 → 55 1.8 → 2.2 NA butyrate, acetate, 6.0 4.4 glua + 8.0 xylb Chapter 3 45 → 55 1.6 → 2.0 NA lactate, ethanol 65 → 55 1.9 → 1.9 NA 75 → 55 0.0 → 1.1 NA Unaugmented (Control) 55 1.9 NA Augmented 55 2.1 NA Upward temperature NA fluctuation Unaugmented 35 → 55 1.4 → 1.8 NA Bioaugmentation during 35 → 55 1.8 → 1.9 36.3% → 6.8% temperature fluctuation Butyrate, Bioaugmentation after a b acetate, 6.0 4.4 glu + 8.0 xyl 35 → 55 1.4 → 1.9 0 → 9.7% Chapter 4 temperature fluctuation lactate, ethanol Upward temperature NA fluctuation Unaugmented 75 → 55 0.0 → 1.5 NA Bioaugmentation during 75 → 55 0.0 → 1.9 0.00% → 30% temperature fluctuation Bioaugmentation after 75 → 55 0.0 → 1.9 0 → 33% temperature fluctuation glua = glucose, xylb = xylose, NA = data not available

156

Chapter 7: General discussion and conclusion

In chapter 6, the gradual increase of glucose did not cause any significant shift in the microbial distribution in unaugmentaed cultures. Thermoanaerobacter remained the most dominant member of the consortium even though lactate concentration increased with increase in glucose concentration. Zhao et al. (2018) showed that increase in acetate concentration caused a shift in the microbial structure as well as a redirection in the degradation pathway during methane production. In this study, it is possible that the microbial community structure remained the same due to the low diversity observed under thermophilic conditions. However, the the impact of different substrate concentration during dark fermentative H2 production under mesophilic conditions could have more significant effects on the microbial community structure due to higher microbial diversity. With cultures augmented with T. neapolitana, Thermoanaerobacter remained the dominant member of the consortium with 75% relative abundance while Thermotoga was 23% at 5.6 mmol L-1 initial glucose concentration. However, the increase in substrate concentration led to increase in the abundance of Thermotoga to 37%, causing a reduction in the relative abundance of Thermoanaerobacter (62%).

Based on the results of this study, it is therefore suggested that microbial diversity plays an important role during stress conditions such as temperature fluctuations or increase in substrate concentration. However, when comparing the effects of temperature fluctuations on the microbial community structure and the effect of increasing substrate concentration, it is obvious that temperature changes during dark fermentative H2 production have a more significant effect on the microbial community composition.

7.1.2. Practical implications and limitations of bioaugmentation

Having bioreactors equipped to efficiently degrade organic materials require the presence of microbial consortia that have the ability to degrade the available waste materials. The concept of bioaugmentation has been studied extensively in bioremediation processes for removal of recalcitrant compounds such as chlorinated compounds by Dehalococcoides from groundwater (Schaefer et al., 2009). This study showed that bioaugmentation can be successfully used as a strategy for enhancing H2 production in batch systems and was validated by integrating molecular methods, i.e., qPCR and/or high-throughput sequencing (Chapter4 and 6). However, previous studies have reported the loss of the added specie over time due reasons such as, inability to compete with members of the native microbial community, phage infection and weak biofilm formation or washout (Bouchez et al., 2000; Fu et al., 2009; Nzila et al., 2016; Zhang et al., 2017). Some studies have used repeated bioaugmentation as a strategy to ensure the enhancement of

157

Chapter 7: General discussion and conclusion

biological processes (Yang et al., 2016a, 2016b). Though the use of this method has been shown to be effective, to save time and cost, based on this study, the pre-adaptation of bacterial species to a native microbial community prior to its application in a biological process is considered practical. With this method, it would also be easier to pre-determine whether or not, the added species is compatible with the native microbial community. The pre-adaptation method used in this study (chapter 6) was successful as T. neapolitana was shown to be an active member of the microbial consortium based on the microbial methods applied. Figure 7.1 gives an illustration of how bioaugmentation can be applied to an industrial process and how microbiological applications such as qPCR can be integrated with engineering principles to enhance the efficiency of biological processes. Based on previous studies, the persistence and survival of a bacteria added into a microbial community depends on the augmentation pattern (Yang et al., 2016a, 2016b). For example, Yang et al (2016a) compared one time bioagumentation and repeated bioaugmentation with Hydrogenispora ethanolica LX-B for enhancing hydrogen production. They observed that repeated bioaugmentation ensured the persistence of the added bacterium in the system while with one-time bioaugmentation, the H. ethanolica became undetectable after three batch incubation cycles. Similarly, Yang et al (2016b) also showed higher methane production with repeated bioaugmentation compared to one time bioaugmentation.

For a robust and commercially viable application of dark fermentative hydrogen production, chemical and physical factors such as pH, temperature, and the partial pressure of H2 influencing the hydrogen yield and production rate need to be addressed. Furthermore, inoculum selection is crucial to ensure operational stability and stress tolerance. Coupled with the low H2 yield obtained during dark fermentative H2 production, the incomplete degradation of organic materials is one of the bottlenecks in the commercialization of dark fermentative H2 production. Nonetheless, the results of chapter 5 show that H2 yields can be enhanced using synthetic co-cultures.

Furthermore, results of chapter 4 also illustrated that H2 yields can be maintained during unstable conditions by bioaugmentation with highly specializes H2-producers. The microbial community structure and its variation during the operation of a fermenter is of prime significance to a biohydrogen production process. As observed in this study, any notable change in the microbial community structure could lead to a significant variation in system performance. It is therefore, suggested that microbial monitoring should be conducted while scaling-up biohydrogen production processes to understand the potential implications of stressed experienced in pilot- and large-scale systems (e.g. inhomogeneities in pH, temperature and substrate concentration due to non-optimal mixing) on the microbial community. This study demonstrated that the use of

158

Chapter 7: General discussion and conclusion

selective primers for monitoring a specific microbial community dominated in dark fermentation can be designed and applied successfully to monitor the fluctuation or dynamics of the specific microorganisms. Similarly, in order to understand the long-term effects of bioaugmentation, it is important to determine the fate or survival of exogenous microorganisms added into a biological system. On this note, the use of microbial monitoring methods is therefore essential and should be integrated with engineering principles in order to enhance biological processes.

159

Chapter 7: General discussion and conclusion

Figure 7.1 Illustration of ways to integrate bioaugmentation and molecular monitoring methods to dark fermentation processes.

160

Chapter 7: General discussion and conclusion

7.2. Future research perspectives In this study bioaugmentation was found beneficial especially during shock conditions, but bioaugmentation should also be studied in continuously fed systems to determine the effects of bioaugmentation and fate of added microorganism(s) in more realistic conditions for commercial

H2 production. Additionally, given the enhancement of H2 production from the use of synthetic co- cultures in batch conditions, further studies should also be conducted to evaluate the H2 production efficiency of the co-culture of T. neapolitana and C. saccharolyticus over a long period and preferably in a system operated in continuous mode. Furthermore, the use of more complex substrates from wastewater sources or lignocellulosic wastes would enable the evaluation of the effectiveness of both the synthetic co-culture and bioaugmented cultures in utilizing organic waste materials for H2 production. For example, it is expected that adding T. neapolitana to an existing microbial community will improve the catabolism of complex organic compounds due to its ability to degrade a wide variety of carbohydrates (De Vrije et al., 2009; Kazanov et al., 2013; Rodionov et al., 2013).

As bioaugmentation of a thermophilic mixed culture with T. neapolitana was demonstrated to enhance H2 production, it would be useful to understand better the underlying mechanisms. As the genomic data of T. neapolitana is available, it should be possible to identify specific peptides for T. neapolitana (most preferably, peptides of hydrogenase which would closely link with H2 production) as a substitute for monitoring the activity of T. neapolitana in a mixed culture. Proteomic quantification provides a better resolution than genomic or transcriptomic quantification for monitoring the activity of the bacteria and it enables the quantification of the actual enzyme responsible for the process (Sidoli et al., 2017). Furthermore, the use of molecular methods in dark fermentative H2 production to monitor cause and effect of the process should be extended to time series of shotgun metagenomics or meta-transcriptomics data. This would allow researchers to quantify the number of functions shared across taxa from the same community and identify the taxa that are expressing genes for specific functions at a given time point (Aguiar- Pulido et al., 2016; Mallick et al., 2017). Obtaining such information through time and in response to disturbances would provide quantitative insight as to how often and under what scenarios the microbial community structure and function are linked, and whether the linkages observed are relevant for H2 production. Applying these molecular tools to carefully designed disturbance experiments will additionally help to unravel mechanisms of community stability. Thus, such information-rich datasets can be used in predicting stability of microbial communities in the face of new disturbances.

161

Chapter 7: General discussion and conclusion

Finally, the diversification of the end products of metabolism (organic acids and alcohols) obtained from thermophilic dark fermentation may help to overcome the low H2 yield obtained from the process. Volatile fatty acids such as acetate and butyrate which are key intermediate products observed in this study can also be considered as intermediates for currently emerging bioprocesses such as medium chain fatty acids generation (Atasoy et al., 2018; Baumann and Westermann, 2016; Bhatia and Yang, 2017). However, it is very difficult to separate the volatile fatty acids from one another to provide pure products and this might make their commercial utilization challenging (Kim et al., 2013). Another possibility would be the use of the effluents of dark fermentation as substrate for anaerobic digestion to produce methane (Mamimin et al., 2015; Martinez-Jimenez et al., 2017; Mishra et al., 2017; Si et al., 2016), for microbial fuel cells to produce electricity (Wang et al., 2011) or to photofermentation (Chen et al., 2008). It should be noted, however, that for now from these options, biogas production is the only commercialized conversion process.

7.3. Conclusions

Results of this study showed that the ability of a microbial consortium to withstand temperature fluctuations depends on the degree and direction of the temperature shift. On one hand, sudden decrease in temperature led to a reduction in H2 production despite due to re-adaptation of thermotolerant species to the lower incubation temperature. On the other hand, higher temperatures lead to loss in microbial diversity, decrease in H2 production and possible temporal termination of H2 production.

Bioaugmentation was shown to be an effective strategy for enhancing H2 production. When the mixture of five different microorganisms (Caldicellulosiruptor saccharolyticus, Clostridium thermocellum, Thermoanaerobacterium thermosaccharolyticum and Thermotoga neapolitana) were used for bioaugmentation, only the relative abundance of T. thermosaccharolyticum correlated with the improvement in H2 yield based on results obtained from molecular analyses. Bioaugmentation with a single strain (T. neapolitana) showed that the use of a single strain with the required properties needed in a biological system is sufficient for improving dark fermentative

H2 production. However, bioaugmentation did not only enhance the H2 yield, it also improved the production rate as well as the substrate degradation efficiency. The addition of a specialized bacterium or a group of specialized microorganisms into an existing consortium helps the microbiome to become more adaptable towards deviations in environmental conditions.

162

Chapter 7: General discussion and conclusion

In this study, the highest H2 yield was obtained with a synthetic co-culture containing C. saccharolyticus and T. neapolitana which resulted to about 3.3 or 12% increase in H2 yield when compared to pure cultures of C. saccharolyticus and T. neapolitana, respectively. The H2 yield obtained with the synthetic co-culture was also higher than the yields obtained with any of the mixed cultures used in this study. However, it should be taken into account that the incubation conditions varied between the experiments conducted using different cultures and therefore the results are not fully comparable.

In summary, this study showed that thermophilic dark fermentative H2 production can be enhanced by using synthetic co-cultures or bioaugmentation. The qPCR method used to target the HydA gene was an important tool developed for monitoring the survival of T. neapolitana in mixed culture systems. The monitoring method targeting the 16S rRNA was also beneficial not only for T. neapolitana but also other members of the genus Thermotoga.

The use of molecular methods improved the understanding on the role of certain species in the consortium and improved the understanding of the microbial community dynamics under varying conditions. The use of molecular methods is therefore important in biological applications as it helps to create a link between the microbial community structure and observed H2 production.

163

Chapter 7: General discussion and conclusion

REFERENCES

Aguiar-Pulido, V., Huang, W., Suarez-Ulloa, V., Cickovski, T., Mathee, K., Narasimhan, G., 2016. Metagenomics, metatranscriptomics, and metabolomics approaches for microbiome analysis. Evol. Bioinforma. doi:10.4137/EBO.S36436

Akutsu, Y., Li, Y.Y., Harada, H., Yu, H.Q., 2009. Effects of temperature and substrate concentration on biological hydrogen production from starch. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.01.048

Allison, S.D., Martiny, J.B.H., 2008. Resistance, resilience, and redundancy in microbial communities. Proc. Natl. Acad. Sci. doi:10.1073/pnas.0801925105

Atasoy, M., Owusu-Agyeman, I., Plaza, E., Cetecioglu, Z., 2018. Bio-based volatile fatty acid production and recovery from waste streams: Current status and future challenges. Bioresour. Technol. doi:10.1016/j.biortech.2018.07.042

Baumann, I., Westermann, P., 2016. Microbial Production of Short Chain Fatty Acids from Lignocellulosic Biomass: Current Processes and Market. Biomed Res. Int. doi:10.1155/2016/8469357

Bhatia, S.K., Yang, Y.H., 2017. Microbial production of volatile fatty acids: current status and future perspectives. Rev. Environ. Sci. Biotechnol. doi:10.1007/s11157-017-9431-4

Braga, R.M., Dourado, M.N., Araújo, W.L., 2016. Microbial interactions: ecology in a molecular perspective. Brazilian J. Microbiol. doi:10.1016/j.bjm.2016.10.005

Chen, C.Y., Yang, M.H., Yeh, K.L., Liu, C.H., Chang, J.S., 2008. Biohydrogen production using sequential two-stage dark and photo fermentation processes. Int. J. Hydrogen Energy 33, 4755–4762. doi:10.1016/j.ijhydene.2008.06.055

164

Chapter 7: General discussion and conclusion

Dreschke, G., Papirio, S., Sisinni, D.M.G., Lens, P.N.L., Esposito, G., 2019. Effect of feed glucose and acetic acid on continuous biohydrogen production by Thermotoga neapolitana. Bioresour. Technol.

Elmqvist, T., Folke, C., Nyström, M., Peterson, G., Bengtsson, J., Walker, B., Norberg, J., 2003. Response diversity, ecosystem change, and resilience. Front. Ecol. Environ. doi:10.1890/1540-9295(2003)001[0488:RDECAR]2.0.CO;2

Ergal, İ., Fuchs, W., Hasibar, B., Thallinger, B., Bochmann, G., Rittmann, S.K.M.R., 2018. The physiology and biotechnology of dark fermentative biohydrogen production. Biotechnol. Adv. doi:10.1016/j.biotechadv.2018.10.005

165

Chapter 7: General discussion and conclusion

FU, S., FAN, H., LIU, S., LIU, Y., LIU, Z., 2009. A bioaugmentation failure caused by phage infection and weak biofilm formation ability. J. Environ. Sci. doi:10.1016/S1001- 0742(08)62396-7

Geng, A., He, Y., Qian, C., Yan, X., Zhou, Z., 2010. Effect of key factors on hydrogen production from cellulose in a co-culture of Clostridium thermocellum and Clostridium thermopalmarium. Bioresour. Technol. doi:10.1016/j.biortech.2010.01.042

Gómez, X., Cuetos, M.J., Prieto, J.I., Morán, A., 2009. Bio-hydrogen production from waste fermentation: Mixing and static conditions. Renew. Energy. doi:10.1016/j.renene.2008.08.011

Gonzales, R.R., Kim, S.H., 2017. Dark fermentative hydrogen production following the sequential dilute acid pretreatment and enzymatic saccharification of rice husk. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2017.08.185

Guo, W.Q., Ding, J., Cao, G.L., Chen, C., Zhou, X.J., Ren, N.Q., 2013. Accelerated startup of hydrogen production expanded granular sludge bed with L-cysteine supplementation. Energy. doi:10.1016/j.energy.2013.08.025

Hafez, H., Nakhla, G., El. Naggar, M.H., Elbeshbishy, E., Baghchehsaraee, B., 2010. Effect of organic loading on a novel hydrogen bioreactor. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2009.10.051

Hernández-Mendoza, C.E., Buitrón, G., 2014. Suppression of methanogenic activity in anaerobic granular biomass for hydrogen production. J. Chem. Technol. Biotechnol. doi:10.1002/jctb.4143

Holling, C.S., 2013. Resilience and stability of ecological systems, in: The Future of Nature: Documents of Global Change.

166

Chapter 7: General discussion and conclusion

Kazanov, M.D., Li, X., Gelfand, M.S., Osterman, A.L., Rodionov, D.A., 2013. Functional diversification of ROK-family transcriptional regulators of sugar catabolism in the Thermotogae phylum. Nucleic Acids Res. doi:10.1093/nar/gks1184

Kim, D.H., Lee, J.H., Kang, S., Hallenbeck, P.C., Kim, E.J., Lee, J.K., Kim, M.S., 2014. Enhanced

photo-fermentative H2 production using Rhodobacter sphaeroides by ethanol addition and analysis of soluble microbial products. Biotechnol. Biofuels. doi:10.1186/1754-6834-7-79

Kim, N.J., Park, G.W., Kang, J., Kim, Y.C., Chang, H.N., 2013. Volatile fatty acid production from lignocellulosic biomass by lime pretreatment and its applications to industrial biotechnology. Biotechnol. Bioprocess Eng. doi:10.1007/s12257-013-0221-8

Kothari, R., 2017. A critical review on factors influencing fermentative hydrogen production. Front. Biosci. doi:10.2741/4542

Lin, Y., Tanaka, S., 2006. Ethanol fermentation from biomass resources: Current state and prospects. Appl. Microbiol. Biotechnol. doi:10.1007/s00253-005-0229-x

Mallick, H., Ma, S., Franzosa, E.A., Vatanen, T., Morgan, X.C., Huttenhower, C., 2017. Experimental design and quantitative analysis of microbial community multiomics. Genome Biol. doi:10.1186/s13059-017-1359-z

Mamimin, C., Singkhala, A., Kongjan, P., Suraraksa, B., Prasertsan, P., Imai, T., O-Thong, S., 2015. Two-stage thermophilic fermentation and mesophilic methanogen process for biohythane production from palm oil mill effluent. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2015.03.068

167

Chapter 7: General discussion and conclusion

Martinez-Jimenez, F.D., Macie Pinto, M.P., Mudhoo, A., De Alencar Neves, T., Rostagno, M.A., Forster-Carneiro, T., 2017. Influence of ultrasound irradiation pre-treatment in biohythane generation from the thermophilic anaerobic co-digestion of sugar production residues. J. Environ. Chem. Eng. doi:10.1016/j.jece.2017.07.030

Melbinger, A., Vergassola, M., 2015. The Impact of Environmental Fluctuations on Evolutionary Fitness Functions. Sci. Rep. doi:10.1038/srep15211

Meyer, A.F., Lipson, D.A., Martín, A.P., Schadt, C.W., Schmidt, S.K., 2004. Molecular and Metabolic Characterization of Cold-Tolerant Alpine Soil Pseudomonas Sensu Stricto. Appl. Environ. Microbiol. doi:10.1128/AEM.70.1.483-489.2004

Mishra, P., Balachandar, G., Das, D., 2017. Improvement in biohythane production using organic solid waste and distillery effluent. Waste Manag. doi:10.1016/j.wasman.2017.04.040

Munro, S.A., Zinder, S.H., Walker, L.P., 2009. The fermentation stoichiometry of Thermotoga neapolitana and influence of temperature, oxygen, and pH on hydrogen production. Biotechnol. Prog. 25, 1035–1042. doi:10.1002/btpr.201

O-Thong, S., Prasertsan, P., Birkeland, N.K., 2009. Evaluation of methods for preparing hydrogen-producing seed inocula under thermophilic condition by process performance and microbial community analysis. Bioresour. Technol. doi:10.1016/j.biortech.2008.07.036

O-Thong, S., Prasertsan, P., Intrasungkha, N., Dhamwichukorn, S., Birkeland, N.Kå., 2008. Optimization of simultaneous thermophilic fermentative hydrogen production and COD reduction from palm oil mill effluent by Thermoanaerobacterium-rich sludge. Int. J. Hydrogen Energy. doi:10.1016/j.ijhydene.2007.12.017

168

Chapter 7: General discussion and conclusion

Palomo-Briones, R., Razo-Flores, E., Bernet, N., Trably, E., 2017. Dark-fermentative biohydrogen pathways and microbial networks in continuous stirred tank reactors: Novel insights on their control. Appl. Energy. doi:10.1016/j.apenergy.2017.04.051

Pawar, S.S., van Niel, E.W.J., 2013. Thermophilic biohydrogen production: how far are we? Appl. Microbiol. Biotechnol. 97, 7999–8009. doi:10.1007/s00253-013-5141-1

Rodionov, D.A., Rodionova, I.A., Li, X., Ravcheev, D.A., Tarasova, Y., Portnoy, V.A., Zengler, K., Osterman, A.L., 2013. Transcriptional regulation of the carbohydrate utilization network in Thermotoga maritima. Front. Microbiol. doi:10.3389/fmicb.2013.00244

Schaefer, C.E., Lippincott, D., Steffan, R.J., 2009. Effect of DHC bioaugmentation cell dosage on remediation of chlorinated solvents, in: In Situ and On-Site Bioremediation-2009: Proceedings of the 10th International In Situ and On-Site Bioremediation Symposium.

Shade, A., Peter, H., Allison, S.D., Baho, D.L., Berga, M., Bürgmann, H., Huber, D.H., Langenheder, S., Lennon, J.T., Martiny, J.B.H., Matulich, K.L., Schmidt, T.M., Handelsman, J., 2012. Fundamentals of microbial community resistance and resilience. Front. Microbiol. doi:10.3389/fmicb.2012.00417

Sidoli, S., Kulej, K., Garcia, B.A., 2017. Why proteomics is not the new genomics and the future of mass spectrometry in cell biology. J. Cell Biol. doi:10.1083/jcb.201612010

Sivagurunathan, P., Lin, C.Y., 2016. Enhanced biohydrogen production from beverage wastewater: Process performance during various hydraulic retention times and their microbial insights. RSC Adv. doi:10.1039/c5ra18815f van de Werken, H.J.G., Verhaart, M.R.A., VanFossen, A.L., Willquist, K., Lewis, D.L., Nichols, J.D., Goorissen, H.P., Mongodin, E.F., Nelson, K.E., van Niel, E.W.J., Stams, A.J.M., 169

Chapter 7: General discussion and conclusion

Ward, D.E., de Vos, W.M., van der Oost, J., Kelly, R.M., Kengen, S.W.M., 2008. Hydrogenomics of the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus. Appl. Environ. Microbiol. 74, 6720–9. doi:10.1128/AEM.00968-08

Wang, A., Sun, D., Cao, G., Wang, H., Ren, N., Wu, W., Logan, B.E., 2011. Bioresource Technology Integrated hydrogen production process from cellulose by combining dark fermentation , microbial fuel cells , and a microbial electrolysis cell. Bioresour. Technol. 102, 4137–4143. doi:10.1016/j.biortech.2010.10.137

Wu, M., Sun, K., Zhang, Y., 2006. Influence of temperature fluctuation on thermophilic anaerobic digestion of municipal organic solid waste. J. Zhejiang Univ. Sci. B. doi:10.1631/jzus.2006.B0180

Zhang, Q.Q., Yang, G.F., Zhang, L., Zhang, Z.Z., Tian, G.M., Jin, R.C., 2017. Bioaugmentation as a useful strategy for performance enhancement in biological wastewater treatment undergoing different stresses: Application and mechanisms. Crit. Rev. Environ. Sci. Technol. 47, 1877–1899. doi:10.1080/10643389.2017.1400851

170

Chapter 7: General discussion and conclusion

Zhao, J., Westerholm, M., Qiao, W., Yin, D., Bi, S., Jiang, M., Dong, R., 2018. Impact of temperature and substrate concentration on degradation rates of acetate, propionate and hydrogen and their links to microbial community structure. Bioresour. Technol. doi:10.1016/j.biortech.2018.01.150

Zurawski, J. V., Conway, J.M., Lee, L.L., Simpson, H.J., Izquierdo, J.A., Blumer-Schuette, S., Nookaew, I., Adams, M.W.W., Kelly, R.M., 2015. Comparative analysis of extremely thermophilic Caldicellulosiruptor species reveals common and unique cellular strategies for plant biomass utilization. Appl. Environ. Microbiol. doi:10.1128/AEM.01622-15

171

Appendixes: supporting information for Chapters

Table S6.1 Production yields of acetate lactate and ethanol per mol of glucose consumed in the unaugmented and the T. neapolitana-augmented culture at different feed glucose concentrations. Soluble metabolites

Feed glucose concentration -1 Culture (mol mol glucose consumed) (mmol L-1) Acetate Ethanol Lactate

5.6 0.21 1.17 0.09 27.8 0.25 1.21 0.11 Cultures without bioaugmentation 55.5 0.22 1.03 0.27

111.0 0.18 1.01 0.31

5.6 0.43 0.87 0.20

Cultures bioaugmented with T. 27.8 0.16 0.70 0.82 neapolitana 55.5 0.31 0.56 0.81 111.0 0.25 0.41 0.86

172