DOCSLIB.ORG

Downloaded from ENCODE and Aligned to the Human Genome (Grch38 Release 95) Using Hisat2 (V2.1.0)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downloaded from ENCODE and Aligned to the Human Genome (Grch38 Release 95) Using Hisat2 (V2.1.0) UCSF UC San Francisco Electronic Theses and Dissertations Title miRNA-independent function of lnc-pri-miRNA loci Permalink https://escholarship.org/uc/item/6rc5w9fw Author He, Daniel Publication Date 2021 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California by Submitted in partial satisfaction of the requirements for degree of in in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________ Chair ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Committee Members ii Acknowledgements I am first and foremost extremely lucky and grateful to have family that is supportive of my academic endeavors throughout my life. As the first of my family to graduate college, I’ve learned the true value of hard-work, determination, and love through my parents. They continue to serve as inspiration for me to grow and become a better version of myself every day. I am incredibly grateful to have had the opportunity to learn and grow as a scientist in the laboratory of Dr. Daniel Amos Lim. Dr. Lim has an unparalleled work-ethic that is motivating and inspiring for his students and mentees. I can truly say that I’ve never worked with a mentor that is so meticulously involved with the growth and success of his mentees. These past 5 years in Dr. Lim’s lab will remain with me forever, and I will never forget the lessons I’ve learned about how to be a good scientist, and a good person. Without a doubt, the academic environment within Dr. Lim’s lab is mentally stimulating – where research spans from fine-grain detail of molecular biology, to broader impact health-care tools. I’d like to thank the lab members for all the help and invigorating discussions we’ve had. In particular, David Wu, a talented MSTP student in the lab was directly involved with my thesis project in the molecular dissection of LOC646329. Outside of the lab, Dr. Aaron Diaz, Soren Muller, and Lin Wang were absolutely instrumental in my thesis project. Their knowledge and approaches from a computational biology standpoint really helped answer questions that elevated our findings and broadened the perspective of our work. I’d like to thank my thesis committee members, which was a team of extraordinary scientists whom I look up to. Dr. Robert Blelloch, Dr. Joe Costello, and Dr. Barbara Panning are all extremely accomplished scientists who gave invaluable guidance throughout my years at UCSF. iii Prior to my graduate education, there are a number of academic mentors that have inspired and instilled the confidence I needed to become a graduate student. I’m extremely appreciative to have had the opportunity to learn from Dr. Stacey Harmer, and Dr. Peggy Farnham at UC Davis. As an undergraduate researcher in Dr. Harmer’s and Dr. Farnham’s lab, I was introduced to the world of academic science. This inspired me to continue working in academic science after my undergraduate education, where I continued to learn under Dr. Abby Dernburg at UC Berkeley. With Dr. Dernburg, I learned about what it meant to be a full-time scientist. This experience launched me into one of the most transformative experiences I’ve had since graduating from UC Davis. I worked with Dr. Benoit Bruneau at the Gladstone Institutes, where I was treated more like a graduate student with intellectual freedom, rather than a staff employee. It was in Dr. Bruneau’s lab where I was truly inspired to become a graduate student myself. Without every single one of these people, and every single one of these events, I would not be where I am today – for that, I am truly grateful. iv miRNA-independent function of lnc-pri-miRNA loci Daniel He Abstract Among the large, diverse set of mammalian long noncoding RNAs (lncRNAs), long noncoding primary microRNAs (lnc-pri-miRNAs) are those that host miRNAs. Whether lnc-pri- miRNA loci have important biological function independent of their cognate miRNAs is poorly understood. From a genome-scale lncRNA screen, lnc-pri-miRNA loci were enriched for function in cell proliferation, and in glioblastoma (GBM) cells with DGCR8 or DROSHA knockdown, lnc-pri-miRNA screen hits still regulated cell growth. To molecularly dissect the function of a lnc-pri-miRNA locus, we studied LOC646329 (a.k.a. MIR29HG), which hosts the miR-29a/b1 cluster. In GBM cells, LOC646329 knockdown reduced miR-29a/b1 levels, and these cells exhibited decreased growth. However, genetic deletion of the miR-29a/b1 cluster (LOC646329-miR29D) did not decrease cell growth, while knockdown of LOC646329-miR29D transcripts reduced cell proliferation. The miR-29a/b1-independent activity of LOC646329 corresponded to enhancer-like activation of a neighboring oncogene (MKLN1), regulating cell propagation. The LOC646329 locus interacts with the MKLN1 promoter, and antisense oligonucleotide knockdown of the lncRNA disrupts these interactions and reduces the enhancer- like activity. More broadly, analysis of genome-wide data from multiple human cell types showed that lnc-pri-miRNA loci are significantly enriched for DNA looping interactions with gene promoters as well as genomic and epigenetic characteristics of transcriptional enhancers. Functional studies of additional lnc-pri-miRNA loci demonstrated cognate miRNA-independent, v enhancer-like activity. Together, these data demonstrate that lnc-pri-miRNA loci can regulate cell biology via both miRNA-dependent and miRNA-independent mechanisms. vi Table of Contents Chapter 1: Introduction ................................................................................................................1 Summary ...................................................................................................................................1 Background ..............................................................................................................................1 Sno-lncRNAs .......................................................................................................................3 Circular lncRNAs.................................................................................................................4 Concluding Remarks ...............................................................................................................6 Chapter 2: lnc-pri-miRNA are at elevated levels in human glioblastoma and enriched for function ...........................................................................................................................................8 Summary ...................................................................................................................................8 Introduction ..............................................................................................................................8 Results .....................................................................................................................................10 lnc-pri-miRNA are enriched in high grade glioma ............................................................10 Discussion................................................................................................................................11 Figures and Tables .................................................................................................................12 Experimental Procedures ......................................................................................................75 Chapter 3: lnc-pri-miRNA loci with miRNA-independent function .......................................77 Summary .................................................................................................................................77 Introduction ............................................................................................................................78 Results .....................................................................................................................................79 vii lnc-pri-miRNA loci regulate cell proliferation in cells with Microprocessor knockdown .........................................................................................................................79 LOC646329 knockdown increases apoptosis and reduces proliferation of GBM cells.....80 Deletion of miR-29a/b1 does not decrease cell growth .....................................................81 LOC646329 has cellular function independent of its cognate miRNAs ............................83 The LOC646329 locus contains transcriptional enhancer activity ....................................85 lnc-pri-miRNA loci are enriched for physical interactions with gene promoters and enhancer characteristics .....................................................................................................87 lnc-pri-miRNAs can regulate local genes independent of its cognate miRNAs ................87 Discussion................................................................................................................................88 Figures and Tables .................................................................................................................96 Experimental Procedures ....................................................................................................127
Load more

Recommended publications
  • ARMCX3 (NM 177948) Human Untagged Clone – SC124834
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC124834 ARMCX3 (NM_177948) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMCX3 (NM_177948) Human Untagged Clone Tag: Tag Free Symbol: ARMCX3 Synonyms: ALEX3; dJ545K15.2; GASP6 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_177948, the custom clone sequence may differ by one or more nucleotides ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCA TTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGA TGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGC AAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGG CAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGT TTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAA GCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTG GTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCT GAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGAC ACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTA CTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGA AGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTG CTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTA AACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCA
    [Show full text]
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • Datasheet: VMA00439 Product Details
    Datasheet: VMA00439 Description: MOUSE ANTI ACBD3 Specificity: ACBD3 Format: Purified Product Type: PrecisionAb™ Monoclonal Clone: 5F9 Isotype: IgG1 Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Mouse monoclonal antibody purified by affinity chromatography from ascites Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 1% Bovine Serum Albumin 50% Glycerol Immunogen Full length recombinant human ACBD3 (NP_073572) produced in HEK293T cells External Database Links UniProt: Q9H3P7 Related reagents Entrez Gene: 64746 ACBD3 Related reagents Page 1 of 2 Synonyms GCP60, GOCAP1, GOLPH1 Specificity Mouse anti Human ACBD3 antibody recognizes ACBD3, also known as PBR- and PKA-associated protein 7, PKA (RIalpha)-associated protein, acyl-Coenzyme A binding domain containing 3, golgi complex associated protein 1 60kDa, golgi phosphoprotein 1 and peripheral benzodiazepine receptor-associated protein PAP7.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • A Novel CFHR5 Mutation Associated with C3 Glomerulonephritis in a Turkish Girl
    A novel CFHR5 mutation associated with C3 glomerulonephritis in a Turkish girl Nesrin Besbas, Bora Gulhan, Safak Gucer, Emine Korkmaz & Fatih Ozaltin Journal of Nephrology ISSN 1121-8428 Volume 27 Number 4 J Nephrol (2014) 27:457-460 DOI 10.1007/s40620-013-0008-1 1 23 Your article is protected by copyright and all rights are held exclusively by Italian Society of Nephrology. This e-offprint is for personal use only and shall not be self- archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”. 1 23 Author's personal copy J Nephrol (2014) 27:457–460 DOI 10.1007/s40620-013-0008-1 CASE REPORT A novel CFHR5 mutation associated with C3 glomerulonephritis in a Turkish girl Nesrin Besbas • Bora Gulhan • Safak Gucer • Emine Korkmaz • Fatih Ozaltin Received: 17 July 2013 / Accepted: 31 July 2013 / Published online: 5 December 2013 Ó Italian Society of Nephrology 2013 Abstract C3 glomerulopathy defines a subgroup of syndrome and persistently low C3 level, thus expanding the membranoproliferative glomerulonephritis (MPGN) char- genetic and phenotypic spectrum of the disease. Ecu- acterized by complement 3 (C3)-positive, immunoglobu- lizumab seems to be ineffective in this subtype.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Location Analysis of Estrogen Receptor Target Promoters Reveals That
    Location analysis of estrogen receptor ␣ target promoters reveals that FOXA1 defines a domain of the estrogen response Jose´ e Laganie` re*†, Genevie` ve Deblois*, Ce´ line Lefebvre*, Alain R. Bataille‡, Franc¸ois Robert‡, and Vincent Gigue` re*†§ *Molecular Oncology Group, Departments of Medicine and Oncology, McGill University Health Centre, Montreal, QC, Canada H3A 1A1; †Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6; and ‡Laboratory of Chromatin and Genomic Expression, Institut de Recherches Cliniques de Montre´al, Montreal, QC, Canada H2W 1R7 Communicated by Ronald M. Evans, The Salk Institute for Biological Studies, La Jolla, CA, July 1, 2005 (received for review June 3, 2005) Nuclear receptors can activate diverse biological pathways within general absence of large scale functional data linking these putative a target cell in response to their cognate ligands, but how this binding sites with gene expression in specific cell types. compartmentalization is achieved at the level of gene regulation is Recently, chromatin immunoprecipitation (ChIP) has been used poorly understood. We used a genome-wide analysis of promoter in combination with promoter or genomic DNA microarrays to occupancy by the estrogen receptor ␣ (ER␣) in MCF-7 cells to identify loci recognized by transcription factors in a genome-wide investigate the molecular mechanisms underlying the action of manner in mammalian cells (20–24). This technology, termed 17␤-estradiol (E2) in controlling the growth of breast cancer cells. ChIP-on-chip or location analysis, can therefore be used to deter- We identified 153 promoters bound by ER␣ in the presence of E2. mine the global gene expression program that characterize the Motif-finding algorithms demonstrated that the estrogen re- action of a nuclear receptor in response to its natural ligand.
    [Show full text]
  • Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and Hela Cells
    International Journal of Molecular Sciences Article Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and HeLa Cells Tereza Da ˇnhelovská 1 , Lucie Zdražilová 1 , Hana Štufková 1, Marie Vanišová 1, Nikol Volfová 1, Jana Kˇrížová 1 , OndˇrejKuda 2 , Jana Sládková 1 and Markéta Tesaˇrová 1,* 1 Department of Paediatrics and Inherited Metabolic Disorders, Charles University, First Faculty of Medicine and General University Hospital in Prague, 128 01 Prague, Czech Republic; [email protected] (T.D.); [email protected] (L.Z.); [email protected] (H.Š.); [email protected] (M.V.); [email protected] (N.V.); [email protected] (J.K.); [email protected] (J.S.) 2 Institute of Physiology, Academy of Sciences of the Czech Republic, 142 00 Prague, Czech Republic; [email protected] * Correspondence: [email protected] Abstract: The Acyl-CoA-binding domain-containing protein (ACBD3) plays multiple roles across the cell. Although generally associated with the Golgi apparatus, it operates also in mitochondria. In steroidogenic cells, ACBD3 is an important part of a multiprotein complex transporting cholesterol into mitochondria. Balance in mitochondrial cholesterol is essential for proper mitochondrial protein biosynthesis, among others. We generated ACBD3 knock-out (ACBD3-KO) HEK293 and HeLa cells and characterized the impact of protein absence on mitochondria, Golgi, and lipid profile. In ACBD3- Citation: Daˇnhelovská,T.; KO cells, cholesterol level and mitochondrial structure and functions are not altered, demonstrating Zdražilová, L.; Štufková, H.; that an alternative pathway of cholesterol transport into mitochondria exists. However, ACBD3- Vanišová, M.; Volfová, N.; Kˇrížová,J.; Kuda, O.; Sládková, J.; Tesaˇrová,M.
    [Show full text]
  • Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia
    ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden.
    [Show full text]
  • ADAMTSL3 As a Candidate Gene for Schizophrenia: Gene Sequencing and Ultra-High Density Association Analysis by Imputation
    Schizophrenia Research 127 (2011) 28–34 Contents lists available at ScienceDirect Schizophrenia Research journal homepage: www.elsevier.com/locate/schres ADAMTSL3 as a candidate gene for schizophrenia: Gene sequencing and ultra-high density association analysis by imputation David J. Dow a, Julie Huxley-Jones b, Jamie M. Hall a, Clyde Francks b, Peter R. Maycox a, James N.C. Kew a, Israel S. Gloger a, Nalini A.L. Mehta a, Fiona M. Kelly a, Pierandrea Muglia b, Gerome Breen c, Sarah Jugurnauth c, Inti Pederoso c, David St.Clair d, Dan Rujescu e, Michael R. Barnes b,c,⁎ a Molecular Discovery Research, GlaxoSmithKline Pharmaceuticals, New Frontiers Science Park (North), Third Avenue, Harlow, CM19 5AW, UK b Computational Biology and Genetics, Quantitative Sciences, Drug Discovery, GlaxoSmithKline Pharmaceuticals, Gunnels Wood Road, Stevenage, SG1 2NY, UK c Division of Psychological Medicine and Social, Genetic and Developmental Psychiatry Centre, Institute of Psychiatry, King's College, London, UK d Department of Mental Health, University of Aberdeen, Aberdeen, United Kingdom e Division of Molecular and Clinical Neurobiology, Department of Psychiatry, Ludwig-Maximilians-University, Munich, Germany article info abstract Article history: We previously reported an association with a putative functional variant in the ADAMTSL3 gene, just below Received 27 July 2010 genome-wide significance in a genome-wide association study of schizophrenia. As variants impacting the Received in revised form 29 November 2010 function of ADAMTSL3 (a disintegrin-like and metalloprotease domain with thrombospondin type I motifs- Accepted 11 December 2010 like-3) could illuminate a novel disease mechanism and a potentially specific target, we have used Available online 15 January 2011 complementary approaches to further evaluate the association.
    [Show full text]
  • A Genomic Approach to Study Down Syndrome and Cancer Inverse Comorbidity: Untangling the Chromosome 21
    PERSPECTIVE ARTICLE published: 04 February 2015 doi: 10.3389/fphys.2015.00010 A genomic approach to study down syndrome and cancer inverse comorbidity: untangling the chromosome 21 Jaume Forés-Martos , Raimundo Cervera-Vidal , Enrique Chirivella , Alberto Ramos-Jarero and Joan Climent* Genomics and Systems Biology (InGSB) Lab, Oncology and Hematology Department, Biomedical Research Institute INCLIVA, Valencia, Spain Edited by: Down syndrome (DS), one of the most common birth defects and the most widespread Anaïs Baudot, Centre National de la genetic cause of intellectual disabilities, is caused by extra genetic material on Recherche Scientifique, France chromosome 21 (HSA21). The increased genomic dosage of trisomy 21 is thought to Reviewed by: be responsible for the distinct DS phenotypes, including an increased risk of developing Cristian Bellodi, Lund University, Sweden some types of childhood leukemia and germ cell tumors. Patients with DS, however, have Jian-Hua Mao, Lawrence Berkeley a strikingly lower incidence of many other solid tumors. We hypothesized that the third National Laboratory, USA copy of genes located in HSA21 may have an important role on the protective effect *Correspondence: that DS patients show against most types of solid tumors. Focusing on Copy Number Joan Climent, Genomics and Variation (CNV) array data, we have generated frequencies of deleted regions in HSA21 in Systems Biology (InGSB) Lab, Oncology and Hematology four different tumor types from which DS patients have been reported to be protected. Department, Biomedical Research We describe three different regions of deletion pointing to a set of candidate genes Institute INCLIVA, Avda Blasco that could explain the inverse comorbidity phenomenon between DS and solid tumors.
    [Show full text]
  • Complement Factor H–Related Hybrid Protein Deregulates Complement in Dense Deposit Disease
    Complement factor H–related hybrid protein deregulates complement in dense deposit disease Qian Chen, … , Christine Skerka, Peter F. Zipfel J Clin Invest. 2014;124(1):145-155. https://doi.org/10.1172/JCI71866. Research Article Nephrology The renal disorder C3 glomerulopathy with dense deposit disease (C3G-DDD) pattern results from complement dysfunction and primarily affects children and young adults. There is no effective treatment, and patients often progress to end-stage renal failure. A small fraction of C3G-DDD cases linked to factor H or C3 gene mutations as well as autoantibodies have been reported. Here, we examined an index family with 2 patients with C3G-DDD and identified a chromosomal deletion in the complement factor H–related (CFHR) gene cluster. This deletion resulted in expression of a hybrid CFHR2-CFHR5 plasma protein. The recombinant hybrid protein stabilized the C3 convertase and reduced factor H–mediated convertase decay. One patient was refractory to plasma replacement and exchange therapy, as evidenced by the hybrid protein quickly returning to pretreatment plasma levels. Subsequently, complement inhibitors were tested on serum from the patient for their ability to block activity of CFHR2-CFHR5. Soluble CR1 restored defective C3 convertase regulation; however, neither eculizumab nor tagged compstatin had any effect. Our findings provide insight into the importance of CFHR proteins for C3 convertase regulation and identify a genetic variation in the CFHR gene cluster that promotes C3G-DDD. Monitoring copy number and sequence variations in the CFHR gene cluster in C3G-DDD and kidney patients with C3G-DDD variations will help guide treatment strategies. Find the latest version: https://jci.me/71866/pdf Research article Complement factor H–related hybrid protein deregulates complement in dense deposit disease Qian Chen,1 Michael Wiesener,2 Hannes U.
    [Show full text]