Phylogenetic Affinities of Monimiaceae Based on Cpdna Gene and Spacer Sequences

Home , Atherospermataceae, Cryptocarya chinensis, Cryptocarya obovata, Daphnandra, Daphnandra micrantha, Doryphora

Vol. 1/1, pp. 61–77 Perspectives © Gustav Fischer Verlag, 1998 in Plant Ecology, Evolution and Systematics

Phylogenetic affinities of Monimiaceae based on cpDNA gene and spacer sequences

Susanne S. Renner

Department of Biology, University of Missouri-St. Louis, 8001 Natural Bridge Rd., St. Louis, MO 63121, and the Missouri Botanical Garden, P.O. Box 299, St. Louis 63166, USA; email: [email protected]

Abstract

Nucleotide sequence data from the chloroplast rbcL gene and the trnL-trnF intergenic spacer of 58 species in 38 genera were used to infer the phylogenetic affinities of Monimiaceae to other Laurales, and to assess whether the family in the traditional wide sense is monophyletic. Besides Monimiaceae, the Laurales comprise Calycan- thaceae, Gomortegaceae, Hernandiaceae, and Lauraceae. Magnoliaceae and Myris- ticaceae were used as outgroups. Based on recent molecular data, Amborellaceae and Chloranthaceae, which have sometimes been included in the order, do not belong in the Laurales, and indeed trnL-trnF sequences of Amborella (Amborellaceae) and Hedyosmum (Chloranthaceae) were too different to be unambiguously aligned with the remaining sequences. Parsimony analyses of the trnL-trnF and trnL-trnF- rbcL data groups the genera into five major clades, Calycanthaceae, Atherosperma- taceae, Gomortega, Siparunaceae, and a weakly supported Monimiaceae s.str.-Lau- raceae-Hernandiaceae clade. RbcL data alone provide no resolution at the family level. Many aspects of traditional intra-familiar classification of Monimiaceae are supported except that the sole perfect-flowered member of the family, the monotypic Sri Lankan Hortonia, is not basal (13 of 15–22 genera sampled). Instead, there are two major clades in Monimiaceae. One comprises the functionally dioecious monospe- cific Peumus from Chile plus the morphologically and functionally dioecious small genera Monimia from the Mascarenes and Palmeria from eastern Australia and New Guinea. The other consists of Hortonia and all remaining genera. The atherospermatoids are supported in their traditional circumscription (14 species, 7 genera, of which 10 and 6 were sampled). The neotropical genus Siparuna, different from recent classifications that have stressed its isolation, is genetically and morphologically very close to the West African species Glossocalyx longicuspis. Both taxa have unisexual flowers of the same general morphology, and both have unitegmic ovules. From the current data it seems that monoecy is basal in Siparuna, but more complete sampling of species with a faster evolving genetic marker is needed for a fuller understanding of the evolution of monoecy and dioecy in this genus.

Keywords: Atherospermataceae, Monimiaceae, Siparunaceae, Laurales, molecular phylogenetics, fossil record, biogeography

Introduction

Among the most noteworthy elements of the Monimiaceae in the traditional wide sense Laurales with respect to floral morphology (e.g. Perkins & Gilg 1901; Money et al. 1950; and biogeography are the Monimiaceae. The Philipson 1993) comprise 28–34 genera dis- 62 S. S. Renner tributed in the tropics and subtropics. They nia and two of the other subfamilies, namely have figured prominently in discussions of the Atherospermatoideae and the Mon- the history of land masses inhabited by their imioideae (the last have varied widely in cir- living and extinct members (Croizat 1952; cumscription: see Table 1 and below). Schod- Mädel 1960; Süss 1960; Rüffle 1965; Knappe de (1969, 1970), by contrast, saw no link be- & Rüffle 1975; Takhtajan 1973; Thorne 1973; tween Hortonia and the Atherospermatoi- Raven & Axelrod 1974), and they have been deae and indeed argued for the exclusion of the subject of much floral morphological, de- the latter from the Monimiaceae. Schodde’s velopmental, and palynological work (e.g. analysis of the distribution among Lauralean Endress 1979, 1980a, b, 1992; Endress & families of 45 mainly morphological, anatomi- Lorence 1983; Sampson 1993, 1996, 1997 cal, and palynological characters showed and references therein; Foreman & Sampson that atherospermatoids were closer to Go- 1987; Sampson & Foreman 1990). However, mortegaceae than to the remaining Monimi- doubts about their monophyly have ham- aceae. The atherospermatoids in Schodde’s pered understanding of the biogeography analysis consist of seven small genera with a and evolution of the group (Pichon 1948; total of 14–16 species. Takhtajan 1969; Schodde 1970; Smith 1972; The Monimioideae, which in earlier classi- Raven & Axelrod 1974; Endress 1972; fications comprise the bulk of monimiaceous Behnke 1981, 1988). In addition, subfamilial genera and slightly over half the species, concepts are unclear and have varied greatly have had a third of their genera variously in- (Table 1). These problems are due to the lack cluded or excluded due to differential weight- of a single predominant feature or morpho- ing of particular characters. Thus, Xymalos logical synapomorphy that would character- was transferred to Trimeniaceae (Hutchinson ize the family and to conflicting distributions 1964); Hortonia separated as Hortoniaceae of characters used by different workers to (Smith 1972); and Peumus excluded as Peu- subdivide it. Thus, as pointed out by Smith moideae (Schodde 1970). Peumus and He- (1972), the Monimiaceae have remained a dycarya have also been seen as deserving catch-all family even after the removal of Tri- family status because of their unusual sieve menia and Piptocalyx (as Trimeniaceae; tube plastids. Later they were re-included into Gibbs 1917) and Amborella (Amborellaceae; the Monimiaceae (Behnke 1981, 1988). Re- Pichon 1948). cently, the trend has been to separate Peu- The most recent treatment (Philipson mus and Monimia as Monimioideae s.str. 1993; Table 1) recognizes six subfamilies de- from the other monimioid genera, which for fined by a combination of characters, includ- nomenclatural reasons results in the estab- ing sexual system, perianth structure, anther lishment of a sixth subfamily, Mollinedioi- opening (whether by slits or valves), ovule deae, for the remaining genera (Thorne position (basal or hanging), fruit type (ach- 1974). Philipson subsequently (1987, 1993) enes or drupes), wood anatomy (phloem rays transferred Palmeria from Mollinioideae to narrow or wide), and number of integuments Monimioideae sensu Thorne because of its (one or two). Previous treatments (Table 1), close similarity to Monimia. most importantly those of Perkins & Gilg The Siparuna-Glossocalyx group, finally, (1901) and Money et al. (1950), recognized has been seen as part of the Atherosperma- two or four subfamilies, based on different toideae (Perkins & Gilg 1901), as deserving weightings of the same set of characters. subfamily status (Money et al. 1950), as com- As expected, ideas about evolutionary re- pletely unrelated to all other Monimiaceae lationships among the subfamilies conflict. and being a separate family (Schodde 1970), Thus, Money et al. (1950) considered Horto- or as consisting of two genera „as distinct as nia, with a single species in Sri Lanka (H. any of the other groups which have been ac- ovalifolia Wight and H. angustifolia Trimen in corded family rank“ and requiring subdivision my view are identical with H. floribunda Wight (Philipson 1987, 1993). This led to the estab- ex Arn.), as the most basal group, probably lishment of Glossocalycoideae for the mono- because of its bisexual flowers, a trait absent typic West African genus Glossocalyx (G. from all other Monimiaceae s.l.; they thus ac- brevipes Benth. is here considered a syn- corded Hortonia subfamily rank. Endress onym of G. longicuspis). (1980b) and Sampson (1993), on the other The primary goals of this study were to in- hand, have stressed the links between Horto- vestigate the molecular support for the mono- Phylogenetic affinities of Monimiaceae 63

Table 1. A comparison of major recent treatments of Monimiaceae. Genera appear in the authors’ original sequences, and subfamilies have been numbered in the sequence in which they were treated by those authors. Six monotypic genera recognized by Perkins & Gilg (1901) and Money et al. (1950), but syn- onymized by Philipson (1993), are omitted

Perkins & Gilg (1901) Money et al. (1950) Philipson (1993)

1. Monimioideae Endl. 1. Hortonioideae Money et al. 1. Hortonioideae Hortonia Wight Hortonia Hortonia 3. Monimioideae 6. Monimioideae Peumus Molina Peumus Peumus Palmeria Monimia Amborella Baill. [Amborellaceae Pichon] [Amborellaceae] 5. Mollinedioideae Thorne Hedycarya Forst. & Forst. Hedycarya Hedycarya Levieria Becc. Levieria Levieria Decarydendron Danguy Decarydendron Kibaropsis Vieill. ex Jérémie Kibaropsis Piptocalyx Oliv. [Trimeniaceae Gibbs][Trimeniaceae] Trimenia Seem. [Trimeniaceae] [Trimeniaceae] Xymalos Baill. Xymalos Xymalos Macropeplus Perk. (= Mollinedia) Macropeplus Macropeplus Mollinedia R. & P. Mollinedia Mollinedia Macrotorus Perk. (= Mollinedia) Macrotorus Macrotorus Ephippiandra Decne. Ephippiandra Ephippiandra Matthaea Blume Matthaea Matthaea Steganthera Perk. Steganthera Steganthera Tetrasynandra Perk. Tetrasynandra Tetrasynandra Wilkiea F. Muell. Wilkiea Wilkiea Kibara Endl. Kibara Kibara Lauterbachia Perk. Lauterbachia Lauterbachia Austromatthaea L. S. Smith Parakibara Philipson Faika Philipson Kairoa Philipson Palmeria F. Muell. Palmeria [in Monimioideae] Monimia Thouars Monimia [in Monimioideae] Tambourissa Sonn. Tambourissa Tambourissa Hennecartia Poiss. Hennecartia Hennecartia

2. Atherospermatoideae Endl. 2. Atherospermatoideae 2. Atherospermatoideae Nemuaron Baill. Nemuaron Nemuaron Daphnandra Benth. Daphnandra Daphnandra Laurelia Juss. Laurelia Laurelia Atherosperma Labill. Atherosperma Atherosperma Doryphora Endl. Doryphora Doryphora Dryadodaphne S. Moore Dryadodaphne Laureliopsis Schodde 4. Siparunoideae Money et al. 3. Siparunoideae Siparuna Aubl. Siparuna Siparuna 4. Glossocalycoideae Thorne Glossocalyx Benth. Glossocalyx Glossocalyx

phyly of Monimiaceae s.l., to assess their Besides Monimiaceae s.l., core-Laurales phylogenetic relationships within Laurales, comprise Calycanthaceae, Gomortegaceae, and to test some of the earlier hypotheses Hernandiaceae, and Lauraceae (Hallier about generic relationships within Monimi- 1905; Takhtajan 1987; Cronquist 1981; aceae. Dahlgren 1989; Thorne 1992). These authors 64 S. S. Renner variously included Amborellaceae, Trimeni- cluded, of which 37 and 19, respectively, are aceae, and/or Chloranthaceae in Laurales newly reported here while the remainder but at least in the case of Amborellaceae and were available from earlier work (Renner et Chloranthaceae this is not supported by al. 1997) or, in the case of 15 rbcL se- molecular evidence (Qiu et al. 1993; Chase & quences, were downloaded from GenBank Cox, in press; Savolainen et al., manuscript; (Table 2). RbcL and trnL-trnF sequences are K. Ueda, pers. comm.). Trimeniaceae have from the same species, usually from the not yet been sequenced, but morphological same leaf, except in the case of Hernandia data argue against its placement in core-Lau- albiflora for which an rbcL but no trnL-trnF se- rales (e.g. Endress & Igersheim 1997 and ref- quence was obtained and Cryptocarya for erences therein). For the present assess- which a GenBank rbcL sequence from C. ment of phylogenetic relationships of Monimi- obovata was combined with a trnL-trnF se- aceae within Laurales, 59 species represent- quence from C. chinensis (Table 2). Martin & ing 35 lauralean and three outgroup genera Dowd submitted two C. obovata sequences were sampled; two sequences of Amborel- to GenBank that differ from each other; I used laceae and Chloranthaceae that were gener- the earlier one (L28950) but replaced all nu- ated proved too different from the remaining cleotides that differed between the two se- lauralean (and also outgroup) sequences to quences by the symbol for unkown nu- be aligned unambiguously. cleotide; unknown nucleotides are consid- The genetic markers used are the large ered as uncertainties in PAUP analyses. subunit of ribulose-1,5-biphosphate carboxy- Within Laurales, Calycanthaceae, Gomor- lase (rbcL) and the non-coding tRNA spacer tegaceae, and Siparunaceae had all their region trnL-trnF of the chloroplast genome. genera sampled, and Atherospermataceae, An earlier study (Renner et al. 1997), based Hernandiaceae, and Monimiaceae s.str. most on morphological data and separate analy- genera (6 of 7, 4 of 5, and 13 of 15–22, re- ses of two smaller molecular data sets from spectively). The lower estimate of the number the same genome regions, already indicated of monimiaceous genera reflects the syn- that the Monimiaceae in the wide sense are onymization of seven monotypic groups as probably not monophyletic, but sampling follows (Renner, unpubl. data): Macropeplus density and number of informative characters Perkins and Macrotorus Perkins belong in were low. The present study, which is based Mollinedia Ruiz & Pavón; Kibaropsis Vieillard on much denser sampling and the combina- ex Jérémie in Hedycarya J. & G. Forst.: Faika tion of two fully parallel data sets, still leaves Philipson, Kairoa Philipson, and Parakibara family relationships within Laurales poorly re- Philipson in Kibara Endl.; and Austromat- solved but provides considerable resolution thaea L.S. Smith in Matthaea Blume. The within families. It is intended to guide future Lauraceae are the only family represented by work on key morphological characters that only a fraction of their genera (4 of 50) but need to be reinvestigated in the monimia- their monophyly is unquestioned. Both their ceous clades, and in Laurales, to contribute tribes are represented (following the classifi- to a comprehensive natural classification of cation of Rohwer 1993): the small and homo- the order. Another goal is to begin the reinter- geneous Laureae by Litsea and the more het- pretation of Monimiaceae biogeography and erogeneous Perseeae by three genera, breeding system evolution made necessary namely Cryptocarya, which represents one of by the molecular data. Rohwer’s two subgroups of Perseeae, and by Persea and Cinnamomum, which represent the other subgroup. Materials and Methods The Monimiaceae s.str. are represented as follows (classification of Philipson 1993; The accessions from which DNA was ex- cf. Table 1): (1) Hortonia floribunda, the sole tracted are listed in Table 2. In most cases, member of the Hortonioideae; (2) all but one leaves included in this study came from field- genus and 10 of 14 species of Atherosperma- collected plants and had either been pre- toideae; (3) nine species of Siparuna, sole served in silica gel or prepared as standard member of Siparunoideae (Philipson consid- herbarium vouchers. A few leaves also came ered the enigmatic Bracteanthus a synonym from fresh plants. In all, 57 trnL-trnF and 38 of Siparuna); (4) Glossocalyx longicuspis, rbcL sequences from 59 species are in- sole member of Glossocalycoideae; (5) two Phylogenetic affinities of Monimiaceae 65

Table 2. Sources, voucher specimens, and GenBank accession numbers for the species from which rbcL and trnL-trnF sequences were obtained for this study. Abbreviations used for herbaria follow the Index Herbariorum (Holmgren et al. 1990). The word aliquot after a source indicates that a DNA extract received from that colleague was used to obtain the respective sequence

Taxon Source GenBank accession numbers

rbcL trnL-trnF

Atherospermataceae Daphnandra micrantha (Tul.) Benth. Melbourne BG 504037 ... AF040668 Daphnandra „crypta“ nom. ined. Canberra BG 702451 ... AF040669 Daphnandra repandula (F. Muell.) F. Muell. Hyland s.n. (Sep. 97) AF052195 AF040670 Doryphora aromatica (F.M. Bailey) Ablett et al. 1997 L77211 ... L.S. Smith Hyland s.n. (Sep. 97) ... AF040671 Doruphora sassafras (Endl.) Endl. Sydney BG, bed 130 ... AF040672 Dryadodaphne novoguineensis (Perk.) A.C. Smith Takeuchi 7095 (MO) 1/2 rbcL seq. AF040673 Laurelia novae-zelandiae Cunn. Sampson s.n. (Oct. 97) AF052196 AF040674 Laurelia sempervirens (R. & P.) Tul. Edinburgh BG 19931681 AF052612 AF012402 Laureliopsis philippiana (Looser) Schodde Landrum & Landrum 8160 (MO) AF040662 AF040675 Nemuaron vieillardii (Baill.) Baill. McKee 12800 (K) 1/2 rbcL seq. AF040676

Calycanthaceae Calycanthus occidentalis Hook. & Arn. Missouri BG 897423 AF022951 AF012396 Chimonanthus praecox (L.) Link Qiu et al. 1993 L12639 ... Missouri BG 896912 ... AF040677 Idiospermum australiense (Diels) S.T. Blake Qiu et al. 1993; aliquot L12651 AF040678

Gomortegaceae Gomortega keule (Molina) I.M. Ueda et al. 1997 D89561 ... Johnson Rodriguez 3070 (CONC) ... AF012404

Hernandiaceae Gyrocarpus americanus Jacq. Qiu et al. 1993; aliquot L12647 AF012398 Hernandia albiflora (C.T. White) Kubitzki Ablett et al. 1997 L77210 ... Hernandia moerenhoutiana Guillem. Mt. Coot-tha BG Brisbane AF052614 AF052198 Hernandia ovigera L. Qiu et al. 1993; aliquot L12650 AF012397 Illigera luzonenis (Presl) Merr. Fernando 1602 (LBC) AF050222 AF052199 Sparattanthelium wonotoboense Kosterm. Munich BG AF052197 AF053342

Lauraceae Cinnamomum camphora (L.) Nees Qiu et al. 1993 L12641 ... & Eberm. Ueda s.n. ... Ueda, unpubl. Cryptocarya obovata R. Br. P.J. Martin & J. Dowd, unpubl. L28950 ... Cryptocarya chinensis (Hance) Hemsley Ueda s.n. ... Ueda, unpubl. Litsea japonica (Thun.) Juss. P.J. Martin & J. Dowd, unpubl. U06843 ... Ueda s.n. ... Ueda, unpubl. Persea americana Mill. Golenberg et al. 1990 X54347 ... Missouri BG 897543 ... AF012401

Magnoliaceae Liriodendron chinense (Hemsley) Sarg. Qiu et al. 1993 L12654 ... Missouri BG 890888 ... AF040679 Magnolia hypoleuca Siebold & Zucc. Qiu et al. 1993 L12655 ... Missouri BG 732556 ... AF012395 66 S. S. Renner

Table 2. (Continued)

Taxon Source GenBank accession numbers

rbcL trnL-trnF

Magnolia macrophylla Michx. Golenberg et al. 1990 X54345 ... Missouri BG 790346 ... AF040680

Monimiaceae Hedycarya angustifolia Cunn. Melbourne BG 940335 ... AF040681 Hedycarya arborea J. & G. Forst. Qiu et al. 1993; aliquot L12648 AF012412 Hennecartia omphalandra Poisson Peña s.n. (MO) AF022950 AF040682 Hortonia floribunda Wight ex Arn. Colombo BG AF040663 AF040683 Kairoa suberosa Philipson W. Takeuchi 5999 (MO) ... AF040684 Kibara coriacea (Bl.) Tul. M. Chase; aliquot ... AF012413 Kibara rigidifolia A.C. Smith NSW 200112 (cult. Sydney BG) AF050221 AF040685 Mollinedia ovata R. & P. Ståhl et al. 3735 (QCA) AF050218 AF040686 Monimia ovalifolia Thouars Strasberg s.n. (Herb. Réunion) ... AF054896 Palmeria scandens F. Muell. Bradford 878 (MO) AF052613 AF052200 Peumus boldus Molina Edinburgh BG 19870707 AF040664 AF012403 Tambourissa amplifolia (Tul.) A. DC. Ntl. Trop. BG 940042 ... AF040687 Tambourissa ficus (Tul.) A. DC. Ntl. Trop. BG 940043 ... AF012410 Tambourissa peltata R. Br. ex Baker Ntl. Trop. BG 940040 ... AF040688 Tambourissa tau Lorence Ntl. Trop. BG 940044 AF050219 AF012411 Tetrasynandra pubescens (Benth.) Perk. Hyland s.n. (Sep. 97) ... AF040689 Wilkiea huegeliana A. DC. DeNardi 23593 (UNSW) AF040665 AF040690 Wilkiea macrophylla (Cunn.) A. DC. Sydney BG 873525 ... AF040691 Wilkiea sp. nov. Canberra BG 9613317 ... AF040692 Xymalos monospora (Harvey) Baill. Gereau & Kayombo 4745 (MO) AF050220 AF040693

Myristicaceae Knema latericia Elmer Qiu et al. 1993; aliquot L12653 AF040694

Siparunaceae Glossocalyx longicuspis Benth. Bos 4659 (MO) AF040666 AF012405 Siparuna aspera (R. & P.) A. DC. Madriñán et al. 1502 (COL) ... AF040695 Siparuna brasiliensis (Spreng.) A. DC. Pignal 309 (P) AF013246 AF012408 Siparuna depressa Jangoux Sothers 2109-74 (INPA) ... AF012407 Siparuna echinata (H.B.K.) A. DC. Potthast 243 (QCA) ... AF040696 Siparuna guianensis Aubl. Chanderbali 247 (MO) ... AF040697 Siparuna lepidota (H.B.K.) A. DC. Ståhl 2254 (QCA) AF040667 AF012406 Siparuna muricata (R. & P.) A. DC. Merello et al. 1102 (MO) ... AF040698 Siparuna sessiliflora (H.B.K.) A. DC. Madriñán et al. 1504 (COL) ... AF012409 Siparuna thecaphora (P. & E.) A. DC. Lohmann s.n. (MO) ... AF040699 of the three genera of Monimioideae; and (6) namely 724R (CATGTACCTGCAGTAGC) ten of 12–19 genera of Mollinedioideae. and 636F (GCGTTGGAGAGATCGTTTCT); Total DNA was isolated from leaf tissues where the 636F primer did not work, a com- using standard methods for plant material (cf. plement of the 724R primer was used in- Renner et al. 1997). The rbcL gene was then stead. Primer sequences were received from amplified using a 26-nucleotide forward M. Chase (Fay et al. 1997). Primers for ampli- primer (1F, ATGTCACCACAAACAGAAAC- fying and sequencing the trnL-trnF intergenic TAAAGC) and a 24-nucleotide reverse spacer are the forward (e) and reverse (f) primer (1460R, CTTTTAGTAAAAGATTGGG primers of Taberlet et al. (1991). Purified dou- CCGAG). To amplify the entire gene from ble-stranded DNAs were sent for automated herbarium material, two internal primers were sequencing to the DNA core facility of the used in addition to the two mentioned above, University of Missouri – Colombia. Both Phylogenetic affinities of Monimiaceae 67 strands of DNA were sequenced for both Results markers, and sequences were aligned by eye. To detect sequencing errors, the rbcL TrnL-trnF sequences of Amborella trichopoda sequences were translated into amino acids Baill. (Amborellaceae) and Hedyosmum bon- using the programme SeqPup and then com- plandianum Kunth (Chloranthaceae) could pared with Fig. 4 in Kellogg & Juliano (1997), not be aligned with the remaining 57 trnL-trnF which lists variable and invariable sites in 499 sequences because they differed in more seed plant rbcL sequences. Alternative than a third of their nucleotides. The analysis amino acids found in Laurales all occurred at of a combined data set of 39 rbcL and trnL- sites already known to be variable within an- trnF sequences (1,776 characters, 307 of giosperms, and no stop codons were found in them parsimony informative; including three any of the sequences. A total of 1331 nu- informative INDELs, see below) produced 56 cleotides, from positions 31 to 1362 of the equally parsimonious trees of 979 steps rbcL gene, and 445 nucleotides of the trnL- length (L) with a consistency index (CI, unin- trnF intergenic spacer were employed for re- formative characters excluded) of 0.680 and construction of phylogenetic relationships in a retention index (RI) of 0.738. A strict con- Laurales, using the test version 4.0d63 of sensus of the 56 trees is shown in Fig. 1. The PAUP* written by David L. Swofford. rbcL-trnL-trnF data recover the traditional as- Insertions/ deletions (INDELs) occurred sigments of genera to families, but branching only in the trnL-trnF data and were treated in patterns among families are unresolved ex- two ways: (1) as missing data or (2) as pres- cept for the weakly supported (63% boot- ence/absence characters in a supplemental strap) Monimiaceae-Lauraceae-Hernandi- matrix. Potentially informative but overlapping aceae clade. INDELs where homology assessment was The trnL-trnF data set comprises 58 se- impossible were excluded from the supple- quences (species), and sampling is thus one- mental matrix. Shortest trees were searched and-a-half times as dense as in the combined for heuristically with the RANDOM addition analysis. Lengths of the aligned trnL-trnF se- sequence, tree bisection-reconnection (TBR) quences (excluding gaps) vary from 373 bp in branch swapping, MULPARS, STEEPEST Hedycarya arborea to 305 bp in Gyrocarpus DESCENT, and COLLAPSE options of PAUP, americanus and Hernandia ovigera, which and character changes were interpreted with share a single long deletion. Two INDELs the ACCTRAN optimization. Characters were were potentially informative at the family unweighted. Bootstrap analyses were carried level: a 6 bp insertion shared by Gyrocarpus, out with 100 replicates, using the SIMPLE ad- Hernandia ovigera, Cryptocarya, and Palme- dition and nearest-neighbour-interchange ria and a 1 bp deletion shared by Hernandi- (NNI) branch swapping options. aceae, Lauraceae, and Monimiaceae s.str. In The networks computed by PAUP were addition, there was one informative bp rooted by positioning the root along the change within a section of the alignment branch connecting the Laurales to the out- where some taxa had undergone deletions, groups Magnolia, Liriodendron, and Knema. namely a change from A to G shared by Mon- These representatives of Magnoliaceae and imiaceae s.str., some Lauraceae, and Her- Myristicaceae were used as outgroups based nandiaceae. When the two informative IN- on molecular phylogenetic trees for lower an- DELs and the single nucleotide change were giosperms obtained by Y.-L. Qiu (Qiu 1993, recoded as binary characters and added to pers. comm. 1997), M. Chase (Chase & Al- the matrix, this did not affect topologies but bert, in press; Chase & Cox, in press), and V. resulted in slightly higher bootstrap values. Savolainen and colleagues (V. Savolainen, These three characters were also used in the pers. comm., 1998). However, these workers, combined analysis (above). and also K. Ueda (pers. comm.), stress that Analyses of the trnL-trnF data resulted in the sistergroup relationship of Laurales and memory overflow when more than 14,000 Magnoliales is poorly supported in their anal- equally parsimonious trees had been stored. yses and that additional outgroups need to The high number of trees is due to con- be sampled to firmly establish the lauralean generic species that differ from each other root. Nevertheless, the dense sampling only by one or two nucleotides, resulting in within Laurales achieved in this study should unresolvable polytomies at the tips of the ensure stable ingroup topologies. tree. Figure 2 shows one of 14,000 trees with 68 S. S. Renner branch lengths proportional to numbers of pidly to provide resolution at the family level nucleotide changes. Among the longest within Laurales. branches are those leading to Gomorte- To allow complete searches and proper gaceae, Calycanthaceae, and Hernandia- statistical evaluation of branch support, an ceae. (The hypothezised most basal species additional analysis was performed on a of the family, Hazomalania voyroni from reduced set of 43 trnL-trnF sequences. Madagascar (Kubitzki 1993b), is now being Figure 3 shows the strict consensus of the added to the data set and may break-up the 333 equally parsimonious trees (445 charac- long hernandiaceous branch.) Clearly, the ters, 140 of them parsimony informative, trnL-trnF intergenic spacer evolves too ra- L= 445 steps, CI = 0.742, RI = 0.809) that

Calycanthaceae

c c

Idiospermum c

c c

Calycanthus c

c c

c 100 c

c c

Chimonanthus c

c 100 c

c c

Gyrocarpus c

c c

c c c

Hernandiaceae c c c

c c c

c c

H. albiflora c

c c c

c c

61 H. moerenhoutiana c

c c c

c c

H. ovigera c

c c c

c c 94 c

c c c

c c

Illigera c

c c c

c c 50 c

c c c

c c

Sparattanthelium c

c c

c c c

c c

Cinnamomum c

c c c

Lauraceae c c c

c c c

c c

Litsea c

c c c

c c 100 c

c c c

Persea c

c 71 c

c c

c 50 c

c c

Cryptocarya c

c c

Hennecartia c

c c

c 63 c

c c

Mollinedia c

c c

Wilkiea c

c c

c 74 c

c c

Monimiaceae

c c

63 Kibara c

c 73 c

c c

Tambourissa c

c c

c 100 c

c c

Xymalos c

c c

Hedycarya c

c c

c 92 c

c c

Hortonia c

c c

c 100 c

c c

Palmeria c

c 85 c

c c

70 Monimia c

c c

c c 98 c

c c c

c c c c

c c c

Peumus c

c c c c

c c c

Doryphora c

c c c c

c Atherospermataceae c c c

c c c c

c c c

Dryadodaphne c

c c c c

c c c

c c 68 c

c c c

c c

Nemuaron c

c c c

c c

Laureliopsis c

c 85 c

c c

Daphnandra c

c c

c 100 c

c c

Gomortegaceae c

c c

c L. sempervirens c

c c

c L. novae-zelandiae c

c c

Gomortega c

Siparunaceae c c

c c

Siparuna c

c c

Siparuna c

c 100 c

c c

c 100 c

Glossocalyx c

c c

Knema outgroup c

c c

Magnolia c

c c

Magnolia c

100 c

Liriodendron c

c c

Fig. 1. Strict consensus of 56 equally parsimonious trees for Laurales based on cpDNA rbcL and trnL-trnF sequences (1776 characters, 307 of them informative, Length = 979 steps, CI = 0.680, RI = 0.738). Num- bers below branches represent boostrap values >50% (100 replicates). H. = Hernandia and L. = Laurelia; for remaining species names see the rbcL column in Table 2. Phylogenetic affinities of Monimiaceae 69 resulted from this analysis. The relationship Discussion between Lauraceae-Hernandiaceae-Monimi- aceae s.str. also found in the combined analysis reappears, albeit with even lower boot- Comparison with previous hypotheses on strap support (51%). Siparuna guianensis relationships and S. depressa, the only monoecious The results of this study indicate that the species of Siparuna sequenced, are basal to Monimiaceae as traditionally circumscribed the other Siparuna species, which are dioe- (Perkins & Gilg 1901; Money et al. 1950; cious. Cronquist 1981; Takhtajan 1987; Dahlgren

Fig. 2. One of 14,000 equally parsimonious trees held in memory from an analysis of the complete (58 species) trnL-trnF data set for Laurales (Length = 463 steps, CI = 0.728, RI = 0.849). Numbers above branches represent numbers of nucleotide substitutions. 70 S. S. Renner

1989; Thorne 1974, 1992; Philipson 1993), united the Atherospermataceae, Gomortega- that is, including Atherospermataceae, Si- ceae, and Siparunaceae albeit only on the parunaceae, and Monimiaceae s.str., are basis of three characters homoplastic within polyphyletic. More characters are needed to Laurales. obtain robust trees for the Laurales, and I am The present molecular data support sev- now sequencing additional markers for this eral aspects of recent morphology-based purpose. A cladistic analysis of morphologi- within-Monimiaceae classifications (Philipson cal, karyological, and palynological charac- 1987, 1993). Thus, Peumus, Monimia, and ters (Renner et al. 1997) also could not iden- Palmeria form a separate clade, sister to all

tify the sister group to Monimiaceae s.str., but other core-monimioid genera. Peumus and

PdTc

cFwcsG

cUrcexI

cQvcetS

cGceF

cEE

cUdI

cQdS

cddH

cUc

cddddddd

dddceddecd

xdrced cyPd

cdePddeddcPdTcPddcdddTcPTcGPdTPTPTcddcddcGPTPT ddddecGuyPHwc

cdeU`cdexdcU`cfIcB ScxdcfIcUIcxd`cfd`fd`fIcxdcxdcxd`fd`fI ddddecRd c

cdedccdecdcdecdcRd ccdedcddddedcedccdedccdedccdedccd ddfcsRTuc

cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdedccdecdcdecdecfIccdedcdcfdcedccdedccdedccdedccd ddgcd@

cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcQacdvctddacgScdugSccdcgScQayFctdvctdctdctdvcQagdacdctdctdvc ddfcPdd

cddc dddcRdddcddHRdHcddHccddHcRHcdddcddcddcdddcRHRddcddcdddc ddfcU`cfI

cddc tdc ddfcQvctS

cddc dddc ddfcGcF

cddc dd

cddc ddfcEE

cddc ddfcUdI

cddc ddfcQdS

cddc ddfcddH

cddc ddfcUc

cddc cPdT8cfcddc cddc ddfcdddd@

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc Fwcs9dcfcxdc Exdc ddgcs9

dd cddc dcgB Iedc9 cdd`sdcB Icxd`fIcxdrcdcfIcxdcxdcB Sc ddfcdddH

dd cddc dcgdddedccxIcUdcecdddccdedccdedccdedccdcRd c dd

dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfQvecFcU`cdedceQScdcecU`cdccdedccdedccdedccdecfIc ddfcPddd@c

dd PdTcPdTc cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfGucyFcQagdacdvexdrcQayFcQagdacdvcdvcQacdctdvcQagd8ugSc ddfcFwcs@c

dd U`cfIcU`cfIc cddc dd cRdHeRHRdddetSeRHcRHRdddcddcRddcdddcRHRddHc dd

dd dcedcdcedc cddc dd cyF ddfcddddddd

dd QaedcQaedc cddc dd dHc ddhcd

dd RdddcRdddc cddc dd ddhgS

dd cScecSc cddc dd ddfcdddH

dd yFceyFc cddc dd dd

dd cdHecdH cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd ddfcEE

dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd ddfcUdI

dd dd ddfcQdS

dd dd cPdT8cddfcd dd ddfcddH

dd dd Fwcs9dcxd cExd ddfcB c

dd PdTcPdTc dd Urec9ccddTcddcGPTPTcPdTcGPTcPTcGPTcBdAcddTcddcddcPddheddfcddT

dd U`cfIcU`cfIc dd dcgcdcfIcxdcxd`fd`fIcU`cfIcxd`fIcB Icxd`fIcxdrcdcfIcxdcxdcB SheddfcU`cfI

dd QacgScdcedc dd dcgcdedccdedccdedcdcedccdedcdddedccdedccdedccdedcRd heddfcQvctS

dd ddd cQaedc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfQvecFccdedccdedccdedcdcedccdedcU`cdedccdedccdedccdedcefIheddfcGcF

dd U`cfIcRdddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfGucyFctdctdccdedctdctddacgSctdvcddagdacdvcdvcQacdctdvcQagd8ugShedd

dd dcedcecSc cRdHeddcddddddddcddcddHRdHcdddcdHRHRdddcddcRddcdddcRHRddHheddfcPdT

dd QacgSceyFc cdddddfcUdI

dd RdHccdH cdddddfcdcdS

dd cdcdH

dd cEE

dd cUdI

dd cQdS

dd cddH

dd cB c

dd cPdT8c cddT

dd Fwcs9dc cUdI

dd Urec9cc9d@c9dTPTPdTcPddcPTcGPddddTcddcddcPddc cddddcfcdcdS

dd dcgc9 c@d`fd`cfIcU`sdcB Icxd`edcfIcxdcxdcB Sc cddddcfcdcdH

dd dcecdddexIcUrcdccdecdcdfdddedcedccdedccdcRd c cddc

dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfQvecxdrecQSedccdecdcdfU`cdedcedccdedccdecfIc cddc

dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfGuccgScecxdrctdvcQacgScQayFcQagdacdvedcgSeQagd8ugSc cddc

dd dd cRddHcectSccdddcRdHcRHcRHRdddeddHeRHRddHc cddc

dd dd yFc ctd cddc

dd dd cdH cddd cddc

dd dd cddc

dd dd cddcfdddddddc

dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcgcd

dd cddc dd cddcgcd

dd cddc dd dddccddd cd cddcfdddddddc

dd cddc dd xdrccxdr cddc

dd cddc dd cdfdchPdTcd@c9ddddcPTFcPTcGPTPT cddcfPdTc

dd cddc 8ecPdTcPdT dd cddddddchU`cfIcQ c@wcdcU`fdrcUIcxd`s9 I cddcfUdIc

dd cddc BdecU`cfIcU`cfI dd cdfdchdcedcxIcUrccdcQagSccddddccdeddd cddcfdcdSc

dd cddc xdecdecdcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdfdchdcedccQSecdcdHccdfcdeU`cd cddcfdcdHc

dd cddc cdecdecdcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcctdvhQacgSccxdretd8 cecQayFctdvcQagdvc cddc

dd cddc cdecdecdcdecd dddccdddedcfRdHcedcedddcddTcRHcdddcRHGc cddcfdddd@c

dd cddc cdecdecdcdecd s9 cD cddcgs9 c

dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc tdvccQacgScQacgS cRdH cddcgcIc

dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc dddccRdHcRdH cddcfddddSc

dd cddc cddc cddcgs9 c

dd cddc cddc cddcgcDc

dd cddc cddc cddcfdddHc

dd cddc dddddcdddddc cddc cddc

dd cddc dcfdc cddc cddcfEEc

dd cddc dcfdc cddc dddccddd cd cd cddcfUdIc

dd cddc dddTcdddTc cddc xdrccxdr cddcfQdSc

dd cddc cfIcecfIc cddc cdfdchPTFcddcddcddcPTcGPTcPTcGPTcPddcddcPddchecddcfddHc

dd cddc dcfdc cddc cddddddchU`fdrcxdcxdcxdcB Icxd`fIcUIcxd`fIcB ScxdcB SchecddcfU

dd cddc GucgScGucgSc cddc cdfdchQagSecdedccdcdddccdedcddddedccdcRd ccdcRd checddcfdddd@c

dd cddc RdHcRdHc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdfdchdHecdedccdcU`cdccdedcdcfdccdecfIccdecfIchecddcgs9 c

dd cddc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcctdvhB fcQagdacddagdacdvcddayFctdvcddugSctddugSchecddcgcDc

dd cddc dddccdddedcfddTccRHRddHRHRdddcdHRHcdddcddddHcdddddHchecddcfdddHc

dd cddc B cDc cddc

dd cddc RdHc cddcfPdTc

dd cddc cddcfU`cfIc

dd cddc cddcfdcedc

dd cddc cddcfdddddddc

dd cddc cddc

dd cddc cddcfdddddcdc

dd cddc cddc

dd cddc cddcfEEc

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cdddcddd cddc dc cddcfUdIc

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cxdrcxdr cxdvhfA cddcfQdSc

dd dd cddc dcedcgddddTePTcEcAEEcddTedAcPTcddcdcdAcddcEcddTcEecddcfddHc

dd dd cddc dddddcgxdcdIeU`fIcUIcd@dIcxdIedIcU`fIcxdcdcdrcxdcBbIcxdIcBbIecddcfB

dd dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfdcedcgcdcdcdedccdcdddcdrcdddccdcdedcdcdccdedcdcdcedcddccdcdcddecddcfddTc

dd dd Pdcf8 cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddectdvctdvgtdcdcdvcQagScQccdeQetdcdedcddagSeQddvctd8bdacdcd8bdvccddcfU`cfIc

dd dd cFwfc8d cddc dd cdddcdddcdfdddddddcRHcRdcdeRdcdddddddddHRHeCCGcddddHRddddddHGccddcfQvctSc

dd dd cUcfFd cddc dd cddcfGcFc

dd dd cdddTcFcd cddc dd cddc

dd dd cdefIcUccd cddc dd cddcfPdTc

dd dd cdecdcddddd cddc dd cddcfUdIc

dd dd cQacgSfcd cddc dd cddcfdcdSc

dd dd cRdHfcd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcfdcdHc

dd dd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddc

dd dd cddc cddc dd cddcfEEc

dd dd cddc cddc dd cddcfUdIc

dd dd cddc cddc dd cPT8 cddchddedc cddcfQdSc

dd dd cddc cddc cPdTcPdT dd cU`s9d c8uyAcheExdchxd cddcfddHc

dd dd cddc cddc cU`cfIcU`cfI dd cQac9cdddTcPTcGPTPTcBddddAPTcGPTcBdAcddTcPTccdcddcddcddcGPTPTcddcfB

dd dd cddc cddc cdecdcdecd dd cRTccxdcfIcB Icxd`s9 Icxdccd9 Icxd`fIcxdrcdcfIcUIccdcxdcxdcxdcxd`fd`fIcddcfddTc

dd dd cddc cddc cQaccdcQaccd dd csGedccdcdddccdedddedccdcdddccdedccdedccdcddddccdedccdedccdedccdcddcfUdIc

dd dd cddc cddc cRdddcRddd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddecAcxIedccdcU`cdccdeU`cdedccdcU`cdccdedccdedccdcdfcdedccdedccdedccdcddcfdcdSc

dd dd cddc cddc SfS ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddecdAugSedcgScQagdacdvcQagdvcQvcQdagdacdvcdvcQacdctddayFctdedvcQagdacdctdctdcddcfdcdHc

dd dd cddc cddc cyFecyF c@RHeddHcRHRdddcRHGcGcCRHRdddcddcRddcddHRHcddddddcRHRddcddcdddddc

dd dd cddc cddc dHcedHc ctd cddc

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cddd cddc

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cddc

dd dd cddc cddc

dd dd PdTcPdTc cddc cddc

dd dd U`cfIcU`cfIc cddc cddc

dd dd QacgScQacgSc cddc dddcddcddccd cddc

dd dd ddd cddd c cddc xdrcxdcxdc cddc

dd dd U`cfIcU`cfIc cddc cdecdedcddcPTFcPTcGPTPT cddc

dd dd dcedcdcedc cddc cdecdedcxdcU`fdrcUIcxd`s9 I cddc

dd dd QacgScQacgSc cddc cdecdedccdcQagSccddddccdeddd cddc

dd dd RdHcRdHc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdecdedccdcdHccdfcdeU`cd cddc

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvctdedccd8 cecQayFctdvcQagdvc cddc

dd dd dddcdddddddddcddTcRHcdddcRHGc dddddc

dd dd s9 cD dddddc

dd dd cRdH

dd dd

dd dd ddddThdcddhecddchfcdhddecd

dd dd xdefIhexdhecxdc d

dd dd cdegSePTcddccdcPddcPddeddTcGPTPTcddcPTcPddeddcPTc

dd dd cdddd eUIcxdccdcB ScU`sdedcfIcxd`fd`fIcxdcUIcU`cdexdcB Ichdddddc

dd dd cdefIeddddedccdcRd cdcfdccdedccdedccdcddddcdccdecdcdddchdddddcfcddddddd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdecdedcfdccdecfIcdcfdccdedccdedccdcdfdccdecdcU`cdchecddcfcd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdegSeQayFctdccddugScQayFctdctdedctdctdccddayFcQacdvctddagdvhecddcfcd

dd dd dd ddddHeRHcddddddddHcRHcddcdddddcddcdddddHRHcRdddcddHRHGhecddcfcd

dd dd dd cddc

dd dd dd cddcfcEE

dd dd dd cddcfcUdI

dd dd dd cddcfcQdS

dd dd dd cddcfcddH

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcfcB c

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcfcdddd

dd dd dd cddcfcB c

dd dd dd cddcfcAu

dd dd 8ecPdTcPdT dd cPdT8c cddcfc8dddd

dd dd BdecU`cfIcU`cfI dd Fwcs9dc Ec cddc

dd dd xdecdecdcdecd dd Urec9cGPddd@c9ddddTcBdAPdTcPddcPTcGPddd@c9TPTc cddcfcdddd@

dd dd cdecdecdcdecd dd dcgxd`cs9 c@dcfIcxdd`cfIcU`sdcB Icxd`cs9 cdd Ic cddcgcs9

dd dd cdecdecdcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfdcgcdecxIcUrcdedccdcdecdcdfdddedcexIcUVdddc cddchD

dd dd cdecdecdcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfQvecFccdfQSccdedccdcdecdcdfU`cdedcecQScU`cdc cddcfcE8

dd dd tdvccQacgScQacgS GucyFctdvcexdrccdcgSccQdacgScQayFcQagdacdvecxdrcQagdv cddcfcUdI

dd dd dddccRdHcRdH cRdHedddcetSecddHccCRdHcRHcRHRdddectSccRHG cddcfcQdS

dd dd cyFetdc yFc cddcfcddH

dd dd dHcedddc cdH cddcfcB c

dd dd cddcfcddT

dd dd cddcfcU`cfI

dd dd cddcfcQvctS

dd dd cddcfcGcF

dd dd cddc

dd dd cddcfcPdT

dd dd cddcfcUdI

dd dd cddddTc cddcfcdcdS

dd dd cxdccfIc cddcfcdcdH

dd dd dcedcPTcGPTPddcPTcPTc cddc

dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgdddHcddddedccRd cddddcdddc cddcfcUdI

dd dd dcfdcfdcecfIcdcecU`cdc cddcfcQdS

dd dd ctdvfQayFctdvcdugScQayFcQagdv cddcfcddH

dd dd cdddfRHcdddcddHcRHcRHG cddcfcB c

dd dd cddcfcddT

dd dd cddddcfcUdI

dd dd cddddcfcdcdS

dd dd cdcdH

dd dd

dd dd cdddedddc dc

dd dd cxdrexdrc yduc

dd dd dcecdePTcGPTcGPTcPTcPddcPTcGPddddddcPT

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfddddddeUIcxd`fIcxd`fIcUIcU`sdcB Icxd`ccdedcB I

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfdcecdeddddedccdedccdcddddcdcecdddccdecdedcddd cddddd

dd dd dd dcecdedcfdccdedccdcdfdcecU`cdccdecdedcU`cd cddddd

dd dd dd ctdvetdvcQayFctdvcdedvcddayFcQayFcQagdacdvccQacddagdvc dd

dd dd dd cdddedddcRHcdddcdddddcdHRHcRHcRHRdddccRddHRHGc dd

dd dd dd dd

dd dd dd dddcedddcgddcddccd ddecd dd

dd dd dd xddvctddrcgxdcxdc d dd

dd dd dd cdIcUdePdTccdedcddcGPTcPTcPddeddcPTc dd

dd dd dd cdcQScdeU`cfIccdedcxdcxd`fIcUIcU`cdexdcB Ic dd

dd dd dd cdcxdrcdedcedccdedccdedccdcddddcdccdecdcdddc dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdedccdedcedccdedccdedccdcdfdccdecdcU`cdc dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcetdvcQacgSctdedccdedvcddayFcQacdvctddagdv dd

dd dd dd dddcedddcRdHcddddddddddddcdHRHcRdddcddHRHG dd

dd dd dd dd

dd dd dd dddcdddcdddcdcddcddcfdc dd

dd dd dd xdrcxdrcxdrcexdcxdc dd

dd dd dd cQvctdvctScddccdedcd@cddcPTcPTc dd

dd dd dd cxIcUIcUrcxdccded@cxdcUIcB Ic dd

dd dd dd QScQScedccdedd cedcddddcdddc dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgxdrcxdrcedccdedGedcdcecU`cdc dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgcdecdectdccdedcAucddayFcQagdv dd

dd dd dd cdecdecddddddddc8ddddHRHcRHG dd

dd dd dd dd

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd

dd dd cddc dd dd

dd dd cddc dd dddcdddcgcd dd

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddc dd xdrt@w dd

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddc dd cdFcecPTcddcGPTPdTcPTc dd

dd dd cddc cdddddePdc dd cdd fcB Icxdcxd`fd`cfIcB Ic dd

dd dd cddc cdfcFw dd cdGcecdddccdedccdecdcdddc dd

dd dd cddc cdfcUc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdcGecU`cdccdedccdecdcU`cdc dd

dd dd cddc cdddTcdddT ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcxAuccQagdacdedvcQacgScQagdv dd

dd cddddde8 dd cddc fIcdefI dd dddccdddcRHRddddddcRdHcRHG dd

dd cdgBd dd cddc cdcdecd dd dd

dd cdgxd dd cddc cGucgScQacgS dd dd

dd cdddTecd dd cddc cRdHcRdH dd dd

dd fIecd dd cddc dd dd

dd cdecd dd cddc dd dd

dd cGucgSetdvc dd cddc dd dd

dd cRdHedddc dd cddc dd dd

dd dd cddc dd dd

dd dd cddc dd dddcdddcedcdd dd

dd dd cddc dd xdrt@wgxd ddfcdddddd@

dd dd cddc dd cdFcecddccddTcPTcGPTPTc ddhdH

dd dd cddc dd cdd fcxdccdcfIcB Icxd`s9 Ic ddgyPHw

dd dd cddc dd cdGcfdccdedcdddedccdddc ddfcdd

dd dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdcGfdccdedcU`cdedccU`cdc ddgsRTu

dd dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcxAucctdvcQagScQagdacdvcQagdv ddhdT

dd dd cddc dd dddccdddcdddcRHcRHRdddcRHG ddfc9dddddA

dd dd cddc dd ddfcddd

dd dd cddc dd ddfcU`cfI

dd dd cddc dd ddfcQacgS

dd dd cddc dd ddfcRdH

dd dd cddc dd dd

dd dd cddc dd ddfcdddd@

dd dd cddc dd ddgcs9

dd dd cddc dd ddhD

dd dd cddc dd dddddddc dd ddfcdddH

dd dd cddc dd dwcdcsdcf8uc d dd

dd dd cddc dd cdecPTcBddTPTPTcPddc9d@c9dTPTcPTcGPTcPddeGPTPThfddfcdddddcd

dd dd cddc dd cdecUIcxdcfd`s9 IcB Sc9 c@d`fIcB Icxd`fIcU`cdexd`s9 Ihfdd

dd dd cddc dd cdecddddccdedccdddcRd exIcUrcdccdcdddccdedcdccdecdedddhfddfcddddd

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgcdecdfcdedccU`cdcefIecQSedccdcU`cdccdedcdccdecdeU`cdhfddhS

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgtdvccQayFccQacdvcQagd8ugSecxdrctdvcddagdacdvcddacdvctdvcQagdvcheddfcdddd

dd dd cddc cddc dddccRHccRdddcRHRddHectSccdddcdHRHRdddcdHRdddcdddcRHGcheddhfI

dd dd cddc cddc yFc ddhgS

dd dd cddc cddc cdH ddfcdddH

dd dd cddc cdddddcddddd cddc dd

dd dd cddc cdwccdcdwccd cddc ddfcdddddcd

dd dd cddc tSftS cddc dd

dd dd cddc UrfUr cddc ddfcEE

dd dd cddc ctScectSc cddc ddfcUdI

dd dd cddc cUrcecUrc cddc ddfcQdS

dd dd cddc cdfcd cddc dddccdddhdd ddfcddH

dd dd cddc cdfcd cddc xdrccxdrhd ddfcB c

dd dd cddc cddc cdfdccPTcPdde9d@c9TPddcPTcGPddd@c9TPT ddfcddT

dd dd cddc cddc cddddddccUIcU`cde9 cdd`sdcB Icxd`cs9 cdd I ddfcU`cfI

dd dd cddc cddc cdfdccddddcdccdecxIcUdcecdddccdecxIcUVddd ddfcQvctS

dd dd cddc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdfdccdfdccdfQScdcecU`cdccdfQScU`cd ddfcGcF

dd dd cddc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcctdvcQayFcQacdvcexdrcQayFcQagdacdvcexdrcQagdvc dd

dd dd cddc cddc dddccdddcRHcRdddcetSeRHcRHRdddcetSeRHGc ddfcPdT

dd dd cddc cddc cyF cyF ddfcUdI

dd dd cddc cddc dHc dHc ddfcdcdS

dd dd cddc cddc ddfcdcdH

dd dd cddc cddc dd

dd dd cddc cddc ddfcEE

dd dd cddc cddc ddfcUdI

dd dd cddc cddc ddfcQdS

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd cddc cddc ddfcddH

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd cddc cddc ddfcB c

dd dd dd cddc cddc ddfcddT

dd dd dd cddc cddc cddddddd dd cd ddfcUdI

dd dd dd cddc cddc cdwcdcsd xd ddfcdcdS

dd dd dd cddc cddc dcePTcGPTPTccddTcPdTcddcddcGPdddcPddcPddcPTc ddfcdcdH

dd dd dd cddc cddc dceB Icxd`fd`fIccdcfIcU`cfIcxdcxdcxd`ccdcB ScB ScB Ic dd

dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgdcedddedccdedccdedcdcedccdedccdecdcRd cRd cdddc dd

dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddgdceU`cdedccdedccdedcdcedccdedccdecdecfIcefIcU`cdc dd

dd c8cePdTcPdTc dd dd cddc cddc dd ctdveQagdacdctdctdvcQagScQacgSccQagdacdvctddugScdugScQagdv dd

dd cBdceU`cfIcU`cfIc dd dd cddc cddc dd cdddeRHRddcddcdddcRHcRdHccRHRdddcdddddHcddHcRHG dd

dd cxdcedcedcdcedc dd dd cddc cddc dd dd

dd dcedcedcdcedc dd dd cddc cddc dd dd

dd dcedcedcdcedc dd dd cdddddcPdT cddc cddc dd dd

dd dcedcedcdcedc dd dd cdfcU`cfI cddc cddc dd dd

dd ctdveQacgScQacgSc dd dd cyPdcdfcdecd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd

dd cdddeRdHcRdHc dd dd cyPHwccdddTcdecd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd

dd dd dd dd cgfIcdecd cddc dd dd

dd dd dd csRTucfcdcdecd cddc dd 9d@cc9d@ cddc dd

dd dd dd csRdcGucgScQacgS cddc dd 9 cc@ cxdc dd

dd dd dd cRdHcRdH cddc cdddddcPdT dd cGuyFcc9d@c9dTPTPTcPTedcPdTcPdd dd

dd dd dd cddc cdfcU`cfI dd xddrec9 c@d`fd`fIcB IedcU`cfIcB S dd

dd dd dd cddc cyPdcdfcdecd dd tddvfxIcUrcdccdedcdddedcdcedcRd dd

dd dd dd cddc cyPHwccdddTcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcFwsGcecQSedccdedcU`cdedcdcedcefI dd

dd dd dd cddc dd cgfIcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddf8 ccAecxdrctdctdctddagdacddacgScdugS dd

dd dd dd cddc csRTucfcdcdecd 8dAcc8dAectSccddcddcddHRHRddHRdHcddH dd

dd dd dd cddc csRdcGucgScQacgS yFc dd

dd dd dd cddc cRdHcRdH cdH dd

dd dd dd cddc dd

dd dd dd cddc cdddedddc dc dd

dd dd dd cddc cxdrexdrcheyAc dd

dd dd dd cddc dcecdePdTcGPdddAPdTcGPTcddcPT dd

dd dd dd cddc ddddddeU`cfIcxd`ccdd`cfIcxd`fIcxdcB I dd

dd dd dd cddc dcecdedcedccdecdcdecdedccdedcddd dd

dd dd dd cddc dcecdedcedccdecdcdecdedccdedcU`cd dd

dd dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddectdvetdvcQacgSctdvccQdacgSctdvcdeddagdvc dd

dd dd dd dd

dd dd dd ddddTgdd dc dd

dd dd dd xdefIgxd dd

dd dd dd cdecdcPTccdcGPTPTcPTcGPdddcPT dd

dd dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddccdegScB Iccdcxd`fd`fIcUIcxd`edcB I dd

dd dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddccdddHcdddccdedccdedcddddedcedcddd dd

dd dd dd dd cdfcU`cdccdedccdedcdcfdcedcU`cd dd

dd dd dd dd tdvcecQagdacdedctdctddayFctdvctddagdvc dd

dd dd dd dd dddcecRHRdddddcddcddHRHcdddcddHRHGc dd

dd dd dd dd dd

dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dd

dd dd dd dd dd

dd dd dd dddddcPdTc dd dddcedddchfcdhecd dd

dd dd dd dwedcU`cfIc dd xddvctddrc dd

dd dd dd ctScdcedc dd cdIcUdePdTcGPTcddcGPTPTcddcPTc dd

dd dd dd cUrcQaedc dd cdcQScdeU`cfIcxd`fIcxdcxd`fd`fIcxdcB Ic dd

dd dd dd tSeRdddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddecdcxdrcdedcedccdedccdedccdedccdcdddc dd

dd dd dd UrfcSc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddecdedccdedcedccdedccdedccdedccdcU`cdc dd

dd dd dd dcfyFc tdvcetdvcQacgSctdvcdccdedctdctdccddagdv dd

dd dd dd dcecdH dddcedddcRdHcdddcdddddddcddcdddddHRHG dd

dd dd dd dd

dd dd dd ddddT dd

dd dd dd xdefI dd

dd dd dd cdecdcPTcddcddcGPTPTcddcddcPddc dd

dd dd dd cdegScUIcxdcxdcxd`fd`fIcxdcxdcB Sc dd

dd dd dd cdddHcddddccdedccdedccdedccdcRd c dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdfcdfcdedccdedccdedccdecfIc dd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcecQayFccQagdacdctdctdvcQagd8ugSc dddd

dd dd dddcecRHccRHRddcddcdddcRHRddHc dddd

dd dd

dd dd cddddc

dd dd ddddT dc cddddc

dd dd xdesGc 8uc cddc

dd dd cdecxIcgcPTcGPTPdTcGPTPTcPTcBddddcPddcPTc cddc

dd dd cdfdcgcB Icxd`fd`cfIcxd`fd`fIcB IcxdedcU`sdcB Ic cddc

dd dd cdfdcgcdddccdedcedccdedccdcdddccdedcdcecdddc cddc

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdectScgcU`cdccdedcedccdedccdcU`cdccdedcdcecU`cdc cddc

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeyFcgcQagdacdvcQacgSctdctdctddagdvcQacddayFcQagdv cddc

dd dd cddc ddddHecdfcRHRdddcRdHcddcddcddHRHGcRddHRHcRHG cddc

dd dd cddc cddc

dd dd cddc cddcfcdTu

dd dd cddc cddcgfdTu

dd dd cddc ddddT cPd cddcgcdddd

dd dd cddc xdesGc 8 c cddcggdHw

dd dd cddc cdecxIcgcPddcPTcPddcPddcPTcBdAcGPTPTcPddc cddcfcdHw

dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cdfdcgcB ScB IcB ScB ScB Icxdrcxd`s9 IcB Sc cddc

dd dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cdfdcgcRd cdddcRd cRd cdddccdecdedddcRd c cddcfcPddd@c

dd dd dd cddc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdectSchcfIcU`cdecfIcefIcU`cdccdecdeU`cdecfIc cddcfcFwcs@c

dd dd dd cddc cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeyFcgcdugScQagd8ugScdugScQagdacdvctdvcQagd8ugSc cddc

dd dd dd cddc cddc ddddHecdfcddHcRHRddHcddHcRHRdddcdddcRHRddHc cddcfcddddddd

dd dd dd dddddcPdTc cddc cddc cddchcd

dd dd dd dcfU`cfIc cddc cddc cddchgS

dd dd dd yPdcdcfdcedc cddc cddc cddcfcdddH

dd dd dd yPHwedddTcdcedc cddc cddc cddc

dd dd dd cdd gcfIcdcedc cddc cddc cddcfcPdT

dd dd dd sRTugdcdcedc cddc cddc cddcfcUdI

dd dd dd sRdcGucgScQacgSc cddc cddc cddcfcdcdS

dd dd dd RdHcRdHc cddc cddc cddcfcdcdH

dd dd dd cddc cddc ddddT cddchcddchfdd cddc

dd dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc xdesGc cdchcdchfxd cddcfcdddd@

dd dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cdecxIcGPddd@c9TPTcPddccPdTcPddccPTcdddTccddTcGPTcPThcddcgcs9

dd dd dd cddc cdfdcxd`cs9 cdd IcU`cdccU`cfIcU`cdccB IcxdcfIccdcfIcxd`fIcUIhcddchD

dd dd dd cddc cdfdccdecxIcUVdddcdedccdecdcdedccdddccdedccdedccdedcddddhcddcfcPdd

dd dd dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdectSccdfQScU`cdcdedccdecdcdedccU`cdccdedccdedccdedcdchecddcfcU`cfI

dd dd dd cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeyFctdvcexdrcQagddacdvcQacgScQacdvcQagdvcdcgSctdctdccdvcddayFhcddcfcQacgS

dd dd dd cdddddcPdT cddc dd ddddHedddcetSeRHCRdddcRdHcRdddcRHGcddHcddcddddddcdHRHhcddcfcRdH

dd dd dd cdfcU`cfI cddc dd cyF tdc cddc

dd dd dd cyPdcdfcdecd cddc dd dHc dddc cddcfcdcE

dd dd dd cyPHwccdddTcdecd cddc dd cddcfcdcUI

dd dd dd dd cgfIcdecd cddc dd cddcfcQScd

dd dd dd csRTucfcdcdecd cddc dd cddcfcCcd

dd dd dd csRdcGucgScQacgS cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddc

dd dd dd cRdHcRdH cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcecddddddd

dd dd dd dd cddcfcdecd

dd dd dd dd cddcfcQacgS

dd dd dd dd dddc ddhecddccdhfcddcfcRdH

dd dd dd dd xdrc xdhfdc cddc

dd dd dd cdddddcPdT dd cdheddTcPTcddcdTEcEfdddcEccdcEcddTc8dcddcEcEfcddcfcPdT

dd dd dd cdfcU`cfI dd cdhexdIcU`fIcxdcd9bIcUIfcScUIccdcBbIcxdIcUdcxdcBbIcUIfcddcfcUdI

dd dd dd cyPdcdfcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdhecdcdcdedccQScddcdddcddTFcdddccdcddedcdcdcdccdcddcdddfcddcfcdcdS

dd dd dd cyPHwccdddTcdecd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdcydcgtdcddagSccxdrcUbddcecfdeQetd8bdacdcdddccd8bddcfcddcfcdcdH

dd dd dd dd cgfIcdecd dddddccdfddddHRHcedccdHCRdfdddcRdcddddHRddddHRddddddHCRdfcddc

dd dd dd csRTucfcdcdecd cddcfcdddd@

dd dd dd csRdcGucgScQacgS cddcgcs9

dd dd dd cRdHcRdH cddchI

dd dd dd cddcfcddddd

dd dd dd cddchS

dd dd dd cddcfcdddd

dd dd dd cddchfI

dd dd dd cddchgS

dd dd dd ddddThfcddc dd cddcfcdddH

dd dd dd xdesGchecxdc d cddc

dd dd dd cdecxIcPTcdddTeddTcGPTcPTcGPTcPddeGPTPT cddcfcEE

dd dd dd cdfdcB IcxdcfIedcfIcxd`fIcB Icxd`fIcU`cdexd`s9 I cddcfcUdI

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cdfdcdddedccdedccdedccdcdddccdedcdccdecdeddd cddcfcQdS

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeyFcQagdvcdcgSctdctdedvcddagdacdvcddacdvctdvcQagdvc cddcfcB c

dd dd dd ddddHeRHGcddHcddcddddddcdHRHRdddcdHRdddcdddcRHGc cddcfcdddd@c

dd dd dd ctd cddcfcFwcs@c

dd dd dd cddd cddc

dd dd PdTcdddddc dd cddcfcEE

dd dd U`cfIcdwedc dd cddcfcUdI

dd dd QacgScectSc dd cddcfcQdS

dd dd ddd cecUrc dd cddcfcddH

dd dd U`cfIcetS dd cddcfcB c

dd dd dcedceUr dd cddcfcddT

dd dd QacgScedc dd ddecddd cddcfcU`cfI

dd dd RdHcedc dd xdvccxdr cddcfcQvctS

dd dd dd cdAedccPTcGPTPTcddcddcPTcGPTPdTcGPTc cddcfcGcF

dd dd dd cdGcdccUIcxd`fd`fIcxdcxdcB Icxd`fd`cfIcxd`fIc cddc

dd dd dd cdcGdccddddccdedccdedccdcdddccdedcedccdedc cddcfcPdT

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcde9dccdfcdedccdedccdcU`cdccdedcedccdedc cddcfcUdI

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvccxdccQayFctdctdctdvcQagddagdacdvcQacgSctdvcdv cddcfcdcdS

dd dd dd dddcedccRHcddcddcdddcRHCRHRdddcRdHcdddcdd cddcfcdcdH

dd dd dd cddc

dd dd dd cddcfcEE

dd dd dd cddcfcUdI

dd dd dd cddcfcQdS

dd dd dd cddcfcddH

dd dd dd cddcfcB c

dd dd dd cddcfcddT

dd dd dd cddcfcUdI

dd dd dd cddcfcdcdS

dd dd dd dddc cddccd cd cddcfcdcdH

dd dd dd xdrc cxdc cddc

dd dd dd cdfcPTcddcddcGPTPTedcddcPdTcdddTcPddcddcPddc cddc

dd dd dd cdfcB Icxdcxdcxd`fdIedcxdcU`cfIcxdcfIcB ScxdcB Sc cddc

dd dd dd cdfcdddccdedccdeddddedccdcdecdedccdcRd ccdcRd c cddc

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdfcU`cdccdedccdedcfdccdcdecd dccdecfIccdecfIc cddc

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeydcQagdvcQagdacdvcQayFctdccddacgSedcgScdugSctddugSc cddc

dd dd dd ddddddcRHGcRHRdddcRHcdddddHRdHeddHcddHcdddddHc cddc PdTc

dd dd dd ctd cddchfcFwcsG

dd dd dd cddd cddchfcUrcexI

dd dd dd cddchfcQvcdccd

dd dd dd cddchfcAdctS

dd dd dd cddchfc8dddcF

dd dd dd cddc

dd dd dd cddchfcPdT

dd dd dd cddchfcU`cfI

dd dd dd cd cddchfcQacgS

dd dd dd dddc cddchfcRdH

dd dd dd xdrchPddcPTcGPTPTcdddTcPTcGPdd@c9ddddcGPTPTcGPTcPddecddc

dd dd dd cdheB ScUIcxd`fd`fIcxdcfIcUIcxd`s9 c@wcdcxd`fdIcxd`fIcB Secddchfcddddd

dd dd dd cdheRd cddddccdedccdedccdcddddccdexIcUrccdedccddddccdedcRd ecddc S

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdhffIcdfcdedccdedccdcdfcdecQSecdedccdfcdedcefIecddchfcdddd

dd dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdcydcgdugScQayFctdctdctdvcdcgScQayFctdvccxdretdedvcQayFctdvcddugSecddc fI

dd dd dddddccdfddHcRHcddcddcdddcddHcRHcdddcedceddddddcRHcdddcddddHecddc gS

dd dd ctd cddchfcdddH

dd dd cddd cddc

dd dd cddchfcPdT

dd dd dddddchfcU`cfI

dd dd dddddchfcQacgS

dd dd cRdH

dd dd

dd dd cdddd@

dd dd cPdT8c cs9

dd dd Fwcs9dc yAc Ac

dd dd Urec9ccPdTcGPTPTcPdTcGPdddAPTcPTFcPT cPdddDc

dd dd dcgcU`cfIcxd`fd`fIcU`cfIcxd`ccddIcU`fdrcB I cFwcs@c

dd dd dcecdddcdecdedccdedcdcedccdecdcddddcQagSedddgcddddddddddddddddddddddddddddddc

dd dd cRddHccRdHcddcddcddHRdHcdddccCRHcddTcRHGc cdcdS

dd dd B cDc cdcdH

dd dd RdHc

dd dd cEPdT

dd dd cUd`cfI

dd dd cQdecd

dd dd cRddddd

dd dd

dd dd dddddddchfcEE

dd dd cPT8hedd dddddddchfcUdI

dd dd cU`s9dhed cddchfcQdS

dd dd cQac9hPddePTcdddTcGPTPTcPddcPddcPT cddchfcddH

dd dd cRTchU`cdeUIcxdcfIcxd`fdIcB ScB ScB I cddchfcB c

dd dd csGhdccdeddddedccdedccddddcRd cRd cddd cddchfcddT

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcAcxIhdccdedcfdccdedccdgfIecfIcU`cd cddchfcU`cfI

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdAugShQacdvcQayFedcgSctdvcQayFcdugScdugScQagdvc cddchfcQvctS

dd dd cddc c@RHedcfRdddcRHeddHcdddcRHcddHcddHcRHGc cddchfcGcF

dd dd cddc ctd cddcfFcPTc

dd dd cddc cddd cddcfUrcU`fIccPdT

dd dd cddc cddcfdccdedccUdI

dd dd cddc cddcfQagSctSccdcdS

dd dd cddc cddcfRHcFccdcdH

dd dd cddc cddc

dd dd cddc cddcfdddddcdccEE

dd dd cddc cddchfcUdI

dd dd cddc cddcedddddddcecQdS

dd dd cddc cPT8 cd cd cddcfdcedcecddH

dd dd cddc cU`s9d cddcfQacgScecB c

dd dd cddc cQac9hPTFcddcddcddcPTcGPTcPTcGPTcPddcddcPddchfcddcfRdHcecddT

dd dd cddc cRTchU`fdrcxdcxdcxdcB Icxd`fIcUIcxd`fIcB ScxdcB SchfcddchfcUdI

dd dd cddc csGhQagSecdedccdcdddccdedcddddedccdcRd ccdcRd chfcddcfEEcecdcdS

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcAcxIhdHecdedccdcU`cdccdedcdcfdccdecfIccdecfIchfcddcfUdIcecdcdH

dd dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdAugShB fcQagdacddagdacdvcddayFctdvcddugSctddugSchfcddcfQdSc

dd dd cddc c@RHedcfddTccRHRddHRHRdddcdHRHcdddcddddHcdddddHchfcddcfddHc

dd dd cddc B cDc cddcfU

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc RdHc cddcfdddd@c

dd dd cddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc cddcgs9 c

dd dd cddc cddc cddcgcIc

dd dd cddc cddc cddcfPdddc

dd dd cddc cddc cddcfB

dd dd cddc cddc cddcfAuc

dd dd cddc PdTcPdTc cddc cddcf8ddddc

dd dd cddc U`cfIcU`cfIc cddc cPT8hddhfcdecddc cddc

dd dd cddc dcedcdcedc cddc cU`s9dhxd cdcgcE cddcfdddd@c

dd dd cddc Qaedcdcedc cddc cQac9hcdcPTcdddTcddcPddccPdTcBdAPT cddcgs9 c

dd dd cddc Rdddcdcedc cddc cRTchcdcUIcxdcfIcxdcU`cdccU`cfIcxd9 I cddcgcDc

dd dd cddc cScdcedc cddc csGhcdcddddccdedccdcdedccdecdedcddd cddcfdddHc

dd dd cddc yFcQacgSc cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcAcxIhcdcdfcdedccdcdedccdecdedcU`cd cddc

dd dd cddc cdHeRdHc cddc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdAugShtddayFccdcgSctddacdvcQacgSeQdagdvc cddcfEEc

dd dd cddc cddc dd c@RHedcfddHRHccddHcddHRdddcRdHeCRHGc cddcfUdIc

dd dd cddc cddc dd tdc cddcfQdSc

dd dd cddc cddc dd dddc cddcfddHc

dd dd cddc cddc dd cddcfB

dd dd cddc cddc dd cddcfddTc

dd dd cddc cddc dd cddcfU`cfIc

dd dd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcfQvctSc

dd dd cddc cddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcfGcFc

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc dd cddc

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddc dd cPT8 dc cddcfPdTc

dd cddc dd cU`s9d Ec cddcfUdIc

dd cddc cdddddcddddd dd cQac9hGPTPTcddcddcGPdddcPddcPTcBdAPTc cddcfdcdSc

dd cddc cdfcd dd cRTchxd`fd`fIcxdcxdcxd`edcU`sdcB Icxd9 Ic cddcfdcdHc

dd cddc cdfcd dd csGhcdedccdedccdedcedcdcecdddccdcdddc cddc

dd cPdTcPdT cddc cdddTcdddT ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcAcxIhcdedccdedccdedcedcdcecU`cdccdcU`cdc cddcfEEc

dd cU`cfIcU`cfI cddc fIffI ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdAugShtdctdctdvcQagdacdvctddayFcQagdvcQdagdv cddcfUdIc

dd cdecdcdecd cddc cdfcd c@RHedcfddcddcdddcRHRdddcddHRHcRHGcCRHG cddcfQdSc

dd cQaccdcQaccd cddc cGucgScGucgS cddcfddHc

dd cRdddcRddd cddc cRdHcRdH cddcfB

dd SfS cddc cddcfddTc

dd cyFecyF cddc cddcfUdIc

dd dHcedHc cddc cddcfdcdSc

dd cddc cddcfdcdHc

dd cddc cddc

dd cddc cPdT8ccddc dd cddc

dd cddc Fwcs9dccxdc xd cddc

dd cddc Urec9cedcPdTcPddcPddcPdTcPddcPTccdc9d@c9dddcd@ cddc

dd cddc dchdcU`cfIcB ScB ScU`cfIcU`sdcB Iccdc9 c@c9@ cddc

dd cddc dcecdddedcdcedcRd cRd cdcedcdcecdddccdexIcUrcxdrc dddddddc

dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfQvecxdredcdcedcefIecfIcdcedcdcecU`cdccdecQSetdvc dddddddc

dd cdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfGuccgScctddacgScdugScdugScQacgScQayFcQagdacdvccxdrc8A

dd cRddHccddHRdHcddHcddHcRdHcRHcRHRdddcctScc8dcdA

dd yFc

dd cdH

dd dddcdddc

dd xdrt@w cddddddc

dd cdFcecGPTcPTcGPTPTcPTc cddddddc

dd cdd fcxd`fIcUIcxd`fd`fIcB Ic cddc

dd cdGcfdccdcddddccdedccdcdddc cddc

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdcGfdccdcdfcdedccdcU`cdc cddc

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcxAucctdvcddayFctdctdctddagdv cddc

dd dddccdddcdddcdHRHcddcddcddHRHG cddc

dd cddc

dd cddcecPdT

dd cddcecU`cfI

dd cddcecQacgS

dd cddcecRdH

dd cddc

dd cddcecPddd

dd cddcecB c

dd dddcedddc cddccd cddcecAu

dd xddvctddrc cxdc cddcec8dddd

dd cdIcUdePTcPTFcGPTcPdTedcddcPTc cddc

dd cdcQScdeB IcU`fdrcxd`fIcU`cfIedcxdcB Ic cddcecPddd@c

dd cdcxdrcdedddcQagScedccdcdecdedccdcdddc cddcecFwcs@c

dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdedccdeU`cdcdHcedccdcdecdedccdcU`cdc cddc

dd ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcetdvcQagd8 cectdvcddacgSctdccddagdv cddccEPdT

dd dd dddcedddcRH9cddTcdddcdHRdHcdddddHRHG cddccUd`cfI

dd dd 9 cD cddccQdecd

dd dd cRdH cddccRddddd

dd dd cddc

dd dd cddcecdddd@

dd dd cddcfcs9

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcgD

dd dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd cddcecPdd

dd dd dd cddcecU`cfI

dd dd dd dddcedddc cddccd cddcecQacgS

dd dd dd xddvctddrc cxdc cddcecRdH

dd dd dd cdIcUdePTcPTFcGPTcPdTedcddcPTc cddc

dd dd dddddcPdTc dd cdcQScdeB IcU`fdrcxd`fIcU`cfIedcxdcB Ic cddcecPddd

dd dd dwedcU`cfIc dd cdcxdrcdedddcQagScedccdcdecdedccdcdddc cddcecB c

dd dd ctScdcedc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdedccdeU`cdcdHcedccdcdecdedccdcU`cdc cddcecAu

dd dd cUrcQaedc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdvcetdvcQagd8 cectdvcddacgSctdccddagdv cddcec8dddd

dd dd tSeRdddc dddcedddcRH9cddTcdddcdHRdHcdddddHRHG cddc

dd dd UrfcSc 9 cD cddccddddddd

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dcfyFc cRdH cddcecdecd

dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd dcecdH cddcecQacgS

dd cddcecRdH

dd cddc

PdTcPdTc dd dddcfdcfcdhcddc dd cddc

U`cfIcU`cfIc dd xdrc cdc d cddc

QacgScQacgSc dd cdfcddcGPdddcPdTcPddccPTcGPTcPddeGPTPdTcGPTc cddc

ddd cddd c dd cdfcxdcxd`ccdcU`cfIcU`cdccUIcxd`fIcU`cdexd`fd`cfIcxd`fIc cddc

U`cfIcU`cfIc dd cdgdccdecdcdecdcdedccddddccdedcdccdecdedcedccdedc cddc

dcedcdcedc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfcdgdccdecdcdecdcdedccdfcdedcdccdecdedcedccdedc cddc

QacgScQacgSc ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddftdeydctdccdvctddacgScQacdvcQayFctdvcddacdvctdvcQacgSctdvcdv cddc

RdHcRdHc ddddddcddddddcddHRdHcRdddcRHcdddcdHRdddcdddcRdHcdddcddhfdddddc dddddc

Fig. 3. Strict consensus of 333 equally parsimonious trees obtained from the analysis of a reduced (43 species) trnL-trnF data set (445 characters, 140 of them informative, Length = 445 steps, CI = 0.742, RI = 0.809). Numbers below branches represent bootstrap values >50% (100 replicates). D. = Doryphora, H. = Hernandia, L. = Laurelia, and S. = Siparuna; see Fig. 2 for remaining species names. Phylogenetic affinities of Monimiaceae 71

Palmeria had traditionally been seen as iso- member of the Monimiaceae whose pollen lated from each other (Perkins & Gilg 1901; has been studied”. There is no comparably Garratt 1934; Money et al. 1950; Schodde detailed study of Monimia pollen, but a sur- 1970; Behnke 1981, but see Behnke 1988), vey of pollen morphology of Malagasy Mon- but Philipson placed them together in a sub- imiaceae (Lorence et al. 1984) revealed a family with Monimia, a genus of three species close resemblance of Monimia pollen to that endemic to Mauritius and Réunion and which of Peumus. Peumus consists of a single resembles Palmeria in the morphology of the species of shrubs or treelets endemic in scle- female flowers and fruits. Sampson & Fore- rophyllous forests in Chile; it is thus one of man (1990) in a detailed comparison of very few extratropical Monimiaceae s.str. It pollen morphology and ultrastructure further- also differs from the remainder of the family in more concluded that “Peumus pollen is having a chromosome number of n = 39, closer to that of Palmeria than to any other rather than n =19 as most other Monimiaceae

Calycanthaceae

Idiospermum c

Calycanthus c

98 c

Chimonanthus c

100 c

Gyrocarpus c

c c

Sparattanthelium c Hernandiaceae c c

c c

c 59 c

c c

c H. albiflora c

c c

c 92 c

c c

c 64 c

c c

c 62 c

H. moerenhoutiana c c c

c c

100 c

H. ovigera c

c c

c 66 c

c c

c Illigera c

c c

Lauraceae c c

c c

c Cinnamomum c

c c

c Litsea c

88 c

Persea c

70 c

Cryptocarya c

Hennecartia c

Mollinedia c

Wilkiea c

56 c

Monimiaceae

65 Kibara c

99 c

Hedycarya c

Tambourissa c

Xymalos c

Hortonia c

Palmeria c

Peumus c

66 c

Doryphora c

Atherospermataceae c

Dryadodaphne c

Daphnandra c

96 Nemuaron c

82 c

57 Laureliopsis c

Gomortegaceae c

L. novae-zelandiae c c

L. sempervirens c c

Siparunaceae c

Gomortega c

Siparuna c

100 Siparuna c

100 c

Glossocalyx c

Liriodendron c

outgroup

Magnolia c

93 c

c c 99 Magnolia c Knema

Fig. 4. Strict consensus of 470 equally parsimonious trees obtained from the analysis of the rbcL data set (1,331 characters, 173 of them informative, Length = 534 steps, CI = 0.657, RI = 0.750). Numbers below branches represent bootstrap values >50% (100 replicates). H. = Hernandia and L. = Laurelia; see Table 2 for remaining species names. 72 S. S. Renner

(Ehrendorfer et al. 1968). Palmeria, on the Among the few morphological features other hand, is a genus of 14 species of lianas suggesting a close relationship between that occur mainly in New Guinea, with one Atherospermataceae and Gomortega is the species westward to east Sulawesi and three peculiar structure of their sieve tube plastids in eastern Australia; it has a chromosome (Behnke 1981, 1988). Most Monimiaceae base number of 19. Peumus has relatively s.str., and all Lauraceae, Hernandiaceae, and narrow phloem rays and non-septate fibers Siparunaceae, have protein-containing plas- (Garratt 1934; Money et al. 1950), while Pal- tids of the same kind as found in most Magno- meria and Monimia have the strikingly broad liaceae and many Myristicaceae (Psc-type rays and septate fibers typical of most core- plastids in the notation of Behnke 1988). A Monimiaceae. few monimiaceous genera have starch-con- Curiously, Bentham (1880b) and Perkins taining plastids, and again such plastids are & Gilg (1901; cf. Table 1) placed the New also found in the outgroups (Magnoliaceae Caledonian Amborella next to Peumus and Myristicaceae). By contrast, Calycan- (Chile). This placement is contradicted by thaceae (including Idiospermum; Kubitzki morphology and anatomy (Pichon 1948; 1993a), Atherospermataceae, and Gomor- Money et al. 1950; Endress & Igersheim tega have plastids of the rare Pcsf-type 1997) as well as by the large estimated aver- (Behnke 1988). Depending on the eventual age sequence divergence of 30% of an Am- position of Calycanthaceae, these plastids ei- borella trichopodat rnL-trnF sequence from ther could have evolved twice within Laurales, the remaining 60 sequences (rbcL data also once in the Calycanthaceae and once in the place Amborella far from Laurales; Qiu et al. common ancestor of Gomortega/Atherosper- 1993; Chase & Albert, in press). mataceae, or they could have been inherited Beginning with Money et al. (1950), Horto- from a common ancestor of Calycanthaceae, nia has been placed in a subfamily by itself Gomortega, and Atherospermataceae and (Table 2) and been interpreted as “the least been lost in Siparunaceae. Traditionally, specialized surviving representative of an an- atherospermatoids have been placed next to cestral monimiaceous stock”. This monospe- siparunoids (Table 2) because the two fami- cific genus is the sole perfect-flowered Mon- lies share narrow phloem rays (up to about 6 imiaceae and also has very distinctive pollen cells wide), a chromosome number of n = 22, (the exine is composed of coarse, hemi-heli- 2-valvate stamens, and basal ovules. Note cal bands, extending from one pole to the that Gomortega has a base number of n = 21, other). Based on the rbcL-trnL-trnF data, Hor- which could have evolved from n = 22. Two- tonia is basal within the larger of the two valvate stamens have evolved several times major clades of Monimiaceae s.str. (Fig. 1). within Laurales, being also found in Hernandi- Morphological circumscriptions of athero- aceae and some species of Lauraceae, but spermatoids (Money et al. 1950; Schodde the basal ovules are restricted to Atherosper- 1969, 1970; Philipson 1993) are fully corrob- mataceae and Siparunaceae. The gynoecium orated by the molecular data, but there are of Gomortega is unique among Laurales in too few characters to address the morphol- that it consists of a syncarpous, 2- or 3-locular ogy-based hypothesis (Schodde 1969, 1970; pistil that is completely inferior; ovule position Renner et al. 1997) that Atherospermataceae is apical (Leinfellner 1968; Endress & Iger- are sister to Gomortegaceae. However, in an sheim 1997). analysis of representatives of Laurales, Mag- Within Atherospermataceae, the molecular noliales, paleoherbs, and gymnosperms for data support Schodde’s (1969, 1970, Schodde which they sequenced rbcL, atpB (cpDNA in Martínez-Laborde 1983) and Martínez- genes) and the nuclear ribosomal 18S gene, Laborde’s (1988) separation of Laureliopsis Ueda et al. (1997) found that Gomortega from Laurelia. Prior to Schodde’s work, the grouped with Atherospermataceae. (Prelimi- Chilean-Argentinian Laureliopsis philippiana nary analyses of an enlarged data set that in- (described in 1934), the only species of Laure- cludes 37 1050 bp-long sequences from the liopsis, was included in Laurelia, a genus com- cpDNA rpl16 intron in addition to the rbcL- prising one species in Chile and another in trnL-trnF sequences analyzed here, show an New Zealand. In the present analysis, Laure- Atherospermataceae-Gomortegaceae-Sipa- liopsis forms a well-supported clade (85% runaceae trichotomy that is supported at the bootstrap in the combined analysis; Fig. 1) with 72% bootstrap level; Renner, unpubl. data.) the monotypic New Caledonian Nemuaron. Phylogenetic affinities of Monimiaceae 73

Fig. 5. Habit and female flower of Siparuna conica Renner & Hausner. The seven styles of the receptive flower shown to the right emerge through a narrow pore in the center of the floral roof (compare text). 74 S. S. Renner

Finally, the molecular data support the Hortonia-Hennecartia clade (Hortonia has older view that Siparuna and Glossocalyx are only slightly concave female receptacles, the closely related (Bentham 1880a; Perkins & other genera have globose or urceolate fe- Gilg 1901; Money et al. 1950; contra Philip- male receptacles). An extreme development is son 1987, 1993). This is also in agreement reached in Tambourissa of Madagascar and with a morphology-based cladistic analysis the South American Hennecartia in which the that found four synapomorphies uniting these carpels are completely embedded in very two genera, namely eglandular valvate sta- massive receptacles. The single species of mens; disporangiate anthers in which the two Hennecartia has the further unusual feature of thecae open not by two, but by a single or in- having only one or two carpels per flower. The completely separated flap; flowers with a flo- only other Monimiaceae with solitary carpels ral roof (a membrane that covers the flower is the East African Xymalos, with the sole center, Fig. 5); and unitegmic ovules (Renner species X. monospora. To obtain more resolu- et al. 1997). tion within Monimiaceae s.str., sequences from nuclear regions are currently being Implications for the evolution of flowers added to the cpDNA data (S. Renner, M. and breeding systems Zanis, & D. Soltis, unpubl. data). Siparuna comprises about 72 species of Traditional classifications of Monimiaceae shrubs, straggling shrubs, and trees and oc- have relied heavily on floral morphology, so it curs from tropical Mexico throughout Central is of interest to explore the evolution of floral America and the West Indies and northern traits on the molecular trees. Paired nectary South America to Bolivia and Paraguay (Ren- glands are present at the base of each of the ner & Hausner 1997). Either 56 or 57 of the 9–14, 40–150, or 3–8 fertile stamens of Peu- species are dioecious, while the remaining 14 mus, Monimia, and Hortonia (see illustrations or 15 are monoecious. The group is most di- in Endress & Hufford 1989), respectively, but verse in Andean mid-elevation forests, but are lacking in Palmeria and all other mon- some species occur at sealevel or up to 3800 imioid genera, implying that such glands m. Relatively few species of Siparuna are were present in the common ancestor of found in the Amazon basin, the Guayana re- Monimiaceae and lost twice, once with the gion, the Brazilian shield region, and the At- Peumus-Palmeria clade and a second time lantic rainforests of Brazil, but is in these re- within the Hortonia–Hennecartia clade. Hor- gions that the monoecious species outnum- tonia is the only Monimiaceae with fully func- ber the dioecious ones. The only monoecious tional bisexual flowers; it also has large species sampled, S. guianensis and S. de- tepals. All remaining genera in the Hortonia- pressa, appear basal to two dioecious Hennecartia clade have unisexual flowers species in the reduced trnL-trnF data set (Fig. and minute tepals. A parallel change from bi- 3) and remain basal when all seven dioecious sexual flowers and large tepals to unisexual species sequenced so far are included in the flowers and minute tepals occurred in the analysis (tree not shown). Dioecy thus seems Peumus-Palmeria clade: tepals in Peumus to have evolved within Siparuna, but this con- are large, those of Palmeria and Monimia are clusion remains preliminary until all monoe- reduced. Female Peumus flowers retain cious species have been sampled. The sister 6–10 staminodes, indicating that the flowers group, Glossocalyx longicuspis, is a dioe- were once bisexual, Monimia and Palmeria cious straggling shrub that is common along have strictly unisexual flowers without a trace forest margins in Cameroon (D. Thomas, of vestigal organs. pers. comm. 1996). As illustrated and discussed by Endress (1979, 1980a, 1994: 232), Monimiaceae s.str. have increasingly complete enclosure of the Implications for biogeography, and the reproductive organs in massive cup-like re- fossil record of monimioid plants ceptacles that raise the floral periphery around Monimiaceae s.str. or above the gynoecium. This trait, too, evolved at least twice within the family, once As circumscribed here, Monimiaceae s.str. within the Peumus-Palmeria clade (massive are pantropical. In the New World, both their female receptacles are found in Palmeria and main clades are represented, one by Molline- Monimia, but not Peumus) and once within the dia (incl. Macrotorus and Macropeplus) and Phylogenetic affinities of Monimiaceae 75

Hennecartia, the other by Peumus. On the Australia (Schodde 1969, 1970; Martínez- African mainland, their sole extant represen- Laborde 1988; Philipson 1993). Ecologically, tative is Xymalos monospora, while in Mada- they are prominent elements of South gascar the same clade is richly represented Chilean laurel forests and temperate ever- by Tambourissa and its satellites with alto- green forests of New Zealand and Tasmania gether 58 species (Lorence 1985, this figure where they grow on well-drained or humid includes a few species described after 1985). sites mainly between 800 and 2400 m eleva- The Mascarenes are home to members of tion. Different from other Laurales, they have both major clades, harbouring Monimia as dry wind-dispersed achenes. well as species of Tambourissa, and both Lower Oligocene atherospermatoid wood clades are also present in New Guinea and has been described from the eastern Cape tropical eastern Australia. Province (Mädel 1960), but Mädel points out Fossil woods (Hedycaryoxylon spp.) char- the problematic assignment of the 58 pieces acteristic of Monimiaceae s.str., that is, with of wood, which in her opinion might also be- strikingly broad rays, have been described long in the vicinity of Hortonia and thus repre- from the Lower Oligocene of the eastern sent Monimiaceae s.str. Undoubtedly athero- Cape province (Mädel 1960) and from the spermatoid wood (Atherospermoxylon), also Lower Senonian of Central Germany (Süss from the Lower Oligocene, is, however, 1960). A fossil leaf of Mollinedia, from the known from Egypt (Kräusel 1939), and an Eocene, has been found on the Antarctic Eocene leaf has been described from Ant- Seymour Island (Dusén 1908). (Lower arctica (Dusén 1908). Atherospermataceous Senonian leaves from Central Germany of leaves are also known from the Lower Protohedycarya ilicoides (Heer) Rüffle were Senonian of Central Germany (Knappe & first assigned to Monimiaceae s.str. [Rüffle Rüffle 1975). Thus, in the past, Atherosper- 1965] but then transferred to Atherosperma- mataceae seem to have occupied a range taceae [Knappe & Rüffle 1975]; Maastrichtian similar to Monimiaceae, but they are now ex- leaves of Protohedycarya pseudoquercifolia tinct in Africa and have only two species in (Kräusel) Rüffle & Knappe (1988) from the South America. The family appears to com- Netherlands, which are deeply dissected into prise two phylogenetically independent Chi- eight almost disconnected lobes, in my opin- lean-Australasian disjunctions because its ion are not monimiaceous.) The Monimi- two Chilean members do not form a mono- aceae s.str. thus may have been widespread phyletic clade (Figs. 1, 4). by the late Cretaceous. Raven & Axelrod The Siparunaceae are restricted to South (1974) hypothesized that they migrated be- America and West Africa. The floristic links tween South America and Africa (from where between tropical Africa and tropical America they reached Madagascar) and between have long been of interest to plant systema- West Gondwana and Australia across a nar- tists and biogeographers, largely because of rower Indian Ocean, which would require a the question of the ages and dispersal histo- minimum age of 100 million years. ries of the groups involved (Thorne 1973; Raven & Axelrod 1974; Goldblatt 1993). At least 80 ancient to moderately derived an- Siparunaceae, Gomortegaceae, and giosperm families are thought to have dis- Atherospermataceae persed directly between Africa and South America before the continents became Gomortega keule, the sole member of Go- widely separated, i.e. up to about 62–66 mil- mortegaceae, is a rare and highly endan- lion years ago. Among these must have been gered tall tree (C. Baeza, University of Con- Siparunaceae (still extant on both sides of the cepción, Chile, pers. comm. 1997) endemic Atlantic) and Atherospermataceae (with two in Chile, and its pollination and seed disper- species in Chile today, but in Africa only sal biology are unknown. It has no published known from Lower Oligocene fossil wood). fossil record (Friis et al. 1997). The Atherospermataceae, or southern sassafrasses, comprise two species in two Acknowledgements genera in Chile and Argentina, and 12 I thank A. Schwarzbach for instructions in the lab, species in five genera in New Guinea, New and G. Hausner, B. Sampson, and the two review- Caledonia, New Zealand, Tasmania, and ers P. Endress and E. M. Friis for comments on the 76 S. S. Renner

manuscript. The botanical gardens of Canberra, Endress, P.K. (1980b) Floral structure and relation- Edinburgh, Melbourne, Missouri - St. Louis, and ships of Hortonia (Monimiaceae). Plant Systemat- Sydney, and The National Tropical Botanical Gar- ics and Evolution, 133, 199–221. den, Lawai, Kauai, Hawaii, provided leaf material Endress, P.K. (1992) Protogynous flowers in Monimi- as did C. Baeza, J. Bradford, A. Chanderbali, E. aceae. Plant Systematics and Evolution, 181, Fernando, D. Foreman, B. Hyland, S. Madriñán, M. 227–232. Pignal, M. Potthast, C. Quinn, F. B. Sampson, B. Endress, P.K. (1994) Diversity and Evolutionary Biol- Ståhl, and D. Strasberg. DNA aliquots came from ogy of Tropical Flowers. Cambridge University Press, Cambridge. M. Chase and Y.-L. Qiu, and K. Ueda graciously Endress, P.K. & Hufford, L.D. (1989) The diversity of supplied three unpublished Lauraceae trnL-trnF se- stamen structures and dehiscence patterns among quences. The drawing of Siparuna is by H. Malitz. Magnoliidae. Botanical Journal of the Linnean Soci- ety, 100, 45–85. Endress, P.K. & Igersheim, T. (1997) Gynoecium diver- References sity and systematics of the Laurales. Botanical Journal of the Linnean Society, 125, 93–168. Ablett, E.M., Playford, J. & Mills, S. (1997) The use of Endress, P.K. & Lorence, D.H. (1983) Diversity and rubisco DNA sequences to examine the systematic evolutionary trends in the floral structure of Tam- position of Hernandia albiflora (C. T. White) Kubitzki bourissa (Monimiaceae). Plant Systematics and (Hernandiaceae), and relationships among the Evolution, 142, 53–81. Laurales. Austrobaileya, 4, 601–607. Fay, M.F., Swensen, S.M. & Chase, M.W. (1997) Taxo- Baillon, H.E. (1869) Histoire des Plantes. L. Hachette nomic affinities of Medusagyne oppositifolia (Medu- et Cie, Paris. sagynaceae). Kew Bulletin, 52, 111–120. Behnke, H.-D. (1981) Sieve-element characters. Foreman, D.B. & Sampson, F.B. (1987) Pollen mor- Nordic Journal of Botany, 1, 381–400. phology of Palmeria scandens and Wilkiea Behnke, H.-D. (1988) Sieve-element plastids, phloem huegeliana (Monimiaceae). Grana, 26, 127–133. protein, and evolution of flowering plants: III. Mag- Friis, E.M., Crane, P.C. & Pedersen, K.R. (1997) Fossil noliidae. Taxon, 37, 699–732. history of magnoliid angiosperms. Evolution and Di- Bentham, G. (1880a) Glossocalyx longicuspis Benth. versification of Land Plants (eds. K. Iwatsuki & P.H. Hooker’s Icones Plantarum, 14, 2, pl. 1301. Raven), pp. 121–156. Springer-Verlag, Tokyo. Bentham, G. (1880b) Monimiaceae. Genera Planta- Garratt, G.A. (1934) Systematic anatomy of the woods rum (eds. G. Bentham & J.D. Hooker), pp. of the Monimiaceae. Tropical Woods, 39, 18–43. 137–146. Lovell Reeve & Co., London. Gibbs, L.S. (1917) A Contribution to the Phytogeogra- Chase, M.W. & Cox, A.V. (in press) Gene sequences, phy and Flora of the Arfak Mountains. Taylor and collaboration, and analysis of large data sets. Aus- Francis, London. tralian Systematic Botany. Goldblatt, P., ed. (1993) Biological Relationships be- Chase, M.W. & Albert, V.A. (in press) A perspective on tween Africa and South America. Yale University the contribution of plastid rbcL DNA sequences to Press, Brookhaven. angiosperm phylogenetics. Molecular Systematics Golenberg, E.M., Giannasi, D.E., Clegg, M.T., Smiley, of Plants III. (eds. D. Soltis, P. Soltis, & J. Doyle). C.J., Durbin, M., Henderson, D. & Zurawski, G. Croizat, L. (1952) Manual of Phytogeography or an Ac- (1990) Chloroplast DNA sequences from a Mio- count of Plant Dispersal Throughout the World. cene Magnolia species. Nature, 344, 656–658. Junk, The Hague. Hallier, H. (1905) Ein zweiter Entwurf des natuerlichen Cronquist, A. (1981) An Integrated System of Classifi- (phylogenetischen) Systems der Bluetenpflanzen. cation of Flowering Plants. Columbia University Berichte der Deutschen Botanischen Gesellschaft, Press, New York. 23, 85–91. Dahlgren, G. (1989) The last Dahlgrenogram. System Holmgren, P.K., Holmgren, N.H. & Barnett, L.C. (1990) of classification of the dicotyledons. The Davies Index Herbariorum 1. The Herbaria of the World. and Hedge Festschrift. (ed. K. Tan), pp. 249–260. Ed. 8., New York Botanical Garden, New York. Edinburgh University Press, Edinburgh. Hutchinson, J. (1964) The Genera of Flowering Plants. Dusén, P. (1908) Über die tertiäre Flora der Seymour- Clarendon Press, Oxford. Insel. Wissenschaftliche Ergebnisse der Schwedi- Kellogg, E.A. & Juliano, N.D. (1997) The structure and schen Südpolar Expedition 1901–1903, 383, 1–27. function of RuBisCo and their implications for sys- Ehrendorfer, F., Krendl, F., Habeler, E. & Sauer, W. tematic studies. American Journal of Botany, 84, (1968) Chromosome numbers and evolution in 413–428. primitive angiosperms. Taxon, 17, 337–353. Knappe, H. & Rüffle, L. (1975) Neue Monimiaceen- Endress, P.K. (1972) Zur vergleichenden Entwick- Blätter im Santon des Subherzyn und ihre phyto- lungsmorphologie, Embryologie und Systematik geographischen Beziehungen zur Flora des ehe- bei Laurales. Botanische Jahrbücher für Syste- maligen Gondwana-Kontinents. Wissenschaftliche matik, 92, 331–428. Zeitschrift der Humboldt-Universität zu Berlin, Endress, P.K. (1979) Noncarpellary pollination and Math.-Nat. Reihe, 24, 493–499. ‘hyperstigma’ in an angiosperm (Tambourissa reli- Kräusel, R. (1939) Ergebnisse der Forschungsreisen giosa, Monimiaceae). Experientia, 35, 45. Prof. E. Stromers in den Wüsten Ägyptens, 4. Die Endress, P.K. (1980a) Ontogeny, function and evolu- fossilen Floren Ägyptens. Abhandlungen der Bay- tion of extreme floral construction in Monimiaceae. erischen Akademie der Wissenschaften, Math.- Plant Systematics and Evolution, 134, 79–120. Nat. Abt., 47, 1–140. Phylogenetic affinities of Monimiaceae 77

Kubitzki, K. (1993a) Calycanthaceae. The Families Rüffle, L. (1965) Monimiaceen-Blätter im älteren Se- and Genera of Vascular Plants. Vol. 2. (eds. K. Ku- non von Mitteleuropa. Geologie, 14, 78–105. bitzki, J.G. Rohwer & V. Bittrich), pp. 197–200. Rüffle, L. & Knappe, H. (1988) Ökologische und paläo- Springer-Verlag, Berlin. geographische Bedeutung der Oberkreideflora von Kubitzki, K. (1993b) Hernandiaceae. The Families and Quedlinburg, besonders einiger Loranthaceae und Genera of Vascular Plants. Vol. 2. (eds. K. Kubitzki, Monimiaceae. Hallesche Jahrbücher für Geowis- J.G. Rohwer & V. Bittrich), pp. 334–338. Springer- senschaften, 13, 49–65. Verlag, Berlin. Sampson, F.B. (1993) Pollen morphology of the Am- Leinfellner, W. (1968) Über die Karpelle verschiedener borellaceae and Hortoniaceae (Hortonioideae: Magnoliales. VI. Gomortega keule (Gomorte- Monimiaceae). Grana, 32, 154–162. gaceae). Österreichische Botanische Zeitschrift, Sampson, F.B. (1996) Pollen morphology and ultra- 115, 113–119. structure of Laurelia, Laureliopsis and Dryado- Lorence, D.H. (1985) A monograph of the Monimi- daphne (Atherospermataceae [Monimiaceae]). aceae (Laurales) of the Malagasy region (South- Grana, 35, 257–265. west Indian Ocean). Annals of the Missouri Botani- Sampson, F.B. (1997) Pollen morphology and ultra- cal Garden, 72, 1–165. structure of Australian Monimiaceae – Austro- Lorence, D.H., Zenger, V.E. & Vinay, P. (1984) Pollen matthaea, Hedycarya, Kibara, Leviera, Stegan- morphological studies on the Monimiaceae in the thera and Tetrasynandra. Grana, 36, 135–145. Malagasy region. Grana, 23, 11–22. Sampson, F.B. & Foreman, D.B. (1990) Pollen mor- Mädel, E. (1960) Monimiaceen-Hölzer aus den phology of Peumus boldus (Monimiaceae) – a com- oberkretazischen Umzamba-Schichten von Ost- parison with Palmeria scandens. Grana, 29, Pondoland (S-Afrika). Senckenbergiana Lethaea, 197–206. 41, 331–391, 10 pl. Schodde, R. (1969) A monograph of the family Athero- Martínez-Laborde, J.B. (1983) Revision de las Mon- spermataceae R. Br. PhD thesis, University of Ade- imiaceae austroamericanas. Parodiana, 2, 1–24. laide, Australia. Martínez-Laborde, J.B. (1988) Some comments on a Schodde, R. (1970) Two new suprageneric taxa in recent classificaion of the Monimiaceae. Taxon, 37, the Monimiaceae alliance (Laurales). Taxon, 19, 834–837. 324–328. Money, L.L., Bailey, I.W. & Swamy, B.G.L. (1950) The Smith, A.C. (1972) An appraisal of the orders and fam- morphology and relationships of the Monimiaceae. ilies of primitive extant angiosperms. Journal of the Journal of the Arnold Arboretum, 31, 372–404. Indian Botanical Society, 50A, 215–226. Philipson, W.R. (1987) A classification of the Monimi- Süss, H. (1960) Ein Monimiaceen-Holz aus der aceae. Nordic Journal of Botany, 7, 25–29. oberen Kreide Deutschlands, Hedycaryoxylon sub- Philipson, W.R. (1993) Monimiaceae. The Families affine (Vater) nov. comb. Senckenbergiana Le- and Genera of Vascular Plants. Vol. 2. (eds. K. Ku- thaea, 41, 317–330, 2 pl. bitzki, J.G. Rohwer & V. Bittrich), pp. 426–437. Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. (1991) Springer-Verlag, Berlin. Universal primers for amplification of three non- Perkins, J. & Gilg, E. (1901) Monimiaceae. Das Pflan- coding regions of chloroplast DNA. Plant Molecular zenreich. (ed A. Engler), pp. 1–122. W. Engelmann, Biolology, 17, 1105–1109. Leipzig. Takhtajan, A.L. (1969) Flowering Plants: Origin and Pichon, M. (1948) Les Monimiacées, famille hétéro- Dispersal. Oliver & Boyd, Edinburgh. gène. Bulletin du Muséum Nationale d’Histoire Na- Takhtajan, A.L. (1973) Evolution und Ausbreitung der turelle, Sér. 2, 20, 383–384. Blütenpflanzen. Gustav Fischer Verlag, Jena. Qiu, Y.-L., Chase, M.W., Les, D.H., Parks, C.R. (1993) Takhtajan, A.L. (1987) Systema Magnoliophytorum. Molecular phylogenies of the Magnoliidae: cladistic Soviet Sciences Press, Leningrad. analysis of nucleotide sequences of the plastid Thorne, R.F. (1973) Floristic relationships between gene rbcL. Annals of the Missouri Botanical Gar- tropical Africa and tropical America. Tropical Forest den, 80, 587–606. Ecosystems in Africa and South America: A Com- Raven, P. H. & Axelrod, D. I. (1974) Angiosperm bio- parative Review. (eds. B.J. Meggers, E.S. Ayensu geography and past continental movements. An- & W.D. Duckworth), pp. 27–47. Smithsonian Institu- nals of the Missouri Botanical Garden, 61, tion Press, Washington. 539–637. Thorne, R.F. (1974) A phylogenetic classification of the Renner, S.S. & Hausner, G. (1997) Siparunaceae and Annoniflorae. Aliso, 8, 147–209. Monimiaceae. Flora of Ecuador 59 (eds. G. Harling Thorne, R.F. (1992) An updated phylogenetic classifi- & L. Andersson), pp. 1–125. Berlings Arlöv, Sweden. cation of the flowering plants. Aliso, 13, 365–389. Renner, S.S., Schwarzbach, A.E. & Lohmann, L. Ueda, K., Nakano, A., Rodriguez, R., Ramírez, C. & (1997) Phylogenetic position and floral function of Nishida, H. (1997) Molecular phylogeny of the Go- Siparuna (Siparunaceae: Laurales). International mortegaceae, a Chilean endemic monotypic, and Journal of Plant Sciences, 158 (Suppl.), 89–98. endangered family. Noticiero de Biologia, 5, 124. Rohwer, J. (1993) Lauraceae. The Families and Gen- era of Vascular Plants. Vol. 2. (eds. K. Kubitzki, J.G. Rohwer & V. Bittrich), pp. 366–391. Springer- Received 11 December 1997 Verlag, Berlin. Revised version accepted 3 April 1998