Characterization of a MAPK module involved in Arabidopsis response to wounding Cecile Sözen

To cite this version:

Cecile Sözen. Characterization of a MAPK module involved in Arabidopsis response to wounding. Vegetal Biology. Université Paris Saclay (COmUE), 2017. English. ￿NNT : 2017SACLS472￿. ￿tel- 02388086￿

HAL Id: tel-02388086 https://tel.archives-ouvertes.fr/tel-02388086 Submitted on 1 Dec 2019

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

NNT : 2017SACLS472

THESE DE DOCTORAT DE L’UNIVERSITE PARIS-SACLAY PREPAREE A L’UNIVERSITE PARIS-SUD

ECOLE DOCTORALE N°567 Sciences du végétal : du Gène à l’Ecosystème

Spécialité de doctorat : Biologie

Par

Mlle Cécile SÖZEN

Characterization of a MAPK module involved in Arabidopsis response to wounding

Thèse présentée et soutenue à Orsay (IPS2) le 29 novembre 2017

Composition du Jury : Dr. Christian MEYER Directeur de Recherche - IJPB, Versailles Président du jury Dr. Claudia JONAK Directrice de Recherche - AIT, Vienne Rapportrice Dr. Debora GASPERINI Directrice de Recherche - LIPB, Halle Rapportrice Dr. Heribert HIRT Directeur de Recherche - KAUST,Thuwal Examinateur Dr. Jean COLCOMBET Chargé de Recherche - IPS2, Orsay Directeur de thèse Dr. Axel de ZELICOURT Maître de Conférences - IPS2, Orsay Invité

LIST OF ABBREVIATIONS

ABA: Abscisic Acid APS: Ammonium PerSulfate ATP: Adenosine Tri-Phosphate Cas9: CRISPR-Associated protein 9 CDPK: Calcium-Dependent Protein Kinase CHX: CycloHeXimide CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats C-terminal: Carboxyl-terminal DMSO: DiMethylSulfOxide DTT: DiThioThreitol ET: Ethylene EtOH: Ethanol GLR: Glutamate Receptor-like HA: HemAgglutinin hpi: hours post-inoculation

H2O2: Hydrogen peroxide JA: Jasmonic Acid kDa: KiloDalton MAPK: Mitogen-Activated Protein Kinase MAP2K: Mitogen-Activated Protein Kinase Kinase MAP3K: Mitogen-Activated Protein Kinase Kinase Kinase MBP: Myelin Basic Protein meJA: methyl-Jasmonate NaF: Sodium Fluoride OG: OligoGalacturonide PRR: Pathogen Recognition Receptor ROS: Reactive Oxygen Species RT-qPCR: Reverse Transcription - quantitative Polymerase Chain Reaction SA: Salicylic Acid SDS-PAGE: Sodium Dodecyl Sulfate - PolyAcrylamide Gel Electrophoresis TBS: Tris-Buffered Saline TEMED: TEtraMEthyleneDiamine T-DNA: Transfer DNA YFP: Yellow Fluorescent Protein Y2H: Yeast two Hybrid

Characterization of a MAPK module involved in Arabidopsis response to wounding 2

LIST OF FIGURES & TABLES

CHAPTER I: INTRODUCTION Figure 1.1: Simplified model depicting cellular events triggered by wounding and herbivory – p.11 Figure 1.2: Biosynthetic pathway of Jasmonic Acid (JA) – p.19 Figure 1.3: Perception and signaling of Jasmonic Acid – p.22 Figure 1.4: Relationship of JA with other phytohormones – p.24 Figure 1.5: JA and systemic signaling – p.25 Figure 1.6: MAPK cascades are key elements of the stress signal transduction in plants – p.35 Figure 1.7: 20 MAPKs in Arabidopsis divided into 4 subgroups – p.36 Figure 1.8: MKK3, the sole member of group B – p.36 Figure 1.9: 20 MEKK-like MAP3Ks divided into 3 clades – p.37 Figure 1.10: PAMP-activated MAPK cascades illustrate the complexity of MAPK signaling – p.37 Figure 1.11: Biotic and abiotic stresses activating MKK3-dependent pathways – p.39 Figure 1.12: Identification of a complete MKK3-dependent module activated by ABA – p.40

CHAPTER II: RESULTS & DISCUSSIONS

Figure 2.1: MKK3 and sub-clade III MAP3Ks interact in yeast – p.46 Figure 2.2: Sub-clade III MAP3Ks, MKK3 and MPK2 constitute a functional module in protoplasts –p.47 Figure 2.3: Transcriptional regulation of MEKK-like MAP3Ks in Arabidopsis thaliana – p.48 Table 2.1: Main conditions under which sub-clade III MAP3Ks are regulated – p.48 Figure 2.4: General model based on the conserved transcriptional regulation of sub-clade III MAP3Ks – p.49 Figure 2.5: MPK2 is activated by wounding in an MKK3-dependent way – p.50 Figure 2.6: MPK1, MPK2 and MPK7 are not transcriptionally regulated by wounding – p.51 Figure 2.7: MPK1, MPK2 and MPK7 are activated by wounding in an MKK3-dependent way – p.51 Figure 2.8: MPK2 is not activated by gentle touch – p.52 Figure 2.9: MPK3 and MPK6 activation by wounding is not dependent on MKK3 – p.52 Figure 2.10: MPK3 and MPK6 have no effect on the activation of MPK2 by wounding – p.53 Figure 2.11: MPK1, MPK2 and MPK7 activation by wounding requires a de novo protein synthesis– p.53 Figure 2.12: CHX induces a constitutive activation of MPK3 and MPK6 – p.54 Figure 2.13: Expression of sub-clade III MAP3Ks upon wounding – p.55 Figure 2.14: Sub-clade III MAP3Ks protein accumulation upon wounding – p.55 Figure 2.15: Subcellular localization of MAP3K18-YFP upon ABA and wounding – p.56 Table 2.2: Testing the wounding-induced activation of MPK2 in map3k mutants led to variable results – p.56 Figure 2.16: MPK2 activity upon wounding is increased in map3k14-1 plants compared to Col-0 – p.56 Figure 2.17: MPK3 and MPK6 activity upon wounding is unchanged in map3k14-1 plants – p.56 Figure 2.18: Some MAP3Ks expression is increased in map3k14-1 plants– p.56

Characterization of a MAPK module involved in Arabidopsis response to wounding 3

Figure 2.19: Truncated MAP3K14 is functional in vivo and leads to a more stable protein – p.57 Figure 2.20: MPK2 activity upon wounding is unchanged in CRISPR map3k14 plants compared to Col-0 p.57 Figure 2.21: Theoretical model depicting the two MAPK groups activated upon wounding – p.58 Figure 2.22: Theoretical model depicting the involvement of specific sub-clade III MAP3Ks depending on the wounding-induced component – p.59

Figure 2.23: MPK2 is not activated by an exogenous treatment with H2O2, OGs, ATP or flg22 – p.60 Figure 2.24: MPK1, 2 and 7 are activated by JA in an MKK3-dependent manner – p.61 Figure 2.25: MPK3 and MPK6 are not activated by an exogenous treatment with JA – p.62 Figure 2.26: MPK2 activation by JA requires its perception by COI1 – p.62 Figure 2.27: MAP3Ks expression upon exogenous treatment with JA – p.63 Figure 2.28: JA-induced activation of MPK2 is reduced in some map3k mutants – p.63

Figure 2.29: MPK2 activation by wounding is not highly dependent on ATP, OGs or H2O2 signaling – p.64 Figure 2.30: JA, but not ABA, has a major role upstream of MKK3-MPK2 in response to wounding – p.64 Figure 2.31: JA does not have a major role upstream of MPK3/MPK6 upon wounding – p.64 Figure 2.32: Expression of candidate MAP3Ks upon wounding is reduced in coi1-16 plants – p.64 Figure 2.33: Expression of candidate MAP3Ks upon wounding is reduced in coi1-34 plants – p.65 Figure 2.34: MKK3-MPK2 is not activated in systemic leaves – p.66 Figure 2.35: Model depicting the JA-dependent MAPK module activated by wounding – p.67 Figure 2.36: MKK3-MPK2 is activated by B. cinerea – p.68 Figure 2.37: MAP3K19 is highly induced 48 hours after inoculation with B. cinerea – p.69 Figure 2.38: MKK3-MPK2 is activated by Spodoptera littoralis – p.70 Figure 2.39: MKK3-MPK2 is activated by S. littoralis and B. cinerea, two JA-producing pathogens – p.70 Table 2.3: Summary of results obtained with B. cinerea inoculations – p.71 Figure 2.40: Lesion outgrowth after inoculation with B. cinerea spores – p.71 Figure 2.41: Some Botrytis-induced genes expression is misregulated in mkk3-1 plants – p.72 Figure 2.42: MKK3 is not involved in resistance towards Spodoptera littoralis – p.73 Figure 2.43: MKK3 negatively regulates SA and JA accumulation after insect feeding – p.73 Figure 2.44: MKK3 is not involved in hormonal regulation upon wounding – p.74 Figure 2.45: Role of MKK3 in the regulation of genes involved in SA and JA biosynthesis pathways – p.75 Figure 2.46: Role of MKK3 in the regulation of SA- and JA-responsive genes – p.76 Figure 2.47: Wounding-induced trichome formation – p.77 Figure 2.48: Transcriptomic analysis of mkk3-1 plants submitted to wounding did not highlight any MKK3- regulated genes – p.78 Table 2.4: Few MKK3-regulated genes were found – p.78 Figure 2.49: Theoretical model on the role of MKK3 in phytohormone regulation upon S. littoralis feeding - p.79

Characterization of a MAPK module involved in Arabidopsis response to wounding 4

CHAPTER III: CONCLUSIONS & PERSPECTIVES

Figure 3.1: Hypothetical model on the interdependent activation of two MAPK modules upon wounding – p.82 Figure 3.2: MPK7 is activated by nitrate in an MKK3- and NLP7- dependent manner – p.84 Figure 3.3: mkk3-1 plants show increased dormancy – p.90

CHAPTER IV: MATERIALS & METHODS

Table 4.1: Mutant lines mentioned in this manuscript – p.92 Table 4.2: Exogenous treatments applied on Arabidopsis plantlets – p.97 Table 4.3: Preparation of the enzymatic solution – p.98 Table 4.4: Composition of W5 and WI solutions – p.98 Table 4.5: Composition of the MMg solution – p.99 Table 4.6: Composition of the PEG solution – p.99 Table 4.7: Primers used to amplify loci for the creation of lines expressing tagged versions of MAP3Ks, MKK3 and MAPKs – p.102 Table 4.8: Composition of the RT mix – p.103 Table 4.9: Genes used for qPCR experiments and corresponding primer couples – p.104 Table 4.10: Description of samples sent for micro-array analyses – p.104 Table 4.11: Dilutions of antibodies used for western blots – p.106

Characterization of a MAPK module involved in Arabidopsis response to wounding 5

TABLE OF CONTENT CHAPTER I: INTRODUCTION ...... 9

I. EARLY CELLULAR EVENTS TRIGGERED BY WOUNDING AND HERBIVORY ...... 12 1. Sensing cell wall integrity and cell death ...... 12 2. Ion fluxes and other second messengers ...... 14 3. Production of Reactive Oxygen Species (ROS) ...... 15 4. Damage-Associated Molecular Patterns (DAMPs) are intercellular signaling molecules produced upon wounding ...... 16 5. JA is a central actor of plant responses to wounding and insects ...... 18 6. Long-distance signaling ...... 25 7. How to differentiate herbivory from mechanical wounding? ...... 27 II. WOUNDING AND HERBIVORY FEEDING INDUCE A LARGE SET OF RESPONSES ...... 29 1. A great transcriptional reprogramming largely dependent on JA ...... 29 2. Various defense responses ...... 31 III. MITOGEN-ACTIVATED PROTEIN KINASE (MAPK) MODULES ARE KEY SIGNALING ACTORS OF ENVIRONMENTAL PERCEPTION ...... 35 1. MAPKs are important stress responsive modules in plants ...... 35 2. Spare data suggest a complex MAPK role in wounding and herbivory interaction ...... 41 IV. OBJECTIVES OF THE PHD WORK: UNVEILING THE FUNCTION OF MKK3 MODULES IN WOUNDING SIGNALING ...... 43 1. MAPKs and signal transduction before this work, a state of knowledge ...... 43 2. Objectives: characterizing the activation of a MAPK module upon wounding stress ...... 44 CHAPTER II: RESULTS & DISCUSSIONS ...... 46

I. TOWARD A GENERAL MODEL FOR THE ACTIVATION OF MKK3-RELATED MODULES ...... 46 1. Identification of MAP3Ks able to interact with MKK3 using the yeast 2-hybrid system ...... 46 2. Functional validation of MAP3Ks using a transient expression system ...... 47 3. Sub-clade III MAP3Ks are strongly transcriptionally regulated by stresses ...... 48 4. Discussion ...... 49 II. IDENTIFICATION AND CHARACTERIZATION OF NEW MAPK MODULES ACTIVATED BY WOUNDING ...... 50 1. Wounding activates an MKK3 module in Arabidopsis thaliana ...... 50 2. The wounding-induced activation of the iconic MPK3 and 6 is not dependent on MKK3 ...... 52 3. The hunt of upstream MAP3K(s) ...... 53 4. Discussion ...... 57

Characterization of a MAPK module involved in Arabidopsis response to wounding 6

III. IDENTIFICATION OF SIGNALING ELEMENTS ACTING UPSTREAM MKK3 UPON WOUNDING ...... 60 1. Exogenous application of some candidate second messengers can activate an MKK3-dependent module...... 60 2. Wounding-induced activation of the MKK3-dependent module is disrupted in mutants of the JA signaling pathway ...... 63 3. MKK3-MPK2 is not activated in systemic leaves ...... 65 4. Discussion ...... 66 IV. ACTIVATION OF AN MKK3-DEPENDENT MODULE BY CELL WALL-DAMAGING PATHOGENS ...... 67 1. Botrytis cinerea activates an MKK3-dependent module in Arabidopsis thaliana 68 2. Spodoptera littoralis activates an MKK3-dependent module in Arabidopsis thaliana ...... 69 3. Discussion ...... 70 V. STUDY OF THE ROLE OF AN MKK3-DEPENDENT MODULE IN WOUNDING-RELATED RESPONSES ...... 71 1. Plants impaired in MKK3 signaling do not show clear detectable phenotype upon Botrytis infection ...... 71 2. Plants impaired in MKK3 signaling do not properly respond to herbivorous insects ...... 73 3. Wounding-induced trichome formation ...... 77 4. Transcriptomic analysis of mkk3-1 plants submitted to wounding did not highlight any MKK3-regulated genes ...... 78 5. Discussion ...... 79 CHAPTER III: CONCLUSIONS & PERSPECTIVES ...... 81

I. A MAPK SIGNALING NETWORK ACTIVATED IN RESPONSE TO WOUNDING ...... 81 1. Toward a sequential and interdependent activation of two MAPK modules ...... 81 2. Spatial organization of MAPK activation upon wounding ...... 82 II. A NOVEL MKK3-DEPENDENT MODULE ACTIVATED BY ENVIRONMENTAL CONSTRAINTS THROUGH TRANSCRIPTIONAL REGULATION OF MAP3K GENES ...... 83 1. An emerging general working model… ...... 83 2. …coexisting with other models? ...... 85 3. Open questions about the functioning of sub-clade III MAP3Ks-MKK3-C-group MAPKs modules ...... 85 III. A ROLE FOR MKK3 IN STRESS RESPONSES? ...... 88 1. A well-conserved MAPK through evolution ...... 88 2. A role in herbivory signaling? ...... 88 3. Characterized phenotypes in other stress and developmental contexts ...... 89 4. The hunt of MPK1/2/7/14 substrates ...... 90

Characterization of a MAPK module involved in Arabidopsis response to wounding 7

CHAPTER IV: MATERIALS & METHODS ...... 92

I. MATERIALS ...... 92 1. Plant material ...... 92 2. Culture media and conditions ...... 93 3. Antibodies ...... 93 4. Vector backbones ...... 94 5. Buffers and solutions ...... 95 II. METHODS ...... 96 1. Plant methods ...... 96 2. Molecular biology methods ...... 100 3. Biochemistry methods ...... 105 CHAPTER V: REFERENCES ...... 107

ANNEX: Review - Convergence of Multiple MAP3Ks on MKK3 Identifies a Set of Novel Stress MAPK Modules

Characterization of a MAPK module involved in Arabidopsis response to wounding 8

CHAPTER I: INTRODUCTION

Agricultural context

Humans started to cultivate plants more than 10.000 years ago for their alimentation. Nowadays, 62% of crop production is intended for human food, 35% for animal feeding and 3% for bioenergy, seed and other industrial products (Foley et al., 2011). Thus it is clear that agriculture and food production are of great concern for people all over the world. International organizations such as the Food and Agriculture Organization of the United Nations (FAO) or the World Health Organization have developed strategies to prevent worldwide food crises and highlighted the urgent need for research and innovation in agricultural sciences. According to the FAO, the world population will reach 9.1 billion by 2050. In order to feed that number of people, food productivity will have to increase by 60- 70% (www.fao.org, 2015). The increase of food productivity is also of great importance to fight poverty in many third-world countries. To reach this objective, different levels are explored. The first one consists in increasing overall plant productivity. Breeding has been performed since crop domestication but new tools coupled to a better knowledge of plant biology are available to accelerate the process. Another possibility will consist in reducing crop losses due to non-optimal growth conditions referred as “stresses”. Such stresses are generally classified in two categories. Abiotic stresses are caused by non-living entities such as drought, salt, heat, cold, whereas biotic stresses are caused by living organisms like bacteria, fungi, viruses or insects. Abiotic and biotic stresses are responsible for about 50% crop losses in the world (Ashraf et al., 2012). It is important to stress the fact that the impact of abiotic stresses is very likely to increase in the future due to global warming issues

(increasing temperatures and CO2 emissions) (Intergovernmental Panel on Climate Change, ipcc.ch). The effects of stresses on plants are diverse: reduction of biomass, decrease of fertility or simply death. It is thus important to find a way to increase crop tolerance to environmental stresses with the aim of improving their quantity and quality. Until now, strategies used to improve crop production have relied on a massive use of chemical products and great deforestations to create surfaces devoted to cultures. Yet these practices have huge impact on human health and environment (destruction of wildlife and plants). Today, the new goal is to develop a sustainable agriculture without impacting the environment. For this reason it became critical to develop new tools based on basic science. Studying and

Characterization of a MAPK module involved in Arabidopsis response to wounding 9

understanding how plant respond to their environment is an important step before being able to engineer plants more resistant to environmental stresses.

Plants are confronted to mechanical stimuli of diverse nature

Like many other organisms, plants are exposed to mechanical stimuli imposed by their environment that can range from a gentle breeze or the touch of neighboring objects during the growth of organs to a strong wounding caused by herbivore feeding or the accidental abscission of aged organs. The sensing of “non-wounding” mechanical stimuli have an important role in plant morphogenesis as it triggers developmental responses of the plant, the best illustrating examples being the shaping of a tree by the wind or the development of roots finding their way through obstacles in the soil (Monshausen & Gilroy, 2009). On the other hand, the wounding of plant tissues can have more detrimental effects as it can cause cell death and create entrances for pathogens thereby facilitating their development inside plant tissues. In the course of my PhD, I have been particularly interested in the mechanical stress caused by herbivorous insects.

Plants and herbivorous insects

Plants and insects have co-evolved for nearly 350 million years (Gatehouse, 2002). Some plant-insect interactions can be beneficial for the plant as in the case of pollination. In some cases, plants can even develop at the expense of insects. An amazing example is the important source of nitrogen that carnivorous plants living on very poor soils find in insects they can catch. Yet many insects have deleterious effects on the plant as in the case of attacks by herbivorous insects that can feed themselves on the targeted plant or deposit their eggs (oviposition). Herbivorous insect species are very diverse and possess different feeding strategies. The majority is composed of beetles and caterpillars that can damage leaves with their mouthparts by chewing, tearing or snipping (Fürstenberg et al., 2013). Sucking insects, like aphids, have specialized organs called stylets that can be inserted into the phloem to suck the liquid content. In this case, the wounding part of the interaction is reduced but aphids can form very large colonies which can have strong effects. Plants have developed advanced response systems to fight and defend themselves against herbivorous insects. A first layer of defense is constitutive. Plants are naturally equipped with physical barriers like a cuticle layer, trichomes, and thorns. They also

Characterization of a MAPK module involved in Arabidopsis response to wounding 10

Wounding Oral secretions

Pep1 ATP HAMPs DAMPs OGs

PEPR1 ? DORN1 WAK1/2 PEPR2 Membrane JA depolarization ABA ET MAPKs Ca2+ activation SA Defense CBL responses + CAM CDPK -physical barriers (trichomes…) O2 NADPHox -resistance to further attacks -callose - O2 deposition Stress response -production of ROS burst JA and ET biosynthesis volatile compounds H2O2 PEPR1/PEPR2 … nucleus cytosol

apoplast

Figure 1.1: Simplified model depicting cellular events triggered by wounding and herbivory Wounding and herbivory can be perceived by the cell through the recognition of Damage- Associated Molecular Patterns (DAMPs) such as OGs, Pep1 or ATP that are self-derived molecules. Plants can also respond to Herbivore-Associated Molecular Patterns (HAMPs) found in insect oral secretions that are recognized through an unknown mechanism. Both DAMPs and HAMPs are able to trigger plant defense responses. Wounding leads to a rapid depolarization of the plasma membrane followed by an important influx of calcium and a burst of Reactive Oxygen Species (ROS). Those events lead to the de novo synthesis of phytohormones and in term to the regulation of stress-responsive genes. Plants will be able to defend themselves by activating specific defense responses in order to prevent further attacks or to repel herbivores.

accumulate secondary metabolites that can function against herbivores. But they also sense the presence of insects by detecting compounds of their oral secretions/oviposition fluids and by the mechanical damage caused by the insect feeding. In order to counteract insect effects, plants activate specific immune responses that are controlled by complex signaling pathways. One specific response is the emission of volatile compounds to repulse herbivores, attract their predators and alert neighboring organs and plants. Mechanical wounding of plant tissues is an unavoidable consequence of herbivory, although the intensity and the extent of damage depend on the mode of feeding of the insect (chewing, sucking…). Insects feed on leaves by continuously wounding them and swallowing small pieces of tissue, simultaneously introducing saliva and other secretions in contact of plant cells. In order to better understand plant defense responses triggered by herbivores, most studies chose to apply a single mechanical wound by crushing or puncturing leaves. Although the major part of responses is similar to the ones observed upon insect attack, a single wound is often not enough to induce the emission of volatiles (Alborn et al., 1997). Cellular events occurring upon wounding and herbivory include membrane depolarization, increase of cytosolic calcium levels, production of Reactive Oxygen Species (ROS), activation of Mitogen-Activated Protein Kinases (MAPKs) along with phosphorylation events and phytohormone accumulation. These cascades of intracellular events finally lead to a strong transcriptional reprogramming allowing the plant to raise defenses against the perceived stress (Savatin et al., 2014; Zebelo & Maffei, 2015). Those wound-triggered cellular events are described in the first part of the introduction and additional information about insect-induced responses is given when available (figure 1.1).

Arabidopsis, a model plant to study plant defense responses

Although studies on this subject have been conducted on different plants species including tobacco (Nicotiana attenuata), tomato (Lycopersicon esculentum), Lima bean (Phaseolus lunatus) and thale cress (Arabidopsis thaliana) closer attention will be paid to literature data provided by works performed on Arabidopsis. Indeed, the latter is commonly used in the laboratory and provides a wide range of advantages. Arabidopsis thaliana was first proposed to be used as a genetic model organism about 75 years ago and started to be widely used as such during the 1980s (Meyerowitz, 2001). The study of this plant has developed our understanding of plants in general but had also an impact on some aspects of

Characterization of a MAPK module involved in Arabidopsis response to wounding 11

research on animals and humans. Indeed, some important processes of human biology can be more easily studied in this model plant and many discoveries made using Arabidopsis were directly useful for human health issues such as cancer or Alzheimer’s disease (Jones et al., 2008). The use of Arabidopsis as a model offers advantages such as a small genome size (≈ 135 million base pairs), the convenience of crossing linked to a strict Mendelian inheritance, the large progeny of each plant (>10.000 seeds) and the short generation time (≈ 8 weeks from germination to mature seed production). Arabidopsis thaliana genome has been entirely sequenced and very well annotated (The Arabidopsis Genome Initiative, 2000). Mutations of desired target sequences have been largely facilitated by the development of various tools such as the collection of T-DNA insertion lines, the TILLING (Targeting Induced Local Lesions in Genomes) technology, the use of approaches based on RNA-silencing and more recently the CRISPR-Cas9 system based on the action of endonucleases aiming desired sites in the genome (Zhang et al., 2016). Large mutant collections are easily accessible to query using online tools.

I. Early cellular events triggered by wounding and herbivory

1. Sensing cell wall integrity and cell death

Wounding caused by insect feeding or other mechanical stimuli is a very complex stress. It locally induces cell death on a variable area as well as a mechanical stimulation of the neighboring living cells. The first events and their relative importance in the initiation of wounding signaling processes are poorly known. In one hand, wounding-induced cell death triggers a strong loss of compartmentalization of cellular molecules such as enzymes or ions which may be involved in the initiation of wounding signaling (ATP, Ca2+…). On the other hand, living cells neighboring the wounding site are abruptly disturbed and probably react by the activation of intra and intercellular signaling pathways. Wounding and herbivore feeding affect the integrity of cuticle and cell wall. Resulting breaches alert the plant of the presence of invading visitors. Among the warning signs are changes in mechanical properties and release of oligosaccharide fragments from the cell wall (Nühse et al., 2012). A loss of cell wall integrity (CWI) can be sensed by Receptor- Like Kinases (RLKs) such as THESEUS 1 but other sensors have been suggested based on studies conducted in yeast where a CWI-dependent pathway has been well characterized

Characterization of a MAPK module involved in Arabidopsis response to wounding 12

(Levin, 2011; Hamann, 2015). Similar sensing systems might be involved in the detection of wounding in plants. Additionally, in the case of a pathogen attack, cell wall-degrading enzymes such as polygalacturonase, pectate lyase and pectin methylesterase, which are released by the pathogen or produced by the plant and activated upon attack, come into play (Walton et al., 1994). Treatment of the plant cell wall with these enzymes can elicit defense responses (Walton, 1994). In most cases, responses are triggered by the recognition of the enzymatic products among which oligogalacturonides have been the most studied (Ferrari et al., 2013). Physical signals could also be generated by stretching of the plasma membrane that could be detected by stretch-activated enzymatic activities. There is much evidence from electrophysiological studies that the plasma membrane of plant cells contain a wide diversity of mechanosensitive (MS) ion channels. A simple touch of the leaf surface can be sensed through MS channels that can trigger further signal transduction events. Thus a soft mechanical stress at the leaf surface was shown to be enough to activate the expression of touch (TCH) genes as well as other cellular responses similar to the ones induced by a stronger wounding (ROS production, Ca2+ influx, resistance to pathogens) (Benikhlef et al., 2013). A number of MS channels activities have been functionally characterized in plant membranes and are good candidates to act as first sensors of mechanical stimuli (Peyronnet et al., 2014; Haswell et al., 2008). Based on their homology to the bacterial MscS channel, the 10 MscS-Like (MSL) proteins of Arabidopsis thaliana have been hypothesized to form mechanosensitive channels in plant cell and organelle membranes. MS channels have the property to convert mechanical stimuli into electrophysiological (potential variation) or biochemical signals. Once they are activated and opened, they often lead to membrane depolarization and to the influx of second messengers such as Ca2+ ions. The link between the activation of MS channels and Ca2+ variation is still not clearly known (Hamilton et al., 2015). Some authors suggest the involvement of a MS calcium channel that could itself generate Ca2+ influx upon a mechanical stimulus. It seems that MSL permeability is more anionic than calcic (Haswell et al., 2008), but as a very low Ca2+ permeability might be enough to induce slight increases of cytosolic Ca2+, a direct role for MS channels in calcium- induced activities cannot be excluded. Alternatively, it is possible that voltage-dependent Ca2+ channels found on plasma membranes (Miedema et al., 2008) could be activated by the depolarization triggered by the opening of MS channels.

Characterization of a MAPK module involved in Arabidopsis response to wounding 13

2. Ion fluxes and other second messengers

As indicated earlier, the depolarization of the plasma membrane causes ion fluxes, the most important being Ca2+ ions as they have been shown to function as second messengers in many signaling pathways (Kudla et al., 2010). Plants can discriminate between various stimuli based on calcium signatures that are defined by their amplitude, frequency, subcellular localization and duration. Peaks of cytosolic Ca2+ are detected within 6 seconds in cells close to the injury site (Beneloujaephajri et al., 2013) and several studies showed that cytosolic calcium levels also increase upon herbivore attack (Arimura & Maffei, 2010). Very recently, the use of a fluorescent calcium biosensor has allowed observing elevations of Ca2+ levels during a biotic interaction with an aphid (Myzus persicae) (Vincent et al., 2017). Using appropriate mutant lines, authors were able to show that these Ca2+ elevations are dependent on BAK1 (Brassinosteroid insensitive-Associated Kinase 1), a well-known co-receptor of Pathogen Recognition Receptors (PRRs), as well as on GLR3.3 and 3.6 channels (GLutamate Receptor-like). In the same study, the vacuolar cation channel TPC1 (Two Pore Channel 1) was shown to importantly contribute to the observed cytosolic elevation. In another study, TPC1-dependent calcium elevations were observed upon feeding of the caterpillar Spodoptera littoralis, both locally and systemically (Kiep et al., 2015). Inositol trisphosphate (InsP3) was shown to mediate Ca2+ release from internal stores (Alexandre & Lassalles, 1990). It was recently shown, along with phosphoinositide, to act as a second messenger of wounding signal transduction and regulate the expression of wound-inducible genes (Mosblech et al., 2008). Interestingly, their production was shown to require the biosynthesis of JA as no increase of InsP3 was observed in plants deficient in JA synthesis. In Arabidopsis, the calcium signal is decoded by three major multigenic families of Ca2+ sensor proteins: calmodulins or calmodulin-like proteins (CAMs), calcineurin B-like proteins (CBLs) and Calcium-Dependent Protein Kinases (CDPKs). Some of those sensors have been studied and were shown to have roles in plant immunity in response to bacterial pathogens but also herbivorous insects (Boudsocq & Sheen, 2013; Arimura & Maffei, 2010). In Arabidopsis, some CDPKs are activated by the bacterial elicitor flg22 and were shown to be important for the transduction of defense responses (Boudsocq et al., 2010). Two CDPKs, CPK3 and CPK13, were directly shown to act as positive regulators of the defense gene PDF1.2 upon exposure to Spodoptera littoralis caterpillars (Kanchiswamy et al., 2010). A calmodulin-like protein, CML42 was shown to sense Ca2+ upon application of oral secretions

Characterization of a MAPK module involved in Arabidopsis response to wounding 14

from S. littoralis and to connect Ca2+ to JA signaling (Vadassery et al., 2012). cml42 plants showed enhanced resistance to the caterpillar as well as higher expression levels of the JA- responsive gene VSP2. Another calmodulin-like protein, CML37, was shown to be involved in the regulation of the Jasmonic Acid (JA) pathway and in resistance to herbivory (Scholz et al., 2014). Three TCH (TouCH) genes encoding calmodulin and calmodulin-like proteins were shown to be induced by mechanical stimuli such as touch or wind, supporting the important role of calcium signaling in the transduction of such environmental cues (Braam & Davis, 1990). The role of Ca2+ sensor proteins in a context of wounding and/or herbivory was also demonstrated in other plants species. Thus, in tomato, LeCDPK2 is involved in the wound-induced ethylene (ET) production (Kamiyoshihara et al., 2010) and in tobacco (Nicotiana attenuata), NaCDPK4 and NaCDPK5 negatively regulate wounding responses and resistance to the herbivore Manduca sexta (Yang et al., 2012). Finally, in maize, ZmCPK11 is activated by wounding in a JA-dependent pathway and is involved in systemic wound responses (Szczegielniak et al., 2012). In addition to calcium signaling, phospholipase D (PLD) has been suggested to play an important role in the mediation of wound-induced responses (Wang et al., 2000). PLD hydrolyzes phospholipids and leads to the production of phosphatidic acid (PA). PLD-induced hydrolysis was observed after wounding in bean leaves and appeared to be mediated by an increase in cytoplasmic Ca2+ concentrations (Ryu & Wang, 1996). Interestingly, PLD was shown to be required for the production of JA and the induction of a JA-regulated gene (Wang et al., 2000; Bargmann et al., 2009).

3. Production of Reactive Oxygen Species (ROS)

Reactive Oxygen Species (ROS) are normally produced in peroxisomes, chloroplasts and mitochondria due to the presence of an oxidizing activity or electron transfer chains in these organelles (Tripathy & Oelmuller, 2012). In addition, ROS production can be induced upon stress conditions and create a ROS burst that is thought to have antimicrobial effects. Stress-induced ROS production was first described in 1983 in potato tubers infected with the oomycete Phytophthora infestans (Doke, 1983). Since this study, many works contributed to show that ROS can also be involved in other stresses including wounding and insect feeding (Suzuki & Mittler, 2012; Maffei et al., 2006).

Characterization of a MAPK module involved in Arabidopsis response to wounding 15

NADPH oxidases are well known producers of ROS (Marino et al., 2012). They transfer electrons from cytosolic NADPH (or NADH) to oxygen in the apoplast, thus leading - to the production of superoxide ions (O2 ). The latter is then converted to hydrogen peroxide

(H2O2) in the apoplast by the action of superoxide dismutase. NADPH oxidases belong to the Respiratory Burst Oxidase Homolog (RBOH) family that has 10 members (RBOHA to RBOHJ) in Arabidopsis (Torres & Dangl, 2005). In response to wounding, the observed oxidative burst is believed to be due to NADPH oxidases. Indeed, in Arabidopsis seedlings, the rapid local and systemic ROS burst is impaired in rbohd mutants (Miller et al., 2009). In tomato (Solanum lycopersicum), the inhibition of NADPH oxidase by specific inhibitors blocks the wound-induced production of ROS and the induction of some defense genes. NADPH oxidases are also involved in wound-induced ROS burst in other plant species such as Medicago truncatula or potato (Soares et al., 2011; Bernards & Razem, 2001). In addition to their oxidase domain, NADPH oxidases also possess Ca2+ binding domains and it was demonstrated that wound-induced ROS burst is dependent on Ca2+ peaks (Monshausen et al., 2009; Beneloujaephajri et al., 2013). Besides NADPH oxidases, ROS can also be produced through the action of apoplastic peroxidases but no evidence was found for their action in wound-induced ROS production in Arabidopsis (Minibayeva et al., 2014). Concerning herbivory, it has been shown that H2O2 is released upon Spodoptera littoralis feeding on Lima bean and, to a lesser extent, upon mechanical damage (Maffei et al., 2006).

4. Damage-Associated Molecular Patterns (DAMPs) are intercellular signaling molecules produced upon wounding

Plants are able to sense their damaged self and trigger responses very similar to those induced by pathogen infection. Endogenous molecules deriving from wounded tissue can act like Damage-Associated Molecular Patterns (DAMPs) and elicit local and systemic plant defenses. In tomato, systemin, an 18 amino-acid peptide, is released in the apoplast after wounding or insect attack (Jacinto et al., 1997). Sensing of systemin leads to the biosynthesis of JA, an important wound phytohormone, that activate defense responses locally and in the neighboring cells (Orozco-Cardenas et al., 1993). Hydroxyproline-rich systemins have also been identified in other Solanaceae (potato, petunia, black nightshade) and are able to trigger plant immunity in response to herbivore attack. In Arabidopsis thaliana, three self-derived families of molecules have been identified so far. They are all recognized by Pattern-

Characterization of a MAPK module involved in Arabidopsis response to wounding 16

Recognition Receptors (PRRs) localized at the plasma membrane level. Oligogalacturonides (OGs) are released from the plant cell wall after degradation of homogalacturonan, the main component of pectin, through the action of wounding-induced hydrolytic enzymes such as polygalacturonase. The size of OGs is important and can determine their efficiency as eliciting molecules. OGs with a degree of polymerization between 10 and 15 are the most active ones (Ferrari et al., 2013). Wall-Associated Kinases (WAKs) are RLKs associated to the cell wall that are required for cell expansion during development but can also mediate stress responses induced by OGs released upon wounding. WAKs are encoded by 5 genes among which WAK1 and WAK2 are transcriptionally induced by wounding. In rice, OsWAK1 is also upregulated by wounding as well as salicylic acid (SA) and JA. By the use of a chimeric receptor approach, authors have shown the ability of WAK1 to bind OGs (Brutus et al., 2010). WAK2 also seems to have a predominant role as wak2-1 plants are not able to activate defense responses induced by OGs (Kohorn et al., 2009). Adenosine Tri Phosphate (ATP) can also act as an extracellular signaling molecule (Tanaka et al., 2014). It is released from plant cells in response to abiotic stresses (Dark et al., 2011), fungal elicitors and mechanical stimuli (Weerasinghe et al., 2009). Concentrations of ATP up to 40 µM were measured after wounding, probably released from neighboring cells whose plasma membrane had lost its integrity (Jeter et al., 2004). Recently the plant receptor of ATP has been identified in Arabidopsis as DORN1 (DOes not Respond to Nucleotides 1), a lectin receptor kinase (Choi et al., 2014). The characterization of dorn1 plants showed the specificity of this receptor for ATP as plants were not impaired in responses to other exogenous stimuli. Based on this observation, transcriptional responses to ATP were compared to those observed upon wounding. 60% of the genes induced by ATP were also induced by wounding and the expression of selected genes was found highly reduced in dorn1 plants after wounding, strongly suggesting that ATP is a major component of wounding response. Pep1 is a 23 amino-acid peptide released from the C-terminal part of its precursor PROPEP1 (Yamaguchi & Huffaker, 2011). The latter constitutes a family with other 7 members that are all produced in response to wounding or pathogen perception, which means that unlike OGs and systemin, whose production does not require any gene regulation, genetically encoded peptides such as Pep1 are produced in a second wave of events to reinforce responses and/or mediate intercellular signaling. Pep1 is perceived by two Receptor- Like Kinases (RLKs), PEPR1 and PEPR2 (for Pep-Receptor1 and 2), which are functionally

Characterization of a MAPK module involved in Arabidopsis response to wounding 17

and structurally very similar to the RLKs FLS2 and EFR (receptors of bacterial elicitors flg22 and elf18 respectively) (Krol et al., 2010). PEPR1 and PEPR2 are transcriptionally induced by wounding and JA as well as upon herbivore attack and application of oral secretions (OS) (Klauser et al., 2015). Besides, the pepr1 pepr2 mutant shows increased sensitivity to Spodoptera littoralis feeding as well as a reduction of JA accumulation upon application of insect OS. Homologues of AtPep1 have been identified in maize; one of them, ZmPep3, triggers the biosynthesis of JA and ET and induces the production of volatile compounds (Huffaker et al., 2013). DAMP signaling is very similar to the one induced by the recognition of PAMPs (Pathogen-Associated Molecular Patterns) that are pathogen-derived molecules, in opposition to the self-derived nature of DAMPs. First, they are recognized at the cell surface by PRRs (mostly receptor-like kinases) that are structurally very similar: a variable ectodomain potentially involved in ligand binding, a single transmembrane domain and an intracellular kinase domain, which is involved in the initiation of the intracellular signaling pathway (Couto & Zipfel, 2016). Secondly, the recognition of both DAMPs and PAMPs by the appropriate receptor leads to a cellular immune signaling involving the steps described earlier: rapid ion-flux changes at the plasma membrane level, increase of Ca2+ levels, production of ROS. In a coordinated manner, activation of phosphorylation cascades conveys immune signaling to the nucleus, resulting in strong transcriptional reprogramming to establish an immune response.

5. JA is a central actor of plant responses to wounding and insects

Phytohormones are small molecules used in various aspects of plant life ranging from development to stress responses. Jasmonic acid, the major component of jasmine scent, and its major derivative JA-Isoleucine (JA-Ile) help to regulate various aspects of plant biology, from stress responses to development. In non-stressed plants, JA is involved in senescence and reproductive development. Stress responses in which JA is involved include some abiotic stresses (drought, UV, ozone…) and mainly biotic stresses caused by insects or other microbial pathogens (Wasternack & Hause, 2013; Santino et al., 2013). Notably, JA has long been described as the major defense hormone against herbivores (Howe & Jander, 2008). Herbivores can activate the synthesis of JA in damaged host tissue and, in turn, JA can activate specific wound-induced defense responses (Campos et al., 2014). Most herbivore-

Characterization of a MAPK module involved in Arabidopsis response to wounding 18

Figure 1.2: Biosynthetic pathway of Jasmonic Acid (JA) (from Acosta & Farmer, 2010) JA is synthesized from the fatty acid α-linolenic acid (18:3) (α -LeA) released from galactolipids of chloroplast membranes. After the action of several enzymes (LOXs, AOS, AOC), OPDA is obtained and is relocated to the peroxisome. The reduction of OPDA by OPR3 followed by several cycles of β-oxidations leads to the synthesis of JA which is then translocated to the cytosol where it can be modified to JA-Ile and other derivatives. JA-Ile is then perceived by the SCF/COI1 complex and allows the expression of defense genes as well as genes encoding enzymes of its own synthesis.

induced responses are also induced by treatments with JA. Moreover, wounding is sufficient to trigger increases of JA and JA-Ile, thus demonstrating that insect-derived molecules are not required to activate JA production (Koo et al., 2009). Mutants defective in JA biosynthesis or perception are highly susceptible to insect attack or other pathogens, highlighting the essential role of JA in defense (Thomma et al., 1998; Stotz et al., 2002). Hereafter is an overview of JA functions in the context of wounding and herbivory, including its biosynthesis, signaling, as well as some indications of crosstalks with other phytohormones.

a. JA homeostasis in response to wounding and herbivory

Jasmonates form a family of oxylipins deriving from enzymatic oxygenation of 18 and 16-carbon triunsaturated fatty acids (Wasternack & Kombrink, 2010). JA is synthesized from the fatty acid α-linolenic acid (18:3) (α-LeA) released from galactolipids of chloroplast membranes (figure 1.2). The enzyme responsible for the release of α-LeA was identified as phospholipase 1 (PLA1). α-LeA is then oxidized by a lipoxygenase (LOX) that is responsible for the insertion of an oxygen at the C-13 position of the acid, thus forming 13-HPOT. The genome of Arabidopsis includes 4 LOXs involved in JA synthesis upon wounding (LOX2, 3, 4 and 6). LOX2 was shown to be required for JA production proximal to the wound (Glauser et al., 2009). However, JA and JA-Ile are still synthesized in the lox2-1 mutant suggesting the involvement of other LOXs. More recent studies using combinations of multiple LOXs mutants revealed that all 4 LOXs contribute to JA synthesis upon wounding (Chauvin et al., 2013). LOX6 was found to have a particular role in early JA synthesis in distal leaves (Farmer et al., 2014). The next step of the JA biosynthesis pathway leads to the formation of its precursor cis-12-oxo-phytodienoic acid (OPDA). The enzymes responsible for this step are ALLENE OXIDE CYCLASE (AOC) and ALLENE OXIDE SYNTHASE (AOS). OPDA is then transported to the peroxisome where it is reduced to OPC-8:0 by 12-oxophytodienoate reductase (OPR3). Next, (+)-7-iso-JA is produced after several rounds of β-oxidations. Upon its subsequent transport to the cytoplasm, JA is modified to methyl-JA (meJA), JA-Ile or other derivatives. JA-Ile is formed by the action of the JAR1 enzyme (Jasmonic Acid Resistant 1) and is the most active form of JA as it seems to be the one that actually plays the major role in Arabidopsis leaves (Staswick & Tiryaki, 2004; Fonseca et al., 2009b). At the histological level, jasmonate biosynthesis in Arabidopsis mainly takes place in the vascular bundles of the vegetative parts of the plant. However, some data suggest a

Characterization of a MAPK module involved in Arabidopsis response to wounding 19

production of JA in cells outside the vessels. For example, LOX2 is found strongly expressed in mesophyll cells (Montillet et al., 2013). The use of promoter::GUS lines allowed the observation of some genes encoding enzymes of the AOC family in Arabidopsis roots (Stenzel et al., 2012). The Arabidopsis microarray datasets from various stress conditions and developmental stages revealed transcriptional regulation of all JA biosynthesis genes (Pauwels et al., 2009; van Verk et al., 2011). However, the activity of some enzymes seems to be post-translationally regulated. Thus, the activity of OPR3 seems to result from a monomer/dimer equilibrium (Schaller & Stintzi, 2009). Unstressed leaves of Arabidopsis contain very low amounts of bioactive JA, typically about 20-50 pmol/g fresh mass but this level increases within 5 minutes upon wounding (Glauser et al., 2008b; Glauser et al., 2009). In the wounded leaf JA levels increase up to 500-fold, reaching about 10 nmol/g fresh mass whereas JA-Ile levels reach less than 10% of the level of JA (Suza & Staswick, 2008). In more details, the first significant increase of JA in the wounded leaf is observed less than 30 seconds after wounding and its level doubles every 20 seconds during the first minute. Concerning JA-Ile, its first significant increase is observed 5 min after wounding (Koo et al., 2009). This remarkable speed of production suggests that all biosynthetic enzymes involved in production of JA/JA-Ile are already present in resting cells. The molecular events linking wounding to the de novo synthesis of JA are largely unknown. Genetic and pharmacological disruption of cell wall integrity has been shown to constitutively activate the JA pathway (Hamann et al., 2009). There is also evidence suggesting that JA/JA-Ile are produced upon perception of DAMPs or bacterial effectors (Campos et al., 2014). In Arabidopsis, the perception of AtPep1 by its receptors PEPR1 and PEPR2 was shown to have a role in JA production as pepr1 pepr2 plants accumulated less JA upon herbivore oral secretion (Klauser et al., 2015). In maize, ZmPEPR3 activates JA synthesis by increasing the level of transcripts encoding the biosynthetic enzymes AOC and AOS (Huffaker et al., 2006). The application of ATP induces the expression of genes encoding enzymes for JA biosynthesis in Arabidopsis (Song et al., 2006; Choi et al., 2014). The responses induced by OGs were however shown to be independent from JA signaling (Ferrari et al., 2007). The exact mechanism by which DAMP signaling leads to JA biosynthesis still remains elusive. Among the intracellular events that could link the perception of self-derived elicitors to JA production are Ca2+ ions, ROS, MAPK cascades and

Characterization of a MAPK module involved in Arabidopsis response to wounding 20

CDPKs (Arimura & Maffei, 2010; Zebelo & Maffei, 2015). For instance, Ca2+ fluxes and associated CDPKs exert a control during the activation of JA biosynthesis genes (Bonaventure et al., 2007). However, it is not clear whether any of the enzymes involved in the biosynthesis of JA are regulated by CDPK/MAPK-dependent phosphorylation or cellular redox changes, although JA-induced phosphorylation of JA signaling components has been observed (Zhai et al., 2013). In addition to JA-Ile, diverse conjugated and oxidized derivatives of JA are produced. These forms of jasmonates include hydroxyhasmonates (HOJAs) and HOJA-Ile as well as dicarboxyjasmonate (HOOCJA-Ile). HOJAs and HOOCJA-Ile accumulate in midveins of wounded leaves (Glauser et al., 2008) and were shown to be products of JA catabolism (Heitz et al., 2012; Koo et al., 2012). These derivatives being less active than JA- Ile in promoting the binding of COI1 to JAZ proteins, they participate to the attenuation of JA responses. Enzymes involved in JA-Ile catabolism are also rapidly induced upon wounding, herbivory and exogenous JA treatments (Bhosale et al., 2013). This co-expression of catabolism genes with other JA-response genes reflects the tight control of JA signaling.

b. JA signaling through COI1-JAZ-MYC signaling module

In 1994, the first JA resistant mutant coi1 (coronatine insensitive 1) was isolated and shown to be impaired in the receptor of JA-Ile (Feys et al., 1994). In Arabidopsis, plants impaired in COI1 do not respond to external JA application. In addition, biochemical approaches showed direct binding of JA-Ile (or its structural mimic coronatine) to COI1 (Yan et al., 2009). COI1 is an F-box protein containing 18 leucine-rich repeat (LRR) that forms a complex with SCF (Skp1/Cullin/F-box), an E3 ubiquitin ligase which mediates protein ubiquitination for targeted degradation by the 26S proteasome (Xie et al., 1998). SCF/COI1 defines a complex specifically involved in jasmonate signaling (Xu et al., 2002). Mutants lacking a functional COI1 are compromised in all known JA-regulated processes and do not respond to exogenous JA, as shown in tobacco, tomato and Arabidopsis (Paschold et al., 2007; Li et al., 2004; Xie et al., 1998). Interestingly, the accumulation of JA-Ile was shown to be dependent on COI1 as wound-induced JA levels were far lower in coi1 plants than in wild- type ones (Chung et al., 2008). Jasmonate ZIM-Domain (JAZ) proteins that form a family of 13 members in Arabidopsis are negative regulators of the transcription of JA-responsive genes (Thines et al., 2007). The absence of DNA-binding domains in JAZ proteins suggests

Characterization of a MAPK module involved in Arabidopsis response to wounding 21

Figure 1.3: Perception and signaling of Jasmonic Acid (from Acosta & Farmer , 2010) a) In the absence of JA-Ile, the repressor JAZ is bound to transcription factors of the MYC family, thus restraining their action. b) When JA-Ile is produced in necessary amounts, it binds to the SCF/COI1 complex, allowing the latter to recruit JAZ repressors and promote their ubiquitination for further degradation by the proteasome. MYC factors are then set free and can activate the expression of defense genes.

that the negative regulation is probably not performed by direct binding to gene promoter sequences but rather by interfering with transcription factors. Indeed, JAZ proteins can bind to many transcription factors and repress their activity. Among them the basic helix-loop- helix (bHLH) transcription factors MYC2, MYC3 and MYC4 have been extensively studied (Fernandez-Calvo et al., 2011). In the absence of JA-Ile, JAZ proteins are stable and repress the action of MYCs, and thus the expression of the downstream MYC-dependent genes, by recruiting two co-repressors TPL (TOPLESS) and NINJA (NOVEL INTERACTOR OF JAZ) and by competing with MED25 (MEDIATOR 25) for interaction with MYCs (figure 1.3). The myc2 myc3 myc4 triple mutant was shown to be highly susceptible to Spodoptera littoralis feeding (Schweizer et al., 2013). JA-Ile binding to COI1 promotes ubiquitination of JAZ proteins and their subsequent degradation by proteolysis (Chini et al., 2007). Protein- protein interaction assays showed that the COI1-JAZ interaction is stimulated by JA-Ile but not by meJA or OPDA (Thines et al., 2007). Poly-ubiquitination of JAZ proteins has been indirectly observed using proteomic approaches (Nagels et al., 2016) and their proteasome- dependent degradation was demonstrated by the use of MG132 treatments that stabilized JAZ proteins (Thines et al., 2007). Interestingly, the expression of JAZ repressors is induced upon wounding and herbivory (Chung et al., 2008). More particularly, the JAZ10 gene is a well-described early marker for JA signaling in wounded leaves (Yan et al., 2007; Acosta & Farmer, 2010). The authors showed that this induction was correlated with the accumulation of JA and JA-Ile and moreover that it was dependent on COI1. Although most of JAZ proteins were shown to be rapidly degraded upon JA-Ile perception, some studies also showed a relative stability of some JAZ proteins following fluctuating JA-Ile levels (Chung et al., 2010). This negative feedback loop probably acts to restrain the duration and amplitude of JA-triggered responses. However, JA is also involved in a so-called positive feedback loop where it can stimulate its own synthesis by inducing MYC2-dependent expression of genes like LOX2, OPR3, AOS and AOC (Browse, 2009). The wound-induced expression of AOS and OPR3 was shown to be COI1-dependent (Devoto et al., 2005).

c. JA crosstalk with other stress related phytohormones

Plant pathogens are usually divided into biotrophs and necrotrophs based on their lifestyles. Biotrophic pathogens feed on living tissue whereas necrotrophs kill the host tissue

Characterization of a MAPK module involved in Arabidopsis response to wounding 22

and feed on dead residues. While it is generally admitted that JA has a role in defense against necrotrophic pathogens and herbivorous insects, SA rather activates resistance against biotrophic pathogens (Thomma et al., 1998). At first glance, SA and JA have antagonistic roles in plants as mutants impaired in one of them display enhanced expression of marker genes of the other (Kloek et al., 2001; Glazebrook, 2005). However, the reality is more complicated. For instance, the hemi-biotrophic bacteria Pseudomonas syringae induces both JA and SA signaling pathways in tomato (Stout et al., 1999). NPR1 was described as the receptor of SA. When SA levels increase, NPR1, which is present as a homodimer, is “monomerized” and goes to the nucleus where it can regulate the expression of specific genes. The JA/SA antagonism principally occurs at the transcriptional level where SA can suppress the induction of JA-dependent genes (Spoel et al., 2003; Caarls et al., 2015). The well-known JA marker gene PDF1.2 is under the control of several transcription factors among which ORA59 from the ERF family (Ethylene Responsive Factor) that is activated by ethylene (ET) and JA. ORA59 was shown to be degraded by SA thus blocking the expression of PDF1.2. This suppression of PDF1.2 expression still occurs in coi1-1 mutants showing that the SA/JA crosstalk is independent on COI1 and is likely to occur downstream. Moreover, redox signaling was shown to be important for SA-induced suppression of JA responses. High SA levels lead to a reduced redox state. Inhibition of glutathione synthesis, a reducing agent, blocked the SA-mediated antagonism of PDF1.2 expression. However, the results of JA and SA crosstalk can vary with hormone concentrations and the type of stimuli (Mur et al., 2006; Spoel et al., 2007). There are evidence of a JA/SA crosstalk in response to wounding. First, external application of aspirin and SA can block JA biosynthesis in wounded tomato leaves and thus inhibit the expression of some wound-induced genes (Peña-Cortés et al., 1993). Moreover, SA was shown to inhibit the JA-induced production of proteinase inhibitor (PI) in wounded tomato leaves (Doares et al., 1995). In addition, the SA-inducing pathogen Hyaloperonospora arabidopsidis was shown to strongly suppress JA-mediated defenses that are activated by caterpillars of Pieris rapae (Koornneef et al., 2008). Less is known about the effect of JA on SA. However, SA-mediated defense responses seem to be enhanced in JA mutants, as demonstrated in wounded tobacco leaves (Niki et al., 1998). Very recently, JA was shown to induce the expression of EDS5, a gene involved in SA biosynthesis, upon elicitation with flg22 (Mine et al., 2017). The same study showed that JA also represses the expression of

Characterization of a MAPK module involved in Arabidopsis response to wounding 23

ABA JA ET SA

MYC2 EIN3 ERF EIL1 ORA59

VSP2, LOX2 PDF1.2 PDF1.2

ORA59 = ERF family MYC ERF branch branch

Figure 1.4: Relationship of JA with other phytohormones JA acts in synergy with ABA for the activation of the MYC branch and with ET for the activation of the ERF branch. The antagonism of SA and JA occurs at the transcriptional level where SA inhibits the action of the ORA59 transcription factor from the ERF family thus inhibiting the expression of PDF1.2.

PAD4, a positive regulator of EDS5 expression. Overall, the study points out the complexity of immune signaling networks and hormonal crosstalks. In the context of herbivores, SA and JA were shown to mediate defense responses towards Spodoptera littoralis, the Egyptian cotton worm (Stotz et al., 2002). By analyzing coi1 and npr1 mutants in Arabidopsis, authors showed that SA and JA have opposite effects on plant. Moreover, exogenous application of SA was able to reduce JA amounts induced by the insect. Another study showed this inhibition of JA-induced resistance by SA in plants challenged by the herbivore Spodoptera exigua (Cipollini et al., 2004). Using a phloem- feeding insect (Bemicia tabaci) another study showed that Arabidopsis plants accumulate SA- responsive defense genes both locally and systemically (Zarate et al., 2006). On the contrary, JA-responsive genes were repressed or not affected by the insect challenge. Moreover, the insect development was boosted in plants constitutively activating SA defenses (cim10, for Constitutive IMmunity 10) and plants impaired in JA defenses (coi1). Finally a more recent study showed that different patterns of phytohormones production can be observable depending on the herbivore species (Diezel et al., 2009). JA-induced responses are usually described as being dependent on two different branches (figure 1.4). MYC2 is the master regulator of the MYC branch that is co-regulated by JA and abscisic acid (ABA) and leads to the activation of the downstream marker genes VSP2 and LOX2 (Lorenzo et al., 2004; Vos et al., 2013). The ERF branch is co-regulated by JA and ET and involves transcription factors of EIN3, EIL1, and ERF families such as ERF1 and ORA59. This branch activates the downstream marker gene PDF1.2 (Zhu et al., 2011). Like JA, ET and ABA generally antagonize SA responses. ET is produced in response to various stress conditions including herbivore attacks or mechanical injury and can modulate the expression of specific ET-regulated genes but also plant physiology (von Dahl & Baldwin, 2007). In Arabidopsis thaliana, the production of ET was observed during interaction with the lepidopteran Pieris rapea and the homopteran Myzus persicae (De Vos et al., 2005). Since then, several studies have elucidated the signaling pathway of ET from the sensing by its receptors to the downstream signaling components and the ethylene-responsive genes (Ju & Chang, 2015). ET can act both positively and negatively on the immune response. In the case of an attack by necrotrophic pathogens, ET acts in synergy with JA for the control of the signaling branch dependent on ERF transcription factors whereas it antagonizes the MYC-dependent branch. It can also affect SA responses.

Characterization of a MAPK module involved in Arabidopsis response to wounding 24

JAZ10 JA

JA

JAZ10

JA JA JA

JAZ10 JAZ10

Figure 1.5: JA and systemic signaling (Modified from Nature Protocols - Farmer lab) Wounding of a leaf leads to the production of JA and JA-Ile in distal leaves within a restricted area of the plant. Consequently, JAZ repressors are also degraded in distal leaves and transcriptional regulations can occur. For instance, JAZ10, a marker of JA signaling is found induced in distal leaves.

For example, when plants are treated with both ET and SA, the SA-induced expression of PR1 (Pathogenesis-Related 1) is strongly amplified (De Vos et al., 2006). On the other hand, ET-responsive transcription factors EIN3 and EIL1 were shown to repress the expression of SA biosynthesis gene SID2 leading to a reduced SA accumulation (Chen et al., 2009). Finally, ET also plays an important role in the JA/SA interaction as it was shown to be able to stop the SA-mediated suppression of JA responses (Leon-Reyes et al., 2010a). Indeed, when ET and JA are produced prior to SA, the antagonistic effect of SA is abolished. This event is no more observable when an inhibitor of ET is used, confirming its important role. ABA is the major drought and salt hormone. However, a production of ABA was observed in potato and tomato plants after wounding (Peña-Cortés et al., 1995). In Arabidopsis thaliana, ABA was shown to affect the expression of herbivore-induced genes and JA biosynthesis (Bodenhausen et al., 2007). ABA acts in synergy with JA to induce MYC2-dependent gene expression during wound responses (Anderson et al., 2004). It was also shown to affect JA-inducible defense responses in maize (Erb et al., 2009) and resistance to herbivores in tomato (Thaler et al., 2004). These data suggest that the regulation of ABA levels in response to herbivory or wounding can modulate JA-induced defense responses. Conversely, JA signaling can have a positive effect on ABA signaling by inducing genes, such as PYL4 and PYL5 that encode proteins of the ABA receptor family as it was observed in Arabidopsis and tobacco (Lackman et al., 2011). Plants mutated in those genes are more sensitive to JA-induced growth inhibition but less sensitive to JA-induced anthocyanin accumulation. Thus, JA-inducible responses depend on ABA and vice versa. In Arabidopsis, ABA and SA response mechanisms also affect each other at multiple levels from biosynthesis to signal transduction pathways (Yasuda et al., 2008).

6. Long-distance signaling

The events described above start locally at the wounding site but can spread systemically throughout the plant, the aim being to alert the rest of the plant of the imminent danger. The existence of a systemic signaling molecule was first reported in tomato in 1972 (Green & Ryan, 1972). JA and other members of the oxylipins family related to JA were shown to be crucial components of the systemic wound signal. Indeed, wounding of Arabidopsis leaves results in a rapid accumulation of JA-Ile in distal leaves (Koo et al., 2009) (figure 1.5). The events leading to jasmonate accumulation distal to wounds can be reduced

Characterization of a MAPK module involved in Arabidopsis response to wounding 25

to two principal mechanisms (Koo & Howe, 2009). One is the transport of jasmonate itself between cells or organs. Labeling experiments conducted in tobacco showed that meJA can move through xylem and phloem (Thorpe et al., 2007). Using jasmonate-specific antibodies, another study performed in tomato showed that jasmonates accumulate in the epidermis, the mesophyll and in parenchyma cells associated with the xylem and the phloem (Mielke et al., 2011). In all those cell types, the observation of JA accumulation was followed by the accumulation of JA-responsive transcripts, as observed by in situ hybridization. In Arabidopsis, several JA derivatives were also found enriched in the midveins of wounded leaves (Glauser et al., 2008). The wound signal is estimated to move at an average of 3.4 to 4.5 cm/min through the plant to stimulate JA accumulation in distal leaves (Glauser et al., 2009). Concerning JA- Ile a speed of less than 2 cm/min is reported for the wound-induced long-distance signal leading to its production in Arabidopsis. The first significant increase of JA in distal leaves was observed 2 minutes after wounding and JA-Ile appears 3 minutes later. Regarding JA- induced genes, JAZ7 is first observed 15 minutes after wounding in distal leaves. Levels of JA in leaves distal to a wounded leaf can exceed 200 pmol/g fresh mass (Glauser et al. 2008b, Glauser et al., 2009, Koo et al., 2009). Notably, accumulation of JA-Ile and JA-induced responses were shown to be quite transient in distal leaves compared to wounded leaves (Koo et al., 2009). For example, the wound-induced expression of JA-responsive genes decreases during a period when JA-Ile levels remain high (Koo et al., 2009). This observation suggests that injured leaves become less sensitive to the JA-Ile signal and that an efficient mechanism must operate to inactivate the signal. The second mechanism leading to JA accumulation in leaves distal to the wound is a rapid signal able to travel through the vasculature and to act over long distances, independently of jasmonate transport. We now know that wounding of a leaf can cause electrical activity and membrane depolarization in distal leaves. Electrical signals were first proposed to activate jasmonate synthesis in 1996 (Herde et al., 1996). In Arabidopsis leaves, the plasma membrane depolarization induced by wounding generates Wound-Activated Surface Potentials (WASPs) that move from the tips of leaves to their center and then to a restricted number of distal leaves (Mousavi et al., 2013). The existence of such signal was first postulated based on the observation that tomato wounded cotyledons generate an action potential in the neighboring unwounded leaves (Wildon et al., 1992). WASPs were also

Characterization of a MAPK module involved in Arabidopsis response to wounding 26

observed in potato (Herde et al., 1996) and avocado trees (Oyarce & Gurovich, 2011). WASPs can be transmitted to leaves from a restricted area of the plant that is consistent with the expression pattern of the JA marker gene JAZ10. GLUTAMATE RECEPTOR-LIKE (GLR) family members were shown to be required for this transmission. Indeed, two mutants of these ion channel proteins, glr3.3 and glr3.6, were deficient in electrical activity in the wounded leaf and showed reduced JAZ10 expression levels in distal leaves (Mousavi et al., 2013). Interestingly, these GLR-dependent systemic depolarization events were also triggered by caterpillar feeding (Salvador-Recatalà et al., 2014). It is notable that the fact that caterpillars and mechanical wounding can induce same changes in electrical activities suggests that insect-derived molecules are not required for this response. Electrical signals being able to activate JA synthesis and lead to the expression of JA-induced responses at the transcriptional level, they might be considered as wounding-induced “elicitors” independently of wounding-induced DAMPs or insect-derived HAMPs. However, the mechanism by which this electrical signal is perceived and lead to JA production is still not known, although the involvement of the RBOHD-dependent ROS production, that is known to transmit signal to distal leaves at a speed similar to WASPs (Miller et al., 2009) was excluded (Mousavi et al., 2013). This distal production of JA-Ile was shown to require the OPR3 and JAR1 enzymes in the unwounded leaves. Additionally, LOX6 was shown to be responsible for rapid jasmonate synthesis in tissues distal to wounds in Arabidopsis (Chauvin et al., 2013).

7. How to differentiate herbivory from mechanical wounding?

Oral secretions (OS) from feeding insects can contain small molecules able to act like elicitors and thus to activate plant immunity. Such molecules called Herbivore- Associated Molecular Patterns (HAMPs) likely allow the plant to distinguish between herbivory wounding and mechanical damage (Mithöfer et al., 2008). They are believed to act like DAMPs/PAMPs whose mechanism of recognition by plants has been largely described. Some studies have shown that herbivore-induced signals can influence wound-induced transcript and phytohormone levels (Reymond et al., 2000, 2004; Schmelz et al., 2009). Up to now, only few HAMPs have been identified and isolated. Among them, fatty acid-amino acid conjugates (FACs) are the best studied elicitors (Fürstenberg-Hägg et al., 2013). The fatty acid part comes from the plant whereas the amino acid part originates from insects and the whole is synthesized in insect midguts. The first characterized FAC is volicitin, identified in

Characterization of a MAPK module involved in Arabidopsis response to wounding 27

oral secretions of Spodoptera exigua (beet armyworm) (Alborn et al., 1997). Since then, FACs were found in oral secretions of many lepidopteran larvae such as Manduca sexta (Halitschke et al., 2001) that, together with tobacco (Nicotiana attenuata), constitutes the most studied plant-herbivore model. Application of volicitin on Zea Mays seedlings was able to trigger great volatile emission which is not observed upon wounding alone (Alborn et al., 1997). In Arabidopsis, application of oral secretions of grasshopper was shown to activate defense signaling pathways such as increase of calcium levels, MAPKs activation and hormone production (Schäfer et al., 2011). The molecular mechanism of HAMPs perception is still not known. However, volicitin is able to bind a plasma membrane protein from Zea Mays in a reversible and saturable way (Truitt et al., 2004). This suggests the existence of a FAC-specific receptor although none was identified so far. In addition to FACs, other elicitors are found in oral secretions such as inceptins or caeliferins. Inceptins, isolated from OS of Spodoptera frugiperda, are structurally comparable to flg22 and act like elicitors by triggering hormonal production and volatile emission (Schmelz et al., 2007). Caeliferins, isolated from regurgitate of the grasshopper Schistocerca Americana, are able to induce volatile compound emission in maize (Alborn et al., 2007). There is a huge diversity of plant perception of herbivore OS as highlighted by testing the responses of different plant species to various FACs (Schmelz et al., 2009). None of the elicitors is able to induce responses in all tested plant species and even closely related species do not respond the same way to a given elicitor. Interestingly, although insect OS contain elicitors able to trigger plant immunity, a recent study showed that application of OS on Arabidopsis leaves can also suppress defense responses (Consales et al., 2012). Thus, by conducting a transcriptomic analysis, authors found that several wound-induced genes expression was suppressed by the application of OS from Pieris brassicae and Spodoptera littoralis. This transcriptional regulation was consistent with an enhanced larval growth. However this inhibition of defense responses was not dependent on JA or SA pathways. In addition to oral secretions, plants are able to perceive the deposition of eggs by some herbivorous insects (oviposition) and activate direct and indirect defenses. Two substances in oviposition fluids are known to elicit defense responses: bruchins and benzyl cyanide (Wu et al., 2010). Besides HAMPs, plants are able to recognize herbivory by their specific feeding pattern. The use of a programmable mechanical device called Mecworm showed that

Characterization of a MAPK module involved in Arabidopsis response to wounding 28

continuous wounding of Lima bean leaves can produce the same bunch of volatiles than those induced by feeding of Spodoptera littoralis larvae (Mithöfer et al., 2005).

II. Wounding and herbivory feeding induce a large set of responses

Wounding of plant tissues is a very strong stress inducing a lot of defense responses from the plant. Such responses are very diverse and include altered plant growth (Agrawal et al., 2000), enhanced trichome formation (Yoshida et al., 2009), production of defense chemicals such as proteinase inhibitors or other proteins decreasing the performance of the feeding insect (Fürstenberg-Hägg et al., 2013). Interestingly, most of wounding-induced defense responses are controlled, at least in part, by JA and closer attention will be paid to those ones.

1. A great transcriptional reprogramming largely dependent on JA

Plants respond to mechanical wounding with the induction of numerous genes. The first wound-inducible defense genes and thus defense proteins were identified in tomato and potato and include proteinase inhibitors (Ryan, 1990; Graham et al., 1986). In Arabidopsis many genes were found induced by mechanical wounding and interestingly many of them are also induced by JA or OPDA (Reymond & Farmer, 1998). Studies aiming to identify more precisely genes specifically induced by wounding are not many. The most cited one reaches back to almost 20 years ago when, using a microarray technique, the expression of 150 selected defense-related genes in Arabidopsis leaves submitted to mechanical wounding was analyzed following kinetics up to 24 hours post-wounding (Reymond et al., 2000). 20 genes were already induced after 15 minutes, including pathogenesis-related genes (PR1, PR2 and PR5), some touch genes (TCH2, TCH3 and TCH4) and genes encoding MAPKs (MPK3 and MEKK1). The number of wounding-induced genes increased to 39 after 90 minutes to decrease again at later time points. Interestingly, looking at cluster of genes showing similar temporal expression, the authors identified genes involved in the biosynthesis of JA (LOX2 and AOS) as well as a JA-responsive gene JR3. Following the production of JA upon wounding, the authors observed a peak of accumulation at 2 hours post-wounding, coherently with the peak of expression observed for the JA-related genes. In order to understand the role

Characterization of a MAPK module involved in Arabidopsis response to wounding 29

of JA signaling in the expression of wound-induced genes, wild-type and coi1 plants were compared. 50 % of the wound-induced genes were no longer induced in coi1 plants. On the contrary, the expression of the other 50% of wound-induced genes was COI1-independent. JA is also an important mediator of defense responses toward herbivorous insects. Therefore the authors decided to compare defense responses triggered by mechanical wounding and herbivorous insects at the transcript level. For that purpose they used larvae of the cabbage butterfly Pieris rapae and compared its effect with mechanically wounded plants. Many transcripts were induced by both stresses but generally their expression level was higher upon mechanical wounding. Wounding and insect feeding led to different transcript patterns. Many genes were induced only by wounding but only a single gene was induced only by the insect. Moreover, between 67 and 84% of insect-induced genes were shown to be dependent on JA signaling (Reymond et al., 2004). These genes mainly encode proteins involved in JA biosynthesis, components of JA signaling pathway (transcription factors), defense-related genes, etc... Insect-induced genes dependent on COI1 were typical of biotic stress responses such as PR genes and were also induced by a treatment with meJA. On the other hand, insect- induced genes that were not dependent on COI1 were mainly related to abiotic stresses (senescence, salt) and were not induced by meJA. Moreover, expression patterns observed in distal leaves were quite similar to those observed in local leaves. In order to investigate the role of insect-specific factors on gene expression, oral secretions were applied to pre-wounded leaves. Some genes expression was enhanced but never at the level of their induction by insect feeding (Reymond et al., 2004). It is usually the case as mechanical wounding is not able to fully reproduce insect-induced responses such as the emission of volatile compounds or levels of JA production that are lower after mechanical wounding. Another following study conducted on Arabidopsis focused more particularly on genes differentially expressed at the wound site and in systemic parts of the plant (Delessert et al., 2004). A microarray containing 3500 cDNA clones was screened to enrich for genes regulated at the wound site 4 hours after the stress. Around 360 were then selected for further analysis following kinetics up to 17h post-wounding and also in response to hormonal treatments such as JA, ET and ABA. Interestingly, the genes identified at the wound site were also importantly regulated in distal sites. Coherently with the previous study, many of the systemically induced genes were also induced by JA and were mostly encoding transcription factors. On the other hand locally induced genes were mainly encoding metabolic proteins

Characterization of a MAPK module involved in Arabidopsis response to wounding 30

such as proteins involved in the biosynthesis of lignin. Interestingly, the authors showed that among the up-regulated genes, the majority were systemically induced whereas down- regulated genes were mostly local. Combined with temporal analyses the authors concluded that the establishment of systemic responses is prioritized by the plant whereas the local response is established later. Locally, photosynthetic and drought-related genes were found induced, respectively regulated by ET and ABA. Finally, more recently, genes encoding transcription factors were shown to be importantly regulated upon wounding (Kilian et al., 2007; Chen et al., 2013), among which members of the WRKY, ERF or Zinc finger families. At the end, all transcriptomic studies pointed out an important overlap between genes induced by wounding and those induced by other stresses, mainly drought and pathogens (Reymond et al., 2000; Cheong et al., 2002). An interesting study compared transcriptomes of Arabidopsis plants grown side by side under identical conditions but submitted to different stresses (including heat cold, salt, drought, wounding and UV-B light), following a time course (Kilian et al., 2007). Sample harvesting and RNA extraction were also performed in the exact same conditions. Overall, the study points out the existence of a common set of early-induced stress response genes, which mainly results from the fact that early signaling pathways are common to many stresses (Ca2+ signaling, ROS production, phosphorylation events and hormone accumulation). Conversely, specific genes are induced later and are rather tissue-specific.

2. Various defense responses

Many defense mechanisms were described to be induced after wounding and insect feeding. I will try to list and classify them and give some information about the cellular machinery involved in their activation. It is likely that many responses are largely determined by the huge wave of genome reprogramming under the control of the rapid JA production observed after wounding.

a. Modification of metabolism to produce toxic and volatile compounds

JA can regulate a wide range of wound-induced defense responses including the synthesis of toxic secondary metabolites, production of morphological structures and the control of plant growth. It was initially shown to induce the expression of proteinase inhibitor proteins, anti-digestive compounds, in tomato (Farmer & Ryan, 1992). Another example is

Characterization of a MAPK module involved in Arabidopsis response to wounding 31

the wound-induced production of nicotine, a toxic alkaloid, in tobacco (Nicotiana attenuata) that was shown to be dependent on meJA (Baldwin, 1998). The observed metabolic changes were shown to be under the control of a wide genetic reprogramming, as demonstrated by the analysis of Arabidopsis cell suspension cultures or seedlings elicited with JA (Pauwels et al., 2009). Among JA-induced metabolites are glucosinolates, anthocyanins, phenylpropanoids, isoprenoids… In addition to toxic compounds production, attacked plants emit volatile organic compounds (VOCs) in order to repel herbivores (direct defense) or to attract predators (indirect defense) (Kessler & Baldwin, 2001). The neighboring plants perceiving these volatile signals are also primed and can adapt in preparation for upcoming challenges (Engelberth et al., 2004). The herbivore-induced emission of VOCs has been well described in several plant species. They mainly include terpenoids, aromatic compounds, amino acid derivatives and most importantly green leaf volatiles (GLVs) which are products of the oxylipin pathway (Clavijo McCormick et al., 2012). VOCs are usually released within 24 h after attack (Dudareva et al., 2006). Different feeding strategies adopted by herbivores can lead to the synthesis of different volatiles. For example, leaf-eaters induce the emission of esters, monoterpenes and sesquiterpenes along with JA signaling, whereas piercing-sucking herbivores also induce SA-mediated pathways (Walling, 2000). Phytohormones can affect VOCs emission by activating enzymes (or the expression of corresponding genes) involved in volatile synthesis (Van Poecke et al., 2001). It is important to note that VOCs induced by wounding and herbivory largely differ both qualitatively and quantitatively. Exogenous application of JA was shown to induce the emission of VOCs and to increase the attraction of carnivore predators (Van Poecke & Dicke, 2004). Besides, inhibition of JA signaling inhibited volatile emission in tomato (Thaler et al., 2002). Insect feeding on one leaf can also trigger volatile emission in systemic leaves as observed in several species (Van Poecke & Dicke, 2004).

b. Development of physical barriers

Wounded plants were shown to develop more trichomes on new generated leaves to prevent further attacks (Yoshida et al., 2009). This increase of trichome density in newly formed leaves was abolished in mutants of JA biosynthetic or signaling pathway showing once again the involvement of JA in this wound-induced phenomenon. In addition to

Characterization of a MAPK module involved in Arabidopsis response to wounding 32

trichomes that function as physical barriers, plants can produce callose, lignin, suberin and other phenolic compounds that are often set up upon wounding. In Arabidopsis, the production of callose requires the callose synthase PMR4 (Jacobs et al., 2003) but no link with JA was described to date.

c. Resistance towards attacking organisms

The main organisms whose fitness is reduced by JA-dependent immunity are necrotrophic pathogens (such as Botrytis cinerea) and herbivores such as caterpillars, aphids, beetles, spider mites… Antisense expression of LOX3 in tobacco was shown to reduce wound-induced JA accumulation and to decrease defense responses towards herbivores (Halitschke et al., 2003). Numerous studies also showed that the defects of JA signaling in coi1 plants lead to increased susceptibility to herbivores. For example, Spodoptera littoralis larvae grow faster on coi1 Arabidopsis plants than on wild type ones (Stotz et al., 2002). In Arabidopsis, the role of JA has also been shown in resistance towards necrotrophic fungi such as Alternaria brassicicola and Botrytis cinerea but also towards the oomycete Pythium irregulare (Thomma et al., 1998; Staswick et al., 1998). The first study showed the susceptibility of coi1 mutants to necrotrophic fungi whereas the second one used different alleles of the jar1 mutant, unable to produce the bioactive form JA-Ile from JA. The involvement of JA in the mediation of defense responses was also shown against the nematode Meloidogyne graminicola in rice (Oryza sativa) using a JA biosynthesis mutant (Nahar et al., 2011). Overall, those studies suggest that JA is involved in defenses against herbivores and necrotrophic pathogens whereas biotrophic organisms yield to SA-dependent defenses. Wounding can also have a priming effect and protect plants from further attacks by pathogens. Thus, wounding was shown to induce a transient but strong resistance to B.cinerea (Chassot et al., 2008). This induced resistance was still occurring in mutants of JA, SA or ET signaling showing probable independence from these hormones or from the main hormonal signaling pathways. The same effect was observed after elicitation with OGs and was also independent from JA, SA and ET (Ferrari et al., 2007).

d. Growth inhibition

Plant growth is often limited by the availability of resources in the environment. Investment in defense mechanisms to fight the continuous threat of herbivorous insects slows down the photosynthetic capacity in leaves and absorption of nutrients and water by roots. In

Characterization of a MAPK module involved in Arabidopsis response to wounding 33

order to reduce the metabolic cost of defense mechanisms, plants use inducible defense strategies. Genetic studies have established an important role for JA in mediating tradeoffs between growth and defense (Havko et al., 2016). The expression of defense features in response to increased JA levels is followed by a strong growth inhibition. Several studies showed that exogenous application of JA or meJA leads to root growth inhibition (Staswick et al., 1992; Feys et al., 1994). The role of the core JA signaling module in the wounding- induced growth inhibition was shown using coi1, myc2 or jar1 mutants which growth was not inhibited by wounding (Zhang & Turner, 2008). More recently, a study showed the effect of JA on growth and photosynthetic efficiency in Arabidopsis by treatments with coronatine, an agonist of the JA receptor (Attaran et al., 2014). Coronatine rapidly stopped plant growth and this was correlated with the expression of genes involved in defense and the repression of genes involved in growth and photosynthesis. One reason for plants to inhibit their growth can be part of their defense strategy to limit food availability for herbivores (Havko et al., 2016). These regulations are concomitant with the activation of secondary metabolism and show the ability of JA to control tradeoffs between growth and defense by reallocating energy. Some studies showed the importance of hormonal crosstalks, especially between JA and gibberellin (GA), in this phenomenon. JAZ proteins, important actors of JA signaling, can also modulate growth responses through a direct interaction with DELLA proteins, which are repressors of the GA pathway. The production of GA leads to the degradation of DELLA proteins interacting with JAZ repressors, the consequences of which is an increased inhibition of MYC factors and thus of a greater repression of defense responses (Hou et al., 2010).

e. Post-wounding healing

Wound healing is an essential biological process to restore functions of damaged cells and surrounding tissues. Plants must restore tissue through cellular regeneration at the damaged site and tissue reorganization. Plant regeneration has mainly been studied in roots where auxin was shown to play an important role during communication between the repair site and other parts of the plant (Asahina et al., 2011; Xu et al., 2006). Auxin accumulates on the acropetal side of the wound while lower levels are found on the basipetal side. Extracellular ATP is known to strongly inhibit polar auxin transport (Tang et al., 2003). Therefore ATP released upon wounding could contribute to the auxin distribution at the

Characterization of a MAPK module involved in Arabidopsis response to wounding 34

Stress signal

MAP3K

P P S/TXXXXXS/T

MAP2K

P P TE/DY

MAPK

Phosphorylation of substrates in cytosol and nucleus

Appropriate response of the plant

Figure 1.6: MAPK cascades are key elements of the stress signal transduction in plants MAPK cascades can be activated upon the perception of a stress by the plant. They are composed of three levels of kinases activating each other by phosphorylation. The module usually starts with the activation of a MAP3K that phosphorylates a MAP2K on two serine and threonine residues following the consensus S/TxxxxxS/T motif. The activated MAP2K will then in turn activate a MAPK by phosphorylating threonine and tyrosine residues on TEY or TDY motif. At the end, MAPKs will be able to phosphorylate and regulate specific substrates in the cytosol or the nucleus such as enzymes or transcription factors. Those regulations will help the plant to trigger specific defense responses toward the perceived stress.

wound site. Besides, the addition of ATP induces the expression of genes involved in the biosynthesis of JA and ET (Choi et al., 2014) and the latter have been postulated to activate specific wound responsive genes that further promote wound healing (Asahina et al., 2011).

III. Mitogen-Activated Protein Kinase (MAPK) modules are key signaling actors of environmental perception

Among all cellular actors found in plants cells are kinases whose function is to phosphorylate and thus regulate specific substrates. Phosphorylation events are part of the most widespread post-translational modifications that proteins undergo. In Arabidopsis, 5% of the genome encodes protein kinases (The Arabidopsis Genome Initiative, 2000). Among them, nearly 10% are involved in MAPK signaling pathways. Coherently, a majority of cellular proteins are thought to be phosphorylated. Due to the rather large amount of articles published on MAPKs and their role in stress signal transduction, it is difficult to describe them exhaustively here. I decided to briefly present the most well established module involving the MAPKs 3, 4 and 6 and to focus on the state of art concerning the module that is at the heart of my project. Thereafter I present the current knowledge about the involvement of MAPKs in the context of wounding and/or herbivory. Presented data mostly come from studies carried out on Arabidopsis and tobacco.

1. MAPKs are important stress responsive modules in plants

a. MAPK modules are abundant in plant genomes

Mitogen-Activated Protein Kinases (MAPKs) are very well conserved proteins among all eukaryotes, from yeast to vertebrates. They were first described in mammals and are now largely studied in plants. They act in signaling cascades activated upon a stress perception, transducing environmental cues into intracellular responses (figure 1.6). The activation of the module commonly starts with a MAPK kinase kinase (MAP3K or MEKK) that phosphorylates and activates a MAPK kinase (MAP2K or MKK) which in turn phosphorylates and activates its downstream MAPK (MPK). MAP3Ks are serine/threonine kinases, thus their downstream MAP2K(s) is dually phosphorylated on serine and threonine residues following the consensus S/TXXXXXS/T motif in their activation loop. MAP2Ks are threonine/tyrosine kinases and phosphorylate their downstream MAPKs on TEY or TDY

Characterization of a MAPK module involved in Arabidopsis response to wounding 35

AtMPK3

A AtMPK6 AtMPK10

AtMPK4 AtMPK11 AtMPK12 B TEY Figure 1.7: 20 MAPKs in Arabidopsis AtMPK5 divided into 4 subgroups AtMPK13 In Arabidopsis, MAPKs can be divided AtMPK1 into 4 groups based on their sequence AtMPK2 C analogy. A, B and C groups contain TEY AtMPK7 phosphorylation motifs whereas members AtMPK14 of group D are phosphorylated on TDY AtMPK8 AtMPK15 motifs. AtMPK9 Serine-rich AtMPK17 region AtMPK16 D TDY AtMPK18 AtMPK19 AtMPK20

AtMKK1

AtMKK2 A

AtMKK6 NTF2 Figure 1.8: MKK3, the sole member of domain group B AtMKK3 B In Arabidopsis, MAP2Ks can be divided Kinase domain into 4 groups based on their sequence AtMKK4 analogy. MKK3 is the only representative C of group B and is defined by a specific AtMKK5 structure. Indeed, in addition to the well AtMKK7 conserved kinase domain, MKK3 possesses a C-terminal Nuclear Transport AtMKK8 D Factor 2 (NTF-2) domain. This domain is AtMKK9 very conserved among MKK3 AtMKK10 homologues found in other species.

Based on Ichimura et al., 2002

motifs of their activation loop (Jonak et al., 1994). Plant MAPKs share important sequence similarities with their homologues in animals and fungi (Ichimura et al., 2002). They are also found in a great amount of other plant species (rice, tobacco, grapevine …) thus indicating that MAPK cascades are much conserved among plants. In Arabidopsis thaliana, 20 genes encode MPKs that can be divided into 4 groups (A-D) based on sequence analogies. A, B and C groups are composed of MPKs whose activation loop contains a TEY motif whereas members of the group D possess a TDY motif (Ichimura et al., 2002) (figure 1.7). The 10 MAP2Ks of Arabidopsis are also divided into 4 subgroups (A-D) (figure 1.8). The fact that they are half as many as MAPKs suggests that a given MAP2K is likely to activate several MAPKs and moreover that MAP2Ks constitute the core of crosstalks between various signal transduction pathways. While MAPKs and MAP2Ks constitute quite homogeneous families, MAP3Ks form a more heterogeneous group in that its members show greater variability of primary structures and domains. The 80 MAP3K-like kinases found in Arabidopsis genome, defined by their similarities with animal MAP3Ks, cluster in 3 families named MEKK-like (20 members), Raf-like (48) and ZIK-like MAP3Ks (11). While there is lots of evidence that MEKK1-like members are indeed MAP2K activators, the last two have not been shown as such so far. The 20 MEKK-like MAP3Ks can further be divided into 3 sub-clades (figure 1.9). Finally, MAP4Ks (MAP3K kinases) can take action as a fourth level of kinases and thus act as adaptors linking upstream signaling elements to the MAPK cascades (Colcombet & Hirt, 2008). Interactions between MAPKs within a cascade can occur through docking sites that are present in the kinases or with the help of scaffolding proteins (Tanoue et al., 2000). Activation of MAPKs can be modulated by phosphatases and among the various ones found in Arabidopsis, the 5 genes composing the MKP (MAPK phosphatase) family seem to be good candidates to control the duration of signaling events or to shut-down the pathway after signaling.

b. The iconic stress-activated MPK3, 4 and 6 reflect the complexity of MAPK signaling

MAPKs have been extensively studied in the context of plant-pathogen interactions. They can be activated upon the perception of Pathogen-Associated Molecular Patterns (PAMPs), which are small molecules released from pathogens betraying their presence such as flg22, EF-Tu or chitin. Most studies on MAPKs use flg22, a 22-amino acid peptide coming from Pseudomonas syringae DC3000 flagellum (Felix et al., 1999). The recognition of the

Characterization of a MAPK module involved in Arabidopsis response to wounding 36

Interaction MAP3K Gene structure with MKK3

- MAP3K12 - MAP3K01 MAP3K02 -

Clade Clade I MAP3K06 n.d. MAP3K07 n.d. - MAP3K05 MAP3K03 - MAP3K04 - MAP3K11 n.d.

Clade Clade II MAP3K10 - MAP3K08 - MAP3K09 n.d. MAP3K13 -

MAP3K14 - MAP3K19 + N-terminal tail + MAP3K20 Kinase domain + MAP3K15 C-terminal tail Clade Clade III MAP3K16 Intron + MAP3K17 + MAP3K18 +

Figure 1.9: 20 MEKK-like MAP3Ks are divided into 3 clades (from Colcombet et al., 2016) In Arabidopsis, there are 20 MEKK-like MAP3Ks separated into 3 clades. Members of the clade III display a sequence specificity as they do not possess any intron unlike members of clades I and II.

A B C Pathogen Salt, cold ? ? PRR (FLS2) BAK1 MEKK1 ANP1/2/3 YODA NB-LRR ETS MEKK1 ? ? MKK6 MKK4/5 MKK2 MKK4/5 MKK4/5 ? MKK1/2 MPK4 MPK3/6 MPK4/6 MPK3/6 MPK3/6 MPK4 MPK4 Defense responses Proper Epidermal cytokinesis development

ETI PTI

Figure 1.10: PAMP-activated MAPK cascades illustrate the complexity of MAPK signaling A: MAPK modules activated by PAMPs such as flg22 lead to Pathogen-Triggered Immunity (PTI). Pathogens can inject effectors into the plant cells, that can be recognized by receptors from the NB- LRR family, leading to the activation of a MAPK module triggering the Effector-Triggered Immunity (ETI). B: A MAPK module responding to salt and cold. C: MAPK modules involved in the control of cell divisions and in the organization of epidermal cells.

latter by the Pattern Recognition Receptor (PRR) FLS2 in complex with BAK1 triggers a first level of response from the plant that is called the PAMP-triggered immunity (PTI). The study of MAPKs in the context of PAMPs recognition led to the identification of MPK3, MPK6 (group A) and MPK4 (group B) that are rapidly and transiently activated by PAMPs. Their activation occurs within a minute and peaks around 15 minutes later (Nühse et al., 2000, Zipfel et al., 2006). The entire modules have been identified and are composed of MKK4/MKK5 acting upstream MPK3/MPK6 (Asai et al., 2002) and MEKK1-MKK1/MKK2 upstream MPK4 (Suarez-Rodriguez et al., 2007, Gao et al., 2008). MPK11, another member of group B very closely related to MPK4, is also rapidly activated by flg22 but the upstream MAP3Ks/MAP2Ks have not been identified yet (Bethke et al., 2012) (figure 1.10A). During the course of their evolution, pathogens have acquired the ability to counteract PTI signaling by introducing effector proteins in plant cells, thus decreasing defense responses. Such effectors are very diverse and lead to the so-called Effector-Triggered Susceptibility (ETS) corresponding to the inability of plants to respond correctly to the pathogen and thus a hypersensitive state. However some plants have also developed intracellular receptors from the NB-LRR family (Nucleotide-Binding Leucine Rich Repeat) able to recognize pathogen effectors. The recognition of effectors by such receptors leads to the Effector-Triggered Immunity (ETI) (Jones & Dangl, 2006). One of the main features of ETI is the Hypersensitive Response (HR) which is characterized by a localized cell death inhibiting the expansion of the pathogens feeding on living cells. A recent study showed that the MKK4/5-MPK3/6 module involved in PTI was also involved in ETI signaling (Tsuda et al., 2013). The difference comes mainly from their activation kinetics: MAPKs activation is quite transient during PTI (about 1 hour) whereas they are activated from 3 to 10 hours after the expression of pathogen effectors in the plant. MAPKs are also involved in the transduction of defense responses to abiotic stresses such as cold, salt, drought, UV or ozone (Moustafa et al., 2014). Thus, for example, mkk2 plants have been shown to be less tolerant to salt and cold, suggesting a role for MKK2 and MKK2-related pathways in plant responses to salinity and temperature changes (figure 1.10B) (Teige et al., 2004). In addition to the transduction of stress signals, MAPKs were shown to be involved in developmental processes. Thus the MAP3Ks ANP1, 2 and 3 were shown to act in module with MKK6 and MPK4 in the control of cytokinesis in Arabidopsis (Kosetsu et al., 2010). In stomatal cells, the MAP3K YODA (YDA) was shown to be

Characterization of a MAPK module involved in Arabidopsis response to wounding 37

involved in stomatal patterning (Bergmann et al., 2004). Besides, evidence was provided that MKK4/5-MPK3/6 is the MAPK module acting downstream of YODA (Wang et al., 2007) (figure 1.10C). Signaling events involving MAPKs in plants are a good way to realize the complexity of cellular mechanisms involved throughout signaling processes. It also indicates that there are still many unresolved steps to have an exhaustive insight in those events. One of the biggest gaps in our knowledge is the identification of the steps linking the perception of PAMPs to MAP3Ks. Same MAPK modules being involved in different events, it is still unknown how functional specificity is maintained between those different processes. Finally, MAPK phosphorylation cascades lead to the regulation of diverse targets (enzymes, transcription factors…). In the case of the well-studied MPK3, 4 and 6, a large number of substrates have been identified (Popescu et al., 2009; Hoehenwarter et al., 2013). The diverse nature of identified targets reflects the range of cellular mechanisms that MAPK cascades can regulate.

c. MKK3 defines a new set of multi-stress-responsive MAPK modules

In this part, I will describe extensively what we know about MKK3-related modules as they largely became the topic of my PhD work. Despite having been described several decades ago (Shibata et al., 1995), our knowledge about this MAP2K and the related modules bloomed recently thanks, partly, to the work of the “Stress signaling” group, in which I realized my thesis and other groups which works are quoted thereafter. MKK3 is an atypical MAPK2 and the only member of sub-group B (Ichimura et al., 2002) (figure 1.8). Its sequence and secondary structure are rather different from the other MAP2Ks but are very well conserved among MKK3 homologues found in other species. A major specificity of MKK3 comes from the presence of an NTF2 (for Nuclear Transport Factor 2)-like domain at its C-terminal part. The role of this domain is still mysterious. As its name suggests, it could have a role in the localization or the shuttling of MKK3 to the nucleus. However other proteins possess NTF2 domains that have been shown to be involved in other processes. For example, the C-terminal NTF2 domain of the Ca2+/calmodulin dependent protein kinase II (CAMKII) was shown to be involved in its oligomerization (Morris & Török et al., 2001) or, in some bacteria, NTF2-like peptides have enzymatic activities (Sultana et al., 2004).

Characterization of a MAPK module involved in Arabidopsis response to wounding 38

A B C D Blue light Wounding JA Pst. DC3000 H2O2

Ca2+ MKK3 MKK3

MKK3 MKK3 CaM MKK3

MPK6

MPK8 MPK6 MPK1 MPK14 MPK2 MPK7 VSP2 PDF1.2

RBOHD JA-induced root growth MYC2 OXI1 inhibition

PR1

ROS homeostasis

(Doczi et al., 2007) (Takahashi et al., 2011) (Takahashi et al., 2007) (Sethi et al., 2014)

Figure 1.11: Biotic and abiotic stresses activating MKK3-dependent pathways A: MKK3 is involved in pathogen signaling. It is transcriptionally induced by P. syringae DC3000 and regulates pathogen-associated genes such as PR1. MKK3 interacts with and activates C-group

MAPKs in vitro. It was also shown to activate MPK7 upon H202. B: MPK8 is activated by wounding in an MKK3-dependent manner. This activation is also dependent on calcium. The module seems to play a role in ROS homeostasis by regulating the expression of RBOHD and OXI1. C: MKK3 acts upstream MPK6 in its activation by JA and controls the expression of PDF1.2 and VSP2. The MKK3-MPK6 module negatively regulates the root growth inhibition induced by JA. D: MKK3 acts upstream of MPK6 in its activation by blue light. The whole module controls the expression of the MYC2 gene.

Even though MKK3 has not been studied as much as other A or C group MAP2Ks (MKK1/2, MKK4/5), data are available in the literature about its potential role in stress responses. Dóczi et al., (2007) showed the role of MKK3 during plant-pathogen interaction (figure 1.11A). They found that mkk3-1 knock-out plants were hypersensitive to P.syringae DC3000 whereas lines expressing a constitutively active MKK3 (MKK3EE) showed a slight resistance to the bacteria. Yeast-2 hybrid studies showed a specificity of interaction between C-group MAPKs (MPK1, 2, 7 and 14) and the MAP2K MKK3 (Dóczi et al., 2007; Lee et al., 2008). Consistently, immunoprecipitation assays from Arabidopsis protoplasts showed an activation of MPK7 by H2O2 that was enhanced by the co-expression of MKK3. MPK1 and

MPK2 were also found activated by H2O2 in an independent study (Ortiz-Masia et al., 2007). Intriguingly, an MKK3-dependent module can also work upstream Reactive Oxygen Species (ROS), as it was shown in the context of wounding (Takahashi et al., 2011). In that study, MKK3 is proposed to work upstream MPK8, a group D MAPK which is activated by wounding in a calcium/calmodulin-dependent as well as an MKK3-dependent manner (figure 1.11B). Diaminobenzidine (DAB), an organic compound that turns brown in the presence of hydrogen peroxide, was used to reveal that plants over-expressing MPK8 are impaired in wounding-induced ROS production whereas plants mutated in MPK8 have trouble to restrict ROS production to the wounding site of the leaf, suggesting a negative role for MPK8 upstream ROS production. However it is difficult to conclude about the role of MKK3 as mkk3 plants have not been tested in their ability to still produce ROS upon wounding. MKK3 has also been claimed to act upstream MPK6 in two different contexts. A first study showed that the MKK3-MPK6 module has an important role in the JA-induced root growth inhibition in Arabidopsis (Takahashi et al., 2007) (figure 1.11C). MPK6 was rapidly activated by JA and this activation was impaired in mkk3 plants but not in mkk2 plants. However no mock control was shown to ensure this JA-induced activation of MPK6. mpk6 as well as mkk3 plants were slightly more sensitive to an exogenous application of JA as reflected by the slightly shorter size of their roots compared to wild-type plants. These plants also showed a reduced expression of the JA marker gene PDF1.2 and increased expression of VSP2. A second study showed the involvement of the MKK3-MPK6 module in blue light signaling (Sethi et al., 2014) (figure 1.11D). MPK6 is specifically activated by blue light but not by red light. This activation is lost in mkk3 as well as in myc2 mutant plants suggesting that MKK3 and MYC2 act upstream the blue light-induced activation of MPK6. Interestingly

Characterization of a MAPK module involved in Arabidopsis response to wounding 39

ABA

MAP3K17 MAP3K18 PYR/PYL

ABA core signaling PP2C module MKK3

SnRK

MPK1 MPK14 MPK2 MAP3K17 MPK7 MAP3K18

Drought responses

Figure 1.12: Identification of a complete MKK3-dependent module activated by ABA (Danquah et al., 2015) ABA can activate a module composed of MAP3K17 and 18, the MAP2K MKK3 and the MAPKs of group C, MPK1, 2, 7 and 14. The activation of the module requires a de novo synthesis of the two MAP3Ks. This MKK3-dependent module transduces the ABA signal to regulate drought responses.

the MKK3-MPK6 module was also shown to negatively regulate the expression of MYC2 which is a well-known actor of JA signaling. More recently, the role of MKK3 upstream C-group MAPKs was demonstrated by the group in which I performed my thesis, in the context of the major drought hormone ABA (Danquah et al., 2015). C-group MAPKs were found activated 4 hours after ABA treatment and this activation was lost in mkk3-1 plants. The authors were able to identify the MAP3Ks acting upstream MKK3 when plants were treated with ABA. Indeed, the ABA-induced activation of MKK3-MPK7 was lost in the map3k17 map3k18 double mutant. Interestingly the study revealed that the ABA-induced activation of C-group MAPKs requires the de novo synthesis of MAP3K17 and MAP3K18 (figure 1.12). This could explain the rather slow activation kinetics of the downstream MAPKs. However the involvement of this entire module in response to ABA was also shown in an independent study (Matsuoka et al., 2015) in which a rapid activation (15 minutes) of MAP3K18 by ABA was shown using lines expressing a tagged version of the kinase. That study also demonstrated the role of MAP3K18 in the regulation of leaf senescence. Another study provided evidence that MAP3K18 is induced and activated by ABA (Mitula et al., 2015). The role of MKK3 in ABA signaling was confirmed by phenotypical studies of plants mutated in MKK3. mkk3-1 plants were more sensitive to drought as reflected by their lower ability to restrict water loss after a long-term drought experiment (Danquah et al., 2015). MKK3 was linked to ABA signaling in other plant species. Thus tobacco plants overexpressing the cotton GhMKK3 were more resistant to drought and closed their stomata more efficiently in response to ABA (Wang et al., 2016). ABA is also a major hormone involved in the control of seed dormancy. In Arabidopsis, germination assays revealed a hypersensitivity of mkk3-1 seeds to ABA whereas MKK3EE seeds were insensitive. In barley, the identification of a recessive mutation for MKK3 revealed its role in breaking seed dormancy (Nakamura et al., 2016) and in wheat MKK3 was found to be a causal gene of seed dormancy (Torada et al., 2016). Additionally, one very recent study places MKK3 downstream of MAP3K20. Both map3k20 and mkk3 plants are defective in microtubule functions and the interaction of the two proteins was shown in vitro. Interestingly mpk18 plants show the same phenotype and seem to directly interact and to form a functional module with MAP3K20, without the need of an intermediate MAP2K (Benhamman et al., 2017). Finally, MKK3 and MPK1 were shown to have a role in auxin signaling as mkk3 and mpk1 plants were hypersensitive to auxin in cell expansion assays (Enders et al., 2017).

Characterization of a MAPK module involved in Arabidopsis response to wounding 40

To summarize, MKK3 has been studied in different stress contexts and in modules involving different MAPKs (figure 1.11). However, while three independent studies showed the interaction of MKK3 with MPK1, 2, 7 and 14 (Dóczi et al., 2007; Lee et al., 2008; Matsuoka et al., 2015), a direct interaction between MKK3 and MPK6 or MPK8 was never proven. Besides, in protoplasts MKK3EE could not activate MPK6 or MPK8 whereas C- group MAPKs were activated.

2. Spare data suggest a complex MAPK role in wounding and herbivory interaction

Intriguingly, MAPK activation in response to wounding was largely documented in species other than Arabidopsis. The first MAPK response to wounding was reported in alfalfa (Bögre et al., 1997). In this study, wounding induces a rapid activation of the alfalfa MMK4 that is shown to be due to a post-translational regulation as it is not blocked by the addition of α-amanitin or cycloheximide, two inhibitors of the transcription and translation steps respectively. In tobacco (Nicotiana attenuata), transcript levels and kinase activities of WIPK (for Wound-Induced Protein Kinase) and SIPK (for SA-Induced Protein Kinase), which are orthologs of Arabidopsis MPK3 and MPK6 respectively, increase rapidly upon wounding (after 1 min), in both local and systemic leaves (Seo et al., 1999). This activity is amplified when oral secretions from Manduca sexta larvae are applied in addition to the wounding (Wu et al., 2007). SIPK and WIPK are involved in the regulation of JA and SA levels in tobacco plants submitted to wounding or herbivory (Seo et al., 2007, Wu et al., 2007). Moreover, NaMEK2 was shown to be the potential MAP3K acting upstream SIPK and WIPK as it was required for the phosphorylation of the latter upon herbivory simulation (wounding + oral secretion). NaMEK2 was also shown to regulate wounding- and herbivory-induced JA and ET levels (Heinrich et al., 2011). Concerning JA, the regulation occurs at the level of enzymes involved in the early steps of its biosynthesis (Kallenbach et al., 2010). Very similarly in tomato (Solanum lycopersicum), LeMPK1 and LeMPK2, which are orthologs of SIPK, were activated by herbivory and their silencing led to the reduction of JA levels and the expression of JA biosynthesis genes (Kandoth et al., 2007). Tobacco MPK4 was also found activated by wounding and was shown to have an important role in the expression of JA- dependent genes (Gomi et al., 2005).

Characterization of a MAPK module involved in Arabidopsis response to wounding 41

In Arabidopsis, wounding was identified among various stresses activating MPK4 and MPK6 (Ichimura et al., 2000). More recently, MPK3 and MPK6 were shown to be involved in wounding-induced ET biosynthesis (Li et al., 2017) through the transcriptional regulation of ACS (1-aminocyclopropane-1-carboxylic acid synthase) genes. They were rapidly activated by wounding and their activation was strongly reduced in the mkk4 mkk5 double mutant, suggesting that MKK4 and MKK5 act upstream of MPK3 and MPK6 also in a wounding context. Coherently, a PP2C-type phosphatase that negatively regulates MPK4 and MPK6 was shown to modulate JA and ET levels upon wounding and have a role in defense responses against necrotrophic pathogens (Schweighofer et al., 2007). Besides, the MAP2K MKK3 was shown to work upstream MPK8 and to regulate Reactive Oxygen Species (ROS) homeostasis upon wounding (Takahashi et al., 2011). To date, no activation of MAPKs was shown in response to a direct insect attack. However, application of grasshopper oral secretion on Arabidopsis leaves triggered the activation of MPK3/MPK6 (Schäfer et al., 2011). In addition to wounding, DAMPs, ROS, as well as wounding-induced phytohormones are also able to activate MAPKs. Thus, a treatment with 1 µM of AtPeps is able to rapidly activate MPK3 and MPK6 (Bartels et al., 2013). Their activation by AtPeps requires the expression of both PEPR1 and PEPR2 as shown by the absence of activation in the pepr1 pepr2 double mutant. Pectin fragments and OGs are also able to activate MPK3 and MPK6 (Kohorn et al., 2009, Denoux et al., 2008), as well as a treatment with 100 µM ATP. MPK3 and MPK6 were not activated in dorn1-1 plants thus showing the involvement of DORN1 for the ATP-induced activation of MPK3 and MPK6 (Choi et al., 2014). In addition to the highly studied MAPKs 3, 4 and 6, MPK1 and MPK2 (group C) were found activated by wounding and JA in Arabidopsis thaliana (Ortiz-Masia et al., 2007). Altogether, these data suggest an important role for MAPKs in the transduction of the wounding signal and a likely role in the regulation of hormone biosynthesis and in particular of JA and SA.

Characterization of a MAPK module involved in Arabidopsis response to wounding 42

IV. Objectives of the PhD work: unveiling the function of MKK3 modules in wounding signaling

1. MAPKs and signal transduction before this work, a state of knowledge

As discussed earlier, many studies focused on the well-known MPK3, 4 and 6, pointing out the essential role of MAPKs, activated rapidly upon a stress perception, in signal transduction. This choice may be explained by the facts that those kinases are intrinsically strongly activated upon stresses and their activities are simple enough to monitor. In particular, “in gel” kinase assays are very efficient techniques for MPK3/4/6. Moreover, antibodies risen against the phosphorylated (=active) forms of the mammalian ERK2 is also able to recognize the phosphorylated form of Arabidopsis MPK3, 4 and 6, providing an easy way to screen for MAPK activation using western blots. Clearly, such tools created a bias in studies and drew the attention on small kinases that are highly expressed and show strong enzymatic activities at the expense of other kinases lacking such features. Some kinases have a larger size (therefore more difficult to refold in in-gel kinase assays) and are weakly expressed or less processive once activated, making their functional characterization difficult without the use of specific antibodies. Our knowledge is therefore reduced concerning other kinases from the different families that are found in plant genomes. Among the 4 sub-groups of MAPKs in Arabidopsis (A, B, C and D), not much is known about members of groups C and D, which are actually the largest ones. The “Stress Signaling” group is working on MAPK and CDPK modules. Its strategy largely consists in developing original tools to study the classical signaling modules defined by MPK3/4/6. For instance, in the past, the group has developed the Tandem Affinity Purification (TAP) system to identify putative interacting proteins to candidate kinases along with other phosphoproteomic approaches and the use of mutations triggering constitutively active MAPKs as a genetic tool in addition to the classical knock-out mutants. Another important objective of the group is to better understand the role of MAPKs other than the most studied MPK3, 4 and 6 in Arabidopsis. The study conducted in the laboratory on the MKK3 module activated by ABA is quite novel in that it deciphered a whole new MAPK module and demonstrated that some MAPK modules are under the control of transcriptional regulation and are therefore late responsive signaling pathways (Danquah et al., 2015;

Characterization of a MAPK module involved in Arabidopsis response to wounding 43

Boudsocq et al,. 2015). That rather slow activation suggests a regulation of late events that are quite difficult to apprehend.

2. Objectives: characterizing the activation of a MAPK module upon wounding stress

The objective of my PhD thesis was to further characterize MKK3-dependent modules. The role of such modules has been largely studied by the “Stress Signaling” group, as well as by other groups, in the context of its activation by ABA (Danquah et al. 2015; Matsuoka et al., 2015; Mitula et al., 2015). However we had arguments suggesting that MKK3-dependent modules could be activated by other cues and be involved in other processes. Firstly based on the numerous studies carried out on MPK3, 4 and 6, it is now well admitted that a given MAPK module can be solicited in different contexts and can thus be activated by different signals to mediate different responses depending on the context. More directly, an old study had shown the activation of MPK1 and MPK2, which at that time had not been associated with MKK3, by other stresses than ABA such as JA, H2O2 and wounding (Ortiz-Masia et al., 2007). Finally, based on Genevestigator data, we noticed that MAP3Ks belonging to the same group as MAP3K17/18 found upstream MKK3 in the ABA context were subjected to a high transcriptional regulation by diverse stresses. Such an observation suggests a shared regulation mechanism for MAP3Ks of that group. During the first year of my PhD I took advantage of the model plant Arabidopsis thaliana as well as biochemical tools developed in the “Stress Signaling” group to identify stresses able to activate some C-group MAPKs and in particular MPK2. Among the signals that gave a positive response were wounding and jasmonic acid (JA) thus confirming previous results obtained in other groups (Ortiz-Masia et al., 2007). MKK3 being expected to act upstream MPK2 and the other C-group MAPKs, I decided to further characterize MKK3- related modules in a context where plants are submitted to wounding. As the majority of studies dealing with wounding, I chose to apply a single (not continuous) mechanical wound by crushing Arabidopsis leaves with a forceps. Taking advantage of several MAPK mutants that were already present in our group as well as newly created lines, my first aim was to identify the complete module (including the MAP3K(s), MKK3 and the downstream MAPKs) that is activated by wounding. All the results that helped me to address that question are gathered in the two first parts of the chapter “Results & Discussions” (I and II). One of the

Characterization of a MAPK module involved in Arabidopsis response to wounding 44

major gaps in our knowledge in plant transduction events is the sequence in which they occur. Thus, it is not quite clear which components induced by wounding are responsible for the activation of MAPKs. Based on data collected in the literature and presented earlier in the introduction, I was able to test different hypotheses. The obtained results pointed out an important role for JA signaling and clarified our vision of signaling pathways induced by wounding; they are presented in the third part of the chapter “Results & Discussions” (III). Finally, after deciphering the signaling pathway leading to the activation of an MKK3-related module by wounding, I was interested in the role of such a module in the activation of defense responses that are induced by wounding. To address that question I mostly relied on plants knocked-out in the MKK3 gene since the latter can be considered as a hub for the modules we studied. In addition to testing the role of MKK3 in the transduction of defense responses to mechanical wounding, I had the chance to study MKK3-related modules in a more “natural” context with the help of colleagues as well as tools that were already set up in our institute. Indeed, as mentioned earlier, wounding is a way to mimic wounds caused by pathogens and particularly herbivorous insects. Thus, our collaboration with Axel Mithöfer from the Max Planck Institute in Jena (Germany) provided new insights on the role of MKK3 in plants attacked by the generalist herbivore Spodoptera littoralis. In addition, since JA turned out to have a key role in the activation of our module, I was also interested in the role of MKK3 in the context of an attack by a necrotrophic pathogen that is known to trigger JA-dependent defense responses. I chose to work with the necrotrophic fungus Botrytis cinerea as it was routinely used by my colleagues. The results obtained regarding the hunt of a role for MKK3- related modules are gathered in the two last parts of the chapter “Results & Discussions” (IV and V).

Characterization of a MAPK module involved in Arabidopsis response to wounding 45

MKK3 MKK3 - -

BD BD BD BD

AD-MAP3K01 AD-MAP3K02 AD-MAP3K03 AD-MAP3K04 AD-MAP3K05 AD-MAP3K08 AD-MAP3K10 AD-MAP3K12 AD-MAP3K13 AD-MAP3K14

AD-MAP3K15

AD-MAP3K16 clade IIIclade AD-MAP3K17 -

AD-MAP3K18 Sub AD-MAP3K19 AD-MAP3K20 AD

-L-W -L-W-H + 3-AT 60mM

Figure 2.1: MKK3 and sub-clade III MAP3Ks interact in yeast Yeast 2-hybrid experiment showing the interaction of MEKK-like MAP3Ks with MKK3. 16 of the 20 MEKK-like kinases of Arabidopsis and MKK3 were respectively fused to the activation domain (AD) and the DNA binding domain (BD) of a transcription factor allowing the growth of yeast on selective media. L: Leucine; W: Tryptophane; H: Histidine; 3-AT: 3-amino-1,2,4-triazole

CHAPTER II: RESULTS & DISCUSSIONS

I. Toward a general model for the activation of MKK3-related modules

Previous studies carried out in our laboratory identified a complete MKK3- dependent MAPK module activated by ABA. This module includes C-group MAPKs (MPK1, 2, 7 and 14) downstream of MKK3 and its activation requires the transcriptional regulation of MAP3K17 and 18, both sub-clade III MAP3Ks. From this observation, we wondered if those characteristics could be extended to all MKK3-dependent modules and built a model that led to the writing of a review (Colcombet et al., 2016).

1. Identification of MAP3Ks able to interact with MKK3 using the yeast 2-hybrid system In order to identify which MAP3Ks could interact with MKK3 and thus could potentially act as activators of MKK3-dependent modules, a pair-wise yeast 2-hybrid (Y2H) experiment using the collection of kinase ORFs available in the laboratory was carried out. This technique enables to test direct protein-protein interactions in vivo by taking advantage of the simplicity of Saccharomyces cerevisiae transformation and the rapid growth of the latter. It is based on the interaction-dependent reconstruction of a functional transcription factor that will allow the subsequent expression of reporter genes necessary for yeast growth on selective media. 16 of the 20 MEKK-like kinases of Arabidopsis and MKK3 were respectively fused to the activation domain (AD fusion) and the DNA binding domain (BD fusion) of the transcription factor and expressed in yeast cells. Yeast growth was observed only when AD-MKK3 construct was co-transformed with 6 of the tested BD-MEKK constructs (figure 2.1). Interestingly, these MAP3Ks all belong to the sub-clade III of the MEKK-like family (figure 1.9). This result suggests an interaction specificity of MKK3 with MAP3Ks belonging to the sub-clade III and that the latter could act upstream MKK3 to define functional modules in the context of their activation by environmental cues (Ichimura et al., 2002; Colcombet et al., 2016).

Characterization of a MAPK module involved in Arabidopsis response to wounding 46

A MAP3K - - - MKK3 - + EE - + - + - + - + - + - + - + MPK2 + + + + + + + + + + + + + + + + + Activity MPK2 (IP α-HA)

Western blot α-YFP (MAP3Ks)

Coomassie staining

Western blot α-Myc (MKK3)

Coomassie staining

Western blot α-HA (MPK2)

Coomassie staining

B MAP3K - - MKK3 - + + + + + + + + + + + MPK2 - + + + + + + + + + + + MG132 - - - + - + - + - + - + Activity MPK2 (IP α-HA)

Western blot α-YFP (MAP3Ks)

Coomassie staining

Figure 2.2: Sub-clade III MAP3Ks, MKK3 and MPK2 constitute a functional module in protoplasts Constructs containing the gene locus of sub-clade III MAP3Ks, MKK3 or MPK2 under a 35S promoter and a specific tag at their C-terminal end (YFP for the MAP3Ks, Myc for MKK3 and HA for MPK2) were created. MPK2-HA, MKK3-Myc and MAP3K-YFP were co-expressed in Arabidopsis mkk3-1 mesophyll protoplasts. Autoradiographs (above dotted lines) show MPK2 activity after immuno- precipitation with α-HA antibodies. Western blots (below dotted lines) show protein amounts of MAP3K-YFP, MKK3-Myc and MPK2-HA after incubation with respectively α-YFP, α-Myc and α-HA antibodies. Coomassie stainings of western blot membranes show total protein amounts of each sample. A: MAP3Ks-YFP and MPK2-HA were co-expressed in the presence or absence of MKK3-Myc. B: All partners were co-expressed in the presence or absence of MG132.

2. Functional validation of MAP3Ks using a transient expression system

The fact that some sub-clade III MAP3Ks and MKK3 interact in Y2H assays does not demonstrate their functionality as phosphorylation cascades in planta. In order to test whether it is indeed the case, I used the transient expression system of Arabidopsis mesophyll protoplasts (Yoo et al., 2007). Protoplast production and transformation is a rapid technique, commonly used in our laboratory to (co-)express proteins which then may be detected by western blot and tested for their activity after immuno-precipitation. This tool has been previously successful to characterize an MKK3-dependent module activated by ABA. It allowed demonstrating the functionality of the MAP3K18-MKK3-C-group MAPKs module in planta as well as the need for MAP3K18 production for MPK7 activation by ABA (Danquah et al., 2015). The ability of sub-clade III MAP3Ks to act upstream MKK3 in a functional module was tested by co-expressing the latter and testing the activity of downstream MAPKs. Several works identified MPK1, 2, 7 and 14, all members of the C-group MAPKs, as being the MAPKs acting downstream MKK3 (Doczi et al., 2007; Danquah et al., 2015). For technical reasons, MPK2 was used as a representative of C-group MAPKs. Plasmids containing gene ORFs of sub-clade III MAP3Ks, MKK3 and MPK2 under a 35S promoter and a specific tag at their C-terminal tail were created. MPK2-HA was co-expressed in mkk3-1 mesophyll protoplasts in combination with each sub-clade III MAP3K-YFP the in the absence or presence of MKK3-Myc. MPK2-HA was then immuno-precipitated using α-HA antibodies and its activity was assayed through the phosphorylation of Myelin Basic Protein (MBP). MPK2-HA showed a strong activity only when both MKK3-Myc and MAP3K-YFP were co- expressed (figure 2.2A). Western blot analyses using α-YFP, α-Myc or α-HA antibodies allowed me to check that the proteins were correctly and equally expressed in all conditions. Concerning MAP3Ks, only MAP3K16, 17, 18, 19 and 20 were detected on the western blots. The other MAP3Ks proteins were not detectable even though their co-transformation was sufficient to increase MPK2 activity. We first hypothesized a very rapid degradation/synthesis “turn-over” of the proteins. Some data in the literature discuss this aspect of MAP3Ks regulation. Thus PP2C phosphatase ABI1 was shown to control the proteasome-mediated degradation of MAP3K18 (Ludwikow et al., 2015). In that work MAP3K18 degradation was blocked by the proteasome inhibitor MG132. To test my hypothesis, I decided to also use

Characterization of a MAPK module involved in Arabidopsis response to wounding 47

100 90

80 70 60 50 40

inducing a strong a inducing 30 Number of treatments treatments of Number

transcriptional regulation transcriptional 20 10 0

Figure 2.3: Transcriptional regulation of MEKK-like MAP3Ks in Arabidopsis thaliana The graph shows the distribution of all MEKK-like MAP3Ks according to the number of stresses inducing a strong transcriptional regulation (fold-change > 3, P-value < 0.001). It was designed based on data obtained from Genevestigator. Sub-clade III MAP3Ks are highlighted in gray.

Kinase Conditions

MAP3K13 Inhibited during germination

MAP3K14 IAA, High light, NO3, drought , hypoxia

MAP3K15 PAMPs, ABA, salt

MAP3K16 Iron and sulfure deficiency, salt, auxin

MAP3K17 ABA, drought

MAP3K18 ABA, drought, high light, salt, Pst DC3000, MeJA

MAP3K19 Pst DC3000 + other pathogens

MAP3K20 Stratification

Table 2.1: Main conditions under which sub-clade III MAP3Ks expression are regulated.

MG132 and see if MAP3Ks were detectable on western blots. Actors of the module were co- expressed as described above, with the exception that MG132 or DMSO (as mock) was added in the expression medium along with transformed protoplasts (see “Materials & Methods for details). Consistently, MPK2-HA was activated when both MKK3-Myc and one of the MAP3K-YFP fusions were co-expressed, regardless of the presence of MG132. Looking at protein accumulation, I was only able to get a signal for MAP3K18 in absence and presence of MG132. The other MAP3Ks (13, 14, 15 and 16) were still not detectable even in presence of MG132 (figure2.2B). As no positive control for the action of MG132 was in our possession it is difficult to ensure that it was indeed “perceived” by the cells and therefore to conclude on the reason why some MAP3Ks proteins are not visible. Overall, these results suggest that sub-clade III MAP3Ks, MKK3 and MPK2 form a module that is functional in planta.

3. Sub-clade III MAP3Ks are strongly transcriptionally regulated by stresses

With the noticeable exception of MAP3K17 and MAP3K18, not much is known about sub-clade III MAP3Ks. Strikingly, the laboratory showed that the activation of MKK3- MPK7 by ABA and drought required the de novo synthesis of those two MAP3Ks. Consequently, MAP3K17 and MAP3K18 genes are strongly transcriptionally regulated by these signals (Danquah et al., 2015). Interestingly, two other members of sub-clade III, MAP3K13 and MAP3K14, were shown to be strongly induced upon nitrate (Marchive et al., 2013; Chardin et al., 2017) and the laboratory recently showed that C-group MAPKs are activated by nitrate (Schenk, Krapp & Colcombet, unpublished). These spare data suggest that a transcriptional regulation may be a conserved regulation feature of sub-clade III MAP3Ks and a way to activate MKK3-C-group MAPKs modules. To test this hypothesis, we took advantage of the Genevestigator database which gathers expression data from many transcriptional Affymetrix experiments (Zimmermann et al., 2004). This database helps finding out rapidly under which conditions one gene is expressed. We got useful information about transcriptional regulations of MEKK-like MAP3Ks that were indeed found to be regulated under a broad range of both biotic and abiotic stresses. Interestingly, sub-clade III MAP3Ks were found induced by the largest number of stresses (figure 2.3). For each MEKK- like MAP3K, the principal environmental perturbations responsible for their transcriptional

Characterization of a MAPK module involved in Arabidopsis response to wounding 48

MAP3K17 MAP3K13 MAP3K ?? MAP3K18 MAP3K14

MKK3

MPK1 MPK14 MPK2

MPK7

Figure 2.4: General model based on the conserved transcriptional regulation of sub-clade III MAP3Ks

Sub-clade III MAP3Ks, MKK3 and C-group MAPKs (MPK1, 2, 7 and 14) define a functional module activated by various stresses. The activation of the module starts with the transcriptional regulation of the upstream MAP3Ks.

regulation were identified and are summarized in table 2.1. In addition, we noticed that sub- clade III MAP3Ks were the ones showing the highest levels of transcriptional changes under the different perturbations, suggesting that they undergo more important regulations than the other MEKK-like MAP3K genes. These observations support our idea of a conserved transcriptional regulation of sub-clade III MAP3Ks upon diverse environmental cues and place those cues as potential activators of MAPK modules involving such MAP3Ks.

4. Discussion

Previous studies have shown that MKK3 forms a functional module with C-group MAPKs (MPK1, 2, 7 and 14). However, little data is provided about the potential upstream MAP3K(s). A previous study of the laboratory showed the role of MAP3Ks 17 and 18 upstream MKK3 in an ABA and drought context (Danquah et al., 2015). Another study showed the interaction of MAP3K20 with MKK3 in a Y2H screen (Benhamman et al., 2017). Interestingly, those three MAP3Ks belong to the sub-clade III and were found interacting with MKK3 along with three other MAP3Ks (15, 16 and 19) in our Y2H assay. The functionality of all members of sub-clade III as activators of MKK3 was then confirmed by transient expression in protoplasts. These include MAP3K13 and 14 which did not interact with MKK3 in Y2H. Looking closer to the structure of MAP3K13 and 14, we realized that transmembrane domains at their C-terminal tail were predicted by several software (Schwacke et al., 2003). This turned out to be a specificity of those two MAP3Ks. The presence of such a domain could explain the absence of interaction between MKK3 and MAP3K13 and 14 in yeast. To go further, previous data from the literature as well as our analysis of Genevestigator data pointed out a conserved transcriptional regulation of sub-clade III MAP3Ks by various stresses. Based on these observations, we propose a general model in which sub-clade III MAP3Ks, MKK3 and C-group MAPKs define functional modules activated by various stresses, one of the main characteristics being the transcriptional regulation of the upstream MAP3Ks (figure 2.4). We postulate that an MKK3-dependent module can be activated by various stresses and that different MAP3Ks are recruited depending on the perceived stress. This hypothetical model suggests that MKK3-dependent modules regulate a common set of responses shared by several activating stimuli which induce otherwise specific responses. In order to strengthen our model, we decided to study the activation of C-group MAPKs in a specific stress context, other than ABA and nitrate. In Arabidopsis, MPK1 and

Characterization of a MAPK module involved in Arabidopsis response to wounding 49

A

Time after wounding

0 5’ 15’ 30’ 1h 2h 4h

Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

B mpk1 Col-0 mpk2 Wounding - + - + + C Activity MPK2 Time after wounding (IP α-MPK2)

0 15’ 30’ 1h 2h (1h after wounding)

Col-0

Activity MPK2 mkk3-1 (IP α-MPK2)

mkk3-2

D

Wounding - + - + - + Activity MPK2 (IP α-MPK2)

(1h after wounding)

Figure 2.5: MPK2 is activated by wounding in an MKK3-dependent way Autoradiographs show MPK2 kinase activity through MBP phosphorylation after immuno- precipitation with specific antibodies from plants submitted to wounding. All protein levels were normalized by Bradford assay. A: Col-0 and mkk3-1 plants were wounded following kinetics from 0 to 4 hours. B: mpk1 mpk2 plants were used to confirm the identity of the observed signals. Plants were wounded and MPK2 activity was assayed 1 hour post-wounding. C: Col-0, mkk3-1 and mkk3-2 plants were wounded following kinetics from 0 to 2 hours. D: Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were used to confirm the role of MKK3. Plants were wounded and MPK2 activity was assayed 1 hour post-wounding. These experiments were performed at least 3 times (n>3) with identical results. MPK2 were shown to be activated by H2O2, JA and wounding (Ortiz-Masia et al., 2007). Two independent studies also showed their activation by ABA (Umezawa et al., 2013;

Danquah et al., 2015). As, H2O2, JA and ABA are all signaling molecules produced upon wounding, we decided to focus on the study of the MKK3-C-group MAPKs module in a context where plants are submitted to mechanical damage.

I. Identification and characterization of new MAPK modules activated by wounding

In this second part, I show results that led me to the identification of an almost complete MKK3-dependent MAPK module activated by wounding. The objectives were to (1) reproduce and characterize the activation of MPK1 and MPK2 by wounding which has been previously shown (Ortiz-Masia et al., 2007) and extend this information to other C-group MAPKs, (2) test whether MKK3 could act upstream those MAPKs as shown in the context of ABA and proposed in the first part of results and (3) identify the upstream MAP3K(s) to complete the module.

1. Wounding activates an MKK3 module in Arabidopsis thaliana

In order to confirm the results previously obtained by Ortiz-Masia and coworkers ((Ortiz-Masia et al., 2007), i.e. the activation of MPK2 by wounding, plants were wounded by squeezing their leaves with a forceps (3 leaves per plant) and wounded leaves were harvested at indicated time-points (see “Materials & Methods” for details). MPK2 was then immuno- precipitated using a specific antibody produced by collaborators (referred as α-MPK2) (Ortiz- Masia et al., 2007) and its activity was tested in a classical kinase assay using MBP as a heterologous substrate. I found that MPK2 was indeed activated by wounding in Col-0 plants. MPK2 is transiently activated from 30 minutes to 2 hours after wounding, showing a peak at 1 hour post-wounding (figure 2.5A – first line). The signal was lost in mpk1 mpk2 plants, showing that the observed activity is indeed specific of MPK2 (and MPK1) (figure 2.5B). According to my working model (described in the previous part), MKK3 should be the MAP2K acting upstream MPK1 and MPK2 in the context of an activation by wounding. In order to confirm this hypothesis, Col-0, mkk3-1 and mkk3-2 plants were wounded and MPK2 activity was assayed. Wounding-induced activation of MPK2 was completely lost in both mkk3 mutants (figures 2.5A and 5C). Finally we created mkk3-1 plants complemented with

Characterization of a MAPK module involved in Arabidopsis response to wounding 50

MPK1 MPK2 MPK7

0,2 0,2 0,2 Col0 Col0 Col0 0,15 mkk3-1 0,15 mkk3-1 0,15 mkk3-1 0,1 0,1 0,1 0,05 0,05 0,05 0 0 0

Relative transcript Relative level 0 15 30 120 Relative transcript Relative level Relative transcript Relative level 0 15 30 120 0 15 30 120 Time after wounding (min) Time after wounding (min) Time after wounding (min)

Figure 2.6: MPK1, MPK2 and MPK7 are not transcriptionally regulated by wounding MPK1, 2 and 7 expression levels were analyzed by RT-qPCR after total RNA extraction from Col-0 and mkk3-1 plants submitted to wounding. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once.

A MPK2-HA in Col-0 MPK2-HA in mkk3-1

Wounding 0 5’ 15’ 30’ 1h 2h 4h 0 5’ 15’ 30’ 1h 2h 4h Activity MPK2 (IP α-HA) Western blot α-HA Coomassie staining

B C MPK7-HA MPK7-HA MPK1-HA in Col-0 in Col-0 in mkk3-1

Wounding 0 30’ 1h 2h Wounding 0 30’ 1h 2h 0 30’ 1h 2h Activity MPK1 Activity MPK7 (IP α-HA) (IP α-HA) Western blot Western blot α-HA α-HA Coomassie staining Coomassie staining

Figure 2.7: MPK1, MPK2 and MPK7 are activated by wounding in an MKK3-dependent way Autoradiographs show MPK1, 2 and 7 kinase activities through MBP phosphorylation after immuno- precipitation with α-HA antibodies. Western blots after incubation with α-HA antibodies show MPK1, 2 and 7 protein amounts. Coomassie stainings of western blot membranes show total protein amounts of each sample. All protein levels were normalized by Bradford assay. A: Col-0 and mkk3-1 plants expressing MPK2-HA were wounded and leaves were harvested following kinetics up to 4 hours post-wounding. B: Col-0 plants expressing MPK1-HA were wounded and leaves were harvested following kinetics up to 2 hours post-wounding. C: Col-0 and mkk3-1 plants expressing MPK7-HA were wounded and leaves were harvested following kinetics up to 2 hours post-wounding.

the MKK3 locus fused to a Yellow Fluorescent Protein (YFP) in its C-terminal end (referred as mkk3/MKK3locus-YFP). MPK2 activation by wounding was restored in those plants (figure 2.5D) indicating that the increase of MPK2 activity upon wounding is dependent on the presence of MKK3. The quite slow activation of MPK2 in response to wounding is likely triggered by a direct phosphorylation of MPK2 by MKK3. Nevertheless an alternative hypothesis would be that wounding induces an MKK3-dependent transcriptional regulation of MPK2 gene triggering an increase of the corresponding protein amount. To exclude this possibility, I monitored the expression levels of MPK2 (as well as MPK1 and MPK7) in wounded Col-0 and mkk3-1 leaves by performing RT-qPCR analyses (figure 2.6). I found that MPK1, 2, and 7 expression levels were not affected by wounding during several hours and no striking difference was observed between Col-0 and mkk3-1 plants. This result suggests that the regulation of C-group MAPKs upon wounding occurs at a later stage. To go one step further, I wanted to monitor MAPKs protein levels upon wounding. As none of the specific antibodies available for MPK1, 2 and 7 in the laboratory functions in western blots, we generated Col-0 lines expressing versions of MPK1, 2 and 7 tagged in their carboxyl-terminal end with a HA epitope. Since endogenous loci were used (including around 2kb of promoter, exons and introns) we assume that the resulting MAPK-HA proteins are expressed at endogenous levels. The same tagged versions were also created in the mkk3-1 background for MPK2 and MPK7. For technical reasons, we did not succeed to produce the corresponding MPK14 line. The activity of MPK1, 2 and 7 was tested after IP with α-HA antibodies in those transgenic lines submitted to wounding. All three MAPKs were found to be activated 30 minutes to 2 hours after wounding, with a peak of activity at 1 hour (figure 2.7 – first lines). The kinetics was similar to the one of MPK2 immuno-precipitated from Col-0 plants using α-MPK2 antibodies. In the case of MPK2-HA and MPK7-HA lines, no signal could be observed in mkk3-1 background, confirming that their activation is dependent on MKK3. MAPKs protein amounts were analyzed by western blot after incubation with α-HA antibodies (figure 2.7 – second lines). MAPK amounts remained stable all along the time course and the proteins were already present at resting conditions (time 0, without wounding). Besides, protein levels were similar in Col-0 and mkk3-1 plants. Taken together, these results suggest that the MKK3-dependent increase of MAPKs activity observed upon wounding is not a consequence

Characterization of a MAPK module involved in Arabidopsis response to wounding 51

Time after touch

0 15’ 30’ 1h 2h

Col-0

Activity MPK2 (IP α-MPK2) mkk3-1

mkk3/MKK3locus-YFP

Figure 2.8: MPK2 is not activated by gentle touch Autoradiographs show MPK2 activity through MBP phosphorylation after IP α-MPK2 from Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants submitted to a gentle touch stress.

A Col-0 mkk3-1

Wounding 0 5’ 15’ 30’ 1h 2h 4h 0 5’ 15’ 30’ 1h 2h 4h Activity MPK2 (IP α-MPK2)

Western blot MPK6 α-pTpY MPK3

Coomassie staining

B C Col-0 mkk3-1 mkk3-2 Wounding 0 15’ 30’ 0 15’ 30’ 0 15’ 30’ MPK6 Western blot MPK3 Western blot MPK6 α-pTpY MPK3 α-pTpY

Coomassie Coomassie staining staining

Figure 2.9: MPK3 and MPK6 activation by wounding is not dependent on MKK3 Autoradiographs show MPK2 activity through MBP phosphorylation. Western blots after incubation with α-pTpY antibodies show MPK3/MPK6 phosphorylation. A: Col-0 and mkk3-1 plants were wounded following kinetics from 0 to 4 hours. B: Col-0, mkk3-1 and mkk3-2 plants were wounded following kinetics from 0 to 30 minutes. These experiments were repeated several times (n>3) with identical results. C: Col-0, mkk3-1, mpk3-1 and mpk6-2 plants were wounded. MPK3 and MPK6 phosphorylation was assayed 1 hour post-wounding.

of the modulation of protein levels but rather occurs at the post-translational level (phosphorylation). As mentioned in the introduction, mechanical stimuli can range from a gentle touch of the leaf surface to tissue breakage caused by environmental perturbations. Although early cellular events like membrane depolarization and ion fluxes seem to be common to every mechanical stimulus, release of cell wall fragments showing a DAMP activity should occur only when there is tissue damage. In order to discriminate between different levels of mechanical stimuli and know if the release of such molecules is necessary for the activation of our MAPK module, I decided to test the activity of MPK2 in plants submitted to gentle touch. For this purpose, leaves of Arabidopsis were bent 10 times back and forward and harvested following a time course. No activation of MPK2 was observed (figure 2.8). However, it would be necessary to ensure that the touch stress was indeed correctly perceived by the plant by testing, for instance, the activation of MPK3 and 6 that is known to happen upon a touch stress.

2. The wounding-induced activation of the iconic MPK3 and 6 is not dependent on MKK3

MKK3 and C-group MAPKs are obviously not the only MAPKs that are activated upon environmental stresses and more particularly upon wounding. Indeed, MPK3, 4 and 6 which are A/B-group MAPKs, are rapidly activated upon wounding of Arabidopsis leaves (Ichimura et al., 2000; Li et al., 2017). Based on these data I wondered if MPK3, 4 and 6 were activated by wounding in our laboratory conditions and moreover if they showed the same characteristics as C-group MAPKs (activation kinetics, dependence on MKK3). I therefore performed western blot analyses using an antibody raised against the pTEpY motif of MAPK activation loop (and referred as anti-pTpY). This TEY motif, which is largely conserved within MAPKs of groups A, B and C, is known to be phosphorylated by upstream MAP2Ks to activate MAPKs. Western blots were performed on soluble protein extracts from Col-0 and mkk3 plants submitted to wounding. Two bands (around 44 kDa and 42 kDa) appeared very rapidly upon wounding (from 5 to 30 minutes, with a peak at 15 minutes) (figure 2.9A – second line). Unlike MPK2 activity, the intensity of these two bands was unchanged in mkk3 loss-of-function mutants (figures 2.9A and 2.9B) indicating that the phosphorylation of the MAPKs corresponding to the observed signals is not dependent on

Characterization of a MAPK module involved in Arabidopsis response to wounding 52

Replicate 1 Replicate 2 Replicate 3

Wounding 0 15’ 1h 0 15’ 30’ 1h 0 15’ 30’ 1h

Col-0

mkk3-1 Activity MPK2 (IP α-MPK2) mpk3-1

mpk6-2

Figure 2.10: MPK3 and MPK6 have no effect on the activation of MPK2 by wounding Autoradiographs show MPK2 kinase activity through MBP phosphorylation in mpk3-1 and mpk6-2 plants submitted to wounding. Three biologically independent experiments were performed showing highly variable results. A MPK2-HA in Col-0 MPK2-HA in mkk3-1 Col-0 DMSO CHX DMSO CHX DMSO CHX

Wounding 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h Activity MPK2 (IP α-HA) Western blot α-HA Coomassie staining

B MPK1-HA in Col-0 MPK7-HA in Col-0 DMSO CHX DMSO CHX

Wounding 0 15’ 1h 0 15’ 1h Wounding 0 15’ 1h 0 15’ 1h Activity MPK1 Activity MPK7 (IP α-HA) (IP α-HA) Western blot Western blot α-HA α-HA Coomassie staining Coomassie staining

C mkk3/MKK3locus-YFP DMSO CHX

Wounding 0 15’ 1h 0 15’ 1h Activity MPK2 (IP α-MPK2) Western blot α-YFP

Coomassie staining

Figure 2.11: MPK1, MPK2 and MPK7 activation by wounding requires a de novo protein synthesis Autoradiographs (first lines) show MAPKs activity through MBP phosphorylation. Western blots (second lines) after incubation with specific antibodies show protein amounts. Coomassie stainings (third lines) of western blot membranes show total protein amounts of each sample. All protein levels were normalized by Bradford assay. A: Col-0 and mkk3-1 plants expressing MPK2-HA were pre-treated with DMSO (control) or 100 µM CHX and submitted to wounding. Col-0 plants expressing wild-type versions of MAPKs were used as control. MPK2 activity and protein amount are shown. B: Col-0 plants expressing MPK1-HA and MPK7-HA were treated with DMSO or CHX prior to wounding. MPK1 and MPK7 activities and protein levels are displayed. C: mkk3/MKK3locus-YFP plants were treated with DMSO or CHX prior to wounding. MPK2 activity and MKK3 protein amounts are depicted.

MKK3. Usually α-pTpY antibodies allow the detection of MPK3, 4 and 6 activations by stresses. According to the size of the observed signals, we assumed that they correspond to MPK3 and MPK6. To confirm that idea, western blot analyses were carried out on soluble protein extracts from mpk3-1 and mpk6-2 mutant plants subjected to wounding. The highest and lowest bands appearing upon wounding respectively disappeared in mpk6-2 and mpk3-1 backgrounds (figure 2.9C). I thus conclude that MPK3 and MPK6 are rapidly and transiently activated upon wounding, independently of MKK3. The activation of MPK3 and MPK6 precedes the one of C-group MAPKs. Therefore we wondered if those two events could be linked and if the activation of C-group MAPKs by wounding could depend on the previous activation of MPK3 and MPK6. To answer that question, MPK2 activity was tested in mpk3-1 and mpk6-2 plants submitted to wounding. This experiment was performed several times and led to highly heterogeneous results (figure 2.10). Overall, no major decrease of MPK2 activity was observed in those mutants suggesting that MPK3 and 6 do not have a role upstream the activation of MPK2 by wounding.

3. The hunt of upstream MAP3K(s)

a. The activation of C-group MAPKs by wounding requires a de novo protein synthesis

Ortiz-Masia and coworkers (2007) showed that MPK1 and MPK2 activation by wounding was lost when plants were pretreated with cycloheximide (CHX), a potent inhibitor of protein synthesis, suggesting that the activation of MPK1 and MPK2 by wounding requires a de novo protein synthesis. Their observation is consistent with our model where the activation of C-group MAPKs requires a transcriptional regulation of sub-clade III MAP3Ks. However, CHX could also have an effect on the synthesis of other important actors and in particular MAPKs or MKK3. To further investigate this idea I took advantage of the lines expressing HA-tagged versions of MPK1, 2 and 7 to monitor the corresponding protein levels upon wounding and CHX treatment. Col-0 and mkk3-1 plants expressing MPK2-HA were sprayed with 100 µM CHX or DMSO (mock) 1h30 before the beginning of the wounding experiment (see “Materials & Methods”) and wounded leaves were harvested at indicated time-points. MPK2-HA was activated 1 hour after wounding when plants were treated with DMSO (figure 2.11A – first line). This activation was lost in plants treated with CHX. In the mkk3-1 background, activation of MPK2-HA was observed neither with DMSO nor after

Characterization of a MAPK module involved in Arabidopsis response to wounding 53

A Col-0 mkk3-1 mkk3/MKK3locus-YFP

DMSO CHX DMSO CHX DMSO CHX

Wounding 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h Western blot α-pTpY Coomassie staining

B Col-0 Col-0

DMSO CHX DMSO CHX

Wounding 0 15’ 1h 0 15’ 1h Wounding 0 15’ 1h 0 15’ 1h Activity MPK3 Activity MPK6 (IP α-MPK3) (IP α-MPK6)

Western blot Western blot α-MPK3 α-MPK6 MPK6

Figure 2.12: CHX induces a constitutive activation of MPK3 and MPK6 Plants were pre-sprayed (1h30 before wounding) with DMSO (control) or 100 µM CHX. They were then wounded following kinetics from 0 to 1 hour. A: Western blots after incubation with α-pTpY antibodies show MPK3 and MPK6 phosphorylation in Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants. B: Autoradiographs show MPK3 and MPK6 kinase activity after immuno-precipitation with respectively α-MPK3 and α-MPK6 antibodies from Col-0 plants. Western blots after incubation with α-MPK3 and α-MPK6 antibodies show MPK3 and MPK6 protein amounts in Col-0 plants. Coomassie stainingS of western blot membranes show total protein amounts of each sample. All protein levels were normalized by Bradford assay.

CHX treatment (figure 2.11A – first line). MPK2 protein amount was monitored by western blot analysis using α-HA antibodies. The level was unchanged by the CHX treatment (figure 2.11A – second line). CHX inhibits the activation of MPK2 but does not affect MPK2 protein levels. Col-0 plants expressing MPK1-HA and MPK7-HA were also used. The results were identical to those found with MPK2 (figure 2.11B). Their activity was lost after CHX treatment but the corresponding protein levels were not impaired. Therefore, I concluded that the activation of MPK1, 2 and 7 by wounding requires the de novo synthesis of a protein other than MAPKs themselves. To test whether this phenomenon occurs at the level of MKK3, the same experiment was carried out with mkk3/MKK3locus-YFP plants. MPK2 activity was measured after IP with α-MPK2 antibodies. In the absence of CHX, MPK2 was activated by wounding whereas this activity was lost after CHX treatment (figure 2.11C). MKK3 protein amount was followed by western blot using α-YFP antibodies. The level was unchanged all along the wounding kinetics and was not impacted by the CHX treatment. This result confirms the necessity of a translational event for MPK2 activation by wounding and shows that this regulation does not occur at the level of MKK3. To test whether this protein synthesis step was also important for the wounding dependent activation of MPK3 and 6, the effect of CHX was tested on the previously observed activation of MPK3 and MPK6 by wounding. When plants were sprayed with DMSO, MPK3 and MPK6 were found phosphorylated 15 minutes after wounding, as previously described (figure 2.12A). After treatment with CHX, MPK3 and MPK6 were found phosphorylated equally at all tested time-points including when the plants were not wounded. To confirm that these MAPKs are indeed activated, I tested their activity by classical kinase assay on MBP after IP with α-MPK3 and α-MPK6 antibodies. I thus confirmed that MPK3 and MPK6 are activated 15 minutes after wounding or by CHX (figure 2.12B – first lines). Finally I was able to show that MPK3 and MPK6 protein levels were unchanged upon wounding and were not impacted by CHX (figure 2.12B – second lines). In conclusion, the effect of CHX on MPK3 and MPK6 activity was quite different from its effect on MPK1, 2 and 7. Indeed, while CHX completely inhibited the activity of the latter, it led to a constitutive phosphorylation of MPK3 and MPK6, regardless of wounding. These results suggest that in resting conditions, some negative regulator(s) (such as phosphatases) whose synthesis is continuously occurring (rapid turn-over), maintain(s) MPK3 and MPK6 in an inactive state until the perception of an environmental disturbance.

Characterization of a MAPK module involved in Arabidopsis response to wounding 54

1 0,9 MAP3K14 MAP3K18 0,8 MAP3K17 0,7 MAP3K15 0,6 MAP3K19 0,5 MAP3K13 0,4 MAP3K16 MAP3K20 0,3 0,2

Relative Relative transcriptlevel 0,1 0 0 5 15 30 60 120 240 Time after wounding (minutes)

Figure 2.13: Expression of sub-clade III MAP3Ks upon wounding MAP3Ks expression levels were measured in Col-0 plants submitted to wounding by RT-qPCR using specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. This result shows an average of three biologically independent experiments (n=3).

Time after wounding A 0 15’ 30’ 1h 2h 4h

70kDa MAP3K18-YFP Western blot α-YFP 35kDa

Coomassie staining

B

Wounding - + - + - + - + - + - + - +

70 kDa Western blot α-YFP 35 kDa 25 kDa

Coomassie staining

Figure 2.14: Sub-clade III MAP3Ks protein accumulation upon wounding Plants expressing YFP-tagged versions of MAP3Ks were wounded following kinetics. Western blots show MAP3Ks protein accumulation after incubation with α-YFP antibodies. A: MAP3K18locus-YFP plants were wou nded following kinetics up to 4 hours post-wounding. B: Sub-clade III MAP3Klocus-YFP plants were wounded and leaves were harvested 2 hours later.

b. Several MAP3K genes are transcriptionally induced upon wounding

To complete the MKK3-dependent module activated by wounding, we wanted to identify the MAP3K(s) acting upstream, our candidates being sub-clade III MAP3Ks (MAP3K13 to 20). According to our model, the activation of the MAPK module requires the transcriptional regulation of upstream MAP3Ks. As a first step, toward the identification of the latter, I investigated the expression of sub-clade III MAP3Ks in Col-0 plants submitted to wounding. On that purpose RT-qPCR analyses were performed and the results are shown in figure 2.13. MAP3K14 was found induced from 5 minutes after wounding displaying a peak of expression at 30 minutes post-wounding. MAP3K15, 17, 18 and 19 were also induced later, from 30 minutes after wounding, showing a peak at 1h (MAP3K15 and 19) and at 2h (MAP3K17 and 18) after wounding. Based on the expression profiles of the candidate MAP3Ks, I postulate that MAP3K14 has a good potential to act upstream our MAPK module at the early time-points of its activation by wounding. MAP3K15, 17, 18 and 19 could also have a role upstream MKK3 and C-group MAPKs but at later time-points. To test whether the MAP3K proteins also accumulate in response to wounding, we completed our collection of MAP3K tagged lines. MAP3K loci, including their endogenous promoter, were fused to YFP at their 3’ end, thus leading to the production of a MAP3Klocus- YFP protein, where the YFP is tagged at the C-terminal end of the protein. MAP3K18locus- YFP line had been created previously and successfully used in the context of ABA (Danquah et al., 2015). To note, the MAP3K18locus-YFP construct includes the endogenous terminator of MAP3K18 whereas the Tnos terminator was used for all the other MAP3Klocus-YFP lines. Plants were wounded and proteins were analyzed by western blots using α-YFP antibodies. Unfortunately, none of the MAP3K-YFP proteins was detectable, except MAP3K18-YFP which appeared 2 hours after the wounding and was still present at 4 hours post-wounding (figure 2.14A and B). This result was consistent with the corresponding MAP3K18 gene expression kinetics. As MAP3K18 protein production was induced by ABA (Danquah et al. 2015) and wounding, we next wondered if their cellular localization was the same upon those two stresses. To study the localization of the protein we took again advantage of the map3k17/18 MAP3K18locus-YFP line. 10 day-old Arabidopsis plantlets were treated with 25 µM ABA or wounded with a needle and leaves were observed 4 hours post-stress under a confocal microscope. After ABA treatment, MAP3K18-YFP expression was observed in guard cells whereas after wounding the protein was detected in epidermal cells (figure 2.15).

Characterization of a MAPK module involved in Arabidopsis response to wounding 55

A YFP Merge

Mock

ABA 25 µM

50 µm

B YFP Merge

Unwounded cotyledons from the same plantlet

Wounded area Wounded cotyledons after 4 hours 200 µm

Figure 2.15: Subcellular localization of MAP3K18-YFP upon ABA and wounding Cotyledons of map3k17/18 MAP3K18locus-YFP plantlets treated with ABA or wounding were observed under a confocal microscope. A: Plantlets were treated with 25 µM ABA and observation was made 4 hours after treatment. B: Cotyledons were wounded with a needle and observation was made 4 hours post-wounding. MPK2 activity Mutant Number of repetition Reproducibility (compared to Col-0) map3k13 3 X NO map3k14-1 4 Increased YES map3k15 2 X NO map3k16 map3k17 3 X NO map3k18 map3k19 3 X NO

Table 2.2: Testing the wounding-induced activation of MPK2 in map3k mutants led to variable results For each mutant background, the table shows the number of experiments performed (testing MPK2 activity upon wounding) and whether the results were reproducible or not.

Time after wounding 0 15’ 30’ 1h 2h 4h

Col-0 Activity MPK2 (IP α-MPK2) map3k14-1

Figure 2.16: MPK2 activity upon wounding is increased in map3k14-1 plants compared to Col-0 Autoradiographs show MPK2 activity through MBP phosphorylation. Col-0 and map3k14-1 plants were wounded and leaves were harvested following a time course. This experiment was performed 4 times (n=4) with similar results.

Col-0 map3k14-1

0 15’ 30’ 1h 0 15’ 30’ 1h

Western blot MPK6 MPK3 α-pTpY

Coomassie staining

Figure 2.17: MPK3 and MPK6 activity upon wounding is unchanged in map3k14-1 plants Western blot after incubation with α-pTpY antibodies shows MPK3 and MPK6 phosphorylation upon wounding in Col-0 and map3k14-1 plants. Coomassie staining shows total protein amount. All protein levels were normalized by Bradford assay.

MAP3K13 MAP3K14 0,5 4 Col0 Col0 0,4 map3k14-1 3 map3k14-1 0,3 2 0,2 0,1 1 0 0 Relative Relative transcriptlevel 0 5 15 30 60 120 240 Relative transcriptlevel 0 5 15 30 60 120 240 Time after wounding (min) Time after wounding (min)

MAP3K15 MAP3K16 0,5 0,5 Col0 Col0 0,4 0,4 map3k14-1 map3k14-1 0,3 0,3 0,2 0,2 0,1 0,1 0 0 Relative Relative transcriptlevel 0 5 15 30 60 120 240 Relative transcriptlevel 0 5 15 30 60 120 240 Time after wounding (min) Time after wounding (min)

MAP3K17 MAP3K18 0,5 0,5 Col0 Col0 0,4 0,4 map3k14-1 map3k14-1 0,3 0,3 0,2 0,2 0,1 0,1 0 0 Relative Relative transcriptlevel Relative Relative transcriptlevel 0 5 15 30 60 120 240 0 5 15 30 60 120 240 Time after wounding (min) Time after wounding (min)

MAP3K19 MAP3K20 0,5 0,5 Col0 Col0 0,4 0,4 map3k14-1 map3k14-1 0,3 0,3 0,2 0,2 0,1 0,1 0 0 Relative Relative transcriptlevel Relative Relative transcriptlevel 0 5 15 30 60 120 240 0 5 15 30 60 120 240 Time after wounding (min) Time after wounding (min)

Figure 2.18: Some MAP3Ks expression is increased in map3k14-1 plants Col-0 and map3k14-1 plants were wounded following a kinetics. Total RNAs were extracted. Sub- clade III MAP3Ks expression was analyzed by RT-qPCR using specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once (n=1).

c. Plants expressing mutant versions of MAP3K14 show different levels of MPK2 activity compared to Col-0 plants

After having identified which MAP3Ks were induced by wounding, I wanted to identify which of them act(s) upstream MKK3-C-group MAPKs using a genetic approach. In this purpose, I used map3k mutant plants impaired in the expression of sub-clade III MAP3Ks and looked if MPK2 was still activated by wounding in those plants. To prove that one of our candidate MAP3Ks acts upstream MKK3-MPK2, we expected MPK2 activity to be decreased or totally abolished in the corresponding map3k mutant background(s). I took advantage of lines that were already available in our group. Mutant lines had been ordered through the SIGnAL database and all lines were carrying a T-DNA insertion. The insertion was in the region encoding the kinase domain of MAP3K16 and MAP3K18. Concerning all the others, the insertion was located on the C-terminal part of the gene, after the kinase domain. The intensity of MPK2 activity in tested mutants was compared to the one observed in Col-0 plants. This experiment was repeated several times on biologically independent replicates, giving highly heterogeneous results that are summarized in table 2.2. Interestingly, wounding-induced activation of MPK2 was increased in the map3k14-1 background whereas the opposite effect would have been expected if MAP3K14 acts positively upstream of our module of interest (figure 2.16). I was also interested in the activation of MPK3 and MPK6 in map3k14-1 plants after wounding. Comparing Col-0 and map3k14-1 plants, both MPK3 and MPK6 activation was unchanged in both genetic backgrounds (figure 2.17). However I could observe the appearance of some bands below MPK3. We hypothesize that these bands very likely correspond to MPK2 and other C-group MAPKs which would be consistent with the increase of MPK2 activity observed in the map3k14-1 background. It was curious to see a decrease of MPK2 activity in the map3k14-1 mutant background. Therefore I wondered if this could be due to an up-regulation of other members of sub-clade III to compensate the absence of MAP3K14. To test this hypothesis, I performed RT-qPCR analyses on material from Col-0 and map3k14-1 plants submitted to wounding. Among all MAP3Ks that are induced upon wounding, MAP3K17 is the only one which expression was unchanged in map3k14-1 plants. Indeed, MAP3Ks 15, 18 and 19 expression was higher in map3k14-1 plants compared to Col-0 (figure 2.18). This experiment was performed only once but could suggest a compensation of the mutation of MAP3K14 by the over-expression of other sub-clade III MAP3Ks. Surprisingly, MAP3K14 expression was also

Characterization of a MAPK module involved in Arabidopsis response to wounding 56

B MAP3K - - -

MKK3 - - + - + - + - +

MPK2 - + + + + + + + + map3k14-1 A (GABI 653801) Activity MPK2 (IP α-HA) 0 Kinase 1392 MAP3K14 domain Western blot α-YFP (At2g30040) (49-910 bp) (MAP3KS) Western blot α-Myc (MKK3) Western blot α-HA (MPK2) Coomassie staining

Figure 2.19: Truncated MAP3K14 is functional in planta and leads to a more stable protein A: Schematic representation of MAP3K14 locus including the position of the T-DNA insertion. The latter is inserted after the region coding for the kinase domain of the MAP3K14 protein. B: Constructs containing the gene locus of one MAP3K (14, 14-1 or 18), MKK3 or MPK2 under a 35S promoter and a specific tag at their C-terminal end (YFP for the MAP3Ks, Myc for MKK3 and HA for MPK2) were created. MPK2-HA, MKK3-Myc and MAP3K-YFP were co-expressed in Arabidopsis mkk3-1 mesophyll protoplasts. Autoradiographs (above dotted lines) show MPK2 activity after immuno- precipitation with HA-specific antibodies. Western blots (below dotted lines) show protein amounts of MAP3Ks, MKK3 and MPK2 after incubation with respectively α-YFP, α-Myc and α-HA antibodies. Coomassie stainings of western blot membranes show total protein amounts of each sample.

Time after wounding Time after wounding Time after wounding

0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h

Col-0

Activity MPK2 (IP α-MPK2) map3k14 -CR1

map3k14-CR2

(Replicate 1) (Replicate 2) (Replicate 3)

Figure 2.20: MPK2 activity upon wounding is unchanged in CRISPR map3k14 plants compared to Col-0 Autoradiographs show MPK2 activity through MBP phosphorylation. Col-0 and two independent CRISPR-constructed map3k14 lines were wounded and leaves were harvested following a time course from 0 to 4 hours. Results from three biologically independent experiments are displayed.

higher in map3k14-1 plants. Studying more carefully the localization of the T-DNA insertion in the MAP3K14 locus, we realized that the mutant could still allow the production of a truncated protein including its whole kinase domain and a part of its C-terminal end (figure 2.19A). To test whether truncated MAP3K14 was able to activate the downstream kinases MKK3 and MPK2, I took advantage of the protoplast expression system. We created a vector containing the coding sequence predicted to be expressed and transcribed in the map3k14-1 mutant (named MAP3K14-1) fused to YFP in it C-terminal tail. When MAP3K14-1-YFP was co-expressed with MKK3-Myc and MPK2-HA in mkk3-1 protoplasts, I observed the activation of MPK2 (figure 2.19B - above dotted line). Interestingly, the truncated MAP3K14-1 protein was detectable whereas the wild-type MAP3K14 protein was still not as previously stated (figure 2.19B - below dotted line). This result goes in the direction of our hypothesis supporting the idea of a higher stability for the truncated form of MAP3K14 that is expressed in the map3k14-1 line and is responsible for an increased MPK2 activity after wounding. Curiously, a weak activation of MPK2 was still visible when MAP3K14-1-YFP was expressed in the absence of MKK3-Myc, which suggests the activation of MPK2 circumventing MKK3. Altogether, these results suggest a role for MAP3K14 upstream the MKK3-MPK2 module at early time-points of its activation by wounding. To strengthen this idea we wanted to have a real knock-out mutant and therefore decided to rely on the recently emerged CRISPR-Cas9 system to create it. Two independent lines including a 1bp insertion in the MAP3K14 gene leading to a frame shift were created. They were both homozygous for the mutant allele. MPK2 activity was tested in both lines and compared to Col-0. Unfortunately results were quite variable (figure 2.20). Although not concluding, this result does not invalidate our hypothesis according to which MAP3K14 acts upstream MKK3- MPK2 in response to wounding. Nevertheless, it suggests a high functional redundancy with other sub-clade III MAP3Ks that are still expressed when MAP3K14 is knocked-out.

4. Discussion

a. Two waves of MAPK activation

In this second part, I identified an almost complete MAPK module activated by wounding in Arabidopsis thaliana. First, I was able to confirm the results previously obtained by Ortiz-Masia and coworkers (Ortiz-Masia et al., 2007) that is the activation of MPK1 and MPK2 by wounding. Thanks to our HA-tagged lines I was also able to extend this observation

Characterization of a MAPK module involved in Arabidopsis response to wounding 57

A 10000 MPK6 9000 MPK3

8000 MPK2 7000 6000 5000 4000 3000 Activation Activation intensity 2000 1000 0 0 5 15 30 60 120 240 Time after wounding (minutes)

B

De novo synthesis Wounding

MAP3K Rapid activation

MKK3 MPK3 MPK6 Slow activation

MPK1 MPK2 MPK7

Figure 2.21: Theoretical model depicting the two MAPK groups activated upon wounding A: Schematic graph showing activation kinetics and peaks of MPK3, MPK6 and MPK2 activities in plants submitted to wounding. Two waves of MAPK activation are visible. B: Theoretical model: the rapid and transient activation of MPK3 and MPK6 is not dependent on MKK3, whereas the rather late activation of MPK1, 2 and 7 is dependent on MKK3. This late activation could reflect the requirement for a de novo protein synthesis which, according to our model, could occur at the MAP3K level.

to MPK7, another member of C-group MAPKs. My results also confirmed our model according to which MKK3 is the MAP2K acting upstream C-group MAPKs in a wounding context. I was also interested in two other A-group MAPKs, MPK3 and MPK6, that were already described to be activated by wounding and a plethora of other stresses (Ichimura et al., 2000; Li et al., 2017). As expected, their activation by wounding was not dependent on MKK3. To summarize, two waves of MAPKs activation occur upon wounding (figure 2.21A). Firstly, two A-group MAPKs (MPK3 and MPK6) that are already activated after 5 minutes and whose activation is not dependent on MKK3. Secondly, three C-group MAPKs (MPK1, 2 and 7) activated later (from 30 minutes after the stress) and whose activation is dependent on MKK3. Testing the effect of the first wave on the other, no major decrease of MPK2 activity was observed. However, these results do not strictly exclude the possibility for MPK3 and MPK6 to act upstream MKK3-MPK2. Indeed, MPK3 and MPK6 being considered as functionally redundant, it would have been necessary to use plants impaired in both MAPK genes. It has been shown that such plants are lethal (Wang et al., 2007) but alternative genetic tools exist which could help to address this question (Aoyama & Chua, 1997). Recently, mpk3 mpk6 double mutant rescued with mutant versions of MPK3 or MPK6 sensitive to a specific inhibitor were generated and constitute an interesting tool to compensate the lethality of the double mutant (Su et al., 2017). Moreover, the wounding-induced activation of MPK3 and MPK6 was shown to be abolished in mkk4 mkk5 plants, placing those two MAP2Ks upstream MPK3 and MPK6 in a wounding context (Li et al., 2017). Such a mutant brings out a new tool to compensate the difficulty to obtain plants where both MPK3 and MPK6 are inactive.

b. Sub-clade III MAP3Ks are transcriptionally regulated by wounding Compared to the classical activation of MPK3 and 6 that is rapid and transient, the activation of C-group MAPKs by wounding occurs quite belatedly. Such slow activation of C-group MAPKs was also observed in the context of a treatment by ABA (Danquah et al., 2015) where it was explained by the requirement for a de novo synthesis of the identified upstream MAP3Ks. Therefore we postulated that the same mechanism is taking place in a wounding context (figure 2.21B). The requirement of a de novo synthesis for the activation of the MKK3-MPK2 module by wounding was shown using the inhibitor of translation cycloheximide. In addition, some of the sub-clade III MAP3Ks were indeed found induced by wounding. To prove that the activation of MPK2 is dependent on the transcriptional induction of the candidate MAP3Ks we used plants mutated in those candidate genes. Although no

Characterization of a MAPK module involved in Arabidopsis response to wounding 58

Wounding

ABA Second messengers? Hormones?

MAP3K17 Sub-clade III MAP3K18 MAP3K?

MKK3

MPK1 MPK14 MPK2

MPK7

Figure 2.22: Theoretical model depicting the involvement of specific sub-clade III MAP3Ks depending on the wounding-induced component A functional redundancy among sub-clade III MAP3Ks upon wounding is very likely. Such a redundancy could be due to the plethora of signals that are induced by wounding and are each responsible for the activation of specific sub-clade III MAP3Ks.

strongly conclusive result was obtained, several indications point toward an important role for MAP3K14. Indeed, MAP3K14 expression was found strongly induced upon wounding and an over-expression of this gene led to an increase of MPK2 activity. However we were not able to get to a conclusive result using plants knocked-out in MAP3K14. The existence of a functional redundancy between MAP3K14 and the other sub-clade III MAP3Ks is very likely. Based on the transcriptional analyses, MAP3Ks 15, 16, 17 and 19 would be good candidates to act upstream MKK3-MPK2 in complement with MAP3K14. It would be necessary to build multiple mutants to get rid of this redundancy and identify which MAP3Ks act upstream MKK3-MPK2 in our context. Moreover, we can imagine that this functional redundancy is due to the plethora of signals that are induced by wounding and are each responsible for the activation of specific MAP3Ks (figure 2.22). For instance, MAP3K17 and 18, identified as acting upstream MKK3 in the context of ABA and also found induced by wounding could be activated by the ABA component of the wounding-induced signals and thus lead to the activation of an MKK3-dependent module. This hypothesis goes in the same direction as our main postulate that an MKK3-dependent module can be activated by various stresses and that different MAP3Ks are recruited depending on the perceived stress. To go further on this idea it is necessary to identify the wounding-induced signals that are required for the activation of MKK3 by wounding. In addition, localization assays pointed out differential subcellular localizations for MAP3K18-YFP upon ABA and wounding stresses. Thus, it is possible that response specificity upon different stresses involving sub-clade III MAP3Ks is maintained through their differential subcellular localization.

c. The truncated version of MAP3K14 is more stable

The fact that a T-DNA insertion in the MAP3K14 gene led to its increased expression upon wounding aroused our curiosity. The insertion being at the C-terminal end of the protein, the latter still possesses a functional kinase domain which however led to a greater activation of its downstream partners than the wild-type protein. By transiently expressing the expected truncated protein in protoplasts, we were able to visualize its production whereas the wild-type version was not detectable. That observation validated our hypothesis whereby MAP3K14 lacking a part of its C-terminal end is more stable. As a reminder, the C-terminal part of MAP3K14 is also the one which is predicted to have a transmembrane domain. The suppression of the transmembrane domain could facilitate the solubilization of the protein and

Characterization of a MAPK module involved in Arabidopsis response to wounding 59

H2O2 1 mM A ABA 0 15’ 1h 2h 4h 6h 8h 10h 24h 4h Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

Western blot Col-0 α-pTpY

B OGs 50µg/mL 0 15’ 30’ 1h 2h 4h Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

Western blot Col-0 C α-pTpY ATP 100 µM

0 15’ 1h 2h 4h 6h 8h 10h 24h Activity MPK2 (IP α-MPK2)

D flg22 1 µM ABA 0 15’ 1h 2h 4h 6h 8h 4h

Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

Western blot Col-0 α-pTpY

Figure 2.23: MPK2 is not activated by an exogenous treatment with H2O2, OGs, ATP or flg22 Autoradiographs show MPK2 activation after IP with α-MPK2 antibodies. Western blots show MPK3/MPK6 activation with α-pTpY antibodies. Plants were submitted to an exogenous treatment with different stress molecules.

A: Col-0 and mkk3-1 plants were treated with 1 mM H2O2. ABA was used as a control. B: Col-0 and mkk3-1 plants were treated with 50 µg/mL OGs. C: Col-0 plants were treated with 100 µM ATP. D: Col-0 and mkk3-1 plants were treated with 1 µM flg22.

thus its visualization by biochemical approaches. Since MAP3K14 did not interact with MKK3 in yeast it would also be interesting to test whether its truncated form can. We also observed an activation of MPK2 in the presence of the truncated MAP3K14 despite the absence of MKK3 in protoplasts. One possible explanation is that sub-clade III MAP3Ks can interact directly with C-group MAPKs, which has never been tested. However a direct interaction of a sub-clade III MAP3K with a MAPK was recently observed with the example of MAP3K20 interacting with MPK18 (Benhamman et al., 2018). Another explanation can be the involvement of other MAP2Ks which endogenous form is still expressed in mkk3-1 protoplasts. We can imagine that the missing carboxyl-terminal part of the truncated form part plays a role in the interaction specificities of MAP3K14 with downstream MAP2Ks.

III. Identification of signaling elements acting upstream MKK3 upon wounding

The large number of cellular events occurring when plants are subjected to wounding is listed in the introduction part. However, the way the different signaling elements coordinate still needs to be deciphered. To better understand the place of the MKK3-C-group MAPKs module in the response of Arabidopsis to wounding, I was interested in the identification of second messengers that are responsible for the signal transmission from the perception of the wounding stress to the activation of the MAPK cascade. These second messengers would thus act upstream our MKK3-dependent module and play an important role in its activation. In order to identify those second messengers, I used two different approaches. The first one consisted in testing whether an exogenous application of candidate molecules on the plants could trigger the activation of our MAPK module. Obviously, that method could not give a direct answer to our question as the molecule’s effect was tested independently from wounding. Therefore the second approach consisted in the use of plants mutated in either genes involved in the biosynthetic pathway of candidate molecules or in their known perception systems/receptors.

1. Exogenous application of some candidate second messengers can activate an MKK3-dependent module

As explained in the introduction, production of second messengers, such as products

of cell wall degradation, H2O2 or phytohormones is one of the early events occurring upon

Characterization of a MAPK module involved in Arabidopsis response to wounding 60

A EtOH JA 50 µM 10’ 30’ 1h 2h 4h 0 10 30’ 1h 2h 4h

Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

B JA 50 µM EtOH

Col-0 0 5’ 30’ 1h 2h 5’ 30’ 1h 2h Activity MPK2 (IP α-HA) Western blot MPK2-HA in α-HA Col-0 Coomassie staining

Activity MPK2 (IP α-HA) Western blot MPK2-HA in α-HA mkk3-1 Coomassie staining

MPK1-HA in MPK7- HA in MPK7-HA in C Col-0 Col-0 mkk3-1 30’ 30’ 30’ 30’ 30’ 30’ 0 EtOH JA 0 EtOH JA 0 EtOH JA

Activity MPK1 Activity MPK7 (IP α-HA) (IP α-HA) Western blot Western blot α-HA α-HA

Coomassie staining Coomassie staining

Figure 2.24: MPK1, 2 and 7 are activated by JA in a MKK3-dependent manner Autoradiographs show MPK2 kinase activity through MBP phosphorylation after IP with specific antibodies. Western blots show MAPKs protein levels after incubation with α-HA antibodies. Coomassie stainings show total protein amounts. All protein levels were normalized by Bradford assay. A: Col-0 and mkk3-1 plants were treated with ethanol (EtOH) or 50 µM JA. Plant material was harvested up to 4 hours post-treatment. MPK2 activity was assayed after IP with α-MPK2 antibodies. B: Col-0 and mkk3-1 plants expressing MPK2-HA were treated with ethanol or 50 µM JA. MPK2 activity was assayed after IP with α-HA antibodies. Col-0 plants expressing the wild-type version of MPK2 were used as control. C: Col-0 and mkk3-1 plants expressing MPK1-HA or MPK7-HA were treated with ethanol or 50 µM JA.

wounding. I tested the ability of some of them to activate MPK2 when applied exogenously on plants. For simplicity, 10 day-old plantlets grown on liquid ½MS medium were used. The molecule was applied directly into the medium, to the roots (see Materials & Methods for more detail). The different molecules tested were: H2O2 (hydrogen peroxide), ATP (Adenosine-Tri-Phosphate), OGs (Oligogalacturonides) and JA (Jasmonic Acid). MPK2 activity was tested as previously after IP with α-MPK2 antibodies. No activation of MPK2 was observed when Col-0 plants were treated with H2O2, ATP and OGs (figure 2.23A, B and C). To be sure that the treatment was nonetheless sensed by the plants α-pTpY western blots were performed to test MPK3 and MPK6 activation that is already known to occur upon those tested stresses (Kovtun et al., 2000; Choi et al., 2014; Galletti et al., 2011). Indeed MPK3 and

MPK6 were found activated by H2O2 and OGs. The test was not performed upon treatment with ATP but further gene expression analyses showed that their presence in plants environment was indeed correctly perceived (not shown). In the introduction part, similarities between DAMP- and PAMP-induced responses were discussed. In order to know if our module could also be activated by PAMPs, I used flg22 on Col-0 and mkk3-1 plants. ABA was also used as a positive control known to activate MPK2. flg22 was not able to activate MPK2 (figure 2.23D). As previously, α-pTpY western blot was performed to ensure that the peptide was sensed by the plants. MPK3 and MPK6 were indeed rapidly activated by the flg22 treatment. In contrast, MPK2 was activated 1 hour after treatment with JA and this activation was abolished in mkk3-1 plants therefore demonstrating that MPK2 is activated by JA in an MKK3-dependent way (figure 2.24A). No activation was observed when plants were treated with ethanol 96° (mock control), thus confirming that the observed signal was indeed triggered by JA and not by a mechanical stress caused by the application itself. As among the tested molecules JA was the only one to give a positive result, I went further on the study of its effect on C-group MAPKs activation. As done previously in the context of wounding, I used plants expressing HA-tagged versions of MPK1, 2 and 7 in order to be able to 1) test those two other C-group MAPKs activation by JA and 2) follow MAPKs protein amounts all along the treatment time course. I first tested the activity of MPK2 in Col-0 and mkk3-1 plants expressing MPK2-HA treated with ethanol (mock control) or 50 µM of JA. MPK2-HA was activated by JA from 30 minutes to 2 hours after the treatment and this activation was lost in the mkk3-1 background (figure 2.24B). No activation was observed when ethanol was

Characterization of a MAPK module involved in Arabidopsis response to wounding 61

JA flg22 EtOH 50 µM 1 mM

0 15’ 30’ 1h 2h 15’30’1h 2h 15’ 30’ 1h

Western blot α-pTpY Col-0

Coomassie staining

Western blot α-pTpY mkk3-1 Coomassie staining

Figure 2.25: MPK3 and MPK6 are not activated by an exogenous treatment with JA Col-0 and mkk3-1 plants were subjected to treatment with JA, flg22 or EtOH (mock control). Western blot analyses show MPK3 and MPK6 phosphorylation after incubation with α-pTpY antibodies. Coomassie stainings show total protein amounts.

A B EtOH JA 50 µM

Col-0 coi1-16 0 15’ 30’ 1h 15’ 30’ 1h

JA 50 µM - + - + Col-0 Activity MPK2 Activity MPK2 (IP α-MPK2) (IP α-MPK2) coi1-34

Figure 2.26: MPK2 activation by JA requires its perception by COI1 Autoradiographs show MPK2 kinase activity through MBP phosphorylation after IP with α-MPK2 antibodies. Experiments were performed several times with identical results. A: Col-0 and coi1-16 plants were treated with 50 µM JA. Samples were harvested 1 hour post- treatment. B: Col-0 and coi1-34 plants were treated with 50 µM JA or ethanol as a control. Samples were harvested following kinetics up to 1 hour post-treatment.

applied. Western blot analyses with α-HA antibodies showed that MPK2 protein level remains constant all along the treatment time course and that the protein is already present before the treatment. Besides, protein levels were similar between Col-0 and mkk3-1 plants showing that the absence of MPK2 activity in mkk3-1 background is not due to an inhibition or a decrease of MPK2 protein production. Similarly, MPK1 and MPK7 were activated 30 minutes after treatment with JA in an MKK3-dependent manner and the corresponding protein levels remained unchanged (figure 2.24C). All together these results show that the regulation of MAPKs activation by JA or by MKK3 does not take place at the translational stage but rather at the post-translational level. I also wondered about the activation of MPK3 and MPK6 by JA since I previously showed they were rapidly activated upon wounding. flg22 was used as a positive control for MPK3 and MPK6 activation and ethanol was used as a mock control. MPK3 and MPK6 were indeed rapidly and strongly activated by flg22 whereas the same basal signal was observed upon JA and EtOH treatments (figure 2.25). Therefore MPK3 and MPK6 are not activated by an exogenous treatment with JA. JA is perceived by the SCF/COI1 complex. In coi1 plants, JA is not perceived anymore and is therefore not able to regulate downstream JA-dependent responses. For the purpose of showing that MPK2 activation by JA requires the perception of the latter by COI1, I used coi1-16 and coi1-34 plants, impaired in COI1, and submitted them to an exogenous treatment with JA. As expected, MPK2 activation was strongly reduced in coi1-16 and coi1- 34 plants (figures 2.26A and B). To go further I was interested in the identification of the MAP3K(s) acting upstream MKK3-MPK2 but this time in the context of an external application of JA. As in the context of wounding I first studied the expression of candidate MAP3Ks in plants submitted to JA. The idea was to correlate the expression pattern of MAP3Ks upon JA treatment with what was observed in the context of wounding. Sub-clade III MAP3Ks expression was studied by RT- qPCR with specific primers (same as for wounding). For this experiment, Col-0 plants were treated with 50 µM JA or ethanol. MAP3K14, 17, 18 and 19 were induced from the beginning of the treatment, all peaking around 1 hour after the treatment (figure 2.27). This suggests the involvement of several MAP3Ks upstream the activation of an MKK3-dependent module by JA and implies a likely functional redundancy among them. To go further in the identification of the MAP3K(s) acting upstream MKK3-MPK2 upon treatment with JA, I used lines impaired in the expression of our candidate MAP3Ks and tested MPK2 activity in those lines.

Characterization of a MAPK module involved in Arabidopsis response to wounding 62

0,4 MAP3K13 0,35 MAP3K14 MAP3K15 0,3

level MAP3K16

0,25 MAP3K17 MAP3K18 0,2

transcrip MAP3K19 MAP3K20 0,15

Relative Relative 0,1

0,05

0 0 30 60 120 240 Time after JA treatment (minutes)

Figure 2.27: MAP3Ks expression upon exogenous treatment with JA Col-0 plants were submitted to wounding and samples were harvested following a kinetics up to 4 hours post-treatment. Sub-clade III MAP3Ks expression was quantified by RT-qPCR using specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. The graph shows an average of expression levels obtained from 2 biologically independent replicates. MAP3Ks expression levels are presented as a ratio between their levels in plants treated with JA and those treated with ethanol.

A Col-0 map3k19

JA 50 µM - + + - + + Activity MPK2 (IP α-MPK2) JA 50 µM

B 0 15’ 30’ 1h 2h 4h

Col-0

Activity MPK2 map3k14-1 (IP α-MPK2)

X X map3k17 map3k18

Figure 2.28: JA-induced activation of MPK2 is reduced in some map3k mutants Autoradiographs show MPK2 activity through MBP phosphorylation after IP with α-MPK2 antibodies from plants treated with JA. Several map3k lines were tested and compared to Col-0. A: Col-0 and map3k19 plants were treated with 50 µM JA. Plants were harvested 1 hour after the treatment. Two independent replicates are shown for each line. B: Col-0, map3k14-1 and map3k17 map3k18 were treated with 50 µM JA following kinetics from 15 minutes to 4 hours.

I focused only on the ones whose expression was previously found to be induced by JA. MPK2 activity was reduced in map3k17 map3k18 plants at 30 minutes and 2 hours post- treatment. No difference was observed in map3k19 and map3k14-1 backgrounds. These results suggest a role for MAP3K17 and 18 upstream MKK3-MPK2 in the context of an external treatment with JA. Nonetheless this experiment was performed only once and does not allow drawing any definite conclusion (figure 2.28A and B).

2. Wounding-induced activation of the MKK3-dependent module is disrupted in mutants of the JA signaling pathway

As the growth conditions were quite different between plants intended for the wounding stress (4 week-old grown on soil) and those used for exogenous treatment with signaling molecules (10 day-old grown on ½ MS medium), I decided to test mutants of biosynthesis or perception of our candidate molecules even though they were not able to activate MPK2 in vitro. The aim was to identify which of our candidate molecules could act upstream the MKK3-MPK2 module in its activation by wounding. Concerning H2O2, I used the rbohd rbohf double mutant impaired in two members of Arabidopsis NADPH oxidase - family, which is responsible for the production of O2 (superoxide) and H2O2 (hydrogen peroxide) at the plasma membrane level. RBOHD, the most highly expressed RBOH in plants was shown to be involved in the control of cell death upon both biotic and abiotic stresses (Torres et al., 2005). Most importantly rbohd plants are impaired in wound-induced ROS burst. RBOHF is known to work redundantly with RBOHD as the rbohd rbohf double mutant shows stronger responses than the single rbohd in defense responses towards pathogens (Torres et al., 2005). However, NADPH oxidases are not the only producers of ROS in plant cells (Minibayeva et al., 2009). Unfortunately, results were highly heterogeneous (figure 2.29A) and do not suggest a major role for RBOHD/F upstream wounding-induced activation of MPK2. In order to test if ATP is an intermediate signal between the wounding and the activation of our MAPK module, dorn1-1 plants mutated in the recently identified DORN1 receptor were used (Choi et al., 2014). MPK2 activation by wounding was unchanged in dorn1 plants (figure 2.29B). Similarly, wak2-1 and wak2-2 plants unable to respond to oligogalacturonides (OGs) were used (Brutus et al., 2010). No difference could be observed between those mutants and Col-0 plants in the activation of MPK2 by wounding (figure 2.29C). ABA is an important phytohormone that was found produced in potato and tomato

Characterization of a MAPK module involved in Arabidopsis response to wounding 63

A rbohd rbohd Col-0 rbohf Col-0 rbohf Wounding Wounding - + - + - + - + Activity MPK2 Activity MPK2 (IP α-MPK2) (IP α-MPK2)

B Col-0 dorn1-1 Wounding - + - + Activity MPK2 (IP α-MPK2)

C

Col-0 wak2-1 WS wak2-2 Wounding 0 30’ 1h 0 30’ 1h 0 30’ 1h 0 30’ 1h Activity MPK2 (IP α-MPK2)

Figure 2.29: MPK2 activation by wounding is not highly dependent on ATP, OGs or H2O2 signaling Autoradiographs show MPK2 activity through MBP phosphorylation after IP with α-MPK2 antibodies from plants submitted to wounding. A: Col-0 and rbohd rbohf were wounded and leaves were collected 1 hour post-stress. Two independent experiments are shown. B: Col-0 and dorn1-1 plants were submitted to wounding. Leaves were harvested 1 hour post-stress. C: Wild-type (Col-0 and WS) and wak2 (wak2-1 and wak2-2) plants were wounded and leaves were harvested following kinetics up to 1 hour post-wounding. A Time after wounding B Replicate 1 Replicate 2 0 15’ 30’ 1h 2h 4h Col-0 coi1-16 Col-0 coi1-16 Col-0 Wounding - + - + - + - + Activity MPK2 Activity MPK2 (IP α-MPK2) hab1 (3938) (IP α-MPK2) hab1 (3943)

C Time after wounding D Time after wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h

Col-0 Col-0

Activity MPK2 coi1-34 Activity MPK2 coi1-34 (IP α-MPK2) (IP α-MPK2) aos aos

1000000 Col0 800000 coi1-34 E 600000 aos Time after wounding intensity 400000 200000 0 15’ 30’ 1h 2h Signal Signal 0 0 15 30 60 120 240 WS Time after wounding (minutes) Activity MPK2 (IP α-MPK2) opr3

160 140 WS 120 opr3 Figure 2.30: JA, but not ABA, has a major role upstream of MKK3- 100 MPK2 in response to wounding 80

intensity 60 40 Autoradiographs show MPK2 activity through MBP phosphorylation 20 after IP with α-MPK2 antibodies from plants submitted to wounding. Band 0 0 15 30 60 120 Protein amounts were normalized by Bradford assay. Graphs show the Time after wounding minutes) quantified intensity of the signal observed on corresponding autoradiographs. A: Col-0 and two independent hab1 lines were submitted to wounding following kinetics from 0 to 4 hours. B: Col-0 and coi1-16 plants were wounded and leaves were harvested 1 hour later. Results from two biologically independent replicates are displayed. C and D: Col-0, coi1-34 and aos plants were wounded and samples were harvested following kinetics up to 4 hours post-stress. E: WS and opr3 plants were wounded and samples were harvested following kinetics up to 4 hours post-stress. Col-0 coi1-34

Wounding 0 15’ 30’ 1h 0 15’ 30’ 1h

Western blot MPK6 α-pTpY MPK3

Coomassie staining

Figure 2.31: JA does not have a major role upstream of MPK3/MPK6 upon wounding Col-0 and coi1-34 plants were subjected to wounding and samples were harvested following a time course up to 1 hour post-wounding. Western blot shows MPK3/MPK6 activity upon wounding after incubation with α-pTpY antibodies. Commassie staining shows total protein amounts.

Figure 2.32: Expression of candidate MAP3Ks upon wounding is reduced in coi1-16 plants Expression of sub-clade III MAP3Ks in Col-0 and coi1-16 plants submitted to wounding was analyzed by RT-qPCR with specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. Average of two biologically independent experiments is displayed.

plants after wounding (Peña-Cortés et al., 1995). We already know that MPK2 is activated by an exogenous treatment with ABA (Danquah et al., 2015). Under the assumption that wounding-induced ABA production is conserved in Arabidopsis I used two independent lines mutated in the HAB1 PP2C gene (Robert et al., 2006) that are known to be ABA-insensitive. No striking difference was observed between Col-0 and hab1 plants when testing the activation of MPK2 by wounding (figure 2.30A). In addition, several plant lines impaired in genes of JA biosynthesis pathway or perception system were used. Two different alleles of the coi1 mutant were used, coi1-16 and coi1-34. In both genetic backgrounds, MPK2 activation by wounding was reduced compared to Col-0 (figures 2.30B, C and D), demonstrating an important role for JA in this activation. I also used aos plants impaired in the AOS (Allene Oxide Synthase) gene involved in the early steps of JA synthesis. In that case, the results were highly heterogeneous as MPK2 activity was rather decreased (figure 2.30C) or unchanged (figure 2.30D) depending on the biological replicate. Finally, I also used the opr3 mutant, impaired in the OPR3 gene involved in the production of JA from its precursor OPDA. This mutant being created in Arabidopsis WS (Wassilewskija) ecotype, MPK2 activity was compared between opr3 and WS plants. Consistently with results obtained using coi1 plants, MPK2 activation by wounding was found completely abolished in opr3 plants (figure 2.30E ). I therefore conclude that the wounding-induced activation of MPK2 highly depends on JA signaling and more particularly on its perception by COI1. In the first part, I showed the existence of 2 waves of MAPKs activation by wounding. MPK3 and MPK6 are rapidly activated, whereas the activation of C-group MAPKs is slower. I wondered if MPK3 and MPK6 activation by wounding was also dependent on JA signaling. Col-0 and coi1-34 plants were compared and no difference was observed in MPK3 and MPK6 activation by wounding (figure 2.31). I thus conclude that the role of JA upstream MPK3 and MPK6 is not as important as for MPK2. To further investigate the place of JA signaling upstream our MKK3-dependent module after wounding, I was again interested in the study of candidate MAP3Ks expression. The experiment was performed on 2 biological replicates. MAP3K14 expression was found decreased by around 50% in coi1-16 plants compared to its expression in Col-0 plants after wounding (figure 2.32). The four other MAP3Ks induced upon wounding (MAP3Ks 15, 17, 18 and 19) were also less expressed in coi1-16 plants but at a lesser extent. The same experiment was performed using the second allele coi1-34 on three biological replicates

Characterization of a MAPK module involved in Arabidopsis response to wounding 64

MAP3K14 MAP3K15 100 150

80 100 /Col0

/Col0 60 34 34 - - 40 50 coi1 coi1 Expression ratio ratio Expression Expression ratio ratio Expression 20 0 0 0 15 30 60 120 240 0 15 30 60 120 240 Time after wounding (minutes) Time after wounding (minutes)

MAP3K16 MAP3K17 300 100

250 80 ratio

ratio 200 /Col0 60 /Col0 34

150 - 34 - 40 100 coi1

coi1

Expression Expression 20

Expression Expression 50 0 0 0 15 30 60 120 240 0 15 30 60 120 240 Time after wounding (minutes) Time after wounding (minutes)

MAP3K18 MAP3K19 150 200

150 ratio 100 /Col0 /Col0

34 100 - 34 50 - coi1 50 coi1 Expression Expression Expression ratio ratio Expression 0 0 0 15 30 60 120 240 0 15 30 60 120 240 Time after wounding (minutes) Time after wounding (minutes)

Figure 2.33: Expression of candidate MAP3Ks upon wounding is reduced in coi1-34 plants Expression of sub-clade III MAP3Ks in Col-0 and coi1-34 plants submitted to wounding was analyzed by RT-qPCR with specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. Results are displayed as the percentage of expression in coi1-34 compared to Col-0 plants. Average of three biologically independent experiments is shown. Dotted lines indicate the expression level in Col-0 plants, which was brought to 100%.

(figure 2.33). The results are displayed as the percentage of MAP3Ks expression in coi1-34 plants compared to their expression in Col-0 plants. Despite a high variability among biological replicates, we can observe that all tested MAP3Ks expression (apart from MAP3K16) is lower in coi1-34 plants in comparison with Col-0. This result confirms the ones obtained with the coi1-16 allele and suggest a role for JA signaling upstream the expression of those MAP3Ks upon wounding.

3. MKK3-MPK2 is not activated in systemic leaves

As described in the introduction part, wounding induces local and systemic responses in the plant. JA has been shown to be an important element involved in the transmission of the stress signal from the wounded site to a restricted area of distal leaves (Glauser et al., 2009). For example, when a single leaf (n°8) is wounded, JA levels increase in this leaf but also in a distal leaf (n°13). However it accumulates at a far lesser extent in leaf n°9, which can then be used as a negative control. In the same way, the JAZ10 gene, a well-known marker of JA, is induced in the wounded leaf n°8 as well as in the distal leaf n°13 but not in the distal leaf n°9 (Mousavi et al., 2013). To note, the level of JAZ10 expression in leaf n°13 is similar to the one observed in the leaf n°8. As JA seems to have an important role upstream our MKK3- dependent MAPK module, I wondered if a JA-dependent systemic activation of this module could occur upon wounding. Leaf n°8 of Col-0 and mkk3-1 plants was wounded and MPK2 activity was tested in leaves n°8 (local), n°9 (negative control) and n°13 (systemic). As usual, MPK2 was activated in the wounded leaf n°8 in Col-0 but not in mkk3-1 plants (figure 2.34A). As expected, no activation was observed in the negative control leaf n°9. Sadly MPK2 was not activated in the distal leaf n°13 where the JA signal is supposed to be transmitted. This experiment was performed three times increasing the percentage of wounded leaf surface each time (40%, 50% and then 100%) but no activation of MPK2 could be observed in the distal leaf n°13. It was important to check that JA indeed accumulated in the distal leaf n°13 in our hands. Therefore, I studied the expression of the JAZ10 marker in leaves n°8, 9 and 13 upon wounding of leaf n°8. Leaves were harvested 1 hour after wounding leaf n°8 and JAZ10 expression levels were compared to leaves harvested on non- wounded plants. In Col-0 plants, JAZ10 expression was highly increased in leaf n°8 after wounding (figure 2.34B). However no increase was noticed in leaf n°13. I decided to also add the mkk3-1 line to see if the expression of this JA marker could be dependent on MKK3. As

Characterization of a MAPK module involved in Arabidopsis response to wounding 65

A Leaf n°8 Leaf n°9 Leaf n°13

Wounding 0 15’ 30’ 1h 2h 0 15’ 30’ 1h 2h 0 15’ 30’ 1h 2h

Col0 Activity MPK2 (IP α-MPK2) mkk3-1

Figure 2.34: MKK3-MPK2 is not activated in systemic leaves A: Autoradiographs show MPK2 activity through MBP phosphorylation in leaves n°8, 9 and 13 of Col-0 and mkk3-1 plants wounded on their leaf n°8. B: Levels of JAZ10 expression were measured by RT-qPCR in leaves n°8, 9 and 13 of Arabidopsis plants. Samples were harvested 1 hour after wounding leaf n°8 of Col-0 plants and also from non- wounded Col-0 plants as controls. C: JAZ10 expression was also measured in mkk3-1 plants. Results are displayed as a ratio of JAZ10 expression between mkk3-1 and Col-0 plants 1 hour after wounding leaf n°8. Dotted lines indicate the level of JAZ10 expression in Col-0 plants, which was brought to 100%. Results of three biologically independent experiments are shown .

relative expression levels were quite different from one experiment to another, results are displayed as a ratio of JAZ10 expression between mkk3-1 and Col-0 plants. JAZ10 levels were a little higher in leaf n°8 of mkk3-1 plants compared to Col-0 plants (figure 2.34C). Intriguingly, JAZ10 was importantly more expressed in leaves n°13 of mkk3-1 plants after wounding. This observation suggests a negative control of JAZ10 expression by MKK3 in distal leaves and thus a negative regulation of JA-dependent responses. Moreover, as JAZ10 is a marker of JA signaling, this result could also suggest a negative regulation of JA signaling in distal leaves by MKK3.

4. Discussion

a. C-group MAPKs, but not MPK3/MPK6, are activated by an exogenous treatment with JA

The aim of this third part was to identify wounding-induced second messengers that could link the perception of wounding to the activation of the MKK3-C-group MAPKs module. None of the exogenously applied molecules was able to activate MPK2 except JA, which confirmed the results previously obtained by Ortiz-Masia and coworkers (Ortiz-Masia et al., 2007). Using HA-tagged lines I also showed the JA-induced activation of MPK1 and MPK7. Most importantly my results confirmed that MKK3 is the MAP2K acting upstream C- group MAPKs in the context of their activation by JA. Notably, the observed kinetics of C- group MAPKs activation by JA was similar to the one observed upon wounding. Wondering if the two waves of MAPK activation observed upon wounding were also occurring in response to JA, we tested the activation of MPK3 and MPK6. According to Takahashi and coworkers (Takahashi et al., 2007), MPK6 is activated by JA and this activation is impaired in mkk3-1 plants. However no mock control was shown to ensure this JA-induced activation of MPK6, which was necessary since MPK6 is activated by many stresses, including touch. In our conditions, adding a mock control as well as a positive control (flg22), neither MPK6 nor MPK3 was activated by JA. In addition, JA was able to trigger the expression of several candidate MAP3Ks. However, their expression pattern was quite different from what was observed after wounding and their expression levels were also quite low. These differences can easily be explained by the difference of plants developmental stage at the moment when the stress is applied as well as their growth conditions (4 week-old plants grown on soil for wounding and 10 day-old

Characterization of a MAPK module involved in Arabidopsis response to wounding 66

Wounding

JA

MAP3K14 MAP3K15 MAP3K17 MAP3K18

MKK3

MPK1

MPK14 MPK2

MPK7

Figure 2.35: Model depicting the JA-dependent MAPK module activated by wounding MKK3-MPK2 activation is largely dependent on JA signaling. This activation probably goes through the transcriptional regulation of MAP3K14, 15, 17 and 18.

plants grown on ½MS for JA treatment). Besides, the concentration of externally applied JA is 5 times higher than the physiological concentrations measured after wounding (up to 10 nmol/g FW, corresponding roughly to 10 µM) (Glauser et al., 2008). To be able to compare expression patterns of MAP3Ks between plants treated with JA and wounded plants it would be wiser to apply JA by spraying it on 4 week-old plants grown on soil in the same conditions as the plants aimed for wounding.

b. Wounding-induced activation of MKK3-dependent modules is largely dependent on JA

Application of exogenous molecules was tested independently from wounding. However, the best way to identify signaling elements acting upstream of an MKK3-dependent module was to use plants impaired in biosynthesis or perception of candidate molecules. Wounding-induced activation of MPK2 was impaired only in plants unable to synthesize or to perceive JA (opr3, coi1-16 and coi1-34). In addition, some MAP3Ks expression induced by wounding was impaired in plants not perceiving JA correctly (coi1-16 and coi1-34). The role of JA in the activation of MKK3-MPK2 by wounding seems to be preeminent and probably goes through the transcriptional regulation of MAP3K14, 15, 17 and 18 genes (figure 2.35). Many signaling molecules are produced upon wounding and it is possible that several participate to MAPK activation by wounding but because of high redundancy between signaling pathways, the study of mutants impaired in only one of them do not show significant results. That is one explanation for the absence of MPK2 activity decrease when other signaling molecules mutants were used (dorn1, wak2 …) and the rather strong but not total decrease of MPK2 activity and MAP3Ks induction observed in coi1 plants. To address this issue it would be necessary to have a multiple mutant unable to produce most of those second messengers. However it is to note that none of the known DAMPs in Arabidopsis could activate MKK3 modules when applied exogenously.

IV. Activation of an MKK3-dependent module by cell wall- damaging pathogens

Wounding is an important signal triggered by cell wall-damaging pathogens such as necrotrophic fungi and herbivorous insects. The results presented in the previous part showed that JA has an important role upstream the activation of MKK3-C-group MAPKs module in

Characterization of a MAPK module involved in Arabidopsis response to wounding 67

A Col-0 mkk3-1 mkk3/MKK3locus-YFP

PDA B. cinerea PDA B. cinerea PDA B. cinerea

0 24h 48h 24h 48h 0 24h 48h 24h 48h 0 24h 48h 24h 48h Activity MPK2 (IP α-MPK2)

B 0 24h 24h 48h 24h 48h 24h 48h B. cinerea - - - - + + + + Wounding - - + + - - + +

Col-0 Activity MPK2 (IP α-MPK2) mkk3-1

Figure 2.36: MKK3-MPK2 is activated by B. cinerea. Autoradiographs show MPK2 kinase activity on MBP after immuno-precipitation with α-MPK2 antibodies from plants with different genetical backgrounds inoculated with B. cinerea spores or PDA. A: MPK2 activity was tested 24 and 48 hours after inoculation with B. cinerea or PDA in Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants. B: MPK2 activity was tested 24 and 48 hours after inoculation with B. cinerea or PDA in Col-0 and mkk3-1 plants. Plants were wounded or not 1 hour prior to the inoculation.

the context of wounding. Interestingly, in Arabidopsis thaliana, JA has been shown to be an important mediator of defense responses against necrotrophic pathogens as well as herbivores. Indeed, plants mutated in COI1 are more sensitive to an inoculation with spores of the necrotroph B. cinerea (Thomma et al., 1998). The importance of the jasmonate pathway in resistance towards generalist herbivores was also shown using coi1 plants (Reymond et al., 2004). Therefore, we wondered if our MKK3-dependent module would be activated by pathogens causing wounding of the leaves. We chose to work with Botrytis cinerea as a representative of necrotrophic fungi, which has commonly been used in our institute and Spodoptera littoralis as a representative of herbivorous insects, in the frame of collaboration with Axel Mithofer (MPI Jena, Germany).

1. Botrytis cinerea activates an MKK3-dependent module in Arabidopsis thaliana

If mechanical wounding is partly mimicking the effect of necrotrophic fungi, it is possible that the MKK3-MPK2 module is also activated when plants are challenged with Botrytis cinerea. In their work, Chassot and coworkers (Chassot et al., 2008) observed an activation of MPK3 and MPK6, 24 hours after inoculation with B. cinerea. Based on this data I chose to test the activity of MPK2 at late time-points: 24 and 48 hours after inoculation. 4 week-old Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were inoculated with B. cinerea spores or PDA (mock control) and MPK2 activity was monitored as described previously. In Col-0 plants, while inoculation with PDA could not activate MPK2, the latter was found active 48 hours after inoculation with the fungus whereas no activation could be observed in mkk3-1 background (figure 2.36A). The complementation with a tagged version of MKK3locus restored Botrytis-triggered MPK2 activation. This result which has been replicated three times on independent plants, leads to the conclusion that MPK2 is activated by B. cinerea in an MKK3-dependent way. Previous works showed that wounding of Arabidopsis leaves causes a transient resistance against the necrotrophic fungus Botrytis cinerea (Chassot et al., 2008). Based on this data I decided to test the activity of MPK2 in leaves submitted to wounding prior to the fungal inoculation. MPK2 activity was monitored as described above, 24 and 48 hours after Botrytis or PDA inoculation of plants which had been pre-wounded with a needle or not. No MPK2 activation was observed in the absence of B. cinerea (with or without wounding) in

Characterization of a MAPK module involved in Arabidopsis response to wounding 68

300 - 250 WoundedWounding to non B.B. cinerea cinerea 200

) WoundingWounding + + B.B. cinereacinerea 150

compared 100 stressed

50 change (

0 Fold

Figure 2.37: MAP3K19 is highly induced 48 hours after inoculation with B. cinerea MAP3Ks expression levels were measured in Col-0 plants inoculated with B. cinerea spores, with or without a pre-wounding. Levels were measured by RT-qPCR using specific primers. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once (n=1).

both Col-0 and mkk3-1 plants (figure 2.36B). MPK2 was found activated in Col-0 plants 48 hours after inoculation with B. cinerea. This activation was lost in mkk3-1 plants. Interestingly, a decrease of activity can be noticed in Col-0 plants when plants are pre- wounded. This decrease was observed in at least two other independent experiments (not shown). It is likely due to the resistance of pre-wounded plants to the fungus. Indeed, pre- wounding induces a lower development of B. cinerea on Arabidopsis leaves which very likely leads to a lower activation of MPK2. Because MKK3-MPK2 module was activated by B. cinerea, we wondered which of our candidate MAP3Ks could act upstream the module in this context. As discussed previously, transcriptional regulation of MAP3Ks seem to be a key event in the activation of MKK3-dependent modules. Col-0 plants were inoculated with B. cinerea spores or PDA alone with or without pre-wounding. Candidate MAP3Ks expression levels were measured 48 hours post-inoculation. Results are displayed as a ratio between gene expression levels in plants inoculated with B. cinerea (with or without pre-wounding) and those inoculated with PDA only. We found that MAP3Ks were not induced by wounding alone at this late time- point (figure 2.37). After inoculation with B.cinerea, we observed a 250-fold induction of MAP3K19. Interestingly this induction was totally abolished when plants were wounded prior to the inoculation. This absence of MAP3K induction when plants were pre-wounded is consistent with the decrease of MPK2 activation and suggests a role for MAP3K19 as the potential MAP3K acting upstream MKK3-MPK2 in the response to B. cinerea. However this experiment was performed only once and would need to be repeated.

2. Spodoptera littoralis activates an MKK3-dependent module in Arabidopsis thaliana

In the same way, we wondered if MKK3-MPK2 could be activated when plants were challenged with an herbivorous insect. For this purpose, we collaborated with Axel Mithöfer (Max Planck Institute in Jena, Germany). He kindly performed some insect feeding assays on Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants. Larvae are left to starve for some time and are then put on leaves to feed for 1 hour or 3 hours. Larvae and leaves which have been chewed are then collected to be weighed or used to characterize plant responses respectively (see Scholz et al., 2012; Vadassery et al., 2012). After submitting plants to the generalist S. littoralis feeding, Axel Mithöfer sent us plant samples from 4 biological replicates. I used two

Characterization of a MAPK module involved in Arabidopsis response to wounding 69

mkk3-1/ Col-0 mkk3-1 MKK3locus-YFP

Insect feeding 0 1h 3h 0 1h 3h 0 1h 3h

Replicate 1 Activity MPK2 (IP α-MPK2) Replicate 2

Figure 2.38: MKK3-MPK2 is activated by Spodoptera littoralis feeding Autoradiograph shows MPK2 kinase activity on MBP after immuno-precipitation with MPK2- specific antibodies in Col-0, mkk3-1 and mkk3/MKK3-YFP plants submitted to S. littoralis feeding. Leaves were harvested 1 hour and 3 hours after the feeding has started.

JA ?

MKK3

MPK1 MPK14 MPK2 MPK7

(pictures from Williamson et al., 2007)

Figure 2.39: MKK3-MPK2 is activated by S. littoralis and B. cinerea, two JA-producing pathogens

B. cinerea and S. littoralis both activate the MKK3-MPK2 module. JA is an important mediator of defense responses towards those two organisms. As JA seems to have an important role in the activation of the MKK3-MPK2 module by wounding, we can postulate that it can also play a key role in response to necrotrophic fungi and herbivorous insects, in particular to the ones tested.

replicates to test MPK2 activation and found it activated in Col-0 plants 1 hour after the feeding start (figure 2.38). This activity was lost in mkk3-1 plants and restored in the complemented line, therefore showing that MPK2 activation by S. littoralis is dependent on MKK3. To complete the module it is necessary to study the expression of MAP3Ks upon S. littoralis feeding and test the corresponding mutant lines in their ability to still activate MKK3-MPK2 as it was done in the case of mechanical wounding.

3. Discussion

In this part I showed the activation of the MKK3-MPK2 module by two cell wall- damaging pathogens: Botrytis cinerea and Spodoptera littoralis. MPK2 is activated 48 hours after inoculation with Botrytis spores in an MKK3-dependent way. Making a parallel with the wounding-induced activation of MKK3-MPK2, such a late activation is probably due to the time going on between the inoculation and the beginning of tissue maceration causing the actual cell damage. Notably, it is actually difficult to know exactly how much time after the tissue lesion our module is activated. This also may explain the difference observed in MAP3Ks induction between wounding and fungal inoculation. Indeed, only MAP3K19 was found strongly induced 48 hours post-inoculation (although the analysis was performed only once). Another explanation is that obviously the two stresses are not exactly the same and despite triggering similar cellular events, the response specificity of each could be reflected at the transcriptional level. That observation is also consistent with our model (see figure 2.4) according to which different stresses can trigger the MKK3-MPK2 module through the transcriptional regulation of different MAP3Ks. MPK2 was less active when the inoculation was preceded by wounding which is known to cause a protection against the fungus and therefore weaker lesions caused by the latter. MPK2 was also activated in an MKK3-dependent way by the generalist herbivore Spodoptera littoralis 1 hour after the feeding start. Interestingly the peak of MPK2 activation observed at the 1h time-point is consistent with the one observed in a wounding context. Obviously, more time-points would be necessary to conclude about a real consistency regarding the kinetics of activation. In addition to degrading the cell wall, these two pathogens trigger JA production in the plant cell, which mediates defense responses (figure 2.39). It could be interesting to check

Characterization of a MAPK module involved in Arabidopsis response to wounding 70

Effect of mkk3-1 on Experiment Appearence of Effect of mkk3-1 on Behavior of wounding-induced Significance n° first lesions resistance to B. cinerea complemented line resistance YES (mkk3-1 more 1 48h NO YES X resistant) 2 48h NO NO NO X YES (mkk3-1 more 3 72h NO YES different from Col-0 resistant) 4 72h NO X NO X

Table 2.3: Summary of results obtained with B. cinerea inoculations This table summarizes the results obtained concerning an effect of the mkk3-1 mutation on the resistance of plants to B. cinerea. The resistance was based on the size of outgrowing lesions and was tested in the context of plants wounded or not prior to the inoculation.

Col-0

mkk3-1

mkk3/MKK3locus-YFP

coi1-16

Figure 2.40: Lesion outgrowth after inoculation with B. cinerea spores Pictures show lesions caused by spores of B. cinerea on Col-0, mkk3-1, mkk3/MKK3locus-YFP and coi1-16 leaves. Pictures were taken 48 hours after the inoculation.

whether JA signaling has an important role upstream our MKK3-dependent module, as in the context of “lab-performed” mechanical wounding, using coi1 plants.

V. Study of the role of an MKK3-dependent module in wounding- related responses

After showing that an MKK3-dependent module is strongly activated by mechanical wounding and cell wall-damaging pathogens, we assumed that this central element has an important role in the transduction of wounding-induced defense responses. As MKK3 acts as a “hub” upstream C-group MAPKs, plants knocked-out in MKK3 constitute a powerful tool to study the role of the MKK3-dependent module in the context of wounding. Therefore, we phenotyped mkk3-1 mutant plants and compared them to Col-0 plants on several levels, focusing particularly on its role in the context of an interaction with cell-wall damaging pathogens.

1. Plants impaired in MKK3 signaling do not show clear detectable phenotype upon Botrytis infection

Before my arrival in the team, colleagues had tested the role of MKK3 in resistance towards B. cinerea by comparing lesions outgrowth on Col-0 and mkk3-1 plants (Axel De Zelicourt - personal communication). No significant difference could be observed. As stated above, wounding can induce a transient resistance towards B. cinerea and this resistance is all the more important as the fungus is applied shortly after the wounding (Chassot et al., 2008). Nevertheless, this acquired resistance could still be observed up to 48 hours after the wounding. I first wanted to confirm the priming effect of wounding on B. cinerea development and then test if our MAPK module of interest could play a role in this phenomenon. Therefore, I compared Col-0 and mkk3-1 plants in their ability to prime defenses against B. cinerea after wounding. I chose to wound leaves 1 hour prior to inoculation with fungal spores and favored the use of a needle. Leaves were punctured once on both sides of the midvein and were inoculated, on the wounding site, with B. cinerea spores or PDA as a mock control. The level of resistance of different plants was compared based on the size of outgrowing lesions. These assays were carried out several times (n>3), mostly blindly with different controls. Overall, they gave highly heterogeneous results that I chose not to display extensively here (table 2.3). One example of Botrytis-caused lesions on

Characterization of a MAPK module involved in Arabidopsis response to wounding 71

Figure 2.41: Some Botrytis-induced genes expression is misregulated in mkk3-1 plants The expression of several Botrytis-induced genes was quantified by RT-qPCR in Col-0 and mkk3-1 plants. Results are presented as a ratio between gene expression levels in plants inoculated with B. cinerea and those inoculated with PDA only. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once (n=1).

different genotypes is presented in figure 2.40. Variabilities were observed at different levels: the speed of the fungal spreading (48 or 72 hours), the significance of the observed differences, the behaviors of the mutant and the complemented lines. These results suggest that MKK3 does not play a very strong role in the wounding-induced resistance towards B. cinerea, which could have overwhelmed the high heterogeneity of experiments. At that time I decided to give more attention to other aspects of my projects and did not dig further in the direction of a role for MKK3 in the resistance to necrotrophic fungi (B. cinerea or others). However, it would be interesting to better set up the experiment parameters to reduce variability and repeat such asays. MKK3-MPK2 is activated 48 hours after inoculation with B. cinerea but MKK3 has no obvious role in resistance/susceptibility towards the fungus. It is possible that mkk3-1 phenotype is subtle and can be detected only at the molecular scale. I decided to test whether the expression of some genes known to be up- or down-regulated when plants are challenged with B. cinerea depends on MKK3. Based on a transcriptomic analysis performed on Arabidopsis leaves inoculated with B. cinerea spores (Windram et al., 2012), top regulated genes were selected and their expression was monitored in Col-0 and mkk3-1 plants inoculated with B. cinerea or PDA. Among them were found genes encoding transcription factors of the WRKY and ERF families and a pathogen-related gene (PR4). Their expressions were measured 24 and 48 hours post-inoculation by RT-qPCR with specific primers. Results are presented as a ratio between gene expression levels in plants inoculated with B. cinerea and those inoculated with PDA only (figure 2.41). First of all, I was able to show that the chosen genes were indeed up-regulated in the presence of B. cinerea, from 24 hours after the inoculation, increasing even more at 48 hours. Some of them were apparently misregulated in mkk3-1 plants. But this experiment having been performed only once, it is difficult to draw any conclusion. Nevertheless, it could be interesting to go further in this direction once the experiment is correctly set up to reduce variability, as well as including other genetic material (complemented line, mkk3-2 and map3k19 mutants).

Characterization of a MAPK module involved in Arabidopsis response to wounding 72

Figure 2.42: MKK3 is not involved in resistance towards Spodoptera littoralis Weights of larvae fed on Col-0 and mkk3-1 plants were measured 8 days after larvae were put on leaves to feed. Three biologically independent experiments were performed with around 25 measurements for each genotype and each replicate. *: p-value =0,05 (M&W)

Figure 2.43: MKK3 negatively regulates SA and JA accumulation after insect feeding Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were submitted to insect feeding. Leaves were harvested 1 hour and 3 hours later. SA, JA, JA-Ile and ABA levels were measured. Each bar represents an average of 4 independent samples.

2. Plants impaired in MKK3 signaling do not properly respond to herbivorous insects

a. Resistance towards Spodoptera littoralis

Since MKK3-MPK2 is activated upon S. littoralis feeding, it was interesting to look for a role for MKK3 in the resistance towards this generalist herbivore. All insect resistance assays were performed by Axel Mithöfer, in his laboratory in Jena. His feeding assays were performed on Col-0 and mkk3-1 plants and larvae were collected and weighed 8 days after the feeding start. The sensitivity of the plant is reflected by larvae weights at the end of the feeding period. Indeed, the more the plant is sensitive the more the larva will feed on it and become heavy. Three biologically independent experiments were performed with around 25 measurements for each genotype and each replicate. Only one out of the three showed a statistical difference between larvae grown on Col-0 and mkk3-1 plants (figure 2.42). The difference is suggesting a higher sensitivity for mkk3-1 plants and would consequently suggest that MKK3 is a positive regulator of plant defenses towards S. littoralis. Unfortunately, this trend is not strong enough to be significant in all replicates. The same experiment was repeated later including the mkk3/MKK3locus-YFP line but unfortunately no differences could be observed (not shown). I therefore conclude that MKK3 is not involved in resistance towards S. littoralis. Another possibility is that the phenotype is too weak and requires a higher number of replicates to be detected out of the experimental variability.

b. Role of MKK3 in the regulation of phytohormone levels upon wounding and Spodoptera littoralis feeding

After performing insect feeding assays, Axel Mithöfer kindly offered to measure phytohormone levels in the different genetic backgrounds we provided him with. As mentioned earlier in the introduction, the few studies mentioning MAPKs in the context of mechanical wounding and herbivory suggested their role in the regulation of phytohormone production (Seo et al., 2007; Heinrich et al., 2011; Li et al., 2017). Therefore, our module being activated upon insect feeding, we could also expect its role in the regulation of phytohormone production. Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were submitted to insect feeding and leaves were harvested, as before, 1 hour and 3 hours after the feeding start. The experiment was performed on four biologically independent samples. Levels of JA, JA-Ile, SA and ABA are shown in figure 2.43. As expected, JA and JA-Ile levels were

Characterization of a MAPK module involved in Arabidopsis response to wounding 73

Figure 2.44: MKK3 is not involved in hormonal regulation upon wounding Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were submitted to mechanical wounding. Leaves were harvested 1 hour and 3 hours later. SA, JA, JA-Ile and ABA levels were measured. Each bar represents an average of 3 independent samples.

increased by the insect challenge. We measured a peak at 1 hour (among the tested time- points) decreasing back at 3 hours to a level that was still higher than at resting conditions. Interestingly these levels are increased in mkk3-1 plants 1 hour and 3 hours after the feeding start. The complemented line behaves like the Col-0, thus confirming that the increase observed in mkk3-1 lines is indeed due to the mutation. The result was even more interesting concerning SA levels. No increase of SA could be observed in Col-0 and mkk3/MKK3locus- YFP plants whereas a high production of SA occurred in mkk3-1 plants. The peak was observed at 1 hour after the feeding start, as for JA. ABA levels were unchanged in all genotypes. These data suggest that MKK3 is involved in the negative regulation of JA, JA-Ile and SA levels upon S. littoralis feeding. In the case of SA, MKK3 is even totally inhibiting the production of SA upon insect feeding. MKK3-MPK2 being activated 1h after the feeding start, and probably already earlier, a role for MKK3 in the regulation of SA and JA levels is not absurd. After these results, we wondered if the same effect of MKK3 on JA and SA production could be observed in response to mechanical wounding. Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants were wounded with a forceps and wounded leaves were collected 1 hour and 3 hours later. Samples from three biologically independent replicates were sent to Axel Mithöfer’s laboratory for phytohormone measurements. Results are shown on figure 2.44. As observed after the insect attack, JA and JA-Ile levels were found increased upon wounding of Col-0 plants, peaking at 1 hour post-wounding. A slight increase of ABA levels could also be observed upon wounding. SA levels did not vary. Because mkk3-1 plants behaved like Col-0 plants, I concluded that MKK3 is not involved in hormonal regulation upon wounding. That would mean that the MKK3-dependent variations observed when plants were submitted to S.littoralis are specific of the insect, independently of wounding. Indeed, in addition to the mechanical wounding resulting from the insect feeding on the leaf, some chemical substances from the insect saliva also come into play. Therefore, it would be interesting to perform an experiment where insect oral secretions are applied to previously wounded leaves and check if the hormonal phenotype is restored. Another explanation is that the mechanistic of wounding performed with forceps is quite different from the one of insect- induced wounds. Indeed, Mithöfer and his collaborators showed that S. littoralis has a specific feeding pattern (Mithöfer et al., 2005). To be able to reproduce it, they developed a robot named “Mecworm” that is able to mimic the strength and the frequency of S. littoralis feeding

Characterization of a MAPK module involved in Arabidopsis response to wounding 74

A

B

Figure 2.45: Role of MKK3 in the regulation of genes involved in SA and JA biosynthesis pathways Expression levels were measured by RT-qPCR in Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants submitted to insect feeding. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once (n=1). A: Expression levels of SA biosynthetis genes PAL1, PAL2, PAL4 and SID2 B: Expression levels of JA biosynthesis genes LOX2, LOX3, LOX4, LOX6 and AOS

on lima bean leaves. We could also submit our different genotypes to that robot. Finally, a third hypothesis which could explain the observed differences between wounding and insect feeding is the likely difference in plant growth conditions between our two laboratories. At this moment, samples are in progress of preparation to test those different hypotheses and the results might be presented during the defense.

c. Role of MKK3 module in the regulation of SA- and JA-related genes upon insect feeding

In tobacco, MAPKs were shown to regulate JA levels after wounding by regulating the activity of enzymes involved in its biosynthesis (Kallenbach et al., 2010) and in wounded Arabidopsis, ethylene levels were shown to be regulated by some MAPKs through the transcriptional regulation of ACS genes (Li et al., 2017). Therefore, in order to have a deeper understanding of the role of MKK3 on the previously observed hormonal regulations, I decided to focus on the enzymes involved in their biosynthesis. Since the tools required to measure the activity of enzymes involved in SA and JA biosynthesis pathways were not available in our vicinity, I decided to analyze the expression levels of genes encoding these enzymes. The idea was to show that the negative regulation of SA and JA levels by MKK3 could occur by the negative regulation of genes involved in their biosynthesis. Some genes were selected and their expression was analyzed by RT-qPCR with specific primers. Concerning SA, two synthesis pathways are known. One of them allows the production of SA from its precursor chorismate. The main enzyme involved in that pathway is isochorismate synthase (ISC), which is encoded by two genes in Arabidopsis (ICS1 and ICS2). ics1 ics2 double mutant showed around 96% of SA reduction after UV treatment, suggesting the existence of an alternative pathway (Garcion et al., 2008). The alternative pathway leads to the synthesis of SA from cinnamate via the action of phenylalanine ammonia lyase (PAL). In Arabidopsis 4 PAL isoenzymes are found (PAL1, 2, 3 and 4). Chemical inhibition of PAL genes in Arabidopsis led to a reduced pathogen-induced SA accumulation (Mauch-Mani et al., 1996). Two other genes, PBS3 and EPS1, operating downstream of PALs or ICS1, have been shown to play an important role in pathogen-induced SA accumulation (Jagadeeswaran et al., 2007, Zheng et al., 2009). To this day, the exact way SA is produced in plants is not fully understood. Thus, based on these pieces of information, I decided to study the expression of PALs and ICS1 (also called SID2). PAL1 and PAL2 expression were found induced upon S. littoralis feeding on Col-0 plants (figure 2.45A). This observation is quite

Characterization of a MAPK module involved in Arabidopsis response to wounding 75

JAZ10 VSP2

0,3 1,5 Col0 Col0 level 0,25 level

mkk3-1 mkk3-1 0,2 mkk3/MKK3-YFP 1 mkk3/MKK3-YFP 0,15 transcript 0,1 transcript 0,5 0,05 0 0 Relative Relative Relative Relative 0 1 3 0 1 3 Time after feeding start (hours) Time after feeding start (hours)

PDF1.2 PR1

2 10 Col0 Col0 mkk3-1 level 8 level

mkk3-1 1,5 mkk3/MKK3-YFP mkk3/MKK3-YFP 6 1 4 transcript transcript 0,5 2

0 Relative Relative

0 Relative 0 1 3 0 1 3 Time after feeding start (hours) Time after feeding start (hours)

Figure 2.46: Role of MKK3 in the regulation of SA- and JA-responsive genes JAZ10, VSP2, PDF1.2 and PR1 genes expression levels were measured by RT-qPCR in Col-0, mkk3-1 and mkk3/MKK3locus-YFP plants submitted to insect feeding. Actin2 (AT3G18780) was used as a housekeeping gene. The experiment was performed only once (n=1).

puzzling as no SA production was observed in Col-0 plants. In mkk3-1 plants, these two genes levels were higher than in Col-0 at time 0 but largely decreased after 1 and 3 hours. More disturbingly, mkk3/MKK3locus-YFP plants did not behave at all like Col-0 plants. PAL4 and SID2 were not induced by insect feeding in any of the three genotypes. Concerning JA, most of the genes participating in its synthesis have been characterized by molecular, genetic and biochemical approaches (Kombrink, 2012). I decided to study the expression of genes operating at the early steps of JA synthesis: all four LOX genes and AOS. All tested genes except LOX6 were induced by S. littoralis feeding on Col-0 plants, following the same pattern as JA production (peaking at 1 hour and decreasing at 3 hours post-feeding). Their expression pattern was quite intriguing in mkk3-1 plants. LOX1, LOX2 and AOS expression was higher after 1 hour but lower after 3 hours, in comparison with Col-0 plants. LOX3 expression was lower in mkk3-1 plants at all time-points. In any case, mkk3/MKK3lcous-YFP plants never behaved like Col-0 plants (figure 2.45B). In a second part I was interested in the study of SA- and JA-responsive genes. I chose some that were well described in the literature. JAZ10, VSP2, PDF1.2 are well-known markers of JA signaling and insect responses. PR1 is known to be highly induced upon pathogen challenge and SA accumulation. JAZ10 and VSP2 were indeed induced in Col-0 plants upon insect feeding (figure 2.46). Their expression peaked at 1 hour and decreased back at 3 hours post-feeding. PDF1.2 and PR1 were not induced by insect feeding on Col-0 plants. JAZ10 and VSP2 expression was decreased in mkk3-1 plants 1 and 3 hours post- feeding. On the contrary PR1 expression was induced in mkk3-1 plants. PR1 was actually the only gene for which a consistency was found with the previously observed SA levels. Unfortunately, once again, the complemented line did not fully play its part. All the qPCR analyses of this part have been performed only once. Additionally, Axel Mithöfer provided us with very few single leaves on which insects had fed. It is known that stress responses strongly depend on leaf age as well as rosette phylotaxy and the fact that the leaves provided by Axel for each genotype and time-point are not of the same age may induce a strong variability hiding a transcriptional phenotype. On another hand, it was confusing for us to note that the complemented line was not able to complement gene expression disturbances whereas it was nicely complementing hormonal deregulations observed in mkk3-1 plants upon insect feeding as well as MPK2 activity decrease observed in mkk3-1 plants upon wounding, B. cinerea and S. littoralis. The most direct conclusion would

Characterization of a MAPK module involved in Arabidopsis response to wounding 76

A

140 Col0 mkk3-1 120

100

80

60

40 Trichomenumbers 20

0 Control Forceps Needle

B

Non-wounded Wounded with Wounded with needle forceps

Figure 2.47: Wounding-induced trichome formation Col-0 and mkk3-1 plants were regularly wounded on their cotyledons and two first leaves and trichomes were counted on leaf n°5 after 12 days. A: The graph shows trichome numbers on leaf n°5 of Col-0 and mkk3-1 plants. Each bar represents an average of around 10 measurements. B: Pictures of trichomes on leaf n°5 of Col-0 plants.

be that the differences observed in genes expression in mkk3-1 plants are not due to the mutation of MKK3 but other variations in the genome. As this non-complementation of gene expressions was observed several times in other experiments when mkk3/MKK3locus-YFP plants were used, we favored the assumption that something could be wrong with this line. We formulated the hypothesis that somehow the C-terminal YFP tag could be disturbing for gene regulations. Nevertheless this hypothesis brings another one: as MPK2 activity is restored in the complemented line, the potential effect of MKK3 on genes expression would be direct (MKK3 directly interacts with some transcription factors or gene promoters) rather than indirect (the regulation goes through the downstream MAPKs). We are currently in the process of creating untagged mkk3/MKK3locus-YFP lines.

3. Wounding-induced trichome formation

One of the documented JA-dependent wound responses is the formation of trichomes, specialized defense cells. Herbivore- or wound-induced damage on old leaves leads to an increased trichome density in newly forming leaves. This wounding-induced trichome formation is abolished in mutants of JA biosynthetic or signaling pathway (Yoshida et al., 2009). As the wounding-induced activation of our MKK3-dependent module depends also largely on JA signaling, I decided to investigate a putative role of MKK3 in trichome formation. For this purpose, I used the published protocol (Poudel et al., 2016) which consists in wounding specific leaves of Arabidopsis plants with intervals over the course of 12 days. At the end, new formed leaves are observed under a stereomicroscope and trichomes are counted. In my case, two different tools were used for the wounding. On one hand, leaves were squeezed through their midvein using a forceps. On the other hand, leaves were punctured once on each side of the midvein with a needle. Wounding was performed on both cotyledons and the two first true leaves of 2 week-old Col-0 and mkk3-1 plants grown on soil. Trichomes were observed on leaf n°5. Measurements were made regardless of the leaf surface which obviously created a bias since wounded plants had a retarded development and were thus far smaller than control plants at day 12. The result is shown on figure 2.47A. The wounding-induced trichome formation was not visible in our conditions: since wounded leaves were smaller they also had less trichome. However, although the trichome density was not measured, no increase was notable by eye (figure 2.47B).

Characterization of a MAPK module involved in Arabidopsis response to wounding 77

B - 10 A 2347 non

1

1929 - Col-0 Col-0 Non-wounded 2h post-wounding 5

mkk3 /

1 3 (log2) 11 2 0 wounding mkk3-1 mkk3-1 - Non-wounded 2h post-wounding wounded -5 2h post

2163 1

- -5 0 5 10 1700

mkk3 Col-0 2h post-wounding / Col-0 non-wounded (log2)

Figure 2.48: Transcriptomic analysis of mkk3-1 plants submitted to wounding did not highlight any MKK3-regulated genes A: Pair comparisons used for the microarray. For comparisons among the same genotype, expression ratios of genes differentially regulated in wounded plants compared to non-wounded plants were calculated. For comparisons among the same condition, expression ratios of genes differentially regulated in mkk3-1 plants compared to Col-0 plants were calculated. Numbers of statistically up- and down- regulated genes (with ratios ≥1 or ≤-1) for each comparison are highlighted in respectively red and green. B: The graph shows the average Log2 ratio of wounded Col-0 plants on non-wounded Col-0 plants compared to the average Log2 ratio of wounded mkk3-1 plants on non-wounded mkk3-1 plants . The correlation coefficient (R²=0,9659) reflects the absence of major differences between the two genotypes. Differentially expressed genes are highlighted in red.

Genes up-regulated in ATG Ratio Genes down-regulated in ATG mkk3-1 number Ratio mkk3-1 number Xyloglucan Copia-like retrotransposon endoTransglycosylase- AT5G57550 1,1783 AT5G35935 -2,4636 Related protein (XTR3) family Gypsy-like retrotransposon AT5G31770 1,1224 MKK3 AT5G40440 -1,7031 family Gypsy-like retrotransposon AT2G13390 1,0596 BETA-AMYLASE 5 AT4G15210 -0,9606 family CALMODULIN-LIKE 41 AT3G50770 -0,9525 QUA-QUINE STARCH AT3G30720 0,9899 RECEPTOR LIKE PROTEIN Gypsy-like retrotransposon AT2G32680 -0,9013 AT4G03790 0,9842 23 family Gypsy-like retrotransposon WRKY30 AT5G24110 -0,8715 AT2G09187 0,9048 family SDE3, SILENCING GLYCINE RICH PROTEIN 9 AT2G05440 -0,8674 AT1G05460 0,8405 DEFECTIVE

Table 2.4: Few MKK3-regulated genes were found The table displays names, ATG numbers and expression ratios of genes that were found misregulated in mkk3-1 plants compared to Col-0 plants upon wounding. A positive ratio reflects a higher expression of the corresponding gene in mkk3-1 plants whereas a negative ratio indicates a lower expression.

4. Transcriptomic analysis of mkk3-1 plants submitted to wounding did not highlight any MKK3-regulated genes

An easy way to gain clues about the role of a protein is to identify misregulated genes in the corresponding mutant. Our laboratory has performed a microarray to compare Col-0 and mkk3-1 plants treated or not with ABA. The analysis had been performed on plants harvested 4 hours after the ABA treatment and thus after the peak of MPK2 activity (Danquah et al., 2015). In the case of wounding, the peak of MPK2 activity is observed at 1 hour post- wounding. Thus we decided to carry out the microarray on samples harvested 2 hours post- wounding. Non-wounded samples were also used as controls. Col-0 and mkk3-1 plants were compared as shown in figure 2.48A. Each condition was tested three times from biologically independent samples. Many genes were regulated by wounding and with rather high log change values (figure 2.48B). For example, 2347 and 1929 genes were found to be statistically up- and down-regulated respectively in Col-0 plants. On the other hand, we were very astonished when we realized that Col-0 and plants impaired in MKK3 virtually do not show any strong differences in term of gene expression. Only a handful of genes were found statistically deregulated when wounded Col-0 and wounded mkk3-1 samples were compared, including XTR3, QQS and SDE3 which are up-regulated in mkk3-1 and BAM5, CL41 or RLP23 that are down-regulated in mkk3-1 (figure 2.48B (in red) and table 2.4). None of the well-known wound-induced genes were found. In conclusion, according to statistical analysis, the wounding stress was indeed reflected at the transcriptional level but no role for MKK3 was highlighted. It is surprising that this approach did not identify “interesting” genes whose expression could depend on MKK3 upon wounding. Several explanations are possible. First of all, it is possible that the chosen time-point, 2 hours after wounding, is not very relevant. As no MKK3-dependent wounding-induced (or JA-induced) genes were described in the literature, we had no reference beside the microarray performed in an ABA context. Another possibility is that the wounding I applied, which was very strong, triggered redundant signaling pathways, rending MKK3 module not necessary. This is supported by the fact that the number of wound-regulated genes we identified is four times higher than other published transcriptomic studies (Kilian et al., 2007). Last, it is possible that MKK3 pathway does not regulate gene reprogramming but other cellular processes such as enzymatic activities involved in wounding responses. It would be interesting to test this hypothesis by performing

Characterization of a MAPK module involved in Arabidopsis response to wounding 78

= specific feeding pattern + oral secretions

JA

Negative SCF/COI1 feedback loop

MKK3

MPK1

MPK14 MPK2 MPK7

Accumulation of JA and SA

Figure 2.49: Theoretical model on the role of MKK3 in phytohormone regulation upon S. littoralis feeding MKK3 negatively regulates JA and SA levels upon insect feeding. Assuming that JA could also have a key role upstream MKK3-MPK2 in the activation upon S. littoralis feeding, a feedback loop would exist that acts to restrain the duration of MKK3-dependent responses.

a metabolomic study of plants impaired in the module. But still, it is surprising that such enzyme regulations do not have any indirect effect on gene expression.

5. Discussion

In this part were presented phenotyping experiments I performed to identify the potential roles of MKK3 in stress responses. I was not able to show any important role for MKK3 in the resistance towards B. cinerea and S. littoralis, the two tested pathogens, which are known to largely induce wounding-related stresses. However, I showed that MKK3 might play a role in phytohormone regulations upon S. littoralis feeding by negatively regulating JA and SA levels. Interestingly this hormonal regulation defect has not been observed using mechanical wounding, suggesting a role for MKK3 specifically under herbivore-induced wounds. A possibility is that insect saliva contains molecules necessary for the complete hormonal response or, alternatively, that wounding performed in the laboratory with forceps does not mimic the insect-induced wounding. Such hypothesis is currently under investigation in the laboratory of our collaborator Axel Mithöfer. Interestingly, JA, which seems to be negatively regulated by MKK3-dependent modules based on mkk3-1 phenotype upon insect interaction, is also a potent activator of the module. This suggests a negative feedback loop in which MKK3 module acts to restrain the duration and the amplitude of the downstream defense-responses it triggers (figure 2.49). Surprisingly, mkk3-1 plants produced SA upon insect feeding whereas Col-0 plants did not. This suggests that one of MKK3 functions is to inhibit SA production upon stresses. The way MKK3 exerts a control on hormonal levels remains to be determined. A possible regulation at the transcriptional level of enzymes involved in their biosynthesis was briefly tested but would need to be pushed further. The variation of hormone levels upon insect feeding was actually the only phenotype for mkk3-1 plants that we obtained. Based on our knowledge on the SA/JA antagonism that SA inhibits JA-induced responses at the transcriptional level, we can expect that JA-dependent wounding-induced (or herbivore- induced) defense responses are reduced in mkk3-1 plants which, unlike Col-0 plants, produce a high amount of SA upon insect feeding. One study assesses the impact of SA and JA on the resistance of Arabidopsis to S. littoralis (Stotz et al., 2002) using coi1 and npr1 mutants. The authors showed that SA and JA have opposite effects on plant resistance as, compared to wild type plants, coi1 plants showed enhanced susceptibility to larvae whereas npr1 plants were

Characterization of a MAPK module involved in Arabidopsis response to wounding 79

more resistant. The fact that npr1 plants, which are impaired in the perception of SA, show an increased resistance to the insect suggests that SA is engaged and mediates susceptibility towards S. littoralis. The authors also claim to have measured SA production upon S. littoralis but do not show any data regarding that point. The authors also tested the relationship between the two hormones. Exogenous application of SA was able to reduce JA amounts induced by the insect. We could not draw any conclusion from our resistance study on the role of MKK3. However among the three independent experiments, the one showing a significant difference between Col-0 and mkk3-1 plants highlighted a higher susceptibility of mkk3-1 plants. If such a difference was to be confirmed by the increase of experimental repetitions, it would be consistent with the pattern of phytohormone production. Indeed, the SA produced in mkk3-1 plants would negatively regulate the JA-mediated resistance towards the insect compared to Col-0 plants and therefore decrease plant resistance. Intriguingly, the regulation of phytohormone levels was not reflected by the large microarray analysis carried out on mkk3-1 mutant. We could have expected differential expression of JA- and SA-related genes. This discrepancy supports the hypothesis that MKK3 rather acts at the post-translational level by regulating the activity or the localization of its targets. Wounding-induced trichome formation was tested as one of the many JA-induced responses without any conclusive outcome. Many others could still be tested such as the production of metabolic and volatile compounds or growth inhibition. Concerning the latter, a study showed a role for MKK3 in the JA-induced root growth inhibition (Takahashi et al., 2007). Since wounding also leads to root growth inhibition through the production of JA (Gasperini et al., 2015), it would be interesting to monitor the growth of mkk3-1 roots upon wounding.

Characterization of a MAPK module involved in Arabidopsis response to wounding 80

CHAPTER III: CONCLUSIONS & PERSPECTIVES

I. A MAPK signaling network activated in response to wounding

1. Toward a sequential and interdependent activation of two MAPK modules

Before I started my PhD project, our knowledge about MAPK involvement in response to wounding in plants was reduced and was mainly concerning A-group MAPKs. In tobacco, WIPK and SIPK, orthologs of Arabidopsis MPK3 and MPK6 respectively, were shown to be rapidly activated by wounding. WIPK was shown to regulate JA levels as transgenic plants in which WIPK (homologue of AtMPK3) expression was suppressed were not able to accumulate JA upon wounding (Seo et al., 1999). In addition, a constitutive expression of the gene led to higher levels of JA compared to wild-type plants (Seo et al., 1999). Silencing of SIPK (homologue of AtMPK6) also led to decreased JA levels (Seo et al., 2007). NaMEK2, identified as the MAP2K acting upstream of WIPK and SIPK upon wounding, was also shown to regulate JA and ET levels (Heinrich et al., 2011). Very similarly in tomato (Solanum lycopersicum), LeMPK1 and LeMPK2, which are orthologs of SIPK, were activated by herbivory and their silencing led to the reduction of JA levels and the expression of JA biosynthesis genes (Kandoth et al., 2007). These observations suggest that in Arabidopsis, MAPKs activated by wounding could also be involved in the regulation of JA levels. In Arabidopsis, the classical MPK3 and MPK6 are also rapidly activated by wounding (Ichimura et al., 2000; Li et al., 2017). Beside these iconic stress-activated MAPKs, another study has shown the activation of the C-group MAPKs MPK1 and MPK2 by wounding (Ortiz-Masia et al., 2007), which has been the starting point of my work. The results I obtained throughout this work gave a more precise view of MAPK cascades in a wounding context. I was able to show that two apparently independent modules are activated with distinct kinetics. First, the well-known MPK3 and MPK6 are activated few minutes after wounding and their activity fades after 30 minutes and I showed that their activation is not dependent on MKK3. Besides MPK3/MPK6, I was able to show that MKK3 and C-group MAPKs (MPK1, 2, 7 and 14) form a functional module activated by wounding.

Characterization of a MAPK module involved in Arabidopsis response to wounding 81

MKK4/MKK5 MAP3K

MKK3 MPK3 MPK6

MPK1 JA MPK14 MPK2 MPK7

MAP3K

ET synthesis ?

Figure 3.1: Hypothetical model on the interdependent activation of two MAPK modules upon wounding Upon wounding, the MKK4/MKK5-MPK3/MPK6 module is rapidly activated and leads to the synthesis of JA. The production of JA activates MKK3-dependent modules through the transcriptional regulation of MAP3Ks. The whole cascade controls ethylene synthesis.

My experiments also suggest that their activation, which occurs quite belatedly, from 30 minutes post-wounding and lasts a couple of hours, is likely dependent on the transcriptional regulation of sub-clade III MAP3Ks and partially under the control of JA. This observation of two waves of MAPK activation is intriguing and raises the question of whether they are dependent on each other. In mpk3 and mpk6 mutants, I was not able to see any decrease of wounding-induced activation of MPK2 but a functional redundancy between MPK3 and MPK6, which has been shown in other contexts, cannot be excluded. Sadly, available mpk3 mpk6 double mutants are lethal because of a redundant role in development (Wang et al., 2007). A recent study showed that MPK3/MPK6 activation by wounding is impaired in the mkk4 mkk5 double mutant (Li et al., 2017). As stated above, orthologs of MPK3 and MPK6 in tobacco (WIPK and SIPK) are involved in wounding-induced JA production and I showed that JA is an important activator of MKK3-dependent modules. Taken together, these data indicate that the activation of MKK3-C-group MAPKs could depend on the MKK4/5- MPK3/6 module. To test this hypothesis, the use of the mkk4 mkk5 double mutant will be very useful. It would also be necessary to measure wounding-triggered JA levels in mkk4 mkk5 mutants to check whether hormonal regulations are conserved among species. Finally, in Arabidopsis, MPK3 and MPK6 were shown to regulate wounding induced ET production by regulating the expression of ACS genes involved in its biosynthesis. Therefore, if the dependency of MKK3-C-group MAPKs activation towards MPK3/6 is confirmed, it would be interesting to measure wounding-induced ET levels in plants impaired in MKK3. Our hypothetic model based on such interdependency is illustrated in figure 3.1.

2. Spatial organization of MAPK activation upon wounding

As stated in the introduction, wounding triggers many cellular events and is therefore very complex to study. An important aspect which deserves some attention is the spatial organization of those events. It is obvious that there is a strong gradient of responses between the cells which have been physically wounded -and are meant to die- and the ones surrounding this central area, which are likely to adapt and survive. Closest cells to the wound site feel the wounding through mechanical repercussion whereas distant cells, sometimes located in other tissues or organs, are alerted by electrical or chemical signals. Neighboring plants may in some extend also react without being injured themselves. This theoretical problematic is complex to tackle but very important if we want to understand the coordination

Characterization of a MAPK module involved in Arabidopsis response to wounding 82

of stress signaling and describe local responses. One possibility is that the MKK4/5-MPK3/6 module is activated very locally at the wounded side and that a systemic signal, JA for instance, allows the activation of MKK3-MPK1/2/7/14 in a surrounding area. In this condition, finding a phenotype controlled by MKK3-related modules would become more complicated without a first characterization of the spatial distribution of MAPK modules. Smart fluorescent sensors have been developed in animals (Harvey et al., 2008; Lindenburg & Merkx, 2014; De la Cova et al., 2017) but will deserve some adaptation for plant system (with the problem of MAPK specificity). An alternative for MKK3-related modules will consist in studying the spatial expression of MAP3Ks. We showed that sub-clade III MAP3Ks are strongly transcriptionally regulated in time and we may assume that they also are in space. Strikingly a preliminary experiment showed that it might be complex: MAP3K18 is expressed specifically in guard cells upon ABA treatment whereas it is expressed in epidermal cells upon wounding. Promoter::GUS lines would be more informative at the tissue and organ levels. Overall, this suggests that it would be useful to resolve the spatial expression of each sub-clade III MAP3Ks in response to stresses upon which they are found induced.

II. A novel MKK3-dependent module activated by environmental constraints through transcriptional regulation of MAP3K genes

1. An emerging general working model…

In the literature, not much was known about the involvement of MKK3/C-group modules in stress responses and even less in the context of wounding and herbivory. Some studies have shown the activation of C-group MAPKs by wounding and JA (Ortiz-Masia et al., 2007) and some even placed MKK3 upstream them in response to H2O2, pathogens or ABA (Dóczi et al., 2007; Danquah et al., 2015). Studies previously carried out by Agyemang Danquah, Marie Boudsocq and Axel de Zelicourt in the “Stress Signaling” group unveiled an atypical mode of activation of MKK3-dependent modules in response to ABA, occurring through an important step of transcriptional regulation of upstream MAP3K genes. This protein synthesis step was responsible for a delay in the activation of the module (Boudsocq et al., 2015; Danquah et al., 2015). This finding was breaking our idea according to which MAPKs are rapidly activated upon stress perception. My work, as well as the work of Camille

Characterization of a MAPK module involved in Arabidopsis response to wounding 83

MPK7-HA in Col-0 MPK7-HA in mkk3-1 A NO3 KCL NO3 KCL

0 15’ 30’ 1h 15’ 30’ 1h 0 15’ 30’ 1h 15’ 30’ 1h Activity MPK7 (IP α-HA)

Western blot α-HA Coomassie staining

B MPK7-HA MPK7-HA in Col-0 in nlp7

0 NO3 KCl 0 NO3 KCl

Activity MPK7 (IP α-HA)

Western blot α-HA

Coomassie staining

(15 min after resupply)

Figure 3.2: MPK7 is activated by nitrate in an MKK3- and NLP7- dependent manner Autoradiographs show MPK7 activity through MBP phodphorylation after IP with α-HA antibodies. Western blot show MPK7 protein amount after incubation with α-HA antibodies. Coomassie stainings show total protein amount.

A: Col-0 and mkk3-1 plants expressing MPK7-HA were supplied with NO3 after 3 days of starvation. MPK7 activity was assayed over a time course following resupply. KCl was used as a control.

B: Col-0 and nlp7 plants expressing MPK7-HAwere supplied with NO3, MPK7 activity was

assayed 15 minutes after resupply.

Chardin and Sebastian Schenk on MPK7 activation in response to nitrogen (which has been performed at the same time in the laboratory, in the frame of a collaboration with Anne Krapp – not published) enlarged this working model to other stimuli, suggesting that the ABA- dependent regulation of MAP3K18 is not anecdotic, but rather a shared mechanism for the activation of MAPK modules. The starting point of the study of MKK3-dependent modules in nitrogen signaling was that MAP3K13 and MAP3K14 appeared strongly and rapidly regulated - by NO3 (nitrate) resupply of previously starved plantlets (Marchive et al., 2013). This regulation is under the control of NIN-like protein 7 (NLP7), a major transcription factor - involved in nitrate signaling in roots which relocates from cytosol to nucleus upon NO3 and - is able to bind promoters of many NO3 -responsive genes including MAP3K13, 14, 17, 18 and 19. All those MAP3Ks are members of the sub-clade III MAP3Ks. Therefore according to our model, MKK3 and C-group MAPKs should be downstream of those MAP3Ks in a nitrate context. Camille Chardin and Sebastian Schenk assayed the activity of MPK7 in Col-0, mkk3- 1 and nlp7 plants after nitrate resupply (figure 3.2). MPK7 was activated by nitrate, less by - nitrite (NO2 ) and not by ammonium or glutamine, and this activation was strictly dependent on MKK3 and partially dependent on NLP7 (which belong to a multigenic family). The laboratory is currently testing the role of MAP3K13 and 14 upstream of MKK3-MPK7. Interestingly, MAP3K13 has also been found recently in a transcriptomic experiment among target genes of NLP8, a very close homologue of NLP7, which is involved in the nitrate- dependent control of seed dormancy (Yan et al., 2016). I was able to show that all sub-clade III MAP3Ks interact with MKK3 and activate MKK3-MPK2 in mesophyll protoplasts. Based on the observations made in the context of ABA and nitrate and on Genevestigator data, we realized that sub-clade III MAP3Ks are generally transcriptionally regulated (Colcombet et al., 2016). A recent study showed that Arabidopsis lines over-expressing MAP3K14, 15, 16, 17 or 18 share a same phenotype of insensitivity to ABA during seed germination (Choi et al., 2017), indicating a functional redundancy among them. Besides, such a result also suggests that strategies of over- expression can lead to wrong conclusions. Overall, these studies reinforced our model according to which transcriptional regulation is a conserved feature of sub-clade III MAP3Ks and that different association of the latter are induced by different stresses.

Characterization of a MAPK module involved in Arabidopsis response to wounding 84

2. …coexisting with other models?

Several studies showed the involvement of MKK3 in module with others MAPKs. Figure 1.11 tries to summarize literature about sub-clade-III MAP3Ks, MKK3 and C-group MAPKs functioning in alternative modules. For example, MKK3 was shown to act upstream MPK6 in response to JA (Takahashi et al., 2007) and to blue light (Sethi et al., 2014). Another study placed MKK3 upstream of MPK8 in response to wounding to control ROS homeostasis (Takahashi et al., 2011). I showed the regulation of MKK3 by JA but was unable to show any JA-induced regulation of MPK6. Furthermore, the laboratory has not been able to show that MPK6 is under the control of MKK3. Indeed, expression of constitutive MKK3 (MKK3EE) in protoplasts does not activate MPK6 or MPK8 (Danquah et al., 2015). It is important also to note that authors often did not include careful controls and therefore the observed MPK6 activation by JA could be due to mechanical stresses related to manipulation. At last, none of those studies could show a direct interaction of MKK3 with MPK6 or MPK8, whereas MKK3 is able to interact with C-group MAPKs and MPK6 with MKK4/5 in Y2H assays (Doczi et al., 2007; Lee et al., 2008). The Y2H assay that we carried out pointed out that MKK3 interacts only with sub- clade III MAP3Ks. However, the reciprocal relationship has never been tested, therefore leaving the possibility that sub-clade III MAP3Ks interact and activate other MAP2Ks. One study from the literature suggests that MAP3K20 could act upstream MKK5-MPK6 in response to ABA (Li et al., 2017).The building of a multiple map3k mutant would help to shut down any potential parallel module which activation is also dependent on sub-clade III MAP3Ks. MAP3K20 has also been proposed to interact directly with MAPK18 (Benhamman et al., 2017).

3. Open questions about the functioning of sub-clade III MAP3Ks- MKK3-C-group MAPKs modules

a. Functional redundancy within the module at the MAP3K and MAPK levels

Upon wounding, I was able to show that many sub-clade III MAP3Ks are transcriptionally induced. Among them, I was able to highlight an important role for MAP3K14 in the activation of MKK3-MPK2 by wounding. However the corresponding single knock-out mutants did not completely shut down the activation of MKK3-MPK2,

Characterization of a MAPK module involved in Arabidopsis response to wounding 85

probably because of high functional redundancy with other MAP3Ks. Similarly, the knock- out mutations of MAP3K17 and MAP3K18 do not totally impair the ABA-dependent MPK7 activation (Danquah et al., 2015). And as a matter of fact, 6 MAP3Ks of sub-clade III are able to interact with MKK3 in Y2H and the whole clade activates MKK3-MPK2 in Arabidopsis mesophyll protoplasts. It would be wise to follow up with the CRISPR-Cas9 technology, that we managed to use to build some map3k single and double mutants, in order to build multiple mutants and thus identify exactly the MAP3Ks acting upstream our module in the context of various stresses. Throughout this work, mkk3-1 was used under the assumption that plants impaired in MKK3 are also indirectly impaired in MPK1, 2, 7 and 14. Those 4 MAPKs being closely related, it is likely that they also share functional similarities. And indeed, we assessed several times MPK1, MPK2 and MPK7 activation in the same samples in response to nitrate or wounding and found that they behave very similarly. Once the role of mkk3-1 is assessed it would be interesting to confirm it using a quadruple mpk1/2/7/14 mutant which is supposed to have an identical phenotype. Two simple hypotheses may explain the duplication of C-group MAPKs. A first possibility is that they have the same function but are not expressed in the same cell types or at the same moment, complementing the lack of each other. The study of promoter::GUS lines will help to address this question. The other possibility is that they do not share same substrates. Identifying them will clearly help to validate this possibility.

b. Are MAP3Ks also regulated by phosphorylation?

Although sub-clade III MAP3Ks are transcriptionally induced by numerous stresses, a post-translational regulation is not to exclude. MAP3K18 de novo synthesis is required for the activation of MKK3-MPK7 by ABA with a rather slow kinetics (4 hours post stress). However, other studies have shown a more rapid activation of C-group MAPKs by ABA (from 15 minutes post-stress) (Ortiz-Masia et al.; 2007; Umezawa et al., 2013) which suggests that a post-translational activation of MAP3Ks is possible. Using Arabidopsis lines constitutively expressing tagged versions of MAP3K18, another study showed the increase of MAP3K18 activity 15 minutes after ABA treatment (Matsuoka et al., 2015). Such differences could be explained by different experimental conditions between laboratories. In any case, it would be interesting to develop genetic tools to be able to test directly the kinase activity of

Characterization of a MAPK module involved in Arabidopsis response to wounding 86

candidate MAP3Ks upon wounding as well as initiate biochemical approaches to identify PTMs on MAP3Ks.

c. A mysterious and conserved NTF2-like domain in the C-terminal end of MKK3

MKK3 is the only member of group B and is characterized by the presence of a NTF2-like domain at its C-terminal end. This domain, which is conserved in all plant MKK3s, was not characterized so far. It could have a role in the nuclear addressing of MKK3 upon a given stress. Once the cellular localization of MKK3 upon stresses is assessed, it could be interesting to compare it to plants expressing a modified MKK3 lacking its NTF2 domain. Preliminary experiments performed by Jean Colcombet in the laboratory suggested that wild- type MKK3 localizes in the cytosol and the nucleus at resting conditions. However, we were not able to see any relocation upon ABA treatment. It is possible that MKK3 nucleo- cytoplasmic turnover increases upon stresses without modifying the relative quantity of nuclear and cytosolic MKK3s. This is difficult to bring to light without using complex microscopy tools such as FRAP (Fluorescence Recovery After Photobleaching). Another possibility is that C-group MAPKs are localized in the nucleus and require the presence of MKK3 there to be activated. It would be interesting to know where MPK1, 2, 7 and 14 are located in resting conditions. Alternatively, the C-terminal NTF2 domain of the Ca2+/calmodulin dependent protein kinase II (CAMKII) was shown to be involved in its oligomerization (Morris & Török et al., 2001). We could imagine the same mechanism occurring for MKK3, in which case NTF2 would have a structural function necessary for the stability and the activity of the protein. To test the hypothesis of MKK3 dimerization, interaction assays could be performed between two MKK3 proteins. Another possibility is to perform western blot analyses to detect MKK3 after protein extraction in non-denaturant conditions. Concerning the effect of the NTF2 domain on MKK3 activity, mkk3-1 plants could be complemented with a version of MKK3 lacking its NTF2 domain and the activity of downstream MAPKs tested.

Characterization of a MAPK module involved in Arabidopsis response to wounding 87

III. A role for MKK3 in stress responses?

1. A well-conserved MAPK through evolution

Although the activation of MKK3-dependent modules upon wounding and diverse conditions was not very complicated to demonstrate, I did not succeed to find and understand the responses controlled by MKK3-dependent signaling pathways in response to mechanical wounding. It is possible that the role of the protein is quite weak and technically difficult to reveal and that appropriate conditions were not fulfilled to bring it to light. However, the protein could still have an important evolutionary role. MKK3 is an atypical MAP2K and the only member of sub-group B (Ichimura et al., 2002). Its sequence and secondary structure are rather different from the other MAP2Ks but are very well conserved among MKK3 homologues found in other plant species (Colcombet et al., 2016). It is highly conserved in almost all monocots and dicots as well as in the primitive angiosperm Amborella trichopoda. MKK3-like kinases are also found in the moss Physcomitrella patens. In addition, a MAP2K possessing an NTF2-like domain in its C-terminal end is also found in the unicellular green algae Chlamydomonas reinhardtii. These observations suggest that MKK3-related pathways could also be conserved among all photosynthetic eukaryotes and probably have a very important role.

2. A role in herbivory signaling?

Throughout my work, the only phenotype obtained for mkk3-1 plants was the increase of JA and SA levels observed upon insect feeding. This hormonal regulation seems to be specific of insect feeding since it was not observed upon mechanical wounding. It would be interesting to better understand such specificity: is it due to insect oral secretions or to their specific feeding pattern? And moreover, is it specific of that particular insect (S. littoralis) or could the observation be extended to other species? To address those questions, we could take advantage of tools developed by our collaborators to test the effects of oral secretions applied on previously mechanically wounded plants or used the Mecworm robot able to mimic insect feeding pattern (Mithöfer et al., 2005). Assays could also be performed with a specialist herbivore such as the commonly used Pieris rapae. In addition to mechanical wounding and insect feeding, MKK3 was found activated by the necrotroph B.cinerea. Broadly speaking, MKK3 seems to be activated by stresses upon

Characterization of a MAPK module involved in Arabidopsis response to wounding 88

which JA is known to have a prevailing role in the mediation of defense responses. It could be interesting to also measure phytohormone levels upon interaction with B. cinerea comparing Col-0 and mkk3-1 plants. Biotrophic pathogens, in response to which SA is the major hormone activating defense responses and JA has a minor role, were not tested in their ability to activate MKK3-dependent modules. However, flg22, which can mimic the interaction with the biotrophic bacterium P. syringae, did not activate MKK3-dependent modules. Moreover, the wounding-induced resistance to B. cinerea was not affected by the mkk3-1 mutation. Since an important production of SA was observed in mkk3-1 plants upon caterpillar feeding, it would be interesting to see if a pre-interaction of mkk3-1 plants with S. littoralis could lead to an increased resistance toward biotrophic pathogens. The theoretical experiment would consist in submitting Col-0 and mkk3-1 plants to S. littoralis feeding prior to an infection with P.syringae and compare bacterial growth in both genotypes.

3. Characterized phenotypes in other stress and developmental contexts

On the other hand, MKK3 has been studied in other stress contexts and some phenotypes have been characterized. mkk3-1 plants were studied in a context of plant- pathogen interaction and were shown to be hypersensitive to Pseudomonas syringae DC3000 (DÓczi et al., 2007). MKK3 was also studied in a JA context together with MPK6 and was shown to have a role in JA-induced growth inhibition. Indeed, mkk3-1 plants were more sensitive to exogenous JA as they displayed shorter roots. mkk3-1 plants also showed a reduced expression of the JA marker gene PDF1.2 (Takahashi et al., 2007). Since wounding was shown to trigger root growth inhibition through the production of JA (Gasperini et al., 2015), it would be interesting to monitor the growth of mkk3-1 roots upon wounding. Other studies showed the hypersensitivity of mkk3-1 plants to auxin (Enders et al., 2017) and gibberellin as well as insensitivity to red light (Lee et al., 2015). Arabidopsis plants impaired in MKK3 were studied in a drought context and appeared to be less efficient to restrict water loss upon long-term mild drought conditions (Danquah et al., 2015). Similarly in cotton, plants over-expressing GhMKK3 were shown to be more resistant to drought and more efficient to close their stomata in response to ABA (Wang et al., 2016). In addition, mkk3-1 plants were shown to be hypersensitive to ABA in root elongation and germination. Indeed, mkk3-1 seeds show a higher decrease of germination rate upon ABA treatment compared to

Characterization of a MAPK module involved in Arabidopsis response to wounding 89

120 Col-0

100 mkk3-1 (%) mkk3/MKK3 80 days 4

60 after

40

Germination 20

0 0 10 20 30 40

Time after seed harvesting (days)

Figure 3.3: mkk3-1 plants show increased dormancy Col-0, mkk3-1 and mkk3/MKK3locus-YFP seeds were harvested differentially and sown on a new medium. Germination rate was calculated 4 days later.

wild-type seeds as well as greater ABA-induced root growth inhibition (Danquah et al., 2015). In both wheat and barley, recessive mutations of MKK3 orthologs revealed a role for MKK3 in the control of dormancy, a phenomenon in which ABA is largely involved (Nakamura et al., 2016; Torada et al., 2016). Recently, some germination assays were performed in the “Stress Signaling” group, comparing Col-0, mkk3-1 and mkk3/MKK3locus- YFP plants. mkk3-1 seeds germinated significantly more belatedly compared to the two other genotypes (figure 3.3). Overall, these data clearly suggest a role for MKK3 in germination/dormancy. Therefore it would be interesting to go further in that direction and better characterize MKK3 and its partners during germination. First it would be necessary to study the expression and the activation of MKK3 in seeds at different stages. Then it would be interesting to check if candidate partners of MKK3 share its dormancy phenotype. Thus, germination assays could be performed on mpk1/2/7/14 quadruple mutants and map3k mutant combinations.

4. The hunt of MPK1/2/7/14 substrates

As many other signaling components, MKK3-related modules are also shared between different stresses (ABA treatment, JA, wounding, pathogens…) thus the specificity of responses should occur downstream the activation of the module and likely at the transcriptional level of stress-responsive genes, which constitutes an output of signaling processes. Unfortunately, our microarray analysis did not point out any MKK3-related wounding-induced genes. Another possibility would be to identify direct substrates of MKK3 and MKK3-related modules. We could take advantage of the TAP-tag technique that is well- mastered in the “Stress Signaling” group that, couple to mass spectrometry, could help identifying interactants of candidate MAPKs. Those could later be validated by Y2H or in planta BiFC (Bimolecular Fluorescent Complementation) assays. Alternatively, phosphoproteomic approaches comparing plants impaired in MKK3-related modules with Col-0 in response to stresses could point candidate substrates that could also be confirmed by in vitro kinase assays. A first hint comes from the work of Umezawa and coworkers which identified MAPK phosphosites in response to ABA (Umezawa et al., 2013). The nature of identified substrates could give some clue about the nature of cellular mechanisms regulated by MKK3 and related modules. So far only one substrate of MKK3-related modules was published. MPK1 was shown to interact with and phosphorylate RBK1 (Rop Binding Protein

Characterization of a MAPK module involved in Arabidopsis response to wounding 90

Kinase 1) in vitro (Enders et al., 2017). Besides, rbk1 mutants shared the auxin hypersensitivity phenotype of mkk3-1 and mpk1 plants but the activation of the whole pathway by auxin was not tested. RBK1 is a predicted S/T protein kinase that was shown to interact with and phosphorylate ROP proteins. These are small GTPases involved in diverse aspects of plant development but also in response to environmental cues (Nibau et al., 2006). It could be interesting to test if RBK1 is a substrate of MKK3-dependent modules in the context of wounding. Overall, my work helped better understanding stress signaling events occurring upon wounding and paved the way to new hypotheses that would be worth to work on in the near future.

Characterization of a MAPK module involved in Arabidopsis response to wounding 91

CHAPTER IV: MATERIALS & METHODS

I. Materials

1. Plant material

The Columbia (Col-0) and Wassilewskija-0 (Ws-0) ecotypes of Arabidopsis thaliana were used. Mutant lines are listed below.

Table 4.1: Mutant lines mentioned in this manuscript

Provided Allele name Ecotype Type of mutation Reference by aos Col-0 T-DNA Park et al., 2002

coi1-16* Col-0 Substitution Ellis & Turner, 2002

coi1-34* Col-0 Substitution E.E. Farmer Acosta et al., 2013 dorn1-1 Col-0 Substitution G. Stacey Choi et al., 2014 HAB Col-0 Substitution Robert et al., 2006

map3k13-1 Col-0 T-DNA (GABI 277E09) A. Krapp

map3k14-1 Col-0 T-DNA (GABI 653B01) A. Krapp

T-DNA (SALK 084817/SALK map3k15 map3k16 Col-0 003255) T-DNA map3k17 map3k18 Col-0 Danquah et al., 2015 (SALK137069/GABI244G02) T-DNA map3k19 Col-0 (WiscDsLoxHs225_01B) mkk3-1 Col-0 T-DNA (SALK 051970) Dóczi et al., 2007

mkk3-2 Col-0 T-DNA (SALK 208528)

T-DNA (SALK mpk1 mpk2 Col-0 M.J. Marcote Ortiz et al., 2007 063847/SALK019507) mpk3-1 Col-0 T-DNA (SALK 151594) S. Ferrari Galletti et al., 2011 mpk6-2 Col-0 T-DNA (SALK 073907) S. Ferrari Galletti et al., 2011 opr3 WS-0 T-DNA (intron) Chehab et al., 2011

T-DNA (SALK 059281/SALK pepr1 pepr2 Col-0 Krol et al., 2010 098161) rbohd rbohf Col-0 T-DNA Torres et al., 2002

wak2-1 Col-0 T-DNA (SAIL 286E03) M. Fagard Kohorn et al., 2006 wak2-2 WS-0 insertion (FLAG 031E03) M. Fagard

* coi1-16 plants contain a second mutation in the PEN2 gene (Ellis & Turner, 2002) and are male fertile under 20°C. coi1-34 plants are partially male sterile.

Characterization of a MAPK module involved in Arabidopsis response to wounding 92

2. Culture media and conditions

a. Plant culture . Plants grown on soil (Jiffy pellet) were cultivated in Percival growth chambers (Plant Climatics) (12h day, 12h night, 70% humidity, 22°C). . ½ MS liquid and solid media were prepared with Murashige Skoog Basal Salts (Sigma M6899) and 0.5% MES, pH 5.7 adjusted with KOH, in the presence or absence of sucrose (1%) and agar (0.5%). Plants were grown in a rotunda (16h day, 8h night, 70% humidity, 23°C).

b. Culture of Botrytis cinerea

Conidial stock suspension of Botrytis cinerea is taken from the -80°C stock and let to thaw at room temperature. The conidial suspension is then spread on Petri dishes containing home- made PDA medium (20 % potato infusion, 2% sucrose and 2% agar) and is let to develop at room temperature. Botrytis cinerea cultures are freshly prepared prior each experiment.

c. Yeast culture For yeast 2-hybrid assays; MaV203 strain was used (genotype – MATα; leu2-3,112; trp1-901; R R his3∆200; ade2-101; cyh2 ; can1 ;gal4∆; gal80∆; GAL1::lacZ; HIS3UASGAL1::HIS3@LYS2; SPAL10::URA3) (Life Technologies). . YPD medium (complex medium): 1% yeast extract, 2% peptone, 2% dextrose; for solid medium 1.2% of agar was added before autoclaving. . YNB medium (minimal medium): 0.17% yeast nitrogen base without amino acids, 2%

dextrose, 0.5% (NH4)2SO4, 0.2% Drop out mix. pH was adjusted to 5.6 with 5 M NaOH. For solid medium, 1.4% of bacto agar was added before autoclaving.

3. Antibodies

a. Primary antibodies:

. α-pTpY: Rabbit monoclonal antibody (Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204)) (Cell Signaling 4370S). . α-Myc: Rabbit polyclonal antibody (SIGMA C3956). . α-HA: Rat monoclonal antibody (SIGMA A2095).

Characterization of a MAPK module involved in Arabidopsis response to wounding 93

. α-GFP: Mouse monoclonal antibody (Roche). . α-MPK6: Rabbit polyclonal antibody (SIGMA A7104). . α-MPK3: Rabbit polyclonal antibody (Davids Biotechnology, Regensburg, Germany). . α-MPK1 and α-MPK2: Rabbit polyclonal antibody kindly provided by M.J. Marcote (Ortiz et al., 2007) . α-MPK7: Rabbit polyclonal antibody developed in Heribert Hirt’s laboratory in Vienna (Dóczi et al., 2007)

b. Secondary antibodies: . α-rabbit: Goat polyclonal antibody conjugated to horseradish peroxidase (SIGMA A6154). . α-mouse: Goat polyclonal antibody conjugated to horseradish peroxidase (SIGMA A5906). . α-rat: Goat polyclonal antibody conjugated to horseradish peroxidase (SIGMA A9037).

4. Vector backbones

. p2GWF7: Destination Gateway expression vector with C-terminal GFP tag for expression of fusion protein in protoplasts. . pDEST22: Destination Gateway vector for yeast 2 hybrid. Allow a constitutive expression of proteins N-terminal fused to GALD4 AD under the control of ADH1 promoter. . pDEST32 modified: Destination Gateway vector for constitutive expression of proteins fused to GAL4 BD under control of ADH1 promoter. This vector has been modified to have a Kanamycin resistance gene. . pDONR207: donor Gateway vector (Invitrogen) used in cloning for generating entry clones. . pGREEN0229: binary vector for the generation of transgenic plants (Halens). . pGREEN0229-HA-Tnos: home-made binary vectors derived from pGREEN0229 for the generation of transgenic plants allowing carrying a MCS-HAx2-Tnos to allow an easy fusion of promotor-ORF or locus with HA in C-terminal.

Characterization of a MAPK module involved in Arabidopsis response to wounding 94

. pGREEN0229-YFP-Tnos: home-made binary vectors derived from pGREEN0229 for the generation of transgenic plants allowing carrying a MCS-YFP-Tnos to allow an easy fusion of promotor-ORF or locus with YFP in C-terminal.

5. Buffers and solutions

a. SDS-PAGE gel . Resolving gel: 30% acrylamide, 1.5M Tris (pH 8.8), 10% SDS, 10% APS . Stacking gel: 30% acrylamide, 1M Tris (pH 6.8), 10% SDS, 10% APS . Running Buffer 10X: 0.25M Tris, 1.92M glycine and 1% SDS

b. Loading buffer (Laemmli) For 6X solution: 30% glycerol, 10% SDS, 0.6M DTT, 0.012% Bromophenol blue, 20% 1.75M Tris-HCl (pH 6.8)

c. Soluble proteins extraction from A. thaliana plant material . Laccus Buffer (10X): 250 mM Tris (pH 7.5), 50 mM EGTA (pH 7.5), 50 mM EDTA (pH 7.5), 750 mM NaCl and 0.5% Triton X-100 . Extraction buffer: 10% Laccus Buffer 10X, 20 mM NaF, 20 mM β-glycerophosphate, 5 mM DTT and EDTA-free protease inhibitors cocktail (cOmplete™, Mini, EDTA-free Protease Inhibitor Cocktail – Roche)

d. Western blot . Transfer Buffer (10X): 0.25 M Tris and 1.92 M glycine

. Transfer Buffer (1X): 70% H20, 10% Transfer Buffer 10X and 20% ethanol 96°. . TBS Buffer (10X): 1 M Tris and 1.5 M NaCl

. TBS-Tween (TBS-T) (1X): 90% H20, 10% TBS 10X and 0.1% Tween-20

Characterization of a MAPK module involved in Arabidopsis response to wounding 95

II. Methods

1. Plant methods

a. Wounding of Arabidopsis leaves For all the wounding experiments, 4 week-old Arabidopsis leaves were squeezed with a forceps through their midveins. Leaves were wounded three times, thus covering approximately 90% of their surface. For each time point and genotype, three leaves from three different plants (9 in total) were wounded. For time courses, leaves were wounded at appropriate time during the day and all samples were harvested at the same time, usually around 1:00 pm. Samples were put in 1.5 mL Eppendorf tubes, frozen in liquid nitrogen and stored at -80°C for further experiments. Wounding usually started at 9:00 am. Here is a timeline of a typical wounding experiment.

Day time

Corresponding 4h 2h 1h 30’ 15’ Collection time point

b. Cycloheximide (CHX) treatment CHX (Sigma- C4859) stock solution (100mg/mL) was kept at 4 °C. When CHX was applied prior to wounding, plants were all sprayed at the same time, 1h30 before first plants were wounded. A solution containing 100 µM CHX in DMSO diluted in water (14 µL for 50 mL) was prepared and sprayed equally to the plant tray. For mock control, only DMSO was diluted in water.

c. Touch stress For gentle touch stress, 4 week-old Arabidopsis leaves were bent 10 times back and forward as described previously (Chehab et al., 2012). Touched leaves were harvested following a time course. Samples were stressed differentially and harvested at the same time.

Characterization of a MAPK module involved in Arabidopsis response to wounding 96

d. Leaf numbering For the study of systemic responses, Arabidopsis plants were grown on soil in Percival chambers. Leaves were wounded following the online Nature protocol “Leaf numbering for experiments on long distance signaling in Arabidopsis” from Farmer lab (Mousavi et al., 2013).

e. Trichome counting Plants were grown on soil in Percival chambers. The protocol was adapted from Poudel et al., 2016. Cotyledons and two first leaves of 2 week-old Arabidopsis plantlets were wounded with intervals over the course of 12 days. At day12, trichomes were observed on leaf n°5 under a stereomicroscope. Pictures were taken and trichomes were counted manually with ImageJ software.

f. Exogenous treatment of Arabidopsis plantlets Seeds were sterilized in a solution of EtOH 76°C + 5% Triton for 10 minutes and a second time in EtOH 76 °C only. 10 seeds were sown on each small Petri dish containing 8mL of the previously prepared ½ MS medium. All exogenous treatments were applied directly in the ½ MS medium, to the roots of 10 day-old Arabidopsis plantlets.

Table 4.2: Exogenous treatments applied on Arabidopsis plantlets

Applied Stock Final Reference Diluted in Stored at molecule concentration concentration JA Sigma Aldrich J2500 50 mM Ethanol -20 °C 50 µM peptide QRLSTGSRINSAKDDAAGLQIA flg22 was synthesized by GeneCust 1 mM H2O -80°C 1 µM to a purity > 85%

ATP 10 mM H2O -20 °C 100 µM

OGs provided by Pr. Felice Cervone 5 mg/mL H2O -20 °C 50 µg/mL ABA Sigma Aldrich A1049 50 mM Ethanol -20 °C 50 µM

H2O2 Sigma Aldrich 95294 ≈10 M H2O 4 °C 1 mM

Characterization of a MAPK module involved in Arabidopsis response to wounding 97

g. Production of Arabidopsis mesophyll protoplasts This protocol was developed by Jane Sheen’s laboratory (Niu & Sheen, 2007). Table 4.3: Preparation of the enzymatic solution Final [C] For 10 mL Cellulase R10 1,50% 0,15 g Macerozyme R10 0,40% 0,04 g Mannitol 800 mM 400 mM 5 mL KCl 2 M 20 mM 100 µL MES 200 mM pH 5,7 20 mM 1 mL

H2O 3,7 mL Heat at 55°C for 10 min

and cool down at RT°

CaCl2 1M 10 mM 100 µL BSA 10 % 0,10% 100 µL

. Digestion of Arabidopsis mesophyll cells: Arabidopsis leaves are cut into very small slices with a razor and put in a Petri dish containing the enzymatic solution previously filter through a 0.45 µm filter. The whole is then submitted to vacuum for 30 minutes and then covered with aluminium fold and left to incubate for 2h30 in Percival chambers.

. Collection of protoplasts: 10 mL of buffer W5 is added in the Petri dish. The solution is then collected with a pipette and put in a rounded 30mL tube through a mesh (35-75µm). The tube is then centrifuged at 800 rpm break 1 for 1 minute. The supernatant is removed and protoplasts are resuspended in 10mL of buffer W5. After a second centrifugation of 2 minutes at 800 rpm break 1, protoplasts are resuspended in 3mL of buffer W5 and kept on ice.

Table 4.4: Composition of W5 and WI solutions

For 500 W5 Final [C] For 500 mL WI Final [C] mL NaCl 5 M 154 mM 15,4 mL Mannitol 800 mM 500 mM 312,5 mL

CaCl 1 M 125 mM 62,5 mL MES 200 mM pH 5,7 4 mM 10 mL 2 KCl 2 M 5 mM 1,25 mL KCl 2 M 20 mM 5 mL

MES 200 mM pH 5,7 2 mM 5 mL H O qs 172,5 mL 2 H O qs 415,85 mL 2

Characterization of a MAPK module involved in Arabidopsis response to wounding 98

. Counting: Protoplasts are counted on a hematometer and resuspended in MMg buffer for a final concentration of 2.105 protoplasts/mL.

Table 4.5: Composition of the MMg solution

For 10 Final [C] mL Mannitol 800 mM 400 mM 5 mL

MgCl2 1 M 15 mM 150 µl MES 200 mM pH 5,7 4 mM 200 µL

H2O qs 4,65 mL

. Protoplasts transformation: Bottoms of small Petri dishes are covered with 1mL CS 5% (calf serum). This coating prevents the protoplasts from stick to plastic walls. 800 µl of buffer WI is added to each Petri dish. For each transformation: 200 µL of protoplasts (2.105 /mL), 20 µL of DNA (2µg/µL), and 200 µL of PEG solution are used. The whole is left to incubate 5 minutes at room temperature.

Table 4.6: Composition of the PEG solution Final [C] For 5 mL PEG 4000 (Fluka) 40% 2 g

H2O qs 1,5 mL Mannitol 800 mM 200 mM 1,25 mL

CaCl2 1 M 50 mM 0,5 mL

. DNA expression: 880 µL of buffer W5 is added to the transformation medium. After centrifugation (2 minutes 800 rpm, break 1) the supernatant is removed and replaced with 200 µL of solution WI. Finally, 1 mL of the protoplast mix is put in each Petri dish and left to incubate over-night (maximum 14 hours). When used, MG132 was added at this step, directly in the Petri dish (10 µM/dish diluted in DMSO) and DMSO alone was used as control.

Characterization of a MAPK module involved in Arabidopsis response to wounding 99

h. Botrytis cinerea inoculation

Conidia were resuspended in liquid potato/dextrose (PD) medium and filtered through Miracloth. Using a microscope, spore density was adjusted to 5.105conidiospores/mL. Arabidopsis leaves were then inoculated with 5 µL drops on each side of the midvein. Liquid PD medium was used as a mock control. Plants were watered, covered and stored in culture chambers. Lesions were measured 48 or 72 hours post-inoculation depending on growth speed. When pre-wounding was performed, holes were made on each side of the midvein with a needle, 1 hour prior to the inoculation. Lesions were quantified by measuring measuring their areas with the ImageJ software.

i. Insect feeding assays Spodoptera littoralis feeding assays were all performed by our collaborators in the Max Planck Institute of Jena (Germany). For more details see Vadassery et al., 2012.

j. Localization assays map3k17map3k18 plants complemented with YFP tagged version of MAP3K18 (map3k17/18/MAP3K18-YFP) were used to visualize the subcellular localization of MAP3K18. Two week-old Arabidopsis plantlets were treated with 25 µM of ABA or their cotyledons were wounded with a needle. Leaves were observed 4 hours after treatment under a confocal microscope.

2. Molecular biology methods

a. Yeast 2-hybrid assay . Vector preparation: Entry clone containing ORFs of interest in a STOP version were recombined using LR enzyme mix in pDEST22 and pDEST32-modified using the Gateway technology. . Yeast preparation: an overnight 10 mL culture of MaV203 yeast in YPD medium was

diluted in 50 mL fresh YPD medium to reach an OD600 of 0.4. The culture was grown for an additional 4 hours at 28 °C. Yeast cells were then collected after centrifugation at 2500 rpm for 5 minutes and the supernatant was discarded. The pellet was re-suspended in 40 mL of 1X TE (10 mM Tris, pH 7.5, 1 mM EDTA) buffer and centrifuged again for 5 minutes at 2500 rpm. The pellet was re-suspended in 7 mL of 1X LiAc/0.5X TE solution

Characterization of a MAPK module involved in Arabidopsis response to wounding 100

(100 mM Lithium Acetate pH 7.5, 5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA) and incubated at room temperature for 10 minutes. . Yeast co-transformation: 1 µg of plasmid DNA (for both prey and bait) was mixed with 100 µg of denatured sheared salmon sperm DNA and 100 µL of yeast suspension. A 700 µL solution of 1X LiAc/40% PEG-3350/1X TE (100 mM Lithium Acetate, pH 7.5, 40% PEG-3350, 10 mM Tris-HCl pH 7.5, 1 mM EDTA) was added to the suspension and mixed thoroughly. The mixture was incubated at 30 °C in water bath for 30 minutes. After adding 80 µL of DMSO, the mixture was heat-shocked at 42 °C for 7 minutes. Yeast cells were collected by centrifugation at 2500 rpm for 10 seconds. The pellet was washed with 1 mL of 1X TE buffer and re-suspended in 100µL of 1X TE buffer. The transformed yeast cells were grown on a selective media (-L-T) for 2/3 days at 28 °C. . Interaction test: single colonies of transformed yeasts were grown in 500µL of liquid selective media (-L-T) overnight at 30 °C. Cells were then dilutes 20 times in water and 5 µL droplets were spotted on selective media –L-T-H + 3AT 60 mM. Yeast growth was monitored at 28 °C for 3 days

b. Construction of CRISPR-generated mutants

Two primers (Cs9-3K13&14-F: ATTGTCCGCTTTGGATGGCTCCGG; Cs9-3K13&14-R: AAACCCGGAGCCATCCAAAGCGGA) to create a CRISPR guide targeting a 100% conserved sequence shared by both MAP3K13 and MAP3K14 were designed following manufacturer instructions. pDGE65 was digested (5 µL DNA 200 ng/µL, 1 µL buffer for T4DNA Ligase (NEB), 3 µL H20, 1 µL Bbs1 Thermo, 37 for 2 hours) and primers were ligated (4.5 µL of the previous digestion mix, 3 µL primers mix (50 pmole/µL each), 1µL buffer for T4DNA Ligase (NEB), 0.5µL T4 Ligase NEB, incubation overnight 16°C). Ligation products were transformed in DH5alpha bacteria. Few colonies were selected to prepare DNA from an overnight 10 mL culture and sequenced for the CRISPR guide. The vector was introduced into thermo-competent Agrobacterium tumefaciens C58C1 strain and used to transform Arabidopsis Col-0 plants using a classical floral dipping method (Clough & Bent, 1998). About 20 T0-Basta R plants were then selected on pots. The number of inserts was then assessed using the BastaR segregation in T1 seeds in plate (½MS+ 1% sucrose). Basta sensitive T1 plants from lines carrying a single insert were transferred carefully on soil. About 50% survived and were genotyped for mutations in MAP3K13 and MAP3K14 genes.

Characterization of a MAPK module involved in Arabidopsis response to wounding 101

Restriction Amplified Primer name Sequence enzyme P2444-MAP3K13locus-F GGGGTACCGTTTTGAAAGTTTTTTACTTTTACGTT Kpn1 highlighted MAP3K13locus P2445-MAP3K13locus-R GAAGATCTAAATACAACTATTTGGCTGTAAACGAG Bgl2 highlighted P2446-MAP3K14locus-F GGGGTACCGATGGCAAGTGTATCGAAGCAGGAAAA Kpn1 highlighted MAP3K14locus P2447-MAP3K14locus-R CGGGATCCATAGATAGACCGATCCGAATCACATGC BamH1 highlighted P2448-MAP3K15locus-F GGGGTACCACTAAAAACGTTATTAAAACATAGCGT Kpn1 highlighted MAP3K15locus P2449-MAP3K15locus-R CGGGATCCATTGTAATTAGTAATCTCAAAACAAGA BamH1 highlighted P2450-MAP3K16locus-F GGGGTACCCAAAATCAATATTACTAAAACTATTTT Kpn1 highlighted MAPK16locus P2451-MAP3K16locus-R CGGGATCCGACTTGGTTAGTGAATTTAACATGAGC BamH1 highlighted P2452-MAP3K19locus-F GGGGTACCTTCAACTTGTCTTCGTCTCGATATTTG Kpn1 highlighted MAP3K19locus P2453-MAP3K19locus-R GAAGATCTCCGTACGGTGACCCAGCTATTGGTAAC Bgl2 highlighted P2454-MAP3K20locus-F GGGGTACCGGTCTGATTCCGACAATAAAGAAAGAA Kpn1 highlighted MAP3K20locus P2455-MAP3K20locus-R CGGGATCCCCGGACTGTAAGCCAACTCCCACCGAC BamH1 highlighted NNNNNNCTGCAGATCTAAGTTTGTAATATAAAGCTCTT P2817-MKK3locusF Pst1 highlighted GC MKK3locus CGGGGTACCTACCTTATCAAGAGTTGGCTCATAACCCT P2818-MKK3locusR Kpn1 highlighted TATTAG P2883-MPK7locis-F CGGGGTACCCTTGGCAACAAGTACCAAAGCAAGTTGC Kpn1 highlighted MPK7locus P2884-MPK7locus_R CCGGAATTCGGCATTTGAGATTTCAGCTTCAGGGTG EcoR1 highlighted CCGGAATTCAGAAACAAAACCAATATATGTTATCGATC P3296-MPK1ocus-F EcoR1 highlighted MPK1locus GATGGAG P3297-MPK1locus-R CGCGGATCCGAGCTCAGTGTTTAAGGTTGAAGCTTGTG BamH1 highlighted CCGGAATTCCTTTTAACAATCAAAATAGTATTGGTCAA P3298-MPK2locus-F EcoR1 highlighted ACAATATTTC MPK2locus CGCGGATCCAAACTCAGAGACCTCATTGTTGTTTATGG P3299-MPK2locus-R BamH1 highlighted TAG NNNTCTAGATAACATAAAAACTCTTTTACGTGAGTGTC P3990-Term3K14-F Xba1 highlighted Terminator C MAP3K14 NNNGCGGCCGCTAAAATTAGATCTGGGTCAAAGTTATA P3991-Term3K14-R Not1 highlighted TAAACC

Table 4.7: Primers used to amplify loci for the creation of lines expressing tagged versions of MAP3Ks, MKK3 and MAPKs

For MAP3K13, genomic DNA was amplified using Pr2664 (CACGTGGGAAATTTTACAAAGATGAG) and Pr51 (CTAACTTCCACCCAACCATCTG) and the 1.5 kb PCR product was sequenced using Pr51. For MAP3K14, genomic DNA was amplified using Pr2661 (CACTTCTTCTTCTTCGTCTTCTTG) and Pr1591 (GAAGAGGCTGACAACTTCACG) and PCR products were sequenced using Pr3212 (GAGTTCCGATAACCCCACCG). Several lines were identified carrying a single mutation in one of the two targeted loci or on both. If necessary, homozygous plants were selected in T2. Two independent lines were used for our genetic analyses. They carry a 1bp insertion in the MAP3K14 ORF leading to a frame shift and a premature truncated protein.

c. Arabidopsis transgenic lines expressing tagged versions of MPK1/2/7, MKK3, MAP3K13/14/15/16/17/18/19/20 from loci

Loci containing promoters, 5’ UTR, exons and introns without their STOP codon were amplified with specific primers using the IProof polymerase (BioRad) from Col-0 genomic DNA. Primers are presented in table 4.7. PCR fragments were first precipitated using phenol- chlorophorme (Sigma P1944) and then in acetate-ethanol in order to remove enzymes and primers. The pellet was re-suspended in appropriate NEB buffer to be digested using appropriate enzymes (see table 4.7). In parallel, pGREEN-HA-Tnos and pGREEN-YFP-Tnos were also linearized using compatible enzymes in presence of CIP (NEB). PCR fragments and vectors were run on electrophoresis gel, DNA was extracted from gel and both partners were ligated with a ratio 1:1 using T4 ligase (NEB) during 1 hour at room temperature. Ligation products were then transformed in home-made thermo-competent DH5aplha bacteria and next day colonies were screened by PCR. 3-5 positive colonies were then grown overnight in 10 mL LB culture at 37 °C. Plasmid DNA was extracted and construction checked by restriction pattern. Finally, the whole insert was sequenced. The vector was then introduced into thermo- competent Agrobacterium tumefaciens C58C1 strain and used to transform Arabidopsis Col-0 plants using a classical floral dipping method (Clough & Bent, 1998). About 20 T0-Basta R plants were then selected on pots. The number of inserts was assessed using the BastaR segregation in T1 seeds in plate (½MS + 1 % sucrose). Homozygous plants were selected in T2. In the case of MAP3K14locus-YFP construct, we decided in a second step to change the Tnos terminator for the MAP3K14 endogenous terminator. The latter was amplified with appropriate primers (see table 4.7), cleaned and digested as described above and pGREEN0229-MAP3K14locus-YPF-Tnos was linearized by corresponding enzymes in

Characterization of a MAPK module involved in Arabidopsis response to wounding 102

presence of CIP. Vector and insert were ligated and positive clones selected following the previous protocol.

d. RNA extraction from plants NucleoSpin® RNA Plant (Macherey Nagel) and RNeasy Plant Mini Kit (Qiagen) kits were used to extract RNA from plants. Extractions were realized according to instructions included in the kits. DNAse treatment was included in the extraction protocol. RNA was quantified using a Nanodrop (ThermoScientific).

e. RT-qPCR . Reverse-transcription (RT): 1 µg of RNA was used for each reaction, diluted in a total of 14 µl water. RNAs were heated 10 minutes at 70°C for denaturation. 16 µl of the RT mix was then added to RNAs and the whole was incubated for 1 hour at 42°C followed by 10 minutes at 75°C.

Table 4.8: Composition of the RT mix

Component µl/reaction Buffer RTAse 5X 6 DTT 3 Oligo dT 0,6

dNTP 0,6 RNAse inhibitor 0,5

H2O 4,5 SuperScriptII RTase 0,8

. qPCR: cDNAs from the previous step were diluted 10 times in water before use. For each sample, 1 µL of cDNA was mixed with 4 µL of primer couples (0,25 µM each) and 5 µL of SybrGreen 2X (Sybr Premix ex Taq II (Tli RNase H Plus) – Takara). Samples were then deposited on a 384 well-plate. Each sample was run in triplicate. The following amplification program was used: 95°C for 30 sec; 40 × [95°C for 5 sec and 60°C for 20 sec]. The program was ended by a denaturation step giving rise to melting curves allowing the validation of amplification specificity. qPCR reactions were carried out in CFX384 Touch Real-Time PCR (Biorad) and analyzed with CFX Manager Software

Characterization of a MAPK module involved in Arabidopsis response to wounding 103

Name ATG number Forward primer Reverse primer ACTIN2 AT3G18780 CGTTTCTATGATGCACTTGTGTG GGGAACAAAAGGAATAAAGAGG MPK1 AT1G10210 TGGTCACTTATCACCGAGGG GCTCCACGACCAATAGGCTT MPK2 AT1G59580 AGAGAGTCAACGGTCATAGCG CGCCATTCTTCTACCTCCCG MPK7 AT2G18170 CAACAACAACAACGACTCGGG TGGCTCAACTAACATCGCCA MAP3K13 AT1G07150 CGCGGTGAGATGAGATCGAG ACAACTATTTGGCTGTAAACGAGA MAP3K14 AT2G30040 ACCAGCTTGGGAAGATCACG GAGTTCCGATAACCCCACCG MAP3K15 AT5G55090 GTCGAGGCTCAACAGCTACT CGATGAAGAAAACTCGGCGG MAP3K16 AT4G26890 CGGCTGATCGGATCGAGAAA ATCCATCCGCCATCGTCTTC MAP3K17 AT2G32510 TACTCGGAGAGGATCGGACG TGTTCCTTCACACCTCGCTC MAP3K18 AT1G05100 TTCACCGGTCGGAGTTCTTG TGTGGAAGGGCTCTCTCGTA MAP3K19 AT5G67080 CGCCGTTAAGATTGCGGATT TTAACAGATTCCGGCGCCAT MAP3K20 AT3G50310 TATCGCAGTGTGCAAACCCT GAAACTCCGGCGACTTTCCT JAZ10 AT5G13220 ATCCCGATTTCTCCGGTCCA ACTTTCTCCTTGCGATGGGAAGA ERF1 AT3G23240 TCTAATCGAGCAGTCCACGC CTCTTATCTCCGCCGCGAAT ERF4 AT3G15210 CTCCGACGTTAGTTGTGCCT CGTTACCGATCCCCATCAGG ERF5 AT5G47230 GGTGGAGAGACGTTTCCGTT ACCAAACGGTGGATGAGGAG PR4 AT3G04720 CGGCAAGTGTTTAAGGGTGA CAAATCCAAGCCTCCGTTGC RHL41 AT5G59820 ATGGGACAAGCTTTGGGAGG TTCAACGTAGTCACCGTGGG STZ AT1G27730 GTAGCGTGTCCAACTCCGAA TCAGGGATCGGAGGGATGTT WRKY15 AT2G23320 GATCTCCACATCCAAGAGGATATTA GCGGCGGAGAGAGAATGATTA MYB51 AT1G18570 CCCTTCACGGCAACAAATGG CCGGAGGTTATGCCCTTGTG PAL1 AT2G37040 ACTTATTAGATTCCTTAACGCCGGA CCGTTGGGACCAGTAGCTTT PAL2 AT3G53260 CTCATTAGATTTTTGAACGCCGGA CGGAGAGGTAGTGACGGAGA PAL4 AT3G10340 CCATCCCGGTCAGATCGAAG ACGTACGTAAAGCGTACCGAT SID2 AT1G74710 AGCTGGAAGTGACCCATCTT TGGTGAACTGCAAAAACAACA LOX2 AT3G45140 GCTAGTTGAAGAGTGGCCGT TAGCATCATAGCCTGGCGTG LOX3 AT1G17420 ACGACCTTGGAAATCCCGAC GCTCTCCGCGTCTTTATCAGA LOX4 AT1G72520 TGATCTCATCCGAAGGGGGA GTACCAGGCTTGGAGCTCAG LOX6 AT1G67560 AGAAAAGGCGCTTGAGGAGAA TCTCGGATTCGGCTGTAGGA AOS AT5G42650 TTATCAACCGTTGGCGACGA TTCGACCACAACACATGCCT VSP2 AT5G24770 TCAGTGACCGTTGGAAGTTGTG GTTCGAACCATTAGGCTTCAATATG PDF1.2 AT5G44420 TTTGCTGCTTTCGACGCAC CGCAAACCCCTGACCATG PR1 AT2G14610 GATCCTCGTGGGAATTATGTG TTCTCGTAATCTCAGCTCTTATTTG

Table 4.9: Genes used for qPCR experiments and corresponding primer couples

(Biorad). actin2 (AT3G18780) was used as a housekeeping gene to normalize expression levels. All qPCR primers used in this work are presented in table 4.9.

. Data exploitation: amplification curves allow the identification of a Cp (“Crossing point”) for each sample. The Cp corresponds to the number of cycles necessary to dissociate the fluorescence level from a threshold value and is directly correlated to the gene expression level. The latter is calculated through the following equation and the average of the three replicates is used to be represented in graphics.

Cp(housekeeping gene) – Cp(target gene) 2

f. Microarray 4 week-old Col-0 and mkk3-1 Arabidopsis plants were wounded with a forceps. Three leaves / plant were wounded, three times each covering ~ 90% of the leaf surface. For each genotype 7 plants were wounded and leaves were harvested 2 hours later. Non-wounded plants were used as control. Three independent experiments were performed.

Table 4.10: Description of samples sent for micro-array analyses

Genotypes Col-0 vs mkk3-1 Time points 0 and 2h Biological replicates 3 Total 12 samples

Total RNAs were extracted and micro array analysis was carried out using the CATMAv7 (Two-Color Microarray-Based Gene Expression Analysis) array (AGILENT technology). The experiment was performed by the Transcriptomic platform in our institute (IPS2, Orsay). Samples were compared by pairs as follows:

Col-0 Col-0 non-wounded 2h post-wounding

mkk3-1 mkk3-1 non-wounded 2h post-wounding

Characterization of a MAPK module involved in Arabidopsis response to wounding 104

3. Biochemistry methods

a. Protein extraction

. for subsequent immuno-precipitation: frozen plants were ground directly using Tissue- LyzerII (Qiagen) in 2 mL Eppendorf tubes containing iron beads. 1 mL extraction buffer was used for each sample. Tubes were vortexed and centrifuged (10 minutes, 14000 rpm, 4°C) to recover soluble proteins. When extraction was done from protoplasts, 200 µL of extraction buffer was added to each sample.

. for subsequent western blot: proteins were extracted with Laemmli buffer and heated 5 minutes at 95°C.

b. Protein quantification and normalization 10 µL of each protein extract (previously diluted 10 times) was mixed with 250 µL Bradford reagent (Coomassie Protein Assay Reagent, Pierce) and dropped on a 96-wells Elisa plate. Each sample was run in triplicate and a BSA range was used for standard protein concentrations (0.5 to 2.5 µg / 10 µL). Absorbance at 595 nm was measured using a TECAN reader and all concentrations were normalized to the less concentrated sample by dilution in the extraction buffer. For all further experiments, > 300µg proteins were used. Samples meant for immuno-precipitation were kept on ice and those meant for SDS-PAGE were mixed with Laemmli and incubated at 95°C for 5 minutes. This quantification step was not carried out for protoplast extracts.

c. Immuno-precipitation (IP) For each protein extract a mix was prepared containing 30 µL of extraction buffer, 10 µL of Protein G sepharose beads (GE Healthcare) and 3 µL of the appropriate antibody. Beads were previously washed 4 times with 1 mL extraction buffer. Next, samples were incubated on a rotating wheel at 4°C for 2 hours. Beads were then washed twice with extraction buffer and once with kinase buffer that are used at the subsequent step. Washing consists in adding 1 mL of buffer per sample and centrifuging a few seconds at 4000 rpm. After the last washing step, all liquid is removed and beads are kept on ice. When IP was performed from protoplast extracts, the protocol was the same except only 1 µL of antibody was used.

Characterization of a MAPK module involved in Arabidopsis response to wounding 105

d. In vitro kinase assay

A mix containing 15 µl kinase buffer (30 mM Tris-HCl (pH 7.5), 1 mM EGTA, 10 mM

MgCl2, 1 mM DTT and 20 mM β-glycerophosphate), 1.5 µL MBP (10 mg/mL) (Sigma 1891) and 0.15 µL of ATP 10 mM per sample is prepared. 33P is added last and 15 µL of the mix is added to each sample, directly deposited on the beads. Samples are incubated at room temperature and the reaction is stopped after 30 minutes with Laemmli. Samples are then boiled 5 minutes at 95 °C and are run for SDS PAGE (15% acrylamide) at constant 30 mA/gel for around 50 minutes. Gels are then dried under vaccum and put in an autoradiography “cassette” for 24 hours. Next day, the radioactive signal is revealed by autoradiography using a Storm or later a Typhoon scanner (GE Healthcare).

e. Western blot Samples are run by SDS PAGE at constant 30 mA / gel for around 1 hour. Migrated proteins are transferred on ethanol-activated PVDF membranes (GE Healthcare) under constant 100V for 90 minutes following manufacturer instruction (BioRAD). Membranes are then blocked in TBS-T + 5% BSA (for further α-pTpY probing) or in TBS-T + 5% milk (for other antibodies) for 1h. Primary antibody diluted in 5% BSA (or milk) was added to membrane and left to incubate over-night at 4°C (or 2-3h at room temperature) under gentle shaking. Membranes were washed 3 times 10 minutes with TBS-T and incubated with secondary antibody coupled to horseradish peroxidase (HRP) diluted in TBS-T 5% BSA (or 5% milk) for 1h. After 3 more washes of 10 minutes with TBS-T, HRP activity on the membrane is revealed using enhanced chemiluminescence reagent (Clarity Western ECL Substrate – Biorad). The subsequent chemiluminescent signal is detected using a ChemiDoc imaging system (Biorad).

Table 4.11: Dilutions of antibodies used for western blots

Primary antibody Dilution In α-pTpY 1/5000 5% BSA α-YFP 1/10000 5% milk α-Myc 1/10000 5% milk α-HA 1/5000 5% milk α-MPK3 1/3000 5% milk α-MPK6 1/3000 5% milk After revelation, membranes can be stained by incubation in Coomassie blue to visualize total protein loading.

Characterization of a MAPK module involved in Arabidopsis response to wounding 106

CHAPTER V: REFERENCES

Acosta, I. F., & Farmer, E. E. (2010). Jasmonates. The Arabidopsis Book. Agrawal, A. A. (2000). Overcompensation of plants in response to herbivory and the by-product benefits of mutualism. Trend in Plant Science, 5(7), 309–313. Ashraf, M., Ahmad, M., Aksoy, A., Öztürk, M., & Sajid, A. (2012). Crop Production for Agricultural Improvement. Springer Science & Business Media. Alborn, H. T., Hansen, T. V, Jones, T. H., Bennett, D. C., Tumlinson, J. H., Schmelz, E. A., & Teal, P. E. A. (2007). Disulfooxy fatty acids from the American bird grasshopper Schistocerca americana, elicitors of plant volatiles. Proceedings of the National Academy of Sciences of the United States of America, 104(32), 12976–81 Alborn, H. T., Turlings, T. C. J., Jones, T. H., Stenhagen, G., Loughrin, J. H., & Tumlinson, J. H. (1997). An Elicitor of Plant Volatiles from Beet Armyworm Oral Secretion. Science, 276(5314). Alexandre, J., & Lassalles, J. P. (1990). Effect of D-myo-Inositol 1,4,5-Trisphosphate on the Electrical Properties of the Red Beet Vacuole Membrane. Plant Physiology, 93(2), 837–40 Anderson, J. P., Badruzsaufari, E., Schenk, P. M., Manners, J. M., Desmond, O. J., Ehlert, C., … Kazan, K. (2004). Antagonistic Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways Modulates Defense Gene Expression and Disease Resistance in Arabidopsis. The Plant Cell, 16(12), 3460–3479 Arimura, G. I., & Maffei, M. E. (2010). Calcium and secondary CPK signaling in plants in response to herbivore attack. Biochemical and Biophysical Research Communications, 400(4), 455–460 Asahina, M., Azuma, K., Pitaksaringkarn, W., Yamazaki, T., Mitsuda, N., Ohme-Takagi, M., … Satoh, S. (2011). Spatially selective hormonal control of RAP2.6L and ANAC071 transcription factors involved in tissue reunion in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 108(38), 16128-32 Asai, T., Tena, G., Plotnikova, J., Willmann, M. R., Wan-Ling, C., Gomez-Gomez, L., … Jen, S. (2002). MAP kinase signaling cascade in Arabidopsis innate immunity. Nature, 415(6875), 977–983 Attaran, E., Major, I. T., Cruz, J. a, Rosa, B. a, Koo, A. J. K., Chen, J., … Howe, G. a. (2014a). Temporal dynamics of growth and photosynthesis suppression in response to jasmonate signaling. Plant Physiology, 165(3), 1302–1314 Attaran, E., Major, I. T., Cruz, J. A., Rosa, B. A., Koo, A. J. K., Chen, J., … Howe, G. A. (2014b). Temporal Dynamics of Growth and Photosynthesis Suppression in Response to Jasmonate Signaling. Plant Physiology, 165(3), 1302–1314 Baldwin, I. T. (1998). Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proceedings of the National Academy of Sciences of the United States of America, 95(14), 8113–8118

Characterization of a MAPK module involved in Arabidopsis response to wounding 107

Bartels, S., Lori, M., Mbengue, M., Verk, M. Van, Klauser, D., Hander, T., … Boller, T. (2013). The family of peps and their precursors in arabidopsis: Differential expression and localization but similar induction of pattern-Triggered immune responses. Journal of Experimental Botany, 64(17), 5309–5321 Beneloujaephajri, E., Costa, A., L’Haridon, F., Métraux, J.-P., & Binda, M. (2013). Production of reactive oxygen species and wound-induced resistance in Arabidopsis thaliana against Botrytis cinerea are preceded and depend on a burst of calcium. BMC Plant Biology, 13(1):160 Bergmann, D. C., Lukowitz, W., & Somerville, C. R. (2004). Stomatal Development and Pattern Controlled by a MAPKK Kinase. Science, 304(5676), 1494-7 Bernards, M. A., & Razem, F. A. (2001). The poly(phenolic) domain of potato suberin: a non- lignin cell wall bio-polymer. Phytochemistry, 57(7), 1115–1122 Bethke, G., Pecher, P., Eschen-Lippold, L., Tsuda, K., Katagiri, F., Glazebrook, J., … Lee, J. (2012). Activation of the Arabidopsis thaliana Mitogen-Activated Protein Kinase MPK11 by the Flagellin-Derived Elicitor Peptide, flg22. Molecular Plant-Microbe Interactions, 25(4), 471–480 Bhosale, R., Jewell, J. B., Hollunder, J., Koo, A. J. K., Vuylsteke, M., Michoel, T., … Maere, S. (2013). Predicting gene function from uncontrolled expression variation among individual wild-type Arabidopsis plants. The Plant Cell, 25(8), 2865–77 Bodenhausen, N., & Reymond, P. (2007). Signaling Pathways Controlling Induced Resistance to Insect Herbivores in Arabidopsis. Molecular Plant-Microbe Interactions MPMI, 20(11), 1406–1420 Bogre, L., Ligterink, W., Meskiene, I., Barker, P., Heberle-Bors, E., Huskisson, N., & Hirt, H. (1997). Wounding Induces the Rapid and Transient Activation of a Specific MAP Kinase Pathway. The Plant Cell, 9(1), 75–83 Boudsocq, M., Danquah, A., de Zélicourt, A., Hirt, H., & Colcombet, J. (2015). Plant MAPK cascades: Just rapid signaling modules? Plant Signaling & Behavior, 10(9) Boudsocq, M., & Sheen, J. (2013). CDPKs in immune and stress signaling. Trends in Plant Science, 18(1), 30–40 Boudsocq, M., Willmann, M. R., McCormack, M., Lee, H., Shan, L., He, P., … Sheen, J. (2010). Differential innate immune signalling via Ca2+ sensor protein kinases. Nature, 464(7287), 418–422 Braam, J., & Davis, R. W. (1990). Rain-, wind-, and touch-induced expression of calmodulin and calmodulin-related genes in Arabidopsis. Cell, 60(3), 357–364 Brutus, A., Sicilia, F., Macone, A., Cervone, F., De Lorenzo, G., & Lorenzo, G. De. (2010). A domain swap approach reveals a role of the plant wall-associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proceedings of the National Academy of Sciences of the United States of America, 107(20), 9452–7 Caarls, L., Pieterse, C. M. J., & Van Wees, S. C. M. (2015). How salicylic acid takes transcriptional control over jasmonic acid signaling. Frontiers in Plant Science, 6, 170

Characterization of a MAPK module involved in Arabidopsis response to wounding 108

Campos, M. L., Kang, J.-H., & Howe, G. A. (2014). Jasmonate-Triggered Plant Immunity. Journal of Chemical Ecology, 40(7), 657–675 Chardin, C., Schenk, S. T., Hirt, H., Colcombet, J., & Krapp, A. (2017). Review: Mitogen- Activated Protein kinases in nutritional signaling in Arabidopsis. Plant Science, 260(October 2016), 101–108 Chassot, C., Buchala, A., Schoonbeek, H. J., Métraux, J. P., & Lamotte, O. (2008). Wounding of Arabidopsis leaves causes a powerful but transient protection against Botrytis infection. Plant Journal, 55(4), 555–567 Chauvin, A., Caldelari, D., Wolfender, J. L., & Farmer, E. E. (2013). Four 13-lipoxygenases contribute to rapid jasmonate synthesis in wounded Arabidopsis thaliana leaves: A role for lipoxygenase 6 in responses to long-distance wound signals. New Phytologist, 197(2), 566– 575 Chehab, E. W., Yao, C., Henderson, Z., Kim, S., & Braam, J. (2012). Arabidopsis touch-induced morphogenesis is jasmonate mediated and protects against pests. Current Biology, 22(8), 701–706 Chen, H., Xue, L., Chintamanani, S., Germain, H., Lin, H., Cui, H., … Zhou, J.-M. (2009). ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. The Plant Cell, 21(8), 2527–40 Chen, W., Provart, N. J., Glazebrook, J., Katagiri, F., Chang, H., Mauch, F., … Wang, X. (2013). Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses. The Plant Cell, 14(3), 559–574 Chen, Z., Zheng, Z., Huang, J., Lai, Z., & Fan, B. (2009). Biosynthesis of salicylic acid in plants. Plant Signaling & Behavior, 4(6), 493–6 Cheong, Y. H., Chang, H.-S., Gupta, R., Wang, X., Zhu, T., & Luan, S. (2002). Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiology, 129(2), 661–677 Chini, A., Fonseca, S., Fernández, G., Adie, B., Chico, J. M., Lorenzo, O., … Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate signalling. Nature, 448(7154), 666–671 Choi, J., Tanaka, K., Cao, Y., Qi, Y., Qiu, J., Liang, Y., … Stacey, G. (2014). Identification of a plant receptor for extracellular ATP. Science (New York, N.Y.), 343(6168), 290–4 Chung, H. S., Cooke, T. F., DePew, C. L., Patel, L. C., Ogawa, N., Kobayashi, Y., & Howe, G. A. (2010). Alternative splicing expands the repertoire of dominant JAZ repressors of jasmonate signaling. The Plant Journal, 63(4), 613–622 Chung, H. S., Koo, A. J. K., Gao, X., Jayanty, S., Thines, B., Jones, a D., & Howe, G. a. (2008). Regulation and function of Arabidopsis JASMONATE ZIM-domain genes in response to wounding and herbivory. Plant Physiology, 146(3), 952–64

Characterization of a MAPK module involved in Arabidopsis response to wounding 109

Cipollini, D., Enright, S., Traw, M. B., & Bergelson, J. (2004). Salicylic acid inhibits jasmonic acid-induced resistance of Arabidopsis thaliana to Spodoptera exigua. Molecular Ecology, 13(6), 1643–1653 Clavijo McCormick, A., Unsicker, S. B., & Gershenzon, J. (2012). The specificity of herbivore- induced plant volatiles in attracting herbivore enemies. Trends in Plant Science, 17(5), 303– 310 Clough, S. J., & Bent, A. F. (1998). Floral dip: a simplified method forAgrobacterium-mediated transformation ofArabidopsis thaliana. The Plant Journal, 16(6), 735–743 Colcombet, J., & Hirt, H. (2008). Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochemical Journal, 413(2), 217–226 Colcombet, J., Sözen, C., & Hirt, H. (2016). Convergence of Multiple MAP3Ks on MKK3 Identifies a Set of Novel Stress MAPK Modules. Frontiers in Plant Science, 07(December), 1–7 Consales, F., Schweizer, F., Erb, M., Gouhier-Darimont, C., Bodenhausen, N., Bruessow, F., … Reymond, P. (2012). Insect oral secretions suppress wound-induced responses in Arabidopsis. Journal of Experimental Botany, 63(2), 727–737 Couto, D., & Zipfel, C. (2016). Regulation of pattern recognition receptor signalling in plants. Nature Reviews Immunology, 16(9), 537–552 Danquah, A., de Zélicourt, A., Boudsocq, M., Neubauer, J., Frei dit Frey, N., Leonhardt, N., … Colcombet, J. (2015). Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana. The Plant Journal, 82(2), 232–244 Dark, A., Demidchik, V., Richards, S. L., Shabala, S., & Davies, J. M. (2011). Release of extracellular purines from plant roots and effect on ion fluxes. Plant Signaling & Behavior, 6(11), 1855–7 De la Cova, C., Townley, R., Regot, S., & Greenwald, I. (2017). A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification. Developmental Cell, 42(5), 542–553 De Vos, M., Van Oosten, V. R., Van Poecke, R. M. P., Van Pelt, J. A., Pozo, M. J., Mueller, M. J., … Pieterse, C. M. J. (2005). Signal Signature and Transcriptome Changes of Arabidopsis During Pathogen and Insect Attack. Molecular Plant-Microbe Interactions, 18(9), 923–937 De Vos, M., Van Zaanen, W., Koornneef, A., Korzelius, J. P., Dicke, M., Van Loon, L. C., & Pieterse, C. M. J. (2006). Herbivore-induced resistance against microbial pathogens in Arabidopsis. Plant Physiology, 142(1), 352–63 Delessert, C., Wilson, I. W., Van Der Straeten, D., Dennis, E. S., & Dolferus, R. (2004). Spatial and temporal analysis of the local response to wounding in Arabidopsis leaves. Plant Mol Biol, 55(2), 165–181 Denness, L., McKenna, J. F., Segonzac, C., Wormit, A., Madhou, P., Bennett, M., … Hamann, T. (2011). Cell Wall Damage-Induced Lignin Biosynthesis Is Regulated by a Reactive Oxygen Species- and Jasmonic Acid-Dependent Process in Arabidopsis. PLANT PHYSIOLOGY, 156(3), 1364–1374

Characterization of a MAPK module involved in Arabidopsis response to wounding 110

Denoux, C., Galletti, R., Mammarella, N., Gopalan, S., Werck, D., De Lorenzo, G., … Dewdney, J. (2008). Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings. Molecular Plant, 1(3), 423–445 Devoto, A., Ellis, C., Magusin, A., Chang, H. S., Chilcott, C., Zhu, T., & Turner, J. G. (2005). Expression profiling reveals COI1 to be a key regulator of genes involved in wound- and methyl jasmonate-induced secondary metabolism, defence, and hormone interactions. Plant Molecular Biology, 58(4), 497–513 Diezel, C., Dahl, C. C. Von, Gaquerel, E., & Baldwin, I. T. (2009). Different Lepidopteran Elicitors Account for Cross-Talk in Herbivory-Induced Phytohormone Signaling, 150(July), 1576–1586 Doares, S. H., Syrovets, T., Weiler, E. W., & Ryan, C. A. (1995). Oligogalacturonides and chitosan activate plant defensive genes through the octadecanoid pathway, 92(May), 4095– 4098 Dóczi, R., Brader, G., Pettkó-Szandtner, A., Rajh, I., Djamei, A., Pitzschke, A., … Hirt, H. (2007). The Arabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group C mitogen-activated protein kinases and participates in pathogen signaling. The Plant Cell, 19(10), 3266–3279 Doke, N. (1983). Generation of superoxide anion by potato tuber protoplasts during the hypersensitive response to hyphal wall components of Phytophthora infestans and specific inhibition of the reaction by suppressors of hypersensitivity. Physiological Plant Pathology, 23(3), 359–367 Dudareva, N., Negre, F., Nagegowda, D. A., & Orlova, I. (2006). Plant Volatiles: Recent Advances and Future Perspectives. Critical Reviews in Plant Sciences, 25(5), 417–440 Ellis, C., Karafyllidis, I., & Turner, J. G. (2002). Constitutive Activation of Jasmonate Signaling in an Arabidopsis Mutant Correlates with Enhanced Resistance to Erysiphe cichoracearum , Pseudomonas syringae , and Myzus persicae. Molecular Plant-Microbe Interactions, 15(10), 1025–1030 Enders, T. a., Frick, E. M., & Strader, L. C. (2017). An Arabidopsis kinase cascade influences auxin-responsive cell expansion. The Plant Journal, 68–81 Enders, T. A., Frick, E. M., & Strader, L. C. (2017). An Arabidopsis kinase cascade influences auxin-responsive cell expansion. Plant Journal, 38(1), 42–49 Engelberth, J., Alborn, H. T., Schmelz, E. a, & Tumlinson, J. H. (2004). Airborne signals prime plants against insect herbivore attack. Proceedings of the National Academy of Sciences of the United States of America, 101(6), 1781–5 Erb, M., Meldau, S., & Howe, G. A. (2012). Role of phytohormones in insect-specific plant reactions. Trends in Plant Science, 17(5), 250–259 Farmer, E. E., Gasperini, D., & Acosta, I. F. (2014). The squeeze cell hypothesis for the activation of jasmonate synthesis in response to wounding. Journal of Physiology, 204(2), 282–288

Characterization of a MAPK module involved in Arabidopsis response to wounding 111

Farmer, E. E., & Ryan, C. A. (1992). Octadecanoid Precursors of Jasmonic Acid Activate the Synthesis of Wound-Inducible Proteinase Inhibitors. The Plant Cell, 4(2), 129–134 Felix, G., Duran, J. D., Volko, S., & Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. The Plant Journal, 18(3), 265–276 Fernández-Calvo, P., Chini, A., Fernández-Barbero, G., Chico, J.-M., Gimenez-Ibanez, S., Geerinck, J., … Solano, R. (2011). The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. The Plant Cell, 23(2), 701–15 Ferrari, S., Galletti, R., Denoux, C., De Lorenzo, G., Ausubel, F. M., & Dewdney, J. (2007). Resistance to Botrytis cinerea induced in Arabidopsis by elicitors is independent of salicylic acid, ethylene, or jasmonate signaling but requires PHYTOALEXIN DEFICIENT3. Plant Physiology, 144(1), 367–79 Ferrari, S., Savatin, D. V, Sicilia, F., Gramegna, G., Cervone, F., & Lorenzo, G. De. (2013). Oligogalacturonides: plant damage-associated molecular patterns and regulators of growth and development. Frontiers in Plant Science, 4(March), 49 Feys, B., Benedetti, C. E., Penfold, C. N., & Turner, J. G. (1994). Arabidopsis Mutants Selected for Resistance to the Phytotoxin Coronatine Are Male Sterile, Insensitive to Methyl Jasmonate, and Resistant to a Bacterial Pathogen. The Plant Cell, 6(5), 751–759 Feys, B. J. F., Benedetti, C. E., Penfold, C. N., & Turner, J. G. (1994). Arabidopsis Mutants Selected for Resistance To the Phytotoxin Coronatine Are Male-Sterile, Insensitive To Methyl Jasmonate, and Resistant To a Bacterial Pathogen. Plant Cell, 6(5), 751–759 Foley, J. a, Ramankutty, N., Brauman, K. a., Cassidy, E. S., Gerber, J. S., Johnston, M., … O’Connell, C. (2011). Solutions for a cultivated planet. Nature, 478(7369), 337–42 Fonseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., … Solano, R. (2009). (+)- 7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nature Chemical Biology, 5(5), 344–350 Fürstenberg-Hägg, J., Zagrobelny, M., & Bak, S. (2013). Plant defense against insect herbivores. International Journal of Molecular Sciences, 14(5), 10242–97 Furuichi, T., Iida, H., Sokabe, M., & Tatsumi, H. (2012). Expression of Arabidopsis MCA1 enhanced mechanosensitive channel activity in the Xenopus laevis oocyte plasma membrane. Plant Signaling & Behavior, 7(8), 1022–6 Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., & Zhang, Y. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Research, 18(12), 1190–1198 Garcion, C., Lohmann, A., Lamodière, E., Catinot, J., Buchala, A., Doermann, P., & Métraux, J.- P. (2008). Characterization and biological function of the ISOCHORISMATE SYNTHASE2 gene of Arabidopsis. Plant Physiology, 147(3), 1279–8 Glauser, G., Dubugnon, L., Mousavi, S. a R., Rudaz, S., Wolfender, J. L., & Farmer, E. E. (2009). Velocity estimates for signal propagation leading to systemic jasmonic acid

Characterization of a MAPK module involved in Arabidopsis response to wounding 112

accumulation in wounded Arabidopsis. Journal of Biological Chemistry, 284(50), 34506– 34513 Glauser, G., Grata, E., Dubugnon, L., Rudaz, S., Farmer, E. E., & Wolfender, J.-L. (2008). Spatial and temporal dynamics of jasmonate synthesis and accumulation in Arabidopsis in response to wounding. The Journal of Biological Chemistry, 283(24), 16400–7 Glazebrook, J. (2005). Contrasting Mechanisms of Defense Against Biotrophic and Necrotrophic Pathogens. Annual Review of Phytopathology, 43(1), 205–227 Gomi, K., Ogawa, D., Katou, S., Kamada, H., Nakajima, N., Saji, H., … Seo, S. (2005). A mitogen-activated protein kinase NtMPK4 activated by SIPKK is required for jasmonic acid signaling and involved in ozone tolerance via stomatal movement in tobacco. Plant & Cell Physiology, 46(12), 1902–14 Graham, J. S., Hall, G., Pearce, G., & Ryan, C. A. (1986). Regulation of synthesis of proteinase inhibitors I and II mRNAs in leaves of wounded tomato plants. Planta, 169(3), 399–405 Green, T. R., & Ryan, C. A. (1972). Wound-Induced Proteinase Inhibitor in Plant Leaves : A Possible Defense Mechanism against Insects, 175(1967), 1–3 Halitschke, R., & Baldwin, I. T. (2003). Antisense LOX expression increases herbivore performance by decreasing defense responses and inhibiting growth-related transcriptional reorganization in Nicotiana attenuata. The Plant Journal, 36(6), 794–807 Halitschke, R., Schittko, U., Pohnert, G., Boland, W., & Baldwin, I. T. (2001). Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. III. Fatty acid-amino acid conjugates in herbivore oral secretions are necessary and sufficient for herbivore-specific plant responses. Plant Physiology, 125(2), 711–7 Hamann, T. (2012). Plant cell wall integrity maintenance as an essential component of biotic stress response mechanisms. Frontiers in Plant Science, 3, 77 Hamann, T. (2015). The plant cell wall integrity maintenance mechanism - Concepts for organization and mode of action. Plant and Cell Physiology, 56(2), 215–223 Hamann, T., Bennett, M., Mansfield, J., & Somerville, C. (2009). Identification of cell-wall stress as a hexose-dependent and osmosensitive regulator of plant responses. Plant Journal, 57(6), 1015–1026 Hamilton, E. S., Schlegel, A. M., & Haswell, E. S. (2015). United in Diversity: Mechanosensitive Ion Channels in Plants. Annual Review of Plant Biology, 66(1), 113–137 Harvey, C. D., Ehrhardt, A. G., Cellurale, C., Zhong, H., Yasuda, R., Davis, R. J., & Svoboda, K. (2008). A genetically encoded fluorescent sensor of ERK activity. Proceedings of the National Academy of Sciences of the United States of America, 105(49), 19264–9 Haswell, E. S., Peyronnet, R., Barbier-Brygoo, H., Meyerowitz, E. M., & Frachisse, J.-M. (2008). Two MscS Homologs Provide Mechanosensitive Channel Activities in the Arabidopsis Root. Current Biology, 18(10), 730–734

Characterization of a MAPK module involved in Arabidopsis response to wounding 113

Havko, N., Major, I., Jewell, J., Attaran, E., Browse, J., & Howe, G. (2016). Control of Carbon Assimilation and Partitioning by Jasmonate: An Accounting of Growth–Defense Tradeoffs. Plants, 5(1), 7 Heinrich, M., Baldwin, I. T., & Wu, J. (2011). Two mitogen-activated protein kinase kinases, MKK1 and MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca sexta-induced responses in Nicotiana attenuata. Journal of Experimental Botany, 62(12), 4355–65 Hepler, P. K. (2005). Calcium: a central regulator of plant growth and development. The Plant Cell, 17(8), 2142–55 Herde, O., Atzorn, R., Fisahn, J., Wasternack, C., Willmitzer, L., & Pena-Cortes, H. (1996). Localized Wounding by Heat Initiates the Accumulation of Proteinase Inhibitor II in Abscisic Acid-Deficient Plants by Triggering Jasmonic Acid Biosynthesis. Plant Physiology, 112(2), 853–860. Hoehenwarter, W., Thomas, M., Nukarinen, E., Egelhofer, V., Röhrig, H., Weckwerth, W., … Beckers, G. J. M. (2013). Identification of novel in vivo MAP kinase substrates in Arabidopsis thaliana through use of tandem metal oxide affinity chromatography. Molecular & Cellular Proteomics : MCP, 12(2), 369–80 Hou, X., Lee, L. Y. C., Xia, K., Yan, Y., & Yu, H. (2010). DELLAs Modulate Jasmonate Signaling via Competitive Binding to JAZs. Developmental Cell, 19(6), 884–894 Howe, G. A., & Jander, G. (2008). Plant Immunity to Insect Herbivores. Annual Review of Plant Biology, 59(1), 41–66 Howe, G. A., Lightner, J., Browse, J., & Ryan, C. A. (1996). An octadecanoid pathway mutant (JL5) of tomato is compromised in signaling for defense against insect attack. The Plant Cell Online, 8(11), 2067-77 Huffaker, A., Pearce, G., & Ryan, C. a. (2006). An endogenous peptide signal in Arabidopsis activates components of the innate immune response. Proceedings of the National Academy of Sciences of the United States of America, 103(26), 10098–103 Huffaker, A., Pearce, G., Veyrat, N., Erb, M., Turlings, T. C. J., Sartor, R., … Schmelz, E. A. (2013). Plant elicitor peptides are conserved signals regulating direct and indirect antiherbivore defense. Proceedings of the National Academy of Sciences of the United States of America, 110(14), 5707–12 Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T., & Shinozaki, K. (2000). Various abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. The Plant Journal, 24(5), 655–665 Ichimura, K., Shinozaki, K., Tena, G., Sheen, J., Henry, Y., Champion, A., … Walker, J. C. (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends in Plant Science, 7(7), 301–308 Jacinto, T., McGurl, B., Franceschi, V., Delano-Freier, J., & Ryan, C. A. (1997). Tomato prosystemin promoter confers wound-inducible, vascular bundle-specific expression of the β-glucuronidase gene in transgenic tomato plants. Planta, 203(4), 406–412

Characterization of a MAPK module involved in Arabidopsis response to wounding 114

Jacobs, A. K., Lipka, V., Burton, R. A., Panstruga, R., Strizhov, N., Schulze-Lefert, P., & Fincher, G. B. (2003). An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation. The Plant Cell, 15(11), 2503–13 Jagadeeswaran, G., Raina, S., Acharya, B. R., Maqbool, S. B., Mosher, S. L., Appel, H. M., … Raina, R. (2007). Arabidopsis GH3-LIKE DEFENSE GENE 1 is required for accumulation of salicylic acid, activation of defense responses and resistance to Pseudomonas syringae. Plant Journal, 51(2), 234–246 Jeter, C. R., Tang, W., Henaff, E., Butterfield, T., & Roux, S. J. (2004). Evidence of a Novel Cell Signaling Role for Extracellular Adenosine Triphosphates and Diphosphates in Arabidopsis. October, 16(October), 2652–2664 Jonak, C., Heberle-Bors, E., & Hirt, H. (1994). MAP kinases: universal multi-purpose signaling tools. Plant Molecular Biology, 24(3), 407–416 Jones, A. M., Chory, J., Dangl, J. L., Estelle, M., Jacobsen, S. E., Meyerowitz, E. M., … Weigel, D. (2008). The Impact of Arabidopsis on Human Health: Diversifying Our Portfolio. Cell, 133, 939–943 Jones, J. D. G., & Dangl, J. L. (2006). The plant immune system. Nature, 444(7117), 323–329 Ju, C., & Chang, C. (2015). Mechanistic Insights in Ethylene Perception and Signal Transdcution, 169(September), 85–95 Kallenbach, M., Alagna, F., Baldwin, I. T., & Bonaventure, G. (2010). Nicotiana attenuata SIPK, WIPK, NPR1 and Fatty Acid-Amino Acid Conjugates Participate in the Induction of Jasmonic Acid Biosynthesis by Affecting Early Enzymatic Steps in the Pathway, 152(January), 96–106 Kamiyoshihara, Y., Iwata, M., Fukaya, T., Tatsuki, M., & Mori, H. (2010). Turnover of LeACS2, a wound-inducible 1-aminocyclopropane-1-carboxylic acid synthase in tomato, is regulated by phosphorylation/dephosphorylation. Plant Journal, 64(1), 140–150 Kanchiswamy, C. N., Takahashi, H., Quadro, S., Maffei, M. E., Bossi, S., Bertea, C., … Arimura, G. (2010). Regulation of Arabidopsis defense responses against Spodoptera littoralis by CPK-mediated calcium signaling. BMC Plant Biology, 10: 97 Kandoth, P. K., Ranf, S., Pancholi, S. S., Jayanty, S., Walla, M. D., Miller, W., … Stratmann, J. W. (2007). Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the systemin- mediated defense response against herbivorous insects. Proceedings of the National Academy of Sciences of the United States of America, 104(29), 12205–12210 Kessler, A., & Baldwin, I. T. (2001). Defensive Function of Herbivore-Induced Plant Volatile Emissions in Nature. Science, 291(5511), 2141-4 Kiep, V., Vadassery, J., Lattke, J., Maaβ, J. P., Boland, W., Peiter, E., & Mithöfer, A. (2015). Systemic cytosolic Ca2+ elevation is activated upon wounding and herbivory in Arabidopsis. New Phytologist, 207(4), 996–1004 Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., … Harter, K. (2007). The AtGenExpress global stress expression data set: Protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. Plant Journal, 50(2), 347–363

Characterization of a MAPK module involved in Arabidopsis response to wounding 115

Klauser, D., Desurmont, G. a., Glauser, G. D. S., Vallat, A., Flury, P., Boller, T., … Bartels, S. (2015). The Arabidopsis Pep-PEPR system is induced by herbivore feeding and contributes to JA-mediated plant defence against herbivory. Journal of Experimental Botany, 66(17), 5327–5336 Kloek, A. P., Verbsky, M. L., Sharma, S. B., Schoelz, J. E., Vogel, J., Klessig, D. F., & Kunkel, B. N. (2001). Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive ( coi1 ) mutation occurs through two distinct mechanisms, 26(5), 509- 522 Kohorn, B. D., Johansen, S., Shishido, A., Todorova, T., Martinez, R., Defeo, E., & Obregon, P. (2009). Pectin activation of MAP kinase and gene expression is WAK2 dependent. Plant Journal, 60(6), 974–982 Kombrink, E. (2012). Chemical and genetic exploration of jasmonate biosynthesis and signaling paths. Planta, 236(5), 1351–1366 Koo, A. J. K., Gao, X., Daniel Jones, a., & Howe, G. a. (2009). A rapid wound signal activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant Journal, 59(6), 974– 986 Koornneef, A., Leon-Reyes, A., Ritsema, T., Verhage, A., Den Otter, F. C., Van Loon, L. C., & Pieterse, C. M. J. (2008). Kinetics of salicylate-mediated suppression of jasmonate signaling reveal a role for redox modulation. Plant Physiology, 147(3), 1358–68 Kosetsu, K., Matsunaga, S., Nakagami, H., Colcombet, J., Sasabe, M., Soyano, T., … Machida, Y. (2010). The MAP kinase MPK4 is required for cytokinesis in Arabidopsis thaliana. The Plant Cell, 22(11), 3778–3790 Kovtun, Y., Chiu, W. L., Tena, G., & Sheen, J. (2000). Functional analysis of oxidative stress- activated mitogen-activated protein kinase cascade in plants. Proceedings of the National Academy of Sciences of the United States of America, 97(6), 2940–2945 Krol, E., Mentzel, T., Chinchilla, D., Boller, T., Felix, G., Kemmerling, B., … Hedrich, R. (2010). Perception of the Arabidopsis danger signal peptide 1 involves the pattern recognition receptor AtPEPR1 and its close homologue AtPEPR2. Journal of Biological Chemistry, 285(18), 13471–13479 Kudla, J., Batistic, O., & Hashimoto, K. (2010). Calcium signals: the lead currency of plant information processing. The Plant Cell, 22(3), 541–63 Kwak, J. M., Mori, I. C., Pei, Z. M., Leonhardt, N., Angel Torres, M., Dangl, J. L., … Schroeder, J. I. (2003). NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis. EMBO Journal, 22(11), 2623–2633 Lackman, P., González-Guzmán, M., Tilleman, S., Carqueijeiro, I., Pérez, A. C., Moses, T., … Goossens, A. (2011). Jasmonate signaling involves the abscisic acid receptor PYL4 to regulate metabolic reprogramming in Arabidopsis and tobacco. Proceedings of the National Academy of Sciences of the United States of America, 108(14), 5891–6 Lee, J. S., Huh, K. W., Bhargava, A., & Ellis, B. E. (2008). Comprehensive analysis of protein- protein interactions between Arabidopsis MAPKs and MAPK kinases helps define potential MAPK signalling modules. Plant Signaling & Behavior, 3(12), 1037–1041 Characterization of a MAPK module involved in Arabidopsis response to wounding 116

León, J., Rojo, E., & Sánchez-Serrano, J. J. (2001). Wound signalling in plants. Journal of Experimental Botany, 52(354), 1–9 Leon-Reyes, A., Du, Y., Koornneef, A., Proietti, S., Körbes, A. P., Memelink, J., … Ritsema, T. (2010). Ethylene Signaling Renders the Jasmonate Response of Arabidopsis Insensitive to Future Suppression by Salicylic Acid. Molecular Plant-Microbe Interactions, 23(2), 187– 197 Levin, D. E., Abe, M., Saka, A., Watanabe, D., Kono, K., Minemura-Asakawa, M., … Ohya, Y. (2011). Regulation of cell wall biogenesis in Saccharomyces cerevisiae: the cell wall integrity signaling pathway. Genetics, 189(4), 1145–75 Li, K., Yang, F., Zhang, G., Song, S., Li, Y., Ren, D., … Song, C.-P. (2017). AIK1, A Mitogen- Activated Protein Kinase, Modulates Abscisic Acid Responses through the MKK5-MPK6 Kinase Cascade. Plant Physiology, 173(2), 1391–1408 Li, L., Zhao, Y., McCaig, B. C., Wingerd, B. A., Wang, J., Whalon, M. E., … Howe, G. A. (2004). The tomato homolog of CORONATINE-INSENSITIVE1 is required for the maternal control of seed maturation, jasmonate-signaled defense responses, and glandular trichome development. The Plant Cell, 16(1), 126–43 Lindenburg, L., & Merkx, M. (2014). Engineering genetically encoded FRET sensors. Sensors (Basel, Switzerland), 14(7), 11691–713 Lorenzo, O., Chico, J. M., Sánchez-Serrano, J. J., & Solano, R. (2004). JASMONATE- INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. The Plant Cell, 16(7), 1938–50 Maffei, M., Bossi, S., Spiteller, D., Mithöfer, A., & Boland, W. (2004). Effects of feeding Spodoptera littoralis on lima bean leaves. I. Membrane potentials, intracellular calcium variations, oral secretions, and regurgitate components. Plant Physiology, 134(4), 1752–62 Maffei, M. E., Mithöfer, A., Arimura, G.-I., Uchtenhagen, H., Bossi, S., Bertea, C. M., … Boland, W. (2006). Effects of feeding Spodoptera littoralis on lima bean leaves. III. Membrane depolarization and involvement of hydrogen peroxide. Plant Physiology, 140(3), 1022–35 Marchive, C., Roudier, F., Castaings, L., Bréhaut, V., Blondet, E., Colot, V., … Krapp, A. (2013). Nuclear retention of the transcription factor NLP7 orchestrates the early response to nitrate in plants. Nature Communications, 4, 1713 Marino, D., Dunand, C., Puppo, A., & Pauly, N. (2012). A burst of plant NADPH oxidases. Trends in Plant Science, 17(1), 9–15 Matsuoka, D., Yasufuku, T., Furuya, T., & Nanmori, T. (2015). An abscisic acid inducible Arabidopsis MAPKKK, MAPKKK18 regulates leaf senescence via its kinase activity. Plant Molecular Biology, 87(6), 565-570 Mauch-Mani, B., & Slusarenko, A. J. (1996). Production of Salicylic Acid Precursors Is a Major Function of Phenylalanine Ammonia-Lyase in the Resistance of Arabidopsis to Peronospora parasitica. The Plant Cell, 8(2), 203–212

Characterization of a MAPK module involved in Arabidopsis response to wounding 117

Melotto, M., Mecey, C., Niu, Y., Chung, H. S., Katsir, L., Yao, J., … He, S. Y. (2008). A critical role of two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with the COI1 F-box protein. The Plant Journal : For Cell and Molecular Biology, 55(6), 979–88 Meyerowitz, E. M. (2001). Prehistory and history of Arabidopsis research. Plant Physiology, 125(1), 15–9 Miedema, H., Demidchik, V., Véry, A. A., Bothwell, J. H. F., Brownlee, C., & Davies, J. M. (2008). Two voltage-dependent calcium channels co-exist in the apical plasma membrane of Arabidopsis thaliana root hairs. New Phytologist, 179(2), 378–385 Miles, G. P., Samuel, M. a., Zhang, Y., & Ellis, B. E. (2005). RNA interference-based (RNAi) suppression of AtMPK6, an Arabidopsis mitogen-activated protein kinase, results in hypersensitivity to ozone and misregulation of AtMPK3. Environmental Pollution, 138(2), 230–237 Miller, G., Schlauch, K., Tam, R., Cortes, D., Torres, M. a., Shulaev, V., … Mittler, R. (2009). The Plant NADPH Oxidase RBOHD Mediates Rapid Systemic Signaling in Response to Diverse Stimuli. Science Signaling, 2(84) Mine, A., Nobori, T., Salazar-Rondon, M. C., Winkelmüller, T. M., Anver, S., Becker, D., & Tsuda, K. (2017). An incoherent feed-forward loop mediates robustness and tunability in a plant immune network. EMBO Reports, 18(3), 464–476 Minibayeva, F., Beckett, R. P., & Kranner, I. (2014). Roles of apoplastic peroxidases in plant response to wounding. Phytochemistry, 112(1), 122–129 Minibayeva, F., Kolesnikov, O., Chasov, a., Beckett, R. P., LÜthje, S., Vylegzhanina, N., … BÖttger, M. (2009). Wound-induced apoplastic peroxidase activities: Their roles in the production and detoxification of reactive oxygen species. Plant, Cell and Environment, 32(5), 497–508 Mithöfer, A., & Boland, W. (2008). Recognition of Herbivory-Associated Molecular Patterns, 146(March), 825–831 Mithöfer, A., Wanner, G., & Boland, W. (2005). Effects of feeding Spodoptera littoralis on lima bean leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to elicit herbivory-related volatile emission. Plant Physiology, 137(3), 1160–8 Mitula, F., Tajdel, M., Cieśla, A., Kasprowicz-Maluśki, A., Kulik, A., Babula-Skowrońska, D., … Ludwików, A. (2015). Arabidopsis ABA-Activated Kinase MAPKKK18 is Regulated by Protein Phosphatase 2C ABI1 and the Ubiquitin-Proteasome Pathway. Plant & Cell Physiology, 56(12), 2351–67 Monshausen, G. B., Bibikova, T. N., Weisenseel, M. H., & Gilroy, S. (2009). Ca2+ Regulates Reactive Oxygen Species Production and pH during Mechanosensing in Arabidopsis Roots. The Plant Cell Online, 21(8), 2341–2356 Monshausen, G. B., & Gilroy, S. (2009). Feeling green: mechanosensing in plants. Trends in Cell Biology, 19(5), 228–35

Characterization of a MAPK module involved in Arabidopsis response to wounding 118

Montillet, J.-L., Leonhardt, N., Mondy, S., Tranchimand, S., Rumeau, D., Boudsocq, M., … Hirt, H. (2013). An abscisic acid-independent oxylipin pathway controls stomatal closure and immune defense in Arabidopsis. PLoS Biology, 11(3) Morris, E. P., & Török, K. (2001). Oligomeric structure of α-calmodulin-dependent protein kinase II11Edited by A. R. Fersht. Journal of Molecular Biology, 308(1), 1–8 Mosblech, A., König, S., Stenzel, I., Grzeganek, P., Feussner, I., & Heilmann, I. (2008). Phosphoinositide and inositolpolyphosphate signalling in defense responses of Arabidopsis thaliana challenged by mechanical wounding. Molecular Plant, 1(2), 249–261 Mousavi, S. a R., Chauvin, A., Pascaud, F., Kellenberger, S., & Farmer, E. E. (2013). GLUTAMATE RECEPTOR-LIKE genes mediate leaf-to-leaf wound signalling. Nature, 500(7463), 422–6 Mur, L. A. J., Kenton, P., Atzorn, R., Miersch, O., & Wasternack, C. (2006). The Outcomes of Concentration-Specific Interactions between Salicylate and Jasmonate Signaling Include Synergy , Antagonism , and Oxidative Stress Leading to Cell Death, 140(January), 249–262 Nagels Durand, A., Pauwels, L., & Goossens, A. (2016). The Ubiquitin System and Jasmonate Signaling. Plants (Basel, Switzerland), 5(1) Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M., & Gheysen, G. (2011). The Jasmonate Pathway Is a Key Player in Systemically Induced Defense against Root Knot Nematodes in Rice. Plant Physiology, 157(1), 305-16 Nakamura, S., Pourkheirandish, M., Morishige, H., Kubo, Y., Nakamura, M., Ichimura, K., … Komatsuda, T. (2016). Mitogen-Activated Protein Kinase Kinase 3 Regulates Seed Dormancy in Barley. Current Biology, 1–7 Nibau, C., Wu, H. M., & Cheung, A. Y. (2006). RAC/ROP GTPases: “hubs” for signal integration and diversification in plants. Trends in Plant Science, 11(6), 309–315 Niki, T., Mitsuhara, I., Seo, S., Ohtsubo, N., & Ohashi, Y. (1998). Antagonistic Effect of Salicylic Acid and Jasmonic Acid on the Expression of Pathogenesis-Related ( PR ) Protein Genes in Wounded Mature Tobacco Leaves, 39(5), 500–507 Nühse, T. S. (2012). Cell wall integrity signaling and innate immunity in plants. Frontiers in Plant Science, 3, 280 Nühse, T. S., Peck, S. C., Hirt, H., & Boller, T. (2000). Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK 6. Journal of Biological Chemistry, 275(11), 7521–7526 Orozco-Cardenas, M. L. (2001). Hydrogen Peroxide Acts as a Second Messenger for the Induction of Defense Genes in Tomato Plants in Response to Wounding, Systemin, and Methyl Jasmonate. The Plant Cell Online, 13(1), 179–191 Orozco-Cardenas, M., McGurl, B., & Ryan, C. A. (1993). Expression of an antisense prosystemin gene in tomato plants reduces resistance toward Manduca sexta larvae. Proceedings of the National Academy of Sciences of the United States of America, 90(17), 8273–6

Characterization of a MAPK module involved in Arabidopsis response to wounding 119

Ortiz-Masia, D., Perez-Amador, M. a., Carbonell, J., & Marcote, M. J. (2007). Diverse stress signals activate the C1 subgroup MAP kinases of Arabidopsis. FEBS Letters, 581(9), 1834– 1840 Oyarce, P., & Gurovich, L. (2011). Evidence for the transmission of information through electric potentials in injured avocado trees. Journal of Plant Physiology, 168(2), 103–108 Paschold, A., Halitschke, R., & Baldwin, I. T. (2007). Co(i)-ordinating defenses: NaCOI1 mediates herbivore-induced resistance in Nicotiana attenuata and reveals the role of herbivore movement in avoiding defenses. Plant Journal, 51(1), 79–91 Pauwels, L., Inzé, D., & Goossens, A. (2009). Jasmonate-inducible gene: what does it mean? Trends in Plant Science, 14(2), 87–91 Pena-Cortés, H., Albrecht, T., Prat, S., Weiler, E. W., & Willmitzer, L. (1993). Aspirin prevents wound-induced gene expression in tomato leaves by blocking jasmonic acid biosynthesis. Planta, 191(1), 123–128 Peyronnet, R., Tran, D., Girault, T., & Frachisse, J.-M. (2014). Mechanosensitive channels: feeling tension in a world under pressure. Frontiers in Plant Science, 5(October), 1–14 Pieterse, C. M. J., Van der Does, D., Zamioudis, C., Leon-Reyes, A., & Van Wees, S. C. M. (2012). Hormonal modulation of plant immunity. Annual Review of Cell and Developmental Biology, 28, 489–521 Popescu, S. C., Popescu, G. V, Bachan, S., Zhang, Z., Gerstein, M., Snyder, M., & Dinesh- kumar, S. P. (2009). MAPK target networks in Arabidopsis thaliana revealed using functional protein microarrays, 80–92 Poudel, A. N., Zhang, T., Kwasniewski, M., Nakabayashi, R., Saito, K., & Koo, A. J. (2016). Mutations in jasmonoyl-L-isoleucine-12-hydroxylases suppress multiple JA-dependent wound responses in Arabidopsis thaliana. Biochimica et Biophysica Acta, 1861(9),1396- 1408 Reymond, P. (2004). A conserved transcript pattern in response to a specialist and a generalist herbivore. The Plant Cell …, 16(November), 3132–3147 Reymond, P., & Farmer, E. E. (1998). Jasmonate and salicylate as global signals for defense gene expression. Current Opinion in Plant Biology, 1(5), 404–411 Reymond, P., Weber, H., Damond, M., & Farmer, E. E. (2000). Differential Gene Expression in Response to Mechanical Wounding and Insect Feeding in Arabidopsis. The Plant Cell, 12(5), 707–720 Ribot, C., Zimmerli, C., Farmer, E. E., Reymond, P., & Poirier, Y. (2008). Induction of the Arabidopsis PHO1;H10 Gene by 12-Oxo-Phytodienoic Acid But Not Jasmonic Acid via a CORONATINE INSENSITIVE1-Dependent Pathway. Plant Physiology, 147(2), 696–706 Robert, N., Merlot, S., N’Guyen, V., Boisson-Dernier, A., & Schroeder, J. I. (2006). A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly affects ABA signaling in Arabidopsis. FEBS Letters, 580(19), 4691–4696 Ryan, C. A. (1990). Protease Inhibitors in Plants: Genes for Improving Defenses Against Insects and Pathogens. Annual Review of Phytopathology, 28(1), 425–449 Characterization of a MAPK module involved in Arabidopsis response to wounding 120

Ryu, S. B., & Wang, X. (1996). Activation of phospholipase D and the possible mechanism of activation in wound-induced lipid hydrolysis in castor bean leaves. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism, 1303(3), 243–250 Salvador-Recatalà, V., Tjallingii, W. F., & Farmer, E. E. (2014). Real-time, in vivo intracellular recordings of caterpillar-induced depolarization waves in sieve elements using aphid electrodes. New Phytologist, 203(2), 674–684 Samuel, M. a, & Ellis, B. E. (2002). Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. The Plant Cell, 14(9), 2059–2069 Savatin, D. V, Gramegna, G., Modesti, V., & Cervone, F. (2014). Wounding in the plant tissue: the defense of a dangerous passage. Frontiers in Plant Science, 5(September), 5:470 Schafer, M., Fischer, C., Meldau, S., Seebald, E., Oelmuller, R., & Baldwin, I. T. (2011). Lipase Activity in Insect Oral Secretions Mediates Defense Responses in Arabidopsis. Plant Physiology, 156(3), 1520–1534 Schaller, A., & Stintzi, A. (2009). Enzymes in jasmonate biosynthesis - structure, function, regulation. Phytochemistry, 70(13-14), 1532–8 Schmelz, E. A., Engelberth, J., Alborn, H. T., Tumlinson, J. H., Teal, P. E. A., & Teal, P. E. A. (2009). Phytohormone-based activity mapping of insect herbivore-produced elicitors. Proceedings of the National Academy of Sciences of the United States of America, 106(2), 653–7 Schmelz, E. A., LeClere, S., Carroll, M. J., Alborn, H. T., & Teal, P. E. A. (2007). Cowpea chloroplastic ATP synthase is the source of multiple plant defense elicitors during insect herbivory. Plant Physiology, 144(2), 793–805 Scholz, S. S., Vadassery, J., Heyer, M., Reichelt, M., Bender, K. W., Snedden, W. a., … Mithöfer, A. (2014). Mutation of the arabidopsis calmodulin-like protein CML37 deregulates the jasmonate pathway and enhances susceptibility to herbivory. Molecular Plant, 7(12), 1712–1726 Schwacke, R., Schneider, A., van der Graaff, E., Fischer, K., Catoni, E., Desimone, M., … Kunze, R. (2003). ARAMEMNON, a novel database for Arabidopsis integral membrane proteins. Plant Physiology, 131(1), 16–26 Schweighofer, A., Kazanaviciute, V., Scheikl, E., Teige, M., Doczi, R., Hirt, H., … Meskiene, I. (2007). The PP2C-type phosphatase AP2C1, which negatively regulates MPK4 and MPK6, modulates innate immunity, jasmonic acid, and ethylene levels in Arabidopsis. The Plant Cell, 19(7), 2213–24 Schweizer, F., Fernández-Calvo, P., Zander, M., Diez-Diaz, M., Fonseca, S., Glauser, G., … Reymond, P. (2013). Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior. The Plant Cell, 25(8), 3117–32 Seo, S., Katou, S., Seto, H., Gomi, K., & Ohashi, Y. (2007). The mitogen-activated protein kinases WIPK and SIPK regulate the levels of jasmonic and salicylic acids in wounded tobacco plants. The Plant Journal : For Cell and Molecular Biology, 49(5), 899–909 Characterization of a MAPK module involved in Arabidopsis response to wounding 121

Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H., & Ohashi, Y. (1995). Tobacco MAP Kinase : A Possible Mediator in Wound Signal Transduction Pathvvays, 270(5244), 1988– 1992 Sethi, V., Raghuram, B., Sinha, A. K., & Chattopadhyay, S. (2014). A Mitogen-Activated Protein Kinase Cascade Module, MKK3-MPK6 and MYC2, Is Involved in Blue Light-Mediated Seedling Development in Arabidopsis. The Plant Cell, 26(8), 3343–3357 Shah, J. (2003). The salicylic acid loop in plant defense. Current Opinion in Plant Biology, 6(4), 365–371 Shibata, W., Banno, H., Ito, Y., Hirano, K., Irie, K., Usami, S., … Machida, Y. (1995). A tobacco protein kinase, NPK2, has a domain homologous to a domain found in activators of mitogen-activated protein kinases (MAPKKs). MGG Molecular & General Genetics, 246(4), 401–410 Soares, N. C., Wojtkowska, J., & Jackson, P. A. (2011). A proteomic analysis of the wound response in Medicago leaves reveals the early activation of a ROS-sensitive signal pathway. Journal of Proteomics, 74(8), 1411–1420 Song, C. J., Steinebrunner, I., Wang, X., Stout, S. C., & Roux, S. J. (2006). Extracellular ATP induces the accumulation of superoxide via NADPH oxidases in Arabidopsis. Plant Physiology, 140(4), 1222–32 Spoel, S. H., Johnson, J. S., & Dong, X. (2007). Regulation of tradeoffs between plant defenses against pathogens with different lifestyles, 2007, 104(47), 18842-7 Spoel, S. H., Koornneef, A., Claessens, S. M. C., Korzelius, J. P., Pelt, J. A. Van, Mueller, M. J., … Pieterse, C. M. J. (2003). NPR1 Modulates Cross-Talk between Salicylate- and Jasmonate-Dependent Defense Pathways through a Novel Function in the Cytosol, 15(March), 760–770 Staswick, P. E., Su, W., & Howell, S. H. (1992). Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proceedings of the National Academy of Sciences of the United States of America, 89(15), 6837–40 Staswick, P. E., & Tiryaki, I. (2004). The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. The Plant Cell, 16(8), 2117–27 Staswick, P. E., Yuen, G. Y., & Lehman, C. C. (1998). Jasmonate signaling mutants ofArabidopsisare susceptible to the soil fungusPythium irregulare. The Plant Journal, 15(6), 747–754 Stenzel, I., Otto, M., Delker, C., Kirmse, N., Schmidt, D., Miersch, O., … Wasternack, C. (2012). ALLENE OXIDE CYCLASE (AOC) gene family members of Arabidopsis thaliana: tissue- and organ-specific promoter activities and in vivo heteromerization. Journal of Experimental Botany, 63(17), 6125–38 Stotz, H. U., Koch, T., Biedermann, A., Weniger, K., Boland, W., & Mitchell-Olds, T. (2002). Evidence for regulation of resistance in Arabidopsis to Egyptian cotton worm by salicylic and jasmonic acid signaling pathways. Planta, 214(4), 648–652

Characterization of a MAPK module involved in Arabidopsis response to wounding 122

Suarez-Rodriguez, M. C., Adams-Phillips, L., Liu, Y., Wang, H., Su, S.-H., Jester, P. J., … Krysan, P. J. (2007). MEKK1 Is Required for flg22-Induced MPK4 Activation in Arabidopsis Plants. Plant Physiology, 143(2), 661–669 Sultana, A., Kallio, P., Jansson, A., Wang, J.-S., Niemi, J., Mäntsälä, P., & Schneider, G. (2004). Structure of the polyketide cyclase SnoaL reveals a novel mechanism for enzymatic aldol condensation. The EMBO Journal, 23(9), 1911–21 Suza, W. P., & Staswick, P. E. (2008). The role of JAR1 in Jasmonoyl-l-isoleucine production during Arabidopsis wound response. Planta, 227(6), 1221–1232 Suzuki, N., & Mittler, R. (2012). Reactive oxygen species-dependent wound responses in animals and plants. Free Radical Biology and Medicine, 53(12), 2269–2276 Swiatek, A., Lenjou, M., Van Bockstaele, D., Inzé, D., & Van Onckelen, H. (2002). Differential effect of jasmonic acid and abscisic acid on cell cycle progression in tobacco BY-2 cells. Plant Physiology, 128(1), 201–11 Szczegielniak, J., Borkiewicz, L., Szurmak, B., Lewandowska-Gnatowska, E., Statkiewicz, M., Klimecka, M., … Muszynska, G. (2012). Maize calcium-dependent protein kinase (ZmCPK11): Local and systemic response to wounding, regulation by touch and components of jasmonate signaling. Physiologia Plantarum, 146(1), 1–14 Takahashi, F., Mizoguchi, T., Yoshida, R., Ichimura, K., & Shinozaki, K. (2011). Calmodulin- Dependent Activation of MAP Kinase for ROS Homeostasis in Arabidopsis. Molecular Cell, 41(6), 649–660 Takahashi, F., Yoshida, R., Ichimura, K., Mizoguchi, T., Seo, S., Yonezawa, M., … Shinozaki, K. (2007). The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. The Plant Cell, 19(3), 805–818 Taki, N., Sasaki-Sekimoto, Y., Obayashi, T., Kikuta, A., Kobayashi, K., Ainai, T., … Ohta, H. (2005). 12-Oxo-Phytodienoic Acid Triggers Expression of a Distinct Set of Genes and Plays a Role in Wound-Induced Gene Expression in Arabidopsis. Plant Physiology, 139(3), 1268– 1283 Tanaka, K., Choi, J., Cao, Y., & Stacey, G. (2014). Extracellular ATP acts as a damage- associated molecular pattern (DAMP) signal in plants. Frontiers in Plant Science, 5(September), 446 Tanoue, T., Adachi, M., Moriguchi, T., & Nishida, E. (2000). A conserved docking motif in MAP kinases common to substrates, activators and regulators. Nature Cell Biology, 2(2), 110–116 Teige, M., Scheikl, E., Eulgem, T., Doczi, R., Ichimura, K., Shinozaki, K., … Hirt, H. (2004). The MKK2 pathway mediates cold and salt stress signaling in Arabidopsis. Mol Cell, 15(1), 141–152 Thaler, J. S., & Bostock, R. M. (2004). Interactions between abscisic-acid-emediated responses and plant resistence to pathogens and insects. Ecology, 85(1), 48–58 Thaler, J. S., Fidantsef, A. L., & Bostock, R. M. (2002). Antagonism Between Jasmonate- and Salicylate-Mediated Induced Plant Resistance: Effects of Concentration and Timing of

Characterization of a MAPK module involved in Arabidopsis response to wounding 123

Elicitation on Defense-Related Proteins, Herbivore, and Pathogen Performance in Tomato. Journal of Chemical Ecology, 28(6), 1131–1159 Thaler, J. S., Stout, M. J., Karban, R., & Duffey, S. S. (1996). Exogenous jasmonates simulate insect wounding in tomato plants (Lycopersicon esculentum) in the laboratory and field. Journal of Chemical Ecology, 22(10), 1767–1781 The Arabidopsis Genome Initiative. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature, 408(6814), 796–815 Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., … Browse, J. (2007). JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature, 448(7154), 661–665 Thomma, B. P. H. J., Eggermont, K., Penninckx, I. a. M. a., Mauch-Mani, B., Vogelsang, R., Cammue, B. P. a., & Broekaert, W. F. (1998). Separate jasmonate-dependent and salicylate- dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences of the United States of America, 95(December), 15107–15111 Thorpe, M. R., Ferrieri, A. P., Herth, M. M., & Ferrieri, R. a. (2007). 11C-imaging: Methyl jasmonate moves in both phloem and xylem, promotes transport of jasmonate, and of photoassimilate even after proton transport is decoupled. Planta, 226(2), 541–551 Torres, M. A., & Dangl, J. L. (2005). Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current Opinion in Plant Biology, 8(4), 397– 403 Torres, M. A., Jones, J. D. G., & Dangl, J. L. (2005). Pathogen-induced, NADPH oxidase– derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nature Genetics, 37(10), 1130–1134 Tripathy, B. C., & Oelmüller, R. (2012). Reactive oxygen species generation and signaling in plants. Plant Signaling & Behavior, 7(12), 1621–33 Tsuda, K., Mine, A., Bethke, G., Igarashi, D., Botanga, C. J., Tsuda, Y., … Katagiri, F. (2013). Dual Regulation of Gene Expression Mediated by Extended MAPK Activation and Salicylic Acid Contributes to Robust Innate Immunity in Arabidopsis thaliana. PLoS Genetics, 9(12) Umezawa, T., Sugiyama, N., Takahashi, F., Anderson, J. C., Ishihama, Y., Peck, S. C., … Shinozaki, K. (2013). Genetics and phosphoproteomics reveal a protein phosphorylation network in the abscisic acid signaling pathway in Arabidopsis thaliana. Science Signaling, 6(270) Vadassery, J., Reichelt, M., Hause, B., Gershenzon, J., Boland, W., & Mithöfer, a. (2012). CML42-mediated calcium signaling coordinates responses to Spodoptera herbivory and abiotic stresses in Arabidopsis. Plant Physiology, 159(3), 1159–1175 Van Poecke, R. M. P., & Dicke, M. (2004). Indirect defence of plants against herbivores: Using Arabidopsis thaliana as a model plant. Plant Biology, 6(4), 387–401 Van Poecke, R. M. P., Posthumus, M. A., & Dicke, M. (2001). Herbivore-Induced Volatile Production by Arabidopsis thaliana Leads to Attraction of the Parasitoid Cotesia rubecula:

Characterization of a MAPK module involved in Arabidopsis response to wounding 124

Chemical, Behavioral, and Gene-Expression Analysis. Journal of Chemical Ecology, 27(10), 1911–1928 Vincent, T. R., Avramova, M., Canham, J., Higgins, P., Bilkey, N., Mugford, S. T., … Sanders, D. (2017). Interplay of Plasma Membrane and Vacuolar Ion Channels, Together with BAK1, Elicits Rapid Cytosolic Calcium Elevations in Arabidopsis during Aphid Feeding. The Plant Cell, 29(6), 1460-1479 Von Dahl, C. C., & Baldwin, I. T. (2007). Deciphering the Role of Ethylene in Plant–Herbivore Interactions. Journal of Plant Growth Regulation, 26(2), 201–209 Vos, I. A., Verhage, A., Schuurink, R. C., Watt, L. G., Pieterse, C. M. J., & Van Wees, S. C. M. (2013). Onset of herbivore-induced resistance in systemic tissue primed for jasmonate- dependent defenses is activated by abscisic acid, 4(December), 1–10 Walling, L. L. (2000). The myriad plant responses to herbivores. Journal Of Plant Growth Regulation, 19(2), 195–216 Walton, J. D. (1994). Deconstructing the Cell Wall. Plant Physiology, 104(4), 1113–1118 Wang, C., Lu, W., He, X., Wang, F., Zhou, Y., Guo, X., & Guo, X. (2016). The Cotton Mitogen- Activated Protein Kinase Kinase 3 Functions in Drought Tolerance by Regulating Stomatal Responses and Root Growth. Plant and Cell Physiology, 57(8), 1629-42 Wang, C., Zien, C. a, Afitlhile, M., Welti, R., Hildebrand, D. F., & Wang, X. (2000). Involvement of phospholipase D in wound-induced accumulation of jasmonic acid in arabidopsis. The Plant Cell, 12(11), 2237–2246 Wang, H., Ngwenyama, N., Liu, Y., Walker, J. C., & Zhang, S. (2007). Stomatal Development and Patterning Are Regulated by Environmentally Responsive Mitogen-Activated Protein Kinases in Arabidopsis. The Plant Cell Online, 19(1), 63–73 Wasternack, C., & Hause, B. (2013). Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of Botany, 111(6), 1021–1058 Wasternack, C., & Kombrink, E. (2010). Jasmonates: Structural Requirements for Lipid-Derived Signals Active in Plant Stress Responses and Development. ACS Chemical Biology, 5(1), 63–77 Weerasinghe, R. R., Swanson, S. J., Okada, S. F., Garrett, M. B., Kim, S. Y., Stacey, G., … Jones, A. M. (2009). Touch induces ATP release in Arabidopsis roots that is modulated by the heterotrimeric G-protein complex. FEBS Letters, 583(15), 2521–2526 Wildon, D. C. (1992). Electrical signalling and systemic proteinase inhibitor induction in the wounded plant. Nature, 355(6357), 242–244 Windram, O., Madhou, P., McHattie, S., Hill, C., Hickman, R., Cooke, E., … Denby, K. J. (2012). Arabidopsis defense against Botrytis cinerea: chronology and regulation deciphered by high-resolution temporal transcriptomic analysis. The Plant Cell, 24(9), 3530–57 Wu, J., & Baldwin, I. T. (2010). New insights into plant responses to the attack from insect herbivores. Annual Review of Genetics, 44, 1–24

Characterization of a MAPK module involved in Arabidopsis response to wounding 125

Wu, J., Hettenhausen, C., Meldau, S., & Baldwin, I. T. (2007). Herbivory Rapidly Activates MAPK Signaling in Attacked and Unattacked Leaf Regions but Not between Leaves of Nicotiana attenuata, 19(March), 1096–1122 Xie, D.-X., Feys, B. F., James, S., Nieto-Rostro, M., & Turner, J. G. (1998). COI1: An Arabidopsis Gene Required for Jasmonate-Regulated Defense and Fertility. Science, 280(5366), 1091-4 Xu, J., Hofhuis, H., Heidstra, R., Sauer, M., Friml, J., & Scheres, B. (2006). A Molecular Framework for Plant Regeneration. Science, 311(5759), 385-8 Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W. L., Peng, W., … Xie, D. (2002). The SCF(COI1) ubiquitin-ligase complexes are required for jasmonate response in Arabidopsis. Society, 14(August), 1919–1935 Yamaguchi, Y., & Huffaker, A. (2011). Endogenous peptide elicitors in higher plants. Current Opinion in Plant Biology, 14(4), 351–7 Yamaguchi, Y., Huffaker, A., Bryan, A. C., Tax, F. E., & Ryan, C. a. (2010). PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis. The Plant Cell, 22(2), 508–22 Yan, D., Easwaran, V., Chau, V., Okamoto, M., Ierullo, M., Kimura, M., … Nambara, E. (2016). NIN-like protein 8 is a master regulator of nitrate-promoted seed germination in Arabidopsis. Nature Communications, 7, 13179 Yan, J., Zhang, C., Gu, M., Bai, Z., Zhang, W., Qi, T., … Xie, D. (2009). The Arabidopsis CORONATINE INSENSITIVE1 Protein Is a Jasmonate Receptor. The Plant Cell Online, 21(8), 2220–2236 Yan, Y., Stolz, S., Chételat, A., Reymond, P., Pagni, M., Dubugnon, L., & Farmer, E. E. (2007). A downstream mediator in the growth repression limb of the jasmonate pathway. The Plant Cell, 19(8), 2470–83 Yang, D.-H., Hettenhausen, C., Baldwin, I. T., & Wu, J. (2012). Silencing Nicotiana attenuata Calcium-Dependent Protein Kinases, CDPK4 and CDPK5, Strongly Up-Regulates Wound- and Herbivory-Induced Jasmonic Acid Accumulations. Plant Physiology, 159(4), 1591– 1607 Yasuda, M., Ishikawa, A., Jikumaru, Y., Seki, M., Umezawa, T., Asami, T., … Nakashita, H. (2008). Antagonistic interaction between systemic acquired resistance and the abscisic acid- mediated abiotic stress response in Arabidopsis. The Plant Cell, 20(6), 1678–92 Yoo, S.-D., Cho, Y.-H., & Sheen, J. (2007). Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols, 2(7), 1565–1572 Yoshida, Y., Sano, R., Wada, T., Takabayashi, J., & Okada, K. (2009). Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis. Development (Cambridge, England), 136(6), 1039–48 Yuan, P., Jauregui, E., Du, L., Tanaka, K., & Poovaiah, B. W. (2017). Calcium signatures and signaling events orchestrate plant–microbe interactions. Current Opinion in Plant Biology, 38, 173–183

Characterization of a MAPK module involved in Arabidopsis response to wounding 126

Zebelo, S. a., & Maffei, M. E. (2015). Role of early signalling events in plant-insect interactions. Journal of Experimental Botany, 66(2), 435–448 Zhai, Q., Yan, L., Tan, D., Chen, R., Sun, J., Gao, L., … Li, C. (2013). Phosphorylation-coupled proteolysis of the transcription factor MYC2 is important for jasmonate-signaled plant immunity. PLoS Genetics, 9(4) Zhang, Y., & Turner, J. G. (2008). Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis. PloS One, 3(11) Zheng, Z., Qualley, A., Fan, B., Dudareva, N., & Chen, Z. (2009). An important role of a BAHD acyl transferase-like protein in plant innate immunity. Plant Journal, 57(6), 1040–1053 Zhu, Z., An, F., Feng, Y., Li, P., Xue, L., Mu, A., … Kim, J. (2011). Derepression of ethylene- stabilized transcription factors ( EIN3 / EIL1 ) mediates jasmonate and ethylene signaling synergy in Arabidopsis, 108(30), 12539–12544 Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., & Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology, 136(1), 2621–32 Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J. D. G., Boller, T., & Felix, G. (2006). Perception of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts Agrobacterium- Mediated Transformation. Cell, 125(4), 749–760

Characterization of a MAPK module involved in Arabidopsis response to wounding 127

ANNEX fpls-07-01941 December 21, 2016 Time: 17:46 # 1

MINI REVIEW published: 22 December 2016 doi: 10.3389/fpls.2016.01941

Convergence of Multiple MAP3Ks on MKK3 Identifies a Set of Novel Stress MAPK Modules

Jean Colcombet1*, Cécile Sözen1 and Heribert Hirt2

1 Institute of Plant Sciences Paris-Saclay, Centre National de la Recherche Scientifique, Institut National de la Recherche Agronomique, Université Paris-Sud, Université d’Evry, Université Paris-Diderot, Sorbonne Paris-Cité, Université Paris-Saclay, Orsay, France, 2 Center for Desert Agriculture, King Abdullah University of Science and Technology, Thuwal, Saudi Arabia

Since its first description in 1995 and functional characterization 12 years later, plant MKK3-type MAP2Ks have emerged as important integrators in plant signaling. Although they have received less attention than the canonical stress-activated mitogen-activated protein kinases (MAPKs), several recent publications shed light on their important roles in plant adaptation to environmental conditions. Nevertheless, the MKK3-related literature is complicated. This review summarizes the current knowledge and discrepancies on Edited by: Gerrit T. S. Beemster, MKK3 MAPK modules in plants and highlights the singular role of MKK3 in green plants. University of Antwerp, Belgium In the light of the latest data, we hypothesize a general model that all clade-III MAP3Ks Reviewed by: converge on MKK3 and C-group MAPKs, thereby defining a set of novel MAPK modules Scott C. Peck, University of Missouri, USA which are activated by stresses and internal signals through the transcriptional regulation Alok Krishna Sinha, of MAP3K genes. National Institute of Plant Genome Research, India Keywords: viridiplantae, MKK3 module, phosphorylation cascade, stress responses, mitogen-activated protein kinases *Correspondence: Jean Colcombet [email protected] saclay.fr INTRODUCTION

Specialty section: Mitogen-activated protein kinase (MAPK) modules are important signaling actors found in all This article was submitted to eukaryotic cells. They are constituted of the MAPK per se, a serine/threonine kinase which is Plant Physiology, phosphorylated and activated by a MAPK Kinase (MAP2K), itself activated by phosphorylation a section of the journal by a MAP2K Kinase (MAP3K). These modules are encoded in plants by large multigenic kinase Frontiers in Plant Science families. For example, the Arabidopsis genome codes for 20 MAPKs, 10 MAP2Ks, and about Received: 24 October 2016 80 MAP3Ks (Ichimura et al., 2002). The MAPK and MAP2K families are both organized in Accepted: 07 December 2016 four well-defined sub-clades (denoted as clades A–D). Under the generic name, MAP3Ks gather Published: 22 December 2016 several distinct kinase families which were shown in animals to activate MAP2Ks. These include Citation: the MEKK-like kinases (20 members in Arabidopsis) which are unambiguously involved in the Colcombet J, Sözen C and Hirt H activation of MAP2Ks/MAPKs in plants, the large 48 membered Raf family for which functional (2016) Convergence of Multiple MAP3Ks on MKK3 Identifies a Set data are scarce and the 11 ZIK kinases which have not been reported to act upstream MAP2Ks in of Novel Stress MAPK Modules. plants so far. Front. Plant Sci. 7:1941. Three modules defined by the three iconic MAPKs, MPK3, MPK4, and MPK6, were the focus doi: 10.3389/fpls.2016.01941 of the vast majority of MAPK studies (Colcombet and Hirt, 2008; Suarez-Rodriguez et al., 2010).

Frontiers in Plant Science | www.frontiersin.org 1 December 2016 | Volume 7 | Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 2

Colcombet et al. MKK3 Modules in Plant Signalling

Although some reports exist on the majority of MAPKs and and Izaurralde, 2003). These data indeed suggest that MKK3 MAP2Ks, plant MKK3s have been the subject of less attention. signaling could require specific shuttling mechanisms between cellular compartments. However, Ca2+/calmodulin dependent protein kinase II (CAMKII) also possesses in its C-terminal tail MKK3, AN ATYPICAL MAP2K, FOUND IN an NTF2-like domain which has been shown to be involved ALL PLANT SPECIES in its assembly of dodecamers (Morris and Török, 2001; Rellos et al., 2010). Therefore, the NTF2 domain might also function in The first MKK3-like MAP2K sequence, NtNPK2, was identified homo- or oligomerization of MKK3 proteins. But some NTF2- from a tobacco cell suspension cDNA library twenty years like domains may also have catalytic activities. For example, ago and proved to code for an active kinase (Shibata the NTF2-like Streptomyces SnoaL codes for a small polyketide et al., 1995). Classical MAP2Ks are usually rather small cyclase involved in antibiotic synthesis and the bacterial δ5-3- (about 350 amino acids) and are globular proteins with ketosteroid isomerase catalyzes the stereospecific isomerization only a single kinase domain. In contrast, NtNPK2 and of steroids (Kim et al., 1997; Sultana et al., 2004), opening all MKK3 homologs are considerably longer (>500 amino up the possibility that the NTF2-like domain of plant MKK3s acids) and contain, besides the protein kinase domain, a might also have an enzymatic activity which would be coupled NUCLEAR TRANSPORT FACTOR2 (NTF2)-like domain in to MAPK signaling. Structure-function investigations would their C-terminal regions. The MAP2K N-terminal tail, which be necessary to elucidate the exact role of this mysterious contains a docking site (D-site) for MAPKs, is also well domain. conserved within MKK3 homologues but divergent from those of other MAP2Ks. Additionally, MKK3 N-terminal tails have secondary structure motifs which are usually not found in other IN PLANTS, MKK3 HAS BEEN INVOLVED MAP2Ks. IN SEVERAL MAPK MODULES AND In the Arabidopsis genome, there is a single MKK3 gene (At5g40440) which defines the B subclade of plant MAP2Ks RESPONSES TO ENVIRONMENT (Ichimura et al., 2002). In the published plant genomes, B-type In plants and mainly in Arabidopsis, several functional studies MAP2Ks are found in almost all dicots and monocots as well placed MKK3 within MAPK modules highlighting its function in as in the primitive angiosperm Amborella trichopoda as a single several distinct physiological signaling processes. Figure 1 gives copy gene. The two gymnosperm sequenced genomes (Pinus an overview of our actual knowledge about MKK3 modules in taeda and Picea abies) do not seem to contain any MKK3 physiological processes. but the explanation could also be due to their low sequence coverage. Alternatively, a loss of MKK3 in gymnosperms could be possible. The moss Physcomitrella patens possesses two well- MKK3 in ROS Signaling and defined MKK3-like kinases (PpMKK3-1 and PpMKK3-2). The Homeostasis unicellular green algae Chlamydomonas reinhardtii codes for MKK3 was first reported to play a role during plant–pathogen very few genes having homology to MAP2Ks. Singularly, the interaction (Dóczi et al., 2007)(Figure 1A): mkk3 knock- best MAP2K candidate [referred as MAP Kinase Kinase 1 in out mutants were shown to be hypersensitive to infection NCBI (XP_001696437) and CrMKK3 in this article] possesses by Pseudomonas syringae DC3000 whereas Arabidopsis lines an NTF2-like domain in its C-terminus. Overall, the CrMKK3 expressing a constitutively active MKK3 (MKK3EE) showed sequence is not very similar to other MKK3s but the CrMKK3 mild resistance to the pathogen. Using yeast two hybrid and gene shares with AtMKK3 several conserved introns which co-immunoprecipitation assays from protoplasts, this study are not found in other Arabidopsis MAP2Ks, suggesting that also suggested that MKK3 and the four C-group MAPKs CrMKK3 and AtMKK3 have a common ancestor containing MPK1/2/7/14 interact together to define a functional MAPK an NTF2 domain and that the primary gene structure is module, that can be activated by H2O2. In support of this notion, highly conserved during evolution. This also suggests that the MPK1/2 activation by H2O2 has been confirmed in vivo by an MKK3-related pathways are conserved among all photosynthetic independent study (Ortiz-Masia et al., 2007). eukaryotes. Interestingly, an MKK3-based MAPK module has also been At present, a role of the NTF2 domain in plant MKK3s reported to act upstream of reactive oxygen species (ROS) has not been reported. A NUCLEAR TRANSPORT FACTOR2 production in response to wounding (Takahashi et al., 2011) domain suggests a function in the localization or shuttling of the (Figure 1B). In this study, the authors showed that plants protein kinase. In eukaryotes, NTF2s are small proteins which mutated in MPK8, which codes for a MAPK of the poorly have indeed been involved in protein import into the nucleus characterized D-clade, fail to locally restrict ROS production in (Moore and Blobel, 1994) and play an important role in the response to leaf wounding. Coherently, MPK8 over-expressing β-importin-dependent macromolecular trafficking by loading the plants do not produce ROS anymore in response to wounding as nucleus with RanGTP (Stewart et al., 1998). But other proteins revealed by DAB staining. The authors also showed that MPK8 containing an NTF2-like domain have distinct roles. For example, activation upon wounding depends on calcium/calmodulin as metazoan p15, through interaction with NTF2s is an important well as on MKK3. This indirectly suggests that MKK3, which actor of nuclear mRNA export (Fribourg et al., 2001; Stutz is activated by H2O2, is also involved in ROS production upon

Frontiers in Plant Science| www.frontiersin.org 2 December 2016| Volume 7| Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 3

Colcombet et al. MKK3 Modules in Plant Signalling

FIGURE 1 | Overview of MKK3 implication in MAPK modules in Arabidopsis thaliana. MKK3 functions upstream of MPK1/2/7/17 in response to H2O2 (A) and ABA (E), of MPK8 in response to wounding (B) and with MPK6 in response to jasmonic acid (JA) (C) and red light (D).

stress conditions such as wounding. To test whether MKK3- C-group MAPKs depends on MAP3K18 synthesis, explaining MPK8 forms a functional module, it could be relevant to test their activation with a rather slow kinetics. Other studies have whether mkk3 plants are impaired in wound-induced ROS shown a more rapid activation of the C-group MAPKs which production. is compatible with a post-translational activation of MAP3Ks (Ortiz-Masia et al., 2007; Umezawa et al., 2013). Interestingly, MAP3K17/18-MKK3-MPK1/2/7/14 in using lines constitutively expressing tagged MAP3K18, Matsuoka Response to ABA, Senescence, and et al.(2015) showed that ABA is also able to directly activate Dormancy the kinase within 15 min and that MAP3K18 activity peaks at In Arabidopsis, MPK1 and MPK2 were shown to be activated 30 min. Taken together, this suggests that the pathway has two by abscisic acid (ABA) (Ortiz-Masia et al., 2007; Umezawa modes of functioning, which may be dependent on unidentified et al., 2013; Danquah et al., 2015). Recently, two independent experimental differences between the laboratories working on studies demonstrated that MKK3, together with MAP3K17 and this ABA-dependent MAPK pathway. Finally, a direct interaction MAP3K18, functions upstream of MPK1, MPK2, MPK7, and between MAP3K18 and the PP2C phosphatase ABI1, but not MPK14 in an ABA-activated MAPK module (Danquah et al., with ABI2, has been described (Mitula et al., 2015). The authors 2015; Matsuoka et al., 2015)(Figure 1E). Apparent discrepancies hypothesized that besides being one of the main actors of the between these studies also suggest a dual mode of activation of ABA core signaling module, ABI1 is also able to dephosphorylate the ABA-related MKK3 module. Indeed, Danquah et al.(2015) MAP3K18 in the absence of ABA, resulting in the degradation showed that, under their experimental conditions, activation of of MAP3K18 by the proteasome. When ABA is perceived by

Frontiers in Plant Science| www.frontiersin.org 3 December 2016| Volume 7| Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 4

Colcombet et al. MKK3 Modules in Plant Signalling

FIGURE 2 | Are MAP3K of clade III building a functional module with MKK3-MPK1/2/7/14? (A) MEKK-like MAP3Ks are organized in three subclades with distinct locus organization (adapted from Danquah et al., 2015). Only members of clade III are interacting with MKK3 (determined using yeast 2 hybrid assay). n.d., not determined. (B) Number of conditions reported in Genevestigator as able to transcriptionally regulate MAP3K genes (fold-change > 3, P-value < 0.001). MAP3Ks of clade-III are shown in gray. (C) General working model for the activation of MKK3-MPK1/2/7/14 module by the stress-dependent transcriptional regulation of MAP3Ks of clade-III.

PYR/PYL receptors, ABI1 is dissociated from MAP3K18 and study similarly reported that Nicotiana benthamiana plants over- MAP3K18 is stabilized and able to activate downstream factors expressing the cotton (Gossypium hirsutum) GhMKK3 were of the signaling module. more resistant to drought and closed more efficiently their Phenotypical characterization in plants with impaired MKK3 stomata in response to ABA (Wang et al., 2016). Additionally, module function confirmed the role of MKK3 in ABA by QTL mapping for seed dormancy, two recessive mutations signaling and/or ABA-dependent processes. Danquah et al. in MKK3 orthologs have been identified in both wheat and (2015) characterized mutant plants in a drought and abiotic stress barley (Nakamura et al., 2016; Torada et al., 2016). In plants, context and showed that plants impaired in the MKK3 module dormancy is under control of seed hormonal content during are less able to restrict water loss when submitted to a long-term maturation and desiccation, with one of the main hormones mild drought experiment. More directly, the stomata of map3K18 being ABA (Shu et al., 2016). In the case of the barley mutant plants are compromised to close in response to ABA (Mitula cultivar “Azumamugi,” the recessive mutation decreases MKK3 et al., 2015) whereas MAP3K18 over-expressors show accelerated activity and thereby increases seed dormancy, suggesting that leaf senescence (Matsuoka et al., 2015), a process known to the activation of the MKK3 module releases seed dormancy be under control of ABA (Song et al., 2016). A very recent (Nakamura et al., 2016).

Frontiers in Plant Science| www.frontiersin.org 4 December 2016| Volume 7| Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 5

Colcombet et al. MKK3 Modules in Plant Signalling

MKK3-MPK6-MYC2 Is Involved in JA and ARE MAP3Ks OF SUBCLADE III BL Signaling ACTIVATORS OF MKK3 MODULES? MKK3 has also been reported to work upstream of MPK6 in the context of two pathways (Figures 1C,D). A first study showed MAP3K13-20 Define a Subclade of that the MKK3-MPK6 module plays a central role in jasmonic MEKK-Like Kinases Which Are Strongly acid (JA)-induced root growth inhibition (Takahashi et al., 2007). Transcribed in Response to Stresses MPK6 is activated by JA within 10 min and this activation is ZIK-, Raf-, and MEKK-like kinases have been shown to impaired in mkk3 but not in mkk2 mutant plants. Since MPK6 act as MAP2K Kinases in animal cells. In plants, ZIK- is very efficiently activated by many stresses, including touch, like kinases (11 members in Arabidopsis) have not been it is unfortunate that mock samples were not tested in these connected to MAPK signaling so far and Raf-like kinases JA-dependent MPK6 activation assays. Coherently, the authors (about 50 members), such as CTR1 and EDR1, seem to showed that both mkk3 and mpk6 mutants are slightly more act rather as negative regulators of MAPK modules (Yoo sensitive to exogenous JA at the root elongation level as well as et al., 2008; Zhao et al., 2014). In contrast, several MEKK1- show reduced activation of the JA-marker gene PDF1. like kinases have been shown to be activators of MAP2Ks MKK3-MPK6 has also been implicated in blue light (BL) (Colcombet and Hirt, 2008). The 20 members of this family signaling. MPK6 is activated specifically by BL but not red light. are organized in three subclades (Figure 2A). Genes of Using knock-out mutants, the authors showed that this activation subclades I and II have many introns and code for kinases is MKK3- and MYC2-dependent. Lee also reported that an mkk3 carrying an additional long C- and N-terminus, respectively. KO mutant shows insensitivity to red light and hypersensitivity Interestingly, MEKK-like kinases of subclade III do not to gibberellin (Lee, 2015). Interestingly, it has also recently been have any introns and code for kinases with rather short shown that MPK6 was able to both interact with the MYC2 tails. promoter to induce its transcription and to phosphorylate MYC2 MAP3Ks of subclade III are largely uncharacterized, with (Sethi et al., 2014). Interestingly, this module was shown to also the notable exception of MAP3K18 which has been shown negatively regulate the expression of the MYC2 transcription to be an important player of ABA signaling (Danquah factor which is a well-known actor of JA signaling. et al., 2015). This work also showed that in contrary to other MAP3Ks which are thought to be mainly regulated How to Conciliate Apparently Opposite by phosphorylation, MAP3K18 is strongly transcriptionally Data regulated in response to ABA and the consequent kinase Taking advantage of the yeast 2 hybrid interaction assay, several production triggers the phosphorylation cascade, explaining groups reported on the interactions between MKK3 and the the delayed activation kinetics of its downstream target MAPKs encoded by the Arabidopsis genome (Dóczi et al., 2007; MAPKs MPK1, 2, 7, and 14 (Boudsocq et al., 2015; Danquah Lee et al., 2008; Matsuoka et al., 2015). In these studies, MKK3 et al., 2015). Interestingly, we noticed that other members interacted with C-group MAPKs but not with MPK6 or MPK8. of subclade III are also transcriptionally regulated (Danquah The absence of an MKK3-MPK6 interaction was not due to et al., 2015). For example, MAP3K13 and MAP3K14 have technical problems as MPK6 was otherwise able to interact been shown to be induced upon nitrate feeding after a with its native MAP2Ks MKK4, and MKK5 (Lee et al., 2008). starvation period (Marchive et al., 2013). Analysis of the In protoplast activation assays, a constitutively active MKK3 Genevestigator database, which integrates many Affymetrix- was also not able to activate MPK6 or MPK8 (Danquah et al., based transcriptome experiments, confirms that MAP3K genes 2015) and no direct interaction between MKK3 and MPK6 from clade III are under transcriptional regulation by various could be shown in the studies reporting that MKK3 and MPK6 stresses (Figure 2B). This suggests that a transcriptional constitute a functional MAPK module (Takahashi et al., 2007; regulation, as shown in the case of ABA regulation of MAP3K18, Sethi et al., 2014). The only suggestion that MKK3 could activate might be a general feature of the regulation of clade III directly MPK6 came from an in vitro kinase assay in which a MAP3Ks. constitutively active MKK3 was able to trigger MPK6-dependent phosphorylation of MBP (Takahashi et al., 2007). From these results, it is tempting to hypothesize that MKK3 Toward a General Model for a Slow does not interact with MPK6 or MPK8, suggesting that the Activation of MKK3 Modules by Stresses MKK3-dependent activation of MPK6 may be indirect. The fact In yeast 2 hybrid assays, MKK3 was shown to interact that MPK1/2, which have been shown to function downstream with six of the eight MAP3Ks belonging to clade III but of MKK3 in response to ROS and ABA, are also activated by none of the MAP3Ks of clades I and II (Figure 2A) JA (Ortiz-Masia et al., 2007) would promote a model in which (Danquah, 2013; Danquah et al., 2015). Interestingly, clade- the MKK3-MPK1/2/7/14 module is necessary for the proper III MAP3Ks as well as type-C MAPKs were found in functioning of the upstream players of JA- or BL-dependent all species containing MKK3. In Arabidopsis, MPK1 and MPK6 activation. The investigation of JA-dependent MPK6 MPK2 have been shown to be activated by several stresses, activation in mutants impaired in MAPK genes of the C-clade such as wounding, ABA, JA, and H2O2.. We propose would help to resolve this issue. a general model in which clade-III MAP3Ks, MKK3,

Frontiers in Plant Science| www.frontiersin.org 5 December 2016| Volume 7| Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 6

Colcombet et al. MKK3 Modules in Plant Signalling

and C-type MAPKs define functional modules activated by many response to specific stresses will help to clarify this point and stresses, one of the main mechanisms of activation being the will be of particular interest in the context of the integration of transcriptional regulation of the upstream MAP3Ks (Figure 2C). environmental cues. This obviously does not exclude the possibility that these modules are also directly activated through phosphorylation of these MAP3Ks in response to various stresses. AUTHOR CONTRIBUTIONS

All authors listed, have made substantial, direct and intellectual CONCLUSION contribution to the work, and approved it for publication.

Recent evidence suggests that MKK3 modules integrate many signals and represent a new landscape of phosphorylation FUNDING cascades which deserve further attention as they were recently suggested to be important crop traits in various crops. In the This work has benefited from a grant (LabEx Saclay Plant future, besides a functional characterization of these modules, Sciences-SPS, reference ANR-10-LABX-0040-SPS), managed by a major challenge will be the identification of the downstream the French National Research Agency under an Investments for responses controlled by the modules. Similar to the iconic stress- the Future program (reference no. ANR-11-IDEX-0003-02). activated MAPKs which are also involved in development, we will have to clarify how MAPKs choose their proper targets when activated by different input signals. A seducing hypothesis ACKNOWLEDGMENT is that the MKK3 modules regulate a set of responses which are shared by several signals. Transcriptome experiments using The authors thank all the members of the Stress Signaling group mutants of the different MAP3Ks or the MKK3 hub kinase in (IPS2) for constructive discussions.

REFERENCES early response to nitrate in plants. Nat. Commun. 4:1713. doi: 10.1038/ncomms 2650 Boudsocq, M., Danquah, A., de Zélicourt, A., Hirt, H., and Colcombet, J. (2015). Matsuoka, D., Yasufuku, T., Furuya, T., and Nanmori, T. (2015). An abscisic Plant MAPK cascades: Just rapid signaling modules? Plant Signal. Behav. acid inducible Arabidopsis MAPKKK, MAPKKK18 regulates leaf senescence 10:e1062197. doi: 10.1080/15592324.2015.1062197 via its kinase activity. Plant Mol. Biol. 87, 565–575. doi: 10.1007/s11103-015- Colcombet, J., and Hirt, H. (2008). Arabidopsis MAPKs: a complex signalling 0295-0 network involved in multiple biological processes. Biochem. J. 413, 217–226. Mitula, F., Tajdel, M., Cie¨sla, A., Kasprowicz-Malu¨ski, A., Kulik, A., Babula- doi: 10.1042/BJ20080625 Skowronska,´ D., et al. (2015). Arabidopsis ABA-activated kinase MAPKKK18 Danquah, A. (2013). Identification and Validation of Key Factors of Stress Tolerance is regulated by protein phosphatase 2C ABI1 and the ubiquitin-proteasome in Arabidopsis thaliana. Orsay: Université de Paris-Sud. pathway. Plant Cell Physiol. 56, 2351–2367. doi: 10.1093/pcp/pcv146 Danquah, A., de Zélicourt, A., Boudsocq, M., Neubauer, J., Frei Dit Frey, N., Moore, M. S., and Blobel, G. (1994). Purification of a Ran-interacting protein that Leonhardt, N., et al. (2015). Identification and characterization of an ABA- is required for protein import into the nucleus. Proc. Natl. Acad. Sci. U.S.A. 91, activated MAP kinase cascade in Arabidopsis thaliana. Plant J. 82, 232–244. 10212–10216. doi: 10.1073/pnas.91.21.10212 doi: 10.1111/tpj.12808 Morris, E. P., and Török, K. (2001). Oligomeric structure of alpha-calmodulin- Dóczi, R., Brader, G., Pettkó-Szandtner, A., Rajh, I., Djamei, A., Pitzschke, A., dependent protein kinase II. J. Mol. Biol. 308, 1–8. doi: 10.1006/jmbi.2001. et al. (2007). The Arabidopsis mitogen-activated protein kinase kinase MKK3 4584 is upstream of group C mitogen-activated protein kinases and participates in Nakamura, S., Pourkheirandish, M., Morishige, H., Kubo, Y., Nakamura, M., pathogen signaling. Plant Cell 19, 3266–3279. doi: 10.1105/tpc.106.050039 Ichimura, K., et al. (2016). Mitogen-activated protein kinase kinase 3 regulates Fribourg, S., Braun, I. C., Izaurralde, E., and Conti, E. (2001). Structural basis seed dormancy in barley. Curr. Biol. 26, 775–781. doi: 10.1016/j.cub.2016. for the recognition of a nucleoporin FG repeat by the NTF2-like domain of 01.024 the TAP/p15 mRNA nuclear export factor. Mol. Cell 8, 645–656. doi: 10.1016/ Ortiz-Masia, D., Perez-Amador, M. A., Carbonell, J., and Marcote, M. J. (2007). S1097-2765(01)00348-3 Diverse stress signals activate the C1 subgroup MAP kinases of Arabidopsis. Ichimura, K., Shinozaki, K., Tena, G., Sheen, J., Henry, Y., Champion, A., FEBS Lett. 581, 1834–1840. doi: 10.1016/j.febslet.2007.03.075 et al. (2002). Mitogen-activated protein kinase cascades in plants: a new Rellos, P., Pike, A. C. W., Niesen, F. H., Salah, E., Lee, W. H., von Delft, F., et al. nomenclature. Trends Plant Sci. 7, 301–308. doi: 10.1016/S1360-1385(02) (2010). Structure of the CaMKII??/calmodulin complex reveals the molecular 02302-6 mechanism of CamKII kinase activation. PLoS Biol. 8:e1000426. doi: 10.1371/ Kim, S. W., Cha, S. S., Cho, H. S., Kim, J. S., Ha, N. C., Cho, M. J., et al. (1997). journal.pbio.1000426 High-resolution crystal structures of delta5-3-ketosteroid isomerase with and Sethi, V., Raghuram, B., Sinha, A. K., and Chattopadhyay, S. (2014). A mitogen- without a reaction intermediate analogue. Biochemistry 36, 14030–14036. activated protein kinase cascade module, MKK3-MPK6 and MYC2, is involved Lee, H. (2015). Mitogen-activated protein kinase kinase 3 is required for regulation in blue light-mediated seedling development in Arabidopsis. Plant Cell 26, during dark-light transition. Mol. Cells 38, 651–656. doi: 10.14348/molcells. 3343–3357. doi: 10.1105/tpc.114.128702 2015.0055 Shibata, W., Banno, H., Ito, Y., Hirano, K., Irie, K., Usami, S., et al. (1995). Lee, J. S., Huh, K. W., Bhargava, A., and Ellis, B. E. (2008). Comprehensive analysis A tobacco protein kinase, NPK2, has a domain homologous to a domain found of protein-protein interactions between Arabidopsis MAPKs and MAPK kinases in activators of mitogen-activated protein kinases (MAPKKs). MGG Mol. Gen. helps define potential MAPK signalling modules. Plant Signal. Behav. 3, Genet. 246, 401–410. doi: 10.1007/BF00290443 1037–1041. doi: 10.4161/psb.3.12.6848 Shu, K., Liu, X. D., Xie, Q., and He, Z. H. (2016). Two faces of one seed: hormonal Marchive, C., Roudier, F., Castaings, L., Bréhaut, V., Blondet, E., Colot, V., et al. regulation of dormancy and germination. Mol. Plant 9, 34–45. doi: 10.1016/j. (2013). Nuclear retention of the transcription factor NLP7 orchestrates the molp.2015.08.010

Frontiers in Plant Science| www.frontiersin.org 6 December 2016| Volume 7| Article 1941 fpls-07-01941 December 21, 2016 Time: 17:46 # 7

Colcombet et al. MKK3 Modules in Plant Signalling

Song, Y., Xiang, F., Zhang, G., Miao, Y., Miao, C., and Song, C.-P. (2016). Abscisic encodes a MAP kinase kinase. Curr. Biol. 26, 782–787. doi: 10.1016/j.cub.2016. acid as an internal integrator of multiple physiological processes modulates leaf 01.063 senescence onset in Arabidopsis thaliana. Front. Plant Sci. 7:181. doi: 10.3389/ Umezawa, T., Sugiyama, N., Takahashi, F., Anderson, J. C., Ishihama, Y., fpls.2016.00181 Peck, S. C., et al. (2013). Genetics and phosphoproteomics reveal a protein Stewart, M., Kent, H. M., and McCoy, A. J. (1998). Structural basis for molecular phosphorylation network in the abscisic acid signaling pathway in Arabidopsis recognition between nuclear transport factor 2 (NTF2) and the GDP-bound thaliana. Sci. Signal. 6:rs8. doi: 10.1126/scisignal.2003509 form of the Ras-family GTPase Ran. J. Mol. Biol 277, 635–646. doi: 10.1006/ Wang, C., Lu, W., He, X., Wang, F., Zhou, Y., Guo, X., et al. (2016). The jmbi.1997.1602 cotton mitogen-activated protein kinase kinase 3 functions in drought tolerance Stutz, F., and Izaurralde, E. (2003). The interplay of nuclear mRNP assembly, by regulating stomatal responses and root growth. Plant Cell Physiol. 57, mRNA surveillance and export. Trends Cell Biol. 13, 319–327. doi: 10.1016/ 1629–1642. doi: 10.1093/pcp/pcw090 S0962-8924(03)00106-5 Yoo, S.-D., Cho, Y.-H., Tena, G., Xiong, Y., and Sheen, J. (2008). Dual control Suarez-Rodriguez, M. C., Petersen, M., and Mundy, J. (2010). Mitogen-activated of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature 451, protein kinase signaling in plants. Annu. Rev. Plant Biol. 61, 621–649. doi: 789–795. doi: 10.1038/nature06543 10.1146/annurev-arplant-042809-112252 Zhao, C., Nie, H., Shen, Q., Zhang, S., Lukowitz, W., and Tang, D. (2014). EDR1 Sultana, A., Kallio, P., Jansson, A., Wang, J.-S., Niemi, J., Mäntsälä, P., et al. physically interacts with MKK4/MKK5 and negatively regulates a MAP kinase (2004). Structure of the polyketide cyclase SnoaL reveals a novel mechanism for cascade to modulate plant innate immunity. PLoS Genet. 10:e1004389. doi: enzymatic aldol condensation. EMBO J. 23, 1911–1921. doi: 10.1038/sj.emboj. 10.1371/journal.pgen.1004389 7600201 Takahashi, F., Mizoguchi, T., Yoshida, R., Ichimura, K., and Shinozaki, K. Conflict of Interest Statement: The authors declare that the research was (2011). Calmodulin-dependent activation of MAP kinase for ROS conducted in the absence of any commercial or financial relationships that could homeostasis in Arabidopsis. Mol. Cell 41, 649–660. doi: 10.1016/j.molcel.2011. be construed as a potential conflict of interest. 02.029 Takahashi, F., Yoshida, R., Ichimura, K., Mizoguchi, T., Seo, S., Yonezawa, M., Copyright © 2016 Colcombet, Sözen and Hirt. This is an open-access article et al. (2007). The mitogen-activated protein kinase cascade MKK3-MPK6 is an distributed under the terms of the Creative Commons Attribution License (CC BY). important part of the jasmonate signal transduction pathway in Arabidopsis. The use, distribution or reproduction in other forums is permitted, provided the Plant Cell 19, 805–818. doi: 10.1105/tpc.106.046581 original author(s) or licensor are credited and that the original publication in this Torada, A., Koike, M., Ogawa, T., Takenouchi, Y., Tadamura, K., Wu, J., journal is cited, in accordance with accepted academic practice. No use, distribution et al. (2016). A causal gene for seed dormancy on wheat chromosome 4A or reproduction is permitted which does not comply with these terms.

Frontiers in Plant Science| www.frontiersin.org 7 December 2016| Volume 7| Article 1941 RESUME EN FRANÇAIS Caractérisation d’un module MAPK impliqué dans la réponse à la blessure chez Arabidopsis thaliana

Chapitre I : Vers un modèle général d’activation de modules MKK3-dépendants

Des études ont montré que MKK3 interagit seulement avec les MAPKs du groupe C (MPK1, 2, 7 et 14). Dans le contexte d’une activation par l’ABA, les MAP3Ks 17 et 18 ont été identifiées comme agissant en amont de MKK3 et les MAPKs du groupe C. Une régulation transcriptionnelle de ces MAP3Ks a été montrée comme étant nécessaire à l’activation du module. En se basant sur ces données, nous nous sommes demandés si ce mode de régulation pourrait être généralisé à tous les modules MKK3-dépendants et avons construit un modèle qui a conduit à la publication d’une revue. Dans un premier temps nous avons réalisé une expérience de double-hybride pour tester l’interaction en levure de MKK3 avec les 20 MAP3Ks fonctionnelles chez Arabidopsis thaliana. Parmi ces MAP3Ks, MKK3 interagit seulement avec 6 des 8 MAP3Ks du sous- clade III (MAP3K15 à MAP3K20). Par la suite et afin de valider la fonctionalité d’un module contenant les MAP3Ks du sous-clade III, MKK3 et les MAPKs du groupe C, les différents partenaires du module ont été exprimés transitoirement en protoplastes. L’activité de MPK2 a été testée par kinase assay en présence des différentes MAP3Ks avec ou sans MKK3. MPK2 est activée lorsque les MAP3Ks du sous-clade III sont co-exprimées, confirmant ainsi la fonctionalité in planta d’un tel module. De plus, les données Genevestigator ont fait apparaître que les MAP3Ks du sous-clade III sont particulièrement régulées par divers stress en comparaison avec les autres MAP3Ks. En nous basant sur ces données nous avons donc construit un modèle selon lequel différentes MAP3Ks du sous-clade III sont recrutées en fonction du stress perçu et conduisent à l’activation de modules MKK3-dépendants.

Chapitre II : Identification de nouveaux modules MAPK activés par la blessure

Dans cette partie, mes résultats ont permis d’identifier un module presque complet activé par la blessure et impliquant la MAP2K MKK3. Mes essais kinase ont pu montrer que les MPK1, 2 et 7 sont activées par la blessure. Leur activation commence 30 minutes après la blessure et dure jusqu’à 2h post-stress avec un pic à 1h. Les niveaux de protéine ne sont pas affectés par la blessure. L’utilisation de mutants mkk3 a pu montrer que cette activation est dépendante de MKK3, donc que MKK3 est la MAP2K en amont des MAPKs du groupe C dans le contexte de la blessure. En revanche ces MAPKs ne sont pas activées par un simple toucher. En parallèle nous avons étudié l’activation des MAPKs 3, 4 et 6 connus pour être rapidement activées par de nombreux stress. Par western-blot en utilisant des anticorps reconnaissant spécifiquement les MAPKs phosphorylées, j’ai pu montrer que les MAPK 3 et 6 sont effectivement rapidement activées par la blessure (dès 5 minutes). En revanche leur activation est indépendante de MKK3 comme l’atteste la présence de leur activation dans le mutant mkk3. En résumé j’ai pu observer deux vagues d’activation des MAPKs. D’abord les MAPKs 3 et 6 activées dès 5 minutes après la blessure indépendamment de MKK3. Puis les MAPKs du groupe C activées bien plus tardivement et dépendamment de MKK3. Cette observation nous a conduits à émettre l’hypothèse selon laquelle la première vague d’activation influencerait la seconde. Pour tester cette idée, j’ai testé l’activation de MPK2 par la blessure chez les simples mutants mpk3 et mpk6. Les résultats obtenus sont très variables et ne nous ont par permis de tirer une conclusion définitive. Dans un second temps nous avons voulu savoir si l’activation des MAPKs du groupe C nécessite une régulation transcriptionelle. Pour tester cette idée, j’ai utilisé un inhibiteur de la traduction, le cycloheximide (CHX). Lorsque les plantes sont traitées par le CHX avant la blessure, aucune activation de MAPK du groupe C n’est observée. La production des protéines de MAPKs ou de MKK3 n’est en revanche pas affectée. Ce résultat suggère que l’activation des MAPKs du groupe C par la blessure requiert la régulation transcriptionelle d’une protéine agissant en amont de MKK3. L’effet du CHX a également été testé sur l’activation des MAPKs 3 et 6. Le CHX conduit à une activation constitutive de ces MAPKs, indépendamment de la blessure. L’étape d’après consistait à identifier les MAP3Ks en amont de MKK3 dans le contexte de blessure. Afin de savoir si, comme dans le contexte d’une activation par l’ABA, l’activation des MAPKs nécessite une régulation transcriptionelle des MAP3Ks, j’ai testé l’expression des MAP3Ks du sous-clade III en réponse à la blessure. J’ai pu quantifier cette expression par une approche de RT-qPCR. L’expression de la MAP3K14 est rapidement et fortement induite par la blessure. Plus tardivement les MAP3Ks 15, 17, 18 et 19 sont également induites mais moins fortement. En revanche pour des raisons techniques les niveaux de protéines des MAP3Ks n’ont pas pu être quantifiés. Nous avons pu étudier la localisation subcellulaire de la MAP3K18 en réponse aux deux stress en réponse auxquels elle est induite : l’ABA et la blessure. Après un traitement ABA, la MAP3K18 est exprimée dans les cellules de garde. En revanche en réponse à la blessure la MAP3K18 est exprimée dans les cellules épidermiques. Pour aller plus loin dans l’identification des MAP3Ks en amont de MKK3, j’ai testé l’activation de MPK2 dans divers mutants map3k. Etant donné que la MAP3K14 était fortement et rapidement induite par la blessure, elle est une bonne candidate pour agir en amont de MKK3 et des MAPKs du groupe C dans les points précoces de leur activation par la blessure. Etonnamment, l’activation de MPK2 par la blessure est plus forte et un peu plus précoce dans le mutant map3k14-1. Après avoir quantifié l’expression du gène MAP3K14 dans ce mutant nous avons réalisé que le mutant permet l’expression d’une version tronquée de la MAP3K14 qui est surexprimée par rapport à la version sauvage dans des plantes sauvages. Afin de savoir si une telle forme tronquée est toujours fonctionelle et peut effectivement permettre l’activation des MAPKs en aval, j’ai exprimé cette forme tronquée en protoplastes en présence de MKK3 et MPK2. MPK2 est activée même quand la forme tronquée de la MAP3K14 est co-exprimée. De plus, cette protéine tronquée est visible en western-blot contrairement à la forme sauvage. Cela suggère que la forme tronquée est plus stable que la forme sauvage, ce qui pourrait expliquer la sur-activation de MPK2 dans le mutant exprimant cette forme tronquée. Nous avons par la suite crée des mutants perte de fonction par la méthode CRISPR-Cas 9 mais les expériences ont donné des résultats très variables.

Chapitre III : Identification d’éléments de signalisation en amont de l’activation des MAPKs en réponse à la blessure

Afin d’identifier les acteurs de la signalisation agissant en amont de l’activation des MAPKs par la blessure, nous avons d’abord tester certaines molécules pour leur capacité à activer les MAPKs du groupe C lorsqu’elles sont appliquées de manière exogène. Plusieurs molécules ont été testées dont l’H2O2, l’acide jasmonique (JA), les oligogalacturonides et l’ATP. Seul le JA est capable d’activer les MAPKs du groupe C. Comme dans le cas de la blessure, cette activation est dépendante de MKK3. Les niveaux de protéines correspondantes ne sont pas affectés par le traitement. Par comparaison les MAPKs 3 et 6 ne sont pas activées par le JA alors qu’elles sont rapidement activées par la blessure. Afin de savoir si le JA a un rôle important en amont de l’activation des modules MKK3-dépendants en réponse à la blessure, j’ai utilisé divers mutants de biosynthèse et de perception du JA. Dans tous les cas, une forte diminution de l’activité de MPK2 a pu être observée, suggérant ainsi que le JA a un rôle prépondérant en amont de MKK3. J’ai également pu étudier l’expression des MAP3Ks induites par la blessure dans les mutants JA. Cette expression est diminuée de manière importante dans ces mutants en comparaison avec les plantes sauvages. Le JA est une phytohormone impliquée dans la signalisation longue distance dans le contexte de blessure ou d’attaque herbivore. Pour cette raison je me suis intéressée à l’activation de MKK3/MPK2 dans des feuilles situées à distance du site de blessure. Aucune activation de MPK2 n’a pu être observée dans ces feuilles.

Chapitre IV : Activation de modules MKK3-dépendants par des pathogènes dégradant la paroi cellulaire

La blessure est un important signal qui peut être déclenché par des facteurs abiotiques tels que la pluie ou le vent mais surtout par des agents biotiques tels que les champignons, les bactéries ou les insectes herbivores. ¨Parmi les pathogènes de plantes, le JA a été montré comme ayant un rôle important en réponse aux champignons nécrotrophes ainsi qu’aux insectes herbivores. Nous avons donc décidé d’étudier le module MKK3/MPK2 en réponse au champignon nécrotrophe Botrytis cinerea et à l’herbivore Spodoptera littoralis. MPK2 est activée 48h après une inoculation avec des spores de B. cinerea. Cette activation est dépendante de MKK3. De la même façon, MPK2 est activée 1h après une attaque par S. littoralis, dépendamment de MKK3.

Chapitre V : Etude du role de MKK3 en réponse à la blessure

Dans cette dernière partie, nous avons étudié le rôle de MKK3 et des modules MKK3- dépendants en réponse à la blessure et à des stress liés. Dans un premier temps nous avons étudié la résistance des plantes mkk3 aux deux pathogènes B. cinerea et S. littoralis précédemment montrés comme activateurs du module. Aucune différence n’a pu être observée entre les plantes sauvages et les plantes mutantes en réponse à ces pathogènes. Nous avons également effectué une étude transcriptomique comparant des plantes sauvages et mkk3-1 2h après une blessure. 5 gènes ont été identifiés comme étant différemment exprimés dans les deux fonds génétiques. Cependant aucun gène marqueur e la blessure ou du JA n’a été identifié.

Conclusion

En conclusion, mon travail de thèse a permis d’identifier un module MAPK comprenant MKK3 et les MAPKs du groupe C et activé par la blessure ainsi que par des pathogènes induisant de la blessure. Dans ce contexte, la MAP3K14 a un rôle important en amont de MKK3. La signalisation JA semble également avoir un rôle prépondérant en amont de l’activation du module. En ce qui concerne le rôle du module, aucun phénotype n’a pus être trouvé pour le moment pour le mutant mkk3-1. Un point intéressant est la présence de 2 vagues d’activation de MAPKs. Il serait intéressant d’aller plus loin dans cette direction et de tester l’activation de MAPKs du groupe C dans le double mutant mkk4 mkk5. En effet une étude récente a montré que MKK4 et MKK5 sont les deux MAPKs en amont de MPK3 et 6 en réponse à la blessure.

Caractérisation d’un module MAPK impliqué dans la réponse à la blessure chez Arabidopsis thaliana

Mots clés: Signalisation – Blessure – MAPK – JA - SA Résumé: Les plantes ne pouvant pas se déplacer activé par la blessure, impliquant la MAP2K MKK3 sont continuellement soumises à des stress et les MAPKs du groupe C MPK1-2-7-14. Le environnementaux. La blessure, souvent générée par laboratoire a montré par le passé que ce module était les herbivores, est l’un des stress les plus fréquents. sous le contrôle de la régulation transcriptionnelle Elle peut causer d’importants dégâts et faciliter des MAP3Ks du sous-clade III (MAP3K13 à 20). l’entrée de micro-organismes pathogènes dans les Certains sont induits par la blessure et parmi eux la tissus. En cas de blessure, la plante active des MAP3K14 semble avoir un rôle majeur en amont du mécanismes lui permettant de guérir les tissus module MKK3/MPK1-2-7-14. Enfin, j’ai pu montrer endommagés et de combattre les infections que l’acide jasmonique (JA), une phytohormone pathogènes. Ce stress complexe est perçu grâce à des produite en réponse à la blessure, tient un rôle récepteurs spécifiques activant des voies de important en amont du module. Ce-dernier est signalisation qui, à terme, conduisent à la mise en également activé en réponse au champignon place de réponses adaptées. Les modules MAPKs nécrotrophe B. cinerea et à l’insecte herbivore S. sont composés de 3 kinases -une MAP3K, une littoralis. Dans ce dernier contexte, MKK3 semble MAP2K et une MAPK- activées en cascades et réguler la production de deux phytohormones, le JA représentent d’importantes voies de signalisation et l’Acide Salicylique (SA). Mon travail a permis de activées par divers stress biotiques et abiotiques ainsi mieux comprendre les processus de signalisation mis qu’au cours du développement. Mon travail de thèse en place lors de la blessure chez la plante. a consisté à caractériser un module MAPK

Characterization of a MAPK module involved in response to wounding in Arabidopsis thaliana

Keywords : Stress signaling – Wounding – MAPK – JA - SA Abstract: Plants being sessile organisms, they have activated by wounding and involving the MAP2K to cope continuously with environmental stresses. MKK3 acting upstream of C-group MAPKs MPK1- Injury, one of the most frequent stress conditions 2-7-14. In the past, the laboratory has shown that that plants must face may cause harsh damages to this module is dependent on the transcriptional the plant tissues and facilitate the entry of regulation of sub-clade III MAP3Ks (MAP3K13 to pathogens. Therefore, plants have evolved 20). Some were found induced by wounding and mechanisms to respond efficiently to wounding by among them MAP3K14 seems to have an important healing damaged tissues and preventing further role upstream MKK3/C-group MAPKs. Finally I pathogen infection. This complex stress is perceived was able to show that Jasmonic Acid (JA), a major by specific receptors which activate signaling phytohormone produced upon wounding, has an pathways leading to adapted responses. MAPK important role upstream the MKK3/C-group modules are composed of 3 kinases (MAP3K, MAPKs module. The module is also activated by MAP2K and MAPK) activated in cascade and the herbivore S. littoralis and the necrotrophic represent important signaling pathways involved in fungus B. cinerea. Upon insect feeding, MKK3 response to various biotic and abiotic stresses as negatively regulates JA and SA levels. My work well as in developmental processes. During my helped to better understand stress signaling events Ph.D, I identified a MAPK module occurring upon wounding.

Université Paris-Saclay Espace Technologique / Immeuble Discovery Route de l’Orme aux Merisiers RD 128 / 91190 Saint-Aubin, France