Erbb2 Requires Integrin 5 for Anoikis Resistance Via Src Regulation Of

Research Article 1373

ErbB2 requires integrin 5 for anoikis resistance via Src regulation of receptor activity in human mammary epithelial cells

Keneshia K. Haenssen1, Sarah A. Caldwell1, Kristina S. Shahriari1, S. RaElle Jackson1, Kelly A. Whelan1, Andres J. Klein-Szanto2 and Mauricio J. Reginato1,* 1Department of Biochemistry and Molecular Biology, 245 N. 15th Street, Drexel University College of Medicine, Philadelphia, PA 19102, USA 2Department of Pathology, Fox Chase Cancer Center, Philadelphia, PA 19111, USA *Author for correspondence ([email protected])

Summary ErbB2, a receptor tyrosine kinase highly expressed in many tumors, is known to inhibit apoptotic signals. Overexpression of ErbB2 causes anoikis resistance that contributes to luminal filling in three-dimensional mammary epithelial acinar structures in vitro. Given that integrins and growth factor receptors are highly interdependent for function, we examined the role of integrin subunits in ErbB2- mediated survival signaling. Here, we show that MCF-10A cells overexpressing ErbB2 upregulate integrin 5 via the MAP-kinase pathway in three-dimensional acini and found elevated integrin 5 levels associated with ErbB2 status in human breast cancer. Integrin 5 is required for ErbB2-mediated anoikis resistance and for optimal ErbB2 signaling to the Mek-Erk-Bim axis as depletion of integrin 5 reverses anoikis resistance and Bim inhibition. Integrin 5 is required for full activation of ErbB2 tyrosine phosphorylation on Y877 and ErbB2 phosphorylation is associated with increased activity of Src in the absence of adhesion. Indeed, we show that blocking elevated Src activity during cell detachment reverses ErbB2-mediated survival and Bim repression. Thus, integrin 5 serves as a key mediator of Src and ErbB2-survival signaling in low adhesion states, which are necessary to block the pro-anoikis mediator Bim, and we suggest that this pathway represents a potential novel therapeutic target in ErbB2-positive tumors.

Key words: Integrin 5, ErbB2, Her2, Src, Bim, Anoikis, 3D culture, Epithelial, Cancer

Introduction anoikis is involved (Debnath et al., 2002). Indeed, we have shown

Journal of Cell Science Cell to extracellular matrix (ECM) adhesion has a central role for that cell detachment at the single-cell level and apoptosis during the structural organization of tissues of multicellular organisms. lumen formation in 3D morphogenesis both require induction of Adhesion-mediated regulation of cell survival contributes to the Bcl-2-family proapoptotic BH3-only protein Bim; and maintenance of tissue homeostasis by allowing cells to remain in oncogenes that induce anoikis resistance and are capable of blocking their correct tissue environment. Absence of survival signals from or delaying lumen formation in 3D culture block Bim induction ECM can trigger apoptosis in a process referred to as anoikis (Frisch (Reginato et al., 2003; Reginato et al., 2005; Reginato and and Screaton, 2001). Tumor cells become anchorage-independent Muthuswamy, 2006). Recent studies have found that Bim is also for growth and survival and most epithelial-derived cancer cells required in the mouse mammary gland for apoptosis during lumen display substantial resistance to anoikis (Schwartz, 1997). This formation (Mailleux et al., 2007), which correlates with the in vitro characteristic has important implications for metastasis because cells 3D acinar morphogenesis culture system. that survive after detachment from their primary site can travel Inhibition of Bim expression in MCF-10A cells is coordinated by through circulatory systems to secondary sites (Simpson et al., both integrin and EGF receptor (EGFR) regulation of Erk signaling, 2008). Studies using three-dimensional (3D) organotypic culture the latter of which depends on cell adhesion. Loss of integrin-receptor systems, which have been increasingly used to understand pathways adhesion leads to downregulation of EGFR expression and signaling regulating glandular morphogenesis and epithelial cancer to the Mek-Erk pathway, which in turn leads to the induction of Bim development (Debnath and Brugge, 2005), have implicated anoikis (Reginato et al., 2003). Cells that overexpress EGFR are able to resistance as an early event in cancer progression. Many early breast escape regulation from loss of integrin engagement. Additionally, cancer lesions, such as ductal carcinoma in situ, are characterized EGFR overexpression allows cell survival from anoikis and inhibit by filling of the luminal space (Harris, 2004). Mechanisms that Bim expression, suggesting that elevated levels of growth factor underly lumen formation have been examined by using MCF-10A receptor can uncouple from integrin regulation. However, recent cells, an immortalized human mammary epithelial cell line. These evidence suggests that integrin receptors are required for oncogenic cells, when cultured on reconstituted basement membrane, undergo phenotypes in vivo (Guo et al., 2006; White et al., 2004). Thus, it a series of morphogenic changes resulting in the formation of acinus- is not clear whether growth factor receptors expressed at high levels like structures that contain a single layer of polarized cells still require integrins in the absence of adhesion for correct survival surrounding a hollow lumen (Muthuswamy et al., 2001). Clearance signaling and anoikis resistance. of centrally located cells in this model involves apoptosis, because ErbB2 (also known as HER2, Neu) is a receptor tyrosine kinase these cells are not in direct contact with matrix, which suggests that (RTK) that is overexpressed in 20% to 30% of invasive breast 1374 Journal of Cell Science 123 (8)

tumors and up to 85% of comedo-type ductal carcinoma in situ (DCIS), a premalignant stage of breast cancer (Hynes and Stern, 1994; Lohrisch and Piccart, 2001). A number of ErbB2 inhibitors, although initially effective in breast cancer patients, lose activity during prolonged treatment (Nahta et al., 2006) indicating the need for identification of additional therapeutic targets. We have previously shown that cells overexpressing ErbB2 can induce anoikis resistance in mammary epithelial cells (Reginato et al., 2003). In addition, activation of ErbB2 in 3D acini leads to an increase in proliferation and luminal filling (Muthuswamy et al., 2001). ErbB2 inhibition of luminal apoptosis during morphogenesis is associated with increased Erk activation and decreased Bim expression (Reginato et al., 2005). It remains unclear whether epithelial cells that overexpress ErbB2 still require integrins for anoikis resistance. Recently, it was shown that mice that express a dominant-negative form of integrin 4 can inhibit ErbB2-mediated mammary oncogenesis, suggesting that cancer cells that overexpress RTKs are dependent on integrin- subunits for their growth and survival (Guo et al., 2006). However, the requirement of specific integrin subunits for ErbB2-mediated anoikis resistance has not yet been addressed. Here, we show that ErbB2-expressing breast cancers positively correlate with increased levels of integrin 5 and that ErbB2 requires integrin 5 for anoikis resistance. Integrin 5 is highly upregulated in ErbB2-overexpressing cells via the regulation of the Mek-Erk kinase pathway. Additionally, integrin 5 is required for ErbB2- mediated anoikis resistance both in 3D acini and in the soft-agar assay for colony formation. Reducing expression of integrin 5 in ErbB2-overexpressing cells leads to loss of Src hyperactivity in the absence of adhesion, decreased ErbB2 tyrosine phosphorylation on Y877 and decreased signaling to the Mek-Erk pathway allowing reversal of Bim inhibition. Elevation of integrin 5 in epithelial Fig. 1. Integrin 5 expression is upregulated in ErbB2-overexpressing cells with low adhesion helps to activate and couple Src activity to cells. (A)RNA was prepared from attached MCF-10A cells infected with RTKs, such as ErbB2, and allows survival from anoikis. Thus, our retrovirus of empty vector (pBabe), wild-type ErbB2 (NeuN) or constitutively

Journal of Cell Science data indicate that tyrosine kinase receptors still require integrins for active ErbB2 (NeuT). qRT-PCR was used to compare mRNA levels for correct survival signaling under conditions of suboptimal matrix integrins 2, 5 and 6. Values were normalized to cyclophilin expression interaction. and represented as mean ± s.e.m of fold change for at least three individual experiments (**P<0.05, ***P<0.01 by Students t-test). (B)Lysates from Results MCF-10A cells expressing pBabe empty vector, NeuN or NeuT were analyzed by immunoblotting with indicated antibodies. pBabe or NeuN cells were Integrin 5 expression is upregulated by ErbB2- placed in morphogenesis assays and (C) cell lysates collected at indicated expressing cells and is elevated in ErbB2-positive breast times and protein analyzed by immunoblotting or (D) cells were fixed and cancers immunostained at day 8 with antibodies for anti-integrin 5 (green) and To determine whether ErbB2 regulates specific integrin subunits in integrin 6 (red), and nuclei counterstained with DAPI (blue). human mammary epithelial cells we examined the RNA expression of a number of integrin subunits in MCF-10A cells that stably overexpress wild-type ErbB2 (pBabe-NeuN) compared with vector alone (pBabe). By using an RNase protection assay (RPA) integrin- eightfold elevation of integrin-5 mRNA but no change in the levels probe set, we found a number of integrin subunits that are of integrins 2 or 6 when compared with control MCF-10A cells. constitutively expressed in normal MCF-10A cells and in cells Consistent with RNA expression, integrin 5 protein levels were overexpressing ErbB2. MCF-10A cells that overexpress ErbB2 did increased twofold in ErbB2 (NeuN or NeuT) overexpressing cells not significantly alter RNA expression of most integrin subunits compared with control cells (Fig. 1B) and analysis by flow compared with control MCF-10A cells. By contrast, we found a cytometry showed a two- to threefold increased membrane substantial and specific upregulation of the integrin-5 subunit in localization of integrin 5 in ErbB2-overexpressing cells cells that overexpress ErbB2 (data not shown). We validated RPA (supplementary material Fig. S1). We found no increase in protein results by using quantitative real-time (QRT) PCR and found that expression of integrin 3, integrin 4 or integrin 1 in ErbB2- integrin-5 mRNA was elevated threefold in ErbB2-overexpressing overexpressing cells compared with control cells (Fig. 1B) and also cells compared with parental MCF-10A cells (Fig. 1A). We did not no change in surface expression of integrin 6 or integrin 1 (data detect changes in other integrin--subunit mRNA expression not shown). including integrins 2 and 6 by QRT-PCR. In addition, we also To determine whether ErbB2 overexpression in MCF-10A cells examined expression of these integrin subunits in MCF-10A cells that undergo 3D morphogenesis also increased the expression of that overexpress constitutively active ErbB2 (NeuT) and found an integrin 5, we analyzed levels of several integrin subunits during ErbB2 requires integrin 5 for survival 1375

morphogenesis. Cells stably overexpressing wild-type ErbB2 (NeuN) had levels three- to fourfold higher of integrin 5 at day 6 and day 8 when compared with control cells (Fig. 1C). Expression of other integrin subunits was not increased – including integrin 3 or integrin 1 – during morphogenesis. We have previously shown that normal cells that undergo morphogenesis in 3D culture induce expression of Bim at about day 8, and that Bim is required for clearing of the central lumen (Reginato et al., 2005). Bim inhibition is associated with luminal filling and decreased apoptosis in cells that overexpress oncogenes, including ErbB2, during morphogenesis (Reginato et al., 2005) (Fig. 1C). We also examined the localization of integrin 5 in normal and ErbB2-expressing acini structures by immunostaining. As previously shown (Muthuswamy et al., 2001), integrin 6 is localized primarily at the basal surface, with weak staining at the lateral surface of normal MCF-10A acini (Fig. 1D). However, unlike integrin 6, integrin 5 is localized predominantly on the lateral surface of normal acini (Fig. 1D, arrowed). In ErbB2-expressing acini, organization and polarity of acini structures are disrupted (see Muthuswamy et al., 2001; Aranda et al., 2006) and localization of integrin 5 is no longer predominantly at the lateral surface. To determine whether expression of integrin 5 correlates with ErbB2-positive breast-cancer tissue, we performed immunohistochemical staining on ErbB2-positive breast-cancer tissue by using breast-cancer-tissue arrays. We found very little staining of integrin 5 in normal breast epithelial cells, benign breast tissue as well as ErbB2-negative malignant tissue (Fig. 2A). However, we found 68% of ErbB2 positive cancer contained Fig. 2. Integrin 5 is elevated in ErbB2 positive breast cancers. (A)Normal elevated integrin 5 staining (Fig. 2A, supplementary material Table and tumor tissue from human breast tissue microarrays were S1). Statistical analysis showed that there is a significant and positive immunohistochemically stained with an anti-integrin 5 antibody (brown) and association between expression of integrin 5 and that of ErbB2 counterstained with hematoxylin (blue) and the expression of integrin 5 was (Pearson’s correlation  0.219, two-tailed, P<0.05) (Fig. 2B). analyzed. Representative images from six tissue sections are shown These results indicate that ErbB2 upregulates RNA and protein (magnification 20ϫ). (B)Immunohistochemistry was used to determine levels of integrin 5 in vitro and that increased expression of integrin integrin 5 expression, which was classified as described in the Materials and Methods section. From 94 cases, 64 out of 70 ErbB2-positive cases were also Journal of Cell Science 5 is associated with ErbB2-positive breast cancers. found to stain positive for integrin 5. A two-tailed Pearson’s correlation test Integrin 5 is required for ErbB2-mediated inhibition of was used to analyze the relationship between integrin 5 expression and ErbB2 status. Results were considered to be significant at P<0.05. luminal apoptosis and anoikis resistance Upregulation of integrin 5 by ErbB2 suggests that integrin 5 contributes to ErbB2-oncogenic phenotypes including anchorage- independence. We have previously shown a crucial interdependence integrin 5 siRNA contained two- or threefold higher centrally between integrins and RTKs in the regulation of normal epithelial localized, activated caspase-3-positive staining than those cell survival during detachment from matrix signals (Reginato et transfected with control siRNA (Fig. 3C). In addition to control al., 2003). Thus, we hypothesized that oncogenes, such as ErbB2, siRNA, we also found no effect of reducing expression of integrin that inhibit anoikis may co-opt specific ECM-related molecules that 3 on luminal apoptosis (data not shown). Thus, integrin 5 contribute to survival in absence of adhesion. To determine whether expression is specifically required for ErbB2-mediated inhibition integrin 5 is required for ErbB2-anoikis resistance, we used RNA of luminal apoptosis. interference (RNAi) to reduce the expression of integrin 5. ErbB2 Since luminal apoptosis during morphogenesis is associated with cells transfected with two separate small interfering (si) RNA anoikis, we sought to determine the role of integrin 5 in ErbB2- oligonucleotides that are homologous to the nucleotide sequence mediated anoikis resistance. Following 48 hours of cell detachment, of integrin 5, but not to control siRNA, showed substantially anoikis sensitivity was increased twofold in ErbB2-overexpressing reduced expression of integrin 5 at day 0 in morphogenesis assay cells that had been transfected with integrin 5 siRNA compared (Fig. 3A). Expression of other integrin subunits, such as integrin with cells transfected with control siRNA (Fig. 4A). Consistent with 3 or integrin 1, was not affected by the transfection of integrin these data, increased apoptosis in ErbB2 cells targeted with integrin 5 siRNA (data not shown). Luminal apoptosis was measured by 5 RNAi was associated with increased levels of cleaved caspase- determining the percent of acini with centrally localized cleaved 3 (Fig. 4B). We have previously shown that ErbB2 partly blocks caspase-3 staining. Reducing integrin 5 expression significantly anoikis by inhibiting expression of the proapoptotic protein Bim (P<0.05) increased luminal apoptosis in ErbB2-expressing acini as during cell detachment (Reginato et al., 2003). Accordingly, we measured by percentage of caspase-3 positive acini (Fig. 3B) examined Bim expression in cells targeted with integrin 5 siRNA. compared with cells transfected with control siRNA. At days 10 ErbB2-overexpressing cells transfected with integrin 5 siRNA and 12 of morphogenesis, acini derived from cells transfected with showed a substantial increase of Bim expression in cells in 1376 Journal of Cell Science 123 (8)

Fig. 4. Integrin 5 is required for ErbB2-mediated anoikis resistance, Bim inhibition and anchorage independence. (A)At 48 hours after initial transfection with siRNA oligonucleotides against integrin 5 or luciferase

Journal of Cell Science Fig. 3. Integrin 5 expression is required for ErbB2-mediated inhibition control, MCF-10A-NeuN were harvested as attached cells, or placed in of luminal apoptosis during morphogenesis. (A)At 48 hours after initial suspension for 48 hours and then analyzed for apoptosis using DNA- transfection with siRNA oligonucleotides against integrin 5 or luciferase fragmentation ELISA. Values represent the mean ± s.e.m. of the fold change of control, MCF-10A-NeuN cells were placed in 3D morphogenesis assay for the A405 for at least three independent experiments (**P<0.05 by Students t-test indicated times followed by cell lysis and immunoblotting using indicated when comparing results for the 48-hour suspension cells). (B)In parallel antibodies. (B)Transfected NeuN cells were cultured in 3D morphogenesis experiments, transfected cells were lysed from monolayer culture or from 448- assay for 10 or 12 days, and then fixed and stained with the activated (cleaved) hour suspension culture and proteins analyzed by immunoblotting. (C)MCF- caspase-3 antibody (red, apoptosis marker). Nuclei were counterstained with 10A cells stably overexpressing activated ErbB2 (NeuT) were transfected with DAPI (blue). (C)Acini positive for activated (cleaved) caspase-3 were counted luciferase control or integrin 5 siRNA oligonucleotides. At 48 hours after and the fold change in caspase-3 positivity per experiment was plotted. Acini initial transfection cells were placed in soft agar plates for 21 days and then containing two or more activated caspase-3 cells were scored as positive (n3, stained with INT Violet. Colony numbers were determined and the percentages >100 acini/experiment; mean ± s.e.m. of the fold change. **P<0.05, normalized to that of control siRNA. The values shown represent averages of ***P<0.01 by Students t-test). normalized values (n3, mean ± s.e.m.; **P<0.001, ***P<0.05 by Students t test).

suspension, whereas transfection with control siRNA (Fig. 4B) or not alter overall cell growth at 3D conditions (supplementary integrin 3 siRNA did not (data not shown). Although RNAi of material Fig. S2A) or in 2D attached cells (supplementary material integrin 5 led to significant increase in luminal apoptosis in 3D Fig. S2B). Although the reduction of integrin 5 levels increased culture and increased anoikis sensitivity in suspended cells, we did luminal apoptosis in ErbB2-overexpressing acini, we found that it not detect any evidence of apoptosis in attached ErbB2 cells in 2D only led to a partial hollowing of the lumen of these acini (data not culture (Fig. 4A) or in outer cells in direct contact with ECM in shown). Since RNAi of integrin 5 had minimal effects on the 3D culture (Fig. 3B). Decreasing integrin 5 levels did not alter growth of ErbB2 cells in 3D culture it is possible that these acini sensitivity of ErbB2-overexpressing cells to other apoptotic stimuli remain – despite increasing apoptosis – partially filled since they including UV or hydrogen peroxide treatment (data not shown) in remain highly proliferative. 2D cell culture, which suggests that the relationship between ErbB2, We also examined the role of integrin 5 in parental MCF-10A integrin 5 and apoptosis is specific to cells at low adhesion. cells. We found that cell detachment of MCF-10A cells also Moreover, reducing integrin 5 in ErbB2-overexpressing cells did resulted in the elevation of integrin 5 protein levels and that ErbB2 requires integrin 5 for survival 1377

reduction of integrin 5 levels by using RNAi in suspension led to increased levels of Bim, cleaved caspase-3 (supplementary material Fig. S3A) and sensitized cells to anoikis, when compared with cells treated with control RNAi (supplementary material Fig. S3B). These findings suggest that integrin 5 has a general role in epithelial anoikis sensitivity. Reducing integrin 5 levels in parental MCF- 10A cells did not alter cell growth or cell organization in 3D culture (supplementary material Fig. S3C). Thus, integrin 5 is crucial for anoikis sensitivity of both normal MCF-10A cells and those that overexpress ErbB2, and is required for ErbB2-mediated inhibition of the proapoptotic protein Bim in the absence of matrix attachment; however, it does not appear to affect cell growth. We also examined the effect of reduced integrin 5 expression on ErbB2-mediated anchorage-independent colony formation. For these experiments we used cells that overexpress the active form of ErbB2 (NeuT) because they form robust colonies in soft agar. We found that NeuT-overexpressing cells when transfected with integrin 5 siRNA formed less than half as many colonies in soft agar compared with cells transfected with control siRNA (Fig. 4C). RNAi of integrin 3 had no effect on colony formation of NeuT cells in soft agar (data not shown). Thus, integrin 5 is specifically required for ErbB2-mediated anchorage independence. To verify specificity of siRNA oligonucleotides, ErbB2-overexpressing cells were infected with short hairpin RNA (shRNA) against integrin 5, which – when compared with scrambled shRNA – was also able to reverse anoikis resistance, Bim inhibition and colony formation in soft agar (supplementary material Fig. S4). This effect of integrin 5 on ErbB2 oncogenesis seems to be specific, as reducing integrin 5 levels in MCF-10A cells that overexpress H-RasG12V, a Fig. 5. Integrin 5 is required for ErbB2-mediated signaling. (A-B)At 48 hours after initial transfection with luciferase control or integrin 5 siRNA constitutively active form of the oncogene H-Ras, had little effect  oligos, MCF-10A-NeuN cells were placed in suspension for indicated times on caspase-3 cleavage or Bim levels in cells in suspension before lysis. Proteins were analyzed by immunoblotting with indicated (supplementary material Fig. S7A) and had no effect on anchorage- antibodies. independent cell growth (supplementary material Fig. S7B). Thus, integrin 5 is required for ErbB2-mediated anoikis resistance in

Journal of Cell Science 3D acini, during anchorage independence and inhibition of Bim expression. a key regulator of ErbB2 tyrosine phosphorylation (Ishizawar et al., 2007) specifically at Y877 (Xu et al., 2007) and that Src activity Role of integrin 5 in ErbB2-mediated signaling is required for ErbB2-mediated soft-agar colony formation. We, Oncogenes, such as ErbB2, maintain active signaling pathways in therefore, sought to examine changes in Src activity in cells the absence of matrix attachment that can regulate cell survival depleted of integrin 5. Cells transfected with control siRNA had pathways. Indeed, we have shown that oncogene overexpression low level of Src activity in attached cells. However, in cells placed can maintain the Erk pathway active during cell detachment, in suspension, Src activity increased dramatically. By contrast, cells allowing inhibition of both Bim expression and anoikis (Reginato transfected with two different siRNAs targeting integrin 5 had et al., 2003) when compared with parental MCF-10A cells slightly reduced levels of Src activity in attached cells and blocked (supplementary material Fig. S3A). Thus, we examined the role of induction of Src activity in cells placed in suspension (Fig. 5A). integrin 5 in the regulation of ErbB2-mediated signaling pathways. We did not detect changes in other integrin-mediated pathways, such Decreased expression of integrin 5 had minor effects on signaling as FAK (data not shown) or Akt, in suspended ErbB2- in attached ErbB2 cells (Fig. 5A). However, decreased integrin 5 overexpressing cells. ErbB2-overexpressing cells that were infected expression in ErbB2-expressing cells decreased Mek and Erk with shRNA targeting integrin 5 also caused inhibition of total activity when cells were placed in suspension (Fig. 5A) in a manner ErbB2 tyrosine activity and reduced Src phosphorylation when consistent with loss of Bim suppression (Fig. 4B, supplementary compared with cells infected with control shRNA (supplementary material Fig. S3A). To determine the source of altered signaling material Fig. S4A). In addition, we detected a similar signaling we examined whether integrin 5 regulated the activation of ErbB2 profile in cells overexpressing the active form of ErbB2 phosphorylation. Decreasing integrin 5 levels had little effect on (supplementary material Fig. S5) and in the ErbB2-expressing breast ErbB2 phosphorylation in attached cells (Fig. 5B). Remarkably, in cancer cell line SKBR3 following cell detachment and knockdown suspended cells we find total phosphotyrosine levels of ErbB2 of integrin 5 (supplementary material Fig. S6A) and inhibited highly elevated, as well a phosphorylation of Y877 and Y1248, anchorage independence (supplementary material Fig. S6B,C). which is in contrast to attached cells. Decreased integrin 5 levels Therefore, we conclude that integrin 5 expression is required for reduced total phosphotyrosine levels of ErbB2 as well as maintaining full ErbB2-tyrosine phosphorylation and ErbB2- phosphorylation of Y877 and Y1248 without altering the total levels mediated Mek-Erk activity during cell detachment, and is associated of ErbB2 protein (Fig. 5B). Recent studies have shown that Src is with elevated Src activity in suspension. 1378 Journal of Cell Science 123 (8)

As in ErbB2-overexpressing cells, normal MCF-10A cells also elevate Src activity when placed in suspension (supplementary material Fig. S3A), and reducing integrin 5 levels blocked activation of Src in the absence of adhesion, reduced Erk activity and increased Bim levels (supplementary material Fig. S3A). Since Src can also phosphorylate EGFR (Giannoni et al., 2008), and EGFR is an important regulator of Bim and anoikis of normal MCF-10A cells (Reginato et al., 2003), we examined levels of total and phosphorylated EGFR in parental MCF-10A cells that expressed reduced amounts of integrin 5. As previously reported, we noticed a rapid loss of total EGFR levels in MCF-10A cells placed in suspension and were unable to detect a difference between control RNAi and integrin 5 RNAi. However, we examined EGFR phosphorylation in ErbB2-overexpressing cells and found that RNAi of integrin 5 was able to reduce phosphorylation of EGFR in MCF- 10A cells in suspension. This suggests that a decrease in integrin 5 levels can decrease the phosphorylation of EGFR in parental cells and may help explain increased anoikis sensitivity in MCF- 10A cells with reduced levels of integrin 5.

Role of Src in ErbB2-mediated anoikis resistance We hypothesized that expression of integrin 5 contributes to activation and/or maintenance of active Src during cell detachment, which could be required for optimal ErbB2 phosphorylation, leading to downstream signaling that allows anoikis resistance through inhibition of Bim. To test this, we examined the role of Src in ErbB2-mediated anoikis resistance. Treatment of ErbB2 cells in suspension with the Src-family-kinase inhibitors PP1 or PP2 reversed anoikis resistance by ErbB2 (supplementary material Fig. S8A). Moreover, treatment of ErbB2 cells during anoikis with PP1 or PP2 showed a decrease of ErbB2 Y877 phosphorylation, an increase of Bim expression and elevated levels of cleaved caspase-3 (supplementary material Fig. S8B). Treatment of attached ErbB2- Fig. 6. Integrin regulation of ErbB2-mediated survival is associated with Src activation in suspension and morphogenesis. (A-C)NeuN-expressing overexpressing cells with PP1 or PP2 had no effect on apoptosis cells were cultured in 3D morphogenesis assay and treated on day 8 with Journal of Cell Science or Bim expression (data not shown). We also tested the effect of DMSO vehicle control or PP2 (10mM). (A)At days 10 and 12, acini were Src inhibitors on ErbB2-overexpressing 3D acini. Starting at day fixed and stained with antibody against activated caspase-3 (red). Nuclei were 8, acini were treated for 48 hours with PP2, and analyzed for cleaved counterstained with DAPI (blue). Representative confocal images for day 12 caspase-3 at days 10 and 12. We observed a twofold increase in are shown, and (B) acini positive for activated caspase-3 were counted at days cleaved caspase-3 staining within the centers of acini treated with 10 and 12 following treatment and the percent of total acini are plotted (n3, PP2 (Fig. 6A,B). As was the case in cells transfected with integrin mean ± s.d., >100 acini/experiment; **P<0.001, ***P<0.0001 by Students t- 5 siRNA, cells that underwent apoptosis due to treatment with test). (C)Cell lysates were prepared on day 12 and proteins analyzed by Src inhibitor were predominantly in the center of each acini (Fig. immunoblotting. (D,E)MCF-10A-NeuN cells were infected with lentivirus 6A). We also sought to determine whether reversal of ErbB2- carrying shRNA constructs against Src or scrambled sequence control. (D)Cells were lysed after 48-hour suspension culture, and proteins analyzed mediated protection from luminal apoptosis in 3D acini following by immunoblotting or (E) were stained with annexin V and propidium iodide, application of PP2 correlated with Src activity, Y877 followed by FACS analysis (n3). Black bars represent annexin V stain (early phosphorylation of ErbB2 and Bim expression. Indeed, 3D acini apoptosis), gray bars represent propidium iodide stain (late apoptosis). treated with PP2 were associated with decreased phosphorylation Histograms are plotted as mean ± s.e.m, *P<0.05 by Students t-test. of Src on Y416, ErbB2 on Y877 and increased levels of Bim expression (Fig. 6C). Src inhibition under these conditions had neither an effect on 3D acini organization of parental MCF-10A mediated survival signaling in a manner similar to a reduction in cell, as indicated by the localization of integrins 6 and 5, nor on the expression of integrin 5. apoptosis of outer cells that were in direct contact with the ECM (supplementary material Fig. S9). To ensure specificity of the Src ErbB2 regulation of integrin 5 via the Mek-Erk pathway inhibitors, we used RNAi to target Src and found that reducing the To characterize ErbB2-mediated regulation of integrin 5 expression of Src also blocked activation of ErbB2, reversed expression, we examined the effect that inhibiting several kinases inhibition of Bim in suspended cells (Fig. 6D) and increased downstream of ErbB2 would have on the expression of integrin 5 sensitivity to anoikis (Fig. 6E) – similar to the effects of Src in MCF-10A cells in 3D culture. Incubation of ErbB2-expressing inhibitors. Thus, a decrease in Src activity in ErbB2-overexpressing acini with a MEK inhibitor (UO126) for 48 hours blocked cells displaying reduced ECM adhesions leads to a decrease in expression of integrin 5 (Fig. 7A), which suggests that signaling ErbB2 activation and the reversal of anoikis resistance through the downstream of Mek regulates expression of integrin 5. Treatment upregulation of Bim expression, and negatively affects ErbB2- of acini with the PI3K inhibitor (LY294002) had no effect on integrin ErbB2 requires integrin 5 for survival 1379

Discussion Our findings show that overexpressed RTKs require specific integrin subunits for anoikis resistance at single-cell level, but also in the more tissue-relevant context of 3D culture. Previous work, using normal epithelial cells, has shown that integrin-mediated adhesion is required for correct growth-factor survival signaling (Reginato et al., 2003). Overexpression of RTKs, as found in many epithelial carcinomas, is thought to uncouple and bypass the requirement for integrin signaling in the absence of adhesion. Our results here reveal that RTKs can regulate specific integrin subunits to maintain their own activation and, thus, remain highly dependent on integrin function under conditions of no or reduced matrix adhesion. We show that epithelial cells that overexpress ErbB2 upregulate integrin 5 RNA and protein, and that integrin 5 is required for ErbB2-mediated anoikis resistance, which is associated with luminal filling during morphogenesis of spheroid epithelial structures in vitro. Moreover, integrin 5 is required in maintaining elevated Src activity, which contributes to ErbB2 phosphorylation and downstream Mek-Erk-mediated inhibition of Bim during loss of adhesion. Activation of Src by cells in suspension is required for ErbB2 phosphorylation, and ErbB2-mediated Bim inhibition and anoikis resistance. In addition, we show that normal epithelial cells also elevate expression of integrin 5 when detached from matrix, thereby allowing activation of Src in suspension to delay anoikis – possibly by maintaining RTK signaling, such as EGF receptor signaling. However, EGFR expression is not maintained in normal cells without adhesion (Reginato et al., 2003). Under conditions when RTKs, such as ErbB2, are overexpressed, our data suggest that Src activation during matrix deprivation functions to maintain Fig. 7. ErbB2 regulates integrin 5 expression via the Mek-Erk pathway RTKs active and protect cells from anoikis. Indeed, recent data in during morphogenesis. (A)MCF-10A-NeuN cells were cultured in 3D prostate cancer cells have shown that Src activation during cell morphogenesis assay and treated on day 4 with DMSO vehicle control, U0126 detachment phosphorylates EGFR on Y845 (a site homologue to (10mM) or LY294002 (50mM). At day 6, acini were lysed and proteins Y877 in ErbB2 ) during cell detachment and blocks anoikis through analyzed by immunoblotting with indicated antibodies. (B)MCF-10A cells the Erk-Bim axis (Giannoni et al., 2009). The integrin-5–Src stably overexpressing Mek2-DD, Myr-Akt or pBabe control vector were Journal of Cell Science survival pathway may be specific for RTKs because a reduction in cultured in 3D morphogenesis assays and lysed at day 4, day 6 or day 8. integrin 5 had no effect on anchorage-independent growth of Ras- Proteins were analyzed by immunoblotting. overexpressing cells. Thus, elevating integrin 5 under low adhesion might be a general mechanism of survival from anoikis that is co- opted by RTKs in cancer cells to maintain their own activity, 5 levels (Fig. 7A). To determine whether activation of the Erk promote cell survival and block luminal clearing in cases where pathway is sufficient to upregulate integrin 5 in 3D acini, stable tissue architecture and cell-matrix interactions are compromised – pools of MCF-10A cells expressing a constitutively active variant possibly in early stages of cancer. of Mek (MEK2-DD) were generated and cultured in 3D. MCF10- Anoikis also serves as a barrier to metastasis (Reddig and Juliano, A cells expressing MEK2-DD contained high levels of activated 2005) and, since integrin 5 is known to support epithelial migration Erk compared with control acini and expression of integrin 5 and metastasis (Imanishi et al., 2007; Jia et al., 2004; Murthy et al., during 3D morphogenesis was substantially upregulated (Fig. 7B). 1996), our results suggest that integrin 5 also contributes to survival Overexpression of an active form of Akt (myristoylated Akt1) had during metastatic dissemination in the absence of matrix adhesion. no effect on the expression of integrin 5 (Fig. 7B). As previously Our data show that expression of integrin 5 positively correlates shown, activation of the Mek-Erk pathway, but not the Akt pathway, with breast cancers in which ErbB2 is overexpressed. While this blocks Bim expression in 3D acini (Fig. 7B) (Reginato et al., 2005). manuscript was under review, an article by Valastyan et al. showed These results reveal that the Mek-Erk pathway in ErbB2-expressing that levels of integrin 5 are also elevated in metastatic breast 3D structures regulates expression of integrin 5. cancers as compared with primary tumors, and that expression of Taken together, these results indicate that increased levels of integrin 5 is associated with a cohort of genes that is associated integrin 5 and increased Src activity in detached mammary with poor clinical outcome of breast cancer (Valastyan et al., 2009). epithelial cells functions as a survival mechanism to transiently Indeed, consistent with our results, Valastyan et al. also showed protect cells against anokis. However, in cells that overexpress that integrin 5 has a crucial role in anoikis resistance of breast RTKs, such as ErbB2, elevation of integrin 5 and Src activity can cancer cells in vitro. Thus, integrin 5 might serve as a key player maintain RTK activity, and allow Erk activation, inhibition of Bim in breast cancer progression including metastasis. expression and chronically block anoikis. Additionally, these data Integrins and RTKs are well know to collaborate and regulate a suggest that RTKs, such as ErbB2, are dependent on specific integrin number of physiological processes including pathways that control subunits for anoikis resistance. cell growth, cell movement and survival (for reviews, see Lee and 1380 Journal of Cell Science 123 (8)

Juliano, 2004; Miranti and Brugge, 2002). Loss of adhesion can ErbB2 activation and survival from anoikis. A number of studies negatively regulate RTKs because detachment of normal cells can have shown that detachment from the substratum induces an result in desensitization to EGF, e.g. by inhibiting the expression increase in the phosphorylation and activity of Src in tumor cell of EGFR (Reginato et al., 2003) and, possibly, by targeting receptors lines (Wei et al., 2004) and in nonmalignant rat intestinal epithelial for degradation as is the case for platelet-derived growth factor cells (Loza-Coll et al., 2005). Intriguingly, in rat intestinal cells Src (PDGF) receptor (Baron and Schwartz, 2000). Interestingly, integrin activity is transiently increased during cell detachment and 4 has recently been shown to cooperate with ErbB2 in a breast contributes to transient protection from anoikis for about two hours. cancer mouse model (Guo et al., 2006). This study has shown that, Moreover, Src activation in suspension correlates with anoikis by using a mouse model of ErbB2-induced mammary carcinoma resistance, as six anoikis-resistant lung-cancer cell lines were found containing an integrin-4-signaling-deficient mutant, tumor growth to induce and maintain Src activation upon cell detachment (Wei and invasion was blocked in vivo. In addition, expression of this et al., 2004). Our study suggests that overexpression of RTKs, such mutant reversed ErbB2-mediated acini disorganization, disruption as ErbB2, induces the expression of specific integrins to help of cell-cell junctions and polarity in 3D culture. In our study, the maintain Src activity in suspension. It is possible that elevated levels reduction of levels of integrin 5 had little to no effect on acinar of integrin 5 help recruit Src to the plasma membrane in the cell growth, organization of cell-cell contacts or polarity of outer absence of adhesion where it can proceed to activate ErbB2 on Y877 cells that were in direct contact with the ECM. Only inner cells in and maintain ErbB2 activity, therefore, inhibiting Bim expression 3D acini that were not in direct contact with the ECM became and suppressing anoikis. Recent data from studies that used prostate sensitized to the loss of integrin 5. This is consistent with our cancer cells suggest a similar model of Src regulation of EGFR finding that reducing integrin 5 in ErbB2-cells cultured in 2D did activation during cell detachment that maintains Erk active in not alter cell growth or induce apoptosis in cells attached to plastic, suspension, and blocks Bim expression and anoikis (Giannoni et but only had an effect during cell detachment. Our study suggests al., 2009). We hypothesize that a similar pathway may explain why that ErbB2 activity and survival function becomes highly dependent a reduction of levels of integrin 5 in normal MCF-10A cells on integrin 5 in the absence of strong ECM adhesions, and that sensitizes these cells to anoikis because we also observed decreased ErbB2 depends on other integrins, such as integrin 6 and integrin Src and Erk activity and increased Bim levels. Although it is not 4, to amplify signals when in direct contact with the ECM. clear how Src becomes active during cell detachment, studies have Evidence of adhesion-independent, growth factor-dependent shown that some tyrosine kinase receptors, such as EGFR and activities of integrins is also emerging and may be especially PDGFR, can bind to Src through its SH2 domain and activate it relevant in cancer cells overexpressing RTKs (Comoglio et al., (Bromann et al., 2004). In addition, recent studies have shown that 2003). Tumor cells overexpressing RTKs may be able to uncouple maintenance of Src activation in prostate cancer cells in suspension from normal regulation by cell adhesion, and also utilize integrins requires the production of reactive oxygen species (ROS) (Giannoni as adaptors to amplify signals. For example, in various tumor cell et al., 2009). It is not clear whether ROS have a role in Src regulation lines integrin 4 can act as a functional signaling molecule – without during anoikis in MCF-10A cells. However, recent studies showed engagement of its extracellular ligand-binding domain – by that loss of adhesion in MCF-10A cells leads to increased ROS complexing with the hepatocyte growth factor (HGF) receptor Met production, which was inhibited in MCF-10A cells overexpressing

Journal of Cell Science (Trusolino et al., 2001). Integrin 4 conspires with Met receptor ErbB2 (Schafer et al., 2009). Since we did not detect major for anchorage-independent growth by activating Met signaling differences in Src activity in suspended cells overexpressing ErbB2 towards the Ras-Erk cascade (Bertotti et al., 2006). It is still also compared with parental MCF-10A cells (supplementary material possible that matrix adhesions contribute to the integrin 5 Fig. S3A), this suggests that ErbB2 does not regulate Src activity regulation of ErbB2 during cell detachment, as it has been shown in absence of adhesion directly or indirectly (via ROS alone). It for the autocrine loop of laminin-5–integrin-6–integrin-4–Rac will be of interest to determine whether integrin 5 has a role in described in the HMT-3544 human breast cancer progression series ROS regulation of normal and ErbB2-overexpressing cells during (Zahir et al., 2003). Although the experiments described in this cell detachment. manuscript were performed by using cells in suspension, they did Accumulating evidence suggests that overexpression or increased not directly distinguish between a ligation-dependent or - activity of Src has a key role in ErbB2-mediated anchorage independent role of integrin 51 because fibronectin is present in independence and cell survival (Bromann et al., 2004; Ishizawar serum, and can be secreted and organized on the cell surface even and Parsons, 2004). However, the link to apoptotic pathways has in suspended cells. Nevertheless, we were unable to detect any not been well characterized. Previous studies have implicated Src staining of fibronectin, the major ligand for integrin 5, in centrally regulation of Stat-3 control of Bcl-xL in cells that express EGFR located cells in acini that overexpress ErbB2 (data not shown). We and ErbB2 (Karni et al., 1999; Song et al., 2003) but in our studies did not observe changes in FAK activity in ErbB2-overexpressing we did not detect changes in Bcl-xL expression in ErbB2- cells compared with normal cells and did not detect any FAK activity overexpressing cells when compared with control MCF-10A cells, in cells in suspension, suggesting that FAK-dependent adhesion or in ErbB2 cells transfected with integrin 5 siRNA (data not signaling was not involved. Whether integrin 5 has adhesion- shown). Our finding that Src is required for ErbB2-mediated independent adaptor functions for ErbB2 activation, as has been inhibition of Bim during anoikis might explain in part how Src shown for integrin 4 regulation of the Met tyrosine kinase regulates ErbB2-mediated anchorage-independent survival. (Trusolino et al., 2001), remains to be determined. Interestingly, non-small cell lung cancer (NSCLC) cell lines, which Activation of Src is known to have a significant role in integrin are dependent on EGF receptor for survival, contain elevated levels and RTK cross talk, allowing synergy between these pathways, of phosphorylated Src-family kinase. Treatment of these cells with especially in transformed cells (Bromann et al., 2004). Our work Src inhibitor reduced phosphorylation of EGFR and ErbB2, and shows that integrin 5 allows the maintenance of Src induced apoptosis (Zhang et al., 2007). The regulation of Bcl-2 phosphorylation in the absence of cell adhesion that, in turn, allows family members was not examined in this study but it is possible ErbB2 requires integrin 5 for survival 1381

that the induction of Bim has a key role because a number of groups Western blot analysis Lysates from 2ϫ106-5ϫ106 MCF-10A cells, either attached or in suspension for the have implicated the regulation of Bim as essential for apoptosis indicated times, were prepared in RIPA lysis buffer (150 mM NaCl, 1% NP40, 0.5% induced by a range of EGFR and ErbB2 inhibitors in NSCLC (Costa DOC, 50 mM Tris-HCl at pH 8, 0.1% SDS, 10% glycerol, 5 mM EDTA, 20 mM et al., 2007; Cragg et al., 2007; de La Motte Rouge et al., 2007; NaF and 1 mM Na3VO4) supplemented with 1 mg/ml pepstatin, leupeptin, aprotinin Deng et al., 2007) and breast cancer cell lines (Piechocki et al., and 200 mg/ml phenyl methylsulphonyl fluoride (PMSF). Lysates were cleared by centrifugation at 16,000 g for 20 minutes at 4°C, analyzed by SDS-PAGE and 2007). Thus, our study suggest that the regulation of ErbB2-Erk autoradiography. Lysates were collected from cells in 3D as previously described axis by integrin 5 and Src is not only crucial for regulating Bim, (Reginato, 2005). Briefly, acini were washed with PBS, incubated with RIPA buffer anoikis resistance and tumor oncogenesis, but may also be a cascade for 15 minutes at 4°C and proteins then analyzed by western blotting using SDS- vital for the development of novel cancer-therapy strategies. PAGE and autoradiography. RNA interference Materials and Methods Transfection of small interfering RNA (siRNA) was carried out as previously described Cell culture and materials (Reginato et al., 2003; Reginato et al., 2005). Briefly, MCF-10A cells were plated MCF-10A cells were obtained from the American Type Culture Collection (ATCC) onto six-well plates at 2ϫ105 cells/well. After 24 hours, cells were transfected with and maintained as described previously (Reginato et al., 2003). Briefly, cells were double-stranded RNA-DNA hybrids at a final concentration of 1 mg annealed cultured in DMEM/F12 (Invitrogen, Carlsbad, CA) supplemented with 5% donor oligonucleotide using Oligofectamine (Invitrogen) according to manufacturer’s horse serum, 20 ng/ml EGF (Peprotech, Rocky Hill, NJ), 10 mg/ml insulin (Sigma, instructions. Cells were retransfected as described at 48 hours. At 76 hours after St Louis, MO), 1 ng/ml cholera toxin (Sigma), 100 mg/ml hydrocortisone (Sigma), initial transfection, cells were used in specific assay at the indicated times. Initial 50 U/ml penicillin and 50 mg/ml streptomycin (Invitrogen). Poly-HEMA and small interfering RNA (siRNA) oligonucleotides (SMARTpool) were obtained from methylcellulose were purchased from Sigma. LY294002 and U0126 were purchased Dharmacon Research (Lafayette, CO) for integrins 5 and 3. Control sense from Calbiochem (San Diego, CA). PP1 and PP2 were purchased from Biomol (luciferase) 5Ј-(GGCUCCCGCUGAAUUGGAAUU)d(TT)-3Ј; ITGA5#1 sense 5Ј- (Plymouth Meeting, PA). Growth factor-reduced Matrigel was obtained from BD- (GCAAGAAUCUCAACAACUCUU)d(TT)-3Ј; ITGA5#2 sense 5Ј-(GAGA - Biosciences (San Diego, CA). Primary antibodies against phosphorylated ErbB2 GGAGCCUGUGGAGUAUU)d(TT)-3Ј; and ITGA3 sense 5Ј-(GUGUACAUCU- (Y877), -cleaved caspase 3, phosphorylated Mek1/2 (S217/S221), phosphorylated AUCACAGUAUU)d(TT)-3Ј. Akt (S473), Akt, phosphorylated EGFR (Y845), EGFR, phosphorylated Src (Y416), Src were obtained from Cell Signaling (Danvers, MA). Antibodies against Actin, Lentivirus vectors and stable cell lines Integrin 5, Mek1, IgG-HRP and Erk2 were obtained from Santa Cruz Biotech (Santa Stable cell lines for shRNA knockdowns were generated by infection with the lentiviral Cruz, CA). Antibodies against integrin 5 (for immunofluorescence), integrin 1 and vector pLKO.1-puro carrying a shRNA sequence for scrambled (Addgene) (Sarbassov phosphotyrosine-PY20 were obtained from BD Biosciences (San Diego, CA). et al., 2005), Src (Sigma-Aldrich) and integrin 5 (Open Biosystems). VSVG- Antibodies against integrin 3 and integrin 6 were obtained from Chemicon pseudotyped lentivirus was generated by the co-transfection of 293-T packaging cells (Temecula, CA). Antibodies against ErbB2 (Calbiochem, La Jolla, CA), with 10 mg of DNA and packaging vectors as described (Rubinson et al., 2003). phosphorylated Erk1/2 (T185/Y187) (Biosource, Camarillo, CA) and Bim (Stressgen, Scrambled shRNA sequence used is 5Ј-CCTAAGGTTAAGTCGCC CTCGCT - Ann Arbor, Michigan) were also obtained. CTAGCGAGGGCGACTTAACCTT-3Ј. Src shRNA sequence used is 5Ј-CCGGG- ACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTT - Retrovirus vectors and stable cell lines TTG-3Ј. Integrin 5 shRNA sequence used is 5Ј-AGGCCATGATGAGTTTG - Retroviral vectors pBabe-NeuN, (human wildtype ErbB2), pBabe-MEK2-DD, GCCGATTCTCGAGAATCGGCCAAACTCATCATGG-3Ј. MCF-10A cells pLNCX-Myr-Akt1 and pBabe-H-RasV12 for stable gene expression have been overexpressing ErbB2 were infected as previously described (Reginato et al., 2003). described previously (Gunawardane et al., 2005; Reginato et al., 2003). Constitutively active ErbB2 mutant (pBabe-NeuT) was kindly provided by Danielle Carroll (Harvard Colony formation using soft-agar assay Medical School, Boston, MA). Vesicular stomatitis virus G-protein-pseudotyped Cells were grown in soft agar and fed as described (Gunawardane et al., 2005). Cells retroviruses were produced and MCF-10A cells were infected and selected as were incubated for 21 days and then stained with 500 ml of 0.05% p- previously described (Reginato et al., 2003). Iodonitrotetrazolium (INT)-violet overnight. Colonies (>50 mm in diameter) were

Journal of Cell Science counted using a Leica DM IRB inverted research microscope (Bannockburn, IL). All Quantitative real-time PCR assays were conducted in duplicate in at least three independent experiments. Total RNA was isolated from cells using the RNeasy Mini Kit according to the manufacturer’s instructions (Qiagen). Equal amounts of total RNA (250 ng) were Detachment-induced apoptosis assay added to Brilliant II quantitative real-time (QRT)-PCR master mix (Stratagene, La MCF-10A cells were placed in suspension in growth medium as previously described Jolla, CA) with primer/probe sets from Applied Biosystems (Foster City, CA). PCR (Reginato et al., 2003). Briefly, tissue culture plates were coated with poly-HEMA reactions were performed in a volume of 25 ml by using a MX 3000 machine, and (6 mg/ml), incubated at 37°C until dry and washed with PBS before use. Cells were analysis was performed using the MxPro software according to the manufacturer’s placed in growth medium containing 0.5% methylcellulose (to avoid cell clumping) instructions (Stratagene). Gene and catalog numbers for the primer/probe sets are as in suspension at a density of 5ϫ105 cells/ml and plated on poly-HEMA-coated plates follows: ITGA2 (Hs00158148_m1), ITGA5 (Hs00233732_m1) and ITGA6 for the indicated time. Cells were then washed with 1ϫ PBS and counted. 2,5ϫ104 (Hs01041011_m1). Expression of the housekeeping gene cyclophillin A cells were used to determine apoptosis with the cell death detection ELISA-kit (Roche, (Hs99999904_m1) was used as an internal loading control. Reacions were conducted Mannheim, Germany) according to manufacturer’s instructions. For some in duplicate in at least three independent experiments. experiments, after washing cells with PBS, they were resuspended in 1ϫ-binding buffer from the Annexin V-FITC Apoptosis Detection Kit I (BD-Pharmingen) Immunohistochemistry according to the manufacturer’s instructions. FITC annexin V and propidium iodide Tissue microarrays containing formalin-fixed paraffin-embedded breast-tumor tissue (Annexin V-FITC kit) were added and the cells incubated in the dark at room samples and normal breast tissue samples were obtained from US Biomax, Inc temperature for 15 minutes followed by analysis using Guava Technologies EasyCyte (Rockville, MD). Breast cancer tissue microarrays BR961 and BRC961, containing Plus. Data were analyzed by using Guava Cytosoft 5.3 software. All time points were 70 cases of ErbB2-positive tissue and 24 cases of ErbB2-negative tissue, were de- performed in duplicate and each experiment was carried out at least three times. paraffinized and rehydrated. Heat-induced antigen retrieval was performed at 95°C for 30 minutes using the DakoCytomation Target Retrieval Solution (Dako North 3D morphogenesis assay America, Inc, Carpinteria, CA). This was followed by a peroxide block in 3% H2O2 Assays were performed as previously described (Reginato et al., 2005). Briefly, cells to quench endogenous peroxidase activity and, subsequently, a 1-hour block in 10% were resuspended in assay medium (DMEM/F12 supplemented with 2% donor horse goat serum in 1ϫ Tris-buffered saline (TBS). Tissue samples were incubated with serum, 10 mg/ml insulin, 1 ng/ml cholera toxin, 100 mg/ml hydrocortisone, 50 U/ml anti-integrin 5 antibody (Santa Cruz) at 4 mg/ml in antibody diluent penicillin, 50 mg/ml streptomycin and 5 ng/ml EGF). Eight-well chamber slides (BD (DakoCytomation) overnight in a humidified chamber at room temperature. Primary Falcon) were coated with 45 ml Matrigel per well and 5ϫ103 cells were plated per antibody was detected using goat anti-rabbit IgG-peroxidase antibody (Sigma) at 35 well in assay medium containing final concentration of 2% matrigel. Assay medium mg/ml in antibody diluent, and signals were amplified and visualized by 3,3Ј- containing 2% Matrigel was replaced every 4 days and chemical inhibitors were diaminobenzidine (DAB kit, DakoCytomation). Sections were counterstained using supplemented to medium as indicated. Harris hematoxylin, dehydrated and mounted using Permount solution (Fisher). For statistical analysis, all cases that stained negative (–) for integrin 5 staining were Immunofluorescence and image acquisition classified as negative and all cases with +, ++ or +++ were classified as positive. Structures were prepared as previously described (Reginato et al., 2005). Briefly, Similar assessment was done for ErbB2-negative and -positive tissue. For statistical acini were fixed in 4% formalin for 20 minutes. Fixed structures were washed with analysis, Pearson’s correlation was used to analyze the relationship between integrin PBS-glycine (130 mM NaCl, 7 mM Na2HPO4, 100 mM glycine). Structures were 5 expression and ErbB2 expression. Results were considered significant at P<0.05. then blocked in IF buffer (130 mM NaCl, 7 mM Na2HPO4, 3.5 mM NaH2PO4, 7.7 mM 1382 Journal of Cell Science 123 (8)

NaN3, 0.1% BSA, 0.2% Triton X-100, 0.05% Tween 20) plus 10% goat serum for Jia, Y., Zeng, Z. Z., Markwart, S. M., Rockwood, K. F., Ignatoski, K. M., Ethier, S. 1 hour, followed by secondary blocking buffer for 40 minutes. Primary antibodies P. and Livant, D. L. (2004). Integrin fibronectin receptors in matrix metalloproteinase- were diluted in secondary blocking buffer, followed by incubation overnight at 4°C. 1-dependent invasion by breast cancer and mammary epithelial cells. Cancer Res. 64, After washing, acini were incubated with secondary antibodies coupled with Alexa- 8674-8681. Fluor dyes (Molecular Probes). Structures were incubated with 0.5 ng/ml of DAPI Karni, R., Jove, R. and Levitzki, A. (1999). Inhibition of pp60c-Src reduces Bcl-XL (4Ј,6Ј-diamidino-2-phenylindole; Sigma) before being mounted with Prolong expression and reverses the transformed phenotype of cells overexpressing EGF and (Molecular Probes). Quantification of caspase-3 staining of structures was performed HER-2 receptors. Oncogene 18, 4654-4662. at 40ϫ magnification. A minimum of 100 acinar structures were counted per Lee, J. W. and Juliano, R. (2004). Mitogenic signal transduction by integrin- and growth experiment,and each experiment was performed three independent times. Confocal factor receptor-mediated pathways. Mol. Cells 17, 188-202. Lohrisch, C. and Piccart, M. (2001). An overview of HER2. Semin. Oncol. 28, 3-11. analysis was performed using the Leica DM6000 B Confocal Microscope. Images Loza-Coll, M. A., Perera, S., Shi, W. and Filmus, J. (2005). A transient increase in the were generated using the Leica Confocal Imaging Software System and converted activity of Src-family kinases induced by cell detachment delays anoikis of intestinal to Tiff format. epithelial cells. Oncogene 24, 1727-1737. Mailleux, A. A., Overholtzer, M., Schmelzle, T., Bouillet, P., Strasser, A. and Brugge, We thank Danielle Carroll for helpful discussions, and Shami Jagtap J. S. (2007). BIM regulates apoptosis during mammary ductal morphogenesis, and its and Ian Henderson for technical assistance. This work was supported absence reveals alternative cell death mechanisms. Dev. Cell 12, 221-234. Miranti, C. K. and Brugge, J. S. (2002). Sensing the environment: a historical perspective by the Department of Defense (DOD) Breast Cancer Research Program on integrin signal transduction. Nat. Cell Biol. 4, E83-E90. Predoctoral Fellowship (to K.K.H.). Murthy, M. S., Reid, S. E., Jr, Yang, X. F. and Scanlon, E. P. (1996). The potential role of integrin receptor subunits in the formation of local recurrence and distant metastasis Supplementary material available online at by mouse breast cancer cells. J. Surg. Oncol. 63, 77-86. http://jcs.biologists.org/cgi/content/full/123/8/1373/DC1 Muthuswamy, S. K., Li, D., Lelievre, S., Bissell, M. J. and Brugge, J. S. (2001). ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial References acini. Nat. Cell Biol. 3, 785-792. Aranda, V., Haire, T., Nolan, M. E., Calarco, J. P., Rosenberg, A. Z., Fawcett, J. P., Nahta, R., Yu, D., Hung, M. C., Hortobagyi, G. N. and Esteva, F. J. (2006). Mechanisms Pawson, T. and Muthuswamy, S. K. (2006). Par6-aPKC uncouples ErbB2 induced of disease: understanding resistance to HER2-targeted therapy in human breast cancer. disruption of polarized epithelial organization from proliferation control. Nat. Cell. Biol. Nat. Clin. Pract. Oncol. 3, 269-280. 8, 1235-1245. Piechocki, M. P., Yoo, G. H., Dibbley, S. K. and Lonardo, F. (2007). Breast cancer Baron, V. and Schwartz, M. (2000). Cell adhesion regulates ubiquitin-mediated degradation expressing the activated HER2/neu is sensitive to gefitinib in vitro and in vivo and of the platelet-derived growth factor receptor beta. J. Biol. Chem. 275, 39318-39323. acquires resistance through a novel point mutation in the HER2/neu. Cancer Res. 67, Bertotti, A., Comoglio, P. M. and Trusolino, L. (2006). Beta4 integrin activates a Shp2- 6825-6843. Src signaling pathway that sustains HGF-induced anchorage-independent growth. J. Cell Reddig, P. J. and Juliano, R. L. (2005). Clinging to life: cell to matrix adhesion and cell Biol. 175, 993-1003. survival. Cancer Metastasis Rev. 24, 425-439. Bromann, P. A., Korkaya, H. and Courtneidge, S. A. (2004). The interplay between Src Reginato, M. J. and Muthuswamy, S. K. (2006). Illuminating the center: mechanisms family kinases and receptor tyrosine kinases. Oncogene 23, 7957-7968. regulating lumen formation and maintenance in mammary morphogenesis. J. Mammary Comoglio, P. M., Boccaccio, C. and Trusolino, L. (2003). Interactions between growth Gland Biol. Neoplasia 11, 205-211. factor receptors and adhesion molecules: breaking the rules. Curr. Opin. Cell Biol. 15, Reginato, M. J., Mills, K. R., Paulus, J. K., Lynch, D. K., Sgroi, D. C., Debnath, J., 565-571. Muthuswamy, S. K. and Brugge, J. S. (2003). Integrins and EGFR coordinately regulate Costa, D. B., Halmos, B., Kumar, A., Schumer, S. T., Huberman, M. S., Boggon, T. the pro-apoptotic protein Bim to prevent anoikis. Nat. Cell Biol. 5, 733-740. J., Tenen, D. G. and Kobayashi, S. (2007). BIM mediates EGFR tyrosine kinase Reginato, M. J., Mills, K. R., Becker, E. B., Lynch, D. K., Bonni, A., Muthuswamy, inhibitor-induced apoptosis in lung cancers with oncogenic EGFR mutations. PLoS Med. S. K. and Brugge, J. S. (2005). Bim regulation of lumen formation in cultured mammary 4, 1669-1679. epithelial acini is targeted by oncogenes. Mol. Cell. Biol. 25, 4591-4601. Cragg, M. S., Kuroda, J., Puthalakath, H., Huang, D. C. and Strasser, A. (2007). Rubinson, D. A., Dillon, C. P., Kwiatkowski, A. V., Sievers, C., Yank, L., Kopinja, J., Gefitinib-induced killing of NSCLC cell lines expressing mutant EGFR requires BIM Rooney, D. L., Zhang, M., Ihrig, M. M., McManus, M. T. et al. (2003). A lentivirus- and can be enhanced by BH3 mimetics. PLoS Med. 4, 1681-1689. based system to functionally silence genes in primary mammalian cells, stem cells and de La Motte Rouge, T., Galluzzi, L., Olaussen, K. A., Zermati, Y., Tasdemir, E., Robert, transgenic mice by RNA interference. Nat. Genet. 3, 401-406. T., Ripoche, H., Lazar, V., Dessen, P., Harper, F. et al. (2007). A novel epidermal Sarbassov, D. D., Guertin, D. A., Ali, S. M. and Sabatini, D. M. (2005).

Journal of Cell Science growth factor receptor inhibitor promotes apoptosis in non-small cell lung cancer cells Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science resistant to erlotinib. Cancer Res. 67, 6253-6262. 307, 1098-1101. Debnath, J. and Brugge, J. S. (2005). Modelling glandular epithelial cancers in three- Schafer, Z. T., Grassian, A. R., Song, L., Jiang, Z., Gerhart-Hines, Z., Irie, H. Y., Gao, dimensional cultures. Nat. Rev. Cancer 5, 675-688. S., Puigserver, P. and Brugge, J. S. (2009). Antioxidant and oncogene rescue of Debnath, J., Mills, K. R., Collins, N. L., Reginato, M. J., Muthuswamy, S. K. and metabolic defects caused by loss of matrix attachment. Nature 461, 109-113. Brugge, J. S. (2002). The role of apoptosis in creating and maintaining luminal space Schwartz, M. A. (1997). Integrins, oncogenes, and anchorage independence. J. Cell Biol. within normal and oncogene-expressing mammary acini. Cell 111, 29-40. 139, 575-578. Deng, J., Shimamura, T., Perera, S., Carlson, N. E., Cai, D., Shapiro, G. I., Wong, K. Simpson, C. D., Anyiwe, K. and Schimmer, A. D. (2008). Anoikis resistance and tumor K. and Letai, A. (2007). Proapoptotic BH3-only BCL-2 family protein BIM connects metastasis. Cancer Lett. 272, 177-185. death signaling from epidermal growth factor receptor inhibition to the mitochondrion. Song, L., Turkson, J., Karras, J. G., Jove, R. and Haura, E. B. (2003). Activation of Cancer Res. 67, 11867-11875. Stat3 by receptor tyrosine kinases and cytokines regulates survival in human non-small Frisch, S. M. and Screaton, R. A. (2001). Anoikis mechanisms. Curr. Opin. Cell Biol. cell carcinoma cells. Oncogene 22, 4150-4165. 13, 555-562. Trusolino, L., Bertotti, A. and Comoglio, P. M. (2001). A signaling adapter function for Giannoni, E., Buricchi, F., Grimaldi, G., Parri, M., Cialdai, F., Taddei, M. L., Raugei, alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107, 643- G., Ramponi, G. and Chiarugi, P. (2008). Redox regulation of anoikis: reactive oxygen 654. species as essential mediators of cell survival. Cell Death Differ. 15, 867-878. Valastyan, S., Reinhardt, F., Benaich, N., Calogrias, D., Szasz, A. M., Wang, Z. C., Giannoni, E., Fiaschi, T., Ramponi, G. and Chiarugi, P. (2009). Redox regulation of Brock, J. E., Richardson, A. L. and Weinberg, R. A. (2009). A pleiotropically acting anoikis resistance of metastatic prostate cancer cells: key role for Src and EGFR-mediated microRNA, miR-31, inhibits breast cancer metastasis. Cell 137, 1032-1046. pro-survival signals. Oncogene 28, 2074-2086. Wei, L., Yang, Y., Zhang, X. and Yu, Q. (2004). Altered regulation of Src upon cell Gunawardane, R. N., Sgroi, D. C., Wrobel, C. N., Koh, E., Daley, G. Q. and Brugge, detachment protects human lung adenocarcinoma cells from anoikis. Oncogene 23, 9052- J. S. (2005). Novel role for PDEF in epithelial cell migration and invasion. Cancer Res. 9061. 65, 11572-11580. White, D. E., Kurpios, N. A., Zuo, D., Hassell, J. A., Blaess, S., Mueller, U. and Muller, Guo, W., Pylayeva, Y., Pepe, A., Yoshioka, T., Muller, W. J., Inghirami, G. and W. J. (2004). Targeted disruption of beta1-integrin in a transgenic mouse model of human Giancotti, F. G. (2006). Beta 4 integrin amplifies ErbB2 signaling to promote mammary breast cancer reveals an essential role in mammary tumor induction. Cancer Cell 6, 159- tumorigenesis. Cell 126, 489-502. 170. Harris, J. R. (2004). Diseases of the Breast. Philadelphia: Lippincott Williams and Wilkins. Xu, W., Yuan, X., Beebe, K., Xiang, Z. and Neckers, L. (2007). Loss of Hsp90 association Hynes, N. E. and Stern, D. F. (1994). The biology of erbB-2/neu/HER-2 and its role in up-regulates Src-dependent ErbB2 activity. Mol. Cell. Biol. 27, 220-228. cancer. Biochim. Biophys. Acta 1198, 165-184. Zahir, N., Lakins, J. N., Russell, A., Ming, W., Chatterjee, C., Rozenberg, G. I., Imanishi, Y., Hu, B., Jarzynka, M. J., Guo, P., Elishaev, E., Bar-Joseph, I. and Cheng, Marinkovich, M. P. and Weaver, V. M. (2003). Autocrine laminin-5 ligates alpha6beta4 S. Y. (2007). Angiopoietin-2 stimulates breast cancer metastasis through the integrin and activates RAC and NFkappaB to mediate anchorage-independent survival alpha(5)beta(1) integrin-mediated pathway. Cancer Res. 67, 4254-4263. of mammary tumors. J. Cell Biol. 163, 1397-1407. Ishizawar, R. and Parsons, S. J. (2004). c-Src and cooperating partners in human cancer. Zhang, J., Kalyankrishna, S., Wislez, M., Thilaganathan, N., Saigal, B., Wei, W., Ma, Cancer Cell 6, 209-214. L., Wistuba, I. I., Johnson, F. M. and Kurie, J. M. (2007). SRC-family kinases are Ishizawar, R. C., Miyake, T. and Parsons, S. J. (2007). c-Src modulates ErbB2 and ErbB3 activated in non-small cell lung cancer and promote the survival of epidermal growth heterocomplex formation and function. Oncogene 26, 3503-3510. factor receptor-dependent cell lines. Am. J. Pathol. 170, 366-376.