DOCSLIB.ORG

Deregulation of Protein Ubiquitination by HPV E6 Proteins

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deregulation of Protein Ubiquitination by HPV E6 Proteins Deregulation of protein ubiquitination by HPV E6 proteins Doctoral thesis for obtaining the academic degree Doctor of Natural Sciences (Dr.rer.nat.) submitted by Felix Ebner at the Faculty of Mathematics and Natural Sciences Department of Biology Konstanz, 2019 Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-2-16o1byax6gd3j7 Date of the oral examination: 10.07.2019 First referee: Prof. Dr. Martin Scheffner Second referee: Prof. Dr. Florian Stengel Table of contents Table of contents Abstract ............................................................................................................................ v Zusammenfassung ........................................................................................................... vii 1 Introduction ............................................................................................................... 1 1.1 Human papillomaviruses ............................................................................................. 1 1.2 The viral life cycle ........................................................................................................ 3 1.3 HPV genome ................................................................................................................ 4 1.3.1 HPV E1 and E2 ...................................................................................................... 5 1.3.2 HPV E4 .................................................................................................................. 7 1.3.3 HPV E5 .................................................................................................................. 7 1.3.4 HPV E6 and E7 oncoproteins ................................................................................ 8 1.3.4.1 HPV E7 ........................................................................................................... 9 1.3.4.2 HPV E6 ......................................................................................................... 10 1.3.5 HPV vaccination .................................................................................................. 14 1.4 The ubiquitin-proteasome system ............................................................................ 15 1.4.1 The ubiquitination cascade ................................................................................ 15 1.4.2 Ubiquitin modifications ...................................................................................... 17 1.4.3 Proteasome-mediated protein degradation ...................................................... 19 1.5 The HECT ligase E6AP ................................................................................................ 20 2 Aims ........................................................................................................................ 23 3 Materials & Methods ............................................................................................... 25 3.1 Materials .................................................................................................................... 25 3.1.1 Bacterial strains and culture media ................................................................... 25 3.1.2 Cell lines and cell culture .................................................................................... 25 3.1.3 Plasmids .............................................................................................................. 26 3.1.4 Oligonucleotides ................................................................................................. 27 3.1.5 Antibodies .......................................................................................................... 28 3.1.6 DNA and protein markers................................................................................... 28 3.1.7 Chemicals ........................................................................................................... 29 3.1.8 Frequently used buffers ..................................................................................... 30 3.1.9 Software ............................................................................................................. 31 3.2 Methods ..................................................................................................................... 32 i Table of contents 3.2.1 Molecular biology ............................................................................................... 32 3.2.1.1 Polymerase chain reaction (PCR) and site directed mutagenesis .............. 32 3.2.1.2 Restriction digest and vector dephosphorylation ...................................... 32 3.2.1.3 Measuring DNA concentrations .................................................................. 32 3.2.1.4 Agarose gel electrophoresis and extraction of DNA from agarose gels ..... 33 3.2.1.5 Ligation ........................................................................................................ 33 3.2.1.6 Gibson Assembly ......................................................................................... 33 3.2.1.7 Transformation of E. coli ............................................................................. 33 3.2.1.8 Mini preparation of plasmid DNA ............................................................... 34 3.2.1.9 Midi preparation of plasmid DNA ............................................................... 34 3.2.1.10 DNA sequencing .......................................................................................... 35 3.2.2 Protein biochemistry .......................................................................................... 35 3.2.2.1 Expression of recombinant proteins and generation of bacterial lysate ... 35 3.2.2.2 Purification of GST-tagged proteins ............................................................ 35 3.2.2.3 Purification of His-tagged proteins ............................................................. 36 3.2.2.4 Purification of bacterially expressed ubiquitin ........................................... 36 3.2.2.5 Biotinylation of ubiquitin ............................................................................ 37 3.2.2.6 MALDI-TOF mass spectrometry .................................................................. 38 3.2.2.7 Protein concentration determination (BCA method) ................................. 39 3.2.2.8 Preparation and detection of in vitro-translated proteins ......................... 39 3.2.2.9 GST co-precipitation assays ........................................................................ 39 3.2.2.10 In vitro ubiquitination assays ...................................................................... 40 3.2.2.11 Sodium dodecyl sulfate – poly acrylamide gel electrophoresis ................. 40 3.2.2.12 Coomassie Blue and colloidal Coomassie staining ..................................... 40 3.2.2.13 Western blotting and immunodetection .................................................... 41 3.2.3 Cell biology ......................................................................................................... 41 3.2.3.1 Preservation and cultivation of mammalian cells....................................... 41 3.2.3.2 Transient transfection experiments............................................................ 42 3.2.3.3 Lysate preparation from human cells ......................................................... 42 3.2.3.4 Determination of β-Gal activities in whole cell extracts ............................. 42 3.2.3.5 Fluorescence-activated cell sorting (FACS) ................................................. 43 3.2.4 Workflow for isolation of proteins modified with biotinylated ubiquitin ......... 43 3.2.4.1 In vitro ubiquitination assay with cell extracts ........................................... 43 3.2.4.2 Streptavidin affinity purification ................................................................. 44 3.2.4.3 In-gel trypsin digestion and peptide extraction .......................................... 44 ii Table of contents 3.2.4.4 LC-MS/MS ................................................................................................... 45 3.2.4.5 Mass spectrometry data analysis................................................................ 45 3.2.5 Statistics and data representation ..................................................................... 46 4 Results ..................................................................................................................... 47 4.1 Establishing a workflow for identification of the E6 ubiquitome .............................. 47 4.1.1 Generation and functional analysis of bioubiquitin ............................................ 48 4.1.2 Alternative strategy for ubiquitination assay using ubiquitin mutants ............. 50 4.1.3 Functional analysis of bioubiquitin mutants ........................................................ 53 4.2 Analysis of the HPV E6 ubiquitome ........................................................................... 57 4.3 XRCC4 as potential E6 substrate ................................................................................ 61 4.3.1 XRCC4 is polyubiquitinated in presence of the E6-E6AP complex ..................... 61 4.3.2 Recombinant GST-XRCC4 is modified with ubiquitin by E6-E6AP...................... 63 4.3.3 The E6-E6AP complex induces reduction of XRCC4 levels in cellulo .................. 64 4.3.4 XRCC4 does not detectably bind to GST-E6 proteins ........................................
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Proteomic Expression Profile in Human Temporomandibular Joint
    diagnostics Article Proteomic Expression Profile in Human Temporomandibular Joint Dysfunction Andrea Duarte Doetzer 1,*, Roberto Hirochi Herai 1 , Marília Afonso Rabelo Buzalaf 2 and Paula Cristina Trevilatto 1 1 Graduate Program in Health Sciences, School of Medicine, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba 80215-901, Brazil; [email protected] (R.H.H.); [email protected] (P.C.T.) 2 Department of Biological Sciences, Bauru School of Dentistry, University of São Paulo, Bauru 17012-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-41-991-864-747 Abstract: Temporomandibular joint dysfunction (TMD) is a multifactorial condition that impairs human’s health and quality of life. Its etiology is still a challenge due to its complex development and the great number of different conditions it comprises. One of the most common forms of TMD is anterior disc displacement without reduction (DDWoR) and other TMDs with distinct origins are condylar hyperplasia (CH) and mandibular dislocation (MD). Thus, the aim of this study is to identify the protein expression profile of synovial fluid and the temporomandibular joint disc of patients diagnosed with DDWoR, CH and MD. Synovial fluid and a fraction of the temporomandibular joint disc were collected from nine patients diagnosed with DDWoR (n = 3), CH (n = 4) and MD (n = 2). Samples were subjected to label-free nLC-MS/MS for proteomic data extraction, and then bioinformatics analysis were conducted for protein identification and functional annotation. The three Citation: Doetzer, A.D.; Herai, R.H.; TMD conditions showed different protein expression profiles, and novel proteins were identified Buzalaf, M.A.R.; Trevilatto, P.C.
    [Show full text]
  • Characterization of the Golgi C10orf76-PI4KB Complex, and Its
    bioRxiv preprint doi: https://doi.org/10.1101/634592; this version posted May 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Characterization of the Golgi c10orf76-PI4KB complex, and its 2 necessity for Golgi PI4P levels and enterovirus replication 3 4 McPhail, J.A.1, Lyoo, H.R.2*, Pemberton, J.G.3*, Hoffmann, R.M.1, van Elst W.2, 5 Strating J.R.P.M.2, Jenkins, M.L.1, Stariha, J.T.B.1, van Kuppeveld, F.J.M.2#, Balla., T.3#, and 6 Burke, J.E.1# 7 * - These authors contributed equally 8 # - Corresponding authors 9 10 Affiliations 11 1 Department of Biochemistry and Microbiology, University of Victoria, Victoria, BC, 12 Canada 13 2 Department of Infectious Diseases & Immunology, Virology Division, Faculty of 14 Veterinary Medicine, Utrecht University, Utrecht, The Netherlands. 15 3 Section on Molecular Signal Transduction, Eunice Kennedy Shriver National Institute 16 of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 17 USA 18 19 Corresponding authors: 20 Burke, John E. ([email protected]), Tel: 1-250-721-8732 21 Balla, Tamas ([email protected]), Tel: 301-435-5637 22 van Kuppeveld, Frank J.M. ([email protected]), Tel: 31-30-253-4173 23 24 Running title 25 Role of c10orf76-PI4KB at the Golgi 26 27 28 29 30 31 32 bioRxiv preprint doi: https://doi.org/10.1101/634592; this version posted May 10, 2019.
    [Show full text]
  • Supplementary Figure and Tables
    USP24-GSDMB complex promotes bladder cancer proliferation via activation of the STAT3 pathway Haiqing He, Lu Yi, Bin Zhang, Bin Yan, Ming Xiao, Jiannan Ren, Dong Zi, Liang Zhu, Zhaohui Zhong, Xiaokun Zhao, Xin Jin, Wei Xiong Supplementary figure 1. A and B, T24 and 5637 cells were infected with indicated constructs for 48 h. The cells were harvested for cell cycle assay (A) and transwell invasion assay (B). Data presented as three replicates. ns, not significant; *, P < 0.05; ***, P < 0.001. Table S1: Sequences of RT-qPCR primers Species Gene Forward (5’-3’) Reverse (5’-3’) Human GAPDH CCAGAACATCATCCCTGCCT CCTGCTTCACCACCTTCTTG Human HK2 TCTATGCCATCCCTGAGGAC TCTCTGCCTTCCACTCCACT Human LDHA GGCCTGTGCCATCAGTATCT CGCTTCCAATAACACGGTTT Human ENO2 GAAGAAAAGGCCTGCAACTG CCAGGTCAGCAATGAATGTG Human GSDMB AGTCTTTGGGTTCGGAGGAT CTTGTCTGGGTCCTCCATGT Human IGFBP3 CCTGCCGTAGAGAAATGGAA AGGCTGCCCATACTTATCCA Table S2: Sequences of ChIP-qPCR primers Species Gene Forward (5’-3’) Reverse (5’-3’) Human IGFBP3 CCCCTGGGGATATAAACAGC GCATTCGTGTGTACCTCGTG Table S3: Sequences of gene-specific shRNAs shGSDMB-1 5′- CCGGGCCTTGTTGATGCTGATAGATCTCGAGATCTATCAGCATCAACAAGGCTTTTTT G-3′ shGSDMB-2 5′- CCGGGCTGTATGTTGTTGTCTCTATCTCGAGATAGAGACAACAACATACAGCTTT TTTG-3′ shSTAT3 5′- CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG -3′ shUSP24-1 5′- CCGGCTCTCGTATGTAACGTATTTGCTCGAGCAAATACGTTACATACGAGAGTTTTTG TG-3′ shUSP24-2 5′- CCGGACAATACTGTGACCGTATAAACTCGAGTTTATACGGTCACAGTATTGTTTTTTG -3′ gene_id si-GSDMB si-NC log2FoldChangepvalue padj gene_namegene_chr gene_start ENSG0000014667410533.42
    [Show full text]
  • Comparing the Mrna Expression Profile and the Genetic Determinism
    González-Prendes et al. BMC Genomics (2019) 20:170 https://doi.org/10.1186/s12864-019-5557-9 RESEARCH ARTICLE Open Access Comparing the mRNA expression profile and the genetic determinism of intramuscular fat traits in the porcine gluteus medius and longissimus dorsi muscles Rayner González-Prendes1, Raquel Quintanilla2, Emilio Mármol-Sánchez1, Ramona N. Pena3, Maria Ballester2, Tainã Figueiredo Cardoso1,4, Arianna Manunza1, Joaquim Casellas5, Ángela Cánovas6, Isabel Díaz7, José Luis Noguera2, Anna Castelló1,5, Anna Mercadé5 and Marcel Amills1,5* Abstract Background: Intramuscular fat (IMF) content and composition have a strong impact on the nutritional and organoleptic properties of porcine meat. The goal of the current work was to compare the patterns of gene expression and the genetic determinism of IMF traits in the porcine gluteus medius (GM) and longissimus dorsi (LD) muscles. Results: A comparative analysis of the mRNA expression profiles of the pig GM and LD muscles in 16 Duroc pigs with available microarray mRNA expression measurements revealed the existence of 106 differentially expressed probes (fold-change > 1.5 and q-value < 0.05). Amongst the genes displaying the most significant differential expression, several loci belonging to the Hox transcription factor family were either upregulated (HOXA9, HOXA10, HOXB6, HOXB7 and TBX1) or downregulated (ARX) in the GM muscle. Differences in the expression of genes with key roles in carbohydrate and lipid metabolism (e.g. FABP3, ORMDL1 and SLC37A1) were also detected. By performing a GWAS for IMF content and composition traits recorded in the LD and GM muscles of 350 Duroc pigs, we identified the existence of one region on SSC14 (110–114 Mb) displaying significant associations with C18:0, C18:1(n-7), saturated and unsaturated fatty acid contents in both GM and LD muscles.
    [Show full text]
  • Mouse Armh3 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Armh3 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Armh3 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Armh3 gene (NCBI Reference Sequence: NM_198296.2 ; Ensembl: ENSMUSG00000039901 ) is located on Mouse chromosome 19. 26 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 26 (Transcript: ENSMUST00000045396). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Armh3 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-333H17 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit defects in chorion and trophoblast layer formation and complete embryonic lethality during organogenesis. Exon 2 starts from the start codon. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 19703 bp, and the size of intron 2 for 3'-loxP site insertion: 3324 bp. The size of effective cKO region: ~602 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 26 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Armh3 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Protein List
    Protein Accession Protein Id Protein Name P11171 41 Protein 4.
    [Show full text]
  • A Single Gene Expression Set Derived from Artificial
    Article A Single Gene Expression Set Derived from Artificial Intelligence Predicted the Prognosis of Several Lymphoma Subtypes; and High Immunohistochemical Expression of TNFAIP8 Associated with Poor Prognosis in Diffuse Large B-Cell Lymphoma Joaquim Carreras 1,* , Yara Y. Kikuti 1, Masashi Miyaoka 1, Shinichiro Hiraiwa 1, Sakura Tomita 1, Haruka Ikoma 1, Yusuke Kondo 1, Atsushi Ito 1, Sawako Shiraiwa 2, Rifat Hamoudi 3,4 , Kiyoshi Ando 2 and Naoya Nakamura 1 1 Department of Pathology, Tokai University, School of Medicine, Isehara, Kanagawa 259-1193, Japan; [email protected] (Y.Y.K.); [email protected] (M.M.); [email protected] (S.H.); [email protected] (S.T.); [email protected] (H.I.); [email protected] (Y.K.); [email protected] (A.I.); [email protected] (N.N.) 2 Department of Hematology and Oncology, Tokai University, School of Medicine, Isehara, Kanagawa 259-1193, Japan; [email protected] (S.S.); [email protected] (K.A.) 3 Department of Clinical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, UAE; [email protected] 4 Division of Surgery and Interventional Science, UCL, London WC1E 6BT, UK; [email protected] * Correspondence: [email protected]; Tel.: +81-0463-93-1121 (ext. 3170); Fax: +81-0463-91-1370 Received: 24 June 2020; Accepted: 17 July 2020; Published: 21 July 2020 Abstract: Objective: We have recently identified using multilayer perceptron analysis (artificial intelligence) a set of 25 genes with prognostic relevance in diffuse large B-cell lymphoma (DLBCL), but the importance of this set in other hematological neoplasia remains unknown.
    [Show full text]
  • Animal: an International Journal of Animal Bioscience
    Animal: An International Journal of Animal Bioscience Comparative selection signature analyses identify genomic footprints in Reggiana cattle, the traditional breed of the Parmigiano Reggiano cheese production system --Manuscript Draft-- Manuscript Number: ANIMAL-19-10695R2 Full Title: Comparative selection signature analyses identify genomic footprints in Reggiana cattle, the traditional breed of the Parmigiano Reggiano cheese production system Short Title: Selection signatures in the Reggiana cattle genome Article Type: Research Article Section/Category: 1. Breeding and Genetics Keywords: Autochthonous breed; Bos taurus; Genome; selection signature; Selection sweep. Corresponding Author: Luca Fontanesi, PhD University of Bologna Reggio Emilia, RE ITALY First Author: Luca Fontanesi, PhD Order of Authors: Luca Fontanesi, PhD Francesca Bertolini Giuseppina Schiavo Samuele Bovo Maria Teresa Sardina Salvatore Mastrangelo Stefania Dall’Olio Baldassare Portolano Manuscript Region of Origin: ITALY Abstract: Reggiana is an autochthonous cattle breed reared mainly in the province of Reggio Emilia, located in the North of Italy. Reggiana cattle (originally a triple-purpose population largely diffused in the North of Italy) are characterized by a typical solid red coat colour. About 2500 cows of this breed are currently registered to its herd book. Reggiana is now considered a dual-purpose breed even if it is almost completely dedicated to the production of a mono-breed branded Protected Designation of Origin (PDO) Parmigiano Reggiano cheese, which is the main driver of the sustainable conservation of this local genetic resource. In this study, we provided the first overview of genomic footprints that characterize Reggiana and define the diversity of this local cattle breed. A total of 168 Reggiana sires (all bulls born over 35 years for which semen was available) and other 3321 sires from three cosmopolitan breeds (Brown, Holstein and Simmental) were genotyped with the Illumina BovineSNP50 panel.
    [Show full text]
  • Highly Heritable and Functionally Relevant Breed Differences in Dog Behavior
    1 Highly Heritable and Functionally Relevant Breed Differences in Dog Behavior Evan L MacLean†, Noah Snyder-Mackler†, Bridgett M. vonHoldt, & James A. Serpell † These authors contributed equally to this work. Supplementary Materials Supplemental Figures S1-S5 Supplemental Tables S1-S8 Supplemental References 2 Fig S1. Scatterplot of regression coefficients for each SNP across genetic datasets, by trait. 3 Fig S2. Correlation of SNP regression coefficients across genetic datasets as a function of p value threshold (from meta-analysis of p values) for inclusion. Points reflect the mean and error bars extend to the minimum and maximum values across traits. 4 Figure S3. Tissue-specific enrichment for the collective set of genes associated with breed differences in dog behavior, mapping SNPs to the nearest gene within 20kb. (A) Enrichment tests using dog gene expression to identify tissue-specific genes. (B) Enrichment tests using human gene expression to identify tissue-specific genes. Bars reflect the -log10 p value from a hypergeometric test for tissue-specific gene enrichment, corrected for multiple comparisons. The dashed line indicates -log10(p = 0.05) and the results for brain tissue are highlighted in red. 5 Figure S4. Trait heritability estimates using Efficient Mixed Model Association (EMMA) and a Bayesian implementation of the ‘Animal Model’ (MCMC). Heritability estimates from EMMA and MCMC were highly correlated within each of the two genetic datasets (Hayward et al., Parker et al.). Across genetic datasets, the heritability estimates for each trait were also highly correlated using both statistical approaches (MCMC: R = 0.81; EMMA: R = 0.94). 6 Figure S5. Distributions of heritability estimates from resampling using Efficient Mixed-Model Association (EMMA).
    [Show full text]
  • FKBP-Related Ncrna-Mrna Axis in Breast Cancer
    FKBP-related ncRNA-mRNA axis in breast cancer Hanchu Xiong Zhejiang University https://orcid.org/0000-0001-6075-6895 Zihan Chen Zhejiang university Wenwen Zheng Zhejiang University School of Medicine Second Aliated Hospital Jing Sun Zhejiang University School of Medicine Second Aliated Hospital Qingshuang Fu Ruian City People's Hospital Rongyue Teng Zhejiang University School of Medicine Sir Run Run Shaw Hospital Jida Chen Zhejiang University School of Medicine Sir Run Run Shaw Hospital Shuduo Xie Zhejiang University School of Medicine Sir Run Run Shaw Hospital Linbo Wang Zhejiang University Xiao-Fang Yu Zhejiang University Jichun Zhou ( [email protected] ) https://orcid.org/0000-0002-0727-4034 Research article Keywords: breast cancer; microRNA; long noncoding RNA; FK506-binding protein; bioinformatic analysis. Posted Date: March 11th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-16732/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Genomics on November 1st, 2020. See the published version at https://doi.org/10.1016/j.ygeno.2020.08.017. Page 1/29 Abstract Background Breast cancer (BC) is a disease with morbidity ranking the rst of women worldwidely. FK506-binding protein (FKBP) family has been demonstrated to possess various functions by interacting with different molecular targets in BC. However, a comprehensive ncRNA-mRNA regulatory axis of FKBP has not yet been reported. Methods FKBP related miRNAs were obtained from miRWalk database. Then, potential lncRNAs, transcription factors as well as mRNAs of screened differentially expressed miRNAs (DE-miRNAs) were analysed by using LncBase v.2, miRGen v3 and miRWalk database.
    [Show full text]
  • Artificial Intelligence Analysis of Gene Expression Data Predicted the Prognosis of Patients with Diffuse Large B-Cell Lymphoma
    Tokai J Exp Clin Med., Vol. 45, No. 1, pp. 37-48, 2020 Artificial Intelligence Analysis of Gene Expression Data Predicted the Prognosis of Patients with Diffuse Large B-Cell Lymphoma Joaquim CARRERAS*1, Rifat HAMOUDI*2 and Naoya NAKAMURA*1 *1Department of Pathology, Tokai University, School of Medicine *2Department of Clinical Sciences, College of Medicine, University of Sharjah, Sharjah, United Arab Emirates (Received December 13, 2019; Accepted February 5, 2020) Objective: We aimed to identify new biomarkers in Diffuse Large B-cell Lymphoma (DLBCL) using the deep learning technique. Methods and Results: The multilayer perceptron (MLP) analysis was performed in the GSE10846 series, di- vided into discovery (n = 100) and validation (n = 414) sets. The top 25 gene-probes from a total of 54,614 were selected based on their normalized importance for outcome prediction (dead/alive). By Gene Set Enrichment Analysis (GSEA) the association to unfavorable prognosis was confirmed. In the validation set, by univar- iate Cox regression analysis, high expression of ARHGAP19, MESD, WDCP, DIP2A, CACNA1B, TNFAIP8, POLR3H, ENO3, SERPINB8, SZRD1, KIF23 and GGA3 associated to poor, and high SFTPC, ZSCAN12, LPXN and METTL21A to favorable outcome. A multivariate analysis confirmed MESD, TNFAIP8 and ENO3 as risk factors and ZSCAN12 and LPXN as protective factors. Using a risk score formula, the 25 genes identified two groups of patients with different survival that was independent to the cell-of-origin molecular classification (5-year OS, low vs. high risk): 65% vs. 24%, respectively (Hazard Risk = 3.2, P < 0.000001). Finally, correlation with known DLBCL markers showed that high expression of all MYC, BCL2 and ENO3 associated to the worst outcome.
    [Show full text]