ORIGINAL ARTICLE a Sub-Population of High

A sub-population of high proliferative potential-quiescent human mesenchymal stem cells is under the reversible control of interferon a/b

A Hatzfeld1, P Eid1, I Peiffer1,MLLi1,4, R Barbet1, RAJ Oostendorp2, V Haydont1, M-N Monier1, L Milon1, N Fortunel1,5, P Charbord3, M Tovey1 and J Hatzfeld1

1CNRS Human Stem Cell Laboratory, rue Guy Moquet, Villejuif, France; 2Laboratory of Stem Cell Physiology, 3rd Department of Internal Medicine, Klinikum rechts der Isar, Mu¨nchen, Germany and 3Laboratoire d’He´matopoie`se, Faculte´ de Me´decine, 2bis Bvd Tonnele´, Tours, France

Type I interferon (IFN) is shown to control the reversible of great interest for use in tissue engineering and cell quiescence of a primitive human bone marrow mesenchymal therapy.7,12–20 (Lazarus et al., Blood, 2000, 96: 392a, abstract). stem cell (MSC) subpopulation. A 24 h pre-treatment of Stro1 þ / These primitive stem cells can differentiate into mature cells of GlycoA- or CD45-/GlycoA- subpopulations with a monoclonal the mesodermal lineage, like osteoblasts, chondroblasts or antibody (mAb) against the IFNAR1 chain of the human type I 3,21–23 a adipocytes. One group has also obtained differentiation IFN receptor (64G12), or with a polyclonal anti-IFN antibody, 21 resulted in a marked increase in the number of very large into cells derived from ectoderm, such as neural cells in colonies (CFU-F 43000 cells) obtained in the presence of low, mouse, or endoderm, such as functional hepatocyte-like cells in but necessary, concentrations of bFGF. Over a 2-month culture human.24 period, this short activation promoted a faster and greater The multifunctional cytokine transforming growth factor-b1 amplification of mesenchymal progenitors for adipocytes and (TGF-b1) has been shown previously to play an important role in osteoblasts. Activation correlated with inhibition of STAT1 and the regulation of the proliferation of stem cells in vitro, such as STAT2 phosphorylation and of STAT1 nuclear translocation. A 25–28 non-neutralizing anti-IFNAR1 mAb was ineffective. We demon- human hematopoietic stem cell (hHSC) subpopulations, strate that control and activated MSCs express ST3GAL3, a and primitive keratinocytes.29 Thus, the use of antisense sialyltransferase necessary to produce the embryonic antigens oligonucleotides has revealed that hHSC quiescence is SSEA-3 and -4. Interestingly, activated MSC progeny expressed mediated in part through an autocrine loop involving TGF- SSEA-3 and -4 at a higher level than control cultures, but this b1.30–33 Similar results have been obtained using either was not correlated with a significant expression of other antibodies against TGF-b25,31,34 or antibodies against the TGF-b embryonic markers. As MSCs represent an essential tool in 35 tissue regeneration, the use of 64G12, which rapidly recruits a cell-surface type II receptor (anti-TbR-II). higher number of primitive cells, might increase amplification The aim of the present study was to address the question of a safety for cell therapy. possible involvement of type I interferons (IFN), as negative Leukemia (2007) 21, 714–724. doi:10.1038/sj.leu.2404589 regulators of the cell cycle of human bone marrow-derived Keywords: human mesenchymal stem cells; interferon receptor; mesenchymal precursor cells, as IFNa has been described as a cell cycle inhibition potent inhibitor of marrow stromal cells.36–38 As a tool to block IFN signalling, we previously produced and characterized a neutralizing monoclonal antibody, 64G12, directed against IFNAR1, one of the two polypeptide chains constituting the receptor for IFNa, b and o.39,40 The anti-IFNAR1 antibody, Introduction 64G12, has been shown to neutralize all human type I IFNs.39,40 In this study, we demonstrate that IFN, at very low concentra- Unlike pluripotent human embryonic stem cells (hESCs), which tions, could control high proliferative potential - Quiescent spontaneously sustain large-scale expansion, adult somatic stem (HPP-Q) cells. We observed that the gene ST3GAL3, encoding cells consist of rare sub-populations of quiescent or slow cycling for a SSEA-4 synthase, is well-expressed in MSCs. However, the cells with a limited capacity for self-renewal in vitro, together expression of SSEA-3 and -4 was not correlated with the with a loss of telomerase activity. Mesenchymal stem cells expression of any other embryonic markers. (MSCs) were initially isolated by Friedenstein et al.1 They consist of a heterogenous and still incompletely characterized cell population.2–7 They can be found in tissues of various origins Materials and methods such as bone marrow, adipose tissue, synovial membrane, placenta, umbilical cord and also in cord blood.4,8–11 They are Bone marrow cell isolation Bone marrow cells were obtained during orthopedic surgery Correspondence: Dr A Hatzfeld, CNRS Human Stem Cell Laboratory, FRE 2942, 7, rue Guy Moquet, 94800 – Villejuif, France. after informed consent of the donors, according to the Helsinki E-mail: [email protected] protocol. Mononuclear cells, recovered by Ficoll density 4Present address: Key Laboratory of Yunnan of Pharmacology for gradient centrifugation, were enriched in the specified sub- Nature Products, Kunming Medical University, 650031 Kunming, population, using the relevant micromagnetic beads from Yunnan, China 5 Miltenyi Biotec (Paris, France). The Stro1 þ IgM antibody, Present address: CEA, Institut de Radiobiologie Cellulaire et obtained from Developmental Studies Hybridoma Bank (DSHB) Molećulaire, Laboratoire de Geńomique et Radiobiologie de la Ke´ratinopoıe´se, Evry, France (University of Iowa, Iowa City, USA) was purified by affinity ¨ 6 Received 18 September 2006; revised 7 December 2006; accepted chromatography and used at the concentration of 1 mg/10 cells. 22 December 2006 The Stro1 þ sub-population was obtained by an indirect Interferon controls human stem cell proliferation A Hatzfeld et al 715 method, using rat anti-mouse IgM microbeads. The CD105 þ , Long-term cultures CD45-/GlycoAÀ and Stro1 þ /GlycoAÀ sub-populations were Long-term expansion assays were carried out in 25 cm2 tissue isolated, using the corresponding microbeads from Miltenyi, culture plates. Cultures were initiated with the purified according to the manufacturer’s protocol. populations plated at the above-specified concentration. After reaching no more than 70–80% confluency, expanded MSC populations were detached by trypsinization (Boehringer, Ingelheim, Germany), counted and replated at the same Human pluripotent cell lines concentration. Cultures were continually passaged until the hESCs were used as positive control for embryonic markers. The growth capacity of the cells was exhausted. Culture medium hESC were hES2 cells provided by embryonic stem (ES) cell was completely renewed two times per week. The cumulated International (ESI), and cultured according to the supplier’s total cell outputs were calculated assuming that all the cells instructions. Briefly, hESCs were amplified in an undifferentiated from the previous passage had been replated. For each cell state on human extracellular matrices replacing murine em- population (control and 64G12 activated MSCs), cultures were bryonic fibroblast (MEF) feeders in a culture medium consisting performed in triplicate. At each step, cell viability was evaluated of 80% knockout (KO) Dulbecco’s modified Eagle’s medium by Trypan blue exclusion. (DMEM) (Invitrogen, Fisher Scientific, Illkirch, France), 20% KO Serum Replacement (KO SR, Invitrogen), 1 mML-glutamine (Invitrogen), 0.1 mM b-mercaptoethanol (Sigma), 1% non- CFU-F cultures essential amino acids (NEAA), and 4 ng/ml human basic For 14-day routine experiments, cells were plated at 103 cells/ fibroblast growth factor (bFGF) (Preprotech, Paris, France) and cm2 for the CD45À/GlycoAÀ sub-population, and 6 Â 103 cells/ conditioned by hMSCs. cm2 for the other sub-populations, in six-well tissue culture plates (Falcon, Becton Dickinson, Le Pont de Claix, France) in 2 ml of medium. Cultures were also performed in 25 cm2 tissue Cytokines and extracellular matrix culture flasks (Falcon). Under this condition, cell density was 10 Transforming growth factor b1 (TGF-b1) was from R&D (UK), times lower to ensure better counting of colony number versus basic fibroblast growth factor (bFGF) from Peprotech and used at colony cell size. Volumes of culture medium were modified the specified concentrations. IFNa 2 (Roferon-A, Roche, accordingly. Complete medium (CM) was constituted by MEMa Hppmann-La-Roche, Grenzach-Wyhlen, Germany) and human without nucleotides (Invitrogen), supplemented with 10% plasma fibronectin were from Roche Diagnostics (Roche, selected Hyclone serum (Perbio Science, Brebieres, France) Meylan, France). and 2 mM glutamine (Invitrogen). Cells were allowed to adhere for 48 h at 371C and 5% CO2. Wells were then washed twice and the remaining adherent cells were further cultured for 24 h in CM with or without 64G12 at 50 mg/ml. Medium was than Antibodies replaced by CM with bFGF at the final concentration of For cell activation, antibodies were as follows: two anti-type I 0.3 ng/ml. Cells were cultured for 14 days with media renewal IFN receptor (anti-IFNAR1) monoclonal antibodies were raised twice a week (containing 0.3 ng/ml bFGF but no 64G12). Cells against the recombinant extracellular region of human IFNAR1, were then fixed, and stained with Giemsa and colonies were one of the two transmembrane glycoproteins constituting the photographed. Colony size was evaluated by counting cells on Type 1 IFN receptor, as described in previous studies.39,40 The enlarged photographs. Colonies with less than 50 cells were not first antibody, 64G12, inhibits the binding of radiolabelled counted. Small colonies were classified into colonies from 50 to recombinant human IFNa 2, IFNa 8, IFNb and IFNo to their cell 100 and 100–1000 cells. Large colonies were classified into surface receptor, and the biological activity of all type I IFN colonies from 1000 to 3000 and more than 3000 cells. tested. Fab from 64G12 were also prepared. The second anti- IFNAR1, 34F10, binds to the IFN receptor with the same affinity as that of the 64G12 antibody, but does not inhibit either the Differentiation culture protocols binding or the biological activity of any type of IFN tested. Anti- MSCs were treated to test their differentiation potential. For IFNa was prepared by one of us and was sheep IgG anti-human adipogenic differentiation, cells were cultured up to confluency IFNa. Each antibody was used at the specified concentrations. and fed in low-glucose DMEM (Invitrogen) with 20% fetal calf For immuno-phenotypic analysis, antibodies were as follows: serum (FCS), 0.5 mM IBMX (Sigma), 60 mM indomethacin (Sigma) À6 anti-SSEA-3 and -4 were obtained from the DSHB and used at a and 10 M dexamethasone (Sigma) with medium renewal every dilution of 1/5 and 1/20, respectively; anti-OCT-4, anti-TRA1-60 other day for 3 weeks. Usually, the first adipocytes appeared at and anti-TRA1-81 from Santa Cruz and used at the concentra- the end of the first week. Adipocytes were stained by Oil Red O. tion of 1/50. Detection of the unlabelled antibodies was For osteogenic differentiation, after confluency, MSCs were performed with goat anti-rat IgM labelled with Alexa 488 for maintained in low-glucose DMEM, 10% FCS, 2 mM 2 b- À7 anti-SSEA-3 and goat anti-mouse IgG labelled with Alexa 633 glycerophosphate, 0.15 mM ascorbate-2-phosphate and 10 M for anti-SSEA-4. All the Alexa-labelled goat antibodies were dexamethasone. Osteoblasts were revealed by alkaline Phos- from Molecular Probes Europe (Leiden, The Netherlands) and phatase, using the Sigma-Aldrich kit and following the used at the 1/200 dilution (10 mg/ml). Fluorescein isothiocyanate manufacturer’s procedure. (FITC)-labelled CD105 was from Caltag. Isotypic controls were performed with the corresponding irrelevant immunoglobulins. For transduction studies, antibodies against phosphorylated Immuno-phenotypic quantification by laser scanning and non-phosphorylated STAT1 and 2 from BioLabs were used cytometer at the respective dilutions of 1/50 for the phosphorylated and After trypsinization, MSCs at the specified passage were 1/200 for the non-phosphorylated forms. The primary antibody plated on Teflon-covered immunofluorescence slides coated was revealed by an FITC-labelled goat anti-rabbit diluted 1/50. with human fibronectin (1 mg/cm2) at the cell density of

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 716 2500 cells/cm2 and grown for 2–3 additional days. Samples DNA (cDNA) was prepared using Superscript RNAse HÀ reverse were then processed for antigen expression. Cells were fixed for transcriptase (RT) and poly-T primers (both Invitrogen). For RT– 5 min by methanol at À201C, washed twice with phosphate- polymerase chain reaction (PCR), the equivalent of 0.5 mg RNA buffered saline (PBS) and once with PBSFbovine serum was amplified using Taq polymerase (Invitrogen) and the albumin (BSA) 0.5%. The specific antibodies were applied at primers as follows: ST3GAL3: ST3 b-galactoside,a-2,3-sialyl- the above-specified concentrations for 30 min at 41C. After three transferase 3, sense primer: TTGGCCTGCCCTTCAACAAT, washes with PBS–BSA 0.5%, when unlabelled primary anti- antisense primer: GTGGTGCCTGGGCCTCTATG GenBank bodies were used, incubation with the relevant labelled accession: BC050380; POU5F1: transcription factor 1 (OCT- secondary antibody was performed for 30 min at 41C. For 4), sense primer: CTCCTGGAGGGCCAGGAATC, antisense nuclear staining, 7-amino actinomycin D (7-AAD) (Sigma) at the primer: CCACATCGGCCTGTTATAT (GenBank accession no: concentration of 5 mg/ml in PBS was applied to slides for 5 min. Z11898); GAPDH: glyceraldehyde-3-phosphate dehydrogen- After three washes with PBS, preparations were mounted in 75% ase, sense primer: GAAGGTGAAGGTCGGAGTC, antisense glycerol in PBS. Appropriate negative controls were used to primer: GAAGATGGTGATGGGATTTC (GenBank accession determine background signal. Analysis was performed using a no: NM_002046.) Products were amplified for 35 cycles of laser scanning cytometer (LSC) (CompuCyte Corp, Cambridge, 941C (30 s), 601C (45 s) and 721C (30 s) using a PTC100 MA, USA), which provided the percentage of positive cells as thermocycler (Bio-Rad Lab, Marnes La Coquette, France), and well as the median value of fluorescence (arbitrary units, a.u.). products were visualized on a 1.5% agarose gel with ethidium Acquisitions and data analyses were performed using Wincyte bromide. software (CompuCyte Corp).

Real-time quantitative PCR using TaqMan low-density Detection of apoptosis arrays A total of 64G12 activated and control MSCs were harvested MSCs at passage 3 and 5, and HESCs were harvested using after 14 days of culture and treated with the Annexin V-FITC Kit Qiagen reagent following the manufacturer’s protocol. Total (Beckman-Coulter, France) following the manufacturer’s in- RNA was prepared according to standard protocols and 5 mgof structions. The percentage of apoptotic cells was determined by RNA was treated by Dnase (Ambion, Applied Biosystems, flow cytometry analysis using a FACS Vantage (Becton Dick- Courtaboeuf, France) to avoid genomic DNA contamination in inson). subsequent RT–PCR. RNAs were reverse- transcribed using the high capacity cDNA Archive kit (ABI Prism, Applied Biosystems, Courtaboeuf, France). Each TaqMan Low Density Array was Cell lysis and immunoblotting of phosphorylated designed for quantification of human genes. The assays were STATs proteins chosen among the TaqMan Gene Expression Assay library to be MSCs were cultured in four flasks at 300 cells/cm2 in CM representative of hESC self-renewal (NANOG: Hs02387400_g1, medium containing 10% FCS. When cells reached half SALL4: Hs00360675_m1, LIN28: Hs00702808_s1, TERT: Hs00162 confluency, flasks were washed with PBS and left overnight in 669_m1, POU5F1: Hs00742896_s1, ZFP42: Hs00399279_m1, CM medium containing 2% FCS, then in FCS-depleted medium UTF1: Hs00747497_g1, TDGF1: Hs02339499_g1). Gene for 2 h. Four different conditions were tested: (1) 30 min in FCS- expression was normalized to endogenous housekeeping gene depleted medium alone; (2) 15 min with 2000 U IFNa; (3) 18S rRNA and hES2 as sample calibrator. An equal amount of 30 min with 64G12 followed by 15 min with 2000 U IFNa; and input cDNA (600 ng) was used per reaction and all PCR were (4) 30 min with 64G12. Cells were then washed, trypsinized and performed in duplicate. Results were analyzed using ABI PRISM counted. They were then centrifuged and resuspended in a small 7900HT Sequence Detection System (ABI), and changes in gene volume. The cell pellet (around 106 cells) was washed with PBS expression levels were calculated using the 2ÀDDCT method. and lysed in 1% Triton X-100 (20 ml), 50 mM Tris, pH 8, 150 mM sodium chloride, 10% glycerol, 1 mM sodium orthovanadate, 10 mM sodium fluoride, 1 mM magnesium chloride, 1 mM 4-(2- Statistical analysis aminoethyl) benzenesulfonyl fluoride hydrochloride , aprotinin, The Student’s t-test was used to determine the statistical leupeptin and pepstatin (5 mg/ml each). After 20 min shaking at significance of differences between means of several (n) 41C and a 10 min centrifugation at 14000 r.p.m., the supernatant experiments. was collected. Twenty microlitres of 2 Â sodium dodecyl sulfate (SDS) buffer were added to the supernatant, heated for 10 min at 901C and 30 mg of proteins was fractionated by 7.5% Results SDS–polyacrylamide gel electrophoresis (PAGE) under reducing conditions, transferred to polyvinylidene difluoride filters Effect of 64G12 anti-IFNAR1 blocking antibody on (PVDF; Boehringer Mannheim) and probed with the appropriate Stro1 þ /GlycoA- longÀterm culture primary specific antibodies for 1 h at 201C, followed by the Figure 1a compares amplification curves of MSCs with 0.3 ng/ml addition for 45 min of secondary antibody horseradish perox- bFGF, with or without 50 mg/ml 64G12 antibody added for 24 h idase (HRP-conjugated goat anti-mouse or anti-rabbit (Jackson only at the onset of the long-term cultures. 64G12 neutralizes ImmunoResearch Baltimore, USA), 1/60000). PVDF blots were the activity of all human type I IFNs39 by blocking IFNAR1, one developed using the SuperSignal WestPico kit (Pierce, Rockford, of the two polypeptide chains of the human type I IFN receptor. USA). We can observe that the short activation of primitive MSCs by a 24 h pre-treatment by anti-IFN is sufficient to trigger immedi- ately an exponential growth, contrasting with the 25 days of Semi-quantitative RT–PCR slower growth observed at the beginning of the untreated Total DNA-free RNA was prepared from Trizol lysed cells as control culture. Moreover, the 64G12-treated cells expanded described by the manufacturer (Invitrogen). Complementary up to a 109 cell output (30 doublings) within 2 months, whereas

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 717

Figure 1 (a) Comparative ampliﬁcation curve of the Stro1 þ /GlycoAÀ mesenchymal sub-population with 0.3 ng/ml bFGF without (open circles) or with (black circles) 50 mg/ml anti-IFNAR1 blocking antibody (64G12) added for 24 h at the onset of culture. This corresponds to one typical experiment out of three. Cell output is the cell number at day x/cells plated at day 0, assuming that all the cells were replated at each passage. (b) Adipogenic and (c) Osteogenic differentiation of 64G12-activated MSC progeny after 10 passages. MSCs were maintained in the respective differentiating media for 3 weeks and stained respectively by Oil Red O for adipocytes and by the alkaline phosphatase technique for osteoblasts.

control cells expanded only up to a 107 cell output (24 with less than 3000 cells and very large colonies with more than doublings). 3000 cells (Figure 2B-c). The larger colonies could reach a Activated cells from passage 10 retained their potentialities to doubling time around 24 h. The total colony number in the differentiate towards adipocytic (Figure 1b) and osteogenic activated culture was increased, an observation, which favors (Figure 1c) lineages, when cultivated in the appropriate media.37 the hypothesis that large colonies are not derived from pre- existing small colonies, but rather from quiescent high proliferative potential, HPP-Q cells, activated by the anti- Sequential effect of anti-IFN and low concentration IFNAR1 antibody 64G12. of bFGF on CFU-F The antibody 64G12 is necessary but not sufficient to amplify In Figure 2a, a histogram of colony frequency versus colony cell quiescent high proliferative potential HPP-Q MSCs as detailed size indicates clearly that in short term cultures with 0.3 ng/ml in Figure 2c. Under conditions without additive, with antibodies bFGF, a 24 h pre-treatment with 50 mg/ml 64G12 antibody, at but without bFGF or with bFGF alone at 0.3 ng/ml, no large the onset of the culture, was necessary to trigger the appearance colonies appeared. Very large colonies with more than of very large colonies with more than 3000 cells. Colonies with 3000 cells appeared only when bFGF was added after a less than 50 cells were not considered. Figure 2B-a views an 64G12 or anti-IFNa pre-treatment. A similar large colony example of a very small colony with around 100 cells; Figure number was obtained with Fab 64G12 and bFGF, excluding a 2B-b views a colony with less than 1000 cells, still considered as non-specific effect of 64G12 Fc fragments. 34F10 antibody a small colony. Very small and small colonies are composed of recognizes IFNAR1 but does not neutralize the transduction large cells with a low nucleocytoplasmic (N/C) ratio. Colonies pathway. When the 34F10 antibody alone was added, results with more than 1000 cells were considered as large colonies in were similar to those obtained with 64G12 added alone. In routine experiments. Large colonies had small cells with a N/C contrast, bFGF with 34F10 was ineffective on large and very ratio five times greater than cells from small colonies and they large colony formation. When a large, non-physiological grew faster as suggested by the two first passages shown in concentration of 50 ng/ml bFGF was added, large colonies Figure 1a. In more precise experiments with cells plated at lower with 1000–3000 cells was observed much later than large cell density, colonies were further classified into large colonies colonies in 64G12-activated cultures: the population doubling

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 718 A Control culture B a c 64G12 activated culture 100

60 b * * ** 40

Colony frequency (%) Colony * 20

small colonies a large colony 0 50-100 100-1000 1000-3000>3000 total >50 and < 1000 cells > 3000 cells

C 40 40 35 35 none 0.3 ng bFGF 50 ng bFGF 30 30

25 25 33.3% 38.9% * 83.3% 20 20

15 15

10 10

5 5

0 0

35 35 50µg 34F10 0.3 ng bFGF+34F10 0.3 ng bFGF+anti IF Nα 30 30

25 25 38.9% 33.3% 83.3% 20 20

15 15

10 10

5 5 Colony frequency (%) Colony 0 0 50µg 64G12 0.3 ng bFGF+64G12 0.3 ng bFGF+Fab64G12 35 35

30 30 61.1%100% 94.4% 25 25

20 20

15 15

10 10

5 5

0 0

50-100 100-1000 1000-3000 >3000

Cell number/colony

Figure 2 (A) Histogram of colony frequency versus colony cell size. Colonies were obtained with 0.3 ng/ml bFGF without (white columns) or with (black columns) 50 mg/ml 64G12 antibody added for 24 h at the onset of culture. Cells were plated in triplicate. Colonies were examined after 14 days of culture and after Giemsa staining. Results are expressed using as 100% the colony number obtained with the 64G12-activated MSCs þ 0.3 ng bFGF. Mean7s.d. of six independent experiments (conﬁdence interval: *P ¼ 0.2; **Pp0.01). (B) Typical examples of small and large colonies. Colonies with less than 50 cells were not considered. (a) One very small colony with 50–100 cells; (b) one small colony with 100–1000 cells; (c) one very large colony with 4 3000 cells after 64G12 activation. Small colonies (a) and (b) grow more slowly and their cells have a ﬁve times smaller nuclear/cytoplasmic ratio than large colony cells. (C) Histogram of colony frequency versus colony cell size under different culture conditions with or without anti-IFN and/or bFGF. 100% is obtained with 50 mg/ml 64G12 þ 0.3 ng bFGF. Very large colonies, with more than 3000 cells, were obtained only if 0.3 ng of bFGF was added after a short pre-treatment of anti-IFN (anti-IFNa or 64G12). With large non- physiological concentrations of bFGF alone (50 ng/ml), no colonies with more than 3000 cells were observed and colonies with 1000–3000 appeared much more slowly (*) than large and very large colonies obtained with 64G12 or anti-IFN and 0.3 ng/ml bFGF.

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 719

Figure 3 (A) Immunoblot of P-STAT1 and P-STAT2 from MSCs treated with or without IFNa and 64G12. The blots were reprobed with anti-STAT1 and anti-STAT2 antibodies indicating that equal amounts of protein were loaded on the gel. 64G12 prevents phosphorylation of STAT1 and STAT2 by IFNa2. (B) Imunoﬂuorescence of STAT1 in MSCs treated by IFNa;(a) Control MSCs with IFNa showing STAT1 translocation in the nucleus; (b) 64G12 prevents STAT1 translocation in the nucleus. Inserts correspond to the respective isotypic controls.

time was over 72 h and no colony with more than 3000 cells MSCs as well as those preincubated with 64G12 alone or was detected. 64G12 with IFNa, phosphorylation of STAT1 and 2 was not IFN has been also described as an inducer of apoptosis.41 observed. The same blots showing the P-STATs were disrupted Consequently, we tested whether the appearance of large and reblotted with anti-STAT1 or anti-STAT2 (A, lower panel) to colonies could be due to 64G12 neutralizing the apoptotic confirm that equal amounts of protein were loaded. effect of IFN. Cells after contact with 64G12 were analyzed by Figure 3b shows that, in the presence of IFNa, 64G12 blocked Annexin-V staining and flow cytometry. There was no difference the translocation of STAT1 from the cytoplasm to the nucleus in the number of apoptotic cells in the activated versus the (3B-b), whereas in cells without added 64G12, STAT1 was control culture: 2.0670.8% for activated MSCs versus translocated into the nucleus in response to IFNa (3B-a). 2.3670.9% for control (n ¼ 3). Therefore, as 64G12, or anti- Therefore, by blocking the phosphorylation of STAT1, which INFa, activate the quiescent cells even if added for a very short constitutes the first step of transduction activation, 64G12 time before bFGF addition, the large colonies did not result from prevented STAT1 translocation. an increase in size in response to a continuous stimulation of cell proliferation by 64G12, or from a protective effect of 64G12 against apoptosis. Expression of human embryonic markers by the progeny of control and 64G12-activated Stro1 þ /GlycoA- mesenchymal cells 64G12 antibody activates MSCs by STAT As OCT-4 has been previously described as slightly expressed in phosphorylation inhibition primitive MSCs,44 we searched for the expression of genes The effect of 64G12 on MSCs was studied at the molecular representative of human embryonic stem cells (hESC) in MSC level. As IFN transduction is mediated by the STAT path- subpopulations activated or not by 64G12. way,42,43 expression of STAT1 and STAT2 (constitutively Comparative transcriptomic studies of control and activated expressed) and their phosphorylated counterparts was evaluated MSC progeny from three different bone marrow cultures by by immunoblotting and immunofluorescence on MSCs with and quantitative real-time PCR are shown in Figure 4a. All the without 64G12. Immunoblotting results are shown in Figure 3a. genes studied, such as TERT, POU5F1 (OCT-4), ZFP42 (REX1), Phosphorylated STAT1 and STAT2 were both detectable in TDGF1 (CRIPTO), SALL4, LIN28, UTF1 and NANOG, were MSCs after contact with IFNa for 30 min. In contrast, in control completely extinguished as compared to their expression in

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 720

Figure 4 (a) Comparative transcriptomic studies of control and activated MSC progeny from three different bone marrow cultures by quantitative real-time PCR. The graph represents relative gene expression analysis using TaqMan Low Density Array. The chosen probes are representative of hESC self-renewal genes. Values were calculated by the 2ÀDDCT method with 18S rRNA as internal calibrator, hES2 as sample calibrator, and an arbitrary threshold chosen at 30 cycles. Arrows indicate a complete extinction of the gene. (b) Comparative semi-quantitative RT–PCR between hESCs, control and 64G12-activated MSCs. Genes compared were ST3GAL3 (a-2,3sialyltransferase, a SSEA4 synthase), POU5F1 (OCT-4) and GAPDH.

hESC, chosen as a sample calibrator with a value of 1. By semi- Effects of 64G12 on different MSC subpopulations quantitative RT-PCR also, POU5F1 was not significantly The above results were obtained on the Stro1 þ /GlycoA- expressed. However, we observed that ST3GAL3, the gene subpopulation. Since the precise phenotype of CFU-F is unclear encoding for a-2,3-sialyltransferase, an SSEA-4 synthase, was at present, three other mesenchymal subpopulations, Stro1 þ , well expressed both in control and activated MSC cultures CD105 þ and CD45/GlycoA-, were isolated and treated with (Figure 4b). Consequently, we looked for the expression of 64G12. Results are shown on Table 1. A significant increase in SSEA-3 and -4 antigens in control and activated MSC cultures. the number of large colonies after treatment with 64G12 was Indeed, these two antigens, together with 0CT-4, TRA1-60 and also obtained with these subpopulations. This implies that all TRA1-81, are classical markers of human embryonic stem these subpopulations contained quiescent primitive cells under cells (hESC). the control of IFNa. However, it is interesting to note that the SSEA-3 immunofluorescence of control and activated cultures CD45-/GlycoA- subpopulation required a plating density six after 14 days are shown in Figure 5a and b by LSC quantification times lower than the others to provide a similar number of large of positive cells and mean fluorescence in arbitrary unit (a.u.). colonies. SSEA-3 expression was significantly increased on 64G12-treated cell progeny: 48% of activated cells were positive, with a mean fluorescence of 5.4 Â 106 a.u., versus 14% positive cells in the Discussion control culture with a mean fluorescence of 1.8 Â 106 a.u. When colonies were individually analyzed, SSEA-3 and -4 were In this study, we have demonstrated that a quiescent primitive always more expressed on large colonies from activated MSCs sub-population of human MSCs is under the reversible growth- than on controls (data not shown). inhibitory control of the IFNa/b. When an MSC-enriched After seven passages, 73% of stimulated MSCs were positive subpopulation of cells from bone marrow were cultured in the for SSEA-3 with a mean fluorescence of 7.0 Â 106 a.u (Figure 5d) presence of a neutralizing antibody (64G12) directed against when the control culture increased to 30% of positive cells with IFNAR1 (one of the two polypeptide chains constituting the a mean fluorescence of 3.7 Â 106 a.u. (Figure 5c). SSEA-4 was receptor for IFNa, b and o39,40), a significant number of also higher on stimulated cells, with 86% of positive cells with a additional very large colonies appeared that were very seldom mean fluorescence of 1.7 Â 106 a.u. (Figure 5f), versus 43.7% or not observed in control cultures. Similar results were obtained positive cells with a mean fluorescence of 0.8x106 a.u. for the with blocking antibody directed against IFNa. A 24 h pre- control culture (Figure 5e). treatment with anti-IFN of primary cells isolated from the OCT-4, TRA 1-60 and TRA 1-81 studied by immunofluore- bone marrow, before initiation of in vitro culture, was sufficient scence were not detected (data not shown). to activate the highly proliferative progenitors. In long-term

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 721 ab

232 32

185 25 SSEA-3 (P1) 139 PC: 14% 19 PC: 48% × 6 × 6 Count MF: 5.410 a. u.

MF: 1.8 10 a. u. Count 92 12

46 6

0 0 0 51015 20 (3.0×10-6) 0 5 10 15 20 (3.0×10-6)

c d 149 60

119 48 89 PC: 30.0% 36 PC: 73.0% MF: 3.7×106 a. u. 59 × 6 Events 24 MF: 7.0 10 a. u. Events 29 12 SSEA-3 (P7) 0 0 0 10 20 30 40 (3.0×10-6) 0 10203040(3.0×10-6)

e f 199 82

159 65 PC: 86.0% 119 PC: 43.7% 49 MF: 1.7×106 a. u. MF: 0.8×106 a. u.

Events 79

Events 32

-39 16 SSEA-4 (P7) 0 0 0.0 2.5 5.0 7.5 10.0(3.0×10-6) 0.0 2.5 5.0 7.5 10.0 (3.0×10-6)

Control culture Stimulation with 64G12

Figure 5 Expression of the human embryonic markers SSEA-3 and SSEA-4 by the progeny of control and 64G12-activated Stro1 þ /GlycoA- MSCs. (a–b) Short-term culture (P1). Immunostaining of control and activated cells and quantification of SSEA-3 antigen by laser scanning cytometer (LSC). Isotypic control in the upper right insert. PC; positive cells; MF; mean fluorescence in arbitrary unit (a.u.); C-F; long-term culture after seven passages. (c–d) Quantification of SSEA-3 by LSC; e–f; quantification of SSEA4 by LSC.

Table 1 Comparison of the large colonies obtained with four follow-up culture, pre-treated cells were able to generate over 2 different subpopulations of MSCs activated or not by 64G12 antibody months an output of cells at least a 100 times greater (109 cell range) than in control culture conditions. Moreover, it appeared Subpopulations 64G12 Number of P-value that the pre-treated cells were able to enter into an exponential large colonies proliferative expansion without the lag phase typically observed Stro 1+/Glyco AÀa(n ¼ 6) À 1(71) p0.01 in control cultures. This further supports the presence of sub- +7(73) populations of quiescent or slowly cycling progenitor cells that a Stro+ (n ¼ 4) À 1(71) p0.01 can be activated. Importantly, progenies of quiescent cells 7 +6(3) generated after blocking IFN maintained their potential to CD 105+a (n ¼ 3) À 3(72) p0.03 +7(73) differentiate towards adipocytes and osteoblasts, even when CD45-/Glyco AÀb (n ¼ 3) À 3(71) p0.03 expanded up to the 10th passage. +9(75) It was striking that extremely low concentrations of IFNa in the range of 0.4–4 IU/ml, which corresponds to 4–40 pg/ml, was Abbreviation: MSC, mesenchymal stem cell. Colony assay was performed as summarized in legend of Figure 2a. sufﬁcient to inhibit 70–80% of the large colony formation (data aNumber of colonies for 6.103 plated cells/cm2. not shown). This is very similar to our previous studies of TGF-b bNumber of colonies for 103 plated cells/cm2. in early hematopoietic progenitor cells. Primitive HPP-Q cells

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 722 were sensitive to growth inhibition by a TGF-b concentration as The frequency of the highly proliferative mesenchymal low as 10 pg/ml.45 For TGF-b, this corresponds to the progenitor cells in bone marrow appears to be very low. Reyes physiological concentration present in plasma (10–300 pg/ml). et al.23 indicated that 0.02–0.08% of CD45À/GlycoAÀ cells Although IFN is not usually detectable in normal plasma, human resulted in clusters of mesodermal progenitor cells (MSCs). This peripheral blood mononuclear cells have been shown to express percentage is similar to the number of MSCs producing large low levels of IFN mRNA,46 suggesting that a paracrine or an colonies we observed after 64G12 activation of the CD45À/ autocrine secretion of IFNa may also participate in this GlycoAÀ subpopulation (0.07%). Moreover, this selected homeostatic regulation. subpopulation allows for at least a sixfold greater enrichment Human stem and progenitor cell control by the TGF-b compared with Stro1 þ , Stro1 þ /GlycoAÀ and CD105 þ superfamily has been extensively studied in vitro with various subpopulations. Comparison of long-term growth curve of cell types such as hHSCs,25–28 keratinocytes,29 and more SSEA-4 þ MSCs according to Gang et al. does not indicate recently, human adult embryonic stem cells (hESCs).47–53 Our any improvement over our long-term culture method, even preliminary study of the effect of TGF-b on MSCs (data not though they use richer growth conditions. Comparison of shown) also indicates that blocking TGF-b can activate a sub- various MSC selection methods with the selection of SSEA-4 þ population of highly proliferative progenitor cells. Interestingly, MSCs has still to be performed to determine which method however, the simultaneous addition of neutralizing antibodies provides the best recovery of HPP-Q MSCs with the largest for TGF-b and IFN had no additive effect, suggesting that both expansion in short-term culture and the best maintenance in treatments activated similar cell subpopulations. Such a long-term culture. possibility was also suggested by the study of Giron-Michel One important application of human primitive MSCs is their et al.54 Using 64G12 in vitro to activate a sub-population of use for tissue repair. Clinically, MSCs have been used with human primitive hematopoietic progenitors, they suggested that promising results in various disorders that depend on their low concentrations of endogenous IFN could have an effect capacity for differentiating into mesenchymal cells such as similar to endogenous TGF-b to activate HPP-Q HSCs.33 cartilage and bone. These cells have proved their efficiency in Altogether, these observations on hHSCs and hMSCs suggest treatment of Osteogenesis Imperfecta,16,17 metachromatic leu- that IFN and TGF-b might be targeting the same pathway kodystrophy and Hurler syndrome.18 responsible for maintaining certain subpopulations of progenitor Another important application of MSCs is derived from their cells in quiescence. apparent immuno-suppressive effect. Co-transplant of MSCs It has been shown that type I IFNs inhibit cell proliferation by enhanced bone marrow engraftment and minimized periods of inducing G1 cell cycle arrest. Thus, inhibition of the action of aplasia. Autologous MSC transplantation improved the rate of endogenously produced type I IFNs by blocking antibody or platelet reconstitution of patients, when compared with the antibody against the receptor could release cells from G1 cell control group, suggesting a faster engraftment.19 In allogenic cycle arrest and thereby promote response to mitogens such as transplantation, infusion of MSCs resulted in a strikingly low bFGF. This may explain why a short exposure of MSCs to 64G12 incidence of graft-versus-host disease.14,20 (Lazarus et al., of no more than 24 h, before culture with bFGF at very low Blood, 2000, 96: 392a, abstract) Interestingly, the 64G12 concentrations, is sufficient to activate sustained proliferation of antibody, administered together with a sub-effective dose of the quiescent highly proliferative progenitor cells. 64G12 may cyclosporine, has been shown to induce prolonged survival of be acting as a ‘competence growth factor’, with bFGF acting as a skin allografts in major histocompatibility complex divergent ‘progression growth factor’ in a model system as suggested by cynomolgus monkeys.15 Pledger et al.55 and Stiles et al.56 We have similarly demon- In view of their tissue differentiation and immunoregulatory strated that the addition of anti-TGF-b antibody to hematopoie- potential, MSCs represent important cells in regenerative tic progenitor cells induced the quiescent cells first to express medicine. One of the major limitations has been the slow cytokine receptors,31,34 then to respond very efficiently to growth of MSCs and their senescence upon passaging and various cytokines such as SF, IL6, FL and TPO added at low expansion. The stress of prolonged expansion also increased the concentrations. possibility of selection of spontaneously transformed clones A somewhat surprising finding was the expression in MSCs of during expansion.59 The use of 64G12, which rapidly recruits a the stage-specific embryonic antigens 3 and 4 (SSEA-3, SSEA-4), higher number of highly proliferative progenitor cells as shown which are commonly used with other markers such as OCT-4, in this study, is to the best of our knowledge, the fastest reported TRA1-60 and TRA1-81 to characterize the non-differentiated technique for safely augmenting MSC expansion for clinical state of hESCs. This was in agreement with our finding of applications. ST3GAL3 gene expression in MSCs at a similar level as in human embryonic stem cells. Even more interesting was the increased expression of SSEA-3 and -4 in cultures from 64G12- Acknowledgements treated cells. This is in agreement with a recent study examining SSEA-4 in MSCs from human bone marrow.57 Very surprisingly, This work was supported by the European Integrated Project these authors showed that with increased passages of MSCS, (PCRD6) ‘GENOSTEM’: ‘Adult mesenchymal stem cells engineer- there was a significant increase in SSEA-4-positive cells up to as ing for connective tissue disorders. From the bench to the bed high as 80%, despite the fact that continuing passages of MSCS side’. Contract no: 503161. RB, MLL and IP were appointed by the led to senescence of these cells. Using quantitative PCR, we Genostem Project. We are indebted to Dr Mary Osborne-Pellegrin could not demonstrate any significant expression of typical for editing the paper. markers of hESCs (TERT, POU5F1, ZFP42, TDGF1, SALL4, LIN28, UTF1 or NANOG) in control or 64G12-treated cells. References Therefore, the SSEA-3 and -4 antigens may not necessarily be associated always with the embryonic state. This is supported by 1 Friedenstein AJ, Chailakhjan RK, Lalykina KS. The development of the conclusion from a recent study demonstrating that SSEA-3 fibroblast colonies in monolayer cultures of guinea-pig bone and SSEA-4 are not essential for hESC pluripotency.58 marrow and spleen cells. Cell Tissue Kinet 1970; 3: 393–403.

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 723 2 Dennis JE, Charbord P. Origin and differentiation of human and 24 Schwartz RE, Reyes M, Koodie L, Jiang Y, Blackstad M, Lund T murine stroma. Stem Cells 2002; 20: 205–214. et al. Multipotent adult progenitor cells from bone marrow 3 Deschaseaux F, Charbord P. Human marrow stromal precursors differentiate into functional hepatocyte-like cells. J Clin Invest are alpha 1 integrin subunit-positive. J Cell Physiol 2000; 184: 2002; 109: 1291–1302. 319–325. 25 Hatzfeld J, Li ML, Brown EL, Sookdeo H, Levesque JP, O’Toole T 4 Majumdar MK, Banks V, Peluso DP, Morris EA. Isolation, et al. Release of early human hematopoietic progenitors from characterization, and chondrogenic potential of human bone quiescence by antisense transforming growth factor beta 1 or Rb marrow-derived multipotential stromal cells. J Cell Physiol 2000; oligonucleotides. J Exp Med 1991; 174: 925–929. 185: 98–106. 26 Larsson J, Karlsson S. The role of Smad signaling in hematopoiesis. 5 Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca Oncogene 2005; 24: 5676–5692. JD et al. Multilineage potential of adult human mesenchymal stem 27 Ruscetti FW, Akel S, Bartelmez SH. Autocrine transforming growth cells. Science 1999; 284: 143–147. factor-beta regulation of hematopoiesis: many outcomes that 6 Simmons PJ, Torok-Storb B. Identification of stromal cell precursors depend on the context. Oncogene 2005; 24: 5751–5763. in human bone marrow by a novel monoclonal antibody, STRO-1. 28 Scandura JM, Boccuni P, Massague J, Nimer SD. Transforming Blood 1991; 78: 55–62. growth factor beta-induced cell cycle arrest of human hemato- 7 Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow poietic cells requires p57KIP2 up-regulation. Proc Natl Acad Sci stromal stem cells: nature, biology, and potential applications. USA 2004; 101: 15231–15236. Stem Cells 2001; 19: 180–192. 29 Fortunel NO, Hatzfeld JA, Rosemary PA, Ferraris C, Monier MN, 8 Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ et al. Haydont V et al. Long-term expansion of human functional Multilineage cells from human adipose tissue: implications for epidermal precursor cells: promotion of extensive amplification by cell-based therapies. Tissue Eng 2001; 7: 211–228. low TGF-beta1 concentrations. J Cell Sci 2003; 116: 4043–4052. 9 In ‘t Anker PS, Scherjon SA, Kleijburg-van der Keur C, de Groot- 30 Cardoso AA, Li ML, Batard P, Hatzfeld A, Brown EL, Levesque JP Swings GM, Claas FH, Fibbe WE et al. Isolation of mesenchymal et al. Release from quiescence of CD34+ CD38- human umbilical stem cells of fetal or maternal origin from human placenta. Stem cord blood cells reveals their potentiality to engraft adults. Proc Cells 2004; 22: 1338–1345. Natl Acad Sci USA 1993; 90: 8707–8711. 10 De Bari C, Dell’Accio F, Tylzanowski P, Luyten FP. Multipotent 31 Sansilvestri P, Cardoso AA, Batard P, Panterne B, Hatzfeld A, Lim B mesenchymal stem cells from adult human synovial membrane. et al. Early CD34high cells can be separated into KIThigh cells in Arthritis Rheum 2001; 44: 1928–1942. which transforming growth factor-beta (TGF-beta) downmodulates 11 Erices A, Conget P, Minguell JJ. Mesenchymal progenitor cells in c-kit and KITlow cells in which anti-TGF-beta upmodulates c-kit. human umbilical cord blood. Br J Haematol 2000; 109: 235–242. Blood 1995; 86: 1729–1735. 12 Prockop DJ, Gregory CA, Spees JL. One strategy for cell and gene 32 Ducos K, Panterne B, Fortunel N, Hatzfeld A, Monier MN, therapy: harnessing the power of adult stem cells to repair tissues. Hatzfeld J. p21(cip1) mRNA is controlled by endogenous Proc Natl Acad Sci USA 2003; 100 (Suppl 1): 11917–11923. transforming growth factor-beta1 in quiescent human hemato- 13 Gregory CA, Prockop DJ, Spees JL. Non-hematopoietic bone poietic stem/progenitor cells. J Cell Physiol 2000; 184: 80–85. marrow stem cells: molecular control of expansion and differ- 33 Fortunel NO, Hatzfeld A, Hatzfeld JA. Transforming growth factor- entiation. Exp Cell Res 2005; 306: 330–335. beta: pleiotropic role in the regulation of hematopoiesis. Blood 14 Angoulvant D, Clerc A, Benchalal S, Galambrun C, Farre A, 2000; 96: 2022–2036. Bertrand Y et al. Human mesenchymal stem cells suppress 34 Fortunel N, Batard P, Hatzfeld A, Monier MN, Panterne B, induction of cytotoxic response to alloantigens. Biorheology Lebkowski J et al. High proliferative potential-quiescent cells: a 2004; 41: 469–476. working model to study primitive quiescent hematopoietic cells. J 15 Benizri E, Gugenheim J, Lasfar A, Eid P, Blanchard B, Lallemand C Cell Sci 1998; 111: 1867–1875. et al. Prolonged allograft survival in cynomolgus monkeys treated 35 Fortunel N, Hatzfeld J, Kisselev S, Monier MN, Ducos K, Cardoso with a monoclonal antibody to the human type I interferon A et al. Release from quiescence of primitive human hematopoie- receptor and low doses of cyclosporine. J Interferon Cytokine Res tic stem/progenitor cells by blocking their cell-surface TGF-beta 1998; 18: 273–284. type II receptor in a short-term in vitro assay. Stem Cells 2000; 18: 16 Horwitz EM, Gordon PL, Koo WK, Marx JC, Neel MD, McNall RY 102–111. et al. Isolated allogeneic bone marrow-derived mesenchymal cells 36 Gronthos S, Simmons PJ. The growth factor requirements of STRO- engraft and stimulate growth in children with osteogenesis 1-positive human bone marrow stromal precursors under serum- imperfecta: implications for cell therapy of bone. Proc Natl Acad deprived conditions in vitro. Blood 1995; 85: 929–940. Sci USA 2002; 99: 8932–8937. 37 Lee BS, Stewart EA, Sahakian M, Nowak RA. Interferon-alpha is a 17 Horwitz EM, Prockop DJ, Fitzpatrick LA, Koo WW, Gordon PL, potent inhibitor of basic fibroblast growth factor-stimulated cell Neel M et al. Transplantability and therapeutic effects of bone proliferation in human uterine cells. Am J Reprod Immunol 1998; marrow-derived mesenchymal cells in children with osteogenesis 40: 19–25. imperfecta. Nat Med 1999; 5: 309–313. 38 Oreffo RO, Romberg S, Virdi AS, Joyner CJ, Berven S, Triffitt JT. 18 Koc ON, Day J, Nieder M, Gerson SL, Lazarus HM, Krivit W. Effects of interferon alpha on human osteoprogenitor cell growth Allogeneic mesenchymal stem cell infusion for treatment of and differentiation in vitro. J Cell Biochem 1999; 74: 372–385. metachromatic leukodystrophy (MLD) and Hurler syndrome 39 Benoit P, Maguire D, Plavec I, Kocher H, Tovey M, Meyer F. A (MPS-IH). Bone Marrow Transplant 2002; 30: 215–222. monoclonal antibody to recombinant human IFN-alpha receptor 19 Koc ON, Gerson SL, Cooper BW, Dyhouse SM, Haynesworth SE, inhibits biologic activity of several species of human IFN-alpha, Caplan AI et al. Rapid hematopoietic recovery after coinfusion of IFN-beta, and IFN-omega. Detection of heterogeneity of the autologous-blood stem cells and culture-expanded marrow me- cellular type I IFN receptor. J Immunol 1993; 150: 707–716. senchymal stem cells in advanced breast cancer patients receiving 40 Eid P, Tovey MG. Characterization of a domain of a human type I high-dose chemotherapy. J Clin Oncol 2000; 18: 307–316. interferon receptor protein involved in ligand binding. J Interferon 20 Le Blanc K, Rasmusson I, Sundberg B, Gotherstrom C, Hassan M, Cytokine Res 1995; 15: 205–211. Uzunel M et al. Treatment of severe acute graft-versus-host disease 41 eaman DW, Chawla-Sarkar M, Jacobs B, Vyas K, Sun Y, Ozdemir with third party haploidentical mesenchymal stem cells. Lancet A et al. Novel growth and death related interferon-stimulated 2004; 363: 1439–1441. genes (ISGs) in melanoma: greater potency of IFN-beta compared 21 Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, with IFN-alpha2. J Interferon Cytokine Res 2003; 23: 745–756. Ortiz-Gonzalez XR et al. Pluripotency of mesenchymal stem cells 42 Darnell Jr JE, Kerr IM, Stark GR. Jak-STAT pathways and derived from adult marrow. Nature 2002; 418: 41–49. transcriptional activation in response to IFNs and other extra- 22 Prockop DJ. Marrow stromal cells as stem cells for nonhemato- cellular signaling proteins. Science 1994; 264: 1415–1421. poietic tissues. Science 1997; 276: 71–74. 43 Yan H, Krishnan K, Greenlund AC, Gupta S, Lim JT, Schreiber RD 23 Reyes M, Lund T, Lenvik T, Aguiar D, Koodie L, Verfaillie CM. et al. Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) Purification and ex vivo expansion of postnatal human marrow acts as a docking site for the latent form of the 113 kDa STAT2 mesodermal progenitor cells. Blood 2001; 98: 2615–2625. protein. EMBO J 1996; 15: 1064–1074.

Leukemia Interferon controls human stem cell proliferation A Hatzfeld et al 724 44 Pochampally RR, Smith JR, Ylostalo J, Prockop DJ. Serum derived from human embryonic stem cells. Proc Natl Acad Sci deprivation of human marrow stromal cells (hMSCs) selects USA 2000; 97: 11307–11312. for a subpopulation of early progenitor cells with enhanced 52 Vallier L, Alexander M, Pedersen RA. Activin/Nodal and FGF expression of OCT-4 and other embryonic genes. Blood 2004; pathways cooperate to maintain pluripotency of human embryonic 103: 1647–1652. stem cells. J Cell Sci 2005; 118: 4495–4509. 45 Fortunel N, Hatzfeld J, Aoustin L, Batard P, Ducos K, Monier MN 53 Xu RH, Peck RM, Li DS, Feng X, Ludwig T, Thomson JA. Basic FGF et al. Specific dose-response effects of TGF-beta1 on developmen- and suppression of BMP signaling sustain undifferentiated pro- tally distinct hematopoietic stem/progenitor cells from human liferation of human ES cells. Nat Methods 2005; 2: 185–190. umbilical cord blood. Hematol J 2000; 1: 126–135. 54 Giron-Michel J, Weill D, Bailly G, Legras S, Nardeux PC, 46 Tovey MG, Streuli M, Gresser I, Gugenheim J, Blanchard B, Azzarone B et al. Direct signal transduction via functional Guymarho J et al. Interferon messenger RNA is produced interferon-alphabeta receptors in CD34+ hematopoietic stem constitutively in the organs of normal individuals. Proc Natl Acad cells. Leukemia 2002; 16: 1135–1142. Sci USA 1987; 84: 5038–5042. 55 Pledger WJ, Stiles CD, Antoniades HN, Scher CD. Induction of 47 James D, Levine AJ, Besser D, Hemmati-Brivanlou A. TGFbeta/ DNA synthesis in BALB/c 3T3 cells by serum components: activin/nodal signaling is necessary for the maintenance of reevaluation of the commitment process. Proc Natl Acad Sci pluripotency in human embryonic stem cells. Development USA 1977; 74: 4481–4485. 2005; 132: 1273–1282. 56 Stiles CD, Capone GT, Scher CD, Antoniades HN, Van Wyk JJ, 48 Besser D. Expression of nodal, lefty-a, and lefty-B in undiffer- Pledger WJ. Dual control of cell growth by somatomedins and entiated human embryonic stem cells requires activation of platelet-derived growth factor. Proc Natl Acad Sci USA 1979; 76: Smad2/3. J Biol Chem 2004; 279: 45076–45084. 1279–1283. 49 Pera MF, Andrade J, Houssami S, Reubinoff B, Trounson A, 57 Gang EJ, Bosnakovski D, Figueiredo CA, Visser JW, Perlingeiro RC. Stanley EG et al. Regulation of human embryonic stem cell SSEA-4 identifies mesenchymal stem cells from bone marrow. differentiation by BMP-2 and its antagonist noggin. J Cell Sci 2004; Blood 2006 [E-pub ahead of print]. 117: 1269–1280. 58 Brimble SN, Sherrer ES, Uhl EW, Wang E, Kelly S, Merrill Jr AH 50 Rho JY, Yu K, Han JS, Chae JI, Koo DB, Yoon HS et al. et al. The Cell Surface Glycosphingolipids SSEA-3 and SSEA-4 are Transcriptional profiling of the developmentally important signal- not Essential for Human ES Cell Pluripotency. Stem Cells 2007; 1: ling pathways in human embryonic stem cells. Hum Reprod 2006; 54–62. 21: 405–412. 59 Rubio D, Garcia-Castro J, Martin MC, de la Fuente R, Cigudosa JC, 51 Schuldiner M, Yanuka O, Itskovitz-Eldor J, Melton DA, Benvenisty Lloyd AC et al. Spontaneous human adult stem cell transformation. N. Effects of eight growth factors on the differentiation of cells Cancer Res 2005; 65: 3035–3039.

Leukemia