1 The evolutionary origin of bilaterian smooth and striated myocytes

2

3

4 Thibaut Brunet1,2, Antje H. L. Fischer1,3, Patrick R. H. Steinmetz1,4, Antonella Lauri1,5,

5 Paola Bertucci1, and Detlev Arendt1,*

6

7

8 1. Developmental Biology Unit, European Molecular Biology Laboratory,

9 Meyerhofstraße, 1, 69117 Heidelberg, Germany

10 2. Present address: Department of Molecular and Cell Biology, Howard Hughes

11 Medical Institute, University of California, Berkeley, Berkeley, United States

12 3. Present address: Ludwig-Maximilians University Munich, Biochemistry, Feodor-

13 Lynen Straße 17, 81377 Munich

14 4. Present address: Sars International Centre for Marine Molecular Biology,

15 University of Bergen, Thormøhlensgate 55, 5008 Bergen, Norway.

16 5. Present address: Institute for Biological and Medical Imaging (IBMI), Helmholtz

17 Zentrum München, Neuherberg, Germany

18

19 * For correspondence: [email protected]

20

21

22 Abstract

23 The dichotomy between smooth and striated myocytes is fundamental for bilaterian

24 musculature, but its evolutionary origin is unsolved. In particular,

25 interrelationships of visceral smooth muscles remain unclear. Absent in fly and

26 nematode, they have not yet been characterized molecularly outside vertebrates.

27 Here, we characterize expression profile, ultrastructure, contractility and

28 innervation of the musculature in the marine annelid Platynereis dumerilii and

29 identify smooth muscles around the midgut, hindgut and heart that resemble their

30 vertebrate counterparts in molecular fingerprint, contraction speed, and nervous

31 control. Our data suggest that both visceral smooth and somatic striated myocytes

32 were present in the protostome-deuterostome ancestor, and that smooth myocytes

33 later co-opted the striated contractile module repeatedly – for example in vertebrate

34 heart evolution. During these smooth-to-striated myocyte conversions the core

35 regulatory complex of transcription factors conveying myocyte identity remained

36 unchanged, reflecting a general principle in cell type evolution.

37

38

39 Introduction

40 Musculature is composed of myocytes that are specialized for active contraction

41 (Schmidt-Rhaesa, 2007). Their contractile apparatus centers on actomyosin, a contractile

42 module that dates back to stem eukaryotes (Brunet and Arendt, 2016a) and incorporated

43 accessory proteins of pre-metazoan origin (Steinmetz et al., 2012). Two fundamentally

44 distinct types of myocytes are distinguished based on ultrastructural appearance. In

45 striated myocytes, actomyosin myofibrils are organized in aligned repeated units

46 (sarcomeres) separated by transverse ‘Z discs’, while in smooth myocytes adjacent

47 myofibrils show no clear alignment and are separated by scattered “dense bodies” (Figure

48 1A). In vertebrates, striated myocytes are found in voluntary skeletal muscles, but also at

49 the anterior and posterior extremities of the digestive tract (anterior esophagus muscles

50 and external anal sphincter), and in the muscular layer of the heart; smooth myocytes are

51 found in involuntary visceral musculature that ensures slow, long-range deformation of

52 internal organs. This includes the posterior esophagus and the rest of the gut, but also

53 blood vessels, and most of the urogenital system. In stark contrast, in the fruit fly

54 Drosophila virtually all muscles are striated, including gut visceral muscles (Anderson

55 and Ellis, 1967; Goldstein and Burdette, 1971; Paniagua et al., 1996); the only exception

56 are little-characterized multinucleated smooth muscles around the testes (Susic-Jung et

57 al., 2012). Also, in the nematode Caenorhabditis, somatic muscles are striated, while the

58 short intestine and rectum visceral myocytes are only one sarcomere-long and thus hard

59 to classify (Corsi et al., 2000; White, 1988).

60 The evolutionary origin of smooth versus striated myocytes in bilaterians accordingly

61 remains unsolved. Ultrastructural studies have consistently documented the presence of

62 striated somatic myocytes in virtually every bilaterian group (Schmidt-Rhaesa, 2007) and

63 in line with this, the comparison of Z-disc proteins supports homology of striated

64 myocytes across bilaterians (Steinmetz et al., 2012). The origin of smooth myocyte types

65 however is less clear. Given the absence of smooth muscles from fly and nematode, it has

66 been proposed that visceral smooth myocytes represent a vertebrate novelty, which

67 evolved independently from non-muscle cells in the vertebrate stem line (Goodson and

68 Spudich, 1993; OOta and Saitou, 1999). However, smooth muscles are present in many

69 other bilaterian groups, suggesting instead their possible presence in urbilaterians and

70 secondary loss in arthropods and nematodes. Complicating the matter further,

71 intermediate ultrastructures between smooth and striated myocytes have been reported,

72 suggesting interconversions (reviewed in (Schmidt-Rhaesa, 2007)).

73 Besides ultrastructure, the comparative molecular characterization of cell types can be

74 used to build cell type trees (Arendt, 2003, 2008; Musser and Wagner, 2015; Wagner,

75 2014). Cell type identity is established via the activity of transcription factors acting as

76 terminal selectors (Hobert, 2016) and forming “core regulatory complexes” (CRCs;

77 (Arendt et al., 2016; Wagner, 2014)), which directly activate downstream effector genes.

78 This is exemplified for vertebrate myocytes in Figure 1B. In all vertebrate myocytes,

79 transcription factors of the Myocardin family (MASTR in skeletal muscles, Myocardin in

80 smooth and cardiac muscles) directly activate effector genes encoding contractility

81 proteins (Fig. 1B) (Creemers et al., 2006; Meadows et al., 2008; Wang and Olson, 2004;

82 Wang et al., 2003). They heterodimerize with MADS-domain factors of the Myocyte

83 Enhancer Factor-2 (Mef2) (Black and Olson, 1998; Blais et al., 2005; Molkentin et al.,

84 1995; Wales et al., 2014) and Serum Response Factor (SRF) families (Carson et al.,

85 1996; Nishida et al., 2002). Other myogenic transcription factors are specific for different

86 types of striated and smooth myocytes. Myogenic Regulatory Factors (MRF) family

87 members, including MyoD and its paralogs Myf5, Myogenin, and Mrf4/Myf6 (Shi and

88 Garry, 2006), directly control contractility effector genes in skeletal (and esophageal)

89 striated myocytes, cooperatively with Mef2 (Blais et al., 2005; Molkentin et al., 1995) –

90 but are absent from smooth and cardiac muscles. In smooth and cardiac myocytes, this

91 function is ensured by NK transcription factors (Nkx3.2/Bapx and Nkx2.5/Tinman,

92 respectively), GATA4/5/6, and Fox transcription factors (FoxF1 and FoxC1,

93 respectively), which bind to SRF and Mef2 to form CRCs directly activating contractility

94 effector genes (Durocher et al., 1997; Hoggatt et al., 2013; Lee et al., 1998; Morin et al.,

95 2000; Nishida et al., 2002; Phiel et al., 2001) (Figure 1B).

96 Regarding effector proteins (Figure 1B) (Kierszenbaum and Tres, 2015), all myocytes

97 express distinct isoforms of the myosin heavy chain: the striated myosin heavy chain ST-

98 MHC (which duplicated into cardiac, fast skeletal, and slow skeletal isoforms in

99 vertebrates) and the smooth/non-muscle myosin heavy chain SM-MHC (which duplicated

100 in vertebrates into smooth myh10, myh11 and myh14, and non-muscle myh9) (Steinmetz

101 et al., 2012). The different contraction speeds of smooth and striated muscles are due to

102 the distinct kinetic properties of these molecular motors (Bárány, 1967). In both myocyte

103 types, contraction occurs in response to calcium, but the responsive proteins differ

104 (Alberts et al., 2014): the Troponin complex (composed of Troponin C, Troponin T and

105 Troponin I) for striated muscles, Calponin and Caldesmon for smooth muscles. In both

106 myocyte types, calcium also activates the Calmodulin/Myosin Light Chain Kinase

107 pathway (Kamm and Stull, 1985; Sweeney et al., 1993). Striation itself is implemented

108 by specific effectors, including the long elastic protein Titin (Labeit and Kolmerer, 1995)

109 (which spans the entire sarcomere and confers it elasticity and resistance) and

110 ZASP/LBD3 (Z-band Alternatively Spliced PDZ Motif/LIM-Binding Domain 3), which

111 binds actin and stabilizes sarcomeres during contraction (Au et al., 2004; Zhou et al.,

112 2001). The molecular study of Drosophila and Caenorhabditis striated myocytes

113 revealed important commonalities with their vertebrate counterparts, including the

114 Troponin complex (Beall and Fyrberg, 1991; Fyrberg et al., 1994, 1990; Marín et al.,

115 2004; Myers et al., 1996), and a conserved role for Titin (Zhang et al., 2000) and

116 ZASP/LBD3 (Katzemich et al., 2011; McKeown et al., 2006) in the striated architecture.

117 Finally, smooth and striated myocytes also differ physiologically. All known striated

118 myocyte types (apart from the myocardium) strictly depend on nervous stimulations for

119 contraction, exerted by innervating motor neurons. In contrast, gut smooth myocytes are

120 able to generate and propagate automatic (or “myogenic”) contraction waves responsible

121 for digestive peristalsis in the absence of nervous inputs (Faussone‐Pellegrini and

122 Thuneberg, 1999; Sanders et al., 2006). These autonomous contraction waves are

123 modulated by the autonomic nervous system (Silverthorn, 2015). Regarding overall

124 contraction speed, striated myocytes have been measured to contract 10 to 100 times

125 faster than their smooth counterparts (Bárány, 1967).

126

127 To elucidate the evolutionary origin and diversification of bilaterian smooth and striated

128 myocytes, we provide an in-depth ultrastructural, molecular and functional

129 characterization of the myocyte complement in the marine annelid Platynereis dumerilii,

130 which belongs to the Lophotrochozoa. Strikingly, as of now, no invertebrate smooth

131 visceral muscle has been investigated on a molecular level (Hooper and Thuma, 2005;

132 Hooper et al., 2008). Platynereis has retained more ancestral features than flies or

133 nematodes and is thus especially suited for long-range comparisons (Denes et al., 2007;

134 Raible et al., 2005). Also, other annelids such as earthworms have been reported to

135 possess both striated somatic and midgut smooth visceral myocytes based on electron

136 microscopy (Anderson and Ellis, 1967). Our study reveals the parallel presence of

137 smooth myocytes in the musculature of midgut, hindgut, and pulsatile dorsal vessel and

138 of striated myocytes in the somatic musculature and the foregut. Platynereis smooth and

139 striated myocytes closely parallel their vertebrate counterparts in ultrastructure, molecular

140 profile, contraction speed, and reliance on nervous inputs, thus supporting the ancient

141 existence of a smooth-striated duality in protostome/deuterostome ancestors.

142

143

144 Results

145 Platynereis midgut and hindgut muscles are smooth, while foregut and somatic muscles

146 are striated

147 Differentiation of the Platynereis somatic musculature has been documented in much

148 detail (Fischer et al., 2010) and, in five days post-fertilization (dpf) young worms,

149 consists of ventral and dorsal longitudinal muscles, oblique and parapodial muscles, head

150 muscles and the axochord (Lauri et al., 2014). At this stage, the first Platynereis visceral

151 myocytes become detectable around the developing tripartite gut, which is subdivided

152 into foregut, midgut and hindgut (based on the conserved regional expression of foxA,

153 brachyury and hnf4 gut specification factors (Martín-Durán and Hejnol, 2015); Figure

154 2—figure supplement 1). At 7 dpf, visceral myocytes form circular myofibres around the

155 foregut, and scattered longitudinal and circular fibres around midgut and hindgut (Figure

156 2A, Figure 2—figure supplement 2A), which expand by continuous addition of circular

157 and longitudinal fibres to completely cover the dorsal midgut at 11dpf (Figure 2A, Figure

158 2—figure supplement 2B) and finally form a continuous muscular orthogon around the

159 entire midgut and hindgut in the 1.5 months-old juvenile (Figure 2A, Figure 2—figure

160 supplement 2C).

161 We then proceeded to characterize the ultrastructure of Platynereis visceral and somatic

162 musculature by transmission electron microscopy (Figure 2C-M). All somatic muscles

163 and anterior foregut muscles display prominent oblique striation with discontinuous Z-

164 elements (Figure 2C-H; compare Figure 1A), as typical for protostomes (Burr and Gans,

165 1998; Mill and Knapp, 1970; Rosenbluth, 1972). To the contrary, visceral muscles of the

166 posterior foregut, midgut and hindgut are smooth with scattered dense bodies (Figure 2I-

167 M). The visceral muscular orthogon is partitioned into an external longitudinal layer and

168 an internal circular layer (Figure 2J), as in vertebrates (Marieb and Hoehn, 2015) and

169 arthropods (Lee et al., 2006). Thus, according to ultrastructural appearance, Platynereis

170 has both somatic (and anterior foregut) striated muscles and visceral smooth muscles.

171 The molecular profile of smooth and striated myocytes

172 We then set out to molecularly characterize annelid smooth and striated myocytes via a

173 candidate gene approach. As a starting point, we investigated, in the Platynereis genome,

174 the presence of regulatory and effector genes specific for smooth and/or striated

175 myocytes in the vertebrates. We found striated muscle-specific and smooth muscle/non-

176 muscle isoforms of both myosin heavy chain (consistently with published phylogenies

177 (Steinmetz et al., 2012)) and myosin regulatory light chain. We also identified homologs

178 of genes encoding calcium transducers (calponin for smooth muscles; troponin I and

179 troponin T for striated muscles), striation structural proteins (zasp/lbd3 and titin), and

180 terminal selectors for the smooth (foxF, and gata456) and striated phenotypes (myoD).

181 We investigated expression of these markers by whole-mount in situ hybridization

182 (WMISH). Striated effectors are expressed in both somatic and foregut musculature

183 (Figure 3A,C; Figure 3—figure supplement 1). Expression of all striated effectors was

184 observed in every somatic myocyte group by confocal imaging with cellular resolution

185 (Figure 3—figure supplement 2). Interestingly, myoD is exclusively expressed in

186 longitudinal striated muscles, but not in other muscle groups (Figure 3—figure

187 supplement 2).

188 The expression of smooth markers is first detectable at 3 dpf in a small triangle-shaped

189 group of mesodermal cells posteriorly abutting the macromeres (which will form the

190 future gut) (Figure 3B, Figure 3—figure supplement 3A-C). At this stage, smooth

191 markers are also expressed in the foregut mesoderm (Figure 3B, Figure 3—figure

192 supplement 3A-C, yellow arrows). At 6 dpf, expression of all smooth markers is

193 maintained in the midgut and hindgut differentiating myocytes (Figure 3D, Figure 3—

194 figure supplement 3D-G, Figure 3—figure supplement 4A-E) but smooth effectors

195 disappear from the foregut, which turns on striated markers instead (Figure 3—figure

196 supplement 1R-W) – reminiscent of the replacement of smooth fibres by striated fibres

197 during development of the vertebrate anterior esophageal muscles (Gopalakrishnan et al.,

198 2015). Finally, in 2 months-old juvenile worms, smooth markers are also detected in the

199 dorsal pulsatile vessel (Figure 3—figure supplement 3H-M) – considered equivalent to

200 the vertebrate heart (Saudemont et al., 2008) but, importantly, of smooth ultrastructure in

201 polychaetes (Jensen, 1974; Spies, 1973). None of the striated markers is expressed

202 around the midgut or the hindgut (Figure 3—figure supplement 4F-K), or in the dorsal

203 vessel (Figure 3—figure supplement 3L). Taken together, these results strongly support

204 conservation of the molecular fingerprint of both smooth and striated myocytes between

205 annelids and vertebrates.

206 We finally investigated general muscle markers that are shared between smooth and

207 striated muscles. These include actin, mef2 and myocardin – which duplicated into

208 muscle type-specific paralogs in vertebrates, but are still present as single-copy genes in

209 Platynereis. We found them to be expressed in the forming musculature throughout larval

210 development (Figure 3—figure supplement 5A-F), and confocal imaging at 6 dpf

211 confirmed expression of all 3 markers in both visceral (Figure 3—figure supplement 5G-

212 L) and somatic muscles (Figure 3—figure supplement 5M).

213 Smooth and striated muscles differ in contraction speed

214 We then characterized the contraction speed of the two myocyte types in Platynereis by

215 measuring myofibre length before and after contraction. Live confocal imaging of

216 contractions in Platynereis larvae with fluorescently labeled musculature (Movie 1,

217 Movie 2) gave a striated contraction rate of 0.55±0.27 s-1 (Figure 4A-E) and a smooth

218 myocyte contraction rate of 0.07±0.05 s-1 (Figure 4G). As in vertebrates, annelid striated

219 myocytes thus contract nearly one order of magnitude faster than smooth myocytes

220 (Figure 4F).

221 Striated, but not smooth, muscle contraction depends on nervous inputs

222 Finally, we investigated the nervous control of contraction of both types of muscle cells.

223 In vertebrates, somatic muscle contraction is strictly dependent on neuronal inputs. By

224 contrast, gut peristalsis is automatic (or myogenic – i.e., does not require nervous inputs)

225 in vertebrates, cockroaches (Nagai and Brown, 1969), squids (Wood, 1969), snails

226 (Roach, 1968), holothurians, and sea urchins (Prosser et al., 1965). The only exceptions

227 appear to be bivalves and malacostracans (crabs, lobster and crayfish), in which gut

228 motility is neurogenic (Prosser et al., 1965). Regardless of the existence of an automatic

229 component, the gut is usually innervated by nervous fibres modulating peristalsis

230 movements (Wood, 1969; Wu, 1939).

231 Gut peristalsis takes place in Platynereis larvae and juveniles from 6 dpf onwards (Movie

232 3), and we set out to test whether nervous inputs were necessary for it to take place. We

233 treated 2 months-old juveniles with 180 μM Brefeldin A, an inhibitor of vesicular traffic

234 which prevents polarized secretion (Misumi et al., 1986) and interferes with

235 neurotransmission (Malo et al., 2000). Treatment stopped locomotion in all treated

236 individuals, confirming that neurotransmitter release by motor neurons is required for

237 somatic muscles contraction, while DMSO-treated controls were unaffected. On the other

238 hand, vigorous gut peristalsis movements were maintained in Brefeldin A-treated animals

239 (Movie 4). Quantification of the propagation speed of the peristalsis wave (Figure 5A-D;

240 see Material and Methods) indicated that contractions propagated significantly faster in

241 Brefeldin A-treated individuals than in controls. The frequency of wave initiation and

242 their recurrence (the number of repeated contraction waves occurring in one

243 uninterrupted sequence) did not differ significantly in Brefeldin A-treated animals

244 (Figure 5E,F). These results indicate that, as in vertebrates, visceral smooth muscle

245 contraction and gut peristalsis do not require nervous (or secretory) inputs in Platynereis.

246 An enteric nervous system is present in Platynereis

247 In vertebrates, peristaltic contraction waves are initiated by self-excitable myocytes

248 (Interstitial Cajal Cells) and propagate across other smooth muscles by gap junctions

249 ensuring direct electrical coupling (Faussone‐Pellegrini and Thuneberg, 1999; Sanders et

250 al., 2006). We tested the role of gap junctions in Platynereis gut peristalsis by treating

251 animals with 2.5 mM 2-octanol, which inhibits gap junction function in both insects

252 (Bohrmann and Haas-Assenbaum, 1993; Gho, 1994) and vertebrates (Finkbeiner, 1992).

253 2-octanol abolishes gut peristalsis, both in the absence and in the presence of Brefeldin A

254 (Figure 5G), indicating that propagation of the peristalsis wave relies on direct coupling

255 between smooth myocytes via gap junctions.

256 The acceleration of peristalsis upon Brefeldin A treatment indicates that gut peristalsis is

257 modulated by secreted signals (neurotransmitters, hormones or neurohormones) whose

258 net combined effect in normal, resting conditions is to slow down the self-generated

259 peristaltic waves. This is consistent with the existence of neurotransmitters that inhibit

260 visceral muscle contraction in other bilaterians such as vertebrates (adrenaline

261 (Burnstock, 1958)) and squids (acetylcholine (Wood, 1969))..To gain insights into the

262 nature of these secreted signals, we investigated the innervation of the Platynereis gut.

263 Immunostainings of juvenile worms for acetylated tubulin revealed a dense, near-

264 orthogonal nerve net around the entire gut (Figure 6A), which is tightly apposed to the

265 visceral muscle layer (Figure 6C) and includes serotonergic neurites (Figure 6B,C) and

266 cell bodies (Figure 6D). Interestingly, some enteric serotonergic cell bodies are devoid of

267 neurites, thus resembling the vertebrate (non-neuronal) enterochromaffine cells –

268 endocrine serotonergic cells residing around the gut and activating gut peristalsis by

269 direct serotonin secretion upon mechanical stretch (Bulbring and Crema, 1959).

270 Discussion

271 Smooth and striated myocyte coexisted in bilaterian ancestors

272 Our study represents the first molecular characterization of protostome visceral smooth

273 musculature (Hooper and Thuma, 2005; Hooper et al., 2008). The conservation of

274 molecular signatures for both smooth and striated myocytes indicates that a dual

275 musculature already existed in bilaterian ancestors: a fast striated somatic musculature

276 (possibly also present around the foregut – as in Platynereis, vertebrates (Gopalakrishnan

277 et al., 2015) and sea urchins (Andrikou et al., 2013; Burke, 1981)), under strict nervous

278 control; and a slow smooth visceral musculature around the midgut and hindgut, able to

279 undergo automatic peristalsis due to self-excitable myocytes directly coupled by gap

280 junctions. In striated myocytes, a core regulatory complex (CRC) involving Mef2 and

281 Myocardin directly activated striated contractile effector genes such as ST-MHC, ST-

282 MRLC and the Troponin genes (Figure 7—figure supplement 1). Notably, myoD might

283 have been part of the CRC in only part of the striated myocytes, as it is only detected in

284 longitudinal muscles in Platynereis. The absence of myoD expression in other annelid

285 muscle groups is in line with the “chordate bottleneck” concept (Thor and Thomas,

286 2002), according to which specialization for undulatory swimming during early chordate

287 evolution would have fostered exclusive reliance on trunk longitudinal muscles, and loss

288 of other (myoD-negative) muscle types. In smooth myocytes, a CRC composed of NK3,

289 FoxF and GATA4/5/6 together with Mef2 and Myocardin activated the smooth

290 contractile effectors SM-MHC, SM-MRLC and calponin (Figure 7—figure supplement 1).

291 In spite of their absence in flies and nematodes, gut myocytes of smooth ultrastructure are

292 widespread in other bilaterians, and an ancestral state reconstruction retrieves them as

293 present in the last common protostome/deuterostome ancestor with high confidence

294 (Figure 7—figure supplement 2), supporting our homology hypothesis. Our results are

295 consistent with previous reports of Calponin immunoreactivity in intestinal muscles of

296 earthworms (Royuela et al., 1997) and snails (which also lack immunoreactivity for

297 Troponin T) (Royuela et al., 2000).

298

299 Origin of the enteric nervous system and enterochromaffine cells

300 In both Platynereis and vertebrates, visceral smooth mycoytes are able to contract

301 automatically but undergo modulation by secretory cells that form an enteric nerve

302 plexus. Interestingly, an enteric nervous system has been found in most bilaterians

303 investigated, including Platynereis (this study), earthworms ((Barna et al., 2001; Csoknya

304 et al., 1991; Telkes et al., 1996), snails (Furukawa et al., 2001), insects (Copenhaver and

305 Taghert, 1989), nematodes (Brownlee et al., 1994), and echinoderms (García-Arrarás et

306 al., 1991, 2001). This suggests that the urbilaterian ancestor already possessed enteric

307 neurons. In vertebrates, the enteric nervous system is entirely produced by the neural

308 crest (Le Douarin and Teillet, 1973), a specialized migratory embryonic lineage which is

309 a vertebrate innovation (Shimeld and Holland, 2000). This suggests that the neural crest

310 “took over” the production of the pre-existing enteric neurons (as it did with pharyngeal

311 cartilage, of endomesodermal origin in stem-chordates (Meulemans and Bronner-Fraser,

312 2007), but produced by the neural crest in amniotes (Lièvre and Le Douarin, 1975; Sefton

313 et al., 2015)). Alternatively, the ancient enteric neurons could have been lost in stem-

314 vertebrates and later replaced by a novel, neural-crest derived population. A careful

315 comparison of the molecular fingerprints of invertebrate and vertebrate enteric neurons

316 will be required to distinguish between these competing hypotheses. Alongside the

317 enteric nervous system (which includes serotonergic neurons in both vertebrates and

318 annelids) the gut wall of both Platynereis and vertebrates also harbors non-neuronal,

319 paracrine serotonergic cells (or enterochromaffine cells) – which are, unlike enteric

320 neurons, of endodermal origin in vertebrates (Andrew, 1974; Fontaine and Le Douarin,

321 1977), and potentially represent another ancient bilaterian cell type modulating gut

322 peristalsis.

323

324

325 Origin of smooth and striated myocytes by cell type individuation

326 How did smooth and striated myocytes diverge in evolution? Figure 7 presents a

327 comprehensive cell type tree for the evolution of myocytes, with a focus on Bilateria.

328 This tree illustrates the divergence of the two muscle cell types by progressive

329 partitioning of genetic information in evolution – a process called individuation (Arendt

330 et al., 2016; Wagner, 2014). The individuation of fast and slow contractile cells involved

331 two complementary processes: (1) changes in CRC (black circles, Figure 7) and

332 (2) emergence of novel genes encoding new cellular modules, or apomeres (Arendt et al.,

333 2016) (grey squares, Figure 7).

334 Around a common core formed by the Myocardin:Mef2 complex (both representing

335 transcription factors of pre-metazoan ancestry (Steinmetz et al., 2012)), smooth and

336 striated CRCs incorporated different transcription factors implementing the expression of

337 distinct effectors (Figure 1B; Figure 7—figure supplement 1) – notably the bilaterian-

338 specific bHLH factor MyoD (Steinmetz et al., 2012) and GATA4/5/6, which arose by

339 bilaterian-specific duplication of a single ancient pan-endomesodermal GATA

340 transcription factor (Leininger et al., 2014; Martindale et al., 2004).

341 Regarding the evolution of myocyte-specific apomeres, one prominent mechanism of

342 divergence has been gene duplications. While the MHC duplication predated metazoans,

343 other smooth and striated-specific paralogs only diverged in bilaterians. Smooth and

344 striated MRLC most likely arose by gene duplication in the bilaterian stem-line

345 (Supplementary File 1). Myosin essential light chain, actin and myocardin paralogs split

346 even later, in the vertebrate stem-line (Figure 7). Similarly, smooth and non-muscle mhc

347 and mrlc paralogs only diverged in vertebrates. The calponin-encoding gene underwent

348 parallel duplication and subfunctionalization in both annelids and chordates, giving rise

349 to both specialized smooth muscle paralogs and more broadly expressed copies with a

350 different domain structure (Figure 7—figure supplement 3). This slow and stepwise

351 nature of the individuation process is consistent with studies showing that recently

352 evolved paralogs can acquire differential expression between tissues that diverged long

353 before in evolution (Force et al., 1999; Lan and Pritchard, 2016).

354 Complementing gene duplication, the evolution and selective expression of entirely new

355 apomeres also supported individuation: for example, Titin and all components of the

356 Troponin complex are bilaterian novelties (Steinmetz et al., 2012). In vertebrates, the new

357 gene caldesmon was incorporated in the smooth contractile module (Steinmetz et al.,

358 2012).

359

360

361 Smooth to striated myocyte conversion

362 Strikingly, visceral smooth myocytes were previously assumed to be a vertebrate

363 innovation, as they are absent in fruit flies and nematodes (two groups which are in fact

364 exceptions in this respect, at least from ultrastructural criteria (Figure 7—figure

365 supplement 2A)). This view received apparent support from the fact that the vertebrate

366 smooth and non-muscle myosin heavy chains (MHC) arose by vertebrate-specific

367 duplication of a unique ancestral bilaterian gene, orthologous to Drosophila non-muscle

368 MHC (Goodson and Spudich, 1993) – which our results suggest reflects instead gradual

369 individuation of pre-existing cell types (see above). Strikingly, the striated gut muscles of

370 Drosophila resemble vertebrate and annelid smooth gut muscles by transcription factors

371 (nk3/bagpipe (Azpiazu and Frasch, 1993), foxF/biniou (Jakobsen et al., 2007; Zaffran et

372 al., 2001)), even though they express the fast/striated contractility module (Fyrberg et al.,

373 1994, 1990; Marín et al., 2004). If smooth gut muscles are ancestral for protostomes, as

374 our results indicate, this suggests that the smooth contractile module was replaced by the

375 fast/striated module in visceral myocytes during insect evolution. Interestingly, chromatin

376 immunoprecipitation assays (Jakobsen et al., 2007) show that the conserved visceral

377 transcription factors foxF/biniou and nk3/bagpipe do not directly control contractility

378 genes in Drosophila gut muscles (which are downstream mef2 instead), but establish the

379 morphogenesis and innervation of the visceral muscles, and control non-contractile

380 effectors such as gap junctions – which are the properties these muscles seem to have

381 conserved from their smooth ancestors. The striated gut myocytes of insects would thus

382 represent a case of co-option of an effector module from another cell type, which

383 happened at an unknown time during ecdysozoan evolution (Figure 7; Figure 7—figure

384 supplement 1).

385 Another likely example of co-option is the vertebrate heart: vertebrate cardiomyocytes

386 are striated and express fast myosin and troponin, but resemble smooth myocytes by

387 developmental origin (from the splanchnopleura), function (automatic contraction and

388 coupling by gap junctions) and terminal selector profile (Figure 1B). These similarities

389 suggest that cardiomyocytes might stem from smooth myocytes that likewise co-opted

390 the fast/striation module. Indicative of this possible ancestral state, the Platynereis dorsal

391 pulsatile vessel (considered homologous to the vertebrate heart based on comparative

392 anatomy and shared expression of NK4/tinman (Saudemont et al., 2008)) expresses the

393 smooth, but not the striated, myosin heavy chain (Figure 3—figure supplement 3H-M).

394 An ancestral state reconstruction based on ultrastructural data further supports the notion

395 that heart myocytes were smooth in the last common protostome/deuterostome ancestor,

396 and independently acquired striation in at least 5 descendant lineages (Figure 7—figure

397 supplement 2B) – usually in species with large body size and/or fast metabolism.

398

399 Striated to smooth conversions

400 Smooth somatic muscles are occasionally found in bilaterians with slow or sessile

401 lifestyles – for example in the snail foot (Faccioni-Heuser et al., 1999; Rogers, 1969), the

402 ascidian siphon (Meedel and Hastings, 1993), and the sea cucumber body wall (Kawaguti

403 and Ikemoto, 1965). As an extreme (and isolated) example, flatworms lost striated

404 muscles altogether, and their body wall musculature is entirely smooth (Rieger et al.,

405 1991). Interestingly, in all cases that have been molecularly characterized, smooth

406 somatic muscles express the same fast contractility module as their striated counterparts,

407 including ST-MHC and the Troponin complex – in ascidians (Endo and Obinata, 1981;

408 Obinata et al., 1983), flatworms (Kobayashi et al., 1998; Sulbarán et al., 2015; Witchley

409 et al., 2013), and the smooth myofibres of the bivalve catch muscle (Nyitray et al., 1994;

410 Ojima and Nishita, 1986). (It is unknown whether these also express zasp and titin in

411 spite of the lack of striation). This suggests that these are somatic muscles having

412 secondarily lost striation (in line with the sessile lifestyle of ascidians and bivalves, and

413 with the complete loss of striated muscles in flatworms). Alternatively, they might

414 represent remnants of ancestral smooth somatic fibres that would have coexisted

415 alongside striated somatic fibres in the last common protostome/deuterostome ancestor.

416 Interestingly, the fast contractile module is also expressed in acoel body wall smooth

417 muscles (Chiodin et al., 2011); since acoels belong to a clade that might have branched

418 off before all other bilaterians (Cannon et al., 2016) (though a position within

419 deuterostomes has also been envisioned (Bourlat et al., 2003, 2006; Philippe et al.,

420 2011)), these could represent fast-contracting myocytes that never evolved striation in the

421 first place, similar to those found in cnidarians. In all cases, the fast contractility module

422 appears to represent a consistent synexpression group (i.e. its components are reliably

423 expressed together), and a stable molecular profile of all bilaterian somatic muscles,

424 regardless of the presence of morphologically overt striation. This confirms the notion

425 that, even in cases of ambiguous morphology or ultrastructure, the molecular fingerprint

426 of cell types holds clue to their evolutionary affinities.

427 Implications for cell type evolution

428 In the above, genetically well-documented cases of cell type conversion (smooth to

429 striated conversion in insect visceral myocytes and vertebrate cardiomyocytes), cells kept

430 their ancestral CRC of terminal selector transcription factors, while changing the

431 downstream effector modules. This supports the recent notion that CRCs confer an

432 abstract identity to cell types, which remains stable in spite of turnover in downstream

433 effectors (Wagner, 2014) – just as hox genes impart conserved abstract identity to

434 segments of vastly diverging morphologies (Deutsch, 2005). Tracking cell type-specific

435 CRCs through animal phylogeny thus represents a powerful means to decipher the

436 evolution of cell types.

437 Pre-bilaterian origins

438 If the existence of fast-contracting striated and slow-contracting smooth myocytes

439 predated bilaterians – when and how did these cell types first split in evolution? The first

440 evolutionary event that paved the way for the diversification of the smooth and striated

441 contractility modules was the duplication of the striated myosin heavy chain-encoding

442 gene into the striated isoform ST-MHC and the smooth/non-muscle isoform SM-MHC.

443 This duplication occurred in single-celled ancestors of animals, before the divergence of

444 filastereans and choanoflagellates (Steinmetz et al., 2012). Consistently, both sm-mhc and

445 st-mhc are present in the genome of the filasterean Ministeria (though st-mhc was lost in

446 other single-celled holozoans) (Sebé-Pedrós et al., 2014). Interestingly, st-mhc and sm-

447 mhc expression appears to be segregated into distinct cell types in sponges, cnidarians

448 (Steinmetz et al., 2012), and ctenophores (Dayraud et al., 2012), suggesting that a cell

449 type split between slow and fast contractile cells is a common feature across early-

450 branching metazoans (Figure 7). Given the possibility of MHC isoform co-option (as

451 outlined above), it is yet unclear whether this split happened once or several times. The

452 affinities of bilaterians and non-bilaterians contractile cells remain to be tested from data

453 on the CRCs establishing contractile cell types in non-bilaterians.

454

455 Conclusions

456 Our results indicate that the split between visceral smooth myocytes and somatic striated

457 myocytes is the result of a long individuation process, initiated before the last common

458 protostome/deuterostome ancestor. Fast- and slow-contracting cells expressing distinct

459 variants of myosin II heavy chain (ST-MHC versus SM-MHC) acquired increasingly

460 contrasted molecular profiles in a gradual fashion – and this divergence process continues

461 to this day in individual bilaterian phyla. Blurring this picture of divergence, co-option

462 events have led to the occasional replacement of the slow contractile module by the fast

463 one, leading to smooth-to-striated myocyte conversions. Our study showcases the power

464 of molecular fingerprint comparisons centering on effector and selector genes to

465 reconstruct cell type evolution (Arendt, 2008). In the bifurcating phylogenetic tree of

466 animal cell types (Liang et al., 2015), it remains an open question how the two types of

467 contractile cells relate to other cell types, such as neurons (Mackie, 1970) or cartilage

468 (Brunet and Arendt, 2016b; Lauri et al., 2014; Tarazona et al., 2016).

469

470 Material and Methods

471

472 Immunostainings and in situ hybridizations

473 Immunostaining, rhodamine-phalloidin staining, and WMISH were performed according

474 to previously published protocols (Lauri et al., 2014). Antibodies against acetylated

475 tubulin and serotonin were respectively purchased from Sigma Aldrich

476 (RRID:AB_477585) and ImmunoStar (RRID:AB_572263). Rhodamine-phalloidin was

477 purchased from ThermoFischer Scientific (RRID:AB_2572408) For all stainings not

478 involving phalloidin, animals were mounted in 97% TDE/3% PTw for imaging following

479 (Asadulina et al., 2012). Phalloidin-stained larvae were mounted in 1% DABCO/glycerol

480 instead, as TDE was found to quickly disrupt phalloidin binding to F-actin. Confocal

481 imaging of stained larvae was performed using a Leica SPE and a Leica SP8 microscope.

482 Stacks were visualized and processed with ImageJ 1.49v (RRID:SCR_003070). 3D

483 renderings were performed with Imaris 8.1 (RRID:SCR_007370). Bright field Nomarski

484 microscopy was performed on a Zeiss M1 microscope. Z-projections of Nomarski stacks

485 were performed using Helicon Focus 6.7.1 (RRID:SCR_014462).

486

487 Transmission electron microscopy

488 TEM was performed as previously published (Lauri et al., 2014).

489

490 Pharmacological treatments

491 Brefeldin A was purchased from Sigma Aldrich (B7561) and dissolved in DMSO to a

492 final concentration of 5 mg/mL. Animals were treated with 50 μg/mL Brefeldin A in 6-

493 well plates filled with 5 mL filtered natural sea water (FNSW). Controls were treated

494 with 1% DMSO (which is compatible with Platynereis development and survival without

495 noticeable effect). Other neurotransmission inhibitors were found to be ineffective on

496 Platynereis (as they elicited no impairment of locomotion): tetanus toxin (Sigma Aldrich

497 T3194; 100 μg/mL stock in distilled water) up to 5 μg/mL; TTX (Latoxan, L8503; 1 mM

498 stock) up to 10 μM; Myobloc (rimabotulinum toxin B; Solstice Neurosciences) up to 1%;

499 saxitoxin 2 HCl (Sigma Aldrich NRCCRMSTXF) up to 1%; and neosaxitoxin HCl

500 (Sigma Aldrich NRCCRMNEOC) up to 1%. (±)-2-Octanol was purchased from Sigma

501 Aldrich and diluted to a final concentration of 2.5 mM (2 μL in 5 mL FNSW). (±)-2-

502 Octanol treatment inhibited both locomotion and gut peristalsis, in line with the

503 importance of gap junctions in motor neural circuits (Kawano et al., 2011; Kiehn and

504 Tresch, 2002). No sample size was computed before the experiments. At least 2 technical

505 replicates were performed for each assay, with at least 5 biological replicates per sample

506 per technical replicate. A technical replicate is a batch of treated individuals (together

507 with their control siblings), and a biological replicate is a treated (or control sibling)

508 individual.

509

510 Live imaging of contractions

511 Animals were mounted in 3% low melting point agarose in FNSW (2-

512 Hydroxyethylagarose, Sigma Aldrich A9414) between a slide and a cover slip (using 5

513 layers of adhesive tape for spacing) and imaged with a Leica SP8 confocal microscope.

514 Fluorescent labeling of musculature was achieved either by microinjection of mRNAs

515 encoding GCaMP6s, LifeAct-EGFP or H2B-RFP, or by incubation in 3 μM 0.1% FM-

516 464FX (ThermoFisher Scientific, F34653). Contraction speed was calculated as (l2-

517 l1)/(l1*t), where l1 is the initial length, l2 the length after contraction, and t the duration

518 of the contraction. Kymographs and wave speed quantifications were performed with the

519 ImageJ Kymograph plugin: http://www.embl.de/eamnet/html/kymograph.html No sample

520 size was computed before the experiments. At least 2 technical replicates were performed

521 for each assay, with at least 2 biological replicates per sample per technical replicate. A

522 technical replicate is a batch of treated individuals (together with their control siblings),

523 and a biological replicate is a treated (or control sibling) individual.

524

525 Ancestral state reconstruction

526 Ancestral state reconstructions were performed with Mesquite 3.04 using the Maximum

527 Likelihood and Parsimony methods.

528

529 Cloning

530 The following primers were used for cloning Platynereis genes using a mixed stages

531 Platynereis cDNA library (obtained from 1, 2, 3, 5, 6, 10, and 14-days old larvae) and

532 either the HotStart Taq Polymerase from Qiagen or the Phusion polymerase from New

533 England BioLabs (for GC-rich primers):

534

535

536

Gene name Forward primer Reverse primer foxF CCCAGTGTCTGCATCCTTGT CATGGGCATTGAAGGGGAGT zasp CATACCAGCCATCCCGTCC AAATCAGCGAACTCCAGCGT troponin T TTCTGCAGGGCGCAAAGTCA CGCTGCTGTTCCTTGAAGCG SM-MRLC TGGTGTTTGCAGGGCGGTCA GGTCCATACCGTTACGGAAGCTTTT calponin ACGTGCGGTTTACGATTGGA GCTGGCTCCTTGGTTTGTTC transgelin1 GCTGCCAAGGGAGCTGACGC ACAAAGAGCTTGTACCACCTCACCC myocardin GACACCAGTCCGAAGCTTGA CGTGGTAGTAGTCGTGGTCG 537

538

539 The following genes were retrieved from an EST plasmid stock: SM-MHC (as two

540 independent clones that gave identical expression patterns) and ST-MRLC. Gene

541 orthology (Supplementary fils 1) was determined by phylogenetic analysis using

542 MrBayes (RRID:SCR_012067) or PhyML (Guindon et al., 2010) run from

543 http://www.atgc-montpellier.fr/phyml/ (RRID:SCR_014629).

544 Other genes were previously published: actin and ST-MHC (under the name mhc1-4)

545 (Lauri et al., 2014) and GATA456 (Gillis et al., 2007).

546

547 Acknowledgements

548

549 We thank Kaia Achim for the hnf4 plasmid, Pedro Machado (Electron Microscopy Core

550 Facility, EMBL Heidelberg) for embedding and sectioning samples for TEM, and the

551 Arendt lab for feedback on the project. The work was supported by the European

552 Research Council “Brain Evo-Devo” grant (TB, PB and DA), European Union’s Seventh

553 Framework Programme project “Evolution of gene regulatory networks in animal

554 development (EVONET)” [215781-2] (AL), the Zoonet EU-Marie Curie early training

555 network [005624] (AF), the European Molecular Biology Laboratory (AL, AHLF, and

556 PRHS) and the EMBL International Ph.D. Programme (TB, AHLF, PRHS, AL).

557 References

558 Alberts, B., Johnson, A., Lewis, J., Morgan, D., Raff, M., Roberts, K., and Walter, P. 559 (2014). Molecular Biology of the Cell (New York, NY: Garland Science).

560 Anderson, W.A., and Ellis, R.A. (1967). A comparative electron microscope study of 561 visceral muscle fibers in Cambarus, Drosophila and Lumbricus. Z. Für Zellforsch. 562 Mikrosk. Anat. 79, 581–591.

563 Andrew, A. (1974). Further evidence that enterochromaffin cells are not derived from the 564 neural crest. Development 31, 589–598.

565 Andrikou, C., Iovene, E., Rizzo, F., Oliveri, P., and Arnone, M.I. (2013). Myogenesis in 566 the sea urchin embryo: the molecular fingerprint of the myoblast precursors. EvoDevo 4, 33. 567 33.

568 Arendt, D. (2003). Evolution of eyes and photoreceptor cell types. Int. J. Dev. Biol. 47, 569 563–572.

570 Arendt, D. (2008). The evolution of cell types in animals: emerging principles from 571 molecular studies. Nat. Rev. Genet. 9, 868–882.

572 Arendt, D., Musser, J.M., Baker, C.V.H., Bergman, A., Cepko, C., Erwin, D.H., Pavlicev, 573 M., Schlosser, G., Widder, S., Laubichler, M.D., et al. (2016). The origin and evolution 574 of cell types. Nat. Rev. Genet. advance online publication.

575 Asadulina, A., Panzera, A., Verasztó, C., Liebig, C., and Jékely, G. (2012). Whole-body 576 gene expression pattern registration in Platynereis larvae. EvoDevo 3, 27.

577 Au, Y., Atkinson, R.A., Guerrini, R., Kelly, G., Joseph, C., Martin, S.R., Muskett, F.W., 578 Pallavicini, A., Faulkner, G., and Pastore, A. (2004). Solution Structure of ZASP PDZ 579 Domain: Implications for Sarcomere Ultrastructure and Enigma Family Redundancy. 580 Structure 12, 611–622.

581 Ayme-Southgate, A., Lasko, P., French, C., and Pardue, M.L. (1989). Characterization of 582 the gene for mp20: a Drosophila muscle protein that is not found in asynchronous 583 oscillatory flight muscle. J. Cell Biol. 108, 521–531.

584 Azpiazu, N., and Frasch, M. (1993). tinman and bagpipe: two homeo box genes that 585 determine cell fates in the dorsal mesoderm of Drosophila. Genes Dev. 7, 1325–1340.

586 Balagopalan, L., Keller, C.A., and Abmayr, S.M. (2001). Loss-of-Function Mutations 587 Reveal That the Drosophila nautilus Gene Is Not Essential for Embryonic Myogenesis or 588 Viability. Dev. Biol. 231, 374–382.

589 Bárány, M. (1967). ATPase activity of myosin correlated with speed of muscle 590 shortening. J. Gen. Physiol. 50, 197–218.

591 Barna, J., Csoknya, M., Lázár, Z., Barthó, L., Hámori, J., and Elekes, K. (2001). 592 Distribution and action of some putative neurotransmitters in the stomatogastric nervous 593 system of the earthworm, Eisenia fetida (Oligochaeta, Annelida). J. Neurocytol. 30, 313– 325. 594 325.

595 Beall, C.J., and Fyrberg, E. (1991). Muscle abnormalities in Drosophila melanogaster 596 heldup mutants are caused by missing or aberrant troponin-I isoforms. J. Cell Biol. 114, 597 941–951.

598 Black, B.L., and Olson, E.N. (1998). Transcriptional control of muscle development by 599 myocyte enhancer factor-2 (MEF2) proteins. Annu. Rev. Cell Dev. Biol. 14, 167–196.

600 Blais, A., Tsikitis, M., Acosta-Alvear, D., Sharan, R., Kluger, Y., and Dynlacht, B.D. 601 (2005). An initial blueprint for myogenic differentiation. Genes Dev. 19, 553–569.

602 Bohrmann, J., and Haas-Assenbaum, A. (1993). Gap junctions in ovarian follicles of 603 Drosophila melanogaster: inhibition and promotion of dye-coupling between oocyte and 604 follicle cells. Cell Tissue Res. 273, 163–173.

605 Bourlat, S.J., Nielsen, C., Lockyer, A.E., Littlewood, D.T.J., and Telford, M.J. (2003). 606 Xenoturbella is a deuterostome that eats molluscs. Nature 424, 925–928.

607 Bourlat, S.J., Juliusdottir, T., Lowe, C.J., Freeman, R., Aronowicz, J., Kirschner, M., 608 Lander, E.S., Thorndyke, M., Nakano, H., Kohn, A.B., et al. (2006). Deuterostome 609 phylogeny reveals monophyletic chordates and the new phylum Xenoturbellida. Nature 610 444, 85–88.

611 Brownlee, D.J.A., Fairweather, I., Johnston, C.F., and Shaw, C. (1994). 612 Immunocytochemical demonstration of peptidergic and serotoninergic components in the 613 enteric nervous system of the roundworm, Ascaris suum (Nematoda, Ascaroidea). 614 Parasitology 108, 89–103.

615 Brunet, T., and Arendt, D. (2016a). From damage response to action potentials: early 616 evolution of neural and contractile modules in stem eukaryotes. Philos. Trans. R. Soc. 617 Lond. B. Biol. Sci. 371, 20150043.

618 Brunet, T., and Arendt, D. (2016b). Animal Evolution: The Hard Problem of Cartilage 619 Origins. Curr. Biol. 26, R685–R688.

620 Bulbring, E., and Crema, A. (1959). The release of 5-hydroxytryptamine in relation to 621 pressure exerted on the intestinal mucosa. J. Physiol. 146, 18–28.

622 Burke, R.D. (1981). Structure of the digestive tract of the pluteus larva of Dendraster 623 excentricus (Echinodermata: Echinoida). Zoomorphology 98, 209–225.

624 Burnstock, G. (1958). The Effect of Drugs on Spontaneous Motility and on Response to 625 Stimulation of the Extrinsic Nerves of the Gut of a Teleostean Fish. Br. J. Pharmacol. 626 Chemother. 13, 216–226.

627 Burr, A., and Gans, C. (1998). Mechanical Significance of Obliquely Striated 628 Architecture in Nematode Muscle. Biol. Bull. 194, 1–6.

629 Cannon, J.T., Vellutini, B.C., Smith, J., Ronquist, F., Jondelius, U., and Hejnol, A. 630 (2016). Xenacoelomorpha is the sister group to Nephrozoa. Nature 530, 89–93.

631 Carnevali, M.D.C., and Ferraguti, M. (1979). Structure and ultrastructure of muscles in 632 the priapulid Halicryptus spinulosus: functional and phylogenetic remarks. J. Mar. Biol. 633 Assoc. U. K. 59, 737–748.

634 Carson, J.A., Schwartz, R.J., and Booth, F.W. (1996). SRF and TEF-1 control of chicken 635 skeletal alpha-actin gene during slow-muscle hypertrophy. Am. J. Physiol. - Cell Physiol. 636 270, C1624–C1633.

637 Chiodin, M., Achatz, J.G., Wanninger, A., and Martinez, P. (2011). Molecular 638 architecture of muscles in an acoel and its evolutionary implications. J. Exp. Zoolog. B 639 Mol. Dev. Evol. 316B, 427–439.

640 Copenhaver, P.F., and Taghert, P.H. (1989). Development of the enteric nervous system 641 in the moth. Dev. Biol. 131, 70–84.

642 Corsi, A.K., Kostas, S.A., Fire, A., and Krause, M. (2000). Caenorhabditis elegans twist 643 plays an essential role in non-striated muscle development. Development 127, 2041– 644 2051.

645 Creemers, E.E., Sutherland, L.B., Oh, J., Barbosa, A.C., and Olson, E.N. (2006). 646 Coactivation of MEF2 by the SAP Domain Proteins Myocardin and MASTR. Mol. Cell 647 23, 83–96.

648 Csoknya, M., Lengvári, I., Benedeczky, I., and Hámori, J. (1991). Immunohistochemical 649 and ultrastructural study of the enteric nervous system of earthworm, Lumbricus terrestris 650 L. Acta Biol. Hung. 43, 241–251.

651 Dayraud, C., Alié, A., Jager, M., Chang, P., Le Guyader, H., Manuel, M., and Quéinnec, 652 E. (2012). Independent specialisation of myosin II paralogues in muscle vs. non-muscle 653 functions during early animal evolution: a ctenophore perspective. BMC Evol. Biol. 12, 107. 654 107.

655 Denes, A.S., Jékely, G., Steinmetz, P.R.H., Raible, F., Snyman, H., Prud’homme, B., 656 Ferrier, D.E.K., Balavoine, G., and Arendt, D. (2007). Molecular architecture of annelid 657 nerve cord supports common origin of nervous system centralization in bilateria. Cell 658 129, 277–288.

659 Deutsch, J. (2005). Hox and wings. BioEssays News Rev. Mol. Cell. Dev. Biol. 27, 673– 675. 660 675.

661 Durocher, D., Charron, F., Warren, R., Schwartz, R.J., and Nemer, M. (1997). The 662 cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 16, 663 5687–5696.

664 Duvert, M., and Salat, C. (1995). Ultrastructural Studies of the Visceral Muscles of 665 Chaetognaths. Acta Zool. 76, 75–87.

666 Endo, T., and Obinata, T. (1981). Troponin and Its Components from Ascidian Smooth 667 Muscle. J. Biochem. (Tokyo) 89, 1599–1608.

668 Enriquez, J., de Taffin, M., Crozatier, M., Vincent, A., and Dubois, L. (2012). 669 Combinatorial coding of Drosophila muscle shape by Collier and Nautilus. Dev. Biol. 670 363, 27–39.

671 Faccioni-Heuser, M.C., Zancan, D.M., Lopes, C.Q., and Achaval, M. (1999). The pedal 672 muscle of the land snail Megalobulimus oblongus (Gastropoda, Pulmonata): an 673 ultrastructure approach. Acta Zool. 80, 325–337.

674 Faussone‐Pellegrini, M.-S., and Thuneberg, L. (1999). Guide to the identification of 675 interstitial cells of Cajal. Microsc. Res. Tech. 47, 248–266.

676 Feral, J.-P., and Massin, C. (1982). Digestive systems: Holothuroidea. Echinoderm Nutr. 677 191–212.

678 Finkbeiner, S. (1992). Calcium waves in astrocytes-filling in the gaps. Neuron 8, 1101– 679 1108.

680 Fischer, A.H., Henrich, T., and Arendt, D. (2010). The normal development of 681 Platynereis dumerilii (Nereididae, Annelida). Front. Zool. 7, 1.

682 Fontaine, J., and Le Douarin, N.M. (1977). Analysis of endoderm formation in the avian 683 blastoderm by the use of quail-chick chimaeras. Development 41, 209–222.

684 Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y., and Postlethwait, J. (1999). 685 Preservation of Duplicate Genes by Complementary, Degenerative Mutations. Genetics 686 151, 1531–1545.

687 Francés, R., Tumang, J.R., Kaku, H., Gurdak, S.M., and Rothstein, T.L. (2006). B-1 cells 688 express transgelin 2: unexpected lymphocyte expression of a smooth muscle protein 689 identified by proteomic analysis of peritoneal B-1 cells. Mol. Immunol. 43, 2124–2129.

690 Furukawa, Y., Nakamaru, K., Wakayama, H., Fujisawa, Y., Minakata, H., Ohta, S., 691 Morishita, F., Matsushima, O., Li, L., Romanova, E., et al. (2001). The Enterins: A Novel 692 Family of Neuropeptides Isolated from the Enteric Nervous System and CNS of Aplysia. 693 J. Neurosci. 21, 8247–8261.

694 Fyrberg, C., Parker, H., Hutchison, B., and Fyrberg, E. (1994). Drosophila melanogaster 695 genes encoding three troponin-C isoforms and a calmodulin-related protein. Biochem. 696 Genet. 32, 119–135.

697 Fyrberg, E., Fyrberg, C.C., Beall, C., and Saville, D.L. (1990). Drosophila melanogaster 698 troponin-T mutations engender three distinct syndromes of myofibrillar abnormalities. J. 699 Mol. Biol. 216, 657–675.

700 García-Arrarás, J., Enamorado-Ayala, I., Torres-Avillán, I., and Rivera, V. (1991). 701 FMRFamide-like immunoreactivity in cells and fibers of the holothurian nervous system. 702 Neurosci. Lett. 132, 199–202.

703 García-Arrarás, J.E., Rojas-Soto, M., Jimenez, L.B., and Diaz-Miranda, L. (2001). The 704 enteric nervous system of echinoderms: unexpected complexity revealed by 705 neurochemical analysis. J. Exp. Biol. 204, 865–873.

706 Genikhovich, G., and Technau, U. (2011). Complex functions of Mef2 splice variants in 707 the differentiation of endoderm and of a neuronal cell type in a sea anemone. 708 Development 138, 4911–4919.

709 Gho, M. (1994). Voltage-clamp analysis of gap junctions between embryonic muscles in 710 Drosophila. J. Physiol. 481, 371–383.

711 Gillis, W.J., Bowerman, B., and Schneider, S.Q. (2007). Ectoderm‐and endomesoderm‐ 712 specific GATA transcription factors in the marine annelid Platynereis dumerilli. Evol. 713 Dev. 9, 39–50.

714 Gimona, M., Kaverina, I., Resch, G.P., Vignal, E., and Burgstaller, G. (2003). Calponin 715 repeats regulate actin filament stability and formation of podosomes in smooth muscle 716 cells. Mol. Biol. Cell 14, 2482–2491.

717 Goldstein, M.A., and Burdette, W.J. (1971). Striated visceral muscle of Drosophila 718 melanogaster. J. Morphol. 134, 315–334.

719 Goodson, H.V., and Spudich, J.A. (1993). Molecular evolution of the myosin family: 720 relationships derived from comparisons of amino acid sequences. Proc. Natl. Acad. Sci. 721 U. S. A. 90, 659–663.

722 Gopalakrishnan, S., Comai, G., Sambasivan, R., Francou, A., Kelly, R.G., and Tajbakhsh, 723 S. (2015). A cranial mesoderm origin for esophagus striated muscles. Dev. Cell 34, 694– 704. 724 704.

725 Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., and Gascuel, O. 726 (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: 727 assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321.

728 Han, Z., Li, X., Wu, J., and Olson, E.N. (2004). A myocardin-related transcription factor 729 regulates activity of serum response factor in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 730 101, 12567–12572.

731 Hirakow, R. (1985). The vertebrate heart in relation to the protochordates. Fortschr. Zool. 732 30, 367–369.

733 Hobert, O. (2016). Chapter Twenty-Five - Terminal Selectors of Neuronal Identity. In 734 Current Topics in Developmental Biology, P.M. Wassarman, ed. (Academic Press), pp. 735 455–475.

736 Hoggatt, A.M., Kim, J.-R., Ustiyan, V., Ren, X., Kalin, T.V., Kalinichenko, V.V., and 737 Herring, B.P. (2013). The Transcription Factor Foxf1 Binds to Serum Response Factor 738 and Myocardin to Regulate Gene Transcription in Visceral Smooth Muscle Cells. J. Biol. 739 Chem. 288, 28477–28487.

740 Hooper, S.L., and Thuma, J.B. (2005). Invertebrate muscles: muscle specific genes and 741 proteins. Physiol. Rev. 85, 1001–1060.

742 Hooper, S.L., Hobbs, K.H., and Thuma, J.B. (2008). Invertebrate muscles: thin and thick 743 filament structure; molecular basis of contraction and its regulation, catch and 744 asynchronous muscle. Prog. Neurobiol. 86, 72–127.

745 Jakobsen, J.S., Braun, M., Astorga, J., Gustafson, E.H., Sandmann, T., Karzynski, M., 746 Carlsson, P., and Furlong, E.E.M. (2007). Temporal ChIP-on-chip reveals Biniou as a 747 universal regulator of the visceral muscle transcriptional network. Genes Dev. 21, 2448– 748 2460.

749 Jensen, H. (1974). Ultrastructural studies of the hearts in Arenicola marina L. (Annelida: 750 Polychaeta). Cell Tissue Res. 156, 127–144.

751 Jensen, H., and Myklebust, R. (1975). Ultrastructure of muscle cells in Siboglinum 752 fiordicum (Pogonophora). Cell Tissue Res. 163, 185–197.

753 Kamm, K.E., and Stull, J.T. (1985). The function of myosin and myosin light chain 754 kinase phosphorylation in smooth muscle. Annu. Rev. Pharmacol. Toxicol. 25, 593–620.

755 Katzemich, A., Long, J.Y., Jani, K., Lee, B.R., and Schöck, F. (2011). Muscle type- 756 specific expression of Zasp52 isoforms in Drosophila. Gene Expr. Patterns 11, 484–490.

757 Kawaguti, S., and Ikemoto, N. (1965). Electron microscopy on the longitudinal muscle of 758 the sea-cucumber (Stichopus japonicus). Ebashi Al Ed. Mol. Biol. Muscular Contract. 759 Tokyo Igaku Shoin Ltd XII 124–131.

760 Kawano, T., Po, M.D., Gao, S., Leung, G., Ryu, W.S., and Zhen, M. (2011). An 761 imbalancing act: gap junctions reduce the backward motor circuit activity to bias C. 762 elegans for forward locomotion. Neuron 72, 572–586.

763 Kiehn, O., and Tresch, M.C. (2002). Gap junctions and motor behavior. Trends Neurosci. 764 25, 108–115.

765 Kierszenbaum, A.L., and Tres, L. (2015). Histology and Cell Biology: An Introduction to 766 Pathology, 4e (Philadelphia, PA: Saunders).

767 Kobayashi, C., Kobayashi, S., Orii, H., Watanabe, K., and Agata, K. (1998). 768 Identification of Two Distinct Muscles in the Planarian Dugesia japonica by their 769 Expression of Myosin Heavy Chain Genes. Zoolog. Sci. 15, 861–869.

770 Labeit, S., and Kolmerer, B. (1995). Titins: Giant Proteins in Charge of Muscle 771 Ultrastructure and Elasticity. Science 270, 293–296.

772 Lan, X., and Pritchard, J.K. (2016). Coregulation of tandem duplicate genes slows 773 evolution of subfunctionalization in mammals. Science 352, 1009–1013.

774 Lauri, A., Brunet, T., Handberg-Thorsager, M., Fischer, A.H.L., Simakov, O., Steinmetz, 775 P.R.H., Tomer, R., Keller, P.J., and Arendt, D. (2014). Development of the annelid 776 axochord: insights into notochord evolution. Science 345, 1365–1368.

777 Le Douarin, N.M., and Teillet, M.-A. (1973). The migration of neural crest cells to the 778 wall of the digestive tract in avian embryo. Development 30, 31–48.

779 Lee, H.-H., Zaffran, S., and Frasch, M. (2006). Development of the larval visceral 780 musculature. In Muscle Development in Drosophila, (Springer), pp. 62–78.

781 Lee, Y., Shioi, T., Kasahara, H., Jobe, S.M., Wiese, R.J., Markham, B.E., and Izumo, S. 782 (1998). The Cardiac Tissue-Restricted Homeobox Protein Csx/Nkx2.5 Physically 783 Associates with the Zinc Finger Protein GATA4 and Cooperatively Activates Atrial 784 Natriuretic Factor Gene Expression. Mol. Cell. Biol. 18, 3120–3129.

785 Leininger, S., Adamski, M., Bergum, B., Guder, C., Liu, J., Laplante, M., Bråte, J., 786 Hoffmann, F., Fortunato, S., Jordal, S., et al. (2014). Developmental gene expression 787 provides clues to relationships between sponge and eumetazoan body plans. Nat. 788 Commun. 5, 3905.

789 Li, L., Miano, J.M., Cserjesi, P., and Olson, E.N. (1996). SM22α, a Marker of Adult 790 Smooth Muscle, Is Expressed in Multiple Myogenic Lineages During Embryogenesis. 791 Circ. Res. 78, 188–195.

792 Liang, C., FANTOM Consortium, Forrest, A.R.R., and Wagner, G.P. (2015). The 793 statistical geometry of transcriptome divergence in cell-type evolution and cancer. Nat. 794 Commun. 6, 6066.

795 Lièvre, C.S.L., and Le Douarin, N.M. (1975). Mesenchymal derivatives of the neural 796 crest: analysis of chimaeric quail and chick embryos. Development 34, 125–154.

797 Mackie, G.O. (1970). Neuroid conduction and the evolution of conducting tissues. Q. 798 Rev. Biol. 45, 319–332.

799 Malo, M., Vurpillot, C., Tomasi, M., Bruner, J., Stinnakre, J., and Israël, M. (2000). 800 Effect of brefeldin A on acetylcholine release from glioma C6BU-1 cells. 801 Neuropharmacology 39, 2214–2221.

802 Marieb, E.N., and Hoehn, K.N. (2015). Human Anatomy & Physiology (Boston: 803 Pearson).

804 Marín, M.-C., Rodríguez, J.-R., and Ferrús, A. (2004). Transcription of Drosophila 805 Troponin I Gene Is Regulated by Two Conserved, Functionally Identical, Synergistic 806 Elements. Mol. Biol. Cell 15, 1185–1196.

807 Martindale, M.Q., Pang, K., and Finnerty, J.R. (2004). Investigating the origins of 808 triploblasty:mesodermal’gene expression in a diploblastic animal, the sea anemone 809 Nematostella vectensis (phylum, Cnidaria; class, Anthozoa). Development 131, 2463– 810 2474.

811 Martín-Durán, J.M., and Hejnol, A. (2015). The study of Priapulus caudatus reveals 812 conserved molecular patterning underlying different gut morphogenesis in the 813 Ecdysozoa. BMC Biol. 13, 29.

814 Martynova, M.G. (1995). Possible Cellular Mechanisms of Heart Muscle Growth in 815 Invertebratea. Ann. N. Y. Acad. Sci. 752, 149–157.

816 Martynova, M.G. (2004). Proliferation and Differentiation Processes in the Heart Muscle 817 Elements in Different Phylogenetic Groups. B.-I.R. of Cytology, ed. (Academic Press), 818 pp. 215–250.

819 McKeown, C.R., Han, H.-F., and Beckerle, M.C. (2006). Molecular characterization of 820 the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev. Dyn. 235, 530–538.

821 Meadows, S.M., Warkman, A.S., Salanga, M.C., Small, E.M., and Krieg, P.A. (2008). 822 The myocardin-related transcription factor, MASTR, cooperates with MyoD to activate 823 skeletal muscle gene expression. Proc. Natl. Acad. Sci. 105, 1545–1550.

824 Meedel, T.H., and Hastings, K.E. (1993). Striated muscle-type tropomyosin in a chordate 825 smooth muscle, ascidian body-wall muscle. J. Biol. Chem. 268, 6755–6764.

826 Meulemans, D., and Bronner-Fraser, M. (2007). Insights from Amphioxus into the 827 Evolution of Vertebrate Cartilage. PLOS ONE 2, e787.

828 Mill, P.J., and Knapp, M.F. (1970). The Fine Structure of Obliquely Striated Body Wall 829 Muscles in the Earthworm, Lumbricus Terrestris LINN. J. Cell Sci. 7, 233–261.

830 Misumi, Y., Miki, K., Takatsuki, A., Tamura, G., and Ikehara, Y. (1986). Novel blockade 831 by brefeldin A of intracellular transport of secretory proteins in cultured rat hepatocytes. 832 J. Biol. Chem. 261, 11398–11403.

833 Molkentin, J.D., Black, B.L., Martin, J.F., and Olson, E.N. (1995). Cooperative activation 834 of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 83, 1125–1136.

835 Morin, S., Charron, F., Robitaille, L., and Nemer, M. (2000). GATA-dependent 836 recruitment of MEF2 proteins to target promoters. EMBO J. 19, 2046–2055.

837 Musser, J.M., and Wagner, G.P. (2015). Character trees from transcriptome data: Origin 838 and individuation of morphological characters and the so-called “species signal.” J. Exp. 839 Zoolog. B Mol. Dev. Evol. 324, 588–604.

840 Myers, C.D., Goh, P.Y., Allen, T.S., Bucher, E.A., and Bogaert, T. (1996). 841 Developmental genetic analysis of troponin T mutations in striated and nonstriated 842 muscle cells of Caenorhabditis elegans. J. Cell Biol. 132, 1061–1077.

843 Nagai, T., and Brown, B.E. (1969). Insect visceral muscle. Electrical potentials and 844 contraction in fibres of the cockroach proctodeum. J. Insect Physiol. 15, 2151–2167.

845 Nishida, W., Nakamura, M., Mori, S., Takahashi, M., Ohkawa, Y., Tadokoro, S., 846 Yoshida, K., Hiwada, K., Hayashi, K. ’ichiro, and Sobue, K. (2002). A Triad of Serum 847 Response Factor and the GATA and NK Families Governs the Transcription of Smooth 848 and Cardiac Muscle Genes. J. Biol. Chem. 277, 7308–7317.

849 Nyitray, L., Jancsó, A., Ochiai, Y., Gráf, L., and Szent-Györgyi, A.G. (1994). Scallop 850 striated and smooth muscle myosin heavy-chain isoforms are produced by alternative 851 RNA splicing from a single gene. Proc. Natl. Acad. Sci. 91, 12686–12690.

852 Nylund, A., Ruhberg, H., Tjonneland, A., and Meidell, B. (1988). Heart ultrastructure in 853 four species of Onychophora (Peripatopsidae and Peripatidae) and phylogenetic 854 implications. Zool Beitr 32, 17–30.

855 Obinata, T., Ooi, A., and Takano-Ohmuro, H. (1983). Myosin and actin from ascidian 856 smooth muscle and their interaction. Comp. Biochem. Physiol. Part B Comp. Biochem. 857 76, 437–442.

858 Ojima, T., and Nishita, K. (1986). Isolation of Troponins from Striated and Smooth 859 Adductor Muscles of Akazara Scallop. J. Biochem. (Tokyo) 100, 821–824.

860 Økland, S. (1980). The heart ultrastructure of Lepidopleurus asellus (Spengler) and 861 Tonicella marmorea (Fabricius)(Mollusca: Polyplacophora). Zoomorphology 96, 1–19.

862 OOta, S., and Saitou, N. (1999). Phylogenetic relationship of muscle tissues deduced 863 from superimposition of gene trees. Mol. Biol. Evol. 16, 856–867.

864 Paniagua, R., Royuela, M., García-Anchuelo, R.M., and Fraile, B. (1996). Ultrastructure 865 of invertebrate muscle cell types. Histol. Histopathol. 11, 181–201.

866 Phiel, C.J., Gabbeta, V., Parsons, L.M., Rothblat, D., Harvey, R.P., and McHugh, K.M. 867 (2001). Differential Binding of an SRF/NK-2/MEF2 Transcription Factor Complex in 868 Normal Versus Neoplastic Smooth Muscle Tissues. J. Biol. Chem. 276, 34637–34650.

869 Philippe, H., Brinkmann, H., Copley, R.R., Moroz, L.L., Nakano, H., Poustka, A.J., 870 Wallberg, A., Peterson, K.J., and Telford, M.J. (2011). Acoelomorph flatworms are 871 deuterostomes related to Xenoturbella. Nature 470, 255–258.

872 Prosser, C.L., Nystrom, R.A., and Nagai, T. (1965). Electrical and mechanical activity in 873 intestinal muscles of several invertebrate animals. Comp. Biochem. Physiol. 14, 53–70.

874 Raible, F., Tessmar-Raible, K., Osoegawa, K., Wincker, P., Jubin, C., Balavoine, G., 875 Ferrier, D., Benes, V., De Jong, P., and Weissenbach, J. (2005). Vertebrate-type intron- 876 rich genes in the marine annelid Platynereis dumerilii. Science 310, 1325–1326.

877 Reynolds, P.D., Morse, M.P., and Norenburg, J. (1993). Ultrastructure of the Heart and 878 Pericardium of an Aplacophoran Mollusc (Neomeniomorpha): Evidence for 879 Ultrafiltration of Blood. Proc. R. Soc. Lond. B Biol. Sci. 254, 147–152.

880 Rieger, R., Salvenmoser, W., Legniti, A., Reindl, S., Adam, H., Simonsberger, P., and 881 Tyler, S. (1991). Organization and differentiation of the body-wall musculature in 882 Macrostomum (Turbellaria, Macrostomidae). Hydrobiologia 227, 119–129.

883 Roach, D.K. (1968). Rhythmic muscular activity in the alimentary tract of Arion ater 884 (L.)(Gastropoda: Pulmonata). Comp. Biochem. Physiol. 24, 865–878.

885 Rogers, D.C. (1969). Fine structure of smooth muscle and neuromuscular junctions in the 886 foot of Helix aspersa. Z. Für Zellforsch. Mikrosk. Anat. 99, 315–335.

887 Rosenbluth, J. (1972). Obliquely striated muscle. In The Structure and Function of 888 Muscle, (New York and London: Academic Press), pp. 389–420.

889 Royuela, M., Fraile, B., Picazo, M.L., and Paniagua, R. (1997). Immunocytochemical 890 electron microscopic study and Western blot analysis of caldesmon and calponin in 891 striated muscle of the fruit fly Drosophila melanogaster and in several muscle cell types 892 of the earthworm Eisenia foetida. Eur. J. Cell Biol. 72, 90–94.

893 Royuela, M., Fraile, B., Arenas, M.I., and Paniagua, R. (2000). Characterization of 894 several invertebrate muscle cell types: a comparison with vertebrate muscles. Microsc. 895 Res. Tech. 48, 107–115.

896 Sanders, K.M., Koh, S.D., and Ward, S.M. (2006). Interstitial cells of Cajal as 897 pacemakers in the gastrointestinal tract. Annu Rev Physiol 68, 307–343.

898 Saudemont, A., Dray, N., Hudry, B., Le Gouar, M., Vervoort, M., and Balavoine, G. 899 (2008). Complementary striped expression patterns of NK homeobox genes during 900 segment formation in the annelid Platynereis. Dev. Biol. 317, 430–443.

901 Schlesinger, J., Schueler, M., Grunert, M., Fischer, J.J., Zhang, Q., Krueger, T., Lange, 902 M., Tönjes, M., Dunkel, I., and Sperling, S.R. (2011). The Cardiac Transcription 903 Network Modulated by Gata4, Mef2a, Nkx2.5, Srf, Histone Modifications, and 904 MicroRNAs. PLOS Genet 7, e1001313.

905 Schmidt-Rhaesa, A. (2007). The Evolution of Organ Systems (Oxford ; New York: 906 Oxford University Press).

907 Sebé-Pedrós, A., Grau-Bové, X., Richards, T.A., and Ruiz-Trillo, I. (2014). Evolution 908 and classification of myosins, a paneukaryotic whole-genome approach. Genome Biol. 909 Evol. 6, 290–305.

910 Sefton, E.M., Piekarski, N., and Hanken, J. (2015). Dual embryonic origin and patterning 911 of the pharyngeal skeleton in the axolotl (Ambystoma mexicanum). Evol. Dev. 17, 175– 184. 912 184.

913 Serb, J.M., and Oakley, T.H. (2005). Hierarchical phylogenetics as a quantitative 914 analytical framework for evolutionary developmental biology. Bioessays 27, 1158–1166.

915 Shaw, K. (1974). The fine structure of muscle cells and their attachments in the 916 tardigrade Macrobiotus hufelandi. Tissue Cell 6, 431–445.

917 Shi, X., and Garry, D.J. (2006). Muscle stem cells in development, regeneration, and 918 disease. Genes Dev. 20, 1692–1708.

919 Shimeld, S.M., and Holland, P.W.H. (2000). Vertebrate innovations. Proc. Natl. Acad. 920 Sci. 97, 4449–4452.

921 Shimeld, S.M., Boyle, M.J., Brunet, T., Luke, G.N., and Seaver, E.C. (2010). Clustered 922 Fox genes in lophotrochozoans and the evolution of the bilaterian Fox gene cluster. Dev. 923 Biol. 340, 234–248.

924 Silverthorn, D.U. (2015). Human Physiology: An Integrated Approach (San Francisco: 925 Pearson).

926 Spies, R.B. (1973). The blood system of the flabelligerid polychaete Flabelliderma 927 commensalis (Moore). J. Morphol. 139, 465–490.

928 Steinmetz, P.R.H., Kraus, J.E.M., Larroux, C., Hammel, J.U., Amon-Hassenzahl, A., 929 Houliston, E., Wörheide, G., Nickel, M., Degnan, B.M., and Technau, U. (2012). 930 Independent evolution of striated muscles in cnidarians and bilaterians. Nature 487, 231– 234. 931 234.

932 Sulbarán, G., Alamo, L., Pinto, A., Márquez, G., Méndez, F., Padrón, R., and Craig, R. 933 (2015). An invertebrate smooth muscle with striated muscle myosin filaments. Proc. Natl. 934 Acad. Sci. 112, E5660–E5668.

935 Susic-Jung, L., Hornbruch-Freitag, C., Kuckwa, J., Rexer, K.-H., Lammel, U., and 936 Renkawitz-Pohl, R. (2012). Multinucleated smooth muscles and mononucleated as well 937 as multinucleated striated muscles develop during establishment of the male reproductive 938 organs of Drosophila melanogaster. Dev. Biol. 370, 86–97.

939 Sweeney, H.L., Bowman, B.F., and Stull, J.T. (1993). Myosin light chain 940 phosphorylation in vertebrate striated muscle: regulation and function. Am. J. Physiol.- 941 Cell Physiol. 264, C1085–C1095.

942 Tarazona, O.A., Slota, L.A., Lopez, D.H., Zhang, G., and Cohn, M.J. (2016). The genetic 943 program for cartilage development has deep homology within Bilateria. Nature 533, 86– 89. 944 89.

945 Telkes, I., Csoknya, M., Buzás, P., Gábriel, R., Hámori, J., and Elekes, K. (1996). 946 GABA-immunoreactive neurons in the central and peripheral nervous system of the 947 earthworm, Lumbricus terrestris (Oligochaeta, Annelida). Cell Tissue Res. 285, 463–475.

948 Thor, S., and Thomas, J.B. (2002). Motor neuron specification in worms, flies and mice: 949 conserved and “lost” mechanisms. Curr. Opin. Genet. Dev. 12, 558–564.

950 Tjønneland, A., Økland, S., and Nylund, A. (1987). Evolutionary aspects of the arthropod 951 heart. Zool. Scr. 16, 167–175.

952 Wagner, G.P. (2014). Homology, Genes, and Evolutionary Innovation (Princeton ; 953 Oxford: Princeton University Press).

954 Wales, S., Hashemi, S., Blais, A., and McDermott, J.C. (2014). Global MEF2 target gene 955 analysis in cardiac and skeletal muscle reveals novel regulation of DUSP6 by p38MAPK- 956 MEF2 signaling. Nucleic Acids Res. gku813.

957 Wang, D.-Z., and Olson, E.N. (2004). Control of smooth muscle development by the 958 myocardin family of transcriptional coactivators. Curr. Opin. Genet. Dev. 14, 558–566.

959 Wang, Z., Wang, D.-Z., Pipes, G.C.T., and Olson, E.N. (2003). Myocardin is a master 960 regulator of smooth muscle gene expression. Proc. Natl. Acad. Sci. 100, 7129–7134.

961 Wei, Q., Rong, Y., and Paterson, B.M. (2007). Stereotypic founder cell patterning and 962 embryonic muscle formation in Drosophila require nautilus (MyoD) gene function. Proc. 963 Natl. Acad. Sci. 104, 5461–5466.

964 White, J. (1988). 4 The Anatomy. Nematode Caenorhabditis Elegans - Cold Spring Harb. 965 Monogr. Arch. 17, 81–122.

966 Witchley, J.N., Mayer, M., Wagner, D.E., Owen, J.H., and Reddien, P.W. (2013). Muscle 967 Cells Provide Instructions for Planarian Regeneration. Cell Rep. 4, 633–641.

968 Wood, J.D. (1969). Electrophysiological and pharmacological properties of the stomach 969 of the squid Loligo pealii (Lesueur). Comp. Biochem. Physiol. 30, 813–824.

970 Wu, K.S. (1939). On the physiology and pharmacology of the earthworm gut. J Exp Biol 971 16, 184–197.

972 Zaffran, S., Küchler, A., Lee, H.-H., and Frasch, M. (2001). biniou (FoxF), a central 973 component in a regulatory network controlling visceral mesoderm development and 974 midgut morphogenesis in Drosophila. Genes Dev. 15, 2900–2915.

975 Zhang, Y., Featherstone, D., Davis, W., Rushton, E., and Broadie, K. (2000). Drosophila 976 D-titin is required for myoblast fusion and skeletal muscle striation. J. Cell Sci. 113, 977 3103–3115.

978 Zhou, Q., Chu, P.H., Huang, C., Cheng, C.F., Martone, M.E., Knoll, G., Shelton, G.D., 979 Evans, S., and Chen, J. (2001). Ablation of Cypher, a PDZ-LIM domain Z-line protein, 980 causes a severe form of congenital myopathy. J. Cell Biol. 155, 605–612.

981 982

983 Figure 1. Ultrastructure and core regulatory complexes of myocyte types.

984 (A) Schematic smooth and striated ultrastructures. Electron-dense granules called “dense

985 bodies” separate adjacent myofibrils. Dense bodies are scattered in smooth muscles, but

986 aligned in striated muscles to form Z lines. (B-D) Core regulatory complexes (CRC) of

987 transcription factors for the differentiation of different types of myocytes in vertebrates.

988 Complexes composition from (Creemers et al., 2006; Meadows et al., 2008; Molkentin et

989 al., 1995) for skeletal myocytes, (Hoggatt et al., 2013; Nishida et al., 2002; Phiel et al.,

990 2001) for smooth myocytes, and (Durocher et al., 1997; Lee et al., 1998) for

991 cardiomyocytes. Target genes from (Blais et al., 2005) for skeletal myocytes, (Nishida et

992 al., 2002) from smooth myocytes, and (Schlesinger et al., 2011) for cardiomyocytes.

993

994 Figure 2. Development and ultrastructure of visceral and somatic musculature in

995 Platynereis larvae and juveniles. (A) Development of visceral musculature. All panels

996 are 3D renderings of rhodamine-phalloidin staining imaged by confocal microscopy.

997 Visceral muscles have been manually colored green and somatic muscle red. Scale bar:

998 50 μm. (B) Schematic of the musculature of a late nectochaete (6 dpf) larva. Body outline

999 modified from (Fischer et al., 2010). Ventral view, anterior is up. (C-M) Electron

1000 micrographs of the main muscle groups depicted in B. Each muscle group is shown

1001 sectioned parallel to its long axis, so in the plane of its myofilaments. Scale bar: 2 μm.

1002 (C’,E’) are schematic drawings of the cells shown in (C,E). The Z-lines are made of

1003 aligned dense bodies (in black), myofilaments are in red, cytoplasm is in yellow and

1004 plasma membrane in grey. Attachment points of myofilaments on the dense bodies are

1005 represented with dotted lines when they are outside of the plane of section in the electron

1006 micrograph. Zoom panel in C’ shows oblique striation with a 5° angle between

1007 myofilaments and Z-lines (compare to Figure 1A). (H) shows another cross-section in the

1008 stomodeum of the individual shown in G, in the region encased by the yellow box, and

1009 observed at a higher magnification. (J) shows the dorsal midgut in cross-section, dorsal

1010 side up.

1011

1012 Figure 2—figure supplement 1. Gut patterning in Platynereis 6 dpf larvae. (A) 6 dpf

1013 Platynereis larva stained with phalloidin and DAPI to show tripartite gut organization.

1014 Maximal Z-projection of a confocal stack, ventral view, anterior side up. The plane of the

1015 cross-sections of Figure 2—figure supplement 2 (in slightly older individuals of

1016 otherwise similar morphology) is indicated by the dotted line. (B-E) WMISH for gut

1017 markers. (B) Ventral view, anterior is up. (C-E) Left lateral views, anterior is up, ventral

1018 is right. (F) Schematic of gut patterning in Platynereis late nectochaete larvae. Asterisk is

1019 the mouth on all panels. Scale bar: 50 μm.

1020

1021 Figure 2—figure supplement 2. Formation of the visceral musculature observed in

1022 cross-section. (A-C) Virtual cross-sections of confocal Z-stacks of Platynereis larvae

1023 stained with DAPI and phalloidin. Dorsal side up. (A’-C’) Schematic drawings of the

1024 same individuals. Note the progressive formation of internal circular fibres around the

1025 gut, followed by the formation of external longitudinal fibres. Due to the complex three-

1026 dimensional organization of the somatic musculature, different subsets of somatic

1027 bundles are observed at different cross-sectional levels within a segment (compare with

1028 Figure 2B). The orientation of somatic myofibres is represented based on information

1029 from 3D reconstructions (Figure 2B) and TEM (Figure 2C-M). Note the progressive

1030 appearance of endodermal nuclei, indicating stepwise cellularization of the midgut from

1031 the macromeres. The outline of the endodermal epithelium could be visualized by

1032 enhancing the intensity of the green (phalloidin) channel and was drawn from that

1033 information in panels (A’-C’). gm: gut muscles, im: intrinsic muscles, vlm: ventral

1034 longitudinal muscles, ppm: parapodial muscles, vom: ventral oblique muscles, ach:

1035 axochord, dlm: dorsal longitudinal muscles, ch: chaetal sac.

1036

1037

1038 Figure 3. Expression of smooth and striated muscle markers in Platynereis larvae.

1039 Animals have been stained by WMISH and observed in bright field Nomarski

1040 microscopy. Ventral views, anterior side up. Scale bar: 25 μm. (A-D) Expression patterns

1041 of the striated marker ST-MHC and the smooth marker SM-MHC. These expression

1042 patterns are representative of the entire striated and smooth effector module (see Figure

1043 2—figure supplement 1 and Figure 2—figure supplement 3). Note that SM-MHC (panel

1044 B) is expressed around the forming midgut and hindgut (dotted white line) as well as in

1045 the stomodeal sheath (white arrows) and in lateral cells in the parapodia. The identity of

1046 these cells is unknown, but preliminary observations suggest they will become part of the

1047 nephridial tubule/nephridiopore complex that opens at the base of the parapodia in

1048 annelids. Asterisk: stomodeum. (E) Table summarizing the expression patterns of smooth

1049 and striated markers in Platynereis and vertebrate muscles. (*) indicates that Platynereis

1050 and vertebrate Calponin are mutually most resembling by domain structure, but not one-

1051 to-one orthologs, as independent duplications in both lineages have given rise to more

1052 broadly expressed paralogs with a different domain structure (Figure 7—figure

1053 supplement 3).

1054

1055

1056 Figure 3—figure supplement 1. Expression of striated muscle markers in Platynereis

1057 larvae. (A-O) Larvae stained by WMISH and observed in bright field Nomarski

1058 microscopy. Ventral views, anterior side up. Scale bar is 20 μm for 48 hpf and 25 μm for

1059 the two other stages. (P) Foregut musculature visualized by rhodamine-phalloidin

1060 fluorescent staining. Z-projection of confocal planes. Ventral view, anterior side up.

1061 Scale bar: 20 μm. (Q) TEM micrograph of a cross-section of the foregut. Foregut muscles

1062 are colored green, axochord orange, ventral oblique muscles pink, ventral nerve cord

1063 yellow. Inset: zoom on the area in the red dashed box with enhanced contrast to visualize

1064 oblique striation. Scale bar: 10 μm. (R-W) WMISH for striated muscle markers

1065 expression in the foregut observed in Nomarski bright field microscopy, ventral views,

1066 anterior side up. Scale bar: 20 μm.

1067

1068

1069 Figure 3—figure supplement 2. Expression of striated muscle markers in the 6 dpf

1070 Platynereis larva. Animals have been stained by WMISH and observed by confocal

1071 microscopy (DAPI fluorescence and NBT/BCIP 633 nm reflection). All striated effector

1072 genes are expressed in all somatic muscles examined. The transcription factor myoD is

1073 detectable in the axochord and in ventral longitudinal muscles, but not in other muscles.

1074

1075

1076 Figure 3—figure supplement 3. Expression of smooth muscle markers in Platynereis

1077 larvae. (A-F) Animals are stained by WMISH and observed by Nomarski bright field

1078 microscopy. Ventral views, anterior side up. Yellow arrows: expression in the foregut

1079 mesoderm. White dashed lines: outline of the midgut and hindgut (or their anlage at 3

1080 dpf). Asterisk: stomodeum. (G) Schematic drawing of a 6 dpf larva (ventral view,

1081 anterior is up) representing gene expression in the forming tripartite gut (compare to

1082 Figure 2—figure supplement 1). (H-M) Molecular profile of the pulsatile dorsal vessel.

1083 All panels show 2 months-old juvenile worms. (H,I) Maximal Z-projections of confocal

1084 stacks. Dorsal view, anterior is up. (H) Dorsal musculature of a juvenile Platynereis

1085 dumerilii individual visualized by phalloidin-rhodamine (green) together with nuclear

1086 (DAPI, blue) and membrane (FM-464FX, red) stainings. The heart tube lies on the dorsal

1087 side, bordered by the somatic dorsal longitudinal muscles (dlm). (I) Expression of SM-

1088 MHC in the heart tube visualized by WMISH. (J) Virtual cross-section of the individual

1089 shown in A. Dorsal side up. Note the continuity of the muscular heart tube with gut

1090 musculature. dlm: dorsal longitudinal muscles. (K) Virtual cross-section of the individual

1091 shown in B, showing continuous expression of SM-MHC in the heart and the midgut

1092 smooth musculature. Note the similarity to the NK4/tinman expression pattern

1093 documented in (Saudemont et al., 2008). (L) Virtual cross-section on an individual

1094 stained by WMISH for ST-MHC expression. Note the lack of expression in the heart,

1095 while expression is detected in intrinsic muscles that cross the internal cavity.

1096 (M) Schematic cross-section of a juvenile worm (dorsal side up) showing the shape,

1097 connections and molecular profile of the main muscle groups. Scale bar: 30 μm in all

1098 panels.

1099 Figure 3—figure supplement 4. Molecular profile of midgut muscles in the 6 dpf

1100 larva. All panels are Z-projections of confocal planes, ventral views, anterior side up.

1101 Blue: DAPI, red: NBT/BCIP precipitate. White dashed line: midgut/hindgut, yellow

1102 dashed ellipse: stomodeum. (A-E) Smooth markers expression. White arrows indicate

1103 somatic expression of GATA456 in the ventral oblique muscles. (F-K) Striated markers

1104 expression; none of them is detected in any gut cell. White arrows: somatic expression.

1105 Scale bar: 20 μm in all panels.

1106

1107

1108 Figure 3—figure supplement 5. General muscle markers are expressed in both

1109 smooth and striated muscles. All panels show gene expression visualized by WMISH.

1110 (A-F) actin expression. (A-B) bright field micrographs in Nomarski optics. (A) is an

1111 apical view, (B) is a ventral view. Abbreviations: dlm, dorsal longitudinal muscles; vc,

1112 ventral mesodermal cells, likely representing future ventral musculature. (C-F) 3D

1113 rendering of confocal imaging of NBT/BCIP precipitate. (C,E) ventral views, anterior

1114 side up. (D,F) ventrolateral views, anterior side up. Abbreviations are as in Figure 1. (G-

1115 M) Z-projections of confocal stacks. Blue is DAPI, red is reflection signal of NBT/BCIP

1116 precipitate. (G-L) Ventral views, anterior side up. White dashed line: midgut, yellow

1117 ellipse: foregut. White arrows: somatic muscle expression. Abbreviations: f.m.: foregut

1118 muscles; r.a.: reflection artifact. (M) Expression in individual somatic muscles. Scale bar:

1119 20 μm in all panels.

1120

1121

1122 Figure 4. Contraction speed quantifications of smooth and striated muscles. (A-

1123 B) Snapshots of a time lapse live confocal imaging of a late nectochaete larva expressing

1124 fluorescent markers. Ventral view of the 2 posterior-most segments, anterior is up.

1125 (C) Snapshots of a time lapse live confocal imaging of a 3 dpf larva expressing

1126 GCaMP6s. Dorsal view, anterior is up. (D-E) Two consecutive snapshots on the left

1127 dorsal longitudinal muscle of the larva shown in C, showing muscle contraction.

1128 (F) Quantification of smooth and striated muscle contraction speeds (see Experimental

1129 procedures and Figure 4-Source data 1), p-value by Mann-Whitney’s U test. Each point

1130 represents a biological replicate (see Material and Methods). (G) Snapshot of a time lapse

1131 live confocal imaging of a late nectochaete larva. Ventral view, anterior is up. Optical

1132 longitudinal section at the midgut level.

1133

1134

1135 Figure 5. Platynereis gut peristalsis is independent of nervous inputs and dependent

1136 on gap junctions. (A) 2 months-old juvenile mounted in 3% low-melting point (LMP)

1137 agarose for live imaging. (B) Snapshots of a confocal live time lapse imaging of the

1138 animal shown in A. Gut is observed by detecting fluorescence of the vital membrane dye

1139 FM-464FX. (C) Kymograph of gut peristalsis along the line of interest in (B).

1140 Contraction waves appear as dark stripes. A series of consecutive contraction waves is

1141 called a contraction event: here, two contraction waves are visible, which make up one

1142 contraction event with a recurrence of 2. (D) Quantification of the propagation speed of

1143 peristaltic contraction waves in mock (DMSO)-treated individuals and Brefeldin A-

1144 treated individuals (inhibiting neurotransmission). Speed is calculated from kymographs

1145 (see Material and Methods and Figure 5-source data 1), p-value by Mann-Whitney’s U

1146 test. Each point represents a contraction wave. 5 biological replicates for each category

1147 (see Material and Methods). (E,F) Same as in E, but showing respectively the frequency

1148 of initiation and the recurrence of contraction events. Each point represents a biological

1149 replicate (see Material and Methods). (G) Representative kymographs of controls,

1150 animals treated with Brefeldin A (inhibiting neurotransmission), animals treated with 2-

1151 octanol (inhibiting gap junctions), and animals treated with both (N=10 for each

1152 condition). 2-octanol entirely abolishes peristaltic waves with or without Brefeldin A.

1153

1154

1155 Figure 6. The enteric nerve net of Platynereis. (A) Immunostaining for acetylated

1156 tubulin, visualizing neurites of the enteric nerve plexus. Z-projection of a confocal stack

1157 at the level of the midgut. Anterior side up. (B) Same individual as in A, immunostaining

1158 for serotonin (5-HT). Note serotonergic neurites (double arrow), serotonergic neuronal

1159 cell bodies (arrow, see D), and serotonergic cell bodies without neurites (arrowhead).

1160 (C) Same individual as in A showing both acetylated tubulin and 5-HT immunostainings.

1161 Snapshot in the top right corner: same individual, showing both neurites (acetylated

1162 tubulin, yellow) and visceral myofibres (rhodamine-phalloidin, red). The acetylated

1163 tubulin appears yellow due to fluorescence leaking in the rhodamine channel. (D) 3D

1164 rendering of the serotonergic neuron shown by arrow in B.

1165

1166

1167 Figure 7. The evolutionary tree of animal contractile cell types. Bilaterian smooth and

1168 striated muscles split before the last common protostome/deuterostome ancestor.

1169 Bilaterian myocytes are split into two monophyletic cell type clades: an ancestrally SM-

1170 MHC+ slow-contracting clade (green) and an ancestrally ST-MHC+ fast-contracting

1171 clade (orange). Hypothetical relationships of the bilaterian myocytes to the SM-MHC+

1172 and ST-MHC+ contractile cells of non-bilaterians are indicated by dotted lines (Steinmetz

1173 et al., 2012). Apomere: derived set of effector genes common to a monophyletic group of

1174 cell types (Arendt et al., 2016). Note that ultrastructure only partially reflects

1175 evolutionary relationships, as striation can evolve convergently (as in medusozoans), be

1176 co-opted (as in insect gut myocytes or in vertebrate and insect cardiomyocytes), be

1177 blurred, or be lost (as in planarians). Conversion of smooth to striated myocytes took

1178 place by co-option of striation proteins (Titin, Zasp/LDB3) and of the fast contractile

1179 module (ST-MHC, ST-MRLC, Troponin complex) in insect cardiomyocytes and gut

1180 myocytes, as well as in vertebrate cardiomyocytes. Nodes can either represent cell type

1181 duplications (indicated by two partly overlapping circles) or speciation events, as typical

1182 for a cell type tree (Arendt, 2008; Serb and Oakley, 2005).

1183

1184

1185 Figure 7—figure supplement 1. Evolution of myogenic Core Regulatory Complexes

1186 (CRC) in Bilateria. Transcription factor families are depicted as in Figure 1. Direct

1187 contact indicates proven binding. Co-option of the fast/striated module happened on three

1188 occasions: in Drosophila gut myocytes, and in cardiomyocytes of both vertebrates and

1189 Drosophila. Note that in both cases, composition of the CRC was maintained in spite of

1190 change in the effector module. In insect gut myocytes, replacement of the smooth by the

1191 striated module entailed a split of the CRC, with the ancient smooth CRC still controlling

1192 conserved differentiation genes (involved in adhesion, morphogenesis, axonal guidance,

1193 or formation of innexin gap junctions), while the striated contractile cassette is

1194 downstream Mef2 alone (Jakobsen et al., 2007). It is less clear whether a similar split of

1195 CRC took place in striated cardiomyocytes. In the striated myocyte line, it is unclear

1196 whether MyoD was part of the ancestral CRC of all striated myocytes (as in vertebrates)

1197 or just of a subset (as in Platynereis). In Drosophila, the myoD ortholog nautilus has been

1198 reported to be only necessary for the formation of a subset of somatic muscles – DA3 and

1199 DO4 (Balagopalan et al., 2001) – though other reports suggest that in nautilus null

1200 mutants, other somatic muscles might be lacking (with low penetrance) (Wei et al., 2007)

1201 or be present but underdeveloped (Enriquez et al., 2012).

1202

1203

1204 Figure 7—figure supplement 2. Ancestral state reconstructions of the ultrastructure

1205 of midgut/hindgut and heart myocytes. (A) Distribution, and ancestral state

1206 reconstruction, of midgut smooth muscles in Bilateria. Ancestral states were inferred

1207 using Parsimony and Maximum Likelihood (ML) (posterior probabilities indicated on

1208 nodes). Character states from: Chordata (Marieb and Hoehn, 2015), Echinodermata

1209 (Feral and Massin, 1982), Chaetognatha (Duvert and Salat, 1995), Mollusca (Royuela et

1210 al., 2000), Annelida (Anderson and Ellis, 1967), Priapulida (Carnevali and Ferraguti,

1211 1979), Nematoda (White, 1988), Arthropoda (Goldstein and Burdette, 1971), and

1212 Tardigrada (Shaw, 1974). (B) Distribution, and ancestral state reconstruction, of

1213 cardiomyocyte ultrastructure in Bilateria. Ancestral states were inferred using Parsimony

1214 and ML (posterior probabilities indicated on nodes). Note that, due to the widespread

1215 presence of striated cardiomyocytes in bilaterians, the support value for an ancestral

1216 smooth ultrastructure in the ML method remain modest (0.56). This hypothesis receives

1217 independent support from the comparison of CRCs (Figure 1B, Figure 7—figure

1218 supplement 1) and developmental data (see Discussion). Character states follow the

1219 review by Martynova (Martynova, 1995, 2004) and additional references for Siboglinum

1220 (Jensen and Myklebust, 1975), chordates (Hirakow, 1985), Peripatopsis (Nylund et al.,

1221 1988), arthropods (Tjønneland et al., 1987), Meiomenia (Reynolds et al., 1993), and

1222 Lepidopleurus (Økland, 1980). In Peripatopsis and Lepidopleurus, some degree of

1223 alignment of dense bodies was detected (without being considered regular enough to

1224 constitute striation), suggesting these might represent intermediate configurations.

1225

1226 Figure 7—figure supplement 3. Domain structure, phylogeny and expression

1227 patterns of members of the calponin gene family. (A) Domain structure of calponin-

1228 related proteins in bilaterians. Calponin is characterized by a Calponin Homology (CH)

1229 domain with several calponin repeats, while Transgelin is characterized by a CH domain

1230 and a single calponin repeat. In vertebrates, Calponin proteins are specific smooth muscle

1231 markers, and the presence of multiple CH repeats allows them to stabilize actomyosin

1232 (Gimona et al., 2003). Transgelins, with a single calponin repeat, destabilize actomyosin

1233 (Gimona et al., 2003), and are expressed in other cell types such as podocytes (Gimona et

1234 al., 2003), lymphocytes (Francés et al., 2006), and striated muscles (transiently in mice

1235 (Li et al., 1996) and permanently in fruit flies (Ayme-Southgate et al., 1989)).

1236 (B) Maximum Likelihood phylogeny of the calponin/transgelin family based on

1237 alignment of the CH domain. Paralogs with calponin and transgelin structures evolved

1238 independently in vertebrates and Platynereis (Pdu, in red squares). (C) Expression

1239 patterns of Pdu-transgelin1. Scale bar: 25 μm. As in vertebrates and insects, transgelin1

1240 is not smooth myocyte-specific, but also detected in striated myocytes.

1241

1242

1243 Supplementary File 1. Phylogenetic trees of the markers investigated. (A) Simplified

1244 Maximum Likelihood (ML) tree for Myosin Regulatory Light Chain (full tree in panel

1245 M), rooted with Calmodulin, which shares an EF-hand calcium-binding domain with

1246 MRLC. (B) ML tree for FoxF, rooted with FoxQ1, the probable closest relative of the

1247 FoxF family (Shimeld et al., 2010). (C) MrBayes tree for bilaterian ZASP/LBD3, rooted

1248 with the cnidarian ortholog (Steinmetz et al., 2012). (D) ML tree for bilaterian Myosin

1249 Heavy Chain, rooted at the (pre-bilaterian) duplication between smooth and striated MHC

1250 (Steinmetz et al., 2012). (E) MrBayes tree for Mef2, rooted by the first splice isoform of

1251 the cnidarian ortholog (Genikhovich and Technau, 2011). (F) MrBayes tree for Titin,

1252 rooted at the protostome/deuterostome bifurcation (Titin is a bilaterian novelty). (G)

1253 MrBayes tree for Troponin T, rooted at the protostome/deuterostome bifurcation

1254 (Troponin T is a bilaterian novelty). (H) MrBayes tree for Troponin I, rooted by the

1255 Calponin/Transgelin family, which shares an EF-hand calcium-binding domain with

1256 Troponin I. (I) MrBayes tree for MyoD, rooted at the protostome/deuterostome

1257 bifurcation (MyoD is a bilaterian novelty). (J) MrBayes tree for Myocardin, rooted at the

1258 protostome/deuterostome bifurcation (the Drosophila myocardin ortholog is established

1259 (Han et al., 2004)). (K) Complete MRLC tree.

1260 Species names abbreviations: Pdu: Platynereis dumerilii; Xenla: Xenopus laevis; Mus:

1261 Mus musculus; Hsa: Homo sapiens; Dre: Danio rerio; Gga: Gallus gallus; Dme:

1262 Drosophila melanogaster; Cte: Capitella teleta; Patvu: Patella vulgata; Brafl:

1263 Branchiostoma floridae; Nve or Nemv: Nematostella vectensis; Acdi: Acropora

1264 digitifera; Expal: Exaiptasia pallida; Rat: Rattus norvegicus; Sko: Saccoglossus

1265 kowalevskii; Limu or Lpo: Limulus polyphemus; Trib or Trca: Tribolium castaneum;

1266 Daph: Daphnia pulex; Prcau: Priapulus caudatus; Cgi or Cgig: Crassostrea gigas; Ling

1267 or Linan: Lingula anatina; Hdiv: Haliotis diversicolor; Apcal or Aca: Aplysia

1268 californica; Spu: Strongylocentrotus purpuratus; Poli or Polis: Polistes dominula; Cin or

1269 Cint: Ciona intestinalis; Hro: Helobdella robusta; Bos: Bos taurus; Capsa: Capsaspora

1270 owczarzaki; Thtr: Thecamonas trahens; Lpo: ; Bga: Biomphalaria glabrata; Cel:

1271 Caenorhabditis elegans; Tt: Terebratalia transversa; Octo: Octopus vulgaris; Sma:

1272 Schmidtea mediterranea; Bbe: Branchiostoma belcheri, Batden: Batrachochytrium

1273 dendrobaditis; Monve: Mortierella verticillata; Alloma: Allomyces macrogynus; Salpun:

1274 Spizellomyces punctatus; Mucor: Mucor racemosus; Lichco: Lichtheimia corymbifera;

1275 Ephmu: Ephydatia muelleri; Sycon: Sycon ciliatum; Amqu: Amphimedon queenslandica;

1276 Osc: Oscarella lobularis; Metse: Metridium senile; Pfu: Pinctada fucata; Rypa: Riftia

1277 pachyptila; Plma: Placopecten magellanicus; Air: Argopecten irradians; Scolop:

1278 Scolopendra gigantea; Artfra: Artemia franciscana; Bmor: Bombyx mori; Loa: Loa loa;

1279 Necator-am: Necator americanus; Trichi: Trichinella spiralis; Asc: Ascaris lumbricoides;

1280 Wuch: Wucheria bancrofti; Ancy: Ancylostoma duodenale; Callorinc: Callorhinchus

1281 milii; Dana: Danaus plexippus; Anop: Anopheles gambiae; Asty: Astyanax mexicanus;

1282 Oreo: Oreochromis niloticus; Icta: Ictalurus punctatus.

1283

1284

1285 Movie 1. Live imaging of somatic muscle contraction visualized by GCaMP6s.

1286 Dorsal view of a 3 dpf Platynereis larva injected (at the zygote stage) with a mRNA

1287 encoding GCaMP6s and mounted in 3% LMP agar between a slide and a cover slip.

1288 Anterior side is up. Left side is the red (GCaMP6s) fluorescence channel, right side

1289 shows overlay of transmitted light and red fluorescence channel. Time step between two

1290 frames: 0.436 s.

1291

1292 Movie 2. Live imaging of visceral muscle contraction visualized by FM-464FX.

1293 Ventral view of a 6 dpf Platynereis larva stained with the vital dye FM-464FX and

1294 mounted in 3% LMP agar between a slide and a cover slip. Red fluorescence signal is

1295 shown. Anterior side is up. Time step between two frames: 1.29s.

1296

1297 Movie 3. Live imaging of gut peristalsis in a control 2 months-old juvenile worm.

1298 Lateral view of an individual stained with FM-464FX and mounted in 3% LMP agar

1299 between a slide and a cover slip. Left side is the transmitted light signal and right side is

1300 the red fluorescence channel. Note the peristalsis waves travelling along the gut,

1301 interrupted with rest periods.

1302

1303 Movie 4. Live imaging of gut peristalsis in a Brefeldin A-treated 2 months-old

1304 juvenile worm. Lateral view of an individual treated with 180 μM Brefeldin-A, stained

1305 with FM-464FX (not shown) and mounted in 3% LMP agar between a slide and a cover

1306 slip. Transmitted light signal is shown. Note the vigorous and constant gut peristalsis

1307 waves travelling along the gut. The straight posture of the animal (compare with its bent

1308 control sibling in Movie 3) is typical of somatic muscle inhibition by Brefeldin A.

1309

1310 Figure 4—source data 1. Contraction speed values measured for somatic and

1311 visceral muscles.

1312

1313 Figure 5—source data 1. Peristalsis waves quantifications in control and Brefeldin

1314 A-treated worms. Control and treated animals are respectively numbered Ctrl1, Ctrl2, …

1315 etc. and BfdA1, BfdA2, … etc. Contraction events are named e1, e2, … etc. Numbers in

1316 columns B and E are the speed of individual contraction waves as defined in Figure 5C.

1317 Contraction events and the recurrence of contraction events are defined in the legend of

1318 Figure 5.

Skeletal myocyte A Cross-striation, solid Z-discs B core regulatory complex Transcription factor families MyoD E12 Striated effectors skeletal actin bHLH MASTR skeletal troponin C SRF/MEF2 skeletal troponin I ZASP/LDB3 SRF or MEF2 Cross-striation, discontinuous Z-elements (MADS domain) C Smooth myocyte Myocardin core regulatory complex (SAP domain)

Fox FoxF1 Smooth effectors Oblique striation, discontinuous Z-elements GATA Nkx3.2 Myocardin smooth actin SRF/MEF2 smooth MLCK NK GATA6 SM22alpha telokin direct caldesmon enhancer binding Smooth ultrastructure demonstrated regulation, D Cardiac myocyte direct binding core regulatory complex untested

demonstrated FoxC1 ? ? Cardiac effectors co-regulation, ? direct binding Thin myofilament: actin Nkx2.5 Myocardin cardiac actin cardiac MHC untested Thick myofilament: myosin GATA4 SRF/MEF2 cardiac troponin T Dense bodies ?

Brunet et al. Figure 1 7 dpf 11 dpf 1.5 months A B Somatic Visceral muscles muscles striated smooth/striated foregut

ventral longitudinal foregut musculature muscles C A midgut G H posterior

Ventral half Ventral foregut hindgut I 3 muscles ventral oblique E midgut D V muscles musculature 4 J K L

P axochord D

M hindgut musculature parapodial F muscles Dorsal half

Somatic muscles Visceral muscles

C E mitochondrion E’ G

Z-lines Z- foregut lines lumen

C’ 5° F

Z- lines DH I foregut Z-lines dense muscles bodies

Z- lines

circular muscles J coelom K M

longitudinal muscles dense bodies dense bodies longitudinal muscles circular L muscles gut epithelium dense bodies

Brunet et al. Figure 2 Striated molecular Smooth General profile molecular muscle profile markers ST-MHC SM-MHC A * B E SM-MHC SM-MRLC Calponin* FoxF GATA456 Actin Mef2 Troponin I Troponin T Troponin Titin ST-MHC ST-MRLC Zasp/LBD3 MyoD Myocardin Annelid longitudinal * striated muscles Annelid striated foregut muscles

72 hpf Annelid oblique/parapodial striated muscles Annelid gut smooth muscles

C D Vertebrate striated * * trunk muscles Vertebrate striated esophageal muscles Vertebrate gut

6 dpf smooth muscles Acto- Calcium Striation Transc. Acto- Transc. Acto- Transcription myosin response factors myosin factors myosin factors Expressed Not expressed Expressed in a subset

Brunet et al. Figure 3 A Lifeact-EGFP B Lifeact-EGFP C GCaMP6s D G FM-464FX H2B-RFP H2B-RFP c. b. c. b. 60 μm longitudinal muscle ventral c. b. t0 longitudinal muscles E foregut

telotroch 51 μm telotroch 20 μm 50 μm 6 dpf t0 t0+280ms 3 dpf t0+436 ms myocytes A’ H2B-RFP B’ H2B-RFP F ) -1 midgut t 0 t0+1.3s 52 μm 61 μm

1 -8 1 p = 8.5*10 hindgut Contraction speed (s 31 27 μm μm 50 μm 0.0 0.4 0.8 1.2 2 2 t t +280ms Somatic striated Visceral smooth 0 0 muscles muscles 6 dpf

Brunet et al. Figure 4 400 μm G D A

Wave propagation speed ( m/s) gut Control 0 100 200 300 Control Brunet etal. Figure 5 pharynx head p =5*10 parapodia 2 months Brefeldin A- treated -3

+2-octanol outline of E B the gut Number of contractions 100 μm per minute 1 2 3 4 5 6 longitudinal fibres circular fibres Control

+Brefeldin-A n. s. Brefeldin A- FM464-FX interest line of treated C time (t) F Kymograph contraction

+Brefeldin-A +2-octanol ) waves Recurrence of contraction events wave propagation

1 2 3 4 5 6 7 speed Control n. s. Brefeldin A- treated Δx = space (x) Δx Δt Δt A outline of the gut BC D

ac-tub serotonin 10 μm phalloidin

neurites ac-tubulin

ac-tubulin 50 μm ac-tubulin serotonin serotonin combined

Brunet et al. Figure 6 Slow-contracting group NM/SM-MHC+ Fast-contracting group ST-MHC+ Somatic striated Cardiomyocytes Gut myocytes myocytes Porifera Cnidaria Deuterostomia Protostomia Protostomia Deuterostomia Deuterostomia Protostomia Cnidaria Porifera

Sponge Nematostella Vertebrate Annelid Drosophila Drosophila gut Annelid gut Vertebrate gut Vertebrate Annelid Planarian Nematostella Jellyfish Sponge exopinacocyte slow myocytes cardiomyocyte cardiomyocyte cardiomyocyte striated smooth smooth striated striated somatic fast striated reticuloapopylocyte myocytes myocytes myocytes myocytes myocytes smooth myocytes myocytes myocytes

sm-actin st-actin SM-MHC SM-MHC SM-MHC striation striation: sm-MELC st-MELC loss loss loss actin loss convergent striation, MELC evolution striation, fast module striation, myocardin MASTR fast fast module myocardin module connexin gap junctions

SM-MRLC ST-MRLC MRLC GATA456 striation: MyoD titin, troponin complex innexin gap junctions SM-MHC ST-MHC ? ? ? ? change in core regulatory complex

apomere SM-MHC ST-MHC module co-option MHC

module loss paralog 1 paralog 2 paralog 2 paralog 1 ancestral species split reciprocal loss of expression gene (division of labor) cell type split gene duplication

Brunet et al. Figure 7 A DAPI phalloidin B foxA * * foregut foregut

foregut/midgut sphincter midgut midgut Fig. 2-Suppl. 2 midgut/hindgut sphincter hindgut hindgut 6 dpf 6 dpf CDEFfoxA bra hnf4 * * * *

foregut bra foxA bra+foxA

midgut hnf4

6 dpf 6 dpf 6 dpf hindgut

Brunet et al. Figure 2 - supplement 1 12 dpf 7 dpf phalloidin DAPI 2 months C A B ppm titdmsuauesmoothmyofibres striated musculature dlm ppm im im dlm Brunet etal. Figure 2-supplement 2 vom vom ach vlm gm ach gm vlm end gm ach vlm vom vom nuclei smooth myocytes gm dlm 30 μm 30 μm im ppm dlm ppm ppm 40 μm B’ A’ C’ ppm ch dlm ppm im im epidermis dlm vom vlm ach end gm ach vlm gm gm end vlm ach end gut cellsnuclei gut vom gm vom ppm im dlm ppm dlm ppm ST-MRLC zasp titin troponin I troponin T A B C D E 48 hpf

EF G H I J 72 hpf

K L M N O

ST-MHC ST-MRLC titin 6 dpf P Q RS T

l Q UVWtroponin I troponin T zasp

Brunet et al. Figure 3 - supplement 1 Axochord Oblique muscles Longitudinal muscles Antennal muscles Parapodial muscles DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP * * * * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ST-MRLC * * * * * * * *

*** *** ** * * * * * * * * * * * * * * * ** * * ** * * * * * * * * * * * * * * * * * ST-MHC * * * * * * * * *

* * * * * ** * ** * * * * * * * * * * * * * * * * * * * * * * zasp * * * * * * * * * * * * * * * *

* * * * ** ** * * * * * * * * * * * * * titin * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * troponin I

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *** *** * * troponin T *

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * myoD * * * * * * * * * * * * * * * * * *

Brunet et al. Figure 3 - supplement 2 SM-MRLC calponin GATA456 G 6 dpf A B C * * * l. d. * 72 hpf foregut

D E F * * * midgut chaetal sacs 6 dpf hindgut

GATA456 GATA456/SM-MHC/SM-MRLC/calponin

DAPI FM-464FX SM-MHC DAPI FM-464FX dlm HIphalloidin DAPI J heart phalloidin M dorsal longitudinal heart coelom intrisic muscles muscles coelom gut muscles dlm gut dlm heart gut tube muscles epidermis SM-MHC intrinsic K DAPI heart muscles gut muscles gut gut heart tube

epidermis ST-MHC L gut heart DAPI intrinsic muscles striated musculature ST-MHC+ muscles intrinsic gut muscles 2 months - heart tube smooth musculature SM-MHC+ blood

gut coelomic lining epidermis

Brunet et al. Figure 3 - supplement 3 A SM-MRLC B SM-MHC C calponin

foregut

D GATA456 E foxF *

Smooth muscle markers midgut

6 dpf F ST-MRLC G ST-MHC H zasp

I titin J troponin I K troponin T Striated muscle markers

Brunet et al. Figure 3 - supplement 4 * * actin a A 24 hpf B 24 hpf C 48 hpf D dlm 48 hpf E 72 hpf F 72 hpf dlm dlm vlm vlm am dlm a vom vom lom

lom vc vc pm lom

* * myocardin mef2 actin G 6 dpf H I 6 dpf J K 6 dpf L

f.m. f.m. f.m. f.m. f.m.

midgut midgut

midgut midgut midgut midgut r.a.

M Oblique muscles Longitudinal muscles Oblique muscles Longitudinal muscles Oblique muscles Longitudinal muscles DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP

ach ach * * * * vlm vlm * * * * * * * * * * * * * * * * * * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * *

Brunet et al. Figure 3 - supplement 5 Evolution of somatic striated CRC

Vertebrate trunk Platynereis trunk striated Drosophila DA3 Caenorhabditis trunk striated myocytes longitudinal myocytes striated myocytes striated myocytes

MyoD E12 MyoD E12 Nau Da hlh-1 hnd-1

MASTR Myocardin SRF/MEF2 MEF2 MEF2 Striated UNC-120 Striated effectors effectors Striated Striated effectors effectors

MyoD E12 Ancestral somatic Myocardin striated CRC SRF/MEF2

Striated effectors

Evolution of visceral smooth CRC Gut myocytes branch Cardiomyocytes branch

Vertebrate gut Platynereis gut Drosophila gut Vertebrate Platynereis Drosophila smooth myocyte smooth myocyte striated myocyte cardiomyocyte cardiomyocyte cardiomyocyte

FoxF1 FoxF biniou FoxC1 Nkx3.2 Myocardin NK3? Myocardin bagpipe NK4 SRF/MEF2 Nkx2.5 Myocardin Myocardin tinman SRF/MEF2 GATA6 MEF2 GATA456 MEF2 GATA4 SRF/MEF2 SRF/MEF2 MEF2 ?GATA4/5/6 Pannier Smooth Gut myocyte Smooth Striated contractile Striated effectors differentiation Striated Smooth effectors effectors effectors effectors effectors effectors

striation striation striation FoxF Ancestral gut FoxC NK3 Myocardin smooth CRC Ancestral SRF/MEF2 NK4 Myocardin GATA4/5/6 cardiac CRC SRF/MEF2 Smooth contractile effectors GATA4/5/6 Differentiation effectors Smooth (morphogenesis, innervation, adhesion) effectors

Fox

NK Myocardin Ancestral visceral SRF/MEF2 smooth CRC GATA4/5/6 Smooth contractile effectors Differentiation effectors

Brunet et al. Figure 7 - supplement 1 Brunet et al. Figure 7-supplement 2 A Chordata B 0.82 Vertebrata Deuterostomia

0.82 Chordata Urochordata Deuterostomia Cephalochordata 1.00 0.53

chordata Echinodermata 0.83 Saccoglossus Hemi- 0.98 0.54 Rhabdopleura

Cephalodiscus Chaetognatha

Hemithris Spiralia 0.56 Meiomenia 0.79 0.88 Mollusca

Lepidopleurus Mollusca 1.00 0.69 Rossia 1.00

0.61 Helix Annelida 0.62 0.73 Mytilus Ecdysozoa Eisenia 0.97 Ultrastructure ofmidgutmuscles Priapulida 0.80 Annelida 0.77 Helobdella Striated One-sarcomere Smooth 0.66

Siboglinum Ecdysozoa Spiralia 0.97 0.63 Nematoda Flabelliderma 0.89 Arenicola Panarthropoda 0.73 Peripatopsis Arthropoda myocytes Smooth heart myocytes Striated heart Protostomia 0.62

0.90 Chelicerata 0.74 0.77 Crustacea Tardigrada Insecta A C Homo sapiens Platynereis dumerilii auhm am Hsa-calponin1 Pdu-calponin

Hsa-calponin2 Pdu-transgelin1

Hsa-calponin3 Pdu-transgelin2

Hsa-transgelin1 Drosophila melanogaster mp20 Hsa-transgelin2 ach vlm Hsa-transgelin3 chd64 vom Caenorhabditis elegans Domains unc-87 Calponin homology Calponin repeats

BrBrananchiosthiostomaoma-f-floloridaeidae-calponi-calponin 00,,9907 Danio-transgelin Deuterostomia B 00,,8256 Danio-transgelin2 Transgelin transgelin1 1Homo-transgelin2 1 RattRattus-trs-tranansgelin2 clade 1 RattRattus-trans-transgelin DAPI Homo-transgelin Homo-transgelin3 1 1Mus-cs-calponin2 1 Homo-calponin2 Xla-calponin2B Latimeria-calponin3-isoformX1 Calponin D 1 00,,5786 Latimeria-calponin3-isoformX2 clade 1 Homo-calponin3 Oryzias-calponin3-like 00,,997300,,978Danio-calponin37 b 0,0,9973Danio-calponin3a Astyanax-calponin3-like 0,0,5846Danio-calponin2 1 Xiphophorus-calponin1-like Takifugu-calponin1-like Meleagris-calponin1 0,0,5959 1 0,520,52 Gallus-calponin1 Chrysemys-calponin1 0,0,595Mu9 ss-c-calponin1 1 Sus-calponin2 00,Sus-calponin,9794 3 Homo-calponin1 00,,99Ceratitis-capitata-myophilin-likeX8 1 1 Drosophila-chd64 Musca-domestica-myophilinXX11 1 midgut 0,0,9734 Riptotortus-pedestrs-pedestris-calponin-trans-calponin-transgelin 0,0,8702 Daphnia-pulex-DAPPUDRAFT_30812-DAPPUDRAFT_308120 0,980,98 Nasonia-vitripennis-myophilin 00,,9927 Bombyx-mori-transgelin 1 Pdu-trandu-transgelin1 0,0,5473 Pdu-trandu-transgelin2 0,0,9953 Echinococcus-myophilin 1 Drosophila-mp20 00,,7643 MMetasetaseiulus-eiulus-occccidenidentalialis-mp20s-mp20-likkee 0,0,5839 Solen-grandis-calponin-like-protein Mytilus-gallopMytilus-galloprrovovincialiialis-calponins-calponin-likeke 0,0,7603 1 Helobdella-robuHelobdella-robusta-Hsta-HELRODRDRAFT_18618AFT_186180 1 1 Capitella-teleella-teletta-Ca-CAPTEDRAFT_1777APTEDRAFT_17776 Helobdella-robusta-HHelobdella-robusta-HELRODRAFT_18523DRAFT_185231 Cerebratulus-lacteus-calponin 1 0,0,715 Capitella-myophilin 1 Helobdella-robusta-HELRODRAFT_18498DRAFT_184984 Pdu-calponin transgelin1 Lottia-gigantea-LOTGIDRAFT_149649 Protostomia 0,0,7716 Aplysia-californica-myophilin-like Crassostrea-gigas-Mp20 DAPI

0.2

Brunet et al. - Figure 7 supplement 3