The Breakpoint of an Inversion of Chromosome 14 in a T-Cell

Home , Chromosome 14

Proc. Nati. Acad. Sci. USA Vol. 84, pp. 9069-9073, December 1987 Genetics The breakpoint of an inversion of chromosome 14 in a T-cell leukemia: Sequences downstream of the immunoglobulin heavy chain locus are implicated in tumorigenesis (T-cell receptor/ataxia-telangiectasia) R. BAER*t, A. HEPPELLt, A. M. R. TAYLORt, P. H. RABBITTS§, B. BOULLIER§, AND T. H. RABBITTS* *Medical Research Council Laboratory of Molecular Biology and §Ludwig Institute for Cancer Research, Hills Road, Cambridge, CB2 2QH, England; and tUniversity of Birmingham, Cancer Research Laboratories, Department of Cancer Studies, the Medical School, Birmingham, B15 2TJ, England Communicated by C. Milstein, August 11, 1987 (received for review July 13, 1987)

ABSTRACT T-cell tumors are characterized by inversions this alternative view. Cytogenetic studies of inv(14) chromo- or translocations of chromosome 14. The breakpoints of these some, by high resolution banding, have identified two differ- karyotypic abnormalities occur in chromosome bands 14qll ent break-reassociation points involved in inv(14) chromo- and 14q32-the same bands in which the T-cell receptor (TCR) somes (15). Notably, the 14q32 breakpoints of nonmalignant a-chain and immunoglobulin heavy chain genes have been clone inversions associated in ataxia-telangiectasia (A-T) are mapped, respectively. Patients with ataxia-telangiectasia are distinct from the 14q32 breakpoints of sporadic inversions particularly prone to development of T-cell chronic lympho- from normal subjects. A similar dichotomy of 14q32 cytic leukemia with such chromosomal abnormalities. We now breakpoints was found in clonal and sporadic t(14;14)(qll;- describe DNA rearrangements of the TCR a-chain gene in an q32) translocations (16). Furthermore, we have analyzed by ataxia-telangiectasia-associated leukemia containing both a in situ hybridization techniques, a clonal expansion ofT cells normal and an inverted chromosome 14. The normal chromosome 14 has undergone a productive join of TCR a-chain containing translocation t(14;14)(qll;q32) in an A-T patient variable (Va) and joining (Ja) gene segments. The other allele and found the break at 14q32 on the centromeric side of the ofthe TCR a-chain gene features a DNA rearrangement, about IGH locus at 14q32.1 (17) (i.e., downstream of IGH locus). 50 kilobases from the TCR a-chain constant (Ca) gene, that A-T is a complex disorder in which patients are apparently represents the breakpoint of the chromosome 14 inversion; this at higher risk of cancer and in particular T-cell leukemia (18) breakpoint is comprised of a TCR Ja segment (from 14qll) associated with marker chromosomes 14 [e.g., inv(14) and fused to sequences derived from 14q32 but on the centromeric t(14;14)] (19, 20). A T-cell chronic lymphocytic leukemia side of C.. These results imply that 14q32 sequences located at (CLL) has been previously described in a patient with A-T in an undetermined distance downstream of the immunoglobulin which an inv(14) chromosome was present (3). The evolution C,, locus can contribute to the development of T-cell tumors. of this malignant clone was studied over a number of years from the apparently preleukemic state until overt cancer (20). The association of chromosomal abnormalities with human Similar studies have been carried out on an A-T associated tumors indicates that such abnormalities may play a caus- t(14;14) (21) where a preleukemic clone apparently developed ative role in cancer. In human T-cell leukemias, a number of into CLL. The tumor cells of the former patient, designated recurring abnormalities involving chromosome 14 band qll AT5B1, provided an opportunity to study the inv(14) chro- have been reported. The most frequent are inversion (inv) of mosomal abnormality in A-T. We now report an analysis of chromosome 14 (qil ;q32), the analogous translocation the inv(14) chromosome from this tumor$ and show that the t(14;14)(qll;q32) (1-5), and t(8;14)(q24;qll) (6-9). Recent 14q32 breakpoint occurs downstream of the immunoglobulin work on the molecular cloning ofbreakpoints associated with ,u-chain constant (C) region gene, whereas the breakpoint at these abnormalities has shown that the 14q11 region involved 14q11 occurs in TCR Ja. These data strongly support the view contains the T-cell receptor (TCR) a-chain gene and that that sequences located downstream of immunoglobulin C, breakpoints specifically occur within the joining (J) region of region at 14q32 can be important for T-cell tumorigenesis this locus (6, 10-12). The inv(14) chromosome is especially (12). interesting since the cytogenetic breakpoints coincide with the chromosome bands in which the TCR a-chain gene maps (14q11) and the immunoglobulin heavy chain genes (IGH; MATERIALS AND METHODS 14q32) are localized. Indeed, it has been shown that the Molecular Cloning and Hybridizations. A library ofgenom- inv(14) chromosome in a T-cell lymphoma cell line (SUP-Ti) ic DNA prepared from leukemic cells (unfractionated periph- was generated by recombination between TCR Ja and im- eral blood) from the AT5B1 patient was constructed in X2001 munoglobulin heavy (H) chain variable (V) region genes (10, (22). The percentage of leukemic cells bearing inv(14) in the 11, 13). Such an association of the a-chain TCR and immu- sampled blood was about 90%. X clones containing rear- noglobulin VH loci was also reported in a rare B-cell tumor were with carrying an inv(14) chromosome (14). ranged segments isolated by screening (23) JaSP The possibility that such gene fusions constitute tumori- Abbreviations: TCR, T-cell receptor; J, joining; V, variable; C, genic events must be considered. However, a different constant; A-T, ataxia-telangiectasia; CLL, T-cell chronic lympho- possibility is that two forms of inv(14) chromosome occur, cytic leukemia; H, heavy. one or both of which might be involved in T-cell tumor tPresent address: University of Texas Health Science Center, 5323 development. There are several lines of evidence to suggest Harry Hines Boulevard, Dallas, TX 75235. 9The sequences reported in this paper are being deposited in the EMBL/GenBank data base (Bolt, Beranek, and Newman Labora- The publication costs of this article were defrayed in part by page charge tories, Cambridge, MA, and Eur. Mol. Biol. Lab., Heidelberg) payment. This article must therefore be hereby marked "advertisement" (accession no. J03597, rearranged normal chromosome 14; acces- in accordance with 18 U.S.C. §1734 solely to indicate this fact. sion no. J03598, rearranged inverted chromosome 14).

9069 Downloaded by guest on September 29, 2021 9070 Genetics: Baer et al. Proc. Natl. Acad. Sci. USA 84 (1987)

(24) and JaBB (see Fig. 2) probes, and subclones were kilobases (kb) from the Ca gene. Recombinant clones were prepared from the X phages in pUC or M13 vectors (25). obtained from a genomic library of AT5B1 DNA, which Genomic hybridization was conducted by fractionation of corresponded to these rearrangements. One set of clones 10 ,ug of digested DNA on 0.8% agarose followed by transfer covered the rearrangement at about 5 kb from Ca and was to cellulose nitrate filters (26). Hybridizations were carried isolated using the previously described JaSP probe (24). A out and monitored as described (27) using probes labeled by representative clone (XA87) is shown in Fig. 1A. Comparison random oligonucleotide primer procedures (28). Somatic cell ofthe restriction map from XA87 with that ofunrearranged Ja hybrids of t(X;14) have been previously described, and the clones located the point of rearrangement near a Ja segment hybridization characteristics of JH and Ja probes have designated JsP. Nucleotide sequence analysis at this position been assessed (12). Somatic cell hybrids of Raji cells revealed that a TCR Va segment had joined to JsP. This Va [carrying t(8;14)(q24;q32)] and Chinese hamster ovary cells (V'-3) segment is identical to a previously described unrear- were prepared using hypoxanthine/aminopterin/thymidine ranged segment (35) belonging to the Va family expressed in growth medium supplemented with ouabain (29). Segregant JM cells. Furthermore, the rearrangement is productive at somatic cell clones were isolated by ring cloning, DNA was the genomic level, indicating the potential ofthe AT5B1 cells prepared, and the presence of the relevant chromosomes in to produce TCR a-chain protein. This is consistent with the hybrids was determined by the hybridization ofimmunoglob- observed surface phenotype of the tumor cells, which in- ulin VH and JH and TCR Ja. probes (data not shown). A clone cludes the TCR-associated protein CD3. (SH-9-10) containing the 8q- chromosome [which has 14q32 Molecular Cloning of the inv(14) Breakpoint. Two further -- qter from the JH locus (30)] but not normal 14 or 14q+ TCR Ja rearrangements occur in AT5B1 DNA. A recombi- chromosomes was selected for use, and another clone (SH4- nant X phage clone (XA23) was isolated using the JaBB probe, 9-1) with only 8q- and 14q+ chromosomes (but not normal and this phage DNA encompasses both rearrangements. One chromosome 14) was utilized as a control. rearrangement represents an 8.1-kb deletion in the Jcr locus of Nucleotide Sequencing. Dideoxynucleotide sequencing was this T cell (R.B. and T.H.R., unpublished results), and the carried out using M13 as described (31, 32). Sequence other rearrangment (approximately 50 kb from Ca) was alignment was facilitated using computer comparisons (33). located near the end of XA23. Preliminary genomic hybrid- In Situ Hybridization. In situ hybridization to metaphase ization placed the latter rearrangement within the region of chromosomes was carried out as described (17). 3H-labeled probes were prepared by nick-translation (34). For grain the A23HR fragment since we found a rearranged DNA analysis, chromosome 14 was divided into four arbitrary fragment in HindIII digests but not in EcoRI digests of sections, and grains falling within each section were summed AT5B1 DNA using the probe JaSH (shown in Fig. 2A). In (17). order to localize the breakpoint more precisely, we carried out nucleotide sequencing of A23HR. This revealed a Ja segment (designated JAJ) just upstream of the Pst I site RESULTS indicated on the map of XA23 (Fig. 2A). However, this Ja Correct TCR a-Chain Rearrangement on the Normal Chro- segment is devoid of the characteristic nanomer and hep- mosome 14 ofAT5B1. Tumor cells from the AT5B1 individual tamer recombination sequences, and sequences upstream of were used as a source of DNA, and Southern filter hybrid- the Ja segment do not resemble other Va or VH segments. izations were carried out with various Ja. probes. These Therefore, it was likely that the DNA fused to JA represents studies revealed three different rearrangements of the TCR the inv(14) chromosomal junction (i.e., that it comes from a-chain gene, at distances of approximately 5.4 and 50 14q32). A lkb

Sp VJcx n Cafnfnln XA 87 1 1 - I, -; Fl RB H B R B B H B H BH B G S T L V ES I N G F E A E F N KS Q T GGATCCACCCTGGTTGAAAGCATCAACGGTTTTGAGGCTGAATTTAACAAGAGTCAAACT ------10 20 30 40 50 60 BamHI Valpha S F H L R K P S V H I S D T A E Y FtJ A TCCTTCCACTTGAGGAAACCCTCAGTCCATATAAGCGACACGGCTGAGTACTTCTGTGCT 70 80 90 100 110 120 N-region Jaipha SP V S V A Y S S A S K I I F G S G T R L S GTGAGTGTTGCGTACAGCAGTGCTTCCAAGATAATCTTTGGATCAGGGACCAGACTCAGC 130 140 150 160 170 180

I R P I ATCCGGCCAAGTAAGTAGAAT 190 200 FIG. 1. TCR a-chain rearrangement at 14qll in AT5B1. (A) Restriction map of clone XA87 corresponding to the rearranged, karyotypically normal chromosome 14q11. The exons of the C0 gene (open bars) and the rearranged V. gene (stippled bars) are shown. R, EcoRI; B, BamHI; H, HindIll. (B) Partial nucleotide sequence of Vd-J. rearrangement. The BamHI site within the V. segment is underlined. The derived protein sequence is indicated in the single-letter code, and the cysteine that is probably involved in the intrachain disulfide bond is circled. A region of putative N-region diversity is indicated. The vertical arrow indicates the RNA splice site at the end of the J segment. Downloaded by guest on September 29, 2021 Genetics: Baer et al. Proc. Natl. Acad. Sci. USA 84 (1987) 9071

1 kb A r |- JAJ

XA23 l H P R Sp H RH R HHHRB SB HS B

_ lI I A23HR JoeSH JceBB

A23HP

AAATAGCAlTCATCTATAGC CTTTATGGATCTCTTACACCAAACAGTCATCACACAATTTTAAAAAAATGTGACCTTCAAAGAAGAAGAAA 10 20 30 40 50 60 70 80 90

100 110 120 130 140 150 160 170 180 Jalpha AJ

F Y F G T G T S L T V I P AGTTCTATTTTGGGACAGGGACAAGTTTGACGGTCATTCCAAGTAAGTCAAAGAAAATTTTCCATCACCATTGTGTTGAGCAAACCCTTT 190 200 210 220 230 240 250 260 270

AAACTGCAG PstI

FIG. 2. Breakpoint of inv(14) within the TCR Ja, region. (A) Restriction map of the region corresponding to one breakpoint of the inv(14) chromosome of AT5B1. The clone XA23 consists of two regions; the open bars correspond to TCR Ja, and the solid bars correspond to material rearranged into Jr,. The locations of probes discussed in the text are shown. The vertical arrow corresponds to the position of a previously characterized deletion in the Ja region of AT5B1 DNA (R.B. and T.H.R., unpublished results). H, HindI11; P, Pst I (mainly one site shown); R, EcoRI; B, BamHI; S, Sac I; Sp, Sph I (only one site shown). (B) Nucleotide sequence at the junction of inv(14) chromosome in TCR Ja. of AT5B1. The Pst I site at the end of JAJ is indicated, and the Ja. sequence is shown in the single-letter code. The vertical arrow shows the RNA splice site at the end of the J segment.

The origin of materialjoined to JAJ was examined by in situ results of the in situ hybridization experiments are shown in hybridization experiments utilizing the A23HR fragment as Fig. 3, where hybridization over chromosome 14 has been the probe. This probe contains 1.4 kb of the Ja locus analyzed in four arbitrary regions. Two peaks of hybridiza- (originating from 14q11) and 1.3 kb of unknown DNA. The tion occur, one at 14q11 (due to the Ja, component of the probe) plus one near the tip of the long arm, approximately Chromosome 14 14q31-q32. Thus, the probe A23HR contains sequences originating from both the 14q11 and 14q31-q32 regions of chromosome 14 and therefore represents the breakpoint of the inv(14) chromosome. The 14q32 Breakpoint in AT5B1 Is Downstream of the q1 1 Immunoglobulin Cot Gene. Previous data of a T-cell clone with a t(14;14) from an A-T patient showed that the translocation breakpoint is downstream of the IGH locus [i.e., on the centromeric side (17)]. This contrasts to the intra-VH breakpoint of a T-cell lymphoma cell line (10, 11) but is similar to recently reported tumors with inv(14) and t(14;14) (12). To q32 -+L determine the origin of the 14q32 adjacent to the inv(14) breakpoint chromosome of the AT5B1 tumor, we have 0 5 10 15 20 conducted hybridization experiments with DNA from human-hamster somatic cell hybrids containing various Number of grains translocations involving chromosome 14 (see Materials and Methods). The hybridization of the probe A23HP (which FIG. 3. In situ hybridization ofthe AT5B1 inv(14)junction probe. carries predominantly 14q32 sequences; Fig. 2A) with these In situ hybridization of probe A23HR (see Fig. 2) to metaphase chromosome of normal human hybrid DNAs is shown in Fig. 4. A23HP detects a 4.3-kb Sac spreads lymphocytes stimulated with I to the phytohemagglutinin. Grains over all chromosomes 14 are shown (120 restriction fragment (equivalent unrearranged 14q32 spreads examined) grouped within four arbitrary regions of chromo- fragment) in HeLa DNA but not the corresponding band in some 14. [A total of 393 grains were counted, of which 9.2% (36 hamster DNA (under the conditions used). Only one of the grains) were localized within chromosome 14; random hybridization hybrids carries this 4.3-kb hybridizing fragment; this hybrid values predict only 3.5%.] (SH-9-1) contains both the reciprocal 14q+ and 8q- chromo- Downloaded by guest on September 29, 2021 9072 Genetics: Baer et al. Proc. Natl. Acad. Sci. USA 84 (1987)

Q -- leukemias. The same chromosome defects occur at a low 0 C? C) frequency (-0.1%) in metaphase spreads of normal lymphocytes (39-41). Nevertheless, detectable differences occur in cz7 T- C) C (C) 2 3 the breakpoints of the inv(14) and t(14;14) chromosomes associated with T-cell clonal proliferations and those that arise sporadically in normal lymphocytes (15). The close association of inv(14) and t(14;14) with T-cell tumors (5, 20, 21) suggests that sequences adjacent to the breakpoints of 6-55 these chromosome abnormalities contribute to oncogenesis. The results described in this paper show that the breakpoint of the inv(14) chromosome in an A-T CLL is composed of a TCR Ja, gene segment fused to sequences originating downstream of the immunoglobulin C,. gene. To date, molecular cloning has been carried out on four chromosome abnormal- 2*3 x ities in T-cell tumors, which include three inv(14) chromosomes and one t(14;14) translocation (10-12). Although the 14q11 breakpoints of these abnormalities all occur within the TCR Ja locus, the 14q32 breakpoints are oftwo distinct types: FIG. 4. Hybridization of 14q32 probe (A23HP) from AT5B1 to in one case (the SUP-T1 lymphoma) breakage occurs within somatic cell hybrids containing translocation of chromosome 14q. the VH locus (10, 11), whereas the other three cases feature Somatic cell hybrids (human X hamster) containing t(X;14) or t(8;14) breakpoints downstream ofthe immunoglobulin Ca gene (12). segregant chromosomes were used as a source of DNA. The Raji Breakage downstream of the IGH locus was also established [t(8;14)(q24;q32)] hybrid clones used were: SH-9-10 containing the in a t(14;14) T-cell clone from an A-T patient (17). The 8q- chromosome (14q32 -- qter) and SH-9-1 containing the 8q- and preponderance of downstream breakpoints (four of five 14q' chromosomes (14pter -- 14q32). W53-5Bc15 (14pter -+ 14q24) cases) suggests that these represent a 14q32.1 breakpoint and W4.3Aaz2 (14q32 -. qter) have been described (44). DNA associated with T-cell tumors, while breakage within the VH aliquots (10 ,ug) were digested to completion with Sac I, fractionated by electrophoresis, blotted, and hybridized to A23HP (see Fig. 2A). locus may generate the 14qter breakpoint that arises sporad- Sizes (indicated at left in kb) were estimated by co-electrophoresis ically in normal T or B lymphocytes due to a low level of with XDNA cut by HindIII. H, HeLa c15, W53.5Bcl.5; Az2, illegitimate recombination between the TCR a-chain and W4.3AaZ2; CHO, Chinese hamster ovary. IGH genes. Since sporadic inv(14) defects occur in normal lymphocytes, it is not surprising that these also emerge somes derived from the t(8;14) ofRaji cells. The Raji-hamster occasionally in T-cell tumors such as the SUP-T1 lymphoma. hybrid SH-9-10 [which has the 8q- chromosome, containing In this regard, it is noteworthy that a rare occurrence of immunoglobulin JH to 14qter (30)], W53-5Bc15, and W4.3A- inv(14) in a B-cell tumor also resulted from recombination

az2 (containing 14pter -+ 14q24 and 14q32 -* 14qter, respec- within the VH locus-i.e., within 14qter. However, the tively) all fail to hybridize with A23HP. These results potentially most important implication of the involved se- therefore indicate that the sequences adjacent to the AT5B1 quences downstream of the IGH locus is that they corre- inv(14) breakpoint, represented by the A23HP, originate spond to a tumor-associated 14q32.1 breakpoint and thus are from 14q32 sequences located between the centromere and likely to contribute specifically to the development of T-cell the JH locus. Since the orientation ofIGH on the long arm of tumors (12). chromosome 14 is telomere-VH-JH-CH-centromere, the The presence of specific chromosomal abnormalities in 14q32 breakpoint of the AT5B1 inv(14) chromosome occurs T-cell tumors led to the suggestion that potential oncogenes at an unknown distance downstream of the JH locus. The might be identified at their chromosomal junctions (42, 43) breakpoint must also be downstream of the immunoglobulin and to the naming of the putative inv(14)-associated gene as C,. gene since Southern filter analysis of AT5B1 DNA does TCL-1 (42). The locus at 14q32.1 described in this and a not reveal rearrangement of the JH-C. region (ref. 36 and previous paper (12) corresponds to TCL-I. However, the R.B. and T.H.R., unpublished data). oncogenicity of the locus is as yet unproven, and furthermore, the tissue specificity of expression and potential DISCUSSION transforming activity of the putative 14q32.1 gene remains to be studied. At present, we refer to this locus as the 14q32.1 A-T Lymphocytes Can Correctly Assemble Antigen Recep- locus (equivalent to TCL-J) until further studies have been tor Genes. A-T is a progressive disease inherited as an conducted on this putative gene. autosomal recessive trait. A fundamental defect of DNA repair is suggested by the severe sensitivity of A-T patients We thank Dr. H. Willard for somatic cell hybrid DNAs and B. to x-rays (37) and the preponderance of cytogenetically Carritt for Chinese hamster ovary cells. We also thank I. Laviner and abnormal clones that arise in the peripheral T-cell population. A. Forster for expert technical help. It has been postulated that a DNA repair defect may also be responsible for the complex immunodeficiency encountered 1. Hecht, F., Morgan, R., Kaiser-McCaw Hecht, B. & Smith, in A-T patients, especially if the ability of developing S. D. (1984) Science 226, 1445-1447. 2. Sadamori, N., Kusano, M., Nishino, K., Tagawa, M., Yao, lymphocytes to assemble antigen receptor gene is impaired E., Yamada, Y., Amagasaki, T., Kinoshita, Y. & Ichimaru, M. (38). Nevertheless, we have observed a potentially produc- (1985) Cancer Genet. Cytogenet. 17, 279-282. tive TCR Va-Ja rearrangement on the normal chromosome 14 3. Taylor, A. M. R., Oxford, J. M. & Metcalf, J. A. (1981) Int. J. of the AT5B1 tumor. This clearly indicates that lymphocytes Cancer 27, 311-319. from A-T patients retain the capacity to properly assemble 4. Ueshima, Y., Rowley, J. D., Variakojis, D., Winter, D. & antigen receptor genes, regardless of whether the efficiency Gordon, L. (1984) Blood 63, 1028-1038. of this process is effected by the A-T disorder. 5. Zech, L., Gahrton, G., Hammarstrom, L., Juliusson, G., Sequences Downstream of the IGH Locus Appear to Con- Mellstedt, H., Robert, K. H. & Smith, C. I. E. (1984) Nature tribute to T-Cell Oncogenesis. The inv(14) and t(14;14) chro- (London) 308, 858-860. mosome abnormalities are observed in a significant propor- 6. Erikson, J., Finger, L., Sun, L., Ar-Rushdi, A., Nishikura, K., tion (25-50%o) of CLLs, T-cell lymphomas, and adult T-cell Minowada, J., Finan, J., Emanual, B. S., Nowell, P. C. & Downloaded by guest on September 29, 2021 Genetics: Baer et al. Proc. Natl. Acad. Sci. USA 84 (1987) 9073

Croce, C. M. (1986) Science 232, 884-886. M. A. & Rabbitts, T. H. (1986) Mol. Biol. Med. 3, 265-277. 7. Finger, L. R., Harvey, R. C., Moore, R. C. A., Showe, L. C. 25. Vieira, J. & Messing, J. (1982) Gene 19, 259-268. & Croce, C. M. (1986) Science 234, 982-985. 26. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517. 8. Shima, ]E. A., LeBeau, M. M., McKeithan, T. W., Minowada, 27. Lefranc, M.-P., Forster, A., Baer, R., Stinson, M. A. & J., Showe, L. C., Mak, T. W., Minden, M. D., Rowley, J. D. Rabbitts, T. H. (1986) Cell 45, 237-246. & Diaz, M. 0. (1986) Proc. Natl. Acad. Sci. USA 83, 28. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 3439-3443. 6-13. 9. Williams, D. L., Look, A. T., Melvin, S. L., Roberson, P. K., 29. Kucherlapati, R. S., Baker, R. M. & Ruddle, F. M. (1975) Dahl, G., Flake, T. & Stass, S. (1984) Cell 36, 101-109. Cytogenet. Cell Genet 14, 362-363. 10. Baer, R., Chen, K.-C., Smith, S. D. & Rabbitts, T. H. (1985) 30. Hamlyn, P. H. & Rabbitts, T. H. (1983) Nature (London) 304, Cell 43, 705-713. 135-139. 11. Denny, C. T., Yoshikai, Y., Mak, T. W., Smith, S. D., Hollis, 31. Bankier, A. T. & Barrell, B. G. (1983) Nucleic Acid Biochem. G. F. & Kirsch, I. R. (1986) Nature (London) 320, 549-551. B 508, 1-34. 12. Mengle-Gaw, L., Willard, H. F., Smith, C. I. E., Ham- 32. Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H. & marstrom, L., Fischer, P., Sherrington, P., Lucas, G., Thomp- Roe, B. A. (1980) J. Mol. Biol. 143, 161-178. son, P. W., Baer, R. & Rabbitts, T. H. (1987) EMBO J. 6, 33. Staden, R. (1986) Nucleic Acids Res. 14, 217-231. 2273-2280. 34. Rigby, P. W. J., Dieckmann, M., Rhodes, C. & Berg, P. (1977) 13. Baer, R., Forster, A. & Rabbitts, T. H. (1987) Cell 50, 97-105. J. Mol. Biol. 113, 237-251. 14. Denny, C. T., Hollis, G. F., Hecht, F., Morgan, R., Link, 35. Yoshikai, Y., Clark, S. P., Taylor, S., Sohn, U., Wilson, 1. I., M. P., Smith, S. D. & Kirsch, I. R. (1986) Science 234, Minden, M. D. & Mak, T. W. (1985) Nature (London) 316, 197-200. 837-840. 15. Aurias, A., Couturier, J., Dutrillaux, A. M., Dutrillaux, B., 36. Rabbitts, T. H., Stinson, A., Forster, A., Foroni, L., Luzzat- Herpin, F., Lamoliatte, E., Lombard, M., Muleris, M., to, L., Catovsky, D., Hammarstrom, L., Smith, C. I. E., Paravatou, M., Prieur, M., Prod'homme, M., Sportes, M., Jones, D., Karpas, A., Minowada, J. & Taylor, A. M. R. Viegas-Pequignot, E. & Volobouev, V. (1985) Hum. Genet. 71, (1985) EMBO J. 4, 2217-2224. 19-21. 37. Taylor, A. M. R., Harnden, D. G., Arlett, C. F., Harcourt, 16. Aurias, A., Dutrillaux, B. & Griscelli, C. (1983) Hum. Genet. S. A., Lehmann, A. R., Stevens, S. & Bridges, B. A. (1975) 63, 320-332. Nature (London) 258, 427-429. 17. Kennaugh, A. A., Butterworth, S. V., Hollis, R., Baer, R., 38. Waldman, T. A. (1982) in Ataxia Telangiectasia: A Cellular Rabbitts, T. H. & Taylor, A. M. R. (1986) Hum. Genet. 73, and Molecular Link Between Cancer, Neuropathology and 254-259. Immune Deficiency, eds. Bridges, B. A. & Harnden, D. G. 18. Spector, B. D., Filipovich, A. H., Perry, G. S. & Kersey, (Wiley, New York), pp. 37-51. J. H. (1982) in Ataxia Telangiectasia: A Cellular andMolecular 39. Beatty-DeSana, J. W., Hoggard, M. J. & Cooledge, J. W. Link Between Cancer, Neuropathology and Immune Defi- (1975) Nature (London) 255, 242-243. ciency, eds. Bridges, B. A. & Harnden, D. G. (Wiley, New 40. Hecht, F., McCaw, B. K., Peakman, D. & Robinson, A. York), pp. 103-108. (1975) Nature (London) 255, 243-244. 19. Oxford, J. M., Harnden, D. G., Parriugton, J. M. & Delhanty, 41. Welch, J. P. & Lee, C. L. Y. (1975) Nature (London) 255, J. D. A. (1975) J. Med. Genet. 12, 251-262. 241-242. 20. Taylor, A. M. R. & Butterworth, S. V. (1986) Int. J. Cancer 42. Croce, C. M., Isobe, M., Palumbo, A., Puck, J., Ming, J., 37, 511-516. Tweardy, D., Erikson, J., Davis, M. & Rovera, G. (1985) 21. McCaw, B. W., Hecht, F., Harnden, D. G. & Teplitz, R. L. Science 227, 1044-1047. (1975) Proc. Natl. Acad. Sci. USA 72, 2071-2075. 43. Rabbitts, T. H., Lefranc, M.-P., Stinson, M. A., Sims, J. E., 22. Karn, J., Matthes, H. W. D., Gait, M. J. & Brenner, S. (1984) Schroder, J., Steinmetz, M., Spurr, N. L., Solomon, E. & Gene 32, 217-224. Goodfellow, P. N. (1985) EMBO J. 4, 1461-1465. 23. Benton, W. D. & Davis, R. W. (1977) Science 196, 180-182. 44. Willard, H. F. & Holmes, M. T. (1984) Hum. Genet. 66, 24. Baer, R., Lefranc, M.-P., Minowada, J., Forster, A., Stinson, 272-275. Downloaded by guest on September 29, 2021