A Planarian Kinesin Associated Protein 3 Homolog Is Required for Spermatogenesis and Ciliogenesis

Wright State University CORE Scholar

Browse all Theses and Dissertations Theses and Dissertations

2020

A Planarian Kinesin Associated Protein 3 Homolog is Required for Spermatogenesis and Ciliogenesis

Donovan Christman Wright State University

Follow this and additional works at: https://corescholar.libraries.wright.edu/etd_all

Part of the Biology Commons

Repository Citation Christman, Donovan, "A Planarian Kinesin Associated Protein 3 Homolog is Required for Spermatogenesis and Ciliogenesis" (2020). Browse all Theses and Dissertations. 2319. https://corescholar.libraries.wright.edu/etd_all/2319

This Thesis is brought to you for free and open access by the Theses and Dissertations at CORE Scholar. It has been accepted for inclusion in Browse all Theses and Dissertations by an authorized administrator of CORE Scholar. For more information, please contact [email protected].

A PLANARIAN KINESIN ASSOCIATED PROTEIN 3 HOMOLOG IS REQUIRED FOR SPERMATOGENESIS AND CILIOGENESIS

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science

DONOVAN CHRISTMAN B.S., Wright State University, 2018

2020 Wright State University WRIGHT STATE UNIVERSITY

GRADUATE SCHOOL

Apr. 29 2020

I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Donovan Christman ENTITLED A Planarian Kinesin Associated Protein 3 is Required for Spermatogenesis and Ciliogenesis BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science.

Labib Rouhana, Ph.D. Thesis Director

David Goldstein, Ph.D Chair, Department of Biological Sciences Committee on Final Examination

Scott Baird, Ph.D.

Shulin Ju, Ph.D.

Barry Milligan, Ph.D. Interim Dean of the Graduate School

ABSTRACT

Christman, Donovan. M.S. Department of Biological Sciences, Wright State University, 2020. A Planarian Kinesin Associated Protein 3 Homolog is Required for Spermatogenesis and Ciliogenesis.

Microtubule-based structures are an essential part of eukaryotic cells as they are involved in a number of processes such as phagocytosis, chromosome separation, intracellular transport, and cell motility. Transport along microtubules is accomplished by kinesin superfamily proteins (KIFs), which are motor proteins that bind cargo and use ATPase activity to move along microtubules in an anterograde fashion. One of the most common kinesin complexes is the heterotrimeric Kinesin

2 complex which is composed of KIF3 subunit dimers and the Kinesin Associated

Protein 3 (KAP3). This complex is known as the KIF3 complex and functions along microtubules in cilia and flagella. A KAP3 ortholog in Schmidtea mediterranea

(Smed-KAP3) was identified as a candidate gene with enriched expression in the planarian reproductive system. Whole-mount in situ hybridization analyses confirmed preferential expression of Smed-KAP3 in planarian testes. Functional analysis by RNA interference (RNAi) followed by immunofluorescence revealed loss of flagella in elongating spermatids of Smed-KAP3 knockdown animals.

Additionally, Smed-KAP3(RNAi) planarians exhibited an inchworm-like movement rather than the continuous gliding seen in negative control knockdowns. The

iii inchworm-like phenotype is indicative of dysfunctional epidermal motile cilia, which line the outside of the organism and propel planarian movement. This was confirmed by transmission electron microscopy analysis, which showed fewer and shorter epidermal cilia on Smed-KAP3(RNAi) animals. From these data we conclude that Smed-KAP3 is required for assembly and/or maintenance of planarian motile cilia and flagella. Broader implications of this research include information that can be applied towards understanding asthenozoospermia and ciliopathies caused by motile cilia disfunction.

TABLE OF CONTENTS

Chapter 1: INTRODUCTION…………………………….……………………………1

1.1 Cilia, Flagella, and Intraflagellar transport……………………………….1

1.2 Kinesin Associated Protein 3 and the KIF3 complex….………………..3

1.3 Planarians………….………………………………………………………..4

1.4 Purpose……………………………………………………………………...6

Chapter 2: MATERIALS AND METHODS...………………………………………..8

2.1 Planarian Maintenance…………………………………………………….8

2.2 Identification and cloning of S. mediterranea KAP3 homologs………..8

2.3 Preparation of riboprobes and dsRNA by in vitro transcription………..9

2.4 Whole-mount and fluorescent in situ hybridization…………………….10

2.5 RNA-interference…………………………………………………...……..11

2.6 Whole-mount immunofluorescence and DAPI staining of

epidermal cilia and protonephridia……………………….…………..12

2.7 Electron microscopy imaging of external cilia………………...………..12

2.8 Light Avoidance Assay……………………………………………………13

2.9 Testes Maceration………………………………………………………...13

Chapter 3: RESULTS………………………………………………………………...15

3.1 Characterization of a KAP3 homolog with preferential expression in

the testes, sensory organs, and epidermis of S. mediterranea…..15

3.2 Smed-KAP3 is necessary for planarian motile cilia-driven gliding

Motility…………………………………………………………………..17

3.3 Smed-KAP3 is required for epidermal cilia integrity………...…….…..19

3.4 Smed-KAP3 is required for fluid homeostasis………..……..…………20

3.5 Smed-KAP3 is required for spermatogenesis………………...... …22

3.6 Analysis of KIF3 complex motor proteins………………………,………23

Chapter 4: DISCUSSION……………………………………………..…………..….25

4.1 KAP3 characterization and expression patterns……………………….25

4.2 KAP3 is required for spermatogenesis in S. mediterranea…………...25

4.3 KAP3 is necessary for ciliary lengthening………………………………26

4.4 KAP3 function in protonephridia…………………………………………28

4.5 The KIF3 complex in ciliogenesis and spermatogenesis……………..29

4.6 KAP3 is known to function in ciliated neurons…..……………………..30

4.7 KAP3 knockdown planarians have normal light sensing capabilities..31

4.8 Conclusions……………………………………………………………..…31

REFERENCES…………………………………………….…………………………..32

APPENDIX…………………………………………………………………………..…75

List of Figures

Figure 1: KAP3 is a highly conserved protein containing multiple Armadillo repeat domains……………………………………………………………...... …42-43

Figure 2: KAP3 protein sequence alignment………………………………..…44-47

Figure 3: KAP3 is expressed in S. mediterranea epidermis and testes…….48-49

Figure 4: Smed-KAP3 is preferentially expressed in secretory, pharyngeal, protonephridial, neuronal, and epidermal cells…………………………………50-51

Figure 5: Smed-KAP3 is expressed in neural, protonephridial, epidermal, pharyngeal, and muscle cell types………………………………………...... 52-53

Figure 6: Smed-KAP3 is expressed in latter stages of spermatogenesis…..54-55

Figure 7: Smed-KAP3(RNAi) planarians exhibit movement defects……...…56-57

Figure 8: Smed-KAP3(RNAi) planarians have motile, epidermal cilia defects but normal dorsal cilia………………………………………………………………….58-59

Figure 9: Smed-KAP3(RNAi) planarians lack fully developed epidermal cilia………………………………………………………………………………..…60-61

Figure 10: Smed-KAP3 is required to maintain fluid homeostasis………..…62-63

Figure 11: Smed-KAP3(RNAi) planarians have a decrease in sperm production………………………………………………………………………..…64-65

Figure 12: Smed-KAP3(RNAi) planarians show defects in spermatogenesis………………………………………………………………..…66-67

Figure 13: Testes isolation reveals tail and head elongation do not occur in Smed-KAP3(RNAi) planarians………………………………………………...…68-69

Figure 14: Smed-KIF3A is required for normal spermatogenesis…………...70-71

Figure 15: Smed-KIF3A is required for epidermal cilia formation on the lateral edge…………………………………………………………………………………72-73

vii

List of Tables

Table 1: Kinesin data from CPEB2 knockdown…………………………..….…….74

Table 2: Phenotypes observed in kinesin-2 family knockdowns…………...…….74

viii

Chapter 1: Introduction

1.1 Cilia, Flagella, and Intraflagellar transport

Microtubules are essential components of every eukaryotic cell. They act

structurally in the cytoskeleton and functionally in the positioning of organelles

during cell division and intracellular transport (Desai and Mitchison, 1997).

Intracellular cargo transport is accomplished by motor proteins that act as a

bridge between the microtubule and the cargo. These motor proteins contain a

microtubule-associating, globular, N-terminus domain with ATPase activity

(Brady, 1985; Vale, 1985). This domain allows the motor to hydrolyze ATP and

move forward, converting chemical energy into mechanical movement (Kull et

al., 1996, Moyer et al., 1998; Hua et al., 1997). The head domain is connected

via a coiled stalk to a C-terminus tail domain which aids in cargo

interaction/binding (Vale and Fletterick, 1997). Together, these domains

represent the most basic motor protein structure. The two classes of

microtubule-associated motors are dynein and kinesin. Dynein motors travel

towards the minus end of microtubules. Minus ends typically point towards the

center of the cell and are anchored with the centrosome in the microtubule

organization center (MTOC; Brouhard and Rice, 2018). Conversely, kinesin

motors transport towards the growing or plus-end of the microtubule, delivering

their cargoes to more distal regions of the cell.

Motile cilia and flagella are microtubule-based structures that are responsible for cellular locomotion and internal fluid movement. They are long, cellular protrusions covered by the cell membrane and are found in nearly every eukaryotic organism (reviewed by Carvalho-Santos et al., 2011). While both have similar functions, one main difference is the size and prevalence of cilia and flagella. Flagellum are larger and longer but are much less common. Cells such as sperm and unicellular flagellates typically have less than three flagella per cell. Cilia are shorter but are much more numerous, as there can be many hundreds of cilia on the cell surface. Airways and internal ducts are lined with cilia that beat synchronously to move mucus or fluids across the cell surface

(reviewed by Satir and Christensen, 2007).

Motile cilia and flagella share the same internal, “9+2”, axonemal microtubule structure in which there are two microtubule singlets in the center surrounded by nine microtubule doublets (reviewed by Chaaban and Brouhard,

2017). Non-motile cilia differ as they have a “9+0” microtubule layout which lacks the central microtubules (reviewed by Wheway et al., 2018). The axoneme arises from a basal body and extends away from the cell while remaining covered by the plasma membrane. Axoneme elongation occurs by the addition of α/β-tubulin dimers to the growing end of the microtubule

(reviewed by Khan and Scholey, 2018). Cilia and flagella are devoid of protein synthesis however, and thus proteins needed to elongate and maintain the axoneme must be moved in via a process called Intraflagellar Transport (IFT; reviewed by Ishikawa and Marshall, 2011; Bhogaraju et al., 2014). IFT of

axonemal proteins in the anterograde direction, that is, away from the cell body,

is accomplished by kinesin-2 subfamily complexes (reviewed by Scholey,

2013). Kinesin-2 is a subfamily of kinesin and comes in one of two forms: KIF17

and KIF3. The kinesin superfamily protein 17 (KIF17) complex is a motor

protein homodimer expressed in neurons and testes (Wong-Riley and

Besharse, 2013). The kinesin superfamily protein 3 (KIF3) complex is a

heterotrimer consisting of two motor proteins and an accessory protein known

as Kinesin Associated Protein 3 (KAP3; Yamazaki et al., 1995, 1996; Scholey,

2013).

1.2 Kinesin Associated Protein 3 and the KIF3 complex

The KIF3 heterotrimeric complex is one of the most widely expressed

kinesin complexes in mammals (Yamazaki et al., 1995). The complex consists

of two motor proteins, KIF3A and either KIF3B or KIF3C (Yamazaki et al., 1995;

Muresan et al., 1998; Yang and Goldstein, 1998), as well as the KAP3

accessory protein (Yamazaki et al., 1995, 1996). The two motor proteins of the

complex intertwine with one another via their coiled stalk domains. This pairs

the N-terminals of the motor proteins together and likewise with the C-terminals

(Yamazaki et al., 1995; Wedaman et al., 1996). This allows for the globular

heads on the N-terminals to hydrolyze ATP in an alternating fashion with each

motor taking turns to hydrolyze ATP and move the complex forward. KAP3 is a

globular, armadillo repeat-containing protein that binds to the C-terminal tail

domains of the motor dimer (Yamazaki et al., 1996; Gindhart and Goldstein,

1996; Shimizu et al., 1996). KAP3 aids in motor-to-cargo interactions through

those armadillo repeats (Takeda et al., 2000; Ichinose et al., 2019).

As previously mentioned, the KIF3 complex, along with KIF17, is

responsible for IFT during axoneme formation. Disruption of the KIF3 complex

results in phenotypes associated with ciliary dysfunction, such as left/right

asymmetry determination (Nonaka et al., 1998; Hirokawa et al., 2009),

incomplete renal ciliogenesis (Lin et al., 2003), and incomplete sperm tail

formation (Lehti et al., 2013). Other roles of the KIF3 complex include axonal

elongation in neurons (Aizawa et al., 1992; Kondo et al., 1994) and

endosome/lysosome transport (Brown et al., 2005). Proteins transported by

KIF3 include fodrin (Takeda et al., 2000), tumor suppressor adenomatous

polyposis coli (Shi et al., 2004), cell polarity proteins PAR3 and PAR6

(Nishimura et al., 2004), as well as N-cadherin and β-catenin (Teng et al.,

2005). Ciliopathies associated with the KIF3 complex include Joubert

syndrome, polycystic kidney disease, and Kartagener syndrome, to name a few

(reviewed by Hirokawa et al., 2009). Most research regarding KIF3’s function

in ciliogenesis focuses on the KIF3 motors: KIF3A, KIF3B, and KIF3C, and not

KAP3. How KAP3 relates to spermatogenesis and ciliogenesis will be the focus

of this study.

1.3 Planarians

The freshwater flatworm Schmidtea mediterranea is quickly becoming a

model organism and is advantageous to use for a multitude of reasons. S.

mediterranea have large numbers of pluripotent stem cells (termed neoblasts) which are the only proliferating cells in somatic tissues and which give rise to all differentiated cells (reviewed by Newmark and Sanchez Alvarado, 2002).

Neoblasts allow for remarkable, whole-body regeneration from small fragments of the organism in response to injury or amputation. The large neoblast population makes planarians extremely adaptable in response to their environment. During times of starvation the animal can shrink and absorb reproductive organs while maintaining the ability to restore the lost organs when food becomes abundant.

S. mediterranea exist in two reproductive forms: an asexual strain that reproduces via transverse fission regeneration, and a hermaphroditic strain that is cross-fertilized via sperm exchange with a partner (reviewed by

Newmark and Sanchez Alvarado, 2002). Hermaphroditic planarians develop their reproductive structures post-embryonically, that is, after hatching, once they reach a certain size (Wang et al., 2007). Reproductive structures include testes, ovaries, and accessory organs such as yolk glands and the copulatory apparatus. These arise from the neoblast population during growth of hermaphroditic planarians.

Planarians are an excellent model species to study ciliopathies and ciliogenesis, as the external epithelium is covered in thousands of motile cilia.

Additionally, hundreds of ciliated cells in protonephridia regulate fluid homeostasis (reviewed by Rompolas et al., 2009; Rink et al., 2011). The external cilia are responsible for the gliding movement of planarians and can

be easily analyzed after experimentation without extensive damage to the

planarian body. Malfunctioning cilia in protonephridial cells results in a bloating

of the animal as they cannot properly filter fluid. Altogether, it is apparent that

planarians are an excellent model to study stem cell biology, regeneration,

reproductive structure development, and ciliogenesis.

1.4 Purpose

The purpose of this research is to test the function of KAP3 in

spermatogenesis. KAP3 was initially flagged as a gene with enriched

expression during S. mediterranea germline development. Knockdown of

Cytoplasmic Polyadenylation Element Binding Protein-2 mRNA transcripts in

S. mediterranea (Smed-CPEB-2) resulted in a loss of reproductive structures

(Rouhana et al., 2017). RNAseq data from sexual (control) and sexual CPEB-

2 knockdown planarians were compared, and differentially expressed

transcripts were analyzed (Rouhana et al., 2017). From this experiment, it is

hypothesized that transcripts found at lower levels in the CPEB-2 knockdowns,

but not wild-type, are likely to contribute to sexual organ and germline

development or function (Rouhana et al., 2017). KAP3 was flagged as one of

these genes.

The initial hypothesis was that KAP3 is involved in germline development

through contributions to sperm tail formation. Analysis of the KAP3 S.

mediterranea homolog revealed many interesting observations. Smed-KAP3

was found to be expressed in the later stages of spermatogenesis, namely

spermatocytes and spermatids. Knockdown of Smed-KAP3 revealed loss of mature sperm in S. mediterranea testes. Smed-KAP3(RNAi) knockdowns also exhibited an inchworming movement which was attributed to malfunctioning external cilia. This behavior was characterized by a light avoidance assay, as well as structural analysis of epidermal cilia by electron microscopy and fluorescence antibody staining. Additionally, knockdown animals demonstrated a bloating phenotype that was attributed to improper protonephridia function.

Chapter 2: Materials and Methods

2.1 Planarian Maintenance

A hermaphroditic sexual clonal line of Schmidtea mediterranea (Zayas et al., 2005) was kept at 18oC in 0.75X Montjuïc salts as described per (Wang et al.,

2007). Asexual planarian populations were maintained at 21oC as per (Sanchez

Alvarado et al., 2002) and were kept in modified Montjuïc salts as described by

(Pearson and Gurley; http://lab.research.sickkids.ca/pearson/wpcontent/uploads/sites/54/2015/10/Plan arian_careNfeedingNliverprep_Pearson.pdf). Planarian populations were fed on a weekly to bi-weekly diet of calf liver chunks and all planarians were starved for one week prior to experimentation.

2.2 Identification and cloning of S. mediterranea KAP3 homologs

Primers were constructed based on (uc_smed_v2_Contig44520) and were used to amplify Smed-KAP3 from sexual strain cDNA using the following oligo primers.

KIFAP3short primer: 5’-GAGCATTGGCACGAGTTCTTCGAGAAGA-3’ (forward)

KIFAP3shortR primer: 5’-CCTTCACTGATAACCGACGCAATCTCTG-3’ (reverse)

KIFAP3longbprimer:5’-GAACTGGAACTATTGATGTACATCCAACTG-3’ (forward)

KIFAP3longRb primer: 5’-CTCCTCTTGACTTTCTAGCATATTGGC-3’ (reverse) cDNA amplicons were then ligated into the pGEM-T vector (Promega, Madison,

WI) by T/A cloning as described by the manufacturer’s protocol. Clones were verified by Sanger sequencing (Retrogen, San Diego, CA). These clones were subsequently used for RNAi and in situ hybridization experiments.

2.3 Preparation of riboprobes and dsRNA by in vitro transcription

Templates for in vitro transcription of riboprobes and dsRNA were generated by PCR using the pGEMT3T7v2 primer (5’-

GAATTAATTAACCCTCACTAAAGGGAGAATTTAATACGACTCACTATAGGGC

GAATTGG-3’) and the pGEMT7SP6v2 primer (5’-

GAATTTAATACGACTCACTATAGGGCGCCAAGCTATTTAGGTGACACTATAG

AATACTC-3’) which anneal to promoters upstream and downstream of the multiple cloning site of pGEM-T. Amplicons were cleaned using DNA Clean and

Concentrator-5 columns (Zymo Research, Irvine, CA), eluted in 20 µl of RNase- free water, and subsequently used for in vitro transcription. SP6 RNA polymerase was used to generate antisense riboprobes while T7 RNA polymerase was used to generate double stranded RNA (dsRNA). Digoxigenin-UTP-labeled riboprobes were synthesized as described by (King and Newmark, 2013), ethanol-precipitated using LiCl after DNase-treatment, and re-suspended in 100 µl hybridization buffer.

DsRNA was synthesized using T7 RNA polymerase as described by (Rouhana et al., 2013).

2.4 Whole-mount and fluorescent in situ hybridization

Asexual planarians 0.3-0.6 cm in length and sexual planarians of 1.0 to 1.5 cm in length were prepared for in situ hybridization as described by King and

Newmark (2013), with alterations for sexual animals as described below. Sexual animals were washed two times with 0.75X Monjuïc salts and killed using a 10%

N-acetyl cysteine (NAC) solution dissolved in phosphate-buffer saline (PBS). The samples were placed on a rocker at room temperature for 8-12 minutes in corroboration with animal size. The NAC solution was removed and the animals were fixed in PBS containing 0.3% Triton-X (PBSTx) and 4% formaldehyde for 1.5 hours at 4oC. Samples were gradually dehydrated, first in a 1:1 Methanol:PBSTX solution and next in 100% methanol before storing samples at -20oC. After gradual rehydration using PBSTx, samples were bleached in a formamide-hydrogen peroxide solution (as per King and Newmark, 2013) under bright light for 2 hours, treated for 12 minutes with 10 µg/ml Proteinase K (Roche, Mannheim, Germany) in PBSTx supplemented with 0.1% SDS, and post-fixed for 10 minutes in PBSTx containing 4% formaldehyde. Subsequent steps for riboprobe incubation, post- hybridization washes, antibody incubation and development for colorimetric ISH were performed as per Pearson et al. (2009). For FISH analyses, development was performed as per King and Newmark (2013). All samples were placed and

mounted in a 4:1 glycerol:PBSTx solution. Colorimetric samples were imaged using a Zeiss V.16 SteREO microscope equipped with a Canon EOS Rebel T3 camera whereas FISH samples were imaged with a Nikon C2+ confocal microscope equipped with NIS elements C software.

2.5 RNA-interference

RNA-interference was performed as described by Rouhana et al. (2013).

Groups of six planarians were fed to satiation with puree liver solution containing gene-specific dsRNA at a concentration of 100 ng/µl twice a week for three or more weeks. Animals were then assessed for movement defects, bloating, and light avoidance, before being fixed for anatomical analysis by immunofluorescence and

DAPI staining. Luciferase open reading frame sequence was used as a negative control as it does not impact planarians physiology (Magley et al., 2019).

Prohormone Convertase 2 (PC2) dsRNA was used as a positive control for RNAi efficacy in spermatogenesis analysis (Collins et al., 2010). Note that two different dsRNA constructs were used to validate the phenotypes seen. One was 724nts in length and the other was 2,622nts in length. Both produced the same phenotype.

In order to confirm that knockdown of KAP3 results in minimal KAP3 levels real time quantitative PCR (RTq-PCR) should be done as described by Lesko et al.,

2020). However, due to time restrictions RTqPCR was not performed.

2.6 Whole-mount immunofluorescence and DAPI staining of epidermal cilia and protonephridia

Whole-mount immunofluorescence analysis using monoclonal anti-α- tubulin antibody clone B-5-1-2 (1:1000 dilution; Cat. No. T5168, Sigma Aldrich, St.

Louis, MO) and DAPI staining was performed as described by Magley and

Rouhana (2019). Goat-anti-mouse IgG AlexaFluor-488 conjugated (1:500 dilution;

A11029, ThermoFisher, Walthham, MA) was used as the secondary antibody.

Samples were imaged using a Nikon C2+ confocal microscope equipped with NIS

Elements C software (version 4.40). The 10X objective was used for entire animal imaging, 20X for imaging large areas of central cilia, and 60X oil immersion for high magnification imaging of cilia and protonephridia.

2.7 Electron microscopy imaging of external cilia

Sexual planarians of 0.5-1.0 cm length were subjected to 3 weeks of RNAi feedings and were fixed overnight at room temperature in a solution containing 9 mls of PBS buffer with 1 ml of glutaraldehyde. Fixed samples were submitted for further processing and TEM analysis by the Campus Microscopy and Imaging

Facility at The Ohio State University for TEM analysis.

2.8 Light Avoidance Assay

Light avoidance assays were performed as described by (Magley and

Rouhana, 2019). Briefly, after RNAi feedings were complete, groups of 6 sexual planarians were collected in 50 ml conical tubes and washed with fresh 0.75X

Montjuïc salts. Planarians were then decanted into the most illuminated region of a 150 x 15 mm Petri dish filled with 50 mls 0.75X Montjuïc salts. Each group of

RNAi planarians were placed in a separate dish. Planarian movement was recorded for 6 minutes and the average time spent within a section of the petri dish

(see Figure 7) was measured for each animal. Standard deviation and two-tailed t-test were calculated for statistical significance.

2.9 Testes Maceration

After RNAi feedings were completed, Smed-KAP3(RNAi) and luciferase(RNAi) planarians were placed in fresh maceration solution. This solution consisted of 150 µl of methanol, 10 µl of acetic acid, 100 µl of glycerol, and 740 µl of water. The planarians were placed in this solution for 1-2 hours with gentle rocking in order to release the testes from the rest of the planarian tissue. Testes lobules appear as white clumps and were paced into 1.5 ml tubes for further processing. Lobules were washed with 1XPBS and centrifuged at 1500 g before fixing with 4% formaldehyde for 15 minutes. Lobules were washed with PBS and placed in blocking solution (0.6% BSA + 0.45% Fish Gelatin) overnight at 4oC. 100

µl of anti-acetylated-α-tubulin (Lys40) monoclonal antibodies (clone 6-11B-1;

Thermo Fisher, Waltham, MA; Catalog No. 32-2700; 1:400) was added for 2 hours

at 4oC. After spinning down for 15 minutes the lobules were washed with 1XPBSTx for 15 minutes and centrifuged again at 1500 g. 100 µl of secondary antibody

(1:400 dilution of goat-anti-mouse IgG AlexaFluor-488 conjugated; Cat. No.

A11029, ThermoFisher, Waltham, MA) was added at 4oC for overnight incubation.

DAPI was also added with the secondary antibody. Tubes were spun at 1500 g and the liquid was aspirated off before adding 10 µl of 50% glycerol/50% PBS to the tubes. Lobules were resuspended and mounted onto glass slides.

Chapter 3: Results

3.1 Characterization of a KAP3 homolog with preferential expression in the testes, sensory organs, and epidermis of S. mediterranea

A KAP3 homolog (Contig29497), identified in a reference transcriptome of

S. mediterranea hermaphroditic strain (Rouhana et al., 2012), was flagged as having a possible role in reproductive system development or function (Rouhana et al., 2017). The sequence of Smed-KAP3 was confirmed through Basic Local

Alignment Search Tool (BLAST) analyses of independent S. mediterranea genomes and transcriptomes compiled in the PlanMine databank (Brandl et al.,

2016). Primers were designed based off (uc_smed_v2_Contig44520) reference sequence (see Methods) and used to clone the entire Smed-KAP3 open reading frame from sexual S. mediterranea cDNA. Amplicons were then ligated into the pGEM-T vector (Promega, Madison, WI) and verified via Sanger sequencing.

Sanger sequencing revealed an alternatively spliced isoform (Smed-KAP3-short) that lacked 114 nucleotides, from the end of exon 7 and all of exon 8, which resulted in the loss of an armadillo repeat domain when compared to dd_Smes_v1_44359_1_1 full length reference sequence (Smed-KAP3-long;

Figure 1, A-C). SMART protein domain prediction showed four armadillo repeats in the Smed-KAP3-long sequence which are believed to aid in protein-cargo interactions (Figure 1, B and C). Smed-KAP3-short has 52% amino acid sequence

identity with its human ortholog, 53% with Mus musculus, 51% with Danio rerio, and 51% with Strongylocentrotus purpuratus (Figures 1 and 2). Smed-KAP3- short has a 0.0 e-value with human KAP3 protein. This indicates KAP3 is a highly conserved protein across a wide range of organisms. No other KAP3 homologs were found in the genome of S. mediterranea. From here on, Smed-KAP3 will refer to transcripts from this gene, without specific assignment to long or short isoforms.

Whole-mount in situ hybridization (WMISH) was utilized to determine Smed-

KAP3 expression in sexually mature S. mediterranea hermaphrodites. Riboprobes designed to recognize Smed-KAP3 detected expression in the testes, which are found in the dorsolateral region (Figure 3A). Detection of Smed-KAP3 was also observed in the head region, possibly labeling sensory neurons, as well as in the epidermis of the planarian body (Figure 3A). To better understand the distribution of expression of Smed-KAP3, I took advantage of single-cell RNAseq (scRNAseq) data available from asexual planarians. ScRNA-seq data revealed Smed-KAP3 expression is highest in neuronal, protonephridial, and secretory cell lineages

(Figures 4 and 5, Plass et al., 2018; Fincher et al., 2018). Protonephridia are responsible for osmoregulation and are known to possess motile cilia, suggesting that Smed-KAP3 may be involved with this ciliated organ. Ciliated cells with sensory function have been noted in planarians as well (Ross et al., 2018).

However, Smed-KAP3 may simply be involved in axonal transport during elongation (Aizawa et al., 1992; Kondo et al., 1994). The scRNA-seq also notes lower expression of Smed-KAP3 in epidermal and pharyngeal cell lineages

(Figures 4 and 5, Plass et al., 2018; Fincher et al., 2018). The planarian epidermis

is covered with cilia that are responsible for locomotion (Glazer et al., 2010), while the pharynx is also known to contain ciliated cells (Adler et al., 2014).

To determine distribution expression of Smed-KAP3 during spermatogenesis, fluorescent in situ hybridization (FISH) was performed on sexually mature S. mediterranea. FISH analyses confirmed WMISH observations as it revealed Smed-KAP3 expression in testes, and more specifically during later stages of spermatogenesis (Figure 6). Smed-KAP3 expression overlapped with that of tektin-1 (Figure 6B), a spermatocyte-specific marker (Chong et al., 2011), as well as with that of protein kinase A (Figure 6C), a spermatid-specific marker

(Chong et al., 2011). Conversely, Smed-KAP3 expression only partially overlapped with that of germinal histone H4 (Figure 6A), which labels spermatogonia (Wang et al., 2007). These observations suggest that Smed-KAP3 expression is highest during latter stages of spermatogenesis in S. mediterranea.

3.2 Smed-KAP3 is necessary for planarian motile cilia-driven gliding motility

To determine the function of Smed-KAP3 I performed RNA interference

(RNAi) to disrupt expression of this gene. After 3-4 weeks of RNAi feeding in sexual

S. mediterranea the animals began to exhibit an inch-worming phenotype. This is representative of epidermal cilia malfunction, as described previously by others

(Rink et al., 2011). This inch-worming phenotype is characterized by the head moving forward first followed by a dragging of the rest of the body in a broken pattern. A separate group of sexual planarians was fed dsRNA with sequence

corresponding to the luciferase gene which acts as a negative control group. The negative control group showed normal planarian locomotion, which is best described as a continuous, gliding pattern. Control sexual planarians moved at

~1.3 mm/sec (0.74 mm/sec for asexuals) while sexual Smed-KAP3(RNAi) animals moved at a speed of ~0.42 mm/sec (0.32 mm/sec for asexuals). To quantify the differences in movement I subjected both groups to a light motility assay which is dependent on planarian light avoidance (Inoue et al., 2004). Planarian RNAi groups were placed directly into the illuminated region of a 150 mm Petri dish and their migration to less-illuminated regions was recorded for five minutes. Control animals moved out of the illuminated regions much faster (average of 49 seconds;

Figure 7, A and C) than Smed-KAP3(RNAi) planarians (average of 226.9 seconds per animal; Figure 7, B and D). All control animals were able to make it to the darkest region of the dish and spent the most time in that region (Figure 7A).

Conversely, only one Smed-KAP3(RNAi) animal made it to the darkest area within the 5-minute time period. The remaining six Smed-KAP3(RNAi) animals made it out of the light but did not reach the darkest region (Figure 7B). Together, these results indicate that Smed-KAP3 is a necessary component for normal planarian locomotion. Furthermore, these results suggest that Smed-KAP3 is not required for photosensory functions as all test animals moved towards dark areas. It is hypothesized that Smed-KAP3 functions in the epidermal cilia responsible for planarian locomotion.

3.3 Smed-KAP3 is required for epidermal cilia integrity

The movement defects observed during Smed-KAP3(RNAi) treatment suggested a role for KAP3 in planarian epidermal motile cilia. To investigate this, asexual planarians were subjected to RNAi treatment until inch-worming appeared

(2.5 weeks). At this point, samples were fixed and processed to observe epidermal cilia. I elected to stain with an anti-acetylated-α-tubulin antibody and visualize using immunofluorescence and confocal microscopy as described by others

(Sanchez Alvarado and Newmark, 1999; Glazer et al., 2010). Epidermal cilia were seen on both luciferase(RNAi) and Smed-KAP3(RNAi) animals, but were less abundant in Smed-KAP3(RNAi) knockdowns (Figure 8, C-F). The ventral epidermis of luciferase(RNAi) planarians displayed large swaths of anti-acetylated-

α-tubulin staining and showed ciliary extensions away from the body (Figure 8, C and E). However, Smed-KAP3(RNAi) planarians had noticeably shorter structures labeled by anti-acetylated-α-tubulin antibodies on their ventral epidermis (Figure

8, D and F). I interpret this as localization of α-acetylated-tubulin near the basal body but with no ciliary formation occurring as a result. Images taken of the lateral epidermis show similar results. Smed-KAP3(RNAi) planarians showed much fewer cilia on the lateral edge when compared to luciferase(RNAi) planarians (Figure 8,

E and F). The low number of cilia on Smed-KAP3(RNAi) knockdowns did not extend from the cell body as can be seen in luciferase(RNAi) planarians (Figure 8,

E’ and F’). It is important to note that staining revealed dorsal cilia in both RNAi groups (Figure 8, A and B). Further analysis of the function of Smed-KAP3 in dorsal cilia needs to be done.

To analyze epidermal cilia directly, I used simple light microscopy. In Smed-

KAP3(RNAi) planarians I observed a lack of consistent ciliary protrusions when compared to luciferase(RNAi) planarians (Figure 9, A and B). To further analyze ciliary structures, I elected to use Transmission Electron Microscopy (TEM).

Control animal cilia were larger, more numerous, and extended further away from the cell. When compared to negative controls, Smed-KAP3(RNAi) planarians exhibited much shorter ciliary projections and often contained what appeared to be underdeveloped ciliary structures projecting from the membrane (Figure 9, C and D). Cross sections of control animal cilia showed a clear 9+2 microtubule pattern (Figure 9C), while Smed-KAP3(RNAi) animal ciliary cross sections lacked such structures and often appeared disorganized (Figure 9D). From these results

I conclude that Smed-KAP3 is an integral component of motile epidermal cilia machinery that is required for formation or growth of axonemes.

3.4 Smed-KAP3 is required for fluid homoeostasis

In addition to the inch-worming phenotype, a second phenotype appeared in Smed-KAP3(RNAi) planarians, though it was after the initial inch-worming movement was observed. Smed-KAP3(RNAi) planarians exhibited a bloating appearance that was not seen in control planarians. I analyzed the bloating phenotype dynamics in asexual planarians (Figure 10, A and B). As the RNAi feedings continued, the planarians would slowly exhibit bloating that started in the posterior region. As RNAi treatment continued past the initial bloating, almost all

planarians eventually exploded and died (Figure 10C). Those that survived were severely blistered and likely only lived because RNAi treatment was stopped once the first planarian exploded. This bloating is characteristic and indicative of malfunctioning protonephridia. Protonephridia are organs that act as a filtration system and are responsible for proper fluid homeostasis (Rink et al., 2011;

Scimone et al., 2011; Thi-Kim Vu et al., 2015). Protonephridia are composed of flame cells that contain multiple motile cilia and are responsible for filtering fluids.

The fluid is then further processed for osmotic changes or secretion which are done by other tubules (Rink et al., 2011; Thi-Kim Vu et al., 2015). To observe any differences in the protonephridia between control and Smed-KAP3(RNAi) planarians, I stopped RNAi treatment once bloating appeared. I stained with anti-

α-tubulin antibody before visualizing with immunofluorescence and confocal microscopy as described by (Glazer et al., 2010; Sanchez Alvarado and Newmark,

1999; Figure 10, D and E). Observations of flame cell distribution did not show any discernable difference between luciferase(RNAi) and Smed-KAP3(RNAi) groups

(Figure 10, D and E). Closer inspection of protonephridial cilia did not result in any significant difference in ciliary prevalence or size when comparing Smed-

KAP3(RNAi) planarians to controls. These results indicate that Smed-KAP3 is required for proper protonephridia function, though further analysis is required.

3.5 Smed-KAP3 is required for spermatogenesis

In situ hybridization revealed that Smed-KAP3 transcripts were most abundant in the testes (Figure 3A), with further FISH analysis showing preferential expression in later stages of spermatogenesis (Figure 6). To test the function of

Smed-KAP3 in spermatogenesis, I performed RNAi feedings on sexual strain juveniles for 4-5 weeks. I elected to use juveniles as they lack fully-developed reproductive structures, thus allowing for RNAi to occur as the animal grows and reproductive structures appear. The testes and copulatory apparatus contain high amounts of sperm which contain highly condensed DNA. DAPI staining can be utilized to assess how much sperm is present in Smed-KAP3(RNAi) knockdowns when compared to negative controls. In addition to luciferase(RNAi) and Smed-

KAP3(RNAi), I used Prohormone Convertase 2 (PC2) dsRNA as a positive control for disruption of sperm development. PC2 is known to be required for maturation of the reproductive system (Collins et al., 2010). DAPI staining of testes in Smed-

KAP3(RNAi) animals was much less apparent than in luciferase(RNAi), but was comparable to PC2(RNAi) animals (Figure 11). Smed-KAP3(RNAi) animals had normal testes distribution when compared to luciferase(RNAi), but had a similar morphology to PC2(RNAi) testes (Figure 11). For further analysis, I isolated testes and stained with DAPI and anti-acetylated-α-tubulin. Smed-KAP3(RNAi) planarians showed an accumulation of cells undergoing incomplete spermatogenesis when compared to negative controls (Figure 12). During the last stage of spermatid maturation, both the head and flagella elongate, which can be identified by long, wispy streaks of DAPI and anti-acetylated-α-tubulin antibody

staining. This can be seen in luciferase(RNAi) planarians (Figure 13A). However,

Smed-KAP3(RNAi) animals did not have comparable elongated structures labeled by either DAPI or anti-acetylated-α-tubulin, which indicated incomplete sperm maturation (Figure 13B). Spermatids remained round or only partially elongated and flagellar development was also severely reduced. Taken together, these results suggest that Smed-KAP3 is required for spermatid elongation and flagella formation.

3.6 Analysis of KIF3 complex motor proteins

In order to test the function of the KIF3 motor proteins in planarians I elected to identify, clone, and knockdown a KIF3A homolog in S. mediterranea as well as a KIF17-like motor protein homolog. RNAseq data from the Smed-CPEB2(RNAi) study (Rouhana et al., 2017) showed KIF3A to have a slightly positive 1.1-fold increase while KIF17 had a 34-fold decrease. As KIF17 is the only other motor protein in the kinesin-2 family I elected to knockdown. Previous research has shown the kinesin-2 complex to be required for spermiogenesis in other species

(Wang et al., 2010; Dang et al., 2011; Hu et al. 2011). As KIF3A is strongly associated with KAP3 in the KIF3 complex, I expected to observe the same Smed-

KAP3(RNAi) phenotypes in spermatogenesis and ciliogenesis regardless of the positive fold change from the Smed-CPEB2(RNAi) study. Smed-KIF3A(RNAi) knockdowns produced identical spermatogenesis and epidermal cilia phenotypes as Smed-KAP3(RNAi) knockdowns (Figures, 14 and 15). Testes analysis of Smed-

KIF3A(RNAi) planarians showed a similar phenotype to that of Smed-KAP3(RNAi) animals but was not as severe (Figure 14, A and B). Smed-KIF3A(RNAi) epidermal cilia appeared shorter and fewer in number when compared to negative controls

(Figure 15, A and B). Smed-KIF3A(RNAi) planarians exhibited an inchworm phenotype followed by a bloating phenotype, which eventually led to animal explosion. Smed-KIF17-like(RNAi) planarians showed no movement or bloating phenotype and had normal spermatogenesis. From these results I conclude that

Smed-KIF3A is necessary for normal KIF3 complex function and normal spermatogenesis, ciliogenesis, and fluid homeostasis S. mediterranea.

Chapter 4: Discussion

4.1 Smed-KAP3 characterization and expression patterns

This study revolves around the characterization of a KAP3 homolog in the planarian flatworm Schmidtea mediterranea. KAP3 is a kinesin accessory protein to the KIF3 complex that aids in motor protein to cargo interactions during cargo transport (Yamazaki et al., 1995). KAP3 is a globular, armadillo repeat-containing protein and is highly conserved as it is found in nearly every eukaryotic organism

(Gindhart and Goldstein, 1996; Shimizu et al., 1996). The KIF3 complex has multiple functions, including endosome/lysosome transport (Brown et al., 2005) and intraflagellar transport (Pooranachandran and Malicki, 2016) during processes such as axonal elongation, ciliogenesis, and sperm tail formation (Aizawa et al.,

1992; Kondo et al., 1994; Lehti et al., 2013). In this study I observed multiple phenotypes from RNAi experiments that are related to the ciliogenesis and spermatogenesis in S. mediterranea.

4.2 Smed-KAP3 is required for spermatogenesis in S. mediterranea

Knockdown of Smed-KAP3 resulted in fewer cells completing spermatogenesis. Thus, it appears that Smed-KAP3 is required for spermatid elongation during male germ cell development. The ciliary interior is separated

from the cytoplasm by the tightly regulated transition zone, and thus proteins required for axoneme elongation must be transported in by the kinesin-2 family (Goncalves and Pelletier, 2017; Cole et al., 1998). Smed-KAP3(RNAi) animal sperm had shorter flagella than controls but microtubular projections were present. This observation indicates that the initial steps of flagella synthesis are not dependent on KAP3 and the KIF3 complex. The lack of full-length flagella seen on Smed-KAP3(RNAi) knockdown spermatids is likely due to improper IFT. IFT is likely impaired as motor proteins can no longer properly bind cargoes in the absence of KAP3.

4.3 Smed-KAP3 is necessary for ciliary lengthening

Motile cilia and flagella are very comparable structures as they both are involved in movement and share the same 9+2 internal microtubule layout

(reviewed by Chaaban and Brouhard, 2017). When compared to control planarians, I observed shortened, but not completely absent, cilia on the ventral surface of Smed-KAP3(RNAi) animals. Similar to the sperm phenotypes the presence of short ciliary projections suggest that the initial steps of ciliogenesis are not performed by the KIF3 complex. Rather than elongated, wispy structures, the ventral surface had many distinct dots of anti-α-tubulin antibody staining. This indicates α-tubulin is sequestered to the basal body where cilia would project but is not being incorporated into the axoneme (Arikawa and Williams, 1993). This observation suggests that sequestering of tubulin is not performed by KAP3 and

the KIF3 complex. This phenotype was also seen in sperm analysis and the same reasoning as to why Smed-KAP3(RNAi) knockdown animals lacked sperm flagella could be applied to the shortened cilia. However, the real interest lies in why ciliogenesis began but then stopped. One possibility behind partial ciliogenesis is likely due to the function of the other kinesin-2 complex, the homodimeric KIF17 proteins. KIF17 lacks an accessory protein, but has been found in cilia and flagella and has been reported to function alongside the KIF3 complex during ciliogenesis

(Scholey, 2008). It is likely that partial cilia and flagella formation in the absence of

Smed-KAP3 is due to the redundant nature of the KIF17 complex. However, complete ciliogenesis is not possible by just KIF17 and requires a functional KIF3 complex.

Another interesting phenotype I observed was the lack of any axonemal structure from Smed-KAP3(RNAi) ciliary cross sections. Electron microscopy of

Smed-KAP3(RNAi) knockdowns showed no 9+2 microtubule layout in the ciliary interior. Considering that no axonemal structure was present, this indicates a problem with IFT. These proteins may only be transported by the KIF3 complex and may not be compatible with KIF17, resulting in under-developed cilia. I conclude that defects in IFT are responsible for a lack of full-length epidermal cilia.

The same reasoning can also be applied to the defects seen in sperm.

4.4 Smed-KAP3 functions in protonephridia

After several weeks of RNAi feeding a bloating phenotype was observed in

Smed-KAP3(RNAi) knockdown animals. Bloating is a result of an inability to maintain proper osmotic pressure and indicates a problem with protonephridia, the organs responsible for osmoregulation (Rink et al., 2011). Protonephridia contain ciliated ‘flame cells’ and other ciliated tubules that filter fluid. Secretion of fluid out of the protonephridia is also performed by cilia. Given the fact that cilia are present, this phenotype is not unexpected. In situ hybridization failed to detect Smed-KAP3 in protonephridia, but background signal may have prevented any discernable signal. However, scRNAseq data reveals high Smed-KAP3 levels of expression in the protonephridia (Wurtzelet al., 2015). Polycystic kidney disease has been associated with the KIF3 complex, so malfunctioning protonephridia and the bloating phenotype should not be unexpected (Lin et al., 2003).

Immunofluorescence staining did not show any conclusive difference in number of flame cells between Smed-KAP3(RNAi) knockdowns and controls. Only some of the structures in the protonephridia are ciliated, namely the flame cells and the tubules in which fluid is directed into from the flame cells (Rink et al., 2011). It is likely that KAP3 is necessary for ciliogenesis in these tubules and Smed-

KAP3(RNAi) animals lack normal protonephridial cilia. A lack of normally functioning cilia in the protonephridia likely causes a backup of fluid which results in the bloating phenotype. One possibility is that RNAi was not performed long enough. As these animals eventually exploded, the RNAi feedings were stopped as soon as the bloating phenotype first appeared. While it is clear that Smed-KAP3

has a role in protonephridial ciliogenesis, it is no understood where it functions in the protonephridia.

Analysis of dorsal cilia showed no clear difference between Smed-

KAP3(RNAi) knockdown planarians and control planarians. S. mediterranea have a distinct patterning of cilia on their dorsal region, in which two lines of non-motile cilia are found along the length of the animal. Both Smed-KAP3(RNAi) knockdowns and negative controls exhibited this patterning. KIF3 and KIF17 have been shown to act redundantly during sensory cilia formation in other systems

(Snow et al., 2004; Insinna et al., 2009), which may explain the presence of dorsal sensory cilia in Smed-KAP3(RNAi) knockdowns. However, the function of KAP3 in

S. mediterranea sensory cilia remains unclear and needs to be further studied. It is possible that RNAi does not result in a maximal decrease of KAP3 mRNA and some KAP3 transcripts are still being translated into proteins. In order to confirm that KAP3 transcripts are at a negligible level real time quantitative PCR (RTqPCR) should be performed as described by (Lesko et al., 2020). However, due to time restraints RTqPCR was not performed for this research.

4.5 The KIF3 complex in ciliogenesis and spermatogenesis

Previous studies have indicated the motor proteins in the KIF3 complex,

KIF3A and KIF3B, are involved in spermatogenesis (Wang et al., 2010; Dang et al., 2011; Hu et al., 2011). Single-cell RNAseq data shows Smed-KIF3A to have high levels of expression in neuronal, secretory, and epidermal cell lineages (Plass

et al., 2018). This is similar to KAP3 scRNAseq data. To test the necessity of these motor proteins in ciliogenesis and spermatogenesis, I performed knockdown of the

KIF3A motor protein as well as of a KIF17-like motor protein. Knockdown of Smed-

KIF3A produced similar defects in ciliogenesis and spermatogenesis as seen in

Smed-KAP3(RNAi) knockdowns while knockdown of Smed-KIF17 produced no such phenotypes and appeared normal. The Smed-KIF3A(RNAi) phenotypes were expected as you will be eliminating any chance of cargo transport as the motor protein is absent. The KIF17-like homodimer does not function in IFT in the absence of the KIF3 complex as there was minimal flagella synthesis and ciliogenesis in the Smed-KIF3A(RNAi) animals.

4.6 KAP3 is known to function in ciliated neurons

Single-cell RNAseq data revealed very high levels of Smed-KAP3 transcript expression in GABA neurons (Plass et al., 2018). In situ hybridization revealed some staining in the head region but was not investigated further as it did not show strong brain patterning. Ciliated neurons in C. elegans are documented to be dependent on kinesin-2 motors (Snow et al., 2004; Pan et al., 2006) and thus may explain the ISH staining. This may also explain as to why Smed-KAP3(RNAi) planarians eventually stopped feeding 3-4 weeks into RNAi feedings (data not shown). As neurons are required for food sensing and kinesin-2 motors are known to be involved in ciliated neurons it is possible that KAP3 knockdown animals cannot properly detect food around them.

4.7 KAP3 knockdown planarians have normal light sensing capabilities

In order to test the motility defects of KAP3 knockdown planarians I subjected the RNAi groups to a light sensory assay in which the planarians move out of the light and into the dark regions (Figure 7). Light is sensed by neurons in the planarian brain and as ISH revealed staining in the head region it is possible that light sensitivity may be impacted. While KAP3 knockdowns were slower moving they did eventually move out of the light although since planarians were placed in the light it could be argued that the only place they had to go was out of the light. In order to confirm that light sensitivity is not negatively impacted I propose an experiment in which both control and KAP3 knockdown planarians are placed in the center of a petri dish which has light on one side and dark on the other side. If light sensitivity is not impacted then both groups should move towards the darker region.

4.8 Conclusions

KAP3 is a unique protein expressed in the testes and epidermis of hermaphroditic S. mediterranea. Smed-KAP3 is required for spermatogenesis and epidermal ciliogenesis. Smed-KAP3 also has a role in protonephridial cilia function and thus has an impact on osmoregulation. I also conclude that Smed-KIF3A is a necessary component of the planarian KIF3 complex and functions in ciliogenesis and sperm flagella synthesis.

References

Adler CE, Seidel CW, McKinney SA, Sánchez Alvarado A. Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife. 2014 Apr 15;3:e02238. doi: 10.7554/eLife.02238.

Aizawa H, Sekine Y, Takemura R, Zhang Z, Nangaku M, Hirokawa N. Kinesin family in murine central nervous system. J Cell Biol. 1992 Dec;119(5):1287-96.

Arikawa K, Williams DS. Acetylated alpha-tubulin in the connecting cilium of developing rat photoreceptors. Invest Ophthalmol Vis Sci. 1993 May;34(6):2145-9

Bhogaraju S, Weber K, Engel BD, Lechtreck KF, Lorentzen E. Getting tubulin to the tip of the cilium: one IFT train, many different tubulin cargo-binding sites? Bioessays. 2014 May;36(5):463-7. doi: 10.1002/bies.201400007.

Brady ST. A novel brain ATPase with properties expected for the fast axonal transport motor. Nature. 1985 Sep 5-11;317(6032):73-5.

Brandl H, Moon H, Vila-Farré M, Liu SY, Henry I, Rink JC. PlanMine--a mineable resource of planarian biology and biodiversity. Nucleic Acids Res. 2016 Jan 4;44(D1):D764-73. doi: 10.1093/nar/gkv1148.

Brown CL, Maier KC, Stauber T, Ginkel LM, Wordeman L, Vernos I, Schroer TA. Kinesin-2 is a motor for late endosomes and lysosomes. Traffic. 2005 Dec;6(12):1114-24.

Brouhard GJ, Rice LM. Microtubule dynamics: an interplay of biochemistry and mechanics. Nat Rev Mol Cell Biol. 2018;19(7):451–463. doi:10.1038/s41580-018- 0009-y

Carvalho-Santos Z, Azimzadeh J, Pereira-Leal JB, Bettencourt-Dias M. Evolution: Tracing the origins of centrioles, cilia, and flagella. J Cell Biol.2011 Jul 25;194(2):165-75. doi: 10.1083/jcb.201011152. Review. Erratum in: J Cell Biol. 2011 Oct 17;195(2):341.

Chaaban S, Brouhard GJ. A microtubule bestiary: structural diversity in tubulin polymers. Mol Biol Cell. 2017 Nov 1;28(22):2924-2931. doi: 10.1091/mbc.E16-05-0271.

Chong T, Stary JM, Wang Y, Newmark PA. Molecular markers to characterize the hermaphroditic reproductive system of the planarian Schmidtea mediterranea. BMC Dev Biol. 2011 Nov 10;11:69. doi: 10.1186/1471-213X-11-69.

Cole DG, Diener DR, Himelblau AL, Beech PL, Fuster JC, Rosenbaum JL. Chlamydomonas kinesin-II-dependent intraflagellar transport (IFT): IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. J Cell Biol. 1998 May 18;141(4):993-1008.

Collins JJ 3rd, Hou X, Romanova EV, Lambrus BG, Miller CM, Saberi A, Sweedler JV, Newmark PA. Genome-wide analyses reveal a role for peptide hormones in planarian germline development. PLoS Biol. 2010 Oct 12;8(10):e1000509. doi: 10.1371/journal.pbio.1000509.

Dang R, Zhu JQ, Tan FQ, Wang W, Zhou H, Yang WX. Molecular characterization of a KIF3B-like kinesin gene in the testis of Octopus tankahkeei (Cephalopoda, Octopus). Mol Biol Rep. 2012 May;39(5):5589-98. doi: 10.1007/s11033-011-1363- 4.

Desai A, Mitchison TJ. Microtubule polymerization dynamics. Annu Rev Cell Dev Biol. 1997;13:83-117. Review. PubMed PMID: 9442869.

Fincher CT, Wurtzel O, de Hoog T, Kravarik KM, Reddien PW. Cell type transcriptome atlas for the planarian Schmidtea mediterranea. Science. 2018 May 25;360(6391). pii: eaaq1736. doi: 10.1126/science.aaq1736.

Gindhart JG Jr, Goldstein LS. Armadillo repeats in the SpKAP115 subunit of kinesin-II. Trends Cell Biol. 1996 Nov;6(11):415-6.

Glazer AM, Wilkinson AW, Backer CB, Lapan SW, Gutzman JH, Cheeseman IM, Reddien PW. The Zn finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis. Dev Biol. 2010 Jan 1;337(1):148-56. doi: 10.1016/j.ydbio.2009.10.025.

Gonçalves J, Pelletier L. The Ciliary Transition Zone: Finding the Pieces and Assembling the Gate. Mol Cells. 2017 Apr;40(4):243-253. doi: 10.14348/molcells.2017.0054.

Hirokawa N, Noda Y, Tanaka Y, Niwa S. Kinesin superfamily motor proteins and intracellular transport. Nat Rev Mol Cell Biol. 2009 Oct;10(10):682-96. doi: 10.1038/nrm2774.

Hu JR, Xu N, Tan FQ, Wang DH, Liu M, Yang WX. Molecular characterization of a KIF3A-like kinesin gene in the testis of the Chinese fire-bellied newt Cynops orientalis. Mol Biol Rep. 2012 Apr;39(4):4207-14. doi: 10.1007/s11033-011-1206- 3.

Hua W, Young EC, Fleming ML, Gelles J. Coupling of kinesin steps to ATP hydrolysis. Nature. 1997 Jul 24;388(6640):390-3.

Ichinose S, Ogawa T, Jiang X, Hirokawa N. The Spatiotemporal Construction of the Axon Initial Segment via KIF3/KAP3/TRIM46 Transport under MARK2 Signaling. Cell Rep. 2019 Aug 27;28(9):2413-2426.e7. doi: 10.1016/j.celrep.2019.07.093.

Ishikawa H, Marshall WF. Ciliogenesis: building the cell's antenna. Nat Rev Mol Cell Biol. 2011 Apr;12(4):222-34. doi: 10.1038/nrm3085.

Khan S, Scholey JM. Assembly, Functions and Evolution of Archaella, Flagella and Cilia. Curr Biol. 2018 Mar 19;28(6):R278-R292. doi: 10.1016/j.cub.2018.01.085.

King RS, Newmark PA. In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea. BMC Dev Biol. 2013 Mar 12;13:8. doi: 10.1186/1471-213X-13-8.

Kondo S, Sato-Yoshitake R, Noda Y, Aizawa H, Nakata T, Matsuura Y, Hirokawa N. KIF3A is a new microtubule-based anterograde motor in the nerve axon. J Cell Biol. 1994 Jun;125(5):1095-107.

Kull FJ, Sablin EP, Lau R, Fletterick RJ, Vale RD. Crystal structure of the kinesin motor domain reveals a structural similarity to myosin. Nature. 1996 Apr 11;380(6574):550-5.

Lehti MS, Kotaja N, Sironen A. KIF3A is essential for sperm tail formation and manchette function. Mol Cell Endocrinol. 2013 Sep 5;377(1-2):44-55. doi: 10.1016/j.mce.2013.06.030.

Lesko SL, Rouhana L. Dynein assembly factor with WD repeat domains 1 (DAW1) is required for the function of motile cilia in the planarian Schmidtea

mediterranea. Dev Growth Differ. 2020 May 2. doi: 10.1111/dgd.12669.

Lin F, Hiesberger T, Cordes K, Sinclair AM, Goldstein LS, Somlo S, Igarashi P. Kidney-specific inactivation of the KIF3A subunit of kinesin-II inhibits renal ciliogenesis and produces polycystic kidney disease. Proc Natl Acad Sci U S A. 2003 Apr 29;100(9):5286-91. Epub 2003 Apr 2.

Magley RA, Rouhana L. Tau tubulin kinase is required for spermatogenesis and development of motile cilia in planarian flatworms. Mol Biol Cell. 2019 Aug 1;30(17):2155-2170. doi: 10.1091/mbc.E18-10-0663.

Moyer ML, Gilbert SP, Johnson KA. Pathway of ATP hydrolysis by monomeric and dimeric kinesin. Biochemistry. 1998 Jan 20;37(3):800-13. Muresan V, Abramson T, Lyass A, Winter D, Porro E, Hong F, Chamberlin NL, Schnapp BJ. KIF3C and KIF3A form a novel neuronal heteromeric kinesin that associates with membrane vesicles. Mol Biol Cell. 1998 Mar;9(3):637-52.

Nishimura T, Kato K, Yamaguchi T, Fukata Y, Ohno S, Kaibuchi K. Role of the PAR-3-KIF3 complex in the establishment of neuronal polarity. Nat Cell Biol. 2004 Apr;6(4):328-34.

Nonaka S, Tanaka Y, Okada Y, Takeda S, Harada A, Kanai Y, Kido M, Hirokawa N. Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell. 1998 Dec 11;95(6):829-37. Erratum in: Cell 1999 Oct 1;99(1):117.

Newmark PA, Sánchez Alvarado A. Not your father's planarian: a classic model enters the era of functional genomics. Nat Rev Genet. 2002 Mar;3(3):210-9.

Pan X, Ou G, Civelekoglu-Scholey G, Blacque OE, Endres NF, Tao L, Mogilner A, Leroux MR, Vale RD, Scholey JM. Mechanism of transport of IFT particles in C. elegans cilia by the concerted action of kinesin-II and OSM-3 motors. J Cell Biol. 2006 Sep 25;174(7):1035-45.

Pearson BJ, Eisenhoffer GT, Gurley KA, Rink JC, Miller DE, Sánchez Alvarado A. Formaldehyde-based whole-mount in situ hybridization method for planarians. Dev Dyn. 2009 Feb;238(2):443-50. doi: 10.1002/dvdy.21849.

Plass M, Solana J, Wolf FA, Ayoub S, Misios A, Glažar P, Obermayer B, Theis FJ, Kocks C, Rajewsky N. Cell type atlas and lineage tree of a whole complex animal by single-cell transcriptomics. Science. 2018 May 25;360(6391). pii: eaaq1723. doi: 10.1126/science.aaq1723.

Pooranachandran N, Malicki JJ. Unexpected Roles for Ciliary Kinesins and Intraflagellar Transport Proteins. Genetics. 2016 Jun;203(2):771-85. doi: 10.1534/genetics.115.180943.

Rink JC, Vu HT, Sánchez Alvarado A. The maintenance and regeneration of the planarian excretory system are regulated by EGFR signaling. Development. 2011 Sep;138(17):3769-80. doi: 10.1242/dev.066852.

Rompolas P, Patel-King RS, King SM. Schmidtea mediterranea: a model system for analysis of motile cilia. Methods Cell Biol. 2009;93:81-98. doi: 10.1016/S0091-679X(08)93004-1.

Ross KG, Molinaro AM, Romero C, Dockter B, Cable KL, Gonzalez K, Zhang S, Collins ES, Pearson BJ, Zayas RM. SoxB1 Activity Regulates Sensory Neuron Regeneration, Maintenance, and Function in Planarians. Dev Cell. 2018 Nov 5;47(3):331-347.e5. doi: 10.1016/j.devcel.2018.10.014.

Rouhana L, Vieira AP, Roberts-Galbraith RH, Newmark PA. PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells. Development. 2012 Mar;139(6):1083-94. doi: 10.1242/dev.076182.

Rouhana L, Weiss JA, Forsthoefel DJ, Lee H, King RS, Inoue T, Shibata N, Agata K, Newmark PA. RNA interference by feeding in vitro-synthesized double-stranded RNA to planarians: methodology and dynamics. Dev Dyn. 2013 Jun;242(6):718- 30. doi: 10.1002/dvdy.23950.

Rouhana L, Tasaki J, Saberi A, Newmark PA. Genetic dissection of the planarian reproductive system through characterization of Schmidtea mediterranea CPEB homologs. Dev Biol. 2017 Jun 1;426(1):43-55. doi: 10.1016/j.ydbio.2017.04.008.

Sánchez Alvarado A, Newmark PA. Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc Natl Acad Sci U S A. 1999 Apr 27;96(9):5049-54.

Satir P, Christensen ST. Overview of structure and function of mammalian cilia. Annu Rev Physiol. 2007;69:377-400.

Scholey JM. Intraflagellar transport motors in cilia: moving along the cell's antenna. J Cell Biol. 2008 Jan 14;180(1):23-9. doi: 10.1083/jcb.200709133.

Scholey JM. Kinesin-2: a family of heterotrimeric and homodimeric motors with diverse intracellular transport functions. Annu Rev Cell Dev Biol. 2013;29:443-69. doi: 10.1146/annurev-cellbio-101512-122335.

Scimone ML, Srivastava M, Bell GW, Reddien PW. A regulatory program for excretory system regeneration in planarians. Development. 2011 Oct;138(20):4387-98. doi: 10.1242/dev.068098.

Shi SH, Cheng T, Jan LY, Jan YN. APC and GSK-3beta are involved in mPar3 targeting to the nascent axon and establishment of neuronal polarity. Curr Biol. 2004 Nov 23;14(22):2025-32

Shimizu K, Kawabe H, Minami S, Honda T, Takaishi K, Shirataki H, Takai Y. SMAP, an Smg GDS-associating protein having arm repeats and phosphorylated by Src tyrosine kinase. J Biol Chem. 1996 Oct 25;271(43):27013-7.

Snow JJ, Ou G, Gunnarson AL, Walker MR, Zhou HM, Brust-Mascher I, Scholey JM. Two anterograde intraflagellar transport motors cooperate to build sensory cilia on C. elegans neurons. Nat Cell Biol. 2004 Nov;6(11):1109-13.

Takeda S, Yamazaki H, Seog DH, Kanai Y, Terada S, Hirokawa N. Kinesin superfamily protein 3 (KIF3) motor transports fodrin-associating vesicles important for neurite building. J Cell Biol. 2000 Mar 20;148(6):1255-65.

Teng J, Rai T, Tanaka Y, Takei Y, Nakata T, Hirasawa M, Kulkarni AB, Hirokawa N. The KIF3 motor transports N-cadherin and organizes the developing neuroepithelium. Nat Cell Biol. 2005 May;7(5):474-82. Epub 2005 Apr 17. Erratum in: Nat Cell Biol. 2005 Jun;7(6):637.

Thi-Kim Vu H, Rink JC, McKinney SA, McClain M, Lakshmanaperumal N, Alexander R, Sánchez Alvarado A. Stem cells and fluid flow drive cyst formation in an invertebrate excretory organ. Elife. 2015 Jun 9;4. doi: 10.7554/eLife.07405.

Vale RD, Reese TS, Sheetz MP. Identification of a novel force-generating protein, kinesin, involved in microtubule-based motility. Cell. 1985 Aug;42(1):39-50.

Vale RD, Fletterick RJ. The design plan of kinesin motors. Annu Rev Cell Dev Biol. 1997;13:745-77.

Vuong LT, Iomini C, Balmer S, Esposito D, Aaronson SA, Mlodzik M. Kinesin-2 and IFT-A act as a complex promoting nuclear localization of β-catenin during Wnt signalling. Nat Commun. 2018 Dec 13;9(1):5304. doi: 10.1038/s41467-018-07605- z.

Wang J, Gao X, Zheng X, Hou C, Xie Q, Lou B, Zhu J. Expression and potential functions of KIF3A/B to promote nuclear reshaping and tail formation during Larimichthys polyactis spermiogenesis. Dev Genes Evol. 2019 Nov;229(5-6):161- 181. doi: 10.1007/s00427-019-00637-5.

Wang W, Dang R, Zhu JQ, Yang WX. Identification and dynamic transcription of KIF3A homologue gene in spermiogenesis of Octopus tankahkeei. Comp Biochem Physiol A Mol Integr Physiol. 2010 Nov;157(3):237-45. doi: 10.1016/j.cbpa.2010.07.004.

Wang Y, Zayas RM, Guo T, Newmark PA. nanos function is essential for development and regeneration of planarian germ cells. Proc Natl Acad Sci U S A. 2007 Apr 3;104(14):5901-6.

Wedaman KP, Meyer DW, Rashid DJ, Cole DG, Scholey JM. Sequence and submolecular localization of the 115-kD accessory subunit of the heterotrimeric kinesin-II (KRP85/95) complex. J Cell Biol. 1996 Feb;132(3):371-80.

Wheway G, Nazlamova L, Hancock JT. Signaling through the Primary Cilium. Front Cell Dev Biol. 2018 Feb 8;6:8. doi: 10.3389/fcell.2018.00008.

Yamazaki H, Nakata T, Okada Y, Hirokawa N. KIF3A/B: a heterodimeric kinesin superfamily protein that works as a microtubule plus end-directed motor for membrane organelle transport. J Cell Biol. 1995 Sep;130(6):1387-99.

Yamazaki H, Nakata T, Okada Y, Hirokawa N. Cloning and characterization of KAP3: a novel kinesin superfamily-associated protein of KIF3A/3B. Proc Natl Acad Sci U S A. 1996 Aug 6;93(16):8443-8.

Yang Z, Goldstein LS. Characterization of the KIF3C neural kinesin-like motor from mouse. Mol Biol Cell. 1998 Feb;9(2):249-61.

Zayas RM, Hernández A, Habermann B, Wang Y, Stary JM, Newmark PA. The planarian Schmidtea mediterranea as a model for epigenetic germ cell specification: analysis of ESTs from the hermaphroditic strain. Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18491-6.

Figure 1: Smed-KAP3 is a highly conserved protein containing multiple Armadillo repeat domains

(A) Diagram showing the full intron and exon structure of Smed-KAP3-long. The alternatively spliced isoform, Smed-KAP3-short, lacks the last 13 nucleotides from exon

7 and all of exon 8 (marked by dashed line; http://wormweb.org/exonintron). Scale bar =

5000 nucleotides. 5’ UTR is 51 nucleotides and 3’ UTR is 62 nucleotides. (B) Diagrams showing the protein domains of Smed-KAP3-long, Smed-KAP3-short, S. purpuratus

KAP3, and H. sapiens KAP3. The alternatively-spliced, shorter isoform, Smed-KAP3- short, has one less armadillo repeat domain. Protein domains were determined by Simple

Modular Architecture Research Tool (SMART) analysis (http://smart.embl- heidelberg.de/). (C) Protein sequence of Smed-KAP3-long. Underlined sequence is armadillo repeats and red sequence is the missing sequence in the Smed-KAP3-short isoform.

Figure 2: Smed-KAP3 protein sequence alignment

KAP3 protein sequence alignment with orthologs from other model organisms.

Species from top to bottom: Caenorhabditis elegans, Smed-KAP3- long, Smed-KAP3- short, Strongylocentrotus purpuratus, Danio rerio, Homo sapiens, and Mus musculus.

The red lines (page 2) represent the missing protein sequence in the alternatively-spliced isoform, Smed-KAP3-short.

Figure 3: Smed-KAP3 is expressed in the epidermis and testes

(A and B) Whole-mount in situ hybridization images depicting Smed-KAP3 expression patterns in S. mediterranea. Luciferase probed animals had some background staining in the digestive system. Scale bar = 1 mm

Figure 4: Smed-KAP3 is preferentially expressed in secretory, pharyngeal, protonephridial, neuronal, and epidermal cells

Single-cell RNAseq data produced from whole animals depicts transcriptome expression in different cell types (Plass et al., 2018). Smed-KAP3 transcript expression levels are highest in secretory, pharyngeal, protonephridial, neuronal, and epidermal cell lineages. Images taken from: Plass et al., 2018; http://planmine.mpicbg.de/planmine/report.do?id=9077092&trail=|9077092

Figure 5: Smed-KAP3 is expressed in neural, protonephridial, epidermal, pharyngeal, and muscle cell types

Single-cell RNAseq data from a separate study (Fincher et al., 2018) shows similar results, with Smed-KAP3 transcripts being highest in neural, protonephridial, epidermal, pharyngeal, and muscle cell lineages. Images taken from: Fincher et al., 2018; http://planmine.mpicbg.de/planmine/report.do?id=9077092&trail=|9077092

Figure 6: Smed-KAP3 is expressed in latter stages of spermatogenesis

Fluorescent in situ hybridization images show different stages of spermatogenesis

(all images taken at 60X magnification). (A) gH4 (magenta) labels spermatogonia cells of the testes. (A’ and A’’) Smed-KAP3 (green) is not expressed highly in spermatogonia cells as can be seen by the lack of overlapping signals. (B) tkn-1 (magenta) labels spermatocytes in the testes. (B’ and B’’) Signal detection for Smed-KAP3 transcripts

(green) overlaps with that of tkn-1, indicating expression in spermatocytes. (C) pka

(magenta) labels spermatid cells in the testes. (C’ and C’’) Smed-KAP3 (green) expression highly overlaps with that of pka, indicating that Smed-KAP3 is also highly expressed in spermatids. Scale bar = 50 µm.

Figure 7: Smed-KAP3(RNAi) planarians exhibit movement defects

In a light assay, sexual planarian movement is measured by their ability to move from the most illuminated region of the plate to the least illuminated region. Region A is the most illuminated while region D is the least illuminated. (A) luciferase(RNAi) planarians move out of the most illuminated region quickly (arrows point to planarians).

(B) Smed-KAP3(RNAi) planarians are much slower when moving out of the most illuminated region. (C and D) Quantitative measurements of how long it takes, on average, for planarians to move from region to region. Two-tailed T-test analysis produced p-values of 0.00102, 0.57186, 0.24627, and 1.6x10-8 for regions A, B, C, and D respectively.

Figure 8: Smed-KAP3(RNAi) planarians have motile, epidermal ciliary defects, but normal dorsal cilia

(A and B) dorsal, non-motile cilia are not affected during RNAi treatment. (C) luciferase(RNAi) planarians have large amounts of ventral, epidermal cilia (green). (D)

Smed-KAP3(RNAi) planarians have much fewer ventral, epidermal cilia present. The α- tubulin stains appear as distinct dots and do not elongate as in control samples. (E and

E’) luciferase(RNAi) planarians have a distinct layer of epidermal cilia on the lateral edge of the animal. (F and F’) Smed-KAP3(RNAi) planarians lack or have substantially reduced density of epidermal cilia on the lateral edge.

Figure 9: Smed-KAP3(RNAi) planarians lack epidermal cilia

(A and B) light microscopy taken at 100X magnification shows that Smed-

KAP3(RNAi) animals lack a consistent layer of epidermal cilia. Arrows point to ciliary layer, and width bar represents the epidermal cell layer. (C and D) Transmission Electron

Microscopy images, - (15000X magnification)-, of luciferase(RNAi) and Smed-

KAP3(RNAi) ciliary structures. Smed-KAP3(RNAi) planarians have shorter and smaller cilia. The 9+2 axoneme structure is clearly seen in negative controls (C’), but not in Smed-

KAP3(RNAi) (D’)

Figure 10: Smed-KAP3 is required to maintain fluid homeostasis

(A) luciferase(RNAi) planarians exhibit normal fluid homeostasis and normal body appearance. (B) Smed-KAP3(RNAi) planarians bloat after continued RNAi feedings.

Scale bar = 1 mm. (C) Population numbers of asexual luciferase(RNAi) and asexual

Smed-KAP3(RNAi) planarians after the last RNAi feeding (5 feedings, 2.5 weeks). (D and

E) Ciliated protonephridial structures of luciferase(RNAi) animals (D and D’) and Smed-

KAP3(RNAi) animals (E and E’). Smed-KAP3(RNAi) planarians all displayed bloating phenotype (n = 9/10), but it is difficult to determine if the cilia on the flame cells contain defects. Scale bars = 100 µm for D and E; 50 µm for D’ and E’.

Figure 11: Smed-KAP3(RNAi) planarians show a decrease in sperm production

(A-C) After RNAi treatment, sexual planarians were fixed and stained with DAPI to assess the presence and distribution of testes lobes. (A) luciferase(RNAi) planarians have normal levels of sperm production. (B) Smed-KAP3(RNAi) planarians have less bright DAPI staining in testes and copulatory apparatus when compared to negative controls. (C) PC2(RNAi) planarians are positive controls for RNAi-mediated spermatogenesis defects. White arrows point to testes and black arrows point to the copulatory apparatus. Scale bar = 1 mm

Figure 12: Smed-KAP3(RNAi) planarians show defect in spermatogenesis

(A) luciferase(RNAi) planarians show normal sperm production, as evidenced by the elongating, DAPI-stained, spermatid nuclei found in the center of the testes. (B)

Smed-KAP3(RNAi) planarians exhibit spermatogenesis defects, as seen by a lack of elongating spermatids. Rather, the sperm remain rounder and do not elongate. Scale bar

= 50 µm

Figure 13: Testes isolation reveals tail and head elongation does not occur in Smed-

KAP3(RNAi)

(A) DAPI staining of luciferase(RNAi) shows normal head elongation, and (A’) anti- acetylated-α-tubulin antibody staining shows normal tail elongation. (B) DAPI staining of

Smed-KAP3(RNAi) confirms defects in head elongation, and (B’) anti-acetylated-α- tubulin antibody staining reveals tail elongation does not occur as in negative controls.

Scale bar = 50 µm.

Figure 14: Smed-KIF3A is required for normal spermatogenesis

(A) luciferase(RNAi) planarians exhibit normal spermatogenesis. (B) Smed-

KIF3A(RNAi) planarians have defects in their sperm that mirror Smed-KAP3(RNAi) animals. (C) Smed-KIF17(RNAi) planarians exhibit normal sperm morphology. Scale bar

= 50 µm

Figure 15: Smed-KIF3A is required for epidermal cilia formation on the lateral edge

(A and A’) luciferase(RNAi) planarians show normal epidermal cilia formation on the lateral edge. (B and B’) Smed-KIF3A(RNAi) planarians have less epidermal cilia.

Scale bars = 50 µm

Table 1: Kinesin data from CPEB2 knockdown

Table 2: Phenotypes observed in kinesin-2 family knockdowns

Knockdown Inch- Bloating Testes defects worming KIF3A(RNAi) Yes Yes Yes KAP3(RNAi) Yes Yes Yes KIF17(RNAi) No No No

Appendix List of KAP3, KIF3A, KIF17-like motor protein, and KIFC3 cDNA reference sequences and clones. uc_Smed_v2_Contig44520 (this is the reference sequence used to make the KAP3 clones First primer is 27 nucleotides in length and 15 are C/G 5’CGGAGAACTTGGCAATCCTATGGCAGG 3’ Second primer is 27 nucleotides in length and 15 are C/G 5’ CAATCGTTGCCATGTCAGACCGGAAGC 3’ First primer to second primer covers as much of the sequence as possible (2390 nucleotides between primers) Third primer is 28 nucleotides in length and 14 are C/G 5’GAGCATTGGCACGAGTTCTTCGAGAAGA 3’ Fourth primer is 28 nucleotides in length and 14 are C/G 5’ CCTTCACTGATAACCGACGCAATCTCTG 3’ 668 nucleotides are between primers three and four (not including primers) 5’ CAAGCTTATCTTTACCGTNAACCNCTATGGGGGGCCNGGANGCCCAATTCTNCCTA TGACNGATGACTTCNAATATTTAAAAAAAAATATAAGAACTGGAACTATTGATGTA CATCCAACTGAAAAAGCATTAATAGTAAATTATGAATTACAAGCTACTATTTTCGG AGAACTTGGCAATCCTATGGCAGGGGATAGAAAAGAATGTCAAAAAATAATTCG TGTGAAAAATCTTGACAGCAATACAAATATTCCAAAATTAGCCCAAGAAATAGTC GATAGTTGTAAATTAATACAACCATCCAAAATTCCAGAAGTTGAGCATTTATTACA TTATTTATTAAGTCGTAAAGAAGTAGCAGTTTCAGAAAAAAGAAAAAACAATGCT GATAATACAGAAACAAGAAAACAATATGCACTCCAGTTCAGTTCTTTGCGGGCCT CATACTTAGAAGAACAAATAATATTTATCGATGAAATCGGATTCAATGTTTCAATG AGAACTAGTATATGCCGTAGTTTACTAGGAAGCCCAGCGGTTCTCAATGTTCCTA GCATTCGAATGGATGCTCTCGAGTCTAGGTCACAACCAGTAACAACCAGTGATTGT GAAGTCAAATCAAAAGCAAGTAATAAGCCAGCTGATCCCGGAGCATTTGATTCAAC TGAAATTGATGAAATCGCAAATCTCAATGACACAGATGAATATCTGGAGCTACTTTA TGAAGATATTCCAGACAAATTAAAAGCATCTGCAATGATTTTGCAACTTGCTCGAAA TCCTGATAATTTAGAGGAACTATATGATAACAGTAGCTTTTTTATTATTATAATTAATT ATACAACTCATTTAAATTTATATATTAAAACAGGTACCCTTATTGGAGCATTGGCAC GAGTTCTTCGAGAAGATTGGAAAGAAAGCACAGATTTAGCCACAAATATTATTTACA TATTTTTTTGTTTTTCATCATTTTCCGATTTTCATCAAATCATAATCCATTTCAAAATT GGCACATTGACGATGAACATCATAGATCACGAATTAAAGAAGTACGAAATGTGGAT

TGACGAATTGCAGAAAAAACGTTCAGAGCAACAAAAAGATCTCGATAAAACATTAAA GAAGGTCGAAACAATGACGCGCAAACAAGAACAATTGTTTAGAGTATCTTACTACA TGCTTCTCAATGTCGCGGAAGATATAAGTCTAGAAATAAAGATGCGCACTAAGAAC TTAGTCGAAATGCTGTCTAAAACTCTGGAAAGAAAGAATCCTGAACTTTTGATTTTG ATCGTTTCCTTTTTAAAAAAGTTGAGTATTTACGGCGAGAATAAATCTGATTTGGTTA AATACAATGTAGTTGAGCGACTTTCTAAGCACGTTCCTAATTCAAATGCTGATTTGT TAAGCATTTCATTGCGATTGTTATTAAATATGAGCTTTGATTCTGCTTTGCGTTTGCG AATCGTCAAATGTGGTTTGTTACCAAAATTGTTAATGAAAATGATTCTCGAGTGCAA AATGGAGAAAGTTCCAATTGAAATTGTTGCTCTTGCTATCAATTTAGTTTGTGATAC AGAGATTGCGTCGGTTATCAGTGAAGGAAAAGGGTTACGTATGTTAATGAAGCGAG CATATAAATCTAGGGATTTCATGATAATGAAAATGCTCCGTAATATTTCTCAGCATG AAGGAGAAATTAAAATGAGGTTTTTGGATTACATCAGTGACTTAGCTGAAGTAATTA CCAATAAGTCTGGCAAATTCGACCATGAATTTGTCGTTGAGTGTGTTGGAATTTTGA GCAATCTGACAATATCTGATCTCGACTTTGAAATGATTTTGACTGAGTTTAATTTAGT GGACTGGATGAAGCAAAATTTACAACCGACTAAAATTGAAGATGATTTAATTTTGGA AGTAGTAATGCTTGTTGGTACAGTATCCAATGATAATACATGTGCAAAAATGATTGC TGATGCTGGAATTATTCAAAGTCTGATAGATCTAATAACAGCTAAACAAGAAGATGA TGAAATTGTTTGTCAGATTGTTTATGTTTTCTATCAATTAATTTTCCATGAATCCACT CGAAAAATAATCATCGAAAAAACTCAAGCACCGGCATATATAATCGACTTGATGCAT GACAAGAATGCTGAAATCCGCAAAGTCTGTGATTGGACATTAGATATCATATCTGA ATTTGATGAAGAATGGTCAAATAAAATTCAACAAGAAAAGTTTCGTTGGTATAATAG CCAGTGGTTGGAAATGATTGAAGGCGGTGCAAACACTCCAGAACTAGATCCCGCC GAAGATCCTGCGTTTCTTTATGACACAGGAATGAATTATCCCTATAATACAGTGGGA GCAGATGATATACTTAGTAGGTATGAAATGTTAATGTCCGGAATGTATGACGAAAA CGGTTTACCAGTCGATGGATCAGTAAGTCCAGTATTGGATCCTTCTCTGGGATCAT TTACAGATGAATTTGGTCGGCCGGTGCAATTGGCAAATTATATGCGTTTTGCATCT GGTGACTTTCCCTACGATCGGCCTGATAATCGAACAGGCTTCCGGTCTGACATGG CAACGATTGAACATTCTATGGCTGTAGATAAATTTGGTCGACCCTTGATAATGGATG TTAATGATGAAGCACTGCAAGACTATGTCGGCCAATATGCTAGAAAGTCAAGAGGA GATTTCAGATAGAAAAATAATTGATGTTTAACAATAAATAAATTCTTTAATTT 3’ KAP3 #2 short primer Cloning Sequence: NNNNNNNNNNNTTGNAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCA TGCTCCCGGCCGCCATGGCCGCGGGATTGAGCATTGGCACGAGTTCTTCGAGAA GATTGGAAAGAAAGCACAGATTTAGCCACAAATATTATTTACATATTTTTTTGTTTTT CATCATTTTCCGATTTTCATCAAATCATAATCCATTTCAAAATTGGCACATTGACGAT GAACATCATAGATCACGAATTAAAGAAGTACGAAATGTGGATTGACGAATTGCAGA AAAAACGTTCAGAGCAACAAAAAGATCTCGATAAAACATTAAAGAAGGTCGAAACA ATGACGCGCAAACAAGAACAATTGTTTAGAGTATCTTACTACATGCTTCTCAATGTC GCGGAAGATATAAGTCTAGAAATAAAGATGCGCACTAAGAACTTAGTCGAAATGCT GTCTAAAACTCTGGAAAGAAAGAATCCTGAACTTTTGATTTTGATCGTTTCCTTTTTA AAAAAGTTGAGTATTTACGGCGAGAATAAATCTGATTTGGTTAAATACAATGTAGTT GAGCGACTTTCTAAGCACGTTCCTAATTCAAATGCTGATTTGTTAAGCATTTCATTG CGATTGTTATTAAATATGAGCTTTGATTCTGCTTTGCGTTTGCGAATCGTCAAATGT

GGTTTGTTACCAAAATTGGTCAATTTATCTCAATCGCTAGAAAATGAAACTTTAGTAT TGTGTATTCTTTATAATATCAGTTGTGAAGATAAGTATAAACCTTATTTTATGAAAAC TGATTGCATTCCTTACTTAATGAAAATGATTCTCGAGTGCAAAATGGAGAAAGTTCC AATTGAAATTGTTGCTCTTGCTATCAATTTAGTTTGTGATACAGAGATTGCGTCGGT TATCAGTGAAGGAATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGC TCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTG GCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGT Long KAP3 - Plate 1 Colony 2 (P1C2) did M13F and SP6 primers 5’ CAAGCTTATCTTTACCGTNAACCNCTATGGGGGGCCNGGANGCCCAATTCTNCCTA TGACNGATGACTTCNAATATTTAAAAAAAAATATAAGAACTGGAACTATTGATGTAC ATCCAACTGAAAAAGCATTAATAGTAAATTATGAATTACAAGCTACTATTTTCGGAG AACTTGGCAATCCTATGGCAGGGGATAGAAAAGAATGTCAAAAAATAATTCGTGTG AAAAATCTTGACAGCAATACAAATATTCCAAAATTAGCCCAAGAAATAGTCGATAGT TGTAAATTAATACAACCATCCAAAATTCCAGAAGTTGAGCATTTATTACATTATTTAT TAAGTCGTAAAGAAGTAGCAGTTTCAGAAAGAAGTCAAATCAAAAGCAAGTAATAA GCCAGCTGATCCCGGAGCATTTGATTCAACTGAAATTGATGAAATCGCAAATCTCA ATGACACAGATGAATATCTGGAGCTACTTTATGAAGATATTCCAGACAAATTAAAAG CATCTGCAATGATTTTGCAACTTGCTCGAAATCCTGATAATTTAGAGGAACTATATG ATAACAGTATATATTAAAACAGGTACCCTTATTGGAGCATTGGCACGAGTTCTTCGA GAAGATTGGAAAGAAAGCACAGATTTAGCCACAAATATTATTTACATATTTTTTTGTT TTTCATCATTTTCCGATTTTCATCAAATCATAATCCATTTCAAAATTGGCACATTGAC GATGAACATCATAGATCACGAATTAAAGAAGTACGAAATGTGGATTGACGAATTGC AGAAAAAACGTTCAGAGCAACAAAAAGATCTCGATAAAACATTAAAGAAGGTCGAA ACAATGACGCGCAAACAAGAACAATTGTTTAGAGTATCTTACTACATGCTTCTCAAT GTCGCGGAAGATATAAGTCTAGAAATAAAGATGCGCACTAAGAACTTAGTCGAAAT GCTGTCTAAAACTCTGGAAAGAAAGAATCCTGAACTTTTGATTTTGATCGTTTCCTT TTTAAAAAAGTTGAGTATTTACGGCGAGAATAAATCTGATTTGGTTAAATACAATGT AGTTGAGCGACTTTCTAAGCACGTTCCTAATTCAAATGCTGATTTGTTAAGCATTTC ATTGCGATTGTTATTAAATATGAGCTTTGATTCTGCTTTGCGTTTGCGAATCGTCAA ATGTGGTTTGTTACCAAAATTGTTAATGAAAATGATTCTCGAGTGCAAAATGGAGAA AGTTCCAATTGAAATTGTTGCTCTTGCTATCAATTTAGTTTGTGATACAGAGATTGC GTCGGTTATCAGTGAAGGAAAAGGGTTACGTATGTTAATGAAGCGAGCATATAAAT CTAGGGATTTCATGATAATGAAAATGCTCCGTAATATTTCTCAGCATGAAGGAGAAA TTAAAATGAGGTTTTTGGATTACATCAGTGACTTAGCTGAAGTAATTACCAATAAGT CTGGCAAATTCGACCATGAATTTGTCGTTGAGTGTGTTGGAATTTTGAGCAATCTGA CAATATCTGATCTCGACTTTGAAATGATTTTGACTGAGTTTAATTTAGTGGACTGGA TGAAGCAAAATTTACAACCGACTAAAATTGAAGATGATTTAATTTTGGAAGTAGTAA TGCTTGTTGGTACAGTATCCAATGATAATACATGTGCAAAAATGATTGCTGATGCTG GAATTATTCAAAGTCTGATAGATCTAATAACAGCTAAACAAGAAGATGATGAAATTG TTTGTCAGATTGTTTATGTTTTCTATCAATTAATTTTCCATGAATCCACTCGAAAAAT

AATCATCGAAAAAACTCAAGCACCGGCATATATAATCGACTTGATGCATGACAAGA ATGCTGAAATCCGCAAAGTCTGTGATTGGACATTAGATATCATATCTGAATTTGATG AAGAATGGTCAAATAAAATTCAACAAGAAAAGTTTCGTTGGTATAATAGCCAGTGGT TGGAAATGATTGAAGGCGGTGCAAACACTCCAGAACTAGATCCCGCCGAAGATCC TGCGTTTCTTTATGACACAGGAATGAATTATCCCTATAATACAGTGGGAGCAGATG ATATACTTAGTAGGTATGAAATGTTAATGTCCGGAATGTATGACGAAAACGGTTTAC CAGTCGATGGATCAGTAAGTCCAGTATTGGATCCTTCTCTGGGATCATTTACAGAT GAATTTGGTCGGCCGGTGCAATTGGCAAATTATATGCGTTTTGCATCTGGTGACTT TCCCTACGATCGGCCTGATAATCGAACAGGCTTCCGGTCTGACATGGCAACGATT GAACATTCTATGGCTGTAGATAAATTTGGTCGACCCTTGATAATGGATGTTAATGAT GAAGCACTGCAAGACTATGTCGGCCAATATGCTAGAAAGTCAAGAGGAGATTTCAG ATAGAAAAATAATTGATGTTTAACAATAAATAAATTCTTTAATTT 3’

KIF3A (Contig36153) Reference sequence, primers used, and clones obtained uc_Smed_v2_Contig36153 (1374nts) gcttatggtcaaactggcacaggaaaaacctttacaatggaaggaaagagggatgtgccggaattgcgaggtattattcc aaattcatttgcccacgtatttggtgcaatcgccaaggcagagacaaatgttctgtttttagttcgtgtatcatacttagagattta taatgaagaggttagagaccttcttggcaaagatcaaactgcgagactggaagttaaagaacgcccggatattggtgtgt acgtgaaagatctggctagctttgtggttcatggagccgatgaaatggataaactgatgacatatggcaataaaaaccgtg tgactggagctacgaatatgaatgagcacagttctcgatctcatgccatttatacggtaactgttgaaggcagtgaaactcta catgacggagagaaaacctttcgacaaggaaaattacatttagtagatcttgctggttcagaaagacaagtaaagacag gagcgactggaatacgacttcaagaagctaacaaaattaatttatcgttggcaactttaggaaacgttatttcagctcttgttg atggcaaaagcactcatgttccatatcgtaactctaaattgacgagattgctccaagattcccttggaggaaattcaaaaac cttaatgattgcaaatatcggcccagcagattataattttgacgaatcagttagctcgttgcgttatgccaatagagccaaaa acataaggaataaagcaataattaatgaagatccaaaagatgcattgttgagacaatatcagaaagaattggaacgatt agaacagcaattaaaggacggaggtatagaagatgtatcaggagaatcagaatcagaatcagaatccgaaattgttata gatgagaatggggtcgaaagacgcgttaaaaaacctaaaaaaatcagatcagagaaaatcagtaagcaacgtttagc agaaatcgaacgatctattgaagagaatagacgaaaattagaacaacagaaagatatggaatcagaagagaaaaat cgtgtccaacaagatcttatcgagaaagaaaataaattagccaaggctcgtcaagaacaacaaatgttgcgcaacaga atgaacgatttacagcggaaaattattgtcggaggtgaaaacctccttgagaaagctgaagaacaagagcggttattgga gaaatcggcaaaggagttagagcgccataaacagactgaagtttctatgagaaagaaactccaagagaaagaggag gagagaatgaatatcgaagtgcagtataatagcttacagttgcaaattgagattagagatatgtatgattctttctgcttcatca cgatt Primer 9: gattgctccaagattcccttggagg 13/25 are GC – 52% Primer 10: cctttgccgatttctccaataaccg 12/25 are GC – 48% KIF3A clone: M13F primer was used (Plus/Plus orientation) NNNNNNNNNNNNTTGTATACGACTCNCTATAGGGCGAATTGGGCCCGACGTCGCA TGCTCCCGGCCGCCATGGCCGCGGGATTGATTGCTCCAAGATTCCCTTGGAGGA AATTCAAAAACCTTAATAATTGCAAATATCGGCCCAGCAGATTATAATTTTGACG

AATCAGTTAGCTCGTTGCGTTATGCCAATAGAGCCAAAAACATAAGGAATAAAGC AATAATTAATGAAGATCCAAAAGATGCATTGTTGAGACAATATCAGAAAGAATTG GAACGATTAGAACAGCAATTAAAGGACGGAGGTATAGAAGATGTATCAGGAGAA TCAGAATCAGAATCAGAATCCGAAATTGTTATAGATGAGAATGGGGTCGAAAGA CGCGTTAAAAAACCTAAAAAAATCAGATCAGAGAAAATCAGTAAGCAACGTTTA GCAGAAATCGAACGATCCATTGAAGAAAATAGACGAAAATTAGAACAACAGAAA GATATGGAATCAGAAGAGAAAAATCGTGTCCAACAAGATCTTATCGAGAAAGAA AATAAATTAGCCAAGGCTCGTCAAGAACAACAAATGTTGCGCAACAGAATGAAC GATTTACAGCGGAAAATTATTGTCGGAGGTGAAAACCTCCTTGAGAAAGCTGAA GAACAAGAGCGGTTATTGGAGAAATCGGCAAAGGAATCACTAGTGCGGCCGCCT GCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTAT TCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGT GAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGT GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTC ACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGG CCAACGCGCGGGGANAGGCGNTTTGCGTATTNNNGCTCTTCNCTTCCTCGCTCAC TGACTCGCTGCGCTCGGNCGTTCGGCTGCGGCGAGNGNATCAGCTCACTCNAAG NNNGNANTACGGNNATCCNCNGAATCNGGGANANNNNGNANNAACNTGNNNNCA NNNNGCAAANNNNNNNNTANNNNNNNCNGNNNTTNTNNNNGNNCNNNNCCNNNA NNNCNNNNNAAANNCNNNNNNNCANNNNNNNNNGNNNNN

KIF17-like motor protein: (Contig34848) Reference sequence, primers used, and clones obtained uc_Smed_v2_Contig34848 (387nts) gataaatttaatacgttattaaaagttctcaaatacttttatcacatggaaatgtttcaggaagcaacttctattaacaaggcac tgaatgctctcggagatgtaatatccgcattaacaactatgagcaaaggatttattccatatagaaacaacaaattaactttat taatgcaagattcattgggtggcactgcgaaaacgttactattggtcaatttatctccagttgactacaacgtttcggaatctttg agttcgttaaattatgcggtcagaatgaagacaattgttaatgagaacttgaaagttgaagataaagaagaagtttctagatt aaaagagataattcaaaaattggttcgaggtgaaccggtggtcatcagt Primer 5: caaggcactgaatgctctcggag 13/23 are GC - 56% Primer 6: ctgatgaccaccggttcacctcg 14/23 are GC – 61% KIF17-like motor protein clone: M13F primer was used (Plus/Plus orientation) NNNNNNNNNNNNNGTATACGACTCNCTATAGGGCGAATTGGGCCCGACGTCGCAT GCTCCCGGCCGCCATGGCCGCGGGATTCAAGGCACTGAATGCTCTCGGAGATGT AATATCCGCATTAACAACTATGAGCAAAGGATTTATTCCATATAGAAACAACAAA TTAACTTTATTAATGCAAGATTCATTGGGTGGCACTGCGAAAACGTTACTATTGGT CAATTTATCTCCAGTTGACTACAACGTTTCGGAATCTTTGAGTTCGTTAAATTATG

CGGTCAGAATGAAGACAATTGTTAATGAGAACTTGAAAGTTGAAGATAAAGAAG AAGTTTCTAGATTAAAAGAGATAATTCAAAAATTGGTTCGAGGTGAACCGGTGGT CATCAGAATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCA ACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGT AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACAC AACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGC TAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGT CGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTA TTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCT GCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATC AGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGA ACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACG AGCATCACAAAAATCGACGCTCAAGGTCAGAGGTGGCGAAACCCGACAGGACT ATAAGATACCAGGCGTTTCCCCCNGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGA CCCTGCCGCTTACCNGNATACCTGTCCGCCTTTNNNCCNTTNGGGNNNNNNGGC GCTTTCTCATANCTCACGCTNNNGNATNNTCANNNCGGGNGNANGNCNNNNNNNN NNGCTGNNNNGNNNNNCNCNNNCCNNNNCNNNCNNNCGCNNGNNNCTNNNCNG NNACNNNNNNNNGNNNNNNNNNNNACGANTNATNNCCNNNNNNNNANNNNNNNN NNNANNNNG

KIFC3 (Contig5308) Reference sequence, primers used, and clones obtained uc_Smed_v2_Contig5308 (1833nts) atgacttatattaactataataaactaggctttgacaataaattgaaaaataataattcttacctgactaattatgaattatttcct cgagacaatgataactttcagataagaaatgattttgacctgaaattaccttacaaaaggcgaacaaataattcatgtattcc gaattttggagaatataatgacaatattaatctccaaagcaagctttacagtccaccgacagacaatattcaggaactctgt gaaatgtttgatgttctatatagctcaggcgacgatttaggatatttagatcaagatgaaattaagaagcttagaacactgtgt attattttagaacaaagcaataatgatttagaatatgtaacaaagagattggatcatgaaaacaaatgtttcgatcctagaat aaatcaattaaaaagtataaataaaactctaaaagaagataatatagaatattttggaagatcagttgaaaatcgatttctat tgaaagatgtggaaaaattgaaagaacttctagatgctttgactagtgccgttaatgaagaagttaacaatcattgcaagctt caagaagaatattttgctgctgaatttaatagaaagcaatttgaaagagatagaatggtctatgaacttacatcagctcaaa caagtcatcagttgaataatttatcattgaaaaaggctcatttagaaaattgtaaggaagacttaatgaaaaaacaagtttat gtaaacagacttcaagatattaaaggctttttcagagtatttgcaagaattcgcatgtttcaaaacaaaaatacagaatccat attttcttttgttactgacgacaaaattggcataaaatcattgaaaacaaacagtaaaactggagatgaagttaaagtttatca atttaataaaatttttaataatgaaagcagtcatattgatatttctaacaattttcaaggatctatcaatcagttaattgtcggttata atgtttgtttgatccattttggaacttcgggatctggcaaaactcacactgttgtaggggattttcaaagcgaatgtgggatcag cacatttctggtaggcaaattgattgacgaaatgaataaagaacacagaaaacgttttaaaattgatgtatcatttctcgaatt ttacaatgacaatttaatctgtttattaagtgaaaagaaaatcaaattaaaagatactgggaaaaaaattctaattgacgatt atgttaaagagtctataataactctaaataactataataggcttctacaacaagtggcacaaaaacggcaaaccagtgca acgtcattttgttctcaatcatctagatcccatctcattattattatatctatcaaatctgaaaatacaattacttttgttaaaactaat agtcgactaataatttgcgacttagctggatttgaaaaaacctcggttaatattgagaatatgagaaagcaatacatggatg aaacgtattatattaataattcattgtcagtattgagtcagattattgaagaatttaatttgtacaagttaaaacatgaacatttga

80 cacaaagaaaatcaacattaccatttaggtcgagtaaattaactcaatttctaaaaccatgcttctttggagatgcctattgtta tttaattatacatgtttcaaatgatccagttcagattcattcaacttgtaaaatccttcagttaggccaaactgccatgtcaactg aattaggtaaaccgatttgccataaaacagattcaggttcaatttgtttatcaaaatacataaga Primer 7: gcgaatgtgggatcagcacatttc 12/24 are GC – 50% Primer 8: tcagttgacatggcagtttggcc 12/22 are GC – 54% the ‘t’ in red was added on by accident KIFC3 Clone: M13F primer was used (Plus/Plus)

NNNNNNNNNNNNNTNNNNNCGACTCNCTATAGGGCGAATTGGGCCCGACGTCGC ATGCTCCCGGCCGCCATGGCCGCGGGATTGCGAATGTGGGATCAGCACATTTCT GGTAGGCAAATTGATTGACGAAATGAATAAAGAACACAGAAAACGTTTTAAAATT GATGTATCATTTCTCGAATTTTACAATGACAATTTAATCTGTTTATTAAGTGAAAA GAAAATCAAATTAAAAGATACTGGGAAAAAAATTCTAATTGACGATTATGTTAAA GAGTCTATAATAACTCTAAATAACTATAATAGGCTTCTACAACAAGTGGCACAAA AACGGCAAACCAGTGCAACGTCATTTTGTTCTCAATCATCTAGATCCCATCTCATT ATTATTATATCTATCAAATCTGAAAATACAATTACTTTTGTTAAAACTAATAGTCGA CTAATAATTTGCGACTTAGCTGGATTTGAAAAAACCTCGGTTAATATTGAGAATAT GAGAAAGCAATACATGGATGAAACGTATTATATTAATAATTCATTGTCAGTATTGA GTCAGATTATTGAAGAATTTAATTTGTACAAGTTAAAACATGAACATTTGACACAA AGAAAATCAACATTACCATTTAGGTCGAGTAAATTAACTCAATTTCTAAAACCATG CTTCTTTGGAGATGCCTATTGTTATTTAATTATACATGTTTCAAATGATCCAGTTCA GATTCATTCAACTTGTAAAATCCTTCAGTTAGGCCAAACTGCCATGTCAACTGAA ATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTT GGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATG GTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACATTCCACACANCATACG AGCCGGAAGCATAAAGTGTAAANCCTGGGGTGCCTAATGAGTGAGCTAACNCAC ATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAANCTGNCGNGCNNCT GCATTAATGAATCGGNCCACNCNNNGGNANAGGCNNNNNNNNNNTGGGNNNTNN TCNGCTCNNNNNTTCNNNGACTCGCTGNNNNNNNGNCNNTCGGNNNNNNNNNCN NNNCNNNTNACNNNNANNGNNGGTANNANNNGNTNNNCCNNNANAATCAGGGNN NN