Carboxyl-Proximal Regions of Reovirus Nonstructural Protein μNS Necessary and Sufficient for Forming Factory-Like Inclusions

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Broering, T. J., M. M. Arnold, C. L. Miller, J. A. Hurt, P. L. Joyce, and M. L. Nibert. 2005. “Carboxyl-Proximal Regions of Reovirus Nonstructural Protein NS Necessary and Sufficient for Forming Factory-Like Inclusions.” Journal of Virology 79 (10): 6194–6206. doi:10.1128/JVI.79.10.6194-6206.2005.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41543038

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA JOURNAL OF VIROLOGY, May 2005, p. 6194–6206 Vol. 79, No. 10 0022-538X/05/$08.00ϩ0 doi:10.1128/JVI.79.10.6194–6206.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Carboxyl-Proximal Regions of Reovirus Nonstructural Protein ␮NS Necessary and Sufficient for Forming Factory-Like Inclusions Teresa J. Broering,1,2†‡ Michelle M. Arnold,1,3† Cathy L. Miller,1 Jessica A. Hurt,4 Patricia L. Joyce,2§ and Max L. Nibert1,3,4* Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 021151; Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin 537062; and Ph.D. Programs in Virology3 and Biological and Biomedical Sciences,4 Division of Medical Sciences, Harvard University, Cambridge, Massachusetts 02138

Received 1 September 2004/Accepted 14 January 2005 Downloaded from Mammalian orthoreoviruses are believed to replicate in distinctive, cytoplasmic inclusion bodies, commonly called viral factories or viroplasms. The viral nonstructural protein ␮NS has been implicated in forming the matrix of these structures, as well as in recruiting other components to them for putative roles in genome replication and particle assembly. In this study, we sought to identify the regions of ␮NS that are involved in forming factory-like inclusions in transfected cells in the absence of infection or other viral proteins. Sequences in the carboxyl-terminal one-third of the 721-residue ␮NS protein were linked to this activity. Deletion of as few as eight residues from the carboxyl terminus of ␮NS resulted in loss of inclusion formation, suggesting that some portion of these residues is required for the phenotype. A region spanning residues 471 to 721 of ␮NS was the smallest one shown to be sufficient for forming factory-like inclusions. The region from positions 471 http://jvi.asm.org/ to 721 (471-721 region) includes both of two previously predicted coiled-coil segments in ␮NS, suggesting that one or both of these segments may also be required for inclusion formation. Deletion of the more amino-termi- nal one of the two predicted coiled-coil segments from the 471-721 region resulted in loss of the phenotype, al- though replacement of this segment with Aequorea victoria green fluorescent protein, which is known to weakly dimerize, largely restored inclusion formation. Sequences between the two predicted coiled-coil segments were also required for forming factory-like inclusions, and mutation of either one His residue (His570) or one Cys residue (Cys572) within these sequences disrupted the phenotype. The His and Cys residues are part of a small consensus motif that is conserved across ␮NS homologs from avian orthoreoviruses and aquareoviruses, suggesting this motif may have a common function in these related viruses. The inclusion-forming 471-721 region of ␮NS was shown to provide a useful platform for the presentation of peptides for studies of protein- on October 13, 2019 by guest protein association through colocalization to factory-like inclusions in transfected cells.

Viruses with ten-segmented, double-stranded RNA ge- mic face of the endoplasmic reticulum (32, 36), and flock house nomes from the family Reoviridae, genus Orthoreovirus, are be- virus (ssRNA genome, family Nodaviridae) on the cytoplasmic lieved to replicate in distinctive, cytoplasmic inclusion bodies face of mitochondria (27). The basis and consequences of such (7, 10, 11, 13, 23, 24, 30, 33, 37–39, 41, 44, 45). These inclusions specific localizations are the subjects of active investigations in are commonly called viral factories (13, 30) or viroplasms (45) many laboratories. We anticipate that studies of mammalian and are similar to cytoplasmic inclusions formed by other vi- orthoreovirus (reovirus) factories in our own laboratory will ruses in the same family. In cells infected by rotaviruses or provide new insights into the still poorly characterized mech- orbiviruses, for example, these structures are called viroplasms anisms for RNA packaging and replication by these and other (12, 40) or viral inclusion bodies (8, 43), respectively. viruses in the family Reoviridae, as well as on the general Many viruses sequester their replication machinery within significance and mechanism of concentrating viral replication localized structures or surfaces in infected cells: for example, at particular sites within cells. herpes simplex virus (double-stranded DNA genome, family In early studies, reovirus factories were determined to con- Herpesviridae) in nuclear inclusions (reviewed in reference 35), tain fully and partially assembled viral particles, viral proteins, vaccinia virus (double-stranded DNA genome, family Poxviri- double-stranded RNA, microtubules, and “kinky” filaments dae) in cytoplasmic inclusions (also called viral factories [re- proposed to be intermediate filaments but not membrane- viewed in reference 29]), brome mosaic virus (single-stranded bound structures or ribosomes (10, 11, 23, 33, 37, 39, 41). The RNA [ssRNA] genome, family Bromoviridae) on the cytoplas- factories have a peculiarly dense consistency that distinguishes them from the adjacent cytoplasm and causes them to appear highly refractile by phase-contrast microscopy. At least part of * Corresponding author. Mailing address: Department of Microbi- ology and Molecular Genetics, Harvard Medical School, 200 Long- this property appears to reflect a protein matrix that suffuses wood Ave., Boston, MA 02115. Phone: (617) 645-3680. Fax: (617) 738- the factories. The determinants or features of one or more 7664. E-mail: [email protected]. viral proteins that would make it capable of forming such a † T.J.B. and M.M.A. contributed equally to this study. matrix are not well understood but might involve a variety of ‡ Present address: Massachusetts Biologic Laboratories, Jamaica Plain, MA 02130. different types of intersubunit interactions, as well as interac- § Present address: Department of Radiation Oncology, University tions with cellular factors. of North Carolina at Chapel Hill, Chapel Hill, NC 27599. Results from our laboratory and others have recently shown

6194 VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6195

that a single reovirus protein, ␮NS, is sufficient for forming morphology of filamentous viral factories. Aside from any ef- phase-dense globular inclusions in the cytoplasm of transfected fects of ␮2, however, ␮NS also requires microtubules for cells (4, 7). The inclusions formed by ␮NS in such experiments undergoing condensation of its smaller inclusions into larger are notably similar in appearance to globular reovirus factories ones, as shown by the effects of the microtubule-depolymeriz- formed in infected cells, as visualized by either phase-contrast ing drug nocodazole. This probably reflects a role for micro- or immunofluorescence (IF) microscopy (4, 7, 30), suggesting tubule-based transport in the formation of ␮NS inclusions and that ␮NS forms the matrix of the factories (7). Moreover, ␮NS the determination of viral factory morphology (7, 30). can associate with several other reovirus proteins and recruit By forming the matrix of viral factories, as well as recruiting them to these inclusions in transfected cells. To date, the viral other components to these structures, the reovirus ␮NS pro- proteins that have been reported to be recruited to inclusions tein could serve to concentrate the components for viral rep- formed by reovirus ␮NS are microtubule-binding core protein lication and assembly, to arrange the components in specific ␮2 (7); nonstructural and ssRNA-binding protein ␴NS (4, 26); ways to promote replication and assembly, and/or to sequester and the core surface proteins ␭1, ␭2, and ␴2 (6). Whole core the components and their mediated functions from antiviral

particles released into the cytoplasm during cell entry are also factors in the cellular environment. To better understand the Downloaded from recruited to ␮NS inclusions (6). Indirect evidence suggests that role of ␮NS in forming the matrix of viral factories, we engi- ␮NS may possess ssRNA-binding activity as well, which may be neered constructs to express a panel of ␮NS truncations and important for recruiting the viral plus-strand RNAs to the point mutants and thereby determined the regions of this factories and/or retaining them there for replication and pack- protein that are involved in forming factory-like inclusions aging in infected cells (1). However, the ssRNA-binding activ- in transfected cells. The results identified several different se- ity of ␴NS is more firmly established (15–17, 19, 34, 42) and quences in the C-terminal one-third of ␮NS that are necessary may play the more important role in ssRNA recruitment to or and sufficient for this activity of ␮NS. retention within the factories (4, 6, 26). Recent studies on the ␮NS homolog from avian orthoreoviruses have reached con- MATERIALS AND METHODS http://jvi.asm.org/ clusions similar to these regarding the roles of ␮NS in forming Cells and antibodies. CV-1 cells were maintained in Dulbecco modified Eagle the factory matrix and recruiting other viral proteins to the medium (Invitrogen Life Technologies) containing 10% fetal bovine serum (Hy- ␮ factories (44, 45). We explicitly specify in the present study Clone Laboratories) and 10 g of gentamicin solution (Invitrogen Life Technol- ogies) per ml. Goat anti-mouse immunoglobulin G (IgG) and goat anti-rabbit when we intend a statement to encompass results for avian IgG conjugated to Alexa 488 or Alexa 594 were obtained from Molecular Probes. orthoreovirus; otherwise, we use the abbreviated name reovi- Rabbit polyclonal antisera to ␮NS or ␮2 have been described previously (5, 7, rus to represent mammalian orthoreovirus only. 30). For some experiments, we used protein A-purified rabbit anti-␮NS or The 80-kDa ␮NS protein is not a component of mature anti-␮2 IgG conjugated to Texas Red, Oregon Green, Alexa 488, or Alexa 594 by using kits obtained from Molecular Probes. Mouse monoclonal antibody (MAb)

virions but is expressed to high levels in infected cells and is on October 13, 2019 by guest FK2 against conjugated ubiquitin (14) was purchased from Medical & Biological concentrated in the reovirus factories (7, 49). Other previous Laboratories. Mouse MAb JL8 against Aequorea victoria green fluorescent pro- findings about ␮NS include its association with transcription- tein (GFP) was purchased from BD Biosciences. Mouse MAb HA.11 against an ally active particles isolated from infected cells (28), its binding immunodominant epitope of influenza A virus hemagglutinin (HA) was pur- ␴ to the surfaces of purified core particles in vitro (5), and its chased from Covance. Mouse MAb 3E10 specific for reovirus NS protein (3) was a gift from T. S. Dermody and coworkers (Vanderbilt University). All capacity to recruit entering core particles to inclusions (6). The antibodies were titrated to optimize signal-to-noise ratios. ␮NS protein has two predicted coiled-coil segments in the Expression constructs. Reovirus proteins were expressed from genes cloned carboxyl-terminal one-third of its sequence (25), but the oli- into the mammalian expression vector pCI-neo (Promega). pCI-M3(T1L) and gomeric status of ␮NS has not been demonstrated. Little else pCI-M3(T3D) to express ␮NS from type 1 Lang (T1L) or type 3 Dearing (T3D) is known about the structure of ␮NS, although domains have reovirus have been described previously (7), as have pCI-M3(41-721) to express ␮NS residues 41 to 721 (7), pCI-M1(T1L) to express ␮2 (30), and pCI-S3(T1L) been predicted from the pattern of conserved and variable to express ␴NS (26). Vent polymerase, which was used for all PCRs, and other regions of sequence among the ␮NS alleles from different enzymes were from New England Biolabs unless otherwise stated. reovirus isolates (25). An isoform of ␮NS lacking ϳ5 kDa from To express ␮NS residues 1 to 683, site-directed mutagenesis was used to its amino terminus and called ␮NSC is also present in virus- introduce a stop codon at nucleotides 2068 to 2070, followed by a Bsu36I site. ␮ QuikChange site-directed mutagenesis (Stratagene) was used according to the infected cells (22, 46). The origin of NSC is not certain, but manufacturer’s protocol with pFastBac-M3(T1L) (5) as a template, forward it is proposed to result from either secondary initiation or primer 5Ј-GGATACGATGAACTAACCTCAGGCTAAATCATTGCG-3Ј, and cleavage near Met41 in ␮NS. A recombinant protein engi- reverse primer 5Ј-CGCAATGATTTAGCCTGAGGTTAGTTCATCGTATC neered to lack the first 40 residues of ␮NS, ␮NS(41-721), C-3Ј (double underline, nucleotide change to add the stop codon; single under- which should be similar to ␮NSC, also forms phase-dense line, nucleotide change to add the restriction site). The region containing the desired mutations was excised by digestion with HindIII and then ligated to globular inclusions in transfected cells (7). pFastBac-M3(T1L) that had been cut with HindIII to remove the same region, Involvement of microtubules in forming reovirus factories generating pFastBac-M3(1-683). The subcloned region was sequenced to con- has also been demonstrated. The M1 segment, which encodes firm its correctness. The M3 gene was removed from pFastBac-M3(1-683) by the structurally minor core protein ␮2, has been shown to digestion with SalI and NheI and then ligated to pCI-neo that had been cut with the same enzymes, generating pCI-M3(1-683). determine both the timing of factory formation (24) and the To generate other ␮NS truncations, start and stop codons and restriction sites morphology of factories (30). The filamentous morphology of were introduced at different positions in the M3 gene by PCR amplification of factories formed by most reovirus strains has been attributed to the desired M3 region. The truncations were made in either T1L or T3D M3. We microtubule association of the ␮2 protein (30). When ␮NS and have found no difference in inclusion formation with T1L and T3D ␮NS (7, 26), ␮ ␮ suggesting that the truncations from these allelic ␮NS proteins are directly 2 are coexpressed in cells without other viral proteins, NS is ␮ ϳ ␮ comparable. In addition, the T1L and T3D NS proteins are 96% identical redistributed with 2 to filamentous inclusions (7), suggesting (25). Each PCR was performed with pGEM-4Z-M3(T1L) or pGEM-4Z-M3 that these two proteins together determine the formation and (T3D) (5) as a template, and the primers are listed in Table 1. Each PCR product 6196 BROERING ET AL. J. VIROL.

TABLE 1. Construction of plasmids with truncated M3 genes

Constructa Primer 1b (5Ј to 3Ј) Primer 2c Enzymesd pGEM-4Z-M3(1-713) CGGGATCCTCGAGCTAATCAATCAGGTCAGCAGCGCCGTCG 1021-1040 BstEII, BamHI pGEM-4Z-M3(1-700) CGGGATCCTCGAGCTAAGTGGCTGATAGAAGGGAGGG 1021-1040 BstEII, BamHI pGEM-4Z-M3(1-470) GGGGTACCTATCGTTCTAGAAAGAGCACCT 778-796 AvaI, KpnI pGEM-4Z-M3(1-362) GGGGTACCTAAGAAGTAATGGAAATCACTTGCG T7 promoter StyI, KpnI pGEM-4Z-M3(1-221) GGGGTACCTAATCATGAGTTGTCTGAATATCAGCAGCC T7 promoter BamHI, KpnI pGEM-4Z-M3(1-173) GGGGTACCTAGGTTGAAGCAAGCCTCTCG T7 promoter BamHI, KpnI pGEM-4Z-M3(173-721) CGGGATCCGTCATGGCTACCAGCGTGTCCGTCAGGAC Reverse 1513-1533 AvaI, BamHI pGEM-4Z-M3(221-721) CGGGATCCGTCATGGCTGATGTCCATTTGGCACCAGG Reverse 1513-1533 AvaI, BamHI pGEM-4Z-M3(363-721) CGGGATCCGTCATGGCTGCTTTAAAGTGGGTGG Reverse 1717-1735 BsmI, BamHI pGEM-4Z-M3(471-721) CGGGATCCGTCATGGCTTCCAATGACGTGACAGATGG Reverse 2191-2209 BsmI, BamHI

a Each construct was designed to contain the portion of the M3 gene encoding the indicated amino acid residues of ␮NS. b For each C-terminal truncation construct, primer 1 is in the reverse orientation relative to the coding strand, and the added stop codon is double underlined. For Downloaded from each N-terminal truncation construct, primer 1 is in the forward orientation relative to the coding strand, and the added start codon cassette is double underlined. The BamHI or KpnI restriction enzyme site added near the 5Ј end of each primer is single underlined; for the 1-470, 1-362, 1-221, and 1-173 constructs, the restriction site overlaps the stop codon by one nucleotide. c Primer 2 for each PCR reaction comprised the indicated nucleotides in the M3 gene plus strand, the 18 nucleotides in the T7 promoter of pGEM-4Z, or the reverse complement of the indicated nucleotides in the M3 gene plus strand. d Each PCR product was digested with the indicated enzymes for cloning. was cut with the restriction enzymes listed in Table 1 and then ligated to a gested with EcoRI and NotI, and the products were ligated to generate pCI-neo- plasmid that had been cut with these same enzymes, the plasmid being either M3(561-721). The correctness of the final constructs was confirmed by sequenc- pGEM-4Z (for pGEM-4Z-M3(1-173) and pGEM-4Z-M3(1-221) or the template ing. http://jvi.asm.org/ plasmid (for all other constructs). The correctness of each construct was con- To generate a ␮NS(471-721) or full-length ␮NS protein with residues His569 firmed by sequencing. The truncated M3 genes were subcloned into pCI-neo by us- and His570 changed to glutamine and Cys572 changed to serine, QuikChange ing the restriction enzymes listed in Table 2. Each construct was named for the res- site-directed mutagenesis was used according to the manufacturer’s protocol idues of ␮NS that the expressed protein should ultimately contain (Tables 1 and 2). with pCI-M3(471-721) or pCI-M3(T3D) as a template, forward primer 5Ј-GG The pEGFP-N1 and pEGFP-C1 vectors (BD Biosciences) were respectively ATATGTATCTGCGACAACAAACTTCCATTAATGGTCATGC-3Ј, and re- used to express fusions of enhanced A. victoria GFP to the C or N terminus of the verse primer 5Ј-GCATGACCATTAATGGAAGTTTGTTGTCGCAGATACA desired ␮NS region. pEGFP-N1-M3(T1L) was previously constructed to express TATCC-3Ј (double underlines, nucleotide changes to provide amino acid chang- GFP fused to the C terminus of ␮NS (␮NS/GFP) (7). To express GFP fused to es; single underline, nucleotide change to remove a DdeI site for screening the N terminus of ␮NS residues 471 to 721, pGEM-4Z-M3(471-721) was cut with purposes). After the QuikChange protocol, the mutated pCI-M3(471-721) or SalI and KpnI, and the excised fragment was then ligated to pEGFP-C1 that had pCI-M3(T3D) plasmid was prepared for subcloning by cutting with NheI and been cut with the same enzymes, generating pEGFP-C1-M3(471-721). To ex- EcoRI or by cutting with BlpI and NotI, respectively. The excised fragments were on October 13, 2019 by guest press GFP fused to the N termini of even smaller C-terminal regions of ␮NS, an then ligated to pCI-neo or pCI-M3(T3D), respectively, that had been cut with the EcoRI site was introduced at the desired position in the M3 gene during PCR same respective pair of enzymes, generating the final versions of pCI-M3(471- amplification. Each PCR was performed with pGEM-4Z-M3(T1L) (5) as a 721)QQS and pCI-M3(T3D)QQS. The correctness of these constructs was con- template, the forward primers listed in Table 3, and a reverse primer comple- firmed by sequencing. To generate a full-length ␮NS protein with Cys561 or Cys572 mentary to the 3Ј end of the M3 coding strand with an added BamHI site changed to Ser or His569, His570, or His576 changed to Gln, QuikChange site- (underlined) (5Ј-GCAGGGGATCCGATGAATGGGGGTCGGGAAGGCTT directed mutagenesis was used according to the manufacturer’s protocol with AAGGG-3Ј). Each PCR product was cut with EcoRI and BamHI and was then pCI-M3(T3D) as a template and the primers listed in Table 4. According to the ligated to pEGFP-C1 that had been cut with the same enzymes. The correctness QuikChange protocol, each mutated plasmid was prepared for subcloning by of each construct was confirmed by sequencing, and the construct was named for cutting with BlpI and NotI. In each case, the excised fragment was then ligated the residues of ␮NS that the expressed protein contains (Table 3). To generate HA-tagged fusions, epitope-encoding forward primer 5Ј-CGTA GCTAGCGTCATGGCTTACCCATACGACGTCCCAGACTACGCTCTCG AGATGC-3Ј and reverse primer 5Ј-GCATCTCGAGAGCGTAGTCTGGGAC TABLE 2. Construction of plasmids to express ␮NS truncations GTCGTATGGGTAAGCCATGACGCTAGCTACG-3Ј (underlining indicates Constructa Enzymesb Size (kDa)c NheI and XhoI sites added to each primer) were annealed by boiling in 1ϫ SSC (150 mM NaCl plus 15 mM sodium citrate [pH 7.0]), followed by cooling at room pCI-M3(1-713) XhoI, NheI 79.3 temperature for 1 h. The duplex oligonucleotide and vector pCI-neo were then pCI-M3(1-700) XhoI, NheI 78.0 digested with NheI and XhoI, and the products were ligated to generate pCI- pCI-M3(1-683) SalId, NheI 76.1 neo-HA. The region encoding ␮NS(561-721) was amplified by PCR from the pCI-M3(1-470) KpnI (blunt), SalI 52.0 template pCI-M3(T1L) by using forward primer 5Ј-GCTAGAATTCATGTAG pCI-M3(1-362) KpnI (blunt), SalI 39.9 TCTGGATATGTATTTGAGACACCAC-3Ј and reverse primer 5Ј-GATCGA pCI-M3(1-221) KpnI (blunt), SalI 23.9 TCCCGGGTCGGGAAGGCTTAAGGGATTAGGGCAA-3Ј (underlining in- pCI-M3(1-173) SacI (blunt), SalI 18.7 dicates an EcoRI or SmaI site added to each primer). The PCR product and pCI-M3(173-721) EcoRI, SalI 61.6 vector pCI-neo-HA were then sequentially digested with SmaI and EcoRI, and pCI-M3(221-721) EcoRI, SalI 56.4 the products were ligated to generate pCI-neo-HA-M3(561-721). The region pCI-M3(363-721) EcoRI, SalI 40.3 encoding ␮NS(471-721) was amplified by PCR from the template pCI-M3(T1L) pCI-M3(471-721) EcoRI, SalI 28.2 by using the forward primer 5Ј-AGCTCTCGAGGTCATGTCCAGTGACATG GTAGACGGGATTAAAC-3Ј (underlining indicates an added XhoI site) and a Each construct was designed to express a truncated ␮NS protein comprising reverse primer 5Ј-CGAAGCATTAACCCTCAC-3Ј. The PCR product and vec- the indicated amino acid residues. b tor pCI-neo-HA were then digested with XhoI and NotI, and the products were Unless otherwise noted, pGEM-4Z plasmids from Table 1 were digested with the indicated enzymes to remove the truncated M3 genes. In some cases, one of ligated to generate pCI-neo-HA-M3(471-721). To generate untagged ␮NS(561- the resulting fragment termini was converted to a blunt end (blunt) with T4 DNA 721), PCR was performed by using the template pCI-M3(T1L), forward primer polymerase before ligation to pCI-neo. Ј 5 -AGCTGAATTCGTCATGGCTTGTAGTCTGGTATGTATTTGAGACA c Expected size of the expressed ␮NS truncation. C-3Ј (underline indicates an added EcoRI site), and reverse primer 5Ј-CGAAG d pCI-M3(T3D)(1-683) was subcloned from pFastBac-M3(T1L)(1-683) as de- CATTAACCCTCAC-3Ј. The PCR product and vector pCI-neo were then di- scribed in Materials and Methods. VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6197

TABLE 3. Construction of plasmids to express ␮NS-GFP fusions

Constructa Forward primerb (5Ј to 3Ј) Expressed proteinc Size (kDa)d pEGFP-C1-M3(471-721) Not applicable GFP/␮NS(471-721) 57.1 pEGFP-C1-M3(561-721) CGGAATTCGTGTAGTCTGGATATGTATTTGAGACACCAC GFP/␮NS(561-721) 46.3 pEGFP-C1-M3(614-721) CGGAATTCGGAAGCGGCTGCCAAATGCCAAACTG GFP/␮NS(614-721) 40.1 pEGFP-C1-M3(625-721) CGGAATTCGATGGACTTGACTCAGATGAATGGAAAGC GFP/␮NS(625-721) 39.1 pEGFP-C1-M3(695-721) CGGAATTCGATGGCCTCCCTTCTATCAGCCACTCCT GFP/␮NS(695-721) 31.1

a Each construct was designed to express a GFP fusion including the indicated amino acid residues of ␮NS. b The EcoRI site added near the 5Ј end of each is underlined. c In each of these proteins, GFP was fused to the N terminus of the ␮NS region. d That is, the expected size of the expressed fusion protein. to pCI-M3(T3D) that had been cut with the same enzymes, generating the Immunoblot analysis. CV-1 cells were transfected as described for IF, and constructs as named in Table 4. The correctness of each subcloned region was whole-cell lysates were collected 18 to 24 h posttransfection (p.t.). CV-1 cells Downloaded from confirmed by sequencing. (1.2 ϫ 106) were washed briefly in PBS and then scraped into 1 ml of PBS and To generate a fusion of ␮NS residues 1 to 41 to the N terminus of GFP and pelleted. The pelleted cells were resuspended in 30 ␮l of PBS containing pro- ␮NS residues 471 to 721 to the C terminus of GFP, DNA encoding residues 1 to tease inhibitors (Roche Biomedicals), lysed into sample buffer, boiled for 10 min, 41 of ␮NS and a large portion of GFP was removed from pEGFP-N1-M3(1-41) and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins (7) by digestion with NheI and BsrGI. pEGFP-C1-M3(471-721) was also cut with were electroblotted from the gels to nitrocellulose in 25 mM Tris and 192 mM these enzymes, and the two DNA fragments were ligated to generate pEGFP- glycine (pH 8.3). Binding of antibodies was detected with alkaline phosphatase- M3(1-41)/GFP/M3(471-721). To generate a fusion of ␮NS residues 1 to 12 to the coupled goat anti-mouse IgG (Bio-Rad Laboratories) and the colorimetric re- N terminus of GFP and ␮NS residues 471 to 721 to the C terminus of GFP, agents p-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphos- forward primer 5Ј-AATTC ATGGCTTCATTCAAGGGATTCTCCGTCAACA phate p-toluidine salt (Bio-Rad Laboratories). CTGTTGCG-3Ј and reverse primer 5Ј-GATCCGCAACAGTGTTGACGGAG Sequence comparisons. The following ␮NS and ␮NS-homolog sequences, each

AATCCCTTGAATGAAGCCATG-3Ј were annealed to generate a small duplex designated as complete coding sequences in GenBank, were compared: ␮NS of http://jvi.asm.org/ encoding ␮NS residues 1 to 12 and having BamHI and EcoRI overhangs at the mammalian orthoreoviruses T1L (accession no. AAF13169), type 2 Jones (ac- respective ends (underlined). This small duplex and plasmid pEGFP-N1 were cession no. AAF13170), and T3D (accession no. AAF13171); ␮NS of avian ortho- both digested with BamHI and EcoRI and then ligated to yield pEGFP-N1- reoviruses 1733 (accession no. AAQ81873), S1133 (accession no. AAS78987), M3(1-12). This plasmid was then digested with NheI and BsrGI, and the excised 1017-1 (accession no. AAS78988), 2408 (accession no. AAS78990), 601G (ac- fragment was ligated to pEGFP-C1-M3(471-721) that had been digested with the cession no. AAS78991), 750505 (accession no. AAS78992), 916SI (accession no. same enzymes, generating plasmid pEGFP-M3(1-12)/GFP/M3(471-721). The AAS78993), 918 (accession no. AAS78994), 919 (accession no. AAS78995), OS161 correctness of the resulting construct was confirmed by sequencing. (accession no. AAS78996), R2 (accession no. AAS78997), and T6 (accession Transfections and IF microscopy. Cells were seeded the day before transfec- no. AAS78998); and NS1 of aquareoviruses grass carp 873 (accession no. tion at a density of 1.5 ϫ 104 per cm2 in six-well plates (9.6 cm2 per well) AAM92735) and golden shiner (accession no. AAM92747). Sequences were containing glass coverslips (19 mm). Cells were transfected with 2 ␮gofDNA compared by using the Bestfit and Pretty programs from the Genetics Computer on October 13, 2019 by guest and 7 ␮l of Lipofectamine 2000 (Invitrogen Life Technologies) or 1.5 ␮lofDNA Group Wisconsin package. The Multicoil program (http://multicoil.lcs.mit.edu and 10 ␮l of Polyfect (Qiagen) according to the manufacturer’s directions. Cells /cgi-bin/multicoil) (48) was used for predicting coiled-coil regions. were further incubated for 18 to 24 h at 37°C before fixation for 10 min at room temperature in 2% paraformaldehyde in phosphate-buffered saline (PBS; 137 mM NaCl, 3 mM KCl, 8 mM Na2HPO4,1mMKH2PO4 [pH 7.5]) or 3 min at RESULTS Ϫ20°C in ice-cold methanol. Fixed cells were washed three times with PBS, permeabilized, and blocked in PBS containing 1% bovine serum albumin and The C terminus of ␮NS is required for forming factory-like 0.1% Triton X-100 (PBSAT). Primary antibodies were diluted in PBSAT and inclusions. We have previously shown that a truncated ␮NS incubated with cells for 25 to 40 min at room temperature. After three washes in ␮ PBS, secondary antibodies diluted in PBSAT were added and incubated with protein lacking the N-terminal 40 residues, NS(41-721), col- cells for 25 min at room temperature. Coverslips were incubated with 300 nM lects in cytoplasmic, factory-like inclusions in transfected cells, 4,6-diamidino-2-phenylindole (DAPI; Molecular Probes) in PBS for 5 min to similarly to full-length ␮NS (7). The N terminus of ␮NS is thus counterstain cell nuclei, briefly washed in PBS, and mounted on glass slides with not required for forming these structures. To determine wheth- Prolong (Molecular Probes). Samples were examined by using a TE-300 inverted er the C terminus of ␮NS is required, we engineered M3 gene microscope (Nikon) equipped with phase and fluorescence optics, and images ␮ were collected digitally as described elsewhere (30). All images were processed constructs to express a series of truncated NS proteins that and prepared for presentation by using Photoshop (Adobe Systems). lacked increasing numbers of residues from the C terminus (Ta-

TABLE 4. Construction of plasmids to express ␮NS point mutants

Primer (5Ј to 3Ј)b Mutationa Forward Reverse C561S CAAGTCAGCTCAATCATCTAGCTTGGATATCTATC GATACATATCCAAGCTAGATGATTGAGCTGACTTG H569Q GATATGTATCTGCGACAACACACTTGCATTAATGG CCATTAATGCAAGTGTGTTGTCGCAGATACATATC H570Q GATATGTATCTGCGACACCAAACTTGCATTAATGG CCATTAATGCAAGTTTGGTGTCGCAGATACATATC C572S GATATGTATCTGCGACACCACACTTCCATTAATGGTC GACCATTAATGGAAGTGTGGTGTCGCAGATACATATC H576Q CCACACTTGCATCAATGGTCAAGCTAAAGAAGATG CATCTTCTTTAGCTTGACCATTGATGCAAGTGTGG

a Desired mutation at the indicated amino acid position of ␮NS. Amino acid residues are written in single-letter code as follows: wild-type residue, position number, and mutant residue. b In each primer, the nucleotide change to give the desired amino acid change is double underlined. For the C561S mutant, this change also caused loss of a BfaI restriction enzyme site useful for screening. For the other mutants, an additional nucleotide change was made to cause loss of a restriction enzyme site (single underline); the lost site is DdeI for H569Q, H570Q, and C572S and MseI for H576Q. 6198 BROERING ET AL. J. VIROL. Downloaded from http://jvi.asm.org/ on October 13, 2019 by guest

FIG. 1. IF microscopy of C- terminally truncated ␮NS proteins. CV-1 cells were transfected with plasmids to express the indicated proteins. The cells were then fixed at 18 h p.t. for subsequent immunostaining. Nuclei were counterstained with DAPI (blue). Scale bars, 10 ␮m. (A) The cells were immunostained both with rabbit anti-␮NS IgG conjugated to Texas red (left column, red in right column) and with mouse MAb FK2 for conjugated ubiquitin (cUb), followed by goat anti-mouse IgG conjugated to Alexa 488 (center column, green in right column). (B) The cells were immunostained both with rabbit anti-␮NS IgG followed by goat anti-rabbit IgG conjugated to Alexa 594 (left column, red in right column) and with rabbit anti-␮2 IgG conjugated to Alexa 488 (center column, green in right column). ble 2). Each of these plasmids was transfected into CV-1 cells, nally truncated ␮NS proteins, CV-1 cells were separately trans- and the cell lysates were subjected to SDS-PAGE, followed by fected with each of the plasmids and later fixed and immuno- immunoblotting with polyclonal anti-␮NS serum (5). The stained with polyclonal anti-␮NS antibodies (Fig. 1A, left and results verified the expression of an appropriately sized, right columns). In addition, the cells were coimmunostained ␮NS-derived protein from each construct (data not shown). with MAb FK2, which recognizes conjugated ubiquitin (14), to To determine the intracellular distribution of the C-termi- determine whether any of these proteins were substantially VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6199

misfolded and targeted for degradation by the ubiquitin-pro- teasome system (Fig. 1A, center and right columns). Each of the C-terminally truncated proteins was diffusely distributed in the cytoplasm and nucleus, in clear contrast to full-length ␮NS, which collected in globular inclusions as expected (Fig. 1A and data not shown). We conclude that all of these truncated pro- teins are negative for forming factory-like inclusions (summa- rized in Fig. 2) and thus that some portion of the smallest region we deleted from the C terminus of ␮NS, residues 714 to 721, is required for inclusion formation. None of the truncated proteins appeared to be aggregated or strongly colocalized with conjugated ubiquitin (Fig. 1A and data not shown), sug- gesting that they were not substantially misfolded.

All of the C-terminally truncated ␮NS proteins appeared to Downloaded from be partially localized to the nucleus (Fig. 1A, left column), even though ␮NS(1-683), ␮NS(1-700), and ␮NS(1-713) were above the 60-kDa limit for passive diffusion through nuclear pores (reviewed in reference 31) (Table 2). In addition, at least some of the truncated proteins appeared to be excluded from nucleoli (Fig. 1A, left column). The relevance of this nuclear pattern is unclear because full-length ␮NS is not detected in the nuclei of infected or M3-transfected cells (7, 30). When coexpressed with ␮2(T1L), each of the C-terminally truncated http://jvi.asm.org/ proteins strongly colocalized with ␮2 on microtubules (Fig. 1B and data not shown; summarized in Fig. 2). This was expected because each protein included ␮NS residues 1 to 41, which are known to be sufficient for association with ␮2 (7, 26). The N-terminal 470 residues of ␮NS are not required for forming factory-like inclusions but affect inclusion shape. To identify the minimal region of ␮NS required for inclusion for- FIG. 2. Summary of ␮NS truncations and their activities. The full- ␮ mation, we engineered M3 gene constructs to express a series length NS protein is indicated by a horizontally elongated black bar on October 13, 2019 by guest of truncated ␮NS proteins that lacked increasing numbers of spanning residues 1 to 721 (positions numbered above and below). The ␮NS truncation mutants are also shown as black bars spanning the residues from the N terminus (Table 2). Each of these plasmids approximate portion of ␮NS that each represents. Enhanced A. victo- was transfected into CV-1 cells, and the cell lysates were sub- ria GFP fused to the N or C terminus of ␮NS in some cases is repre- jected to SDS-PAGE, followed by immunoblotting with the sented by an open bar. An influenza virus HA epitope fused to the N anti-␮NS serum (5). The results verified expression of an ap- terminus of ␮NS in some cases is represented by an open circle. propriately sized, ␮NS-derived protein from each construct Approximate extents of the coiled-coil segments predicted by Multicoil are indicated by vertically elongated gray bars. The capacity of each (data not shown). protein to form factory-like inclusions in transfected cells (Inc) and to The intracellular distribution of each of the N-terminally colocalize with T1L ␮2 in transfected cells (␮2) is indicated as positive truncated ␮NS proteins was determined as described above for (ϩ), negative (Ϫ), or not determined (nd). Localized structures that the C-terminal truncations, including coimmunostaining with costained for conjugated ubiquitin were concluded to be aggregates of ␮ misfolded protein (agg). The results for ␮NS(1-721), ␮NS(1-721)/GFP, MAb FK2. With the exception of NS(363-721), which showed ␮NS(1-41)/GFP, ␮NS(14-721), and ␮NS(41-721) have been reported a distinctly aggregated pattern and strongly colocalized with previously (7, 26). conjugated ubiquitin (Fig. 3), each of the N-terminally trun- cated proteins collected in globular inclusions (Fig. 3, left and right columns, and data not shown). However, the proteins with ␮2 (7, 26). From the results summarized in Fig. 2, we missing more than the 40 N-terminal residues of ␮NS often conclude that ␮NS residues 471 to 721 are a sufficient part of formed inclusions with more elongated shapes and enclosed ␮NS for forming factory-like inclusions. These residues en- fenestrations than those formed by full-length ␮NS or ␮NS(41- compass the two predicted coiled-coil segments of ␮NS, the 721) (Fig. 3, left and right columns). Although these inclusions intervening “linker” between these segment, and the C-termi- had altered morphologies, they did not colocalize with conju- nal “tail” that follows the second predicted coiled-coil segment gated ubiquitin (Fig. 3, center and right columns), suggesting (25). Given the altered morphologies of the inclusions formed that these truncated proteins were not substantially misfolded. by ␮NS proteins lacking more than the 40 N-terminal residues, The behavior of ␮NS(363-721), on the other hand, suggested we also conclude that some portion of residues 41 to 172 plays that it was in fact largely misfolded. a distinguishable role in modulating inclusion morphology. When coexpressed with ␮2(T1L), none of the N-terminally Residues 561 to 721 of ␮NS are sufficient for allowing a truncated ␮NS proteins colocalized with ␮2 on microtubules GFP-tagged protein, but not an HA-tagged or untagged pro- or in inclusions (data not shown; summarized in Fig. 2). This tein, to form factory-like inclusions. To determine whether a was expected because each of these proteins lacks ␮NS resi- region of ␮NS smaller than residues 471 to 721 may be suffi- dues 14 to 40, which are known to be required for association cient for inclusion formation, and also to allow more ready 6200 BROERING ET AL. J. VIROL. Downloaded from http://jvi.asm.org/ on October 13, 2019 by guest

FIG. 3. IF microscopy of N-terminally truncated ␮NS proteins. CV-1 cells were transfected with plasmids to express the indicated proteins. The cells were then fixed and stained as described for Fig. 1A. Scale bars, 10 ␮m. detection of these smaller proteins, we next generated con- terminus of ␮NS(614-721), ␮NS(625-721), or ␮NS(695-721) structs to express GFP fused to the N terminus of selected ␮NS was diffusely distributed in the cytoplasm and nucleus of most truncations (Table 3). Each of these plasmids was transfected or all cells expressing them (Fig. 4B and data not shown). From into CV-1 cells, and the cell lysates were subjected to SDS-PAGE, these results, we conclude that residues 561 to 721 are a suf- followed by immunoblotting with GFP-specific MAb JL-8. The ficient part of ␮NS in GFP fusions for forming factory-like results verified production of an appropriately sized, GFP- and inclusions (summarized in Fig. 2), albeit at a lower efficiency ␮NS-derived fusion protein from each construct (Fig. 4A). than full-length ␮NS or ␮NS(471-721). The first predicted To determine the intracellular distribution of each fusion coiled-coil segment (25) is thus dispensable for inclusion for- protein, CV-1 cells were transfected and later immunostained mation by a ␮NS-GFP fusion. On the other hand, some por- with the GFP-specific MAb. Nonfused GFP was diffusely dis- tion of residues 561 to 613, in the linker between the two tributed in the cytoplasm and nucleus, and GFP fused to the C predicted coiled-coil segments, is required. terminus of full-length ␮NS (␮NS/GFP) collected in globular Given that A. victoria GFP is known to weakly dimerize (9) inclusions as previously shown (7) (also see Fig. 4B). GFP and also that GFP/␮NS(561-721) was less efficient at forming fused to the N terminus of ␮NS(471-721) [GFP/␮NS(471-721)] factory-like inclusions than was GFP/␮NS(471-721), we hy- also collected in inclusions (Fig. 4B), which appeared similar to pothesized that the GFP tag may partially complement an those formed by ␮NS(471-721) (Fig. 3) or ␮NS/GFP (Fig. 4B). otherwise-required contribution of the first predicted coiled- GFP fused to the N terminus of ␮NS(561-721) collected in coil segment of ␮NS for forming inclusions. We therefore inclusions as well, although a small fraction of the transfected tested another version of ␮NS(561-721), this one fused to an cells (ϳ13%) displayed a diffuse distribution of this protein epitope of influenza virus HA (47) at its N terminus [HA/␮NS (Fig. 4B and data not shown). In contrast, GFP fused to the N (561-721)]. After expression in transfected CV-1 cells and im- VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6201 Downloaded from

FIG. 5. IF microscopy of HA-tagged or untagged versions of ␮NS (561-721) and ␮NS(471-721). CV-1 cells were transfected with plasmids to express the proteins as indicated. The cells were then fixed at 18 h p.t. and immunostained either with mouse MAb HA.11 for the influenza virus HA epitope, followed by goat anti-mouse IgG conjugated to Alexa 488 ␮ (left panels), or with rabbit anti- NS IgG, followed by goat anti-rabbit http://jvi.asm.org/ IgG conjugated to Alexa 594 (right panels). Scale bars, 10 ␮m.

munostaining with tag-specific MAb HA.11, HA/␮NS(561-721) was diffusely distributed in the cytoplasm and nucleus and thus not concentrated in inclusions (Fig. 5). Fusion of the HA tag to the N terminus of ␮NS(471-721) [HA/␮NS(471-721)], in con- trast, caused little or no reduction in its capacity to form fac-

tory-like inclusions (Fig. 5). We also generated and tested a third on October 13, 2019 by guest version of ␮NS(561-721), this one lacking any tag. After expres- sion in transfected CV-1 cells and immunostaining with anti- ␮NS antibodies, untagged ␮NS(561-721) was diffusely distrib- uted in the cytoplasm and nucleus and thus not concentrated in inclusions (Fig. 5). Untagged ␮NS(471-721) tested in par- allel formed factory-like inclusions (Fig. 5) as seen in the pre- ceding experiments (see Fig. 3). Based on these results, we con- clude that the more N-terminal predicted coiled-coil segment of ␮NS is required for inclusion formation in the absence of a fusion tag such as GFP that can independently self-associate. Putative metal-chelating residues His570 and Cys572 are required for factory-like inclusion formation. In an effort to identify specific residues in ␮NS that may be required for inclu- sion formation, we compared the deduced protein sequences of ␮NS homologs from mammalian and avian orthoreoviruses, as well as from aquareoviruses (see Materials and Methods for the GenBank accession numbers) (2, 25, 45). In all, the ␮NS homologs derived from 17 isolates in the three groups: 3 mam- FIG. 4. Immunoblotting and IF microscopy of GFP-tagged deriv- malian isolates from the Orthoreovirus genus, 12 avian isolates atives of ␮NS. CV-1 cells were transfected with plasmids to express from the Orthoreovirus genus, and 2 piscine isolates from the GFP or ␮NS-GFP fusions as indicated and then analyzed at 18 h p.t. Aquareovirus genus. The overall identity scores for any two ␮ by immunoblotting (A) or IF microscopy (B). Scale bars, 10 m. (A) ␮NS homologs from separate groups are small: Ͻ30% in each Whole-cell lysates were separated by SDS-PAGE, transferred to ni- trocellulose, and immunoblotted with mouse MAb JL8 for GFP fol- case (2, 45) (the present study and data not shown). Despite lowed by goat anti-mouse IgG conjugated to alkaline phosphatase. this degree of divergence, the C-terminal one-third of each of Positions of molecular weight markers are indicated (in kilodaltons) to these ␮NS homologs contains two predicted coiled-coil seg- the left of each panel. (B) After fixation, cells were immunostained ments, of similar lengths and spacing, separated by a linker and with mouse MAb JL8 for GFP, followed by goat anti-mouse IgG followed by a C-terminal tail (data not shown), as previously conjugated to Alexa 488. described for the mammalian and avian isolates (25, 45). Interestingly, in the linker between the predicted coiled-coil 6202 BROERING ET AL. J. VIROL. Downloaded from http://jvi.asm.org/

FIG. 6. Sequence conservation in the “linker” region of ␮NS homologs and IF microscopy of ␮NS proteins with mutations at His and/or Cys on October 13, 2019 by guest residues in the consensus motif. (A) Sequence conservation. Sequences are shown in single-letter code, with position numbers indicated at left and right. The consensus motif was defined by comparing the illustrated region from the ␮NS homologs of 3 mammalian orthoreoviruses (mORV), 12 avian orthoreoviruses (aORV) (all identical in this region), and 2 aquareoviruses (AqRV) (both identical in this region). Conserved positions are highlighted by being boxed. Asterisks indicate conserved positions corresponding to His570 and Cys572 in mammalian orthoreovirus ␮NS. These and other His and Cys residues in or near the consensus motif are highlighted by being circled. (B) IF microscopy. CV-1 cells were trans- fected with plasmids to express the indicated proteins. The cells were then fixed at 18 h p.t. and immunostained both with rabbit anti-␮NS IgG conjugated to Oregon Green and with mouse MAb FK2 for conjugated ubiquitin, followed by goat anti-mouse IgG conjugated to Alexa 594. Nuclei were counterstained with DAPI. Only the anti-␮NS staining is shown since no colocalization with FK2 staining was apparent. Scale bars, 10 ␮m. segments, we identified a small consensus motif common to 6A). The constructs were generated with all three of these mu- all of the examined ␮NS homologs (Fig. 6A). This sequence, tations in the setting of either full-length ␮NS or ␮NS(471-721). Ile/Leu-x-x-Tyr-Leu-x-x-His-Thr/Val-Cys-Ile/Val-Asn (where We then transfected CV-1 cells with these mutant plasmids and “x” represents nonconserved positions), includes two residues costained the cells with anti-␮NS antibodies and MAb FK2 for (underlined) with strong potential to chelate transition metal conjugated ubiquitin. Both proteins, designated ␮NS(1-721) ions such as Zn2ϩ. The two residues correspond to His570 and QQS and ␮NS(471-721)QQS, were diffusely distributed in the Cys572 in the mammalian orthoreovirus ␮NS proteins. Each of cytoplasm and nucleus (Fig. 6B and data not shown), and nei- the ␮NS homologs contains other His and/or Cys residues flank- ther strongly colocalized with conjugated ubiquitin (data not ing the consensus motif, but the position and spacing of these shown). This distribution was in sharp contrast to the inclu- residues is not conserved among the examined sequences (Fig. sions in which both full-length ␮NS and ␮NS(471-721) con- 6A). In mammalian orthoreovirus ␮NS, the other conserved His centrated (data not shown for this experiment, but see previous and Cys residues in this region are Cys561, His569, and His576. figures), demonstrating that one or more of residues His569, The consensus motif spans residues 563 to 574 in the mamma- His570, and Cys572 is important for inclusion formation. lian orthoreovirus ␮NS proteins and is thus near the beginning We next generated constructs encoding single mutations at of the minimal C-terminal region of ␮NS that we showed to be residues Cys561 (to Ser), His569 (to Gln), His570 (to Gln), sufficient for inclusion formation in GFP fusions (Fig. 4). Cys572 (to Ser), or His576 (to Gln) within full-length ␮NS. To determine whether the conserved residues with metal- The mutant plasmids were transfected into CV-1 cells, and the chelating potential in the consensus motif are important for cells were costained with anti-␮NS antibodies and MAb FK2 inclusion formation, we first generated constructs encoding for conjugated ubiquitin. Both ␮NS(1-721)H570Q and ␮NS(1- Gln (Q) substitutions for both His570 and the adjacent resi- 721)C572S were diffusely distributed in the cytoplasm and nu- due, His569, as well as a Ser (S) substitution for Cys572 (Fig. cleus (Fig. 6B). In contrast, ␮NS(1-721)C561S, ␮NS(1-721) VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6203 Downloaded from http://jvi.asm.org/ on October 13, 2019 by guest

FIG. 7. IF microscopy of ␴NS coexpressed with ␮NS-GFP fusions. (A) CV-1 cells were transfected with plasmids to express the proteins indicated. The cells were then fixed at 18 h p.t. and immunostained with ␴NS-specific mouse MAb 3E10, followed by goat anti-mouse IgG conjugated to Alexa 594 (center column, red in right column). GFP-containing fusions were visualized directly (left column, green in right column). Nuclei were counterstained with DAPI (blue). Scale bars, 10 ␮m. (B) Summary of the fusions and their activities. See Fig. 2 legend for explanations of most details. Dashed lines indicate internally deleted regions of ␮NS. The capacity of each protein to colocalize with T1L ␴NS in transfected cells (␴NS) is indicated as positive (ϩ), negative (Ϫ), or unknown (?). The results for ␮NS(1-721), ␮NS(1-721)/GFP, ␮NS(1-41)/GFP, ␮NS(14- 721), and ␮NS(41-721) have been reported previously (7, 26).

H569Q, and ␮NS(1-721)H576Q all collected in globular inclu- N-terminal 41 residues of ␮NS fused to the N terminus of GFP sions indistinguishable from those formed by wild-type ␮NS [␮NS(1-41)/GFP] are diffusely distributed in cells, we encoun- (Fig. 6B). None of the mutant proteins strongly colocalized with tered difficulties in using IF microscopy to determine whether conjugated ubiquitin (data not shown). From these findings, we the N terminus of ␮NS is sufficient for association with ␴NS (7, conclude that His570 and Cys572 are specifically required for 26). Upon finding in the present study that GFP/␮NS(471-721) ␮NS to form factory-like inclusions in transfected cells. collected in factory-like inclusions in transfected cells (Fig. ␴NS recruitment to factory-like inclusions containing ␮NS 4B), we recognized that this protein provided a new platform residues 1 to 12 connected by GFP to ␮NS residues 471 to 721. on which to assay protein-protein associations through redis- We have previously shown that ␴NS colocalizes with full- tribution to its distinctive inclusions. When GFP/␮NS(471-721) length ␮NS but not with ␮NS(41-721) or ␮NS(13-721) in co- was coexpressed with ␴NS, ␴NS remained diffusely distributed transfected cells, indicating that the N terminus of ␮NS is in the cytoplasm and nucleus and did not colocalize with the required for recruiting ␴NS (7, 26). Because both ␴NS and the GFP/␮NS(471-721) inclusions (Fig. 7A). This was expected, 6204 BROERING ET AL. J. VIROL.

because some portion of ␮NS residues 1 to 13 is required for An otherwise-uncharacterized region of ␮NS (residues 41 to recruiting ␴NS to ␮NS inclusions (26). 172) affected the shape of the inclusions in the present study, To determine whether ␮NS residues 1 to 41 can direct re- causing them to be more compact and less fenestrated when cruitment of ␴NS to the inclusions of GFP/␮NS(471-721), we present in the inclusion-forming protein. This effect could re- constructed a plasmid to express these residues fused to the N flect a direct interaction of some portion of residues 41 to 172 terminus of GFP/␮NS(471-721). When expressed in trans- with the C-terminal, inclusion-forming region of ␮NS or with fected CV-1 cells, this protein, ␮NS(1-41)/GFP/␮NS(471-721), some cellular protein, which in an unknown manner produces collected in inclusions similar to those formed by ␮NS(471- more compact inclusions. This effect could also reflect an in- 721) or GFP/␮NS(471-721) (data not shown). When ␴NS was direct mechanism, such as a reduction in the turnover rate of coexpressed with ␮NS(1-41)/GFP/␮NS(471-721) and coimmu- the inclusion-forming protein such that holes do not develop nostained with anti-␴NS MAb 3E10 (3) and the anti-␮NS within the inclusions. serum, ␴NS strongly colocalized with the ␮NS(1-41)/GFP/␮NS Previous reports have shown that the N-terminal 40 residues (471-721) inclusions (Fig. 7A). This was in stark contrast to of ␮NS are involved in associations with at least two other reo-

the diffuse distribution of ␴NS expressed alone (26) or coex- virus proteins: microtubule-binding protein ␮2 and ssRNA- Downloaded from pressed with GFP/␮NS(471-721) (Fig. 7A). When coexpressed binding protein ␴NS (7, 26). Moreover, the specific residues with ␮2, ␮NS(1-41)/GFP/␮NS(471-721) was redistributed to necessary or sufficient for these activities have been shown to filamentous inclusions (data not shown), as expected because be separable. Residues 1 to 41 of ␮NS are sufficient for asso- of the presence of ␮NS residues 14 to 40 (26) (also see Fig. 2 ciation with ␮2 (7), but only some portion of residues 14 to 40 and 7B). These results newly demonstrate that ␮NS residues of ␮NS is necessary for this activity (26). In contrast, some 41 to 470 are dispensable for recruiting ␴NS (summarized in portion of residues 1 to 13 of ␮NS is necessary for association Fig. 7B). with ␴NS (26), and residues 1 to 12 of ␮NS may be sufficient We additionally constructed a plasmid to express ␮NS res- for this activity (the present study). Other, complementary evi- idues 1 to 12 fused to the N terminus of GFP/␮NS(471-721). dence suggests the N-terminal 40 residues of ␮NS represent a http://jvi.asm.org/ When expressed in transfected CV-1 cells, this protein, ␮NS discrete domain. A form of ␮NS lacking ϳ5 kDa of N-terminal (1-12)/GFP/␮NS(471-721), collected in factory-like inclusions sequence is produced in infected cells concomitantly with the (data not shown). Moreover, when coexpressed, ␴NS was full-length protein (7, 46). Although the origin of this smaller strongly recruited to the ␮NS(1-12)/GFP/␮NS(471-721) inclu- form, called ␮NSC, remains in question, the fact that it is sim- sions (Fig. 7A). When coexpressed with ␮2, ␮NS(1-12)/GFP/ ilar to ␮NS(41-721), which lacks both ␮2 and ␴NS association ␮NS(471-721) was not redistributed to filamentous inclusions activities, suggests that it and full-length ␮NS may play distin- (data not shown), as expected because of the absence of ␮NS guishable roles in infection. Interestingly, a ␮NSC-like form of

residues 13 to 41 (26). These results demonstrate that ␮NS ␮NS has been recently identified in avian orthoreovirus and on October 13, 2019 by guest residues 13 to 470 are dispensable for recruiting ␴NS (sum- found not to associate with the avian orthoreovirus ␴NS pro- marized in Fig. 7B) and suggest that ␮NS residues 1 to 12 may tein as well, suggesting that the different activities of ␮NS and be sufficient for this association. ␮NSC in this regard may be a conserved point of regulation for reoviruses in general (45). The avian orthoreovirus ␮2 protein ␮ DISCUSSION has not yet been examined for NS association. Except for the modulation of inclusion shape described in Numerous observations suggest that the inclusion bodies in the present study and a predicted coiled-coil segment from reovirus-infected cells are sites of viral replication and assem- residues 518 to 561 (25), the large central portion of ␮NS bly (4, 6, 33, 38, 39). The roles of nonstructural protein ␮NS in spanning residues 41 to 560 remains without well-characterized forming the matrix of these viral factories and recruiting other activities. This region from positions 41 to 560 may contain the components to them have become a focus of recent studies in residues responsible for ␮NS associations with other reovirus this field (4, 6, 7). Given the recent findings and the absence of components, including the individual core-surface proteins, ␭1, strong evidence for other functions of this protein, we hypoth- ␭2, and ␴2 and whole core particles (6, 7). In fact, these esize that the primary role of ␮NS in reovirus infection is to activities are shared by ␮NS and ␮NSC, indicating they do not build and organize the factories to promote replication and require the N-terminal 40 residues of ␮NS. Further truncation/ assembly. We find it intriguing that reovirus may have a protein deletion analyses are needed to determine whether each of the dedicated to this role, and we therefore wish to learn more individual core-surface proteins, as well as core particles, may about how the different regions of ␮NS carry out specific ac- associate with ␮NS/␮NSC through a distinct set of residues, tivities toward this end. such as those for ␮2 and ␴NS in the unique N-terminal region Current summary of ␮NS functional regions. Truncation of ␮NS. and deletion analyses have been a fruitful approach for iden- Other components with which ␮NS/␮NSC may yet be shown tifying discrete regions of ␮NS involved in its different activi- to associate include the reovirus RNA-dependent RNA poly- ties. For example, the current study demonstrated that the merase ␭3, the reovirus outer-capsid proteins, the reovirus C-terminal one-third of ␮NS (residues 471 to 721) is a suffi- RNA molecules, and any possible number of cellular factors. cient part of this protein for forming factory-like inclusions in For each of these potential associations, again, further trunca- transfected cells in the absence of infection or other viral tion/deletion analyses could aid in ascertaining whether each proteins. The present study also identified several smaller re- component may associate with ␮NS or ␮NSC through a dis- gions of sequence, and even single residues, within this third of tinct set of residues in ␮NS. In any case, the emerging picture ␮NS that are required for inclusion formation. of ␮NS is one of a protein involved in multiple interactions to VOL. 79, 2005 INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN 6205

form the factory matrix and to recruit other components to the resulting from its deletion can be largely rescued by fusion to factories, with a modular organization of its primary sequence GFP. We interpret this result to indicate that the role of the for performing these many distinct activities. first predicted coiled-coil segment is in self-association, which How does ␮NS form factory-like inclusions? There are GFP can also mediate (9), but we acknowledge that this inter- many possible interactions that could be involved in forming pretation requires further testing. Although the more C-termi- the three-dimensional structure that each inclusion likely rep- nal one of the two predicted coiled-coil segments in ␮NS has resents, even before the addition of other viral components as not been directly tested for its role in inclusion formation, we found in the factories in infected cells. For example, ␮NS-␮NS expect that at least part of it is also required. Coiled-coil in- interactions may be all that are required for forming factory- teractions between ␮NS subunits could, for example, mediate ␮ like inclusions. Alternatively, interactions of NS with one or the formation of basal oligomers, which then interact through more cellular factor may be necessary, with the cellular fac- other motifs to form the inclusions. Alternatively, one or both ␮ tor(s) acting as bridges between NS monomers or oligomers. of the coiled-coil segments could mediate hetero-oligomeriza- ␮ The presence of predicted coiled-coil segments in NS has led tion with a cellular protein. As noted in Results, predicted

␮ Downloaded from to the suggestion that NS forms a basal small oligomer, pos- coiled-coil segments are also found flanking the proposed sibly a dimer, through ␣-helical coiled-coil interactions (25). If metal chelation sequences in each of the ␮NS homologs from so, then inclusions are likely built by linking these small oli- avian orthoreoviruses and aquareoviruses, suggesting a con- gomers together, with or without the help of cellular factors. In served function for these motifs. any case, according to the new results, ␮NS(471-721) must be Formation of ␮NS inclusions as a tool to study protein– capable of mediating or instigating all of the necessary inter- protein associations inside cells. The characteristic subcellular actions for inclusion formation. The smaller regions within localization of ␮NS and its inclusion-forming derivatives—in ␮NS(471-721) that are required for forming inclusions might be directly involved in these interactions. cytoplasmic, phase-dense, globular inclusions—has proven a ␮ The consensus motif that spans residues 563 to 574 of ␮NS potent tool for studying associations between NS and other http://jvi.asm.org/ and that is partially conserved in the homologous proteins of viral proteins in infected or transfected cells (4, 6, 7). In avian orthoreoviruses and aquareoviruses includes residues the present study, we acquired original evidence that GFP/ ␮ His570 and Cys572, which are required for inclusion forma- NS(471-721) may provide a useful platform for examining tion. Given that His and Cys residues have strong potential to possible associations between any two proteins in transfected chelate transition metal ions such as Zn2ϩ, we hypothesize that cells. In particular, full-length proteins or protein regions ex- metal chelation by His570 and Cys572 is a part of their role in pressed as fusions to GFP/␮NS(471-721) should localize to the forming inclusions. Moreover, considering that His570 and distinctive, globular inclusions induced by the region from po-

Cys572 are so closely spaced and that nearby residues with sitions 471 to 721. The capacity of this fused protein or protein on October 13, 2019 by guest the same potential for metal chelation—Cys561, His569, and region to associate with another, “test” protein can then be His576—are dispensable for inclusion formation, we hypothe- assayed by examining cells in which the test protein has been size that His570 and Cys572 form half of an intermolecular coexpressed with the inclusion-forming fusion protein. If the metal-chelating motif, similar to the zinc hook of Rad50 (18) test protein localizes to the globular inclusions, then it and the or the zinc clasp of CD4/8 and Lck (20, 21). The latter two fused protein or protein region can be concluded to associate. motifs provide four zinc-chelating residues, two from each Of course, nonfused GFP/␮NS(471-721) should be tested in participating subunit, and contribute to homodimerization in parallel as a negative control for the specificity of test protein the case of Rad50 or heterodimerization in the case of CD4/8 localization to the inclusions. A range of relative expression and Lck. Of course, further work is needed to determine wheth- levels of the two proteins could also be tested, in case relative er ␮NS residues His570 and Cys572 indeed chelate a metal ion overexpression of the test protein may retard inclusion forma- ␮ and, if so, whether this chelation may contribute to NS homo- tion by the other. We are currently extending our studies of the ␮ dimerization or NS heterodimerization with a cellular pro- feasibility of this approach as a general one for studying pro- tein, either of which could be required for inclusion formation. tein-protein associations within the “native” cellular environ- ␮ Some portion of the C-terminal eight residues of NS (Phe- ment in which the proteins normally reside and function. Ser-Val-Pro-Thr-Asp-Glu-Leu) is also required for inclusion formation. Since this region contains no His or Cys residues, it must contribute to forming inclusions by a mechanism distinct ACKNOWLEDGMENTS from that hypothesized for His570 and Cys572. Although this region is not highly conserved in the homologous proteins of We express our sincere gratitude to Elaine Freimont and Jason avian orthoreoviruses and aquareoviruses, each of the ␮NS Dinoso for laboratory maintenance and technical assistance and to other members of our lab for helpful discussions. We also thank John homologs terminates in Leu and has at least one acidic residue Patton and John Parker for reviews of a draft of the manuscript. and no basic residues in its C-terminal eight positions. Further This study was supported in part by NIH grants R01 AI47904 work is needed to determine whether these C-terminal resi- (M.L.N.) and F32 AI56939 (C.L.M.) and by a junior faculty grant from dues may contribute to ␮NS-␮NS interaction or to ␮NS inter- the Giovanni Armenise-Harvard Foundation (M.L.N.). T.J.B. and action with a cellular protein, either of which could be addi- M.M.A. were also supported by NIH grant T32 AI07245 to the Viral tionally required for inclusion formation. Infectivity Training Program. J.A.H. was also supported by NIH grant T32 GM07226 to the Biological and Biomedical Sciences Training Evidence in the present study suggests that the more N- Program. At earlier stages of this work, C.L.M. was also supported by terminal of the predicted coiled-coil segments in ␮NS (25) is NIH grant T32 AI07061 to the Combined Infectious Diseases Training required for inclusion formation but that the loss of function Program. 6206 BROERING ET AL. J. VIROL.

REFERENCES 24. Mbisa, J. L., M. M. Becker, S. Zou, T. S. Dermody, and E. G. Brown. 2000. Reovirus ␮2 protein determines strain-specific differences in the rate of viral 1. Antczak, J. B., and W. K. Joklik. 1992. Reovirus genome segment assortment inclusion formation in L929 cells. Virology 272:16–26. into progeny genomes studied by the use of monoclonal antibodies directed 25. McCutcheon, A. M., T. J. Broering, and M. L. Nibert. 1999. Mammalian against reovirus proteins. Virology 187:760–776. reovirus M3 gene sequences and conservation of coiled-coil motifs near the 2. Attoui, H., Q. Fang, F. M. Jaafar, J. F. Cantaloube, P. Biagini, P. De Micco, carboxyl terminus of the ␮NS protein. Virology 264:16–24. and X. De Lamballerie. 2002. Common evolutionary origin of aquareovi- 26. Miller, C. L., T. J. Broering, J. S. L. Parker, M. M. Arnold, and M. L. Nibert. ruses and orthoreoviruses revealed by genome characterization of golden 2003. Reovirus ␴NS protein localizes to inclusions through an association shiner reovirus, grass carp reovirus, striped bass reovirus and golden ide requiring the ␮NS amino terminus. J. Virol. 77:4566–4576. reovirus (genus Aquareovirus, family Reoviridae). J. Gen. Virol. 83:1941– 27. Miller, D. J., M. D. Schwartz, and P. Ahlquist. 2001. Flock house virus RNA 1951. replicates on outer mitochondrial membranes in Drosophila cells. J. Virol. 3. Becker, M. M., M. I. Goral, P. R. Hazelton, G. S. Baer, S. E. Rodgers, E. G. 75:11664–11676. Brown, K. M. Coombs, and T. S. Dermody. 2001. Reovirus ␴NS protein is Morgan, E. M., and H. J. Zweerink. required for nucleation of viral assembly complexes and formation of viral 28. 1975. Characterization of transcriptase 68: inclusions. J. Virol. 75:1459–1475. and replicase particles isolated from reovirus-infected cells. Virology 4. Becker, M. M., T. R. Peters, and T. S. Dermody. 2003. Reovirus ␴NS and 455–466. ␮NS proteins form cytoplasmic inclusion structures in the absence of viral 29. Moss, B. 2001. Poxviridae: the viruses and their replication, p. 2637–2671. In infection. J. Virol. 77:5948–5963. D. M. Knipe and P. M. Howley (ed.), Fields virology. Lippincott Williams & 5. Broering, T., A. McCutcheon, V. Centonze, and M. Nibert. 2000. Reovirus Wilkins Co., Philadelphia, Pa. ␮ 30. Parker, J. S., T. J. Broering, J. Kim, D. E. Higgins, and M. L. Nibert. 2002. Downloaded from nonstructural protein NS binds to reovirus cores but does not inhibit their ␮ transcription activity. J. Virol. 74:5516–5524. Reovirus core protein 2 determines the filamentous morphology of viral 6. Broering, T. J., J. Kim, C. L. Miller, C. D. Piggott, J. B. Dinoso, M. L. Nibert, inclusion bodies by interacting with and stabilizing microtubules. J. Virol. 76: and J. S. L. Parker. 2004. Reovirus nonstructural protein ␮NS recruits viral 4483–4496. core surface proteins and entering core particles to factory-like inclusions. 31. Quimby, B. B., and A. H. Corbett. 2001. Nuclear transport mechanisms. Cell. J. Virol. 78:1882–1892. Mol. Life Sci. 58:1766–1773. 7. Broering, T. J., J. S. L. Parker, P. L. Joyce, J. Kim, and M. L. Nibert. 2002. 32. Restrepo-Hartwig, M. A., and P. Ahlquist. 1996. Brome mosaic virus heli- Mammalian reovirus nonstructural protein ␮NS forms large inclusions and case- and polymerase-like proteins colocalize on the endoplasmic reticulum colocalizes with reovirus microtubule-associated protein ␮2 in transfected at sites of viral RNA synthesis. J. Virol. 70:8908–8916. cells. J. Virol. 76:8285–8297. 33. Rhim, J. S., L. E. Jordan, and H. D. Mayor. 1962. Cytochemical, fluorescent- 8. Brookes, S. M., A. D. Hyatt, and B. T. Eaton. 1993. Characterization of virus antibody and electron microscopic studies on the growth of reovirus (ECHO inclusion bodies in bluetongue virus-infected cells. J. Gen. Virol. 74:525–530. 10) in tissue culture. Virology 17:342–355. 9. Campbell, R. E., O. Tour, A. E. Palmer, P. A. Steinbach, G. S. Baird, D. A. 34. Richardson, M. A., and Y. Furuichi. 1985. Synthesis in Escherichia coli of the http://jvi.asm.org/ ␴ Zacharias, and R. Y. Tsien. 2002. A monomeric red fluorescent protein. reovirus nonstructural protein NS. J. Virol. 56:527–533. Proc. Natl. Acad. Sci. USA 99:7877–7882. 35. Roizman, B., and A. E. Sears. 2001. Herpes simplex viruses and their repli- 10. Dales, S. 1963. Association between the spindle apparatus and reovirus. cation, p. 2231–2295. In D. M. Knipe and P. M. Howley (ed.), Fields virology. Proc. Natl. Acad. Sci. USA 50:268–275. Lippincott Williams & Wilkins Co., Philadelphia, Pa. 11. Dales, S., P. Gomatos, and K. C. Hsu. 1965. The uptake and development of 36. Schwartz, M., J. Chen, M. Janda, M. Sullivan, J. den Boon, and P. Ahlquist. reovirus in strain L cells followed with labeled viral ribonucleic acid and 2002. A positive-strand RNA virus replication complex parallels form and ferritin-antibody conjugates. Virology 25:193–211. function of retrovirus capsids. Mol. Cell 9:505–514. 12. Eichwald, C., J. F. Rodriguez, and O. R. Burrone. 2004. Characterization of 37. Sharpe, A. H., L. B. Chen, and B. N. Fields. 1982. The interaction of rotavirus NSP2/NSP5 interactions and the dynamics of viroplasm formation. mammalian reoviruses with the cytoskeleton of monkey kidney CV-1 cells. J. Gen. Virol. 85:625–634. Virology 120:399–411.

13. Fields, B. N., C. S. Raine, and S. G. Baum. 1971. Temperature-sensitive 38. Silverstein, S. C., and S. Dales. 1968. The penetration of reovirus RNA and on October 13, 2019 by guest mutants of reovirus type 3: defects in viral maturation as studied by immu- initiation of its genetic function in L-strain fibroblasts. J. Cell Biol. 36: nofluorescence and electron microscopy. Virology 43:569–578. 197–230. 14. Fujimuro, M., H. Sawada, and H. Yokosawa. 1994. Production and charac- 39. Silverstein, S. C., and P. H. Schur. 1970. Immunofluorescent localization of terisation of monoclonal antibodies specific to multi-ubiquitin chains of double-stranded RNA in reovirus-infected cells. Virology 41:564–566. polyubiquitinated proteins. FEBS Lett. 349:173–180. 40. Silvestri, L. S., Z. F. Taraporewala, and J. T. Patton. 2004. Rotavirus rep- 15. Gillian, A. L., and M. L. Nibert. 1998. Amino terminus of reovirus nonstruc- lication: plus-sense templates for double-stranded RNA synthesis are made tural protein sigma NS is important for ssRNA binding and nucleoprotein in viroplasms. J. Virol. 78:7763–7774. complex formation. Virology 240:1–11. 41. Spendlove, R. S., E. H. Lennette, J. N. Chin, and C. O. Knight. 1964. Effect 16. Gillian, A. L., S. C. Schmechel, J. Livny, L. A. Schiff, and M. L. Nibert. 2000. of antimitotic agents on intracellular reovirus antigen. Cancer Res. 24:1826– Reovirus nonstructural protein ␴NS binds in multiple copies to single- 1833. stranded RNA and shares properties with single-stranded DNA binding 42. Stamatos, N. M., and P. J. Gomatos. 1982. Binding to selected regions of proteins. J. Virol. 74:5939–5948. reovirus mRNAs by a nonstructural reovirus protein. Proc. Natl. Acad. Sci. 17. Gomatos, P. J., O. Prakash, and N. M. Stamatos. 1981. Small reovirus USA 79:3457–3461. particle composed solely of ␴NS with specificity for binding different nucleic 43. Theron, J., H. Huismans, and L. H. Nel. 1996. Site-specific mutations in the acids. J. Virol. 39:115–124. NS2 protein of epizootic haemorrhagic disease virus markedly affect the 18. Hopfner, K. P., L. Craig, G. Moncalian, R. A. Zinkel, T. Usui, B. A. Owen, formation of cytoplasmic inclusion bodies. Arch. Virol. 141:1143–1151. A. Karcher, B. Henderson, J. L. Bodmer, C. T. McMurray, J. P. Carney, J. H. 44. Touris–Otero, F., M. Cortez–San Martin, J. Martinez-Costas, and J. Bena- Petrini, and J. A. Tainer. 2002. The Rad50 zinc-hook is a structure joining vente. 2004. Avian reovirus morphogenesis occurs within viral factories and Mre11 complexes in DNA recombination and repair. Nature 418:562–566. begins with the selective recruitment of ␴NS and ␭Ato␮NS inclusions. 19. Huismans, H., and W. K. Joklik. 1976. Reovirus-coded polypeptides in J. Mol. Biol. 341:361–374. infected cells: isolation of two native monomeric polypeptides with affinity 45. Touris-Otero, F., J. Martinez-Costas, V. N. Vakharia, and J. Benavente. for single-stranded and double-stranded RNA, respectively. Virology 70: 2004. Avian reovirus nonstructural protein ␮NS forms viroplasm-like inclu- 411–424. sions and recruits protein ␴NS to these structures. Virology 319:94–106. 20. Huse, M., M. J. Eck, and S. C. Harrison. 1998. A Zn2ϩ ion links the 46. Wiener, J. R., J. A. Bartlett, and W. K. Joklik. 1989. The sequences of cytoplasmic tail of CD4 and the N-terminal region of Lck. J. Biol. Chem. 273: reovirus serotype 3 genome segments M1 and M3 encoding the minor pro- 18729–18733. tein ␮2 and the major nonstructural protein ␮NS, respectively. Virology 169: 21. Kim, P. W., Z. Y. Sun, S. C. Blacklow, G. Wagner, and M. J. Eck. 2003. A 293–304. zinc clasp structure tethers Lck to T-cell coreceptors CD4 and CD8. Science 47. Wilson, I. A., H. L. Niman, R. A. Houghten, A. R. Cherenson, M. L. Connolly, 301:1725–1728. and R. A. Lerner. 1984. The structure of an antigenic determinant in a 22. Lee, P. W. K., E. C. Hayes, and W. K. Joklik. 1981. Characterization of protein. Cell 37:767–778. anti-reovirus immunoglobulins secreted by cloned hybridoma cell lines. Vi- 48. Wolf, E., P. S. Kim, and B. Berger. 1997. MultiCoil: a program for predicting rology 108:134–146. two- and three-stranded coiled coils. Protein Sci. 6:1179–1189. 23. Mayor, H. D. 1965. Studies on reovirus. 3. A labile, single-stranded ribonu- 49. Zweerink, H. J., M. J. McDowell, and W. K. Joklik. 1971. Essential and cleic acid associated with the late stages of infection. J. NCI. 35:919–925. nonessential noncapsid reovirus proteins. Virology 45:716–723.