Supplementary Data

SUPPLEMENTARY DATA

Supplementary Research Design and Methods

Preparation of rabbit polyclonal anti-mouse Mincle antibody and Western blot analysis Anti-mouse Mincle antibody was prepared as reported previously [1] using the peptide CFYSMPWICEMPEISPLD corresponding to the last 18 amino acids of the carboxyl terminus of the mouse Mincle protein. The peptide emulsified with 100 μg of Keyhole Limpet Hemocyanin (KLH; Thermo Fisher Scientific, Rockford, IL) in complete Freund’s adjuvant was immunized in rabbits, which was followed by boosting with 100 μg of KLH in incomplete Freund’s adjuvant every 2 weeks. The immunized rabbit sera were evaluated by a conventional ELISA method and the serum showing the highest titer was purified using a protein A column (Millipore, Billerica, MA) and an affinity column following the manufacturer’s instruction. Whole cell lysates were prepared as described [2]. Samples (10 μg protein per lane) were separated by 5-20 % gradient SDS-PAGE (ATTO, Tokyo, Japan) and Western blot analysis was performed as described [3] using anti-mouse Mincle antibody.

Human study on Mincle expression in the adipose tissue A total of 23 Japanese male patients with ischemic heart disease who received bypass surgery in Tokushima University Hospital were recruited in this study (Table). They were classified by BMI (nonobese, BMI < 25.0 and obese, BMI ≥ 25.0, according to the criteria of the Japan Society for the Study of Obesity) [4]. Some were treated with anti-hypertensive drugs including angiotensin II receptor antagonists (nonobese group, 9/12; obese group, 9/11), lipid-lowering medications such as statins (nonobese group, 4/12; obese group, 8/11), and oral anti-diabetic agents (nonobese group, 4/12; obese group, 6/11). There was no appreciable difference in serum CRP levels between the groups (nonobese group, 0.14 ± 0.03; obese group, 0.14 ± 0.03). Subcutaneous adipose tissue samples were obtained from the thoracic walls during cardiac surgery. Samples were frozen in liquid nitrogen immediately and stored at -80°C for total RNA extraction. Blood samples were obtained after an overnight fast. Serum concentrations of total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL- C), low density lipoprotein cholesterol (LDL-C) were measured according to the standard procedures. The study protocol was approved by the ethical committee on human research of The University of Tokushima Graduate School and Tokyo Medical and Dental University, and all participants gave written informed consent.

Human study on Mincle expression in circulating monocytes A total of 50 Japanese non-diabetic subjects were recruited in this study (Supplementary Table 3). They were classified by BMI (nonobese, BMI < 25.0 and obese, BMI ≥ 25.0, according to the criteria of the Japan Society for the Study of Obesity) [16]. Some were treated with antihypertensive drugs including angiotensin II receptor antagonists (nonobese group, 0/25; obese group, 6/25) and lipid-lowering medications such as statins (nonobese group, 0/25; obese group, 14/25). Patients treated with antidiabetic drug(s) were excluded. Peripheral blood mononuclear cells were collected from heparinized blood samples through density gradient centrifugation with lymphocyte separation solution (Nacalai Tesque, Kyoto, Japan) [5]. Human monocytes were obtained by magnetic-assisted cell sorting (MACS) with anti-human CD14 immunomagnetic beads (Miltenyi Biotech, Bergisch Gladbach, Germany), and mRNA expression was analyzed by quantitative real-time PCR [5]. The study protocol was approved by the ethical committee on human research of Kyoto Medical Center and Tokyo Medical and Dental University, and all participants gave written informed consent.

References 1. Matsumoto M, Tanaka T, Kaisho T, Sanjo H, Copeland NG, Gilbert DJ, Jenkins NA, Akira S. A novel LPS-inducible C-type lectin is a transcriptional target of NF-IL6 in macrophages. J Immunol 1999;163:5039-5048 2. Suganami T, Nishida J, Ogawa Y. A paracrine loop between adipocytes and macrophages aggravates inflammatory changes: role of free fatty acids and tumor necrosis factor a. Arterioscler Thromb Vasc Biol 2005;25:2062-2068 3. Suganami T, Yuan X, Shimoda Y, Uchio-Yamada K, Nakagawa N, Shirakawa I, Usami T, Tsukahara T, Nakayama K, Miyamoto Y, Yasuda K, Matsuda J, Kamei Y, Kitajima S, Ogawa Y. Activating transcription factor 3 constitutes a negative feedback mechanism that attenuates saturated fatty acid/Toll-like receptor 4 signaling and macrophage activation in obese adipose tissue. Circ Res 2009;105:25-32 4. Examination Committee of Criteria for 'Obesity Disease' in Japan; Japan Society for Study of Obesity. New criteria for 'obesity disease' in Japan. Circ J 2002;66:987-992 5. Satoh N, Shimatsu A, Himeno A, Sasaki Y, Yamakage H, Yamada K, Suganami T, Ogawa Y. Unbalanced M1/M2 phenotype of peripheral blood monocytes in obese diabetic patients: effect of pioglitazone. Diabetes Care;33:e7

Supplementary Table 1. Primers used to detect mouse mRNAs.

Genes Primers Arginase 1 Fw: 5’- CTCCAAGCCAAAGTCCTTAGAG -3’ Rv: 5’- AGGAGCTGTCATTAGGGACATC -3’ CD11c Fw: 5’- CTGGATAGCCTTTCTTCTGCTG -3’ Rv: 5’- GCACACTGTGTCCGAACTC -3’ F4/80 Fw: 5’-CTTTGGCTATGGGCTTCCAGT-3’ Rv: 5’-GCAAGGAGGACAGAGTTTATCGTG-3’ iNOS Fw: 5’- CCAAGCCCTCACCTACTTCC -3’ Rv: 5’- CTCTGAGGGCTGACACAAGG -3’ Mannose receptor Fw: 5’- ACCAAATCGCCTGCATCC -3’ Rv: 5’- CACTTGGGAGTTTTTGAAGCATC -3’ Mincle Fw: 5’- ACCAAATCGCCTGCATCC -3’ Rv: 5’- CACTTGGGAGTTTTTGAAGCATC -3’ TNFα Fw: 5’-ACCCTCACACTCAGATCATCTTC-3’ Rv: 5’-TGGTGGTTTGCTACGACGT-3’ 36B4 Fw: 5’-GGCCCTGCACTCTCGCTTTC-3’ Rv: 5’-TGCCAGGACGCGCTTGT-3’

Supplementary Table 2. Primers used to detect human mRNAs.

Genes Primers CD11c Fw: 5’- CTTTGCCATTGAGGGTACGG -3’ Rv: 5’- GCCATCTCCAATTCGAAGGA -3’ CD68 Fw: 5’- ACATGGCGGTGGAGTACAATG -3’ Rv: 5’- AATGTCCACTGTGCTGCGTG -3’ IL-6 Fw: 5’-GGACGGCTTTTACTTAAACGCCAAGG-3’ Rv: 5’-ATCTTCCCTAGTTACCCAGGTTCAGC-3’ IL-10 Fw: 5’-AACAAGAGCAAGGCCGTGG-3’ Rv: 5’-GAAGATGTCAAACTCACTCATGGC-3’ Mincle Fw: 5’- AAGAACTGCTCAGCCATGGG -3’ Rv: 5’- CCTGCTCCTCCTGTGAGTTGA -3’ TNFα Fw: 5’-AAGAGTTCCCCAGGGACCTCT-3’ Rv: 5’-CCTGGGAGTAGATGAGG TACA-3’ ß-actin Fw: 5’- AGTACTCCGTGTGGATCGGC -3’ Rv: 5’- GCTGATCCACATCTGCTGGA -3’

Supplementary Table 3. Clinical characteristics and metabolic parameters BMI < 25 Group BMI ≥ 25 Group (Nonobese) (Obese) n (M/F) 25 (17/8) 25 (16/9) Age 49.1 ± 1.2 48.0 ± 1.8 BMI, kg/m2 22.1 ± 0.4 29.5 ± 0.8** SBP, mmHg 128 ± 2.2 143 ± 4.9** DBP, mmHg 82 ± 2.1 87 ± 3.0 TG, mg/dl 139 ± 14 230 ± 33* HDL-C, mg/dl 86 ± 5.7 78 ± 9.0 LDL-C, mg/dl 108 ± 7.1 112 ± 7.6 HbA1c, % 4.9 ± 0.1 5.2 ± 0.1** M, male; F, female; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; TG, serum triglyceride concentrations; HDL-C, serum high density lipoprotein cholesterol concentrations; LDL-C, serum low density lipoprotein cholesterol concentrations. Data are expressed as the mean ± SEM. *P < 0.05. **P < 0.01. Nonobese, n = 25; Obese, n = 25.

Supplementary Table 4. Genes upregulated in the coculture of 3T3-L1 adipocytes and RAW264 macrophages. Fold increase of expression level Gene symbols Gene titles Control Coculture culture vs. vs. 3T3-L1 Control culture Raet1a retinoic acid early transcript 1, alpha 446 1.62 Ptgs2 prostaglandin-endoperoxide synthase 2 321 2.39 Ddx3y DEAD box polypeptide 3, Y-linked 176 2.03 Ccl3 chemokine (C-C motif) ligand 3 165 1.69 Mpeg1 macrophage expressed gene 1 99.7 1.53 Tm6sf1 transmembrane 6 superfamily member 1 84.3 1.58 Ccl4 chemokine (C-C motif) ligand 4 83.3 1.52 Slpi secretory leukocyte protease inhibitor 67.2 1.71 Ccnb1 cyclin B1 67.0 1.86 Slc2a6 solute carrier family 2, member 6 63.4 1.63 Uhrf1 ubiquitin-like, containing PHD and RING finger 63.0 1.93 domains, 1 Tnf tumor necrosis factor 61.2 1.90 Ptpn22 protein tyrosine phosphatase, non-receptor type 8 53.7 1.55 Igh-6 immunoglobulin heavy chain 6 46.1 1.69 Slc16a3 solute carrier family 16, member 3 43.0 2.44 Spdye5 Williams-Beuren syndrome chromosome region 5 36.3 2.77 homolog Clec4e C-type lectin, superfamily member 9 35.4 2.79 (Mincle) Msr1 macrophage scavenger receptor 1 35.2 1.56 Ccl9 chemokine (C-C motif) ligand 9 33.4 1.52 Csf2 colony stimulating factor 2 31.9 1.81 Lcp2 lymphocyte cytosolic protein 2 31.1 1.51 Fli1 Friend leukemia integration 1 29.2 1.52 Emilim2 elastin microfibril interfacer 2 25.6 1.62 Ap1s3 adaptor-related protein complex AP-1, sigma 3 24.7 1.68 Pik3ap1 phosphoinositide-3-kinase adaptor protein 1 20.3 1.62 Plcg2 phospholipase C, gamma 2 18.7 1.98 Bcat1 branched chain aminotransferase 1 16.3 1.84 Ccr1 chemokine (C-C motif) receptor 1 15.4 1.97 Cfp properdin factor, complement 14.1 2.20 Rrm2 ribonucleotide reductase M2 13.7 1.75 Unc5c unc-5 homolog A 13.2 1.56 Dok2 downstream of tyrosine kinase 2 13.0 1.76 Tesl testis derived transcript 11.5 1.77 RIPK3 receptor-interacting serine-threonine kinase 3 10.6 1.66 Nrp2 neuropilin 2 10.3 2.58 Ect2 ect2 oncogene 10.1 1.82 CXCL11 chemokine (C-X-C motif) ligand 11 10.1 10.5

Ube2c ubiquitin-conjugating enzyme E2C 9.04 1.83 Ccnb2 cyclin B2 8.81 1.56 Lyn Yamaguchi sarcoma viral (v-yes-1) oncogene 8.40 1.98 homolog Plaur urokinase plasminogen activator receptor 7.74 1.95 Hmmr hyaluronan mediated motility receptor 7.47 1.53 Kif23 kinesin family member 23 7.31 1.72 Gpsm3 G-protein signalling modulator 3 7.17 1.58 Irf8 interferon regulatory factor 8 6.15 1.83 Slfn2 schlafen 2 6.14 3.27 B4galnt1 beta-1,4-N-acetyl-galactosaminyl transferase 1 5.91 1.91 Mcm3 minichromosome maintenance deficient 3 5.83 2.26 Nlrp3 NLR family, pyrin domain containing 3 5.74 2.00 Atp2a3 ATPase, Ca2+ transporting, ubiquitous 5.06 1.55 Cd44 CD44 antigen 4.94 2.55 Ccna2 cyclin A2 4.29 1.70 Pcdh7 protocadherin 7 4.00 1.54 Trip13 thyroid hormone receptor interactor 13 3.99 1.85 Il1rl1 interleukin 1 receptor-like 1 3.76 1.94 S100a8 S100 calcium binding protein A8 3.73 3.55 Spred1 sprouty protein with EVH-1 domain 1 3.15 1.50 Mcm6 minichromosome maintenance deficient 6 2.97 1.68 Actr3 ARP3 actin-related protein 3 homolog 2.90 1.60 Tagln2 transgelin 2 2.78 2.38 Cenpa centromere protein A 2.71 1.53 Tcf19 transcription factor 19 2.68 1.66 Hmga1 high mobility group AT-hook 1 2.67 1.80 MT2 metallothionein 2 2.65 2.71 Ccl2 chemokine (C-C motif) ligand 2 2.44 15.9 Mmp3 matrix metalloproteinase 3 2.21 6.93 Rab8b RAB8B, member RAS oncogene family 2.20 1.72 Nfkbie nuclear factor of kappa light polypeptide gene 2.19 9.24 enhancer in B-cells inhibitor, epsilon Cks2 CDC28 protein kinase regulatory subunit 2 2.16 1.55 Tpm4 tropomyosin 4 2.13 1.50 Fosl1 fos-like antigen 1 2.00 2.86 Casp4 caspase 4 1.99 5.55 Ler5 immediate early response 5 1.99 1.93 Tubb2a tubulin, beta 2A 1.97 1.87 Erdr1 erythroid differentiation regulator 1 1.94 1.52 H2-q7 histocompatibility 2, Q region locus 7 1.88 1.98 Lmnb1 lamin B1 1.86 1.66 Bmp2k BMP2 inducible kinase 1.84 1.64 Plod2 procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 1.80 1.50 Ube1l ubiquitin-activating enzyme E1-like 1.78 1.59 Pold1 polymerase (DNA directed), delta 1, catalytic 1.78 1.64 subunit

Aprt adenine phosphoribosyl transferase 1.77 1.54 Manf mesencephalic astrocyte-derived neurotrophic factor 1.77 1.63 Myd88 myeloid differentiation primary response gene 88 1.76 1.68 Ptgir prostaglandin I receptor 1.75 3.37 Il13ra1 interleukin 13 receptor, alpha 1 1.74 6.30 Cxcl5 chemokine (C-X-C motif) ligand 5 1.72 2.92 Hyou1 hypoxia up-regulated 1 1.71 1.74 Arhgdib Rho, GDP dissociation inhibitor (GDI) beta 1.71 1.58 Nop56 NOP56 ribonucleoprotein homolog 1.70 1.70 Slc39a14 solute carrier family 39, member 14 1.69 4.36 Ddx39 DEAD box polypeptide 39 1.68 1.71 Socs3 suppressor of cytokine signaling 3 1.67 2.22 Hist1h2ad histone cluster 1, H2ad 1.64 1.73 Ikbke inhibitor of kappaB kinase epsilon 1.64 4.43 Pfn1 profilin 1 1.64 1.73 Trim30 tripartite motif protein 30 1.61 2.85 Pwp2 periodic tryptophan protein homolog 1.61 1.70 Cxcl16 chemokine (C-X-C motif) ligand 16 1.61 3.22 Trp53 transformation related protein 53 1.60 1.72 Traf3 Tnf receptor-associated factor 3 1.57 1.63 Rnabp1 RAN binding protein 1 1.53 1.52 Ggta1 glycoprotein galactosyltransferase alpha 1 1.53 1.54 Bxdc1 brix domain containing 1 1.50 1.59 Osmr oncostatin M receptor 1.50 2.32 Bub3 budding uninhibited by benzimidazoles3 homolog 1.49 1.52 Tfrc transferrin receptor 1.49 1.57 Arf6 ADP-ribosylation factor 6 1.48 1.50 Pgk1 phosphoglycerate kinase 1 1.48 1.93 Ripk2 receptor (TNFRSF)-interacting serine-threonine 1.45 4.70 kinase 2 Sept7 septin 7 1.44 1.64 Nme1 expressed in non-metastatic cells 1 1.44 2.18 Lbp lipopolysaccharide binding protein 1.43 8.79 Ipo5 karyopherin (importin) beta 3 1.42 1.50 Adam17 a disintegrin and metalloproteinase domain 17 1.42 1.61 Trim25 tripartite motif protein 25 1.40 1.95 Csprs component of Sp100-rs 1.39 1.68 Mtyh9 myosin heavy chain IX 1.39 1.69 Tifa Traf2 binding protein 1.37 3.46 Ifngr2 interferon gamma receptor 2 1.36 2.25 Ifi203 interferon activated gene 203 1.36 3.47 Oxsr1 oxidative-stress responsive 1 1.32 1.73 Samhd1 SAM domain and HD domain, 1 1.29 2.38 Ninj1 ninjurin 1 1.27 1.64 Cxcl1 chemokine (C-X-C motif) ligand 1 1.27 5.50 Eef1e1 eukaryotic translation elongation factor 1 epsilon 1 1.27 1.60 Apobec1 apolipoprotein B mRNA editing enzyme, catalytic 1.26 1.81

polypeptide 1 Litaf LPS-induced TN factor 1.25 1.65 Acsl5 acyl-CoA synthetase long-chain family member 5 1.25 1.53 Codc86 coiled-coil domain containing 86 1.24 1.80 Ptpn12 protein tyrosine phosphatase, non-receptor type 12 1.24 1.50 Ugcg UDP-glucose ceramide glucosyltransferase 1.23 2.04 H2-d1 histocompatibility 2, D region locus 1 1.23 1.65 Cotl1 coactosin-like 1 1.23 4.99 Six4 sine oculis-related homeobox 4 homolog 1.23 1.82 Tlr4 toll-like receptor 4 1.22 1.55 Angptl4 angiopoietin-like 4 1.22 1.64 Saa3 serum amyloid A 3 1.21 79.8 Tnfaip2 tumor necrosis factor, alpha-induced protein 2 1.20 4.03 Junb Jun-B oncogene 1.20 3.58 Timp1 tissue inhibitor of metalloproteinase 1 1.17 4.21 Psmb2 proteasome (prosome, macropain) subunit, beta type 1.16 1.50 2 Nufip1 nuclear fragile X mental retardation protein 1.15 1.55 interacting protein 1 Ifi202b interferon activated gene 202B 1.15 4.08 Dr1 down-regulator of transcription 1 1.14 1.67 Scly selenocysteine lyase 1.14 1.60 Gadd45b growth arrest and DNA-damage-inducible 45 beta 1.14 3.29 Nab1 Ngfi-A binding protein 1 1.14 1.67 Egfr epidermal growth factor receptor 1.13 1.52 Tm9sf4 transmembrane 9 superfamily protein member 4 1.13 1.52 Nolc1 nucleolar and coiled-body phosphoprotein 1 1.15 1.55 Ckap4 cytoskeleton-associated protein 4 1.13 1.55 Twf2 twinfilin, actin-binding protein, homolog 2 1.11 1.50 Tbcd tubulin-specific chaperone d 1.10 1.65 Isg15 ISG15 ubiquitin-like modifier 1.09 5.19 Sept9 septin 9 1.08 1.50 Casp12 caspase 12 1.08 1.70 Clic4 chloride intracellular channel 4 1.08 1.62 Nek6 NIMA (never in mitosis gene a)-related expressed 1.08 1.70 kinase 6 Ereg epiregulin 1.06 5.98 Chi3l1 chitinase 3-like 1 1.06 4.55 Degs1 degenerative spermatocyte homolog 1.06 1.66 Sdhc succinate dehydrogenase complex, subunit C, 1.06 1.59 integral membrane protein Psmd11 proteasome (prosome, macropain) 26S subunit, non- 1.06 1.59 ATPase, 11 Bysl bystin-like 1.06 2.06 Ccl7 chemokine (C-C motif) ligand 7 1.05 11.5 Nup85 nucleoporin 85 1.05 2.18 Tor3a torsin family 3, member A 1.05 2.18

Ifitm2 interferon induced transmembrane protein 2 1.05 1.50 Ccl8 chemokine (C-C motif) ligand 8 1.04 2.01 Ubd ubiquitin D 1.04 2.12 Klf10 Kruppel-like factor 10 1.04 2.00 Stat2 signal transducer and activator of transcription 2 1.03 1.99 Tlr3 toll-like receptor 3 1.03 1.83 Traf5 Tnf receptor-associated factor 5 1.02 1.67 Axl AXL receptor tyrosine kinase 1.02 1.76 Pak1ip1 PAK1 interacting protein 1 1.01 1.55 Itgav integrin alpha V 1.01 1.98 Ptx3 pentaxin related gene 1.01 28.7 Pim1 proviral integration site 1 1.01 2.44 Stat6 signal transducer and activator of transcription 6 1.00 1.55 Eif1a eukaryotic translation initiation factor 1A 1.00 1.71 Fam105b family with sequence similarity 105, member B 1.00 1.69 Casp7 caspase 7 0.99 1.57 Glipr2 GLI pathogenesis-related 2 0.98 1.80 Lpgat1 lysophosphatidylglycerol acyltransferase 1 0.98 1.56 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), 0.98 1.64 member 5 Snx5 sorting nexin 10 0.98 1.92 Slc29a1 solute carrier family 29 (nucleoside transporters), 0.97 1.52 member 1 Hpx hemopexin 0.97 23.1 Fmr1 fragile X mental retardation syndrome 1 Homolog 0.97 1.71 Hspa4 heat shock protein 4 0.96 2.26 Gnptab N-acetylglucosamine-1-phosphate transferase, alpha 0.96 1.66 and beta subunits Fas Fas (TNF receptor superfamily member 6) 0.95 5.30 Trim21 tripartite motif protein 21 0.95 1.62 Rnf14 ring finger protein 14 0.95 2.35 Sec61b Sec61 beta subunit 0.94 1.56 Pde4b phosphodiesterase 4B, cAMP specific 0.94 1.57 Ifrg15 interferon alpha responsive gene 0.94 1.76 Ehd1 EH-domain containing 1 0.93 2.30 Psme2 proteasome (prosome, macropain) 28 subunit, beta 0.93 1.68 Mvp major vault protein 0.92 1.66 Rab32 RAB32, member RAS oncogene family 0.92 2.35 Csf1 colony stimulating factor 1 0.92 3.97 Psmb8 proteosome (prosome, macropain) subunit, beta type 0.92 1.80 8 (large multifunctional protease 7) Sod2 superoxide dismutase 2, mitochondrial 0.92 3.32 Nfkbib nuclear factor of kappa light chain gene enhancer in 0.90 1.54 B-cells inhibitor, beta Lamp2 lysosomal-associated membrane protein 2 0.90 1.50 Sco2 SCO cytochrome oxidase deficient 2 0.90 1.85 Dusp1 dual specificity phosphatase 1 0.89 1.53

Agfg1 ArfGAP with FG repeats 1 0.89 1.56 Mtap7d1 microtubule-associated protein 7 domain containing 0.88 1.51 1 Lrg1 leucine-rich alpha-2-glycoprotein 1 0.88 2.01 Lrrk1 leucine-rich repeat kinase 1 0.88 1.73 Ndufab1 NADH dehydrogenase (ubiquinone) 1, alpha/beta 0.88 1.96 subcomplex, 1 Hivep2 human immunodeficiency virus type I enhancer 0.88 1.84 binding protein 2 Bcl10 B-cell leukemia/lymphoma 10 0.88 1.61 Ets1 E26 avian leukemia oncogene 1, 5' domain 0.88 1.90 Ass1 argininosuccinate synthetase 1 0.87 7.84 Gbp2 guanylate nucleotide binding protein 2 0.87 6.96 Parp9 poly (ADP-ribose) polymerase family, member 9 0.87 2.58 Tapbp TAP binding protein 0.87 2.37 Rela v-rel reticuloendotheliosis viral oncogene homolog 0.87 1.81 A Cxcr7 chemokine (C-X-C motif) receptor 7 0.86 2.91 Ext1 exostoses (multiple) 1 0.86 1.60 Exoc6 exocyst complex component 6 0.85 1.65 Fscn1 fascin homolog 1, actin bundling protein 0.85 2.26 Eps15l1 epidermal growth factor receptor pathway substrate 0.84 1.87 15-like 1 Ralb v-ral simian leukemia viral oncogene homolog B 0.84 1.60 Fxc1 fractured callus expressed transcript 1 0.83 1.62 Myo10 myosin X 0.83 2.00 Stat1 signal transducer and activator of transcription 1 0.83 2.35 Slc11a2 solute carrier family 11 (proton-coupled divalent 0.83 1.95 metal ion transporters), member 2 Serpina3n serine (or cysteine) proteinase inhibitor, clade A, 0.83 2.86 member 3N D17wsu104e DNA segment, Chr 17, Wayne State University 104, 0.82 1.54 expressed Serpina3g serine (or cysteine) proteinase inhibitor, clade A, 0.82 25.7 member 3G Gapdh glyceraldehyde-3-phosphate dehydrogenase 0.82 1.62 Il10rb interleukin 10 receptor, beta 0.82 1.51 Akr1e1 aldo-keto reductase family 1, member E1 0.81 1.69 Ldha lactate dehydrogenase A 0.81 1.54 Ifi35 interferon-induced protein 35 0.81 1.72 Tnip1 TNFAIP3 interacting protein 1 0.81 4.70 Surf4 surfeit gene 4 0.80 1.50 Lmld6 jumonji domain containing 6 0.80 1.87 Lactb2 lactamase, beta 2 0.80 1.60 Gcnt2 glucosaminyl (N-acetyl) transferase 2, I-branching 0.79 1.88 enzyme Hif1a hypoxia inducible factor 1, alpha subunit 0.79 1.64

Cd47 CD47 antigen 0.79 1.62 Ifnar2 interferon (alpha and beta) receptor 2 0.78 1.64 Ifngr1 interferon gamma receptor 1 0.78 2.40 Il6 interleukin 6 0.78 12.0 Cln8 ceroid-lipofuscinosis, neuronal 8 0.77 1.77 Ogfr opioid growth factor receptor 0.77 1.83 Antxr1 anthrax toxin receptor 1 0.76 1.83 Stx6 syntaxin 6 0.76 1.60 Vcam1 vascular cell adhesion molecule 1 0.76 7.68 Parp3 poly (ADP-ribose) polymerase family, member 3 0.76 1.54 Cmpk2 cytidine monophosphate kinase 2 0.76 4.17 Tnpo2 transportin 2 0.76 1.91 Cebpb CCAAT/enhancer binding protein (C/EBP), beta 0.75 1.82 Ghr growth hormone receptor 0.75 1.69 Tssc1 tumor suppressing subtransferable candidate 1 0.75 2.03 Fstl1 follistatin-like 1 0.74 1.52 Sae1 SUMO1 activating enzyme subunit 1 0.74 1.59 Nfkb2 nuclear factor of kappa light polypeptide gene 0.73 4.07 enhancer in B-cells 2, p49/p100 Lgals9 lectin, galactose binding, soluble 9 0.73 1.73 Dcun1d1 DCN1, defective in cullin neddylation 1, domain 0.72 1.60 containing 1 Klf6 Kruppel-like factor 6 0.72 1.55 H2-k1 histocompatibility 2, K1, K region 0.71 1.92 Tsc22d1 TSC22 domain family, member 1 0.70 2.01 Smarcb1 SWI/SNF related, matrix associated, actin 0.70 2.04 dependent regulator of chromatin, subfamily b, member 1 Psmb10 proteasome (prosome, macropain) subunit, 0.70 4.01 beta type 10 Fkbp11 FK506 binding protein 11 0.69 1.76 Tap2 transporter 2, ATP-binding cassette, sub-family B 0.69 2.53 (MDR/TAP) Hp haptoglobin 0.68 4.10 Minpp1 multiple inositol polyphosphate histidine 0.68 1.75 phosphatase 1 Sh3tc1 SH3 domain and tetratricopeptide repeats 1 0.67 2.29 Tpm3 tropomyosin 3, gamma 0.67 1.75 Mycbp c-myc binding protein 0.67 1.54 Nadk NAD kinase 0.67 2.08 Lipa lysosomal acid lipase A 0.66 2.11 Hic1 hypermethylated in cancer 1 0.65 1.94 Sh3kbp1 SH3-domain kinase binding protein 1 0.64 1.75 Tradd TNFRSF1A-associated via death domain 0.64 1.53 Arl6ip5 ADP-ribosylation factor-like 6 interacting protein 5 0.64 1.72 Ap3m2 adaptor-related protein complex 3, mu 2 subunit 0.64 1.52 Smpd1 sphingomyelin phosphodiesterase 1, acid lysosomal 0.63 1.86

P4ha1 procollagen-proline, 2-oxoglutarate 4-dioxygenase 0.63 1.61 (proline 4-hydroxylase), alpha 1 polypeptide Pcp2 Purkinje cell protein 2 (L7) 0.62 1.62 Jak3 Janus kinase 3 0.62 1.53 Vasn vasorin 0.62 2.23 Surf6 surfeit gene 6 0.62 2.25 Itpk1 inositol 1,3,4-triphosphate 5/6 kinase 0.61 1.82 Pdgfrb platelet derived growth factor receptor, beta 0.60 1.58 polypeptide Cfb complement factor B 0.58 13.1 Serpine1 serine (or cysteine) proteinase inhibitor, clade E, 0.58 3.10 member 1 Cyth3 cytohesin 3 0.57 1.72 Cdc42ep5 CDC42 effector protein 5 0.57 1.81 Cast calpastatin 0.56 1.56 Tle3 transducin-like enhancer of split 3 0.55 1.71 Tnfaip3 tumor necrosis factor, alpha-induced protein 3 0.55 10.9 Plk2 polo-like kinase 2 0.53 2.63 Naga N-acetyl galactosaminidase, alpha 0.52 1.54 Nedd9 neural precursor cell expressed, developmentally 0.50 1.50 down-regulated gene 9 Nrp1 neuropilin 1 0.49 1.70 Mmp13 matrix metalloproteinase 13 0.48 12.7 Gpr43 G protein-coupled receptor 43 0.48 1.58 Cyr61 cysteine rich protein 61 0.46 3.76 Akap2 A kinase (PRKA) anchor protein 2 0.45 2.14 Mmab methylmalonic aciduria (cobalamin deficiency) type 0.42 1.50 B Ltpb2 latent transforming growth factor beta binding 0.41 2.61 protein 2 Pfkl phosphofructokinase, liver, B-type 0.39 1.81 Tgm2 transglutaminase 2, C polypeptide 0.36 1.59 Maff v-maf musculoaponeurotic fibrosarcoma oncogene 0.25 5.47 family, protein F

Supplementary Figure 1. Mincle mRNA expression in macrophages in the transwell coculture system.

RAW264 macrophages were cocultured with adipose tissue explants prepared from wildtype mice fed a standard diet. Coculture was performed using a transwell insert to examine Mincle and TNFα gene expression in RAW264 macrophages. Cont, control culture; Co, coculture. **P < 0.01, n = 4.

Supplementary Figure 2. Cluster analysis of microarray data of the coculture of 3T3-L1 adipocytes and RAW264 macrophages.

Cluster analysis was performed using microarray data of the contact coculture of 3T3-L1 adipocytes and RAW264 macrophages (Co), the control culture (Cont), and 3T3-L1 adipocytes alone (3T3-L1). Mincle (Clec4e) shows a similar expression pattern with 8 genes: Cd14 (cluster of differentiation 14), Ccl9 (chemokine (C-C motif) ligand 9), Cd68 (cluster of differentiation 68), Spp1 (secreted phosphoprotein 1, osteopontin), Slc15a3, P2r6 (purinergic receptor P2Y, G-protein coupled, 6), Ifi203 (interferon activated gene 203), and Cybb (Cytochrome b-245).

Supplementary Figure 3. M1 and M2 marker mRNA expression in peritoneal macrophages from TLR4 signal-deficient C3H/HeJ mice.

Expression of M1 (CD11c and TNFα) and M2 (Mannose receptor and Ym-1) marker mRNAs in peritoneal macrophages from TLR4 signal-deficient C3H/HeJ (HeJ, filled bars) and control C3H/HeN (HeN, open bars) mice. *P < 0.05, n = 4.