1 2 Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma 3 initiation and maintenance. 4 5 Mannu K. Walia1, Patricia M.W. Ho1, Scott Taylor1, Alvin Ng1,2, Ankita Gupte1, Alistair M. Chalk1,2, 6 Andrew C.W. Zannettino3, T. John Martin1,2,5 & Carl R Walkley1,2,4,5 7 8 1St. Vincent’s Institute of Medical Research, Fitzroy, VIC 3065, Australia. 9 2Department of Medicine, St Vincent’s Hospital, University of Melbourne, Fitzroy, VIC 3065, Australia. 10 3Myeloma Research Laboratory, School of Medicine, Faculty of Health Sciences, University of 11 Adelaide, Adelaide, SA 5005, Australia and Cancer Theme, South Australian Health and Medical 12 Research Institute, Adelaide, SA 5000, Australia. 13 4ACRF Rational Drug Discovery Centre, St. Vincent’s Institute of Medical Research, Fitzroy, VIC 14 3065, Australia. 15 5Co-senior author 16 17 Correspondence address: 18 Carl Walkley or Jack Martin 19 E-mail address: [email protected] ; [email protected] 20 St Vincent’s Institute, 21 Fitzroy, Victoria 3065, 22 Australia 23 24 25 Short Title: p53 loss activates PTHrP-cAMP-CREB1 signalling 26 27
1 28 Abstract
29 Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon
30 which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with
31 intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event
32 in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for
33 osteoblastic cells and OS development are poorly understood. Here we use murine OS models to
34 demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of
35 both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and
36 CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this
37 pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our
38 results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.
39
40
2 41 Introduction
42 Mutations within the P53 pathway occur in all human cancers (1). While the mutation of TP53 itself is
43 a common event, how this contributes to the initiation of cancer is incompletely understood. The most
44 prevalent mutations are point mutations that result in proteins with altered function (2). Extensive
45 analysis of these mutations using mouse models has revealed the pervasive cellular consequences of
46 mutant P53 (3-5). In osteosarcoma (OS), the most common primary tumour of bone, unique genomic
47 rearrangements and other mutation types most often result in null alleles of P53 (6, 7). The reason for
48 this distinct TP53 mutational preference in osteoblastic cells, the lineage of origin of OS, is not
49 understood, nor are the signaling cascades that are altered in p53-deficient osteoblastic cells that
50 facilitate the initiation of OS. Understanding how the loss of P53 modifies osteoblast precursor cells to
51 enable OS initiation will provide new avenues to improve clinical outcomes.
52 OS occurs predominantly in children and teenagers and 5 year survival rates have plateaued
53 at ~70% for patients with localised primary disease and ~20% for patients with metastatic or recurrent
54 disease (8, 9). The advances in the understanding of OS biology and genetics have brought limited
55 patient benefit to date or changes in clinical management. Sequencing of OS using both whole
56 genome and exome approaches identified the universal mutation of TP53 accompanied by recurrent
57 mutation of RB1, ATRX and DLG2 in 29%-53% of cases (6, 7, 10). The OS predisposition of Li-
58 Fraumeni patients and mouse models support the key role of p53 mutation in OS: Trp53+/- and Trp53-
59 /- mice develop OS in addition to other tumors while conditional deletion of Trp53 in the osteoblastic
60 lineage results in full penetrance OS, largely in the absence of other tumor types (11-16). The
61 consequence of p53 loss in osteoblastic cells is only understood to a limited extent. A more complete
62 understanding of the pathways impacted by loss of p53 will be important to understanding the rewiring
63 of osteoblastic cells that underlies OS initiation.
64 Genetic association studies (GWAS) in OS have identified changes in cyclic AMP (cAMP)
65 related processes as predisposing to OS. A GWAS defined two OS susceptibility loci in human: the
66 metabotropic glutamate receptor GRM4 and a region on chromosome 2p25.2 lacking annotated
67 transcripts (17). GRM4 has a role in cAMP generation. A GWAS in dogs with OS identified variants of
68 GRIK4 and RANK (TNFRSF11A), both involved in cAMP pathways (18). Using a murine OS model
69 induced by an osteocalcin promoter-driven SV40T/t, OS were identified that deleted a regulatory
70 subunit of the cAMP-dependent protein kinase (PKA) complex, Prkar1a, or with amplification of
3 71 Prkaca, the PKA catalytic component (19). A recent transposon mediated mutagenesis OS model
72 recovered both activating and inactivating mutations within cAMP related pathways, but no functional
73 analysis was performed (20). Evidence from multiple species implicates enhanced cAMP-PKA activity
74 in OS. Osteoblastic cells are highly sensitive to cAMP levels, and major regulators of the osteoblast
75 lineage such as PTHrP/PTH increase cAMP and activate cAMP-dependent signaling (21). The
76 requirement for these pathways in OS initiation and maintenance has not been tested.
77 Parathyroid hormone (PTH) and PTH-related protein (PTHrP) are key regulators of osteoblast
78 and skeletal homeostasis (22, 23). PTHrP and PTH activate their common receptor, PTHR1 (24, 25).
79 Binding to PTHR1 on osteoblasts or OS cells activates adenylyl cyclase, stimulates cAMP production,
80 followed by PKA activation, leading to many of the transcriptional changes associated with
81 PTH/PTHrP treatment (26-29). In normal osteoblasts PTHrP is produced by osteoblastic lineage cells
82 and acts in a paracrine manner upon other osteoblastic cells at different stages of differentiation (30,
83 31). The long-term administration of PTH(1-34) resulted in a high incidence of OS in rats (32).
84 Elevated expression of PTHR1 is a feature of human and rodent OS (33, 34). PTHrP was expressed
85 in murine OS subtypes (35), placing it as a plausible ligand for activating PTHR1 signaling. It is
86 presently unknown how PTHrP might act in OS. The consequence of PTH/PTHrP signaling via cAMP-
87 PKA is phosphorylation of the cAMP response element binding (CREB1) protein (36). CREB1
88 regulates gene expression through the activation of cAMP-dependent or -independent signal
89 transduction pathways (37).
90 We sought to understand how loss of p53 leads to the initiation of OS. We identified that an
91 early consequence of p53 deletion in osteoblastic cells was increased cAMP levels and the autocrine
92 activation of cAMP signalling via PTHrP. This same signaling node is active in OS and was important
93 in both the initiation and maintenance of OS. The activation of the PTHrP-cAMP-CREB1 axis was
94 required for the hyperproliferative phenotype of Trp53 deficient osteoblasts and the maintenance of
95 established OS, identifying this as a tractable pathway for therapeutic inhibition in OS.
96
4 97 Results
98 cAMP and CREB1 dependent signaling are activated in Trp53 -deficient osteoblasts
99 As inactivating mutations of TP53 are universal in conventional OS, we used this to model an OS
100 initiating lesion (7). Primary osteoblasts were isolated from R26-CreERT2ki/+Trp53+/+ (WT) and R26-
101 CreERT2ki/+Trp53fl/fl (KO) animals and in vitro tamoxifen treatment was used to induce deletion of p53.
102 Over 20 days culture, a loss of expression of p53 target genes in the KO cultures + tamoxifen
103 occurred, compared to both WT and non-tamoxifen treated isogenic R26-CreERT2ki/+Trp53fl/fl cultures
104 (Figure 1A). Given the strong association between osteoblastic differentiation, OS and cAMP
105 signaling, we assessed if pathways were impacted by loss of p53. CREB1 transcriptional target genes
106 were identified from ChIP and ChIP-Chip studies of CREB genomic occupancy (38, 39). Only those
107 targets that associated with CREB1 in response to cAMP activation were considered. Analogously,
108 p53 target genes were defined from a ChIP-seq dataset from human HCT116 cells (40) and further
109 refined against a second independent dataset of p53 ChIP-seq from murine embryonic fibroblasts
110 (38). Strikingly, the expression of CREB1 target genes was increased, inversely paralleling the
111 reduction in p53 target genes (Figure 1A, Figure 1 - figure supplement 1A-B). Similar gene expression
112 results were obtained using shRNA against Trp53 in primary WT osteoblasts, demonstrating that the
113 observed changes did not result from proliferation differences (Figure 1 - figure supplement 1C-E).
114 The altered transcript levels were reflected at the protein level, where loss of p53 was associated with
115 an increase in total CREB1 and phosphorylated CREB1 (pCREB1) in the KO cells (Figure 1B).
116 Interestingly, the KO cultures had increased cAMP levels compared to WT or isogenic controls
117 (Figure 1C). Collectively, these results demonstrate that derepression of cAMP/CREB1 pathways is
118 an early event following Trp53 mutation in osteoblasts.
119 The tamoxifen treated Trp53-KO osteoblasts hyperproliferate after ~15 days (41), coinciding
120 with the loss of p53. Coinciding with the increased proliferation of the p53-deficient cultures was an
121 increase in cAMP per cell and an activation of CREB1 target genes, potentially explained by the
122 increased Pthlh expression (also known as Pthrp, Figure 1A-C). As elevated PTHrP would increase
123 cAMP levels, the involvement of both CREB1 and PTHrP in the p53-deficient response was
124 assessed. Primary osteoblasts from the respective genotypes were infected with two independent
125 shRNAs against either Creb1 or Pthlh then cultured ± tamoxifen. Efficient and stable knockdown of
126 Creb1 and Pthlh mRNA respectively was confirmed in both WT and KO cultures before tamoxifen
5 127 treatment (Figure 1D, Figure 1 - figure supplement 2A-B). The p53-WT cells were largely unaffected
128 by the shRNA’s independent of tamoxifen treatment, except for an initial delayed proliferation in
129 shCreb1 cultures (Figure 1E-F). The control (shLuc) infected KO osteoblasts hyperproliferated
130 following tamoxifen treatment from day 15 onward (Figure 1E-F). In contrast, knockdown of either
131 Creb1 or Pthlh completely prevented the hyperproliferation of the KO + tamoxifen cells (Figure 1E-F,
132 Figure 1 - figure supplement 2C-F). Therefore, intact PTHrP and CREB1 signaling are required for the
133 hyperproliferation of p53 deficient osteoblasts.
134 Finally, to assess the requirements for PTHrP and CREB1 in p53-deficient osteoblasts, we
135 infected cells with the respective shRNAs after they had been cultured for 21 days with tamoxifen,
136 such that the cells had already undergone the hyperproliferative transformation prior to knockdown.
137 The p53-KO osteoblasts underwent apoptosis within 48 hours of knockdown with either shCreb1 or
138 shPthlh whilst the isogenic control (-tam) cultures were minimally affected (Figure 1G-H). The
139 knockdown of PTHrP/CREB1 led to an expected downregulation of PTHrP-CREB1 targets (Figure 1I,
140 Figure 1 - figure supplement 2G-H). The hyperproliferative effect of loss of Trp53 in osteoblastic cells
141 required PTHrP and CREB1.
142
143 Autocrine PTHrP is a primary stimulus of cAMP in OS
144 Having established the necessity of PTHrP and CREB1 for the hyperproliferation and survival of p53-
145 deficient osteoblasts, we sought to understand the contribution of this pathway in OS. We
146 systematically profiled the contribution of PTHrP, cAMP and CREB1 in primary cell cultures derived
147 from murine OS models compared to primary osteoblasts. We made use of the Sp7(Osx)-Cre
148 Trp53fl/flRb1fl/fl model (Cre:lox deletion of Trp53 and Rb1; referred to as fibroblastic OS) which yields a
149 OS characterised by predominant areas of fibroblastic or poorly differentiated/undifferentiated (42)
150 histology and a cell surface phenotype consistent with immature osteoblasts (43, 44). The second
151 model was the Sp7(Osx)-Cre TRE_shp53.1224Rb1fl/fl model (shRNA knockdown of Trp53; referred to
152 as osteoblastic OS) which histologically resemble osteoblastic OS with large mineralized areas,
153 appreciated by von Kossa staining or microCT, and a cell surface phenotype of mature osteoblasts
154 (44). The early passage cells from both models have comparable genetic and pharmacological
155 sensitivities to those of primary human patient derived OS cultures where tested (45, 46). As a control
156 population (referred to herein as “primary osteoblasts”), we isolated osteoblastic cells from the
6 157 collagenase digested long bones of wild-type C57BL/6 mice. These cells are negative for
158 haematopoietic markers (lineage markers, CD45, CD11b, F4/80), negative for the endothelial cell
159 surface marker CD31 and co-express CD51 and Sca-1. The majority of the cells have a cell surface
160 phenotype consistent with pre-osteoblasts (lin-CD45-CD31-CD51+Sca1+) when the cultures are
161 initiated, and when induced to differentiate acquire a mature osteoblast/osteocyte gene expression
162 profile.
163 We first assessed PTHrP given that PTHrP stimulates cAMP generation following activation
164 of PTHR1, ultimately leading to CREB1 phosphorylation and transcriptional activation (Figure 2A).
165 Osteoblastic OS cells expressed high levels of Pthlh transcript (Figure 2B), consistent with our
166 previous data identifying substantial levels of intracellular PTHrP in OS cells (35). As other GPCRs
167 are expressed on OS cells, such as β-adrenergic receptors (Figure 2 - figure supplement 1A), we
168 sought to determine if PTHrP was an OS autocrine ligand. Cells were treated with the
169 phosphodiesterase inhibitor, IBMX, without adding exogenous PTHrP, thus assaying the cAMP
170 induced by autocrine activation of receptor-linked adenylyl cyclase by ligand(s) provided by the OS
171 cells. Treatment with a neutralising anti-PTHrP antibody significantly and substantially reduced cAMP
172 levels (47) (Figure 2C, Figure 2 - figure supplement 1B). Using the shRNAs against Pthlh, a >50%
173 reduction in the cAMP accumulation was observed (Figure 2D-E, Figure 2 - figure supplement 1C).
174 The reduction of cAMP levels by Pthlh knockdown or by antibody mediated PTHrP neutralization are
175 consistent with OS–derived PTHrP as an endogenous ligand promoting cAMP accumulation.
176 Knockdown of Pthlh (Figure 2 - figure supplement 1D) reduced the proliferation (Figure 2 -
177 figure supplement 1E), transcription of known target genes (Figure 2 - figure supplement 1F-G) and
178 the levels of pCREB1, and surprisingly, total CREB1 in OS cells at early time points post infection
179 (Figure 2F). Correspondingly there was a significant reduction in the basal expression of CREB1
180 target genes (Figure 2G). Next, cell survival 48-72 hr after shRNA infection was assessed. Primary
181 osteoblasts were largely unaffected by Pthrp knockdown. In contrast there was a rapid induction of
182 apoptosis following Pthlh knockdown in OS cells (Figure 2H-I). To determine the contribution of
183 elevated PTHrP expression on OS initiation, we retrovirally overexpressed PTHrP in wild-type primary
184 osteoblasts. Surprisingly, the cells overexpressing high levels of PTHrP failed to thrive and a
185 significant proportion underwent cell death indicating that PTHrP overexpression alone is not
186 sufficient to support OS initiation (Figure 2 - figure supplement 2A-C). Two different fibroblastic OS
7 187 lines infected with control (sh-Luc) or sh-Pthlh_A were grafted subcutaneously in vivo and both had
188 significantly reduced proliferation as measured by tumor weight (Figure 2J), comparable to the effects
189 of shPthr1 knockdown in the same OS lines (35). These results demonstrate that PTHrP is a critical,
190 OS cell-derived stimulus of the elevated cAMP in OS.
191
192 Elevated cAMP levels in OS lead to sustained CREB1 activation.
193 We next assessed basal cAMP levels in normal osteoblasts and the two OS subtypes in unstimulated
194 proliferating cultures (with and without phosphodiesterase inhibition but no exogenous ligand
195 treatment). OS cells produced significantly greater amounts of intracellular cAMP compared to
196 primary murine osteoblasts (Figure 3A, Figure 3 - figure supplement 1A). Furthermore, treatment with
197 the direct cAMP agonist forskolin in the presence of IBMX resulted in an increased and sustained
198 accumulation of cAMP in OS compared to primary osteoblasts (Figure 3B). Without IBMX the relative
199 responses to forskolin remained the same, albeit with lower cAMP levels (Figure 3 - figure
200 supplement 1B).
201 Based on the elevated cAMP in OS, we tested the dynamics of CREB1 phosphorylation in
202 serum starved cells to acute elevation of cAMP induced by forskolin. Induction of pCREB1 was rapid
203 in normal osteoblasts, peaking at 30 minutes, then reducing throughout the 120 min time course as
204 expected (Figure 3C-D). In contrast, OS cells displayed continuous and persistent activation of
205 pCREB1, consistent with the cAMP levels (Figure 3C-D). The OS-specific altered dynamics of cAMP
206 and pCREB1 resulted in aberrantly extended transcriptional activation of known CREB1 target genes
207 based on both transcript expression and chromatin occupancy of CREB1/pCREB1 (Figure 3E-F,
208 Figure 3 - figure supplement 1C-D). The requirement for CREB1 in the transcription of these targets in
209 fibroblastic OS was confirmed using siRNA (Figure 3 - figure supplement 1E). Importantly, there was
210 no evidence of compensation for loss of Creb1 by the related Crem1 in either OS subtype (Figure 3 -
211 figure supplement 1F-G) (48).
212
213 OS cells fail to reduce CREB1 activity during maturation.
214 We assessed the levels of pCREB1, the downstream transcriptional effector of cAMP signaling, in
215 proliferating OS cells compared to primary osteoblasts. CREB1 was more prominently phosphorylated
216 in the osteoblastic OS than in either the fibroblastic OS or primary osteoblasts (Figure 3G). qRT-PCR
8 217 using independent OS cultures and primary osteoblasts demonstrated that the mean Creb1
218 expression was 2-3 fold higher in osteoblastic OS compared to fibroblastic OS and primary
219 osteoblasts (Figure 3 - figure supplement 1H). Analysis of RNA-seq from human OS revealed a
220 significant increased in the expression level of Creb1 in OS compared to normal osteoblasts (Figure
221 3H) (20). During culture in differentiation inductive conditions, CREB1 levels reduced over the first 7
222 days in osteoblasts and stayed low for the remainder of the culture (Figure 3I, Figure 3 - figure
223 supplement 2A). In contrast, OS cells maintained CREB1 expression under the same conditions
224 (Figure 3I, Figure 3 - figure supplement 2B). The decrease in CREB1 expression (both transcript and
225 protein levels) upon differentiation was confirmed in primary human osteoblasts (Figure 3 - figure
226 supplement 2C-D).
227 In human OS, somatic SNV mutations in negative regulators of cAMP levels were described,
228 including members of the phosphodiesterases (PDE), A kinase anchoring proteins (AKAP) and
229 protein phosphatases (PP) (7). There was a 2-3 fold decreased expression of several members of
230 these gene families in the murine OS cells compared to primary osteoblasts (Figure 3J, Figure 3 -
231 figure supplement 2E). The reduced expression of PDE, AKAPs and PPs would be expected to favour
232 the accumulation and action of cAMP following GPCR activation.
233
234 Constitutively active cAMP differentially impacts primary osteoblasts and p53-deficient OS
235 As intracellular cAMP increased following p53 deletion in primary osteoblasts, we sought to determine
236 the effect of elevated cAMP levels on normal osteoblast differentiation. Primary osteoblasts were
237 treated with the forskolin and their response compared to that of OS cells (43, 44). Forskolin
238 stimulates cAMP independently from cell surface GPCRs so was used instead of PTHrP, allowing a
239 meaningful comparison of the isolated consequences of elevated cAMP as undifferentiated primary
240 osteoblasts express less PTHR1 compared to the OS cells (44).
241 After 72 hr treatment, primary osteoblasts had altered cell surface phenotypes and reduced
242 expression of Runx2 and Osx (Figure 4A-C) (44). Brief exposure to forskolin (24 hr) yielded the same
243 result (Figure 4 - figure supplement 1A-B). During differentiation, cAMP activation led to decreased
244 expression of differentiation markers and failure to normally mineralise (Figure 4D-E, Figure 4 - figure
245 supplement 1C-D). Therefore continuously elevated cAMP increased features associated with
246 immature osteoblasts. In OS cells, the cell surface phenotypes and expression of Runx2 and Sp7
9 247 were the inverse of primary osteoblasts after 72 hr forskolin treatment (Figure 4F-H, Figure 4 - figure
248 supplement 1E). Under differentiation conditions, forskolin induced less profound changes in the
249 expression of markers of osteoblast maturation, with the exception of Osteocalcin (Figure 4I), and
250 resulted in increased mineralization (Figure 4J, Figure 4 - figure supplement 1D-G). To determine the
251 consequences of CREB1 retention in OS cells, CREB1 was knocked down using both shRNAs
252 (3’UTR, CDS) in fibroblastic OS cells and differentiation evaluated (Figure 4 - figure supplement 1J-L).
253 Both early and late markers of maturation were reduced with sh-Creb1 (Figure 4 - figure supplement
254 1J). Mineralization was significantly reduced in sh-Creb1 expressing cells compared to controls
255 (Figure 4 - figure supplement 1K-L). The level of intracellular cAMP achieved with forskolin treatment
256 is significantly higher that that achieved by cell derived autocrine/paracrine stimuli, such as secreted
257 PTHrP (Figure 4 – figure supplement 2A-C). These levels likely reflect maximal stimulation through
258 the cAMP pathway in these cells which yields a distinct biological effect on primary osteoblastic cells
259 compared to OS derived primary cultures. Therefore continuously elevated cAMP has distinct effects
260 on the behaviour of normal osteoblasts and OS.
261
262 OS subtypes have a differential dependence upon CREB1
263 Reducing PTHrP levels caused apoptosis of OS cells and also reduced levels of CREB1/pCREB1
264 (Figure 2F, Figure 2H-J). To determine if loss of CREB1 impacted OS cell survival similarly we
265 assessed the effects of Creb1 knockdown. In all cohorts there was loss of CREB1 protein (Figure 5A-
266 C). CREB1 knockdown in primary osteoblasts caused reduced proliferation in the first week then the
267 cells recovered and proliferated similarly to control infected cells thereafter, with no apparent effect on
268 survival (Figure 5A). Loss of CREB1 in fibroblastic OS cells resulted in sustained proliferation
269 impairment, yet cell survival was not appreciably impacted (Figure 5B). Knockdown of CREB1 in
270 osteoblastic OS, the most common clinical subtype, caused profound proliferation arrest and
271 apoptosis (Figure 5C). The effect was so complete that we have not been able to establish stable sh-
272 Creb1 expressing cultures from the osteoblastic OS. The phenotype was observed with both sh-
273 Creb1 constructs and in ≥3 independent cultures. Therefore, CREB1 is dispensable for normal
274 osteoblast function yet required for proliferation of fibroblastic OS and survival of osteoblastic OS.
275
276 OS subtypes can be discriminated by CREB1 target gene signatures
10 277 Given the subtype specific effects of CREB1 knockdown, we sought to determine if CREB1 gene
278 signatures could be used to appreciate differences between the subtypes. We modelled our analysis
279 on the evidence that PTHrP was the endogenous ligand leading to cAMP accumulation and CREB1
280 activation. We defined a PTHrP-specific gene signature bioinformatically from previous microarrays
281 comparing PTHrP(1-141) to PTH(1-34) in differentiating osteoblasts (49). The top 45 candidates from
282 the signature were validated. Using proliferating primary osteoblasts, fibroblastic OS and osteoblastic
283 OS cells, 32 of the 45 genes were most highly expressed in the osteoblastic OS (Figure 6A).
284 Archetypal CREB1 target genes were all more highly expressed in osteoblastic OS (Figure 6B, Figure
285 6 - figure supplement 1A-C). Chromatin immunoprecipitation-PCR (ChIP-qPCR) demonstrated
286 enrichment of active pCREB1 and serine 2 phosphorylated RNA polymerase II (pPolII), a mark of
287 active transcription, on CREB1 target genes in osteoblastic OS (Figure 6C, Figure 6 - figure
288 supplement 1D) (50). Promoter binding was generally lower in the fibroblastic OS, consistent with the
289 expression patterns of the target genes. The enhanced binding of CREB1 in osteoblastic OS
290 corresponded to the elevated levels of cAMP and osteoblastic OS is characterised by increased
291 CREB1 activity.
292
293 Somatic SNV mutations in human OS overlap with the cAMP-CREB1 interactome
294 Mutations and oncogenic effects of the cAMP pathway have been described in the context of other
295 tumor types, including breast (51-54) and haematological malignancies (55-59) amongst other
296 tumors. The mutational landscape of OS has been recently defined, identifying 1704 somatic single
297 nucleotide variations (SNV mutations) across 20 cases of sporadic conventional OS (7). To determine
298 if these somatic SNV mutations were functionally related, we assessed pathways enriched within the
299 somatic SNV mutations (Figure 7A). In the top 20 pathways were signatures associated with ion
300 channel complexes, transmembrane transporter complexes, PI3K signaling, calcium channel
301 signaling, and protein kinase A (PKA) activity, all of which are related to cAMP (Figure 7A). Based on
302 this result, we compared the somatic SNV mutations of human OS to the 169 genes comprising the
303 KEGG cAMP interactome. To determine if this was OS specific or a more generalised feature of
304 tumors, we further compared the cAMP interactome with whole genome sequencing that identified
305 SNV mutations of other human cancers (60-64). Genes within the cAMP interactome were most
306 highly enriched within the somatic SNV mutations of human OS (Figure 7B). These data suggest that,
11 307 despite the diverse mutational pattern of somatic SNV mutations in human OS, recurrent and
308 enriched changes in the cAMP and CREB1 pathways occur in OS.
309
12 310 Discussion
311 There remains an incomplete understanding of the cellular rewiring that accompanies the loss or null
312 mutation of TRP53. Although the p53 pathway can be targeted, most interventions aim to activate or
313 restore function of the mutant P53 protein, an approach not feasible in null settings (65), the most
314 common case in OS (7). The identification of critical cellular pathways that are activated/altered in
315 response to TRP53 deficiency may yield novel avenues to test therapeutically.
316 Using the fact that loss/mutation of TRP53 is essentially universal in OS, we modelled an
317 initiating lesion in primary osteoblastic cells and used this to understand the consequences in these
318 cells. Several lines of evidence have implicated the cAMP pathway in OS, yet the functional
319 requirement for this pathway has not been evaluated. We recently demonstrated a role for PTHR1 in
320 OS proliferation and maintenance of the undifferentiated state (35). We therefore sought to determine
321 if these pathways intersected in the p53 deletion dependent initiation and maintenance of OS. There
322 was a co-ordinated increase in Pthlh, cAMP per cell and CREB1 levels and transcriptional activity
323 when osteoblasts became functionally p53-deficient. This was unexpected, as it suggested that a very
324 early event in the initiation of OS following the loss of p53 is the activation of the
325 PTHrPcAMPCREB1 signaling axis. Whilst the detailed processes through which p53 loss
326 activates this pathway is to be resolved, these results demonstrate that this is an essential pathway in
327 the manifestations of the p53-deficient phenotype in osteoblastic cells. Furthermore, we demonstrated
328 that this pathway was also required for the survival of osteoblasts rendered p53-deficient prior to loss
329 of PTHrP or CREB1. Therefore, activation of the PTHrPcAMPCREB1 signaling axis appears to
330 be a core component of the rewiring of osteoblastic lineage cells in response to loss of Trp53 (Figure
331 7C).
332 Our results, together with prior studies implicating cAMP pathways in OS, indicate that
333 elevated cAMP signaling could be considered oncogenic in OS. Forcibly increasing intracellular cAMP
334 in normal osteoblasts retained them in an immature state, consistent with the recent report identifying
335 forskolin as an inducer of pluripotency (66). Analysis of human OS identified somatic SNV mutations
336 in a number of negative regulators of cAMP levels (7). Inactivating mutations in these would be
337 predicted to elevate PKA and CREB1 activity. Khokha and colleagues identified mutations in Prkar1a
338 using a murine model of OS, with a corresponding PRKAR1A low human OS subset defined (19). In
339 the same study, mutually exclusive amplification of the α-subunit of PKA (Prkarca) was also reported.
13 340 Our data reconcile these observations and indicate that the increased PKA-CREB1 activity is
341 ultimately important for this tumor, in that it has evolved mechanisms ensuring elevated and persistent
342 cAMP levels mediated primarily by autocrine production of PTHrP and modulated by reduced
343 expression of negative regulators of cAMP activity. In normal physiology, PTHrP acts in a paracrine
344 manner whilst in OS, as reported here, there is capacity for PTHrP to act in an autocrine and
345 paracrine manner, as well as intracrine activities. Reducing PTHrP levels was tolerated by normal
346 osteoblasts but not OS cultures.
347 While mutations promoting accumulation of cAMP are important, the stimulus of cAMP had
348 not been defined. We demonstrate that PTHrP is a key OS cell-intrinsic inducer of cAMP. PTHrP is
349 required for normal bone homeostasis via its actions upon osteoblastic cells (31). The functions of
350 PTHrP in malignant osteoblast biology, however, have not been resolved. Reducing PTHR1
351 expression on OS cells enhanced differentiation and mineralization in vivo (35). There was a trend to
352 greater levels of PTHrP, notably intracellular, in osteoblastic OS compared to fibroblastic OS (35).
353 These data are consistent with the present measurements of pCREB1 levels in the subtypes and the
354 CREB1 dependence of the osteoblastic OS. We did not previously impact OS in vivo using a
355 neutralizing anti-PTHrP antibody (35). We reconcile the failure to achieve a therapeutic dose of
356 antibody in vivo, with high concentrations of PTHrP likely within the immediate cell environment in OS
357 (35). The reduction in CREB1 levels when PTHrP was reduced was unexpected, raising the
358 possibility to be explored, that PTHrP may contribute to maintenance of CREB1 levels in an
359 analogous manner to the role of JAK2 in preventing proteasomal degradation of CREB1 (67).
360 Coupled with the present data, targeting PTHrP is a candidate therapeutic strategy in OS, although
361 any intracrine contribution of PTHrP needs to be evaluated. The therapeutic targeting of components
362 downstream of PTHrP/PTHR1 signalling may also be feasible, with several recent reports of inhibitors
363 of CREB signalling activity (68, 69), although these are yet to progress to preclinical evaluation.
364 The management of OS has not substantively changed for the last three decades. The
365 identification of the pathways that are utilised during the evolution from osteoblastic lineage cells to
366 OS cells may reveal new means to target this tumour. Recent sequencing and modeling has revealed
367 the genetic complexity and diverse mutational patterns of OS, yet underlying these data is the
368 recurrent and universal inactivation of the P53 pathway (7, 20). The Notch pathway has been
369 implicated in OS and is potentially druggable, however the evidence from human OS is equivocal as
14 370 mutations in this pathway are not common in sporadic OS (70). Recent work from two groups using
371 whole genome screening identified the PI3K/mTOR pathway as a conserved therapeutic vulnerability
372 in OS, demonstrating the power of understanding the biological networks underpinning OS (10, 45).
373 The identification of pathways synthetically lethal with p53-deficiency, or that are required for the
374 maintenance of p53 deficient phenotypes, will yield new means to target these cells. Using this
375 approach we have defined a requirement within the osteoblast lineage for continuous PTHrP and
376 CREB1 activity for the initiation and maintenance of OS, yet normal osteoblasts could tolerate the
377 depletion of both of these factors. A striking feature of the requirement for CREB1 was the differences
378 between OS subtypes. The OS subtypes could be discriminated from normal osteoblasts and each
379 other based on the progressive enrichment of CREB1 gene signatures that reflected their
380 dependence on this pathway for proliferation and survival. These observations raise the largely
381 unexplored possibility that OS subtypes are at some level genetically distinct and have different
382 biological dependences. Collectively, the constitutive activity of the PTHrP-cAMP-CREB1 axis, tightly
383 coupled to loss of p53, represents an essential node in OS that is amenable to therapeutic inhibition
384 at multiple levels.
385
386
15 387 Materials and Methods
388 Study approval
389 All experiments involving animals were approved by the Animal Ethics Committee of St. Vincent’s
390 Hospital, Melbourne. Primary human osteoblasts were isolated from bone marrow aspirates from the
391 posterior iliac crest of de-identified healthy human adult donors with informed consent and consent to
392 publish (IMVS/SA Pathology normal bone marrow donor program RAH#940911a, Adelaide, South
393 Australia).
394
395 Animals
396 Balb/c nu/nu mice (ARC, Perth, WA) were used as recipients for transplant of OS cell lines. For in vivo
397 tumor growth 25,000 (OS80) or 75,000 (OS494H) cells were implanted subcutaneously on the back
398 flank of Balb/c nu/nu recipients (35). Cells were resuspended in extracellular matrix (Cultrex
399 PathClear BME Reduced Growth Factor Basement Membrane Extract). All animals received sh-Luc
400 infected cells on one flank and sh-Pthlh infected cells on the alternate flank.
401
402 OS cell cultures and normal osteoblastic cells
403 Primary mouse OS cell cultures were derived from primary tumors from each of the two mouse
404 models of OS and were maintained and studied for less than 15 passages (43, 44) (all cells used
405 were obtained directly from primary and metastatic tumor material isolated directly from genetically
406 engineered mouse models of OS, no further authentication performed by the authors, mycoplasma
407 negative as tested by PCR based assay by the Victorian Infectious Diseases Reference Laboratory).
408 Normal mouse osteoblastic cells were derived from crushed and collagenase digested long bones of
409 8-wk old C57BL/6 mice. Osteoblastic cell populations were purified either by FACS (FACSAria, BD
410 Biosciences, San Jose, CA) as previously described (71, 72), or directly cultured following
411 collagenase digestion (all primary osteoblasts were isolated directly from mouse long bone, no further
412 authentication performed by the authors, not tested for mycoplasma). All cell cultures were
413 maintained in αMEM (Lonza, Basel, Switzerland) medium supplemented with 10% fetal bovine serum
414 (Sigma, St. Louis, MO, USA; non heat inactivated), 2 mM Glutamax (Life Technologies, Carlsbad, CA,
415 USA), and except in siRNA transfection experiments, 100 U/ml penicillin and streptomycin (Life
416 Technologies) antibiotics. Cells were cultured in a humidified 5% CO2 atmosphere at 37° Celsius.
16 417 Normal human osteoblasts were derived from bone marrow aspirates from the posterior iliac crest of
418 healthy human adult donors (17–35 years of age), with informed consent (IMVS/SA Pathology normal
419 bone marrow donor program RAH#940911a). The cells were outgrown from the bony spicules that
420 were collected following filtration of the BM through a 70 μm filter (73). The human osteoblasts were
421 obtained directly from primary human bone material, no further authentication performed by the
422 authors, not tested for mycoplasma.
423
424 In vitro differentiation of OS cell lines, and primary osteoblasts
425 All cells were seeded at 3000 cells/cm2 on 6-well plates in αMEM with 10% FCS three days prior to
426 differentiation induction. When cells had reached 100% confluence (Day 0), control cells were
427 harvested, and all other cells were replenished 3 times per week with osteoblastic differentiation
428 media: αMEM (Lonza), 10% (v/v) FBS, 25mM HEPES, 1% (v/v) (Gibco), Penicillin-Streptomycin
429 (Gibco), 2 mM GlutaMAX™ (Gibco), 50 μg/ml ascorbate (Sigma), 0.01 M β-glycerophosphate
430 (Sigma).
431
432 cAMP response assays
433 Three independent cell lines from each group were used. 500 and 1000 cells from each group were
434 seeded in triplicates in a 384 well plate. Cells were treated for 1hr +/-100 μM Isobutylmethylxanthine
435 (IBMX) before measuring intracellular cAMP. Intracellular cAMP was measured using the LANCE ultra
436 cAMP kit (Perkin Elmer, AD0262) as directed by the manufacturer. Kinetics of cAMP was
437 demonstrated using 10μM forskolin over a time course of 2 hr. For the agonist treatment experiment
438 1000 cells were seeded as described, then treated +/-100 μM IBMX before adding 10 μM forskolin
439 following a time course of 2 hr. Intracellular cAMP was measured as described above. For shRNA
440 infected cells, 48 hr post infection cells were treated with 100 μM IBMX and assayed for intracellular
441 cAMP by radioimmunoassay as described (35). Where indicated cells were treated with 10 μg/ml anti-
442 PTHrP neutralizing antibody at 37°C for 5 hr (47). To compare cAMP levels between different cells
443 equal number of cells were seeded.
444
445 siRNA knockdown
17 446 Cells were transfected 24 hr after seeding with Dharmacon On-Target Plus siRNA pools (GE
447 Healthcare Life Sciences, 20nM final concentration) complexed with DharmaFECT3 (GE Healthcare
448 Life Sciences) in Opti MEM reduced serum media (Life Technologies). Cells transfected with a non-
449 targeting On-Target Plus control siRNA pool or mock transfected cells served as controls. All assays
450 were carried out in culture medium without antibiotics. Cells were transfected for 72 hr with siRNA
451 pool directed against Creb1 along with the non-targeting control siRNA. After 72 hr incubation with
452 siRNA, the control and the Creb1 knockdown cells were treated with 10 μM of forskolin to assess
453 Creb1 target gene induction.
454 ON-TARGETplus smart pool siRNA-Creb1
455 Target sequence 1:J-040959-12; Target sequence: UUUGUUAACUUCCGAGAAA
456 Target sequence 2:J-040959-11; Target sequence: GCUAUUGGCCUCCGGAAA
457 Target sequence 3:J-040959-10; Target sequence: GCUGAGUAUUAUAGCGUAU
458 Target sequence 4:J-040959-09; Target sequence: GAUAAGAGUAAGUCGAGA
459
460 Plasmids and constructs
461 Two independent lentiviral shRNA plasmids targetting Creb1 (A= 3’UTR; TRCN0000096629; B= CDS;
462 TRCN0000096658) and Pthlh (A= 3’UTR; TRCN0000179093; B= CDS; TRCN0000180583) were
463 purchased from Sigma-Aldrich in the pLKO.1-puro vector. The pLKO.1-puro sh-Luciferase plasmid
464 (Cat No. SHC007) was used as the control for the Sigma shRNA constructs. Lentiviral packaging
465 vector psPax2 (plasmid #12260) was obtained from Addgene (Cambridge, MA, USA), the pCMV-Eco
466 Envelope (Cat No. RV112) vector was purchased from Cell Biolabs (San Diego, CA, USA). Three
467 independent cell lines from each group were infected with shRNA against Creb1, Pthlh or luciferase
468 control. After 48hrs cells were selected with 2μg/ml puromycin.
469 shRNA sequences
470 Pthlh 3’ UTR (TRCN0000179093):
471 CCGGCCAATTATTCCTGTCACTGTTCTCGAGAACAGTGACAGGAATAATTGGTTTTTTG
472 Pthlh CDS (TRCN0000180583):
473 CCGGGATACCTAACTCAGGAAACCACTCGAGTGGTTTCCTGAGTTAGGTATCTTTTTTG
474 Creb1 3’ UTR (TRCN0000096629):
475 CCGGGCCTGAAAGCAACTACAGAATCTCGAGATTCTGTAGTTGCTTTCAGGCTTTTTG
18 476 Creb1 CDS (TRCN0000096631):
477 CCGGCAGCAGCTCATGCAACATCATCTCGAGATGATGTTGCATGAGCTGCTGTTTTTG
478 Luciferase CDS (TRCN0000072259):
479 CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT
480
481 Alizarin staining for mineralization
482 Cells were washed 3 times with PBS and fixed with 70% EtOH. Cells were washed 3 times with water
483 then stained with 0.5% alizarin (w/v) in water for 30 minutes at room temperature. This was followed
484 by 3 washes with water and a 15 minute wash in 1 ml of PBS while shaking. PBS was removed and
485 plates were allowed to dry. Well images were then taken using an EPSON perfection V700 photo
486 scanner. Alizarin dye was eluted overnight in 1 ml of 10% CTP (1-Hexadecylpyridinium chloride, w/v)
487 in PBS with shaking. To construct a standard curve, a 1 mM solution of alizarin was dissolved in PBS
488 aided by sonication, and 2-fold serial dilutions were made beginning from 400 μM. 200 μl of each
489 serial dilution and 200 μl of eluted dye from each well were added separately to duplicate wells in a 96
490 well plate. The absorbance was read at OD562nm using a Polarstar optima+ microplate reader.
491
492 Flow cytometry
493 OS cell lines (less than passage 5 from establishment) were prepared by trypsinization. Antibodies
494 against murine CD45, Mac1, Gr1, F4/80, B220, IgM, CD2, CD3, CD4, CD8, Ter119, Sca1, CD51,
495 PDGFRα (CD140a), CD31, either biotinylated or conjugated with eF450, PE, PerCP-Cy5.5, or APC
496 were obtained from eBioscience (San Diego, CA) or Pharmingen. Biotinylated antibodies were
497 detected with Streptavidin-Qdot605 (Invitrogen). Flow cytometry was performed on an LSRII Fortessa
498 (BD Bioscience) interfaced with CellQuest software, data was analyzed on FlowJo (TreeStar).
499
500 Annexin V staining
501 OS cells (3 independently derived fibroblastic and osteoblastic OS cultures) and primary osteoblasts
502 were infected with 2 independent shRNA against Creb1 and Pthlh. shRNA directed against luciferase
503 (sh-Luc) was used as the control. Cells were infected for 48-72 hr prior to harvesting by trypsinization.
504 Cells were washed then stained in 1x Annexin Binding buffer (eBioscience) diluted 1:20 with Annexin
505 V-APC (1 mg/ml) (eBioscience) and 7-Aminoactinomycin D (7AAD) (100 μg/ml) (Life Technologies)
19 506 for 15 minutes. Following the addition of 4 volumes of 1x Annexin Binding buffer, apoptotic cells were
507 detected and quantified using FACS (LSRFortessa). Live cells (Annexin V negative, 7AAD low) and
508 cells in early and late stages of apoptosis (Annexin V positive, 7AAD low/high) were quantified.
509
510 PTHrP overexpression
511 Murine HA tagged Pthlh cDNA was generated by gene synthesis (Integrated DNA Technologies) and
512 cloned into the retroviral MSCV-IRES-Zeocin. Constructs were sequence verified. Retrovirus was
513 generated by transient transfection of 293T cells (purchased from ATCC, no authentication
514 performed, mycoplasma negative as tested by PCR based assay by the Victorian Infectious Diseases
515 Reference Laboratory) using the EcoPac envelope plasmid as previously described (74). Primary
516 osteoblasts were infected by spin-infection with 8 μg/mL polybrene (Sigma). Levels of PTHrP were
517 assayed by radioimmunoassay using UMR106.01 cells as previously described (75) (derived by TJ
518 Martin, no authentication performed, not mycoplasma tested).
519
520 RNA extraction, cDNA synthesis and Quantitative realtime PCR (QPCR)
521 RNA was extracted using RNA extraction kits with on-column DNase digestion (Qiagen, Limburg,
522 Netherlands; Bioline, London, UK) or TriSure reagent (Bioline). cDNA was synthesised from total RNA
523 using a Tetro cDNA synthesis kit (Bioline) or AffinityScript cDNA synthesis kit (Agilent Technologies,
524 Santa Clara, CA, USA). Gene expression was quantified on a Stratagene Mx3000P QPCR system
525 (Agilent) using Brilliant II SYBR green QPCR master mix (Agilent) with primers specific to genes of
526 interest (Primer sequences in Table S2). Gene expression between samples was normalized to β2m
527 expression. Relative expression was quantified using the comparative CT method (2-(Gene Ct – Normalizer
528 Ct)). Samples were amplified in duplicate.
529
530 Western blotting
531 Protein lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.4, 1% NP-40, 0.5% sodium
532 deoxycholate, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, 50 mM NaF). Protein (10-25 μg) was
533 electrophoresed on 10% Bis Tris or 4-12% Bis-Tris gradient NuPAGE Novex protein gels (Life
534 Technologies) and transferred to PVDF membrane (Merck Millipore, Billerica, MA, USA). Membranes
535 were blocked in 5% skim milk in TBST (20 mM Tris, 150 mM NaCl, 0.1% Tween-20) for 1 hr before
20 536 incubation with primary antibodies diluted in 5% skim milk in TBST overnight a 4°C, or for 1 hr at room
537 temperature in the case of pan-ACTIN. All antibodies (p53 (1C12) Cell Signaling 2524) (Phospho-
538 CREB (Ser133) Cell Signaling Technologies, #9198), Anti-CREB1 ChIP grade (ab31387) were used
539 at 1:2000, except pan actin (Ab-5, Thermo Scientific, Waltham, MA, USA) that was used at 1:3000.
540 Anti-PTHrP antibody (R88) was generated in house against PTHrP(1-15). IgG was extracted from
541 whole serum using Protein G Sepharose 4B fast Flow (GE Healthcare Life Sciences, Cat number 17-
542 0618-01). Protocol for PTHrP western is the same as described for CREB1 except 3% BSA was used
543 for blocking instead of skim milk. Following four washes of 10 min in TBST, membranes were
544 incubated with secondary goat-anti-mouse or goat-anti-rabbit HRP conjugated antibodies (Thermo
545 Scientific, Waltham, MA, USA) diluted 1:10,000 in 5% milk in TBST for 1 hr at room temperature.
546 Following four 10 minute washes with TBST, membranes were exposed to ECL Prime (GE
547 Healthcare Life Sciences, Piscataway, NJ, USA) and exposed to x-ray film to detect the expression
548 levels of proteins.
549
550 Chromatin Immunoprecipitation
551 5x106 cells for each subtype were seeded and allowed to proliferate for 24 hr. An additional counting
552 plate for each subtype was used as cell count control. Primary osteoblasts and OS cells were treated
553 with 10 μM forskolin or 0.1% v/v DMSO for a time course of 2 hours or used in an unstimulated state
554 (PTHrP- or forskolin- free). Adherent cells were fixed with 1% formaldehyde-PBS for 30 mins at room
555 temperature. Cross-linking was quenched by incubating cells with 0.125 M glycine diluted in PBS for
556 10 minutes at room temperature. Following two washes with PBS, cells were scraped and snap
557 frozen as pellets at -80°C until use. Cell pellets were diluted in sonication buffer (1% SDS, 10 mM
558 EDTA, 50 mM Tris-HCl pH 8.1) with protease inhibitors (Roche, Burlington, NC, USA) and the DNA
559 sheared to lengths between 200-800 bp using a UCD-200 Bioruptor (Diagnenode, Denville, NJ, USA)
560 on high at 4°C for a total shearing time of 15 minutes (90 minutes of 10 seconds on and 50 seconds
561 off). Cell debris was cleared by centrifugation at 13,000 rpm for 10 minutes at 4°C and supernatants
562 were diluted 10-fold in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM ETA, 16.7 mM
563 Tris-HCl pH 8.1, 167 mM NaCl) with protease inhibitors. After removing 1% input for the total number
564 of cells of each sample as an input control, samples were incubated with either 2 μg CREB1 antibody
565 (Abcam: (ab31387), 2 μg of phospho-CREB1 antibody (Cell Signaling: 9198), 2 μg of phospho-Pol II
21 566 antibody Abcam: (ab103968) and 2 μg of control rabbit IgG (Merck Millipore), or no antibody overnight
567 at 4°C with rotation. Complexes were collected for 1 hour at 4°C with rotation with 60 μl of protein A
568 sepharose beads (Invitrogen) that had been pre-blocked for 1 hr in 1 mg/ml BSA and 20 μg/ml of
569 yeast tRNA (Sigma Aldrich, R5636). Beads were washed one time each with Low Salt buffer (0.1%
570 SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 150 mM NaCl), High Salt buffer (0.1%
571 SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 500 mM NaCl) and LiCl buffer (0.25 M
572 LiCl, 1% NP40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8.1), followed by two washes with
573 TE buffer. Protein-DNA complexes were eluted from the beads (0.1 M NaHCO3, 1% SDS) at RT for
574 30 min with two rounds of elution. Protein was digested by incubation with 50 μg/mL of proteinase K
575 at 45°C for 1 hr. RNA was digested by incubation with 10 μg/mL RNaseA at 37°C for 30 min. DNA
576 was purified by two extractions with phenol:chloroform:isoamyl alcohol and ethanol precipitation.
577 CREB1, pCREB1 and Pol II bound and input samples were analysed by QPCR using primers that
578 amplified CREB1 target gene promoters or negative control regions (Sequences in Table S3 and for
579 respective ChIP conditions refer to Table S3)
580
581 Bioinformatics and data mining
582 Somatic SNV mutations within human OS and enriched cAMP related functional pathways
583 Somatic SNV mutations derived from WGS of human osteosarcoma was downloaded (76). 1704
584 somatic SNV mutations comprising of insertions and deletions were subjected to pathway analysis.
585 Analysis for functional pathways was performed using Cytoscape v3.1.1 (www.cytoscape.org) (77)
586 (78). Highly enriched pathways within the cAMP signaling were selected based on FDR. cAMP
587 interactome data containing 169 genes within the Kegg pathway were downloaded (entry number:
588 map04024). The data set was overlapped using Biovenn and Venny (BioinfoGP, CNB-CSIC Key:
589 citeulike: 6994833) with SNV mutations derived from WGS of human osteosarcoma. The overlap
590 between the two databases was considered. Please refer to the Table S1 for the gene sets and the
591 overlaps.
592
593 Enrichment of somatic SNV mutations within the cAMP interactome
594 cAMP interactome data containing 169 genes within the Kegg pathway were downloaded (entry
595 number: map04024). Data from the indicated human tumor sets was obtained from the analysed data
22 596 files and compared as total somatic SNV mutations (all) or predicted non silent SNV mutations as
597 indicated. The tumor somatic SNV mutation data sets were overlapped using Biovenn and Venny
598 (BioinfoGP, CNB-CSIC Key: citeulike: 6994833) with the cAMP interactome. Log p values are
599 calculated using the hypergeometric distribution (phyper function in R). The human set size of 39,227
600 is derived using all symbols from HGNC.
601
602 RNA-seq and data analysis
603 RNA-Sequencing (RNA-Seq) was conducted at the Ramaciotti Centre for Genomics (University of
604 New South Wales, Australia) on the Illumina HiSeq 2000 with 100bp paired-end reads. Reads were
605 aligned to the mouse genome build mm9/NCBI37 using Casava 1.7 and Bowtie v0.12.2 mapping
606 software, normalized using Voom linear modeling (79) and transcript abundance measured as reads
607 per kilobase of exon per million mapped reads (RPKM) (80). The datasets are deposited in GEO
608 (accession number GSE58916).
609
610 Statistical Analysis
611 Data were presented as mean ± SEM. Statistical comparisons were performed in Prism 6.0 unless
612 otherwise indicated. Parametric Student’s t-test, area under the curve or 2-way ANOVA with multiple
613 comparison test were used for comparisons with P<0.05 considered as significant; Analysis of the
614 enrichment for somatic SNV mutations within the cAMP interactome in each of the indicated tumor
615 type was defined using hypergeometric distribution test (phyper function in R). P values as indicated
616 in the Figure legend.
617
23 618 Author Contributions:
619 M.W., T.J.M. and C.W. conceived study; M.W., P.H., S.T., A.G., A.N., A.M.C., A.Z., T.J.M performed
620 experiments, analyzed and interpreted data; A.Z. provided samples and reagents; T.J.M and C.W.
621 provided intellectual input and conceptual advice; M.W., T.J.M. and C.W. wrote the manuscript; All
622 authors reviewed and commented on the manuscript.
623
624 Acknowledgements:
625 We thank the SVH BioResources Centre for animal care; S Paton for technical assistance; L Purton
626 and J Heierhorst for comments and discussion; SVI Flow Cytometry Facility (M Thomson) for
627 assistance with FACS analysis; the neutralizing monoclonal antibody against PTHrP was kindly
628 provided by Chugai Pharmaceutical Co., Gotemba, Japan.
629 This work was supported by grants: NHMRC Project Grant APP1084230 (to CW, MW, TJM);
630 Australian Sarcoma Study Group Johanna Sewell Research Grant (to CW, MW); Cancer Council of
631 Victoria APP1047593 (CW); Zig Inge Foundation (CW); NHMRC Career Development Award
632 APP559016 (CW); Victorian Cancer Agency Mid-Career Research Fellowship MCRF15015 (CW);
633 Cancer Therapeutics CRC PhD Scholarship (AN); in part by the Victorian State Government
634 Operational Infrastructure Support Program (to St. Vincent’s Institute); CW was the Phillip Desbrow
635 Senior Research Fellow of the Leukaemia Foundation.
636
637 Conflict of Interest Statement:
638 The authors have declared that no competing interests exist. The funders had no role in study design,
639 data collection and analysis, decision to publish, or preparation of the manuscript.
640
641
24 642 References
643 1. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646-
644 74.
645 2. Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers: origins, consequences,
646 and clinical use. Cold Spring Harb Perspect Biol. 2010;2(1):a001008.
647 3. Bieging KT, Attardi LD. Deconstructing p53 transcriptional networks in tumor suppression.
648 Trends Cell Biol. 2012;22(2):97-106.
649 4. Bieging KT, Mello SS, Attardi LD. Unravelling mechanisms of p53-mediated tumour
650 suppression. Nat Rev Cancer. 2014;14(5):359-70.
651 5. Goh AM, Coffill CR, Lane DP. The role of mutant p53 in human cancer. J Pathol.
652 2011;223(2):116-26.
653 6. Ribi S, Baumhoer D, Lee K, Edison, Teo AS, Madan B, et al. TP53 intron 1 hotspot
654 rearrangements are specific to sporadic osteosarcoma and can cause Li-Fraumeni syndrome.
655 Oncotarget. 2015;6(10):7727-40.
656 7. Chen X, Bahrami A, Pappo A, Easton J, Dalton J, Hedlund E, et al. Recurrent somatic
657 structural variations contribute to tumorigenesis in pediatric osteosarcoma. Cell Rep. 2014;7(1):104-
658 12.
659 8. Janeway KA, Barkauskas DA, Krailo MD, Meyers PA, Schwartz CL, Ebb DH, et al. Outcome
660 for adolescent and young adult patients with osteosarcoma: a report from the Children's Oncology
661 Group. Cancer. 2012;118(18):4597-605.
662 9. Mirabello L, Troisi RJ, Savage SA. International osteosarcoma incidence patterns in children
663 and adolescents, middle ages and elderly persons. Int J Cancer. 2009;125(1):229-34.
664 10. Perry JA, Kiezun A, Tonzi P, Van Allen EM, Carter SL, Baca SC, et al. Complementary
665 genomic approaches highlight the PI3K/mTOR pathway as a common vulnerability in osteosarcoma.
666 Proc Natl Acad Sci U S A. 2014;111(51):E5564-73.
667 11. Mutsaers AJ, Walkley CR. Cells of origin in osteosarcoma: mesenchymal stem cells or
668 osteoblast committed cells? Bone. 2014;62:56-63.
669 12. Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Jr., Butel JS, et al. Mice
670 deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature.
671 1992;356(6366):215-21.
25 672 13. Quist T, Jin H, Zhu JF, Smith-Fry K, Capecchi MR, Jones KB. The impact of osteoblastic
673 differentiation on osteosarcomagenesis in the mouse. Oncogene. 2015;34(32):4278-84.
674 14. Wang X, Kua HY, Hu Y, Guo K, Zeng Q, Wu Q, et al. p53 functions as a negative regulator of
675 osteoblastogenesis, osteoblast-dependent osteoclastogenesis, and bone remodeling. J Cell Biol.
676 2006;172(1):115-25.
677 15. Lengner CJ, Steinman HA, Gagnon J, Smith TW, Henderson JE, Kream BE, et al. Osteoblast
678 differentiation and skeletal development are regulated by Mdm2-p53 signaling. J Cell Biol.
679 2006;172(6):909-21.
680 16. Zhao S, Kurenbekova L, Gao Y, Roos A, Creighton CJ, Rao P, et al. NKD2, a negative
681 regulator of Wnt signaling, suppresses tumor growth and metastasis in osteosarcoma. Oncogene.
682 2015;34(39):5069-79.
683 17. Savage SA, Mirabello L, Wang Z, Gastier-Foster JM, Gorlick R, Khanna C, et al. Genome-
684 wide association study identifies two susceptibility loci for osteosarcoma. Nat Genet. 2013;45(7):799-
685 803.
686 18. Karlsson EK, Sigurdsson S, Ivansson E, Thomas R, Elvers I, Wright J, et al. Genome-wide
687 analyses implicate 33 loci in heritable dog osteosarcoma, including regulatory variants near
688 CDKN2A/B. Genome Biol. 2013;14(12):R132.
689 19. Molyneux SD, Di Grappa MA, Beristain AG, McKee TD, Wai DH, Paderova J, et al. Prkar1a is
690 an osteosarcoma tumor suppressor that defines a molecular subclass in mice. J Clin Invest.
691 2010;120(9):3310-25.
692 20. Moriarity BS, Otto GM, Rahrmann EP, Rathe SK, Wolf NK, Weg MT, et al. A Sleeping Beauty
693 forward genetic screen identifies new genes and pathways driving osteosarcoma development and
694 metastasis. Nat Genet. 2015;47(6):615-24.
695 21. Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E, Richards J, et al. A G protein-
696 linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science.
697 1991;254(5034):1024-6.
698 22. McCauley LK, Martin TJ. Twenty-five years of PTHrP progress: from cancer hormone to
699 multifunctional cytokine. J Bone Miner Res. 2012;27(6):1231-9.
700 23. Martin TJ. Parathyroid hormone-related protein, its regulation of cartilage and bone
701 development and role in treating bone diseases. Physiological Reviews. 2016.
26 702 24. Suva LJ, Winslow GA, Wettenhall RE, Hammonds RG, Moseley JM, Diefenbach-Jagger H, et
703 al. A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and
704 expression. Science. 1987;237(4817):893-6.
705 25. Juppner H, Abou-Samra AB, Uneno S, Gu WX, Potts JT, Jr., Segre GV. The parathyroid
706 hormone-like peptide associated with humoral hypercalcemia of malignancy and parathyroid hormone
707 bind to the same receptor on the plasma membrane of ROS 17/2.8 cells. J Biol Chem.
708 1988;263(18):8557-60.
709 26. Gardella TJ, Juppner H. Molecular properties of the PTH/PTHrP receptor. Trends Endocrinol
710 Metab. 2001;12(5):210-7.
711 27. Pioszak AA, Xu HE. Molecular recognition of parathyroid hormone by its G protein-coupled
712 receptor. Proc Natl Acad Sci U S A. 2008;105(13):5034-9.
713 28. Swarthout JT, Tyson DR, Jefcoat SC, Jr., Partridge NC. Induction of transcriptional activity of
714 the cyclic adenosine monophosphate response element binding protein by parathyroid hormone and
715 epidermal growth factor in osteoblastic cells. J Bone Miner Res. 2002;17(8):1401-7.
716 29. Partridge NC, Kemp BE, Veroni MC, Martin TJ. Activation of adenosine 3',5'-monophosphate-
717 dependent protein kinase in normal and malignant bone cells by parathyroid hormone, prostaglandin
718 E2, and prostacyclin. Endocrinology. 1981;108(1):220-5.
719 30. Martin TJ. Osteoblast-derived PTHrP is a physiological regulator of bone formation. J Clin
720 Invest. 2005;115(9):2322-4.
721 31. Miao D, He B, Jiang Y, Kobayashi T, Soroceanu MA, Zhao J, et al. Osteoblast-derived PTHrP
722 is a potent endogenous bone anabolic agent that modifies the therapeutic efficacy of administered
723 PTH 1-34. J Clin Invest. 2005;115(9):2402-11.
724 32. Vahle JL, Sato M, Long GG, Young JK, Francis PC, Engelhardt JA, et al. Skeletal changes in
725 rats given daily subcutaneous injections of recombinant human parathyroid hormone (1-34) for 2
726 years and relevance to human safety. Toxicologic pathology. 2002;30(3):312-21.
727 33. Martin TJ, Ingleton PM, Underwood JC, Michelangeli VP, Hunt NH, Melick RA. Parathyroid
728 hormone-responsive adenylate cyclase in induced transplantable osteogenic rat sarcoma. Nature.
729 1976;260(5550):436-8.
27 730 34. Yang R, Hoang BH, Kubo T, Kawano H, Chou A, Sowers R, et al. Over-expression of
731 parathyroid hormone Type 1 receptor confers an aggressive phenotype in osteosarcoma. Int J
732 Cancer. 2007;121(5):943-54.
733 35. Ho PW, Goradia A, Russell MR, Chalk AM, Milley KM, Baker EK, et al. Knockdown of PTHR1
734 in osteosarcoma cells decreases invasion and growth and increases tumor differentiation in vivo.
735 Oncogene. 2015;34(22):2922-33.
736 36. Datta NS, Abou-Samra AB. PTH and PTHrP signaling in osteoblasts. Cell Signal.
737 2009;21(8):1245-54.
738 37. Mayr B, Montminy M. Transcriptional regulation by the phosphorylation-dependent factor
739 CREB. Nat Rev Mol Cell Biol. 2001;2(8):599-609.
740 38. Kenzelmann Broz D, Spano Mello S, Bieging KT, Jiang D, Dusek RL, Brady CA, et al. Global
741 genomic profiling reveals an extensive p53-regulated autophagy program contributing to key p53
742 responses. Genes Dev. 2013;27(9):1016-31.
743 39. Ravnskjaer K, Kester H, Liu Y, Zhang X, Lee D, Yates JR, 3rd, et al. Cooperative interactions
744 between CBP and TORC2 confer selectivity to CREB target gene expression. EMBO J.
745 2007;26(12):2880-9.
746 40. Sanchez Y, Segura V, Marin-Bejar O, Athie A, Marchese FP, Gonzalez J, et al. Genome-wide
747 analysis of the human p53 transcriptional network unveils a lncRNA tumour suppressor signature. Nat
748 Commun. 2014;5:5812.
749 41. Ng AJ, Walia MK, Smeets MF, Mutsaers AJ, Sims NA, Purton LE, et al. The DNA helicase
750 Recql4 is required for normal osteoblast expansion and osteosarcoma formation. PLoS Genet.
751 2015;11(4):e1005160.
752 42. Berman SD, Calo E, Landman AS, Danielian PS, Miller ES, West JC, et al. Metastatic
753 osteosarcoma induced by inactivation of Rb and p53 in the osteoblast lineage. Proc Natl Acad Sci U
754 S A. 2008;105(33):11851-6.
755 43. Walkley CR, Qudsi R, Sankaran VG, Perry JA, Gostissa M, Roth SI, et al. Conditional mouse
756 osteosarcoma, dependent on p53 loss and potentiated by loss of Rb, mimics the human disease.
757 Genes Dev. 2008;22(12):1662-76.
28 758 44. Mutsaers AJ, Ng AJ, Baker EK, Russell MR, Chalk AM, Wall M, et al. Modeling distinct
759 osteosarcoma subtypes in vivo using Cre:lox and lineage-restricted transgenic shRNA. Bone.
760 2013;55(1):166-78.
761 45. Gupte A, Baker EK, Wan SS, Stewart E, Loh A, Shelat AA, et al. Systematic Screening
762 Identifies Dual PI3K and mTOR Inhibition as a Conserved Therapeutic Vulnerability in Osteosarcoma.
763 Clin Cancer Res. 2015;21(14):3216-29.
764 46. Baker EK, Taylor S, Gupte A, Sharp PP, Walia M, Walsh NC, et al. BET inhibitors induce
765 apoptosis through a MYC independent mechanism and synergise with CDK inhibitors to kill
766 osteosarcoma cells. Sci Rep. 2015;5:10120.
767 47. Onuma E, Sato K, Saito H, Tsunenari T, Ishii K, Esaki K, et al. Generation of a humanized
768 monoclonal antibody against human parathyroid hormone-related protein and its efficacy against
769 humoral hypercalcemia of malignancy. Anticancer Res. 2004;24(5A):2665-73.
770 48. Mantamadiotis T, Lemberger T, Bleckmann SC, Kern H, Kretz O, Martin Villalba A, et al.
771 Disruption of CREB function in brain leads to neurodegeneration. Nat Genet. 2002;31(1):47-54.
772 49. Allan EH, Hausler KD, Wei T, Gooi JH, Quinn JM, Crimeen-Irwin B, et al. EphrinB2 regulation
773 by PTH and PTHrP revealed by molecular profiling in differentiating osteoblasts. J Bone Miner Res.
774 2008;23(8):1170-81.
775 50. Ho CK, Shuman S. Distinct roles for CTD Ser-2 and Ser-5 phosphorylation in the recruitment
776 and allosteric activation of mammalian mRNA capping enzyme. Mol Cell. 1999;3(3):405-11.
777 51. Kok M, Zwart W, Holm C, Fles R, Hauptmann M, Van't Veer LJ, et al. PKA-induced
778 phosphorylation of ERalpha at serine 305 and high PAK1 levels is associated with sensitivity to
779 tamoxifen in ER-positive breast cancer. Breast Cancer Res Treat. 2011;125(1):1-12.
780 52. Miller WR. Regulatory subunits of PKA and breast cancer. Ann N Y Acad Sci. 2002;968:37-
781 48.
782 53. Beristain AG, Molyneux SD, Joshi PA, Pomroy NC, Di Grappa MA, Chang MC, et al. PKA
783 signaling drives mammary tumorigenesis through Src. Oncogene. 2015;34(9):1160-73.
784 54. Pattabiraman DR, Bierie B, Kober KI, Thiru P, Krall JA, Zill C, et al. Activation of PKA leads to
785 mesenchymal-to-epithelial transition and loss of tumor-initiating ability. Science.
786 2016;351(6277):aad3680.
29 787 55. Pigazzi M, Manara E, Bresolin S, Tregnago C, Beghin A, Baron E, et al. MicroRNA-34b
788 promoter hypermethylation induces CREB overexpression and contributes to myeloid transformation.
789 Haematologica. 2013;98(4):602-10.
790 56. Sandoval S, Kraus C, Cho EC, Cho M, Bies J, Manara E, et al. Sox4 cooperates with CREB
791 in myeloid transformation. Blood. 2012;120(1):155-65.
792 57. Shankar DB, Cheng JC, Kinjo K, Federman N, Moore TB, Gill A, et al. The role of CREB as a
793 proto-oncogene in hematopoiesis and in acute myeloid leukemia. Cancer Cell. 2005;7(4):351-62.
794 58. Smith PG, Wang F, Wilkinson KN, Savage KJ, Klein U, Neuberg DS, et al. The
795 phosphodiesterase PDE4B limits cAMP-associated PI3K/AKT-dependent apoptosis in diffuse large B-
796 cell lymphoma. Blood. 2005;105(1):308-16.
797 59. Mullighan CG, Zhang J, Kasper LH, Lerach S, Payne-Turner D, Phillips LA, et al. CREBBP
798 mutations in relapsed acute lymphoblastic leukaemia. Nature. 2011;471(7337):235-9.
799 60. Ellis MJ, Ding L, Shen D, Luo J, Suman VJ, Wallis JW, et al. Whole-genome analysis informs
800 breast cancer response to aromatase inhibition. Nature. 2012;486(7403):353-60.
801 61. Morin RD, Mungall K, Pleasance E, Mungall AJ, Goya R, Huff RD, et al. Mutational and
802 structural analysis of diffuse large B-cell lymphoma using whole-genome sequencing. Blood.
803 2013;122(7):1256-65.
804 62. Berger MF, Hodis E, Heffernan TP, Deribe YL, Lawrence MS, Protopopov A, et al. Melanoma
805 genome sequencing reveals frequent PREX2 mutations. Nature. 2012;485(7399):502-6.
806 63. Cazier JB, Rao SR, McLean CM, Walker AK, Wright BJ, Jaeger EE, et al. Whole-genome
807 sequencing of bladder cancers reveals somatic CDKN1A mutations and clinicopathological
808 associations with mutation burden. Nat Commun. 2014;5:3756.
809 64. Tirode F, Surdez D, Ma X, Parker M, Le Deley MC, Bahrami A, et al. Genomic Landscape of
810 Ewing Sarcoma Defines an Aggressive Subtype with Co-Association of STAG2 and TP53 Mutations.
811 Cancer Discov. 2014;4(11):1342-53.
812 65. Khoo KH, Verma CS, Lane DP. Drugging the p53 pathway: understanding the route to clinical
813 efficacy. Nat Rev Drug Discov. 2014;13(3):217-36.
814 66. Hou P, Li Y, Zhang X, Liu C, Guan J, Li H, et al. Pluripotent stem cells induced from mouse
815 somatic cells by small-molecule compounds. Science. 2013;341(6146):651-4.
30 816 67. Lefrancois-Martinez AM, Blondet-Trichard A, Binart N, Val P, Chambon C, Sahut-Barnola I, et
817 al. Transcriptional control of adrenal steroidogenesis: novel connection between Janus kinase (JAK) 2
818 protein and protein kinase A (PKA) through stabilization of cAMP response element-binding protein
819 (CREB) transcription factor. J Biol Chem. 2011;286(38):32976-85.
820 68. Mitton B, Hsu K, Dutta R, Tiu BC, Cox N, McLure KG, et al. Small molecule screen for
821 inhibitors of expression from canonical CREB response element-containing promoters. Oncotarget.
822 2016.
823 69. Xie F, Li BX, Kassenbrock A, Xue C, Wang X, Qian DZ, et al. Identification of a Potent
824 Inhibitor of CREB-Mediated Gene Transcription with Efficacious in Vivo Anticancer Activity. J Med
825 Chem. 2015;58(12):5075-87.
826 70. Tao J, Jiang MM, Jiang L, Salvo JS, Zeng HC, Dawson B, et al. Notch activation as a driver of
827 osteogenic sarcoma. Cancer Cell. 2014;26(3):390-401.
828 71. Semerad CL, Christopher MJ, Liu F, Short B, Simmons PJ, Winkler I, et al. G-CSF potently
829 inhibits osteoblast activity and CXCL12 mRNA expression in the bone marrow. Blood.
830 2005;106(9):3020-7.
831 72. Singbrant S, Russell MR, Jovic T, Liddicoat B, Izon DJ, Purton LE, et al. Erythropoietin
832 couples erythropoiesis, B-lymphopoiesis, and bone homeostasis within the bone marrow
833 microenvironment. Blood. 2011;117(21):5631-42.
834 73. Atkins GJ, Bouralexis S, Evdokiou A, Hay S, Labrinidis A, Zannettino AC, et al. Human
835 osteoblasts are resistant to Apo2L/TRAIL-mediated apoptosis. Bone. 2002;31(4):448-56.
836 74. Singbrant S, Wall M, Moody J, Karlsson G, Chalk AM, Liddicoat B, et al. The SKI proto-
837 oncogene enhances the in vivo repopulation of hematopoietic stem cells and causes
838 myeloproliferative disease. Haematologica. 2014;99(4):647-55.
839 75. Partridge NC, Alcorn D, Michelangeli VP, Ryan G, Martin TJ. Morphological and biochemical
840 characterization of four clonal osteogenic sarcoma cell lines of rat origin. Cancer Res.
841 1983;43(9):4308-14.
842 76. Chen X, Bahrami A, Pappo A, Easton J, Dalton J, Hedlund E, et al. Recurrent somatic
843 structural variations contribute to tumorigenesis in pediatric osteosarcoma. Cell Rep. 2014;7(1):104-
844 12.
31 845 77. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software
846 environment for integrated models of biomolecular interaction networks. Genome Res.
847 2003;13(11):2498-504.
848 78. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, et al. A travel guide to
849 Cytoscape plugins. Nat Methods. 2012;9(11):1069-76.
850 79. Law CW, Chen Y, Shi W, Smyth GK. voom: Precision weights unlock linear model analysis
851 tools for RNA-seq read counts. Genome Biol. 2014;15(2):R29.
852 80. Chepelev I, Wei G, Tang Q, Zhao K. Detection of single nucleotide variations in expressed
853 exons of the human genome using RNA-Seq. Nucleic Acids Res. 2009;37(16):e106.
854
32 855 Figure Legends
856 Figure 1. Intact PTHrP and CREB1 are necessary for hyperproliferation of p53-deficient
857 primary osteoblasts. (A) Heat map of qPCR data. Expression of the PTHrP/CREB1 and p53 target
858 genes between indicated cell types. Data from >3 independent cell lines for each, expressed as fold
859 change relative to non-tamoxifen treated isogenic culture. (B) Western blot of p53, pCREB1 and
860 CREB1, β-ACTIN used as a loading control. Data representative of 2-3 independent cell lines from
861 each. (C) Quantification of cAMP levels (+IBMX) in the R26-CreERT2p53+/+ (vehicle and tamoxifen
862 treated) and R26-CreERT2p53fl/fl vehicle and tamoxifen treated (p53Δ/Δ) primary osteoblasts, and day
863 5, 10, 15 and 20 days post tamoxifen. Data from 2 R26-CreERT2p53+/+ and 4 R26-CreERT2p53fl/fl
864 independent cultures; mean ± SEM. (D) Experimental outline for proliferation assay; Western blot of
865 p53, pCREB1 and CREB1 in indicated cell types, β-ACTIN used as a loading control at Day 0 of
866 culture. Proliferation assays performed in the indicated genotype post CREB1 (E) and PTHrP (F)
867 knockdown with tamoxifen treatment commencing at day 0; shLuc = control shRNA; Data from 4
868 independent R26-CreERT2p53fl/fl and 2 R26-CreERT2p53+/+ cultures; mean ± SEM and statistics = area
869 under the curve across the time course. (G) AnnexinV/7-AAD profiles of R26-CreERT2p53fl/fl +/-
870 tamoxifen treatment infected with control (shLuc), shCreb1_A or shPthlh_A. (H) Percent apoptotic
871 cells in each culture +/- tamoxifen. (I) Heat map of qPCR data. Expression of the p53 and
872 PTHrP/CREB1 target genes between cell types; 3 independent cell cultures for each condition. Data
873 expressed as mean ± SEM (n=3). For all panels: *P<0.05, **P<0.01, ***P<0.001. See Figure 1- Figure
874 supplement 1 and Figure 1- Figure supplement 2.
875
33 876 Figure 2. Cell autonomous stimulation of cAMP by PTHrP in OS
877 (A) Cartoon of PTHrP-PTHR1-cAMP-CREB1 axis. (B) qPCR expression of Pthlh normalized to β2m;
878 mean ± SEM (n=3). (C) cAMP levels after anti-PTHrP antibody treatment for fibroblastic OS (light
879 grey) and osteoblastic OS (dark grey). Expressed as normalized mean cAMP ± SEM ((n=3/subtype).
880 (D) Knockdown of Pthlh transcript using 2 independent shRNA (A and B) in indicated OS subtypes.
881 Data normalized to β2m, expressed as mean ± SEM (n=3/subtype). (E) Fold reduction of cAMP levels
882 in sh-Pthlh infected OS subtype cells. IBMX in all treatments, data displayed as normalized mean
883 cAMP ± SEM (n=3/subtype). The data is the mean of 3 independent cell cultures for each subtype. (F)
884 pCREB1/CREB1 protein levels following knockdown of PTHrP. Pan-ACTIN/ATF-1 used as a loading
885 control. Data are representative of 2 independent cell cultures from each OS subtype. (G) Expression
886 of indicated CREB1 target gene transcripts following Pthlh knockdown. Means ± SEM (n=3/subtype).
887 (H) AnnexinV/7-AAD staining of indicated cells following infection with two independent sh-Pthlh (A
888 and B) or sh-Luc control. (I) Quantitation of dead cells in indicated cell type. The data represents 3
889 independent cell cultures for each type, mean ± SEM (n=3). *P<0.05, **P<0.001, ***P<0.0001. (J) In
890 vivo bilateral grafts of independent fibrobastic OS lines OS80 and 494H with control (sh-Luc) on one
891 flank and sh-Pthlh_A on the other flank. Data expressed as mean weight ± SEM (n=3 tumours per
892 shRNA per cell line; performed once); P value as indicated. See Figure 2 - Figure supplement 1 and
893 Figure 2 - Figure supplement 2.
894
895
34 896 Figure 3. Persistent, elevated cAMP production in OS compared to primary osteoblasts. (A)
897 cAMP levels in indicated cells (1000 cells per well) with and without IBMX treatment. Data from 3
898 independent cultures per type, mean ± SEM. (B) Intracellular cAMP levels in indicated cell type
899 following treatment with forskolin; mean ± SEM (n=3 per cell type; 1000 cells per well); statistical
900 significance for OS vs normal Ob; all points of fibroblastic vs osteoblastic OS not significantly
901 different. (C) Western blot and (D) quantification of CREB1/pCREB1 during a time course of cAMP
902 activation by forskolin. Data representative of 2 independent cultures each. (E) Heat map of qPCR
903 data. CREB1 target gene expression in indicated cells; data expressed as relative expression. (F)
904 ChIP analysis of CREB1/pCREB1 on the promoters of indicated genes over a 2 hr time course
905 following stimulation with forskolin. Data is represented as percentage of input. The data from 2
906 independent cell lines for each subtypes mean occupancy ± SEM (n=2-3 assays per line). (G)
907 Western blot of CREB1/pCREB1 expression in proliferating non stimulated cultures, β-ACTIN used as
908 a loading control. Data representative of 3-4 independent cell lines from each type. (H) CREB1
909 transcript expression in human osteoblasts and osteosarcoma (data taken from PMID: 25961939). (I)
910 Western CREB1/pCREB1 expression in indicated cell types under differentiative conditions, ATF-1
911 used as a loading control. (J) Relative expression of negative regulators of cAMP in OS subtypes
912 compared to primary osteoblasts by qPCR and normalized to β2m represented as a heat map
913 (n=3/cell type). *P<0.05, **P<0.001, ***P<0.0001. See Figure 3 - Figure supplement 1 and Figure 3 -
914 Figure supplement 2.
915
916
35 917 Figure 4. Constitutively elevated cAMP differentially affects primary osteoblasts and
918 osteosarcoma cells. (A) Primary osteoblasts treated with DMSO or forskolin for 72 hr and assessed
919 for expression of Sca-1, CD51, PDGFRα , representative results shown, n=3 independent
920 experiments. (B) Quantitation of cell surface markers from each treatment (n=3 independent cultures)
921 (C) Expression of Sp7 (Osterix) and Runx2 by qPCR after 72hrs of forskolin treatment. Expression
922 levels normalized to β2m; mean ± SEM (n=3). (D) Expression level of indicated genes over 21 days of
923 treatment with DMSO or forskolin. Expression normalized to β2m; mean ± SEM (n=3). (E)
924 Mineralisation analysis of primary osteoblasts at day 21 after treatment. Images are representative of
925 3 independent experiments. (F) Fibroblastic OS cells were treated with DMSO or forskolin for 72 hr
926 and assessed for expression of Sca-1, CD51, PDGFRα, representative results shown. (G)
927 Quantitation of cell surface markers from (n=3 independent cultures of fibroblastic OS) from each
928 treatment. (H) Expression of Sp7 (Osterix) and Runx2 in fibroblastic OS by qPCR following 72 hr
929 treatment. Expression levels normalized to β2m; mean ± SEM (n=3). (I) Expression of indicated
930 genes in fibroblastic OS over 21 days from each treatment. Expression normalized to β2m; mean ±
931 SEM (n=3). (J) Representative images of alizarin red stained fibroblastic OS cells treated with DMSO
932 or forskolin for 21 day; n=3 independent OS cultures; *P<0.05, **P<0.001, ***P<0.0001. See Figure 4
933 - Figure supplement 1 and Figure 4 - Figure supplement 2.
934
935
36 936 Figure 5. CREB1 is differentially required for proliferation and survival by OS subtypes. (A)
937 CREB1 in primary osteoblasts 72 hr after infection with indicated shRNA construct. ATF1 was used
938 as a loading control; representative blot from 3 independent cultures; proliferation plotted as mean ±
939 SEM (n=3). (B) Western blot of CREB1 and proliferation kinetics of shCreb1 knockdown and sh-Luc
940 fibroblastic OS; representative blot from 3 independent OS lines; proliferation as mean ± SEM (n=3).
941 (C) Western of CREB1 in osteoblastic OS cells 72 hr after infection; ATF1 = loading control. Viability
942 (annexinV/7AAD) of indicated OS subtype following infection with each shRNA. Data are
943 representative of 3 independent cell lines/type; quantitation of dead cells. Data from 3 independent
944 cell lines/subtypes; mean ± SEM. *P<0.05, **P<0.001, ***P<0.0001
945
946
37 947 Figure 6. CREB1 signatures discriminate OS subtypes. (A) Heat map of qPCR data. Expression
948 of the PTHrP/CREB1 gene set between indicated cell types. Data from 3 independent cultures for
949 each, expressed as fold change relative to primary osteoblasts. (B) Examples of CREB1 target gene
950 expression between the indicated cell types. Expression levels normalized to β2m and depicted as
951 relative expression ± SEM (n=3). (C) ChIP-qPCR for the indicated target genes from proliferating cells
952 (no exogenous ligand/stimulus of cAMP applied) with CREB1, pCREB1 and pPolII. Data represented
953 as fold occupancy relative to Dpp10 promoter, expressed as mean ± SEM. *P<0.05, **P<0.001,
954 ***P<0.0001. See also Figure S6 – Figure supplement 1.
955
956
38 957 Figure 7. A high proportion of the cAMP interactome are somatic SNV mutations in human
958 osteosarcoma. (A) Analysis of functional pathways within the somatic SNV mutations of human OS
959 using Cytoscape. Brown color indicates a cAMP related pathway, blue color indicates non cAMP
960 related pathways. (B) Analysis of the enrichment for somatic SNV mutations within the cAMP
961 interactome in each of the indicated tumor types. Based on somatic SNV mutations identified by
962 whole genome sequencing. P value defined using hypergeometric distribution test. (C) Graphical
963 summary of the differences between primary osteoblasts and OS subtypes regarding cAMP and
964 CREB1 function. See also Figure S7 – Figure supplement 1.
965
966
39 967 Figure Supplement Legends
968 Figure 1 – figure supplement 1. Expression of p53 and PTHrP/CREB1 target genes in R26-
969 CreER p53+/+ and R26-CreER p53fl/fl cultures +/- tamoxifen.
970 (A) Expression of p53 (Mdm2, Cdkn1a1, Atp9a1, Atf3, Bax) and PTHrP/CREB1 (Nr4a1, Nr4a2,
971 Nr4a3, Rgs2, Areg) target genes at the indicated time points +/- tamoxifen in WT (R26-CreER p53+/+)
972 primary osteoblast cultures (n=2 independent cultures). (B) Expression of p53 (Mdm2, Cdkn1a1,
973 Atp9a1, Atf3, Bax) and PTHrP/CREB1 (Nr4a1, Nr4a2, Nr4a3, Rgs2, Areg) target genes at the
974 indicated time points +/- tamoxifen in p53 deficient (R26-CreER p53fl/fl) primary osteoblast cultures
975 (n=4 independent cultures). QPCR data normalized to β2m, for all the experiments above Students t-
976 test was used, *P<0.05. (C) Expression of p53, CREB1, ATF1 and ACTIN after infection with a control
977 (sh-Luc) or p53 targeting shRNA in primary long bone osteoblasts. (D) Expression of p53 (Mdm2,
978 Cdkn1a1, Atp9a1, Atf3, Bax) and PTHrP/CREB1 (Nr4a1, Nr4a2, Nr4a3, Rgs2, Areg) target genes at
979 the indicated time points 48 hr after selection of cells infected with control (sh-Luc) or p53 targeting
980 shRNA (n=3 independent cultures). qPCR data normalized to β2m. (E) Raw data normalized to β2m,
981 for data in panel D; Students t-test was used, *P<0.05..
982
983
40 984 Figure 1 – figure supplement 2. Effects of shRNA against Pthrp and Creb1 in R26-CreER
985 p53+/+ and R26-CreER p53fl/fl cultures +/- tamoxifen.
986 (A) Expression of Pthlh, Creb1 and p53 in WT (R26-CreER p53+/+) primary osteoblast cultures (n=2
987 independent cultures) at Day 0. (B) Expression of Pthlh, Creb1 and p53 in p53 deficient (R26-CreER
988 p53fl/fl) primary osteoblast cultures (n=4 independent cultures) at Day 0 of tamoxifen addition. (C)
989 Expression of CREB1 and p53 at Day 15 and 21 in WT (R26-CreER p53+/+) primary osteoblast
990 cultures (n=2 independent cultures). (D) Genomic PCR for p53 locus at Day 15 and 21 in WT (R26-
991 CreER p53+/+) primary osteoblast cultures (n=2 independent cultures). (E) Expression of CREB1 and
992 pCREB1 at Day 15 and 21 in p53 deficient (R26-CreER p53fl/fl) primary osteoblast cultures (n=4
993 independent cultures). (F) Genomic PCR for p53 locus at Day 15 and 21 in p53 deficient (R26-CreER
994 p53fl/fl) primary osteoblast cultures (n=4 independent cultures). (G) Expression of p53 target genes
995 and (H) PTHrP/CREB1 target genes 72hrs after infection of isogenic p53 deficient (R26-CreER p53fl/fl)
996 +/- tamoxifen primary osteoblast cultures at day 21 post tamoxifen/vehicle addition (n=3 independent
997 cultures). Data expressed as fold change relative to shLuc vehicle control cultures. qPCR data
998 normalized to β2m, for all the experiments above Students t-test was used, *P<0.05, **P<0.001,
999 ***P<0.0001.
1000
1001
41 1002 Figure 2 – figure supplement 1. PTHrP, an endogenous ligand for cAMP signaling in OS.
1003 (A) Average number of reads (TMM normalised, RNA-seq) representing the GPCRs expressed in
1004 fibroblastic and osteoblastic OS. (B) cAMP assays in 3 independent cell cultures within 2 OS
1005 subtypes depicting the effect of PTHrP blockade using anti-PTHrP antibody. (C) cAMP assays in 3
1006 independent cell cultures within 2 OS subtypes post Pthlh knockdown. (D) Western blot showing the
1007 loss of PTHrP protein upon knockdown as compared to control cells (E) Cell proliferation post
1008 knockdown of Pthlh in two fibroblastic OS cultures. (F, G) Expression of genes in fibroblastic OS
1009 cultures (OS80 and 494H) by qPCR and normalized to Hprt. Data expressed as relative expression.
1010
1011
42 1012 Figure 2 – figure supplement 2. PTHrP overexpression alone does not initiate OS.
1013 (A) Quantification of PTHrP levels in the media of primary osteoblasts infected with control retrovirus
1014 (MSCV_Control; empty vector) or PTHrP expressing retrovirus (MSCV_PTHrP). Media from infected
1015 cells was applied to UMR106.01 cells and cAMP levels measured by radioimmunoassay. (B)
1016 Representative AnnexinV/7-AAD staining profiles of primary osteoblasts following infection with
1017 control or PTHrP overexpressing retrovirus. (C) Quantitation of cell death from AnnexinV/7-AAD
1018 staining following infection with control or PTHrP overexpressing retrovirus. Data expressed as mean
1019 ± SEM, Students t-test was used, *P<0.05, **P<0.001, ***P<0.0001.
1020
1021
43 1022 Figure 3 – figure supplement 1. cAMP is constitutive in mouse OS leading to continuous
1023 phosphorylation of CREB1
1024 (A) Quantification of cAMP in primary osteoblasts, and OS with and without IBMX treatment (500
1025 cells/well). Data represents 3 independent cell cultures for each type, mean ± SEM. (B) Kinetics of
1026 cAMP accumulation in OS subtypes as compared to primary osteoblasts in the absence of IBMX
1027 treated with 10 μM forskolin (using 500 cells/well). (C-D) qPCR validation of CREB1 target gene
1028 expression following 10 μM forskolin treatment over a time course of 2 hours. The data represents 3
1029 independent cell cultures for each subtype ± SEM (n=3). (E) Expression of CREB1 target genes post
1030 knockdown of Creb1 using siRNA by qPCR and normalized to β2m. Means ± SEM (n=3). The data
1031 represents 3 independent cell lines for each subtype ± SEM (n=3). Effect of Creb1 knockdown on
1032 Crem1 expression in fibroblastic OS (F) and osteoblastic OS (G), respectively. Expression of Crem1
1033 by qPCR and normalized to β2m. Means ± SEM (n=3). (H) Expression of Creb1 in primary
1034 osteoblasts compared to each OS subtype by qPCR and normalized to β2m. Means± SEM (n=3). For
1035 all the experiments above Students t-test was used to assess statistical significance, *P<0.05, **P
1036 <0.001, ***P <0.0001
1037
1038
44 1039 Figure 3 – figure supplement 2. Altered Creb1 dynamics in osteoblasts and OS.
1040 (A) Expression of Creb1 during in vitro differentiation of primary osteoblasts, data expressed as mean
1041 ± SEM (n=3). (B) Expression of Creb1 during in vitro differentiation of fibroblastic OS, data expressed
1042 as mean ± SEM (n=3). (C) Expression of CREB1 protein during in vitro differentiation of primary
1043 human osteoblasts isolated from normal healthy donors (17-35 year old). (D) Expression of CREB1
1044 transcript during in vitro differentiation of primary human osteoblasts and markers of osteoblast
1045 differentiation state as indicated, data expressed as normalized gene expression compared to
1046 β2microglobulin expression; graphed as mean ± SEM (n=5 independent donor samples). (E)
1047 Expression of negative regulators of cAMP in OS subtypes compared to primary osteoblasts by qPCR
1048 and normalized to β2m (n=3/cell type). *P<0.05, **P <0.001, ***P <0.0001.
1049
1050
45 1051 Figure 4 – figure supplement 1. cAMP has different effects in OS and primary osteoblasts.
1052 (A, B) Expression of Runx2 and Osterix by qPCR and normalized to β2m; means ± SEM (n=3). (C,
1053 D) Quantitation of elution of Alizarin red stain from primary osteoblasts and fibroblastic OS cells
1054 treated with DMSO or 10 μM forskolin for 21 days. The data is representative of 3 independent
1055 experiments with each. (E) Cell surface profiling for Sca-1 and CD51 (αV Integrin), PDGFRα on
1056 osteoblastic OS cells (F) Quantitation of Sca-1/CD51, Sca-1/PDGFRα and
1057 CD51/PDGFRα populations in osteoblastic OS (n>3) with (blue bars) and without (black bars)
1058 forskolin treatment. (G) Mineralisation assay showing alizarin red staining of osteoblastic OS cells. (H)
1059 Quantitation of elution of Alizarin red staining of osteoblastic OS cells treated with DMSO or 10 μM
1060 forskolin for 21 days. The data is representation of 3 independent experiments. (I) Representative
1061 western blot for CREB1 following infection with 2 independent shRNA or control shRNA (shLuc). (J)
1062 Gene expression analysis of fibroblastic OS infected with the indicated shRNA and placed in
1063 differentiating conditions for the indicated periods of time. qPCR data normalized to β2m (n=3/cell
1064 type). (K-L) Representative alizarin stained wells and quantitation of alizarin elution from day 21
1065 cultures in differentiating conditions with fibroblastic OS. For all the experiments above Students t-test
1066 was used, *P<0.05, **P<0.001, ***P<0.0001.
1067
1068
46 1069 Figure 4 – figure supplement 2. Level of cAMP in primary osteoblasts and osteosarcoma cells
1070 +/- forskolin.
1071 (A) Intracellular cAMP levels in primary osteoblasts and fibroblastic OS cells at day 0 and day 21 of
1072 culture in differentiation inductive conditions with no exogenous agonist added (IBMX treated only);
1073 data expressed as cAMP level (pmol) per μg protein; graphed as mean ± SEM (n=3). (B) Intracellular
1074 cAMP levels in primary osteoblasts and fibroblastic OS cells at day 21 of culture in differentiation
1075 inductive conditions with forskolin (continuously present in the culture); data expressed as cAMP level
1076 (pmol) per μg protein; graphed as mean ± SEM (n=3). (C) Intracellular cAMP levels in primary
1077 osteoblasts and fibroblastic OS cells at day 21 of culture in differentiation inductive conditions with
1078 acute forskolin treatment at day 21 (20 minute exposure to forskolin only); data expressed as cAMP
1079 level (pmol) per μg protein; graphed as mean ± SEM (n=3).
1080
47 1081 Figure 6 – figure supplement 1. CREB1 defines OS subtypes by driving specific gene
1082 signatures.
1083 (A, B. C) Expression of Creb1 signatures (upregulated, downregulated and unchanged) were
1084 assessed in mouse OS subtypes compared to primary osteoblast cells by qPCR. Expression
1085 normalized to β2m respectively. Data represents average relative expression ± SEM (n≥3). (D) ChIP
1086 experiments depicting the binding of CREB1, pCREB1 and Pol II on CREB1 target genes. Enriched
1087 DNA by ChIP was amplified using primers against the promoters of mentioned targets. Data is
1088 represented as fold occupancy calculated with respect to binding over a cold promoter DPP10.
1089
1090
48 1091 Figure 7 – figure supplement 1. Analysis of cAMP and cGMP pathway enrichment of somatic
1092 SNV tumor mutations.
1093 Table comparing the enrichment of somatic SNV tumor mutations within OS, Ewings and Breast
1094 cancer in the cAMP pathway, cGMP pathway and those unique to the cAMP and cGMP pathway
1095 respectively.
1096
49 1097 Supplemental Information contains 3 tables
1098 Table S1: Genes within the cAMP interactome that overlap with SNV mutations within human OS
1099 Table S2: Oligonucleotide sequences used in RT-PCR
1100 Table S3: Primers for promoter regions for ChIP and antibody conditions
1101
1102 1103 1104
50 1105 Table S1: Genes within the cAMP interactome that overlap with SNV mutations within human OS 1106 cAMP int. cAMP int. cAMP int. cAMP int. Overlap(SNVs) 1107 ABCC4 CREB5 MAP2K1 ROCK1 ADCY1 1108 ACOX1 CREBBP MAP2K2 ROCK2 ADRA1A 1109 ACOX3 DRD1 MAPK1 RRAS ADRA2B 1110 ADCY10 DRD5 MC2R RRAS2 AKAP1
1111 ADCY2 EDNRA MEK1 SLC9A1 AKAP3 1112 ADCY3 EP300 MEK2 SOX9 AKAP5 1113 ADCY4 EPAC2 MYL9 SSTR1 AKAP6 1114 ADCY5 FFAR2 NFAT2 SSTR2 ANXA1 1115 ADCY6 FOS NFATC SUCNR1 ATP1A1 1116 ADCY7 FSH NFATC1 TIAM1 ATP2B1 1117 ADCY8 FSHR NFKB1 TNNI3 CACNA1D 1118 ADCY9 FXYD1 NFKBIA TSHR CACNA1F 1119 ADCYAP1R1 FXYD2 NPY VAV CACNA1S 1120 ADORA1 GABBR NPY1R CFTR 1121 ADORA2A GHRL NR1C1 DRD2 1122 AF6 GHSR ORAI1 F2R 1123 AKAP2 GLI1 OXTR GIPR 1124 AKT GLI3 PACAPRI GNAI3 1125 AMH GLP1R PAK1 GRIA2 ANPRA GNAS PKA GRIN2A 1126 ARAP3 GPR109 PLCE GRIN2B 1127 BAD GPR119 PLD1 GRIN3A 1128 BDNF GPR81 PLN HCN4 1129 BRAF GRIA1 PPP1C PDE10A 1130 CACNA1C GRIA3 PPP1R12A PDE2A 1131 CALM GRIA4 PPP1R1B PDE4B 1132 CAMK2 GRIN1 PTCH1 PDE4D 1133 CAMK4 GRIN2C PTGER2 PDE6B
1134 CHRM1 GRIN2D RAC1 PIK3C2B 1135 CHRM2 GRIN3B RAC2 PIK3CG 1136 c-Jun HCN2 RAC3 PIK3R4 1137 CNGA1 HHIP RAF1 PIK3R6 1138 CNGA2 HTR1 RAP1A PPP2R2B 1139 CNGA3 HTR4 RAP1B PPP2R3A 1140 CNGA4 HTR6 RAPGEF3 PRKCA 1141 CNGB1 JNK RAPGEF4 PRKCB 1142 CNGB3 JUN RELA PTGER3 1143 CREB1 KAT3 RHOA RYR2 1144 CREB3 LIPE VIPR2 SSTR5 1145
51 1146 Table S2: Oligonucleotide sequences used in RT-PCR 1147 Gene Forward Primer Reverse Primer Kcne4 GTTATGTCCTTCTATGGCGTTTTC ATCATAGGTAGCGGCTTCATAGC Il6 AACAAGAAAGACAAAGCCAGAGTC CTCCAGCTTATCTGTTAGGAGAGC Cxcl1 TCATAGCCACACTCAAGAATGGT TTTGGACAATTTTCTGAACCAAG Dusp1 TCACGCTTCTCGGAAGGATA TGATGTCTGCCTTGTGGTTG Nfil3 GAGAAGAAAGACGCCATGTATTG AGCTCAGCTTTTAAAGTGGCATT Usp2 CTGAAGCGCTATACAGAATCGTC AAACCAAGTTTTTCCTTCTCCAG Gem TGGGAGAAGATACATATGAGCGTA GAGTAGACGATCAGATAGGCATCC Foxc2 GCCAGAGAAGAAGATCACTCTGA CACTTTCACGAAGCACTCATTG Efnb2 GGGGTCTAGAATTTCAGAAGAACA ATCTTGTCCAACTTTCATGAGGAT Btg2 GCTGTATCCGTATCAACCACAAG GATGCGGTAAGACACTTCATAGG Ddit4 TTTCAGTTGACCCTGGTGCT GATGACTCTGAAGCCGGTACTTAG Lif ACCTTGAGAAAATCTACCGAGAAGT AAAAATTTCTCCATTTTTGGCATA Plaur ACAGAGCACTGTATTGAAGTGGTG GAAAGGTCTGGTTGCTATGGAA Nrp1 TACCCTCATTCTTACCATCCAAGT CCACGTAGTCATACTTGCAGTCTC Nfkbiz TAAACATCAAGAATGAGTGCAACC GTTGGTATTTCTGAGGTGGAGAGA Ifngr1 GTGGGGAGATCCTACATACGAA CTTGCCAGAAAGATGAGATTCC Rnf122 GTCTTCATGCTTAGCCTCATCTTC CAGGTCCCATAGAGCTGTAACTTC Ugdh CCTTCCTATTTATGAGCCTGGATT CCATATGTTTTTGTTGGTGTGTTC Osbpl9 GTGTTAGCTACCTTGGGACATCAT AGAACTCTGGGACTGTATTTGGAG Ier3 AATTTTCACCTTCGACCCTCTC TTGGCAATGTTGGGTTCC Cebpd TCCTGCCATGTACGACGAC TGTGGTTGCTGTTGAAGAGGT Vegfa GAAACCATGAACTTTCTGCTCTCT ACTTGATCACTTCATGGGACTTCT Sox9 AGAAGGAGAGCGAGGAAGATAAGT CTTGACGTGTGGCTTGTTCTT Fos GCTATCTCCTGAAGAGGAAGAGAAA AACGCAGACTTCTCATCTTCAAGT Nr4a3 GGTGCAGAAAAATGCAAAATATG CTGTCTGTACGCACAACTTCCTTA Dusp1 TCACGCTTCTCGGAAGGATA TGATGTCTGCCTTGTGGTTG Sik2 ACCTTGAGAAAATCTACCGAGAAGT AAAAATTTCTCCATTTTTGGCATA Junb CATCAACATGGAAGACCAGGA GTTCTCAGCCTTGAGTGTCTTCA Gtpbp10 CCAAGTGCTAGGAGAACTCAATAAA GCTATGACTTTTAGGTCAAGGTGAA Adamts1 GACCAGGAAGCATAAGGAAGAAG CGAGAACAGGGTTAGAAGGTAATG Bmp8a CTGAGTTCCGGATCTACAAAGAAC AGCGTCTGAAGATCCAAAAAGA Lst1 ACAACCAATGATTTCCTGCTAAAT AGATGAACAGGATGATGACAAGC Dlec1 TCTAGACAGCAAGTTAATGCGAAA ACAGCTAAACGTCAGCTTTGAAC Tnfrsf12a GCTGGTTTCTAGTTTCCTGGTCT GTCTCCTCTATGGGGGTAGTAAACTT Golga3 AAAAAGAACTCCAAATCAAGCAAG CCTCAGACACAACTGAAGTGCTAC Tcf7 TTTCTCCACTCTACGAACATTTCA CCTGAGGTCAGAGAATAAAATCCA Aqp3 ATCAACTTGGCTTTTGGCTTC GCATAGATGGGCAGCTTGAT Hmg20b CTTTGTAGTGGCTGTCAAGCAG CATTTGGGAGAATCTTCTTTCTTTT
52 Tex264 GTCTACTATGACAACCCCCATACG GAAGGAGAATATCTTGAAGCCAAA Creb1 CAAGTCCAAACAGTTCAGATTTCA TGGTGCATCAGAAGATAAGTCATT
Id1 GGTGAACGTCCTGCTCTACG AGACTCCGAGTTCAGCTCCA
Dsip1 GGTGAACGTCCTGCTCTACG AGACTCCGAGTTCAGCTCCA
Rgs2 GTCCTCAAAAGCAAGGAAAATCTA CATCAAACTGTACACCCTCTTCTG
Nr4a1 CTCCTCCACGTCTTCTTCCTC CAGGGACTGCCATAGTACTCAGA
Areg CACAGGGGACTACGACTACTCAG TCTTCCTTTTGGGTTTTTCTGTAG
Nr4a2 ACTGAAATTACTGCCACCACTTCT TGTGCATCTGAATGTCTTCTACCT
Pepck AGTGAGGAAGTTCGTGGAAGG GCCAACAGTTGTCATATTTCTTCA
Bnip3l GTCTCTAAGCATGAGGAAGAGTGG AGAAGGTGTGCTCAGTCGTTTT 1148 1149
53 1150 1151 Table S3: Primers for promoter regions for ChIP and antibody conditions 1152 Gene promoter Forward primer Reverse primer Nr4a2 CTGCCAACATGCACCTAAAGT CTTAAAATCAGCCCCAGTCGT Nr4a1 TTCTGTTTCTAGGGACAGTGCAT ACCCTACTCCAAGAGCTATCCTTT Cga CTCTTCATAAGCTGTCCTTGAGGT GGTAAATTCTACCCAGTGATTGGA Areg TGATAACTAAGGAAACTGAGGTCCA TTTGGAGAGGGAAAAATAAAATCA Dpp10 AAGATCAGGGACTGTGGTACTGA GGAATAGTGCATGTTTCCTTCTG Cebpd CACGGTTCACTAGTTCTGGTCTC CTGGAGCGAAATGAAAATCTG Ifgnr1 CTATGGTTTCCAGGAGCTTCAGT AACTTCAGTTTGAACATGCACCT Rnf22 CTATGGTTTCCAGGAGCTTCAGT AACTTCAGTTTGAACATGCACCT Gem AAGCCCTTTTTGTACAAGTGTGA GAGTGGGACAGTTTCTGTTTGAG Foxc2 TTATCCATCACTGCATTCAACAG AGTAGGAAAGAGCCTGGAGATTTT Fos GGTGCATACAGGAAGACATAAGC GCAAAAGTCCTGAAACAAAACAA Jun AGCAAAGATTAGCAAAGGGAAAG CCAACTTTGAATCTGACAACTCC Sox9 AGCAAAGATTAGCAAAGGGAAAG CCAACTTTGAATCTGACAACTCC Vegfa 1 GGGTGATGATAACAACAATTTGG GAATATGGGCACAACAATTCAGT Vegfa 2 ATTTGAGGGAGTGAAGAACCAAC AGTCTGTGCTCTGGGATTTGATA Aqp3 AGTCAAGGGTCATAGCTCCAGAT TGGACCCAGAAGTGAGTTTCTAA Plaur CCTCAAAGGCTTTCTGTAGGAAT AGGGGAAAAACAAGTTGAAAGAG Tnfrs12a GTTGTGTCTGCCCCTCAAGT TTGCCCTATCTCTGGGTCTG Il6 TCCTTTCCTGTCTGGAAGATACA GGCAAAGAGATAAGGAAAAAGGA 1153 Ab directed against Cell number per ChIP Amount Origin of Ab
Creb1 6x106 2μg Abcam (ab31387)
Phospho-Creb1 6x106 2μg Cell Signaling (#9198)
Pol II (phospho-S2) 2x106 2μg Abcam (ab103968) 1154 1155 1156
54 Figure 1Walia etal D A Tamoxifen Isolate Ob Cdkn1a1 Cdkn1a1 GHI
T2 f/f T2 fl/fl Mdm2 Mdm2 Nr4a2 Nr4a2 Nr4a3 Nr4a3 Nr4a1 Nr4a1 Atp9a Atp9a Pthr1 Pthlh
R26CreER Trp53 R26CreER p53 Rgs2 Rgs2 Areg Areg 0 Atf3 Atf3 Bax Bax Day 7AAD
Annexin V 7AAD Annexin V T2 fl/fl T2 R26CreER Trp53 R26CreER WT 5-7 days -+ hu B A shLuc 5 shLuc (shRNA) Day 0 Tamoxifen added Infect Fold changecomparedto- Tamoxifen control + Tam Vehicle (2 days) select Puro . . 2.5 1.0 0.0 -+ sh Day 0 10 Creb1 Cell proliferation sh Creb1 -+ 15 CREB1 p53 CREB1 p53 ATF1 ATF1 ACTIN ACTIN + Tam Vehicle _A -+ 20 sh EF
Pthlh Cell Number (x105) Cell Number (x105) Cell Number (x105) 1.0 2.0 3.0 1.0 2.0 3.0 1.0 2.0 3.0
0 0 0
p53 targets p53 p53 targets p53 CREB1 targets CREB1 _A targets CREB1
061218 061218 218 12 6 0
+ Tam Vehicle R26 R26
Trp53 CreER R26 WT CreER R26
fl/fl T2 sh sh T2 shLuc + Tam shLuc - Tam sh sh CreER CreER Creb1 Creb1 Creb1 Creb1 asDays Days sh sh sh sh sh sh sh sh B Creb1 Creb1 Creb1 Creb1 Pthlh Pthlh Pthlh Pthlh _B + Tam _B - Tam T2 _A + Tam _A - Tam sh sh +-+ -+ WT Luc Luc -B (+) -A (+) -B (+) -A (+) -B (-) -A (-) -B (-) -A (-) (-) (+) 0 R26 218 12 6 0 061218 061218 CreER 020 10 %Apoptosis T2 Trp53 ** * *
fl/fl
CREB1 pCREB1 p53 Tamoxifen ACTIN ATF1
**** ****
**** **** 30 Cell Number (x105) Cell Number (x105) Cell Number (x105) 1.0 2.0 3.0 1.0 2.0 3.0 1.0 2.0 3.0 0 0 Tamoxifen Tx Vehicle Tx 0 R26 061218 061218 061218
cAMP pmol/+g protein C
shLuc 0.0 0.1 0.2 0.3 0.4 sh sh sh sh shLuc + Tam shLuc - Tam CreER Pthlh Pthlh Pthlh Pthlh asDays Days ..ND ..ND N.D. N.D. N.D. N.D. N.D. R26 01 051 520 15 10 5 20 15 10 5 sh + Tam no Tam CreER _B - Tam _B + Tam Pthlh _A + Tam _A - Tam T2 asDays Days _A WT sh N.D. =notdetected
Pthlh T2 WT _B
sh R26 Creb1 061218 061218 061218
CreER cAMP pmol/+g protein sh _A 0.0 0.1 0.2 0.3 0.4
Creb1 R26 Rgs2 Nr4a3 Nr4a2 Nr4a1 Bax Cdkn1a1 Mdm2 Pthlh Creb1 Rgs2 Nr4a3 Nr4a2 Nr4a1 Bax Cdkn1a1 Mdm2 Pthlh Creb1 Areg Atf3 Atp9a Areg Atf3 Atp9a CreER _B T2 + Tam no Tam Trp53
** ** *
T2
p53 targets p53 targets p53 CREB1 targets CREB1 CREB1 targets CREB1 fl/fl *
Trp53 *** fl/fl Figure 2 Walia et al
ABC PTHrP
Adenylyl Cyclase *** 1.5 Cell Surface 0.0008 *** PTHR1R1 G a Cytoplasm G _ s G _ ** * s G s s` cAMP
2m)
` 0.0006 ATP 1.0
0.0004
PKA PKA ns 0.5
Inactive expression (/ 0.0002 PKA PKA Fold reduction in cAMP Fold reduction in cAMP Active
Pthlh 0.0 PKA PKA 0.0000 ++++IBMX P Primary Ob Fibroblastic Osteoblastic CREB Activate Target Genes ++_-PTHrP Nucleus OS OS
DEF sh-Pthlh_A = 3’UTR; sh-Pthlh_B = CDS *** 1.5 0.000015 *** Fibroblastic OS Osteoblastic OS * *** 494H 716H 98sc 98I 2m) ** *** ` ** 1.0 0.000010 ** pCREB1
CREB1 ATF1 0.000005 0.5 expression (/ ACTIN sh-Luc sh-Luc sh-Luc sh-Luc Fold reduction in cAMP Fold reduction in cAMP Pthlh AB AB AB AB 0.000000 0.0 sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh Fibroblastic OS Osteoblastic OS Fibroblastic OS Osteoblastic OS G
Nr4a2 Nr4a1 Rgs2 Areg ** 0.006 *** 0.006 ** 0.004 ** 0.00020 ** *** * ** ** ** ** ** 0.003 ** 0.00015 ** 0.004 0.004 ** ** 0.002 0.00010
0.002 0.002 0.001 0.00005
Normalized expression 0.000 0.000 0.000 0.0 sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Luc A B sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh sh-Pthlh Fibroblastic OS Osteoblastic OS Fibroblastic OS Osteoblastic OS Fibroblastic OS Osteoblastic OS Fibroblastic OS Osteoblastic OS
HIJ % Dead cells (AnnexinV/7AAD) OS80 (Fibroblastic OS) sh-Luc sh-Pthlh_A sh-Pthlh_B 1 0 20 40 60 80 100 7AAD rmr bOsteoblastic OS Primary Ob Annexin V sh-Luc *** *
ns 0.1 sh-Pthlh_A Primary Ob
sh-Pthlh_B P=0.043 Tumor Weight (grams) Weight Tumor 0.01 Fibroblastic OS sh-Luc A sh-Luc sh-Pthlh *** *** sh-Pthlh_A 494H (Fibroblastic OS)
Fibroblastic OS sh-Pthlh_B 1
sh-Luc *** 0.1 *** sh-Pthlh_A P=0.057 Tumor Weight (grams) Weight Tumor 0.01 sh-Pthlh_B sh-Luc A Osteoblastic OS sh-Pthlh Figure 3 Walia et al
A B Primary ObFibro.OS Osteo. OS E 400 Minutes post forskolin treatment *** 200 *** *** *** ** 150 *** Gene Name 0 15304560120 300 *** Nr4a3 100 Fos 50 Nr4a2 200 Nr4a1 ** ** Rgs2 * 0.9 Il6 Aqp3 100 0.6 Kcne3 Cxcl1 Primary Ob 0.3 Sox9 cAMP (fmoles/1000 cells) (fmoles/1000 cAMP 0 Rel.exp
cAMP (picomoles/1000 cells) (picomoles/1000 cAMP 02.01.5 -++ -+- IBMX 0 Gene Name Primary ObFibroblastic Osteoblastic 0 15 30 45 60 120 Nr4a3 OS OS Fos Minutes post forskolin treatment Nr4a2 Nr4a1 Minutes post forskolin Rgs2 Il6 CDtreatment Aqp3 Kcne3 0 15304560120 Cxcl1 Primary ObFibro.OS Osteo. OS Fibroblastic OS 2.0 Sox9 pCREB1 Rel.exp 02.01.5 Gene Name 1.5 Nr4a3 CREB1 Fos Primary Ob Nr4a2 Nr4a1 pCREB1 1.0 Rgs2 Il6 Aqp3 Kcne3
pCREB1/CREB1 Fibro.OS CREB1 0.5 Cxcl1 Sox9 Osteoblastic OS pCREB1 Rel.exp 0 02.01.5 015304560120 CREB1 Osteo OS Minutes post forskolin treatment
FGNr4a2 Promoter Primary ObFibroblastic OS Osteoblastic OS 15 *** 123123123 *** 10 *** pCREB1 *** CREB1 *** ***
% Input ** ATF-1 5 * * Actin
0 0 15 30 45 60 120 IgG -Ab I H Minutes post forskolin Days post 0714 treatment differentiation 15
Nr4a1 Promoter pCREB1 * 6 *** 10 CREB1 ** 4 *** Primary Ob ATF1 ** **
% Input 5 Days post 2 * * * 0714differentiation Average number of reads Average
pCREB1 0 0 0 15304560120 IgG-Ab Normal Human Ob OS Minutes post forskolin CREB1 treatment
Fibroblastic OS ATF1 J Dpp10 Promoter Primary Fibroblastic Osteoblastic 4 Primary Ob - CREB1 Days post Ob OS OS Protein Phosphatase 1 Primary Ob - pCREB1 0714differentiation Fibro OS - CREB1 Protein Phosphatase 2 3 Phosphodiesterase A Fibro OS - pCREB1 pCREB1 Phosphodiesterase B 2 Phosphodiesterase C CREB1 Phosphodiesterases D % Input NS Akap12 1 ATF1
Osteoblastic OS Relative Expression 0 0.5 2.0 0 0 15 30 45 60 120 IgG -Ab Figure 4 Walia et al
A B C E Primary Osteoblasts 100 0.5 *** *** β2m) DMSO DMSO 80 *** 0.4 Forskolin 60 0.3 *** 40 *** 0.2 % Population % * 20 0.1 DMSO
0 Normalized expression (/ 0.0 CD51+ CD51+ CD51+ Sca1+ Osterix Runx2 Sca1- Sca1+ PDGFRα PDGFRα
D Runx2 Sp7 (Osterix) Pthr1 Osteocalcin 10 80 20 400 FORSKOLIN DMSO * Forskolin *** *** 8 60 15 *** 300 ** Forskolin 6 40 *** * 10 200 4 Day 0 Day 21 20 5 100 2
Relative fold induction
0 0 0 0
CD51 0 7 14 21 0 7 14 21 0 7 14 21 0 7 14 21 Sca1 Days of differentiation
F G H J 0.06 Fibroblastic OS 100 ***
*** β2m) DMSO DMSO 80 ** Forskolin *** 0.04 60
40 0.02 % Population % * 20 DMSO
0 Normalized expression (/ 0.0 CD51+ CD51+ CD51+ Sca1+ Osterix Runx2 Sca1- Sca1+ PDGFRα PDGFRα I Runx2 Sp7 (Osterix) Pthr1 Osteocalcin 10 80 20 400 FORSKOLIN DMSO Forskolin
8 Forskolin 60 15 300 6 10 ** 40 Day 0 Day 21 4 ** 200 20 ** 5 10 2 ** Relative fold induction * * 5 * 0 0 0 0 CD51 0 7 14 21 0 7 14 21 0 7 14 21 0 7 14 21 Sca1 Days of differentiation Figure 5 Walia et.al
A C sh-Creb1 sh-Creb1 sh-Creb1 sh-Creb1 sh-Luc AB AB AB AB sh-Luc sh-Luc sh-Luc Creb1 Creb1 Atf1 Atf1 Primary Ob Osteoblastic OS
Fibroblastic OS Osteoblastic OS 2.0 sh-Luc ) 6 sh-Creb1_A 1.5
ns sh-Luc 1 ns
Cell Number (x10 0.5
0 _A 0 3 6 9 12 15
Days Creb1 sh- B sh-Creb1
sh-Luc AB _B Creb1 Atf1 Creb1 sh- Fibroblastic OS 7AAD Annexin V
*** 3 sh-Luc ** )
7 70 sh-Creb1_A ** 60 2 ** 50 40 * 30 1 20 ns Cell Number (x10 ns 10 0 0 % Dead cells (Annexin V/7AAD) sh-Luc sh-Creb1_A sh-Luc sh-Creb1_A 03691215 Fibroblastic OS Osteoblastic OS Days Figure 6 Walia et al
A B C Primary Ob 0.4 Fibroblastic OS ** Osteoblastic OS 8 Sox9 0.3 ** 6 ***
Primary Ob Fibroblastic OS Osteoblastic OS expression * ** Sox9 0.2
Sox9 4 Nr4a3 Promoter Btg2 0.1
Dpp10 2
Fold occupancy/
Areg Ugdh Fos Normalized 0.0 0 Golga Prim Fibro. Osteo CREB1 pCREB1 Pol-II IgG Dusp1 Ob OS OS control Pdit4 4 Nr4a2 ** Gem ** 6 Fos Rgs2 3 ** Rnf22
expression Tcf7 4 *** 2 **
Vegfa Fos Nr4a1 Promoter 2 Aqp3 1
Dpp10 Lif1 Fold occupancy/
Tex2 Normalized Hmg20 0 0 Tnfrs10 Prim Fibro. Osteo CREB1 pCREB1 Pol-II IgG Cebpd Ob OS OS control Ifngr1 0.03 Efnb2 ** 80 *** Nr4a2 Sik2 Plaur ** 0.02 60 Bmp8a expression Adam
Nr4a2 40
Junb Promoter *** Gtpb 0.01 *** Ier3 20
Dpp10 Nrp1 Fold occupancy/ Osbp1 Normalized 0.00 Usp2 0 Nfil3 Prim Fibro. Osteo CREB1 pCREB1 Pol-II IgG Nfkb2 Ob OS OS control Dlec1 *** 0.05 ** Pkig-inh 8 Areg Foxc2 0.04 *** Lst1 6 *** Cxcl1 ** expression 0.03 *** Kcne4
Areg 4
Il6 Promoter 0.02 Lpin 2
Dpp10 Fold Change 0.01 Fold occupancy/
Normalized 0.00 0 02.51.5 Prim Fibro. Osteo CREB1 pCREB1 Pol-II IgG Ob OS OS control Figure 7 Walia et al
AB- log10 (FDR ) 0 24 6 DNA templated transcription Mutation Number of Number of Tumor Type Category p value Reference Extracellular structure organization Class (All or non silent) Genes in Sample Genes in cAMP pathway Transcription initiation via RNA Pol II Chen et al., Ion channel complex OsteosarcomaSNV All 1704 39 -19 9.46x10 Cell Reports Transmembrane transporter complex Chen et al., ERK1 and ERK2 cascade SNVnon silent 1480 33 1.09x10-15 Inositol lipid mediated signaling Cell Reports Triode et al., Divalent inorganic cation complex EwingsSNV All 1724 24 1.11x10-7 Phosphatidylinositol-mediated signaling Can. Discovery Calcium channel complex Triode et al., SNVnon silent 1470 20 1.60x10-6 Gated channel activity Can. Discovery Phosphatidylinositol 3 Kinase signaling Ellis et al., BreastSNV All 3483 30 8.20x10-5 Cation channel complex Nature Protein serine/Threonine kinase activity Berger et al., MelanomaSNV All 911 10 -3 Voltage gated calcium channel complex 2.09x10 Nature Protein Kinase A Binding BladderSNV All 592 1 n.s. Cazier et al., Regulation of MAP kinase activity Nat Comm. Voltage-gated channel activity Morin et al., LymphomaSNV All 2251 30 -9 Protein serine/Threonine kinase activity 8.73x10 Blood Ephrin receptor Binding
Other cAMP/PKA related
C PTHrP PTHrP PTHrP PTHrP PTHrP
Adenylyl Adenylyl PTHrP Adenylylyly PTHrP Cyclase Cyclase Cyclasee Cell Surface
PTHR1R1 G a Cytoplasm PTHR1R1 G a PTHR1R1 G a G _ s G _ G _ s G _ G _ s G _ s G s s G s s G s s` cAMP s` cAMP s` cAMP
ATP ATP ATP PTHrP PTHrP
PTHrP
PKA PKA PKA PKA PTHrP PKA PKA PKA PKA PKA PKA Inactive Inactive Inactive PKA PKA Active Active Active
PKA PKA PKA PKA P PKA PKA P X P P P CREB Activate Target Genes CREB PROLIFERATION P CREB SURVIVAL Nucleus Normal Osteoblast Fibroblastic Ostesarcoma Osteoblastic Osteosarcoma