Environmental DNA Detection of Rare and Invasive Fish Species in Two Great Lakes Tributaries

University of Windsor Scholarship at UWindsor

Great Lakes Institute for Environmental Great Lakes Institute for Environmental Research Publications Research

11-29-2017

Environmental DNA detection of rare and invasive fish species in two Great Lakes tributaries

Katherine D. Balasingham University of Windsor

Ryan P. Walter University of Windsor

Nicholas E. Mandrak

Daniel D. Heath University of Windsor

Follow this and additional works at: https://scholar.uwindsor.ca/glierpub

Part of the Biochemistry, Biophysics, and Structural Biology Commons, Biodiversity Commons, Biology Commons, and the Marine Biology Commons

Recommended Citation Balasingham, Katherine D.; Walter, Ryan P.; Mandrak, Nicholas E.; and Heath, Daniel D.. (2017). Environmental DNA detection of rare and invasive fish species in two Great Lakes tributaries. Molecular Ecology, 27, 112-127. https://scholar.uwindsor.ca/glierpub/129

This Article is brought to you for free and open access by the Great Lakes Institute for Environmental Research at Scholarship at UWindsor. It has been accepted for inclusion in Great Lakes Institute for Environmental Research Publications by an authorized administrator of Scholarship at UWindsor. For more information, please contact [email protected]. This article isThis article by protected copyright. All rights reserved. 10.1111/mec.14395doi: differences to lead between the of this version c and Version Record.Please copyediting, paginationbeen throughthe andproofreadingtypesetting, process,may which This article acceptedhas been for publication andundergone fullpeer review buthasnot Email: 1 Contact: Canada 3C3, ON, L3S Markham Irenemount Crescent, 123 Current/Permanent Biology of Department D. Katherine Correspondence DNA,next environmental K Title Running 4A5,Canada L7R ON Burlington, d United States CA92831, Fullerton, Blvd, c Canada ON M1C1A4, b Riverside Drive a Article :Original Article type 0000 ID: (Orcid BALASINGHAM D MS. KATHERINE

Department of Biology, ofBiology, Department Department of Biological Sciences, Sciences, ofBiological Department Present Address Present eywords Accepted Sciences, Aquatic Fisheriesand for Laboratory Lakes Great Article Environmental DNA [email protected] 2990 : -

647 Balasingham

: eDNA analysis of : eDNA analysis - 588 West, ON : : Department of Biological Science Biological of Department :

5799 Address

Research, Environmental for Institute Lakes Great , -

generation sequencing, sequencing, generation

N9C 1A2 : in two GreatLakes tributaries

riverine riverine

detection , Katherine Balasingham D. Canada University Toronto University of

fish community

Nicholas Ryan P.Ryan Walter Daniel D. Heath

of - endangered species endangered E. Mandrak 0002 s , California State University, 800 N State College N 800 State University, State , California rare and invasive

- 8355 a

, Scarborough c a ,d

Fisheries and Oceans Canada, Canada, Oceans and Fisheries

3051) b ,d a

, invasive, , 1265 , 1265

University of Windsor, ofWindsor, University Military Trail, Toronto, Trail,Toronto, Military

fish species

fish ite thisarticle as

community

This article isThis article by protected copyright. All rights reserved. Accepted2012 for in thesystem fece and blood, sperm, and eggs cells, skin urine,as shed such sources environmental methods Introduction based species affecting factors the species identified other species and identified also Riv Sydenham the River and Articleand eDNA River. Sydenham the River and from native species photogenis pellucida Ammocrypta next detecti with non alternative, Abstract

fish fish - PCR and and PCR ; generation sequencing sequencing for generation

Balasingham et al. 2016 etal. Balasingham methods o data. Additionall data. community The The n

has led to the development of alternative sampling sampling alternative of thedevelopment led to has

of methods ) ,

need toneed extraction rare aquatic species aquatic rare

one invasive species ( species one invasive next

significant positive and negative species co species negative positive and significant DNA , -

for for invasive approach for the detection of of the detection for approach invasive the extended - generation sequencing generation

as well as well as improved two large

(eDNA) monitor aquatic species distributions without the us without distributions species aquatic monitor o target species target ur eDNA method detected method ur eDNA ;

and characterization and

Northern Madtom Northern y, eDNA y,

period . er, respectively In aquatic environments, the environments, In aquatic

). Great Lakes Great Lakes individual mapping of of mapping Out of 82 fish species detected in both rivers using capture using inboth rivers detected fishspecies 82 Out of

The DNA can can DNA The the detection of three species at species three detectionof the . is Our study used a used study Our s

Round Goby Round

easily implemented as an initial survey tool, or alongside alongside or tool, initial survey an as implemented easily spatial of time of .

Our

species

results demonstrate that that results demonstrate

, species tributar distribution inanecosystem distribution (“meta

(Ficetola et al. 2008; Taberlet et al. 2012 etal. 2008;Taberlet et al. (Ficetola , Noturus stigmosus Noturus

of of which included our four targetspecies ourfour included which then then DNA ,

Neogobius melanostomus Neogobius of interest interest of 86.2% and72.0 86.2% barcoding”) distribution patterns distribution y river be extracted from extractedfrom be custom designed custom from rare species rare s

aquatic - in southern Ontario in southern e occurrence provides a provides DNA , approaches

; has proven to be to proven has

and Silver Shiner and

% of the fish species fish % ofthe of of

risk environmental eDNA metabarcoding species .

Environmental DNA Environmental ; group water

( better understanding of understanding better pattern s Eastern Sand Darter Sand Eastern

. with possible than

and and

ing such as such )

- is and and specific specific samples using non using samples

may remain may remain invasive invasive

derived from biological biological from derived , Canada , s

between our target between our an additional 78 an additional very ,

samples offers an offers samples

Notropis Notropis the analysis of of the analysis .

primer ; Our Our

sensitive sensitive Thomsen et al. et al. Thomsen capture capture in the Grand Grand the in ; the Grand ; the

analyses , detectable detectable that that

coupled coupled

- only target target only

, set based based

capture target

for the the for - and

s -

This article isThis article by protected copyright. All rights reserved. thus could inva simple pr sensitivity detection the M Zealand carps 2012), of Hulme 2006) number approaches 2015) etal. (Spear al. 2015) et (Sigsgaard in R successfully SAR for methods eDNA employed have Severalstudies (i.e. rare). at lowabundances extirpated at(SAR) risk forspecies especially useful is 2016). This approach sampling invasive iver (Laramie et al. 2014), Japanese Giant Giant S Japanese etal. 2014), (Laramie iver

ovides ovides Japan (Fukumoto et al. 20 etal. (Fukumoto Japan AcceptedB American Article

spread of Ruffe ( Ruffe of spread sion (

Hypophthalmichthys Hypophthalmichthys Bluegill Bluegill presence ) While eDNA has been used extensively for determining determining for extensively used been has While eDNA With successful

ri an alternative, valuable sampling method for aquatic aquatic species. for method sampling valuable an alternative, to facilitate the to facilitate s udsnail in Canada in Canada be utilized be k

; have expanded to encompass encompass to expanded have

. assessments for example, example, for Recent Recent w ullfrog ( Lepomis macrochirus Lepomis

data does not does data

( and in Pennsylvania (Pitt etal.2017) inPennsylvania and Potamopyrgus antipodarum Potamopyrgus , less impact on the sampled ecosystem thesampled on impact , less Gymnocephalus cernua Gymnocephalus

( according to the tothe according Lithobates catesbeianus Lithobates to characterize whole communities whole characterize to , and Eastern H Eastern , and ork ork application implementation of implementation . Sampled Chinook Chinook on es spp.) spp.) 15), European Weather L Weather 15), European

estab invasive species invasive

provide an ecological context for context an ecological provide in northern USA (Jerde et al. 2011;M (Jerde et al. USA in northern S s

lished for lished water water almon

) of of ellbender

in Japanese ponds (Takahara (Takahara ponds Japanese in Species at RiskAct at Species eDNA should

invasive species invasive ( Oncorhynchus tschawytscha Oncorhynchus

) in the Great Lakes (Tucker etal.2016) (Tucker Lakes Great inthe ) alamand early eradicat analyses to analyses eDNA analys eDNA )

detection

) in ponds throughout southern France (Dej southern throughout ponds in (

Cryptobranchus alleganiensis Cryptobranchus in streams in Idaho, USA (Goldberg et al. 2013), et al. USA(Goldberg Idaho, in in streams

contain DNA from all inhabitants in the system thesystem in fromallinhabitants DNA contain er er oach that that are . ( Andrias Andrias

using eDNA methods include include methods eDNA using (SARA; SARA SARA 2016) (SARA;

species with species (Yamanaka (Yamanaka ion

e ( early in theirinvasion early in Misgurnus s (Bohmann et al. 2014; Barnes &Turner Barnes 2014; etal. s (Bohmann

and ease of applicability of ease and

or control or endangered, threatened, or threatened, endangered, the distribution of distribution the japonicus conservation et al. & Minamoto 2016 Minamoto &

low abundan low ahon et al. 2013), New 2013), etal. ahon fossilis

)

programs programs

2013; Doi et al. 2015), Asian et 2015),Asian Doi al. 2013; in the Upper Columbia Columbia Upper in the ) in the Katsura River basin River the Katsura in

and are and ) ) ,

in Jutland, Denmark Denmark Jutland, in in North Carolina, USA Carolina, North in management

(i.e. ( target target Anderson 2005; Anderson . ce , With increased increased With

detection thus still few in few still , eDNA , eDNA eDNA analysis analysis eDNA the detection ) . species e Moreover ,

an etal. present ,

and

, and and and

This article isThis article by protected copyright. All rights reserved. Accepted species, and species. invasive o perspective an ecological distributi 2011; eDNA ( methods DNA extraction protocol sampling by affected al. 2015 et Turner Altermatt 2014; Deiner & al. et 2012; (Takahara water chemistry rate and 2002),flow et al. (Diffey al. 2015), turbidity (Strickler et temperature such as factors abiotic 2015),and al. Klymuset etal. 2014; (Pilliod biomass biotic the powerful, Article al. Pereiraet 2017). 2015; be semi to shown been et 2016; Port al. that species metabarcoding Willerslev & (Thomsen etal.2016). system (Simmons a as species) (e.g. recently introduced species unknown for monitors gathering presence

factors such as life stage (Maruyama et al. 2014; Fukumoto et al. 2015; Spear etal. 2015;Spear et al. Fukumoto etal.2014; (Maruyama stage such aslife factors Jerde et Jerde et al.2015; protocol Effective management and conservatio and management Effective analys While eDNA on of rare and invasive species. species. invasive rareand of on are common

results s of

continue to improve to continue often often Evans et al. 2016; Valentini et al. et 2016). Valentini al. 2016; et Evans In this this In

the whole

data for

must be interpreted with caution with be interpreted must

native missed 2015) -

study, Dejean et al. 2012; Rees et al. 2014; McKee etal. McKee 2015). al. et 2014; Rees al. et 2012; Dejean quantitative when using spiked samples and spike and samples spiked when using quantitative

Matheson et al. 2010; McKee et al. 2015; Eichmiller et al. 2016 et 2015;Eichmiller McKee al. et al. 2010; et Matheson n e

s of target species distribution and community composition are composition community and distribution target s of species the whole community indirectly indirectly community the whole

SAR

communit species

for PCR primer design, design, primer PCR for using

we characterize we (Bohmann et al. 2014; Renshaw et al. 2015; Turner et al. 2015) etal. Turner al. 2015; et 2014;Renshaw etal. (Bohmann By t By

spatial patterns in relation to in patterns relation spatial ; argeting highly conserved regions that flank polymorphic regions regions polymorphic flank that regions conserved highly argeting

Balasingham et al. 2016 etal. Balasingham capture

in two large Great Lakes tributar Lakes largeGreat in two to y

produce reliable reliable produce , with a , with T he inclusion ofc inclusion he

or observation or d n of aquatic ecosystems require ofaquatic ecosystems n

the the spatia high likelihood high NGS .

eDNA quantity and qual and quantity eDNA

This method of metabarcoding has also also has metabarcoding of method This

and sensitive sensitive and of the resulting amplicons theresulting of l distribution of three three of l distribution ommunity ommunity - ). eDNA detection sensitivity is also also is sensitivity detection ). eDNA based based benefits ecosystem management as it asit management ecosystem benefits

the presence of presence the of detecting cryptic, elusive, or rare orrare elusive, cryptic, detecting of methods ( methods “ composition composition y rivers passive surveillance passive eDNA analyses (Jerde et al. (Jerde etal. analyses eDNA d

communities (Diaz communities Pompan , the Grand River and River , theGrand

other native or nativeor other data ity SAR data data

, one invasive invasive , one can be used for for beused can

on et al. 2011; et on al. o affected n the the n thus thus ) 2015) ; however, ; ”

of theof provides

and and by by -

Real Real and

This article isThis article by protected copyright. All rights reserved. an Ontario, drainage area approximately km long main two has River The Sydenham Currently biodiversity aquatic of Study Area &Methods Materials species. and invasive shared habitat of speciesinterest of of with group Future studies invas including rare, interactions, species important investigate (meta the sampling basin specific River, the Sydenham

annual mean mean annual Accepted Article native

(identified using (identified barcoding) PCR primer PCR The The

with a a with approximately 300 approximately , 5 to maximize data gathered on on gathered data maximize to

fish community composition community fish

- specific primers specific 1 fish 1 Grand River Grand River Sydenham

of both branches both of

designed designed 100 mean annual mean annual discharge discharge

is species

and and

km long km long a powerful approach for approach a powerful for the CO1 mtDNA gene mtDNA CO1 the for

. Our . using using

; historical

potential potential approximately 80 fishspecies 80 approximately

to detectthe to drains into Lake Erie (Fig. 1) and is (Fig. and LakeErie1) into drains

have b have

approach to meta to approach rate o eDNA metabarcoding method metabarcoding eDNA

with a with and custom reference species sequence databases species sequence reference and custom km

discharge of 16.9m of discharge is

long

is 2 een reported reported een capture ecological interactions of target species, especially in regard to SAR to SAR in regard especially target species, of interactions ecological f approximately 64 f approximately tributary tributary

mean annual annual mean branche

725 km 725

with catchment drainage area of 6800km of area drainage catchment with distribution of target species of distribution . - the spatial relationship spatial the Our Our based based survey of Lake St.Clair Lake of 2 s

analyz , the N , barcoding ( use of use of designed to target all all target to designed Metcalfe (SCRCA 2013a; SCRCA 2013b) SCRCA 2013a; (SCRCA discharge discharge 3 ·s ing orth Sydenham orth Sydenham - combined eDNA combined 1

m ,

and the E and the

(

community composition and co and composition community 3 - 2003; et Staton al.

data) simultaneously g simultaneously ·s Smith et al. 2003; Smith et al. - 1 s

. (Fig. 1) ( of 34.4 m 34.4 of

Singer & So1980 Singer We used a used We in . We use We

the largest watershed in southern southern in watershed the largest a s ive, and common native species. species. native common and ive, st Sydenham st

among ,

which which River

known should should

3 and and d ·s

NGS NGS - custom 1 . The

enerates , SAR

NGS NGS historically historically which Staton et al. 2003). etal.2003). Staton Marson & Mandrak 2009). &Mandrak Marson

fish use this this use and intensive water intensivewater and

in the in the , inva )

. The watershed Thewatershed .

total catchment catchment total methods methods River - es in the es in designed designed 2

for optimal detection detection optimal for

is (Li et al. 2016). etal.2016). (Li

critical information critical information siv approximately 70 approximately Sydenham River Sydenham

meta which is which e species, and e species, had had - occurrence to occurrence Great Lakes group barcoding a high level level a high

has - It

has has

This article isThis article by protected copyright. All rights reserved. Acceptedsubstrates SARAunder Endangered development, urban and practices agricultural from pollution and eutrophication by caused degradation habitat bottoms with rivers, sandy etal. (Ginson 2015) study a morerecent 12 caught in were since1987 captured been 2011). its and t Lake Erie Grand River, extirpated), Canada the genus Article on impacts detrimental present to be known historical the species, invasive pellucida Study Species species with 83 fish ofallfreshwater half more than

deemed “poor” w “poor” deemed ESD

( The Northern Madtom ( Madtom The Northern The target species The four SARA SARA ), or Ammocrypta

Northern Madtom ( Madtom Northern comprised of sand, gravel, and silt for nesting (DFO 2012). The Canadian distribution is distribution Canadian The (DFO 2012). nesting silt for gravel, and ofsand, comprised populations

Eastern Sand Darter Sand Eastern current current

invasive species invasive 2016

present in Grand River in 1999 (Wright & Imhof 2001). Imhof & 1999(Wright in Grand River in present ). distributions distributions

Round Goby Round at high densities densities high at Its

ith only 43 individuals recorded recorded 43individuals ith only in Grand River in found in Canada (COSEWIC 2009). 2009). (COSEWIC Canada in found many native many

distribution in Canada in

when it was first reported (DFO 2011). P (DFO 2011). reported first when itwas for burrowing for

Noturus stigmosus Noturus (including (including

in thisstudy in NMT)

(

in at least the one of atleast in ESD) ESD) ( Neogobius Neogobius melanostomus

(SARA 2016). It prefers big rivers with slightly turbid water and water slightly turbid bigwith rivers Itprefers (SARA 2016).

species in Canada and at and

at many is a small (120 mm) (120 small is a were is a

Round Goby Round (COSEWIC 2009). 2009). (COSEWIC

small small ributaries, Sydenham River, and Thames River (DFO (DFO River Thames River,and Sydenham ributaries, -

risk species species risk deemed “good” and more than 735 individual than 735 more and “good” deemed include three include in Ontario (158 species; Mandrak & Mandrak (158 species; Ontario in

locations is limited to is limited (71 ), and and

mm) . )

ESD , and disease ( disease , and two study rivers two study Silver Shin Silver in the in (Poos et al. 2010; DFO 2011; DFO2012 2011; DFO et 2010; al. (Poos

in ,

SAR benthic benthic

benthic, cavity benthic, It is listed as T as It is listed inhabits

both Main Big Creek, Big Otter Creek Creek (likely BigOtter Big Creek, ). The target ). The

last last ;

Eastern Sand Darter Eastern

study

threats er two darter opulations in Sydenham River Sydenham in opulations

lakes

( DFO 2011; Finch et al. 2013 etal. Finch 2011; DFO Notropis photogenis Notropis

rivers decades decades . The invasive invasive The

hreatened hreatened

- and shallow streams or or streams shallow and and the only member of member theonly and SAR nesting, catfish listed as listed catfish nesting, ESD , with known with

have overlapping overlapping have

(DFO populations are populations

Crossman 1992), 1992), Crossman

by SARA (

Ammocrypta Ammocrypta 2011) Round Goby Round

), and one one ), and s have s have

and only only and

in ) .

is This article isThis article by protected copyright. All rights reserved. Acceptedand young 2011; Sep to April from al. 2011 andi Lakes the Great length is10 It is a 1992). (Jude etal. Clairin1990 inSt. Lake initialreports Europe, with (DFO 2013). mana 1982 prefer River Grand in population asingle although ArticleCanada as assessed four al. et 2012). (Edwards space and habitat food for Goby Round the species suchas invasive with competition and fragmentation, habitat and loading nutrient suchas degradation habitat include toNMT threats The main either River intheGrand be to present known not is NMT DFO2012). 2012; it has although River Sydenham to restricted known ). gement (i.e. nutrient and/or sediment loading), habitat fragmentation, and introduced species species introduced and fragmentation, habitat sediment loading), and/or (i.e. nutrient gement

s Kornis et al. 2012 et al. Kornis The main threat to to threat main The

fast ). (SARA 2016) (SARA The The RG - of - 0 mm 0 Threatened populations flowing systems flowing Round Goby Round Silver Shi

the Detroit River, Lake St. Clair and its tributaries, St. Clair River, Thames River, and River, Thames ClairRiver, St. tributaries, andits Clair Lake St. River, the Detroit - season thespawning during eggs to lay crevices open or substrate in burrow rocky the

tember

- individual was was individual (N’Guyen etal.2016) (N’Guyen year year .

s expanding rapid expanding s ner There are no current areno There of ;

, by COSEWIC ( COSEWIC by

Edwards et al. 2012). al.2012). et Edwards

in in

( ( directly competing with with competing directly native species species native

RG SS SS is considered considered is Bronte Creek, Bronte Creek,

)

with ) originally arrived arrived ) originally populations ishabit populations is a small is asmall not been collected in collectedin not been reportedly reportedly

deep riffles riffles deep COSEWIC 2011 COSEWIC ly upstream in tributaries (Poos et al. 2010 (Poos tributaries in upstream ly ) (143 , “ such as

highly invasive highly fair Grand River, S River, Grand

or historic historic or caught thee caught in

mm) ”

and with It to the Great Lakes Great Lakes to the

NMT feed at degradation via contamination from poor water poor from contamination via degradation at

minnow NMT sand, clay and gravel clay and sand, only a only ) but listed as listedas ) but s

populations populations (DFO 2012 the

on mussels ( mussels on

and and , ixteen Mile Creek, and Thames River Thames and MileCreek, ixteen

benthic species species benthic few individuals collected (DFO 2013). (DFO collected few individuals Sydenham River since 1975 (COSEWIC 1975(COSEWIC since River Sydenham

with ast Sydenham River in 2003 (DFO 2013). 2013). (DFO in 2003 River Sydenham ast ESD

a Canadian distribution consisting of consisting of distribution Canadian a

for benthic habitat habitat benthic for ; Burkett & Jude 2015 Jude Burkett& ; of of via ballast water from Eastern Eastern water from via ballast e.g. e.g. Special Concern Special Concern SS

dreissenids substrates in in that that the small ( small currently or historically. historically. currently or has has Sydenham River Sydenham ; Bronnenhuber et ; Bronnenhuber spread

average body body average ), ( McKee & Parker Parker McKee & by SARA by space (Kornis (Kornis space

insect ).

throughout throughout

larvae, larvae,

in in . It is It ,

A This article isThis article by protected copyright. All rights reserved. control sediment load) of the filtration by followed filtering (47 filterpapers microfiber Extraction eDNA and 4riv ( 2 a subset of replicate sitewere collected each at cooler inthe andstored the sealed, air, River) 4 from Grand s samples asbottom characterized were depths greater collected at samples in River Sydenham double rinsed using and minutes from modified Grand River Water DFO2012). 2002; (COSEWIC Furthermore, 1 amples

09 Accepted Article in the field

surface, surface, Sampling Sampling –

Within 24 hours of of hours Within 24 Water s

each each er cont er (river control (river

we and

- also

5 72 river sample, river sample, coolers containing ice containing coolers RG feed nocturnally RG feed

Jerde et al. (2011) al. et Jerde

samples per site per samples using the same the same using rols). ampling was was ampling

bottom, and 3 river controls) controls) 3 river bottom, and

in in and 43

included mid to late to late mid

by by

s ) opening a opening

were were sites sites lab

500 collection mm diameter, mm the

The direct impacts of RG on SS is not currently known (DFO 2013). (DFO known currently isnot SS on ofRG impacts direct The conducted by DFO via boat via boat DFO by conducted in the included controls for controls October 2013 October

filtration apparatus filtration

m river sample on new filter new on river sample for for - .

distilled water (ddH water distilled L 500

All field equipment was sterilized sterilized was field equipment All which also directlyc also which

of ddH of . eDNA analysis eDNA Grand d S ,

urface urface s (2 mL Nalgene bottle bottle Nalgene mL all water samples were filtered using Whatman® glass glass filteredusing Whatman® were samples all water

alongside - 3 bottom samples and 10 samplesand 3 bottom

River 1.2 the O was filtered on a separate filter to act filtertoas separate ona O wasfiltered small small

in the

amples amples µ and 170 Grand River samples River Grand 170 and 7 m pore size; Whatman, Maidstone, UK). Prior to UK).Prior Maidstone, size;Whatman, m pore

were collected in 500 collectedin were ri subset of subset

ver control ver . In total . In the the . This allowed each sample allowedeach This .

Sydenham 2 were river water samples river water O). Water samples samples O). Water ompetes ompetes in in filled withddH filled s ,

site sample September September collecte we (up to 4 filters for samples with high high with 4 filters forsamples to (up

amples River using a using River included with with - d just under thesurface d justunder 15 surface sa 15 surface by soaking in 10% bleach for10 bleach in 10% soaking by NMT . If any . If any

mL Nalgene bottles and stored stored bottlesand Nalgene mL s to early October October to early

( 2 184 Sydenham River Sydenham 184 3 from Sydenham River and River Sydenham 3 from O toO from .

for foraging foraging for The m The .

sampling protocol sampling

( Blank r Blank 108 108 lab

expose the contents to thecontents expose

to have its own haveits own to 44

mples) and we used we used mples) and control surface, surface,

ajority of samples ofsamples ajority si tes iver

lab in the in space

site 2013 tested tested

cont 58 ,

control while

bottom,

samples samples in the

lab rols

This article isThis article by protected copyright. All rights reserved. data catch DFO based on and target species Primer the sample in suspended - The mixture mixed again, centrifuged was solution then minutes rpm for20 complete allow minute per 3000strokes at minutes homogenized tubes were The buffer. digestion (CTAB) bromide cetyl trimethylammonium of 400 No. 11079110), placed imme bet at stored to potential target DNA positive for Accepted20 Article

we o C. DNA was pelletizedby was C. DNA vortexed with equal volumes ofchloroform volumes equal with vortexed diately

en each use using 95% ethanol 95% useusing each en

with with into 2 into Design We f DNAextraction, For - 20 . All All .

an an

designed a designed s contamination contamination

for DNA extraction. DNAextraction. for o m were left overnight at overnight were left 30

C until DNA extraction. extraction. C until DNA equal volume of isopropanol and and isopropanol of volume equal

extracted e extracted L cellular br cellular

µ screwcap screwcap L of

114 , then ,

µ L 10

additional species additional of ddH of group during PCR PCR amplification, during

and FishMa and mM TEBuffer the the eakdown and protein and eakdown DNA w tubes containing µ 400 containing tubes (i.e. false (i.e. false ilters were ilters -

s 2 centrifugati specific specific upernatant O, 400 O, superna The The as

stored at at stored using P positive . One half . One half

µ fish

(McLaughlin e (McLaughlin L

tant

cut into halve into cut of phenol of

on, on,

that potentially that filters

Mini CO1 CO1 was was

1.0 transferred to a new anew to transferred s washed once with 70% ice 70% with once washed - ) 20 - in placed Eachfilterwas . transferred to anew to transferred PCR PCR

of the filter thefilter of

Beadbeater µ w digestion. The sa The digestion. one tenth one -

t L isoamyl for a second phase separation. separation. phase asecond for isoamyl o ere L he corresponding sample he corresponding

- C until further analysis. further C until of 20 of

chloroform: primer of 1.0 of t al. 2010; Meixler e 2010; t al.

cut into s

using sterile forceps and razor andrazor forceps sterile using

inhabit mm glass beads glass mm

volume of 3M sodium acetate acetate sodium 3M of volume set - was stored was · 24 (Fisher Scientific LTD, BioSpec.) BioSpec.) to LTD, Scientific (Fisher 24 µ

strips to help with digestion and and digestion to help with strips (PS1) (PS1) -

1 isoamyl isoamyl

RNa

mples were centrifuged at 13 centrifugedat mples were the two 1.5

developed developed 1.5 se A

mL Eppendorf Eppendorf mL

and the second half was used was half thesecond and

- mL alcohol alcohol

cold a

t al. 2011 t al. to to Great Lakes tributaries Great Lakes

packed dry packed 15

Eppendorf Eppendorf

would be would be eliminate RNA eliminate

ethanol m to L (25:24:1), and400 (25:24:1),

Falcon tube and tubeand Falcon amplify ; see Supp. Table Table see Supp. tube ,

(BioSpec Cat. Cat. (BioSpec excluded and re and blades blades tube , The mix The

(

our four our then pH 5.2 pH

present in present ,

and - for two for cleaned cleaned

000

due due

)

ed .

This article isThis article by protected copyright. All rights reserved. 52 at temperature annealing seconds were 1.0 polymerase, andreverse each forward eDNA ( detect could primers PS1 that our concentration target DNA lowest the toestimate used species was seconds 95 at denaturation initial to an were set ng· RG,for 35.4 and series dilution fragment complementarity, www.premierbiosoft.com/ 1990 (Kwok etal. ~250bp. of wereselec regions polymorphic surrounding regions species ofreads) (number strength signal measure of the t (forward) (Biomatters, v.6.1 Geneious & Hebert 2007) Ratnasingham (BOLD; LifeDatabase of S1 Arm )

Accepted Article .

The PS1 primers were designed using using designed primers were PS1 The arget and n and arget bruster & Pry 2008; Kim et al. 2014 Kim et al. & Pry2008; bruster set to an to an set PCR

from both rivers from eDNA

and

length and Uni and

Degenerate base Degenerate

60 PCR reactions consisted of2.5 consisted PCR reactions initial denaturation at 95 at denaturation initial

o on . µ C annealing temperature for 60 seconds for60 temperature C annealing L ; Epp et al. 2012 ; Eppetal. PS1 efficiency was was efficiency PS1 - L of eDNA L ofeDNA - 1 uniform uniform B - SYBR™ Green Green SYBR™

target species target for SS, 46.4 ng· SS, for

(reverse) by DFO by

PS1 netprimer annealing temperature annealing sample, and ddH sample, and

www.geneious.com sites

for NGS for primer, 0.2 to estimate expected PCR amplification efficiency. Highly conserved Highlyconserved efficiency. PCRamplification expected to estimate qRT ).

sequences were avoi were µ

Pr L sensitivity sensitivity - ) -

imer 1 PCR with PCR

o were used to used were library preparation (Table 1). (Table preparation library for ESD, and 30.0 ng· 30.0 ESD,and for C, 30 seconds at 72 30seconds C,

). o o C for C for C

mM of each dNTP, 0.2 dNTP, each mM of - COI sequences sequences COI

BLAST (Ye et al. 2012) et (Ye al. BLAST for 10 minutes, followed by 45 cycles of 95 cycles of 45 by followed 10minutes, for ded within 5 ded within

µ unambiguously 2 . O foratotal O L of1 L We determined the primer the determined We 2 minutes, then 40 cycles of 30seconds cycles 40 of then 2 minutes, tested tested initial DNA template concentrations of 38.4 ng· of38.4 concentrations DNAtemplate initial ). s The , no secondary structure, and structure, and , nosecondary 0 verify ted for primer design, targeting a fragment size size afragment targeting design, primer ted for X for

Taq primers were were primers for 118 fish species 118fish for

. all four target species u target species all four collected from NCBI Genbank and Barcode Barcode and Genbank NCBI from collected bp of the 3 the of bp

primer specificity, low self low specificity, primer A 10 A o

reaction reaction reaction buffer, 25 buffer, reaction C for extension, final ex final extension, C for µ

L as well as provide asemi provide well as as

- 1 -

fold serial dilution for each target target foreach serialdilution fold for NMT. for

mg and volume of 25 of volume NGS ∙ ’ end to minimize mispriming mispriming ’ endtominimize mL

synthesized Net Primer (Premier Biosoft (Premier Net Primer - 1 allowed

The The BSA, 0.1 units 0.1 units BSA, - template match for match template and aligned using alignedusing and qRT

mM MgCl mM

sing a10

appropriate appropriate us to identify both both to identify us with with µ - PCR conditions conditions PCR L tension at 72 tension at . - PCR conditions conditions PCR -

5’ tails 5’ o qu at 94 at C for 15 C for Taq 2 , 0 antitative antitative - fold fold

.5 µ

o : C, 30 C,

Uni µ each each

M of M of L

o - 1 , C -

This article isThis article by protected copyright. All rights reserved. concentration ddH cen tubes were The ethanol. with70%ice once washed the pellet was and discarded, isopropanol centrifuged, library) was volume o tenth and one isopropanol and tube), samplesper (72 mL tube adaptors at a finalextension and seconds, 60 30seconds, for denaturation c cycle PCR 10 polymerase, (5’ adaptor B consisted of preparation library library preparation; 100 ON, Canada) Mississauga, Coulter, XP (Beckman Next NGSlibrary. inthe included amplification for andassessed above, described were control samples thelab however, below; described NGS library preparation the in andincluded riversamples as were treated template hold at4 andafinal 10minutes, for

Acceptedadaptor Article

2 bp - O. Generation Sequencing Preparation Sequencing Generation .

Next, 20 Next, Unique barcodes barcodes Unique After

were blank

(5’ onditions started witha 2 started onditions -

CCATCTCATCCCTGCGTGTCTCCGACTCAGxxxxxxGATacctgcctgccg) 2.5 -

eDNA

CCTCTCTATGGGCAGTCGGTGATacgccaccgagc

using purified again using Agencourt AMPure XP AMPure using Agencourt again purified )

µ were µ L ofclean L of 10X L of10X L of

PCR Agilent H Agilent

also included for each prepared mastermix. each prepared for included also the library the

amplification were Taq ed PCR product, and ddH and product, ed PCR

trifuged again, ethanol discarded, and t and discarded, ethanol trifuged again, igh igh

reaction buffer, 25 reaction ligated

72 was was Sensitivity DNA chip DNA Sensitivity C annealing temperature for 30 seconds, 72 seconds, for30 temperature C annealing

precipitated precipitated o o f 3M sodium acetate (pH 5.2). 5.2). (pH acetate sodium f 3M - C for 5minutes C for C. minute denaturation at95 denaturation minute gel extract gel ,

to the PCR to thePCR a t thus thus controls Five PCR DNA he he

PS1 PS1 required two rounds of PCR of two rounds required extracted and underwent the first round of PCR, as PCR,as roundof first the underwent and extracted PCR products were products PCR

ed to remove primer dimer and f dimer primer and to remove by inspection on an ag onan by inspection at

mM MgCl mM

mplicons using using mplicons and and - 2 20 . O for a total reaction volume 25.5 of volume reaction O foratotal

Second r Second on an on

o bioanalyzed C (4 target species benchmark DNA and ano and DNA benchmark species (4 target

, 10µ overnight -

2 3’) Agilent 2100 Bioanalyzer (Agile Bioanalyzer 2100 Agilent , 0.

ound PCR products PCR ound , 0.5 L of each sample combined in a 1.5 combined in sample each L of 2

mM of each dNTP, 0.5 each mM of C followed by 6 cycles of 95 6 cycles of by C followed

T a second cleaned using Agencourt AMPure AMPure Agencourt using cleaned

The combined PCR products (i.e. products PCR combined The µ he river control samples (n =7 (n samples control he river

he to using M

de arose gel; arose library A+barcode+key+Uni . termine final D final termine Second round Second

equal volumes of volumesof equal ,

short , 0.1 units , 0.1

o was ragments less than than less ragments C extensio

they were not not were they

- with attached attached with

cycle PCR for NGS NGS for cycle PCR eluted in50 eluted Taq Taq

PCR µ NA n for 30 n for

M P1+Uni µ nt L. L. - s A

Short o -

cold C µ L of ) - - - This article isThis article by protected copyright. All rights reserved. by DFO the along type with habitat associated geology characteris environmental based on systems water habitats along the Community 2014). et (Zhan al. match by produced diversityoverestimation avoids eDNA species identification 10 value 10to of database custom against the create reads). accepted default re ( Next a on sequenced Technologies, Caporaso etal. 2010) Caporaso

Accepted Articlemove ir -

spatial spatial Generation Sequencing Generation es of three es of matches sequence a

minimum average quality score of 25 (corresponds of25(corresponds score quality average minimum in 2010 to2013 in 2010

We also The eDNA NGS sequences sequences ( custom Melles et al. 2013 Melles et al. and and distribution data

Germany

318 Species Species compared the eDNA the compared each river. for database reference -

We used the used We 60 allows was processed using processed using was

presence presence

with and percent identity from 0% to96% from identity percent and - chip .

We classified a classified We to remove

)

during June during . Occurrence . Finally, . Finally, more than three than more rare sequences sequences rare

Specific Aquatic Ecosystem Classification (AEC) values (which define define (which (AEC) values Classification Ecosystem Aquatic Specific in asample in using the Ion Chef the Ion using ) were included included ) were data for the data for

Filtering using fish fish

the library sequences that that sequences species COI sequences previously used previously COIsequences species

BLASTn

, July Analysis .

p species species Disregarding one Disregarding two rivers. two resence data resence Quantitative Insights into Microbial Ecology (QIIME) (QIIME) software Ecology Microbial into Insights Quantitative to be counted; to be

target and August for the Gr forthe and August primer

to to with default with

TM w

PCR PCR or as show how show as

System (Life Technologies, USA). Technologies, (Life System SAR

- “ diluted template we present

The The and sequence sequence re with with

smaller than smaller

filtered filtered

an important consideration for consideration important an

hit (singleton parameters parameters

to afinal to invasive species invasive

species occurrence to ” the

at asite at mismatches,

to an average error rate of 1% in rate of1%in error average to an ensure ensure

data from data from

artefacts and River, and from 2010 to 2012 to 2010 from River, and and NGS concentration of 55 of concentration tics such as soil type,climate, and soil ticsas such high confidence in high confidence only only

200 changed changed sequences were compared were compared sequences s ) two or , but

capture

or or if itreturned bp, w for PS1 primer design to design to primer PS1 for ere that that

de patterns patterns accepting eDNA eDNA accepting from an expect from

mapped mapped hits (doubletons) (doubletons) hits - do not meet meet the do not replicate -

based

may be may

at least three least at pmoL∙L the the

methods rare to display display to

sequences, sequences, returned returned

species species ed

- 1

and (E)

used used

This article isThis article by protected copyright. All rights reserved. thefor spe areas in those collected samples area, particular a in highabundance in occurs species Ifa site asaproportion. atthe obtained sequences species site. thesame at eDNAsequencesreturned of as Semi methods for analyses co detected species co species of patterns ifthe determine same co pairs species =TRUE) (thresh threshold relationship co spatial nosignificance) (i.e. andrandom negative, positive, determine to Griffithetal.2016) 2013; (Veech “cooccur” package the with Team 2015) (RStudio 0.99.892 methods. the during

- the number of eDNA sequences for ofeDNAsequences the number

Accepted Article capture the DFO using analyses occurrence two sampling methods were methods two sampling - Quantitative eDNA Analysis eDNA Quantitative June, August, and September for the Sydenham River the Sydenham for September August, and June,

signal semi visualized were target species ourfour for eDNA detections Additionally, W .

hole cies as a measure of relative signalstrength. ofrelative asameasure cies s between species s

both sampled rivers both sampled that have insufficient co insufficient that have

at a given site based on its conc its based site on given at a - river - occurrences, we focus on our target target spe our focuson we occurrences, community analysis of species co species of analysis community ,

which removed any species pairs pairs species any removed which ,

using using com at sites that were sampled using capture using sampled were that at sites

the default settings of the package the of default settings the bined - occurrence information (Veech 2013) (Veech information occurrence should should a

target species at a specific site divided by the total number number total by the sitedivided at a specific target species

to determine the percent of species detected using eDNA eDNA detected using species of percent determine the to - occurrences were identified. While we report all we report While identified. were occurrences entration of eDNA sequences out of all eDNA ofalleDNA out ofeDNAsequences entration reflect reflect - This method illustrates the abundance of target oftarget theabundance illustrates method This based data and our eDNA our dataand based a - occurrences was was occurrences higher higher

. that do not share any sites notshareany do that cies. We performed theco We performed cies. proportion proportion The The

species occurrence results from from results species occurrence co . We also kept the default keptdefault the also We . - - of occurrence distribution occurrence based data separately to data separately based - mpleted based methods ande based methods

. eDNA sequence returns sequence eDNA We performed performed We

using R Studio v. v. Studio R using - quantitatively ; this removes removes this ; - occurrence occurrence species - DNA DNA

This article isThis article by protected copyright. All rights reserved. 72 811 seque (and removing lowlab of us visible PCR amplification produced control samples remove DNA 5 total of COI sequence for were returned Next detection plateaued species target our of four all for our for primers both for end 3’ the of bp 5 within mismatches 3’ the of bp 5 within mismatch primers the of one only in f mismatch total 0 with mismatch, primer River Sydenham the and River Grand the in found Design Primer R esults

0 Accepted Article

sequence sequence sequences), sequences), fish

- (no PCR a PCR (no Gen

After Our next Our the one site that returned 5 RG sequences from further analyses further sequencesfrom RG 5 that returned site one the sequences were returned were sequences

eration s per sample ( sample s per se - limit (Figure 2). (Figure limit based contamination level. contamination based t prxmtl 10 approximately at quence reads, all were reads, quence group removing removing

database, mplification

0.22% matched matched 0.22% - Sequence Data Sequence generation sequencing sequencing generation 3 - specific 54 n

ces that did not match any of the fish sequences in our custom database custom our in the fish sequences anyof match didnot that ces (1 range range s

one pecies 70

)

Grand River and River Grand primer PS1 was designed to have have to designed was PS1 primer

We thus concluded that field contamination was low, although we did although low, was field contamination that concluded thus We ad 8.5 and , out of out = or samp or 1

ESD 5 to to n fr ihr h frad r reverse or forward the either for end

RG epae dilution template 75

seven 50

across (2

. ; 5 msace i bt primers both in mismatched %

however 607

% les 079 produced 6.5 million r 6.5 produced

river control river matched or majority or

that returned < returned that

reads/sample

sequences) and 0.18% matched matched 0.18% and sequences) h dlto sre qRT series dilution the 1 84 ,

Sydenham River) Sydenham the corresponding lab control was negative fish negative for was control lab the corresponding

. RG Figure 1 shows the level of forward and reverse reverse and forward of level the shows 1 Figure ,

ing our group ing our

s (68.3 ( which

721 ( site S20 site ).

3 eDNA sequences eDNA sequences 3 After BLAST After

%) 2 67

reflects four of the species the of aw reads

sequences) ) minimum

was contaminated contaminated was

samples with an average of7107 anaverage with samples target species. species. target - specific primers ( primers specific - PCR test. Detection sensitivity sensitivity Detection test. PCR

ing against the custom custom the against ing h P1 primer PS1 the . Only Only . .

. A total of primer, None ofthe354 None

, mismatch mismatch

NMT 0.28 , 24.4 from further analysis further from 9.8 % matched % matched

(1 u tee were there but % PS1 amplified DNA DNA amplified PS1 % had a had % 2 430 736 430 2

683 and returned a a returned and of fishes had a a had fishes of PS1), indicative indicative PS1), o all for

approximate approximate sequences)

lab lab mismatch mismatch SS

reads species fish )

(2 ,

54 no no

This article isThis article by protected copyright. All rights reserved. Accepted River Sydenham North inthe flowing water u and lower in =MTS) water(AEC slow MTS Community samples bottom in count read had greater eDNA samples, bottom than surface samples sequenc 281 also one detected in G40) G10, and reads/sample to 489 = 184 (range sample reads/sample ( Grand Riversites site Article (raRiver the Sydenham the mean of witha persitevariedwidely, reads eDNA sequence samples) River Sydenham removed) surface samples 8 bottom and sequence reads removed) surface samples 18 bottom and sequence reads species 2 (Table Grand River (ra River Grand (S28) (S28)

detected atseven (moderate, turbid,slow) (moderate,

( ) All Grand River sample sites were dominated by cool, turbid water with slow flow (AEC = = (AEC flow slow with water turbid bycool, dominated were sites sample River All Grand RG Supp. Table S2 Table Supp. . and five and The

was detected was and and es (r ), and four ), and remaining 23.8 remaining

with a mean of 701 eDNA sequ eDNA of701 mean a with

from 43 from Grand River site Grand River Species Species ange = 3 to 1 =3 ange

5 samples total samples 5 Grand River sites ( sites Grand River nge 3 nge =

3 sites sites A n

Sydenham River sites( River Sydenham sites sites ge = 4 to 25 734 to = 25 ge 4

and Supp. Table S2 Table and Supp. in in ;

- this to 1372 Occurrence 27 in Sydenham River (S4, S8, S14, S15, S21, S30, and S41) with a mean of mean S41) with a S30,and S21, S15, S14, S8, (S4, River in Sydenham

% ). Sydenham River sample sites were sample River Sydenham ). comprising 50 comprising comprising 54 comprising

7 160 reads/site) reads/site) 160 correspond sequence reads reads sequence

samples in total from both rivers fromboth intotal samples (G6) in a surface sample with 48 with sample asurface in (G6) )

with a mean of 192 a meanof with 9

G15, G15, reads/ pper East Syd East pper

NMT .

reads/ ).

. Sydenham River Sydenham . G17, G18, G17, s

sample

SS segment ( segment

B fish species fish species had greater eDNA read count in surface samples, and samples, surface count in read eDNA greater had )

ences (r ences ( . was only detected in Grand River inGrand detected only was the

Fig. 3 Fig. 4 samples total samples 4 Grand River had a total of total Riverhada Grand sample ( 227 (Table majority ofsampledsites majority )

and and enham River segments, River segments, enham )

G19, G19, 062 .

AEC = LTS AEC = 1 to ange =10

Finally, sequences per sequences ).

3 a from from from

RG sequences) sequences) ) and G24; and . mean of mean

resulted

was was 1

ESD 65 bottom and 101 and 65 bottom 50

842 ) with a mean of mean ) a with

(low, turbid, slow) turbid, (low,

not found at found not bottom and 90 and bottom

(113 Grand River and 164 Grand Riverand (113

eDNA sequence matches. matches. eDNA sequence

had higher sequence reads in reads had higher sequence

also eDNA 3 Fig 3

in a total of of total a in 044 reads/site) 044 1 matched sample 28

dominated by cool, by dominated )

. sequences sequences sequences per sample in per sample sequences 3 ESD 44 725 . and warm, and

The number of number The

(range = 59 to 485 485 to =59 (range

one w 61

280 sequences per sequences 280

ere at three surface surface samples 6

co surface surface samples

10 087 ; Sydenham River Sydenham returned eDNA eDNA returned

Fig. 3). Fig. 3). . detected in four detected - per sample sample per occurring NMT turbid, slow turbid,

sites (G7, sites

eDNA eDNA

was was

turbid, turbid, NMT RG

native native

(8 (8 was was

(7 SS -

This article isThis article by protected copyright. All rights reserved. co positive had one Table were There further analysis. 54 (Fig. occurrences were pairs species for ( pairs species 492random and negative, 7 49 positive, (62.3959 1 producing analyzed 17siteswere across species 56 River, Sydenham ( occurrences remaining co insufficient due to removed thatwere pairs sampling) co species chance, andrandom < 0.05), expected, methods River the Sydenham methods both detected using and River Grand detected in methods

Acceptedspec Article 50

S detected species across 43 across detected species 3 ies across 43 sites, in which 1 43sites,inwhich ies across eDNA For co Species thatcapture species ofthe and62.5% detected 82.6% method the eDNA Overall, P D , %) pairs %)

, producing 1 , producing ). For NMT, ESD, NMT,ESD, ).For producing results for positive for producing results > 0.05). > - P 371 occurrence analysis included analysis occurrence

< 0.05), negative 0.05), < Fig.4A

species pairs resulted in 13 posi in resulted pairs species

- were removed and 581 pairs were analyzed were pairs 581 and were removed Using presence/absence data from capture data from presence/absence Using

- based detection in detection based analyzed further. There were 42 positive, 0 negative, and 236 0and negative, positive, 42 Therewere further. analyzed occurrence was analyzed using presence data presence using analyzed was occurrence - , Supp. Table Table , Supp. , , Supp. Table S Table , Supp. occurrence with Common Carp ( Carp withCommon occurrence l

y respectively (Table 4). (Table respectively

081 species pair pair species 081 - occurring occurring and SS and 65 ly co , eDNA detected 86.2% and 72.0 86.2% , eDNAdetected

positive, 0 negative, and 0negative, positive, S

- sites. there were no significant negative or positive co positive negative or were nosignificant there 3 occurring 3 A species pairs (occurrences not different from that expected by expected that from notdifferent pairs(occurrences species C

) ). In the Sydenham River, theSydenham ). In 137 (79 137 the Grand River, a total of 1 of River, atotal the Grand

the Sydenham River the Sydenham in the G in the ly co A total of

combinations of which 710 (65.7 710 which of combinations 47 species across 29sites 47 speciesacross

- species pairs (occur together less often than expected, expected, than often less (occur together pairs species occurring . 5 rand River, based on DFO capture based on River, rand - tive, 11 negative, and 347 random species co species and347random negative, tive, 11 %) were removed, and removed, were %) occurrence data. data. occurrence 947 (77 947 Cyprinus carpio Cyprinus

species pairs (occur together more often than often more together (occur pairs species Fig.4A 229 . 3 ,

%) species pai species %) respectively (Table 4). For all species species 4). all For (Table respectively

, random co random -

% of the total in the Grand River and River Grand the the totalin % of Supp based methods in the Grand River, Grand in the methods based for species co species for 1

Co 431

f 225 rom (that were pr (that were . Table S . Table - occurrence ) in the Grand River. Grand ) the in

294 p sp

540 s 540 capture ecies pairs pairs ecies - ecies pairs were analyzed analyzed pairswere ecies occurrences ( occurrences %) were removed. removed. were %) rs were removed and 278 and removed were rs

species pairs remained for pairsremained species 3 - pecies pairs of which which pairsof pecies occurrence B ). -

based and and based esent in the eDNA eDNA inthe esent analysis for the for analysis -

based based data random co random - were analyzed for were analyzed occurrences. Fig.4B, Supp. Fig.4B, . There were There .

- based based eDNA . In the Inthe . Species Species - -

RG RG and and

our our

This article isThis article by protected copyright. All rights reserved. Accepted in upstream (>farther 100) numbers read sequence eDNA high detected but we need the without interactions species and potential habitat use of comparisons us tomake and allowed the distribution on information approach eDNA/NGS combined our that show NGSanalysis eDNA and analysis. the f datafor gathered distributional we also sequence custom a using metabarcoding Risk Species at of Detection Discussion (Fig. 5B, downstream Article moving when River increase Sydenham inthe proportions detection whereas pattern, an oscillating respectively). sequences 577 as identified theremaining NMT and SiteS21,3 In respectively). sequences RGand as identified theremaining ESD and S21 NMT insite the p detection loweDNA very had species target SAR fish of total number Semi majority of the s of majority - Quantitative eDNAData Quantitative to physically capture individuals. capture to physically ESD was detected detected ESD was By using a of proportion the illustrates Figure 5

Across both both watersheds Across

(30.3% PCR primer set designed to amplify a a toamplify designed set PCR primer - ites ites assigned NGS reads NGS assigned

Supp ). ;

where these detections these In site G01, a total of 375 eDNA sequences were collected, 116 belonging to 116belonging werecollected, sequences 375eDNA total of siteG01,a In mainly . Table S . Table

Downstream

the species was detected, except for ESD in site G01 ESDinsite for detected,except was the species of , we detected 65 of 82 65of , wedetected

in in

invasive, native, and rare species in flowing freshwater systems, systems, freshwater in flowing rarespecies native,and invasive, 2 the the B). B). Golden Redhorse ( Redhorse Golden

712 eDNA sequences were obtained and 1 and obtained were eDNA 712 sequences

lower East Sydenham River using using River Sydenham East lower

arranged -

database included all four of our target target our fourof all included

eDNA percent detecti percent eDNA Brindled Madtom ( Madtom Brindled i eDNA eDNA sh community community sh

with community with

roportions from from , NGS reads NGS

we not only detected our species of interest, but but interest, of species our onlydetected we not

Moxostoma erythrurum Moxostoma upstream to downstream sites downstream to upstream fishes fishes broad broad that allowed that

(< 10%; Fig.5A,Supp (< 10%;

for each target species eachtarget for known to inhabit the to inhabit known range range Noturus miurus Noturus - specific primers was able to provide provide able to was primers specific on of RG in the Grand River the Grand in ofRG on of of fish fish SAR and invasive invasive and SAR

species capture species )

(16 )

the

and RG (11 and2 (11 RG and co - 124 belonged to belonged 124 based . Table S . Table , 2 and 87 2 and

- two rivers followed by followed (30 occurrence upper East East upper

relative to the to relative . .9%) The three The

methods, methods, species 2

B) across B) across and reflects

using

. We

This article isThis article by protected copyright. All rights reserved. at itwas the fact that sequence reads, based on was site GrandRiver atone NMT of thedetection While water samples. ( unlikely highly is eDNA residual timefor suchalong residence however, inthe 1970’s; presence to theirknown dating eDNA residual wedetected that possibility is An alternative species. target our flavus sequences NMT COI a96% had sequences oureDNA Furthermore, 2002). (COSEWIC behaviour missed by perhaps River, Sydenham 5 (Fig. sites fourindependent in least detection at with coupled matches eDNA sequence of number the high al.2012), et (Edwards since 1975 River the Sydenham reported in not been have NMT Although presence. NMT of historical reports and records capture withDFO donot agree eDNA detections the cases, both In (G6). Grand Riversite eDNA, Riverusing inGrand only detected SS was upstream. to bedetected eDNA sources downstream for mechanism there isno reflect target eDNA. samples. downstream eDNA inweaker resulting locateddownstream, individuals fewer there are to isolated based metho signal the eDNA of flow hydrological the with consistent populations new of thediscovery perhaps or upstream individuals of movement andin River Sydenham Accepted e Thomsen Article )

DNA sources upstream from the site the from upstream DNA sources or Brindled Madtom ( Madtom Brindled or NMT was detected detected NMT was the the t al. t al. 2012; ds detected ESD in several sites throughout Grand River whereas eDNA detections were detections whereaseDNA River Grand sites throughout inseveral ESD ds detected Since eDNA has the potential for downstream downstream for the potential has eDNA Since upper Grand River. Lack of ESD eDNA detections downstream could also indicate that indicate also could downstream detections ESDeDNA of Lack River. Grand upper in Balasingham et al. 2016 etal. Balasingham

Fewer individuals in a larger river system can also lead to rapid dilution of dilution to rapid lead also can system largerriver in individuals a Fewer

our custom database, and database, custom our North Sydenham River. Sydenham North in Sydenham River and returned 48 eDNA sequence matches at one atone matches 48 eDNAsequence returned River and Sydenham in Noturus miurus Noturus and this distribution this and capture a single

of detection of - ) based , themos , )

upstream site indicates itis indicates site upstream NMT detected we as , especially The eDNA The 90 A

) suggests that there is a source source of thereisa that suggests ) methods duetolo methods -

92 agrees with DFO capture data (DFO 2013). 2013). (DFO data capture DFO agrees with t closely related species that related t species closely %

and is thus unlikely an artifact unlikelyan isthus and (Thomsen & Willerslev 2015); however, 2015); however, & Willerslev (Thomsen

- sequence match sequence based distribution may be indicati may be distribution based flow

in lotic systems, eDNA signals can eDNAsignals loticsystems, in w abundance and cryptic cryptic and w abundance - ,

for Stonecat for 99% identity match to identity match 99% concentrations in in concentrations at best, at e ; however, it is not itisnot ; however, DNA in surface surface DNA in 48

a signal of avery of a signal co

recovered recovered - NMT occurs with occurs . Capture .

( Noturus Noturus eDNA in in eDNA ve of

This article isThis article by protected copyright. All rights reserved. Accepted high with invader, aggressive known TheRG rivers. is a match reads eDNA sequence (Thompson and local habitat ofInvasive Species Detection target SAR. capture alongside be eDNA to used for the potential ourresultshighlight Overall, sampling. and thewater methods eDNA of sensitivity detection the higher to likely attributable are differences the detections, capture 50years. over for extirpated Gar identified whereaseDNA sampled sites Article ( Darter Slackwater the rare identified netting seining and brucei Patch for probability the detection had 20X eDNA that (2016) found b not had whereit asite eDNA at ( Loach Weather the European detected al. (2015) et Sigsgaard example, For et al. 2015 Sigsgaard 2015; Johnston etal. 2 (Tréguier invertebrates species,including avariety of of known range than species, orcryptic forrare sensitivity, especially thi at taken river control no was there (although species foranyfish amplification produce not did Grand River the region of individuals few, isolated

( Lepisosteus oculatus Lepisosteus ) than traditional leaf litterbag surveys. Janosik and Johnston (2015) showed that tra that showed (2015) and Johnston Janosik litterbag surveys. leaf traditional ) than - The spread of aggressive invasive species such as the RG can cause detrimental changes to changes detrimental cause RG can the species suchas invasive aggressive of The spread based and the potential for target species movement between the time of the capture surveys surveys capture ofthe time the between movement targetfor species the potential and

& Simon 2014; Burkett & Jude 2015). Not sur Not Jude 2015). Burkett & 2014; Simon &

methods, or as astand as or methods, negatively negatively . s specific site). Previous work has shown that eDNA has a higher detection detection ahigher has that eDNA work hasshown Previous s specific site). Although eDNA sample contamination is a possibility, lab controls for this for controls lab a possibility, is contamination sample eDNA Although ) eDNA ) impact native biodiversity via competition and direct predation directpredation and viacompetition biodiversity native impact

ed RG DNA, with detections in93 withdetections RG ed DNA, Hence, while our eDNA detection of SAR did not directly correspond to to correspond directly not SAR did of detection eDNA Hence, our while

in Thames River Thames in een detected by detected een ; Boothroyd et al. 2016 etal. Boothroyd ; - alone detection methodology formo methodology detection alone it

in 23 of the sites. the sites. 23of in

where it had previously been thought to be to thought been previously ithad where capture capture - density capture density prisingly, a large portion a largeportion prisingly, Etheostoma boschungi Etheostoma - based Boothroyd ) and amphibians (Pierson et al. 2016). et 2016). al. (Pierson amphibians ) and -

based % of all sampled sites allsites sampled % of

methods for 17 years. Pierson et al. Pierson 17 years. for methods

- methods, and has extended the hasextended and methods, Nosed Salamander ( Nosed Salamander

et al. (2016) detected Spotted Spotted detected (2016) et al. - based based nitoring and mapping mapping and nitoring M 014), fish 014), detections in both the both detections in isgurnus ) one in (76.1 across es

%) fossilis

out of 49 of out (Janosik & (Janosik Urspelerpes Urspelerpes

of our our of ditional ditional

both both ) using ) using This article isThis article by protected copyright. All rights reserved. at were captured eDNA contributing few individuals capture after the fa RG invasive the rates for species. invasive of the spread when monitoring S Table Supp. reads/species; to 1 =1 (range sites at species those forallother reads eDNA sequence number of the low overall eDNAquality/quantity lower likelydue to previously had detections RGeDNA positive notproduce that did to designed traps RG pheromone example, For considered. be should tributaries GreatLakes large these two RG tolimit Th fishbiodiversity. for hotspots localized may be th including species) (≥ 10 species detected fish data, capture past of weredownstream detections withRG eDNA extra sites howevertwo records, capture abundance at low capture captures past RG of upstream using captured individuals were detected analysis 2010). eDNA et al. (Poos tributaries Lakes ofGreat invasion secondary sinceits River Grand and River Sydenham

Accepted rivers inboth rther upstream Article - Interestingly, sites in upper Grand and East Sydenham rivers had an overall higher number of of highernumber an overall had rivers Sydenham East and Grand sites inupper Interestingly, based . Thus, RG . Thus, its attract only RG would be ideal (Kornis et et al. (Kornis beideal RG onlywould attract

hence numbers while maintaining the relatively higher biodiversity in the upper reaches of of reaches upper in the biodiversity higher relatively the maintaining while numbers

methods were used to when eDNA sampling occurred sampling eDNA to when used were methods - neighbouring sites sites neighbouring based based surveys the invasion front the invasion

downstream migration of RG eDNA may have contributed to those detecti to those contributed have may RG eDNA of migration downstream was

relative present at those sites and the failure of our eDNAana our of the sitesand failure atthose present 2 A sites ). The The ). , as would be expected given that that given our expected wouldbe , as RG in nine Grand River andfive River Grand nine in RG , in capture

to . , indicating that , indicating dicating potential movement of the invasion front upstream with front upstream the invasion of movement dicating potential At capture . The . The in low numbers low in impact

the the - b new ased sites where sites where ( or PCR inhibition PCR or -

based of false negatives negatives false of

Sydenham River sites were also upstream from past frompast upstream were River sites also Sydenham

methods. The The methods. e three target SAR (Fig. (Fig. 3 target SAR three e However, i However, e use of appropriate, non ofappropriate, e use

methods, and eDNA extended the RG range range theRG extended eDNA and methods, it .

had had Our captu

been sites where RG were captured captured RG were where been sites

2012

likely eDNA detect eDNA n this study, eDNA had higher detection higherdetection had eDNA this study, n ) re

in those samples those in ; Smith 2014). Curiously, the few sites the few Curiously, Smith2014). ; new

based using Sydenham River sites where no no siteswhere River Sydenham moved upstream from the time the from upstream moved

Grand River Grand

eDNA methods can be methods eDNA

, or possibly missed when in in missedwhen possibly , or sampling sampling methods methods ion showed ion showed ), indicating - invasive management of of management invasive . This is supported by by issupported . This did not not did ranged from from ranged RG lysis to detectlysis them is sites were sites were RG in

that those areas areas those that detect all of those of all high 1

- RG, 3 ons.

that years years

RG RG 36

This article isThis article by protected copyright. All rights reserved. Accepted positive species of knowledge patterns dispersal in differences habit or highly divergent resource River the Sydenham Riverand the Grand both tributaries where some Shiner Spotfin and Catfish the Channel between differentiation habitat bedriving River may theGrand water in cooler The flowing). slow habitat but the andE lower sites. at individual together detected werenot they theserivers, in were found both species while Hence, co negative of noevidence showed Articlespiloptera methods albeit rivers, inboth occurrences species. community critical fish of the allows identification potentially Species Co both methods detection sites ,

eDNA eDNA In the Sydenham River, both Channel Catfish and Spotfin Shin Spotfin and Catfish bothChannel River, theSydenham In that demonstrating The majority of species co species of The majority Co C (Fig. 4A) (Fig. apture ) co negatively - - Occurrence and Community Composition Community and Occurrence occurrence data help to explain patterns in target species spatial distribution and and distribution spatial species intarget patterns explain to help occurrence data and capture and ast Sydenham River where Sydenham ast fish utilized co - based methods identified statistically significant po significant statistically identified methods based . species interactions. Overall interactions. species

- For example, example, For . occurrences in both rivers (Fig. 4B). rivers both in occurrences

Thus, Thus,

by these two species in the Grand River River Grand the in species these two by - have based based - occurred with Channel withChannel occurred false false the

ideal approach to fish community characterization is a combination of of combination isa characterization community to fish approach ideal methods negative negative . rmer water. rmer water. using the capture presence data, presence the capture using

many many at use between species pairs, species between use at - occurrences detected using eDNA were as expected based on our onour based expected wereas using eDNA detected occurrences - occurrence in the Sydenham River (Fig. 5A, 5A, River (Fig. Sydenham inthe occurrence , as the Channel Catfish was found mostly in downstream sites indownstream mostly found was Catfish Channel asthe , the the fewer species pairs pairs species fewer , especially detections occur water was warm, turbid, and slow moving (AEC = LTS), (AEC= moving andslow warm,turbid, was water Hence, despite habitat homogeneity being fairly high in fairlyhighin being homogeneity habitat despite Hence, , t ,

our eDNA data identified statistically significant significant statistically identified data eDNA our he few negative co negative few he Catfish ( Catfish in in

critical critical

Only the RG eDNA data showed one positive positive one showed eDNAdata RG the Only Ictalurus punctatus Ictalurus

us were detected than with the with the than were detected in early invasion invasion early g

interactions

both both

was of was potential potential Spotfin Shiner ( Shiner Spotfin - er were caught in sites in the in the in sites caught er were occurrences may represent may represent occurrences capture siti type MTS (cool, turbid, and turbid, (cool, type MTS ve and negative conegative ve and resource competition resource

for SAR and invasive invasive SAR and for monitoring ) in the Grand River, but River, but theGrand in ) - based Supp Cyprinella Cyprinella

and eDNA and . Table S . Table .

eDNA - 2

, o ). r This article isThis article by protected copyright. All rights reserved. primer targeting a universal correspond sites. in certain agroup of affect may also fine in variation may which migrate downstream degrade, or techniques capture RG. highly invasive co and target invasiv with our co other with patterns spatial to their due SAR target islikely our stream MTS by dominated were segments channel flow low and flow lowgroundwater by dominated areawas the study River segment, North Sydenham co significant that most occurrences habitat channel flow 2012 the river throughout co - -

Accepted species. occurring Article fairlycommon thatisalso aspecies River, theGrand Carpin Common with occurrence ,

thus ) .

throughout throughout - In the Grand River, allsample Grand In the based based ,

- does not display any spatial limitations anyspatial display not does specific primer may result in primer bias and primer bias in result may primer specific

such that low that such eDNA detection rates detection eDNA linearly with target species DNA concentration. For example, Pereira et al. (2017) tested et al. Pereira Forexample, DNA concentration. target with species linearly ,

since the habitat type was was type habitat since the with with presence data presence However, NGS read coun NGS read However,

warm, turbidwaters warm, cool, turbid water (AEC =MTS) (AEC turbid water cool,

The greater number of significant negative species co species negative significant of number greater The - our scale eDNA species distribution patterns distribution eDNA species scale

and was also observed to also was and This also highlights the broad range of habitats t ofhabitats range broad the highlights also This e species as the RG was detected in virtually e virtually in detected the RG was as e species

- study area. Th area. study occurrences are based on species species basedon are occurrences - density Legionella pneumophila Legionella

- is likely du is likely occurring species. Similarly, no significant co nosignificant Similarly, species. occurring species aremissed species among

low s is lik

were collected were sample size sample size whereas the whereas similar e to higher detection thresholds detection higher e to t

species due to varying rates of DNA release intot release ratesofDNA to varying due species

in meta in ely explains the lackof ely explains types result in biased in result

feed throughout the study area, increasing the likelihood likelihood the increasing area, the study throughout . The . The , ,

highlighting therelatively highlighting or or barcoding studies is studies barcoding

which which on dreissenids on

V4 and V5 16S rRNA regions in 16SrRNAregions V4 andV5 ( l strong ecological interactions interactions ecological strong ower and ower Shaw et al. 2016 et al. Shaw general at sites with sites at poor poor limits limits preferring

species co species (Davy et2015). al. (Davy amplification of low abundance species species abundance oflow amplification

lack of si of lack u the ability the

pper East East pper statistically significant negative co negative significant statistically , the diet of RG , thediet of

high groundwater flow groundwater high

very sample site in both rivers siteinboth very sample similar habitat resourc habitat similar hat areexploit hat )

gnificant co gnificant . Conversely, eDNA can settle, eDNAcansettle, . Conversely, generally found to to found generally - occurrence patterns, patterns, occurrence

- for capture for occurrences obtained using using obtained occurrences

to detect to - Sydenham River Sydenham occurrences were found found were occurrences

homogenous homogenous

Additionally, the use Additionally, ( - Ru occurrences with with occurrences relative to relative

spiked drinking drinking spiked - able by the by able significant significant based based etz III etal. etz III riverine riverine and he habitat he es. In the Inthe es. and the

other other

fast fast

This article isThis article by protected copyright. All rights reserved. are asthey expected favo abundance proportions produ which generally et 2013 Carew al. etal. (Amend 2010; species abundance morein or, confidence) indicatesgreater signal (stronger confidence fordetection a proxy proportion site produced per reads as each species for data eDNA presence Strength eDNA Signal 2016) through multiple marker better visualize DN s communities. inmock species abundance individual with linearly increased count ( NGS used (2015) also (R correlation pneumophila different ofsix (a mixture mock communities ofeDNA reads and Proctophyllodes clavatus Proctophyllodes uggest that future eDNA studies should spike should eDNAstudies future uggestthat

Accepted Article to DNA targetspecies’ individual with spiked replicates efficiency against thePCR compare A and nuc urable habitats .

lease

NGS reducing primerbias reducing metric provides a provides metric data data

in neighbouring sites sites neighbouring in data ) was quantitative of ) quantitative was - 2 free

= 0.88 for nuclease for = 0.88

primer bias and amplification efficiency. We also suggest future studies studies suggest future We also efficiency. andamplification bias primer

loci, are provides provides water . For the three SAR, eDNA proportions were generally less than 10%, which is which 10%, is than less generally were eDNA proportions SAR, thethree . For

consistent with the expected relationship between between relationship expected the with consistent

as this approach has been shown to been shown has approach this as at at

and COI degenerate primers COI degenerate and ced

very low very for each for

and higher

a 10 semi

semi (Wilcox et al. 2013; Miya et al. 2015; Evans et al. 2016; Shaw et al. Shawet etal.2016; Evans 2015; et Miya al. al. 2013; (Wilcox et - P. sylviae P. fold dilutions for for dilutions fold

densities species (Fig. 5, Supp. Table S Table (Fig.5,Supp. species eDNA reads perreads site eDNA - in - - L. pneumophila L. quantitative quantitative free water and R water and free quantitative measure of measure quantitative

both rivers, indicating that the eDNA semi eDNA the that indicating both rivers, ) in different abundance ratios and found that NGS read read that NGS andfound ratios abundance ) different in semi

and would contribute to little to contribute and would - quantitative quantitative field metric metric for comparative comparative

abundance for each d for abundance to measure abundance of two bird feather mites mites bird feather oftwo measure abundance to - 2 collected eDNA samples collected eDNA

= 0.89 for drinking water). drinking = 0.89for

than other species, other than

; Elbrecht & Leese 2015 &Leese ; Elbrecht species abundance, abundance, species increase species detection species increase proportions of the total number ofeDNA number ofthetotal proportions signal Legionella NGS analysis. The authors found authors The NGS analysis. 2

B ) .

strength This eDNA sequence read read sequence eDNA

sp. Including the spiked spiked the Including sp. ilution with ilution species abundance and and abundance species the the

had similar eDNA eDNA had similar

and can and

eDNA in in eDNA with all target target species’ all with thus -

quantitative quantitative Diaz ) . For

Nevertheless, w Nevertheless, we visualized o visualized we ,

- a thus

Real et al. et Real sensitivity sensitivity the water water the strong strong

example, RG example, incorporate incorporate ,

be used as as be used directly,

NGS L. L. ur ur e ,

This article isThis article by protected copyright. All rights reserved. with large for with together and NGS analysis eDNA employ should studies refined, future based possible habit limitations, s has characterization eDNA community d species overall and species interactions key identifies assessment Community sameenvironment. the inhabiting fromallspecies template DNA contain eDNA samples co analysis eDNA program. also sites no several detected in detect can successfully aone that demonstrates difficu inhabit rare,cryptic, or are that species sensitivity for co to target and harmful identification capture physical the using determined specieswas offish the distribution past, the In plans. SAR to Conservation species Conclusion proportion only samples high were proportions whereSAR eDNA cases the In collected samples.

Accepted and structure mmunity Article detected the invasive RG at sites RG atsites detected invasive the critical target species. critical target at (e.g. biodiversity biodiversity hotspots) (e.g. at facilitate the facilitate present present Overall, oureDNA Overall, - scale monitoring of whole community structure and important interspecific relationships relationships important interspecific and structure wholecommunity of monitoring scale

of rareeDNA. of

included included and management management and of individuals, but those methods are logistically difficult, expensive, unintentionally unintentionally expensive, difficult, logistically are methods butthose individuals, of

on presence datapresence for on in both the Grand and Sydenham Sydenham and the Grand both in preserv amplified DNA from three fromthree species DNA amplified the majority - coupled coupled with -

occurring species, harmful to the ecosystem, and may exhibit low detection detection exhibit maylow and the ecosystem, to harmful occurring species, , time sampling effort for water from two very large Great Lakes tributaries tributaries Lakes Great very large two from water effort for time sampling

- thus

based based species t identified

ation of ,

programs require require programs determine important species co species important determine

and can and

critical habitat or critical habitat of the of in

not in identified not NGS dividual using - detection

contemporary , also provide also

thus

capture

target species. As eDNA methods continue to be to continue methods AseDNA species. target ,

focus focus r detailed detailed iver

approach uch data - based

to the DFO capture the DFO s s

management management 72 (86.4% and

, develop spatial develop the opportunity to passively assess to passively the opportunity

fish thus providing a greater chance for chance greater providing a thus information on the spatial distribution of distribution thespatial on information

methods. Moreover, our eDNA analysis analysis eDNA our Moreover, methods. lt to sample areas. Our study Our study toareas. lt sample can be used to screen screen for to can beused

identified

community, including SAR including community, - occurrence or interactions, since interactions, or occurrence istribution across sites. across istribution assessment in ways not not ways in assessment .4% respectively). .4% respectively). -

based fish inventory based fish ly at least 70% least at (approximately 30%), those those 30%), (approximately explicit capture

management management

- of the known theknown of based methods based

critical critical ,

which which were While

and

a high a high , This article isThis article by protected copyright. All rights reserved. COSEWIC J Caporaso Carew ME, VJ,Metzeling Pettigrove L,Hoffmann AA (2013) Burkett EM JE,Bronnenhuber DM, BA,Higgs HeathDD.(2011). Dufour strategies, invasion secondary and Dispersal rangeexpansion NE,Boothroyd M,Mandrak FoxM,Wilson CC(2016) K,Evans A,GilbertBohmann MTP MA, Turner DNABarnes ecology CR(2016)andof environmental implications conservati The for KD,Balasingham Walter RP,DD Heath DA,Armbruster Pry T LWJ Anderson AS,Amend Seifert TD(2010) microbial KA,Bruns Quantifying communitieswith 454pyrosequencing: sequence does R P OFTHIS DISCUSSION HEPBURN DR. SA PATEL, MARIAM SARAJAM BY PROVIDED OFWATER COLLECTION G RESE RISK SPECIES AT ANDENGINEE SCIENCES OFFISHER DEPARTMENT (NSERC) OF FUN WAS THIS PROJECT Acknowledgments EFERENCES Accepted Article MC KELLY A. ÁSPÁRDY, SUBBA data. 45 rapid identificationmacroinvertebrate of bioindicator species. diversity diets and St.Clair inthe River, Michigan. 20 Round nonindigenous geneticsof the Goby, 1119 ( spotted gar threatened in Ecology &Evolution Genetics a river ecosystem. 29 Invasions abundance count? . , 1845 ,

S49 (2002) G, .

, Jude DJ(2015), Jude Long

Nature Methods

FROM THE UNIVERSITY UNIVERSITY THE FROM - Kuc

S52

R , - CANADA, CANADIAN CANADA, (2005) , 1859. 17

AO CHAGANTI, AO CHAGANTI, 7

COSEWIC assessment and update and reportCOSEWIC on status assessment the zynski . , , 1

1003 - 17.

(2008) Limit(2008) ofblank, l California’s reaction to

J, Stombaugh J J, Stombaugh -

1016. MYCHEK JUSTIN MEEM, Molecular Resources Ecology MolecularEcology ARCH FUND (SARRFO) G (SARRFO) FUND ARCH

, ROJECT. 7

29 (5): 335 DED BY THE DED BY RING RESEARCH RESEARCH COUNCI RING

SAMPLES, EQUIPMENT, EQUIPMENT, SAMPLES, Lepisosteus oculatus NICHOLS IESON, STACEY MCINTY STACEY IESON, IES AND OCEANS (DFO) ANDOCEANS IES , - 358 term impactsRound invasive of Goby et DR. DR. - al 367. -

336

. ( (2016)Residual eDNAdetectionquantitative assessedby sensitivity real

et al XIAOPING HE, XIAOPING 2014

AQUATIC INVASIVE SPE INVASIVE AQUATIC -

O’ROURKE, JASON BARN JASON O’ROURKE, OF WINDSOR OF , .

imi 19 (

Caulerpa taxifoliaCaulerpa NATURAL SCIENCES AND SCIENCES NATURAL 2010 )

Environmental DNAwildlife for Environmental biodiversityand monitoring. biology , 5555 t of detection and limitt ofq Neogobius melanostomus ) ).

QIIME allows analysis of highQIIMEanalysis of allows Aquatic Conservation:FreshwaterAquatic Marine and Ecosystems Environmental detectionhabitat DNA (eDNA) and of occupancy - , 5565.

- doi: 10.1111/1755 doi: LONDER, AND CALVIN K CALVIN AND LONDER, Journal LakesResearchGreat of RANT TO RPW, DDH, AN RPW,DDH, TO RANT DR , FOR AID INPROTOCO AID , FOR Environmental monitoring next Environmental using generation sequencing:

RE, DILRAJ SANGHERA, RE, DILRAJ AND CATCH DATA. DATA. CATCH AND SPECIES AT SPECIES L (NSERC) L (NSERC) . : a model for invasive species forinvasive : amodel rapidresponse. KYLE WELLBAND, KYLE WELLBAND, Frontiersin CIES NETWORK CIES Neogobius melanostomus Northern Madtom - 0998.12598. DISCOVERY GRANT TO D TO GRANT DISCOVERY UCZ, AND ALEX PRICE PRICE AND ALEX UCZ, uantification. R

, in Great Lakes tributaries., inGreat Lakes

ISK ENGINEERING RESEARCH ENGINEERING Zoology -

throughput communitythroughput sequencing PROGRAMME LABORATORY LABORATORY

ELLENDOCK. THANK YO THANK ELLENDOCK. RYAN SCOTT, SCOTT, RYAN D NEM , L DESIGN AND AND L ON DESIGN , The

41 SAMEER JAFAR, SAMEER 10

(CAISN), THE (CAISN), Noturus stigmosusNoturus , 862 , doi:

Clinical Biochemist Reviews . . on genetics. on genetics. -

872. 10.1186/1742 on fish community on fish WE THANK ROBIN THANK WE , A NATURAL A , NATURAL FROM DFOFOR FROM

SUPPORT SUPPORT AND RUSSELL AND RUSSELL Molecular Ecology, DH , AND A AND ,

Biological Conservation COUNCIL COUNCIL

KETA KETA in Canada. in Canada. - - , GOING GOING time PCR intime - 26 9994 , 1107 WAS WAS U TO Trends - 10 , - -

This article isThis article by protected copyright. All rights reserved. KE,Klymus Richter CA,Chapman DC, Paukert C(2015) S Kim TG,Jeong DJ,ReiderJude RH, (1992)in ofGobiidae GR Lakes Establishment Great Smith basin. the CL,MahonJerde AR(2015) confidenceinenvironmental DNAspecies Improving detection. CL,MahonJerde AR,WL, DM Chadderton Lodge (2015) CE Environmentalan Janosik AM,DNA effective Johnston as tool imperiled of fordetection fishes. H CS,SepulvedaA, RayGoldberg A,J, Baumgardt WaitsLP R,Ginson RP, Walter Ma S,Fukumoto UshimaruA, Finch JE, MA(2013) M,Faber Biological Koops sanddarter traitseastern ( of Ficetola C,PompanonF,TaberletP Miaud GF, NT,OldsEvans BP, MA Renshaw Epp LS,Boessenkool EP S,Bellemain Elbrecht F(2015) V,DNA Can Leese Eichmiller tocapture PWand LM, JJ,Miller Optimizing extract (2016) Sorensen DNA techniques environmental for Edwards AL, Doi T, H,Takahara Minamoto T DFO DFO (2012) DFO (2011)Recovery Diaz T, Dejean Valentini A, Miquel C Deiner K, Altermatt F( Davy CM, Wilson KiddAG, CC(2015)Development and Griffith DM, Veech COSEWIC COSE COSEWIC (2009) Acceptedulme PE Article -

(2013) Real J, Serrano D,Real J,Serrano Piriz R(2015) A, proves metabarcoding successfulof Jovani NGS assessment forquantitative WIC (2011) environmental DNA environmental metabarcoding. paststudying andpresent ecosystems. Biomass detection quantification and fish. of atRiskSpecies Series.Fisheries ActRecovery Strategy Oceans Ottawa. and Canada, viii +42pp. 5608. in Detection the EnvironmentalDNA of 2012/068. Rep. Advis. Sci. Advis. 2011/020. Sec. Sci.Rep. Advis. of mites case on abundance: the symbiont feather birds. b e88786. f Software, o the Status of Status Endangered Wildlifeon the inCanada. Ottawa.(www.sararegistry.gc/ca/status/status_e.cfm) Xi+45pp. (www.sararegiOttawa.pp. vii49 + populations (www.sararegistry.gc/ca/status/status_e.cfm) Wildlife ofEndangered Status Ottawa.Committeeon the vii inCanada. 15pp. + ( populationof bacteria dynamics insoil. Aquatic Sciences 15 DNA. environmental Biology ofFishes Ecology mudsnailsNew Zealand ( specialist Applied closely speciesendemic and relatedexotic inrivers:of species study giant acase inJapan. salamanders River, comparisonstoamoresouthern with population. Canada, Biology Letters Hypophthalmichthys nobilis reshwater reshwater arcoding:American example the the of bullfrog , 461

(2012) (2006)

Recovery PotentialRecovery of Assessment PotentialRecovery of Assessment

Laurin -

, Ecology 463.

43 –

Eastern Sand Darter Eastern Sand -

69 Rep. 2012/051.

Sequence Relationshipswith Innovative an Metabarcoding Protocol. Y,K Cho

COSEWIC Report Status on and COSEWICstatus report assessment onthe and COSEWICstatus report assessment onthe , Beyond control:Beyond widermanagement implications forthe ofbiological invasions. t

f En urtles. and Quebec populations, in Canada. Committee on the Status of Endangered Wildlife ofEndangered and populations, Status Quebec inCanada. Committeeon the inCanada. 835

, 1

JA, Marsh CJ(2016) Co Probabilistic cooccur: Species AY, , -

, dangered Wildlife in Canada. 2 dangered Wildlife inCanada. Poten 17. 4 -

, 2014 ,

52 847. , Staton 49 98

42 ndrak NE, Beneteau CL, NE,ndrak Beneteau Heath DD - PLoS ONE ,

Minamoto T , 416 , 1889 358

3 Conservation Letters (2014)

) tial Assessment

Transport Distance of Invertebrate Environmental Distance Invertebrate Transport of DNANatural ina Riv 425.

- SK (2012) SK Potamopyrgus antipodarum - 365. et al. et al et

421. - et al. 1893.

Comparison ofdroplet digital quantitative PCRand real ) and ) and , -

10 . Based EcosystemBased AssessmentsQuantify Species Abundance? PrimerTesting and Bias

( et al.

Ammocrypta pellucida (2012) (2015)

(2016) mes of Quantification :

(2015) e0130965 silver carp (

Recovery Strategy for the Strategyfor Recovery stry.gc.ca/status/status_e.cfm) Molecular (2012) Molecular Ecology Resources

of Darter Sand Eastern (

Improved detection Improved alien invasiveof an species environmental through DNA D Northern Madtom Northern

MolecularEcology

from an Invasive Fish Species. InvasiveFish from an Applied MicrobiologyApplied Biotechnology and

roplet DigitalChain roplet Polymerase A basin A (2008) Silver Shiner Northern Madtom ,

(2011) New environmental metabarcodes for analyzing metabarcodes New environmental soil DNA:potential for

150 Hypophthalmichthys molitrix

Ecology Resources month Interim Report.48pp. - Species detection using environmental detectionSpecies using DNAfromwatersamples.

scale DNArare applicationfor assessment environmental of Quantification of eDNA shedding eDNA of Quantification ratesfrom bighead invasive carp - Lithobatescatesbeianus

va 157. “Sight

(2013) lidation of

(2015) ). ( ).

Notropis photogenis Freshwater ScienceFreshwater Ecology & EvolutionEcology - unseen” detectionunseen” rare of aquatic

Experimental andAppliedAcarology

( , Environm

Silver Shiner DarterEastern Sand Noturusstigmosus 21

( Hierarchical genetic of structure analysis habitat inthe Noturusstigmosus Northern Madtom , ocosm fish and and speciesocosmfish amphibian diversityvia Ammocrypta pellucidaAmmocrypta

1821 e nvironmental DNA(eDNA) Ecology Fish ofFreshwater , ,

- 16 16 Occurrence inR. Analysis ental DNA as anewmethod earlyental DNAas for detection of - 1833. , 56 , 29

Environmental Science Technology Ammocrypta pellucida

Notropis photogenis Reaction (PCR) - - . 68. 41.

, ). ) in Canada. DFO inCanada. Sci.Sec.Can. ) Advis. Sci. Journal of Applied of Journal Ecology

, 32

Biological ConservationBiological 5

) in Canada. Prepared forCommittee) in Canada. on , ,

792 ) in Canada. in Sec. DFO Can.Sci.) Canada. Advis. Ammocrypta pellucida 695

PLoS ONE PLoS

( , Noturusstigmosus

98 – - Canadian JournalFisheries of and 708. 800. - , ) in Canada. DFO Can.Sci. in ) Canada. Advis. time forPCR

6105 MolecularEcology Resources Outperforms Real Outperforms

, - 10 6113. m species using JournalApplied of

, in in JournalStatistical of ) in the lower Thames ) in lower the Thames arkers for , e0130324. 22 , er. Canada. CommitteeCanada. 67

, 234

, 209 , PLoS ONE examining examining ) in , Environmental

- , 183 245.

, Ontario , Ontario 49 - 218. Canada. d Journal of etection of , , ,

- 953 49

77 TimePCR ,

9 , –

, 5601 - 84.

959.

, - This article isThis article by protected copyright. All rights reserved. RStudio MA,Renshaw Olds BP, CL, Jerde McVeigh DM(2015)MM, roomtemperature The Lodge preservation filtered of Re S,Ratnasingham Hebert PDL ( (2001) DataSystem BOLD:BarcodeofLife The Port JL,Romero JA,O’Donnell SchwalbPoos AJ, AN,Ackerman M,Dextrase JD F, CoissacPompanon E, Taberlet P Pitt ShinskieJJ, JL,Tavano AL, Pilliod CS,Arkle Goldberg Waits RS, DS, LP SFPierson AM, Spear TW, McKee Pereira RPA, Peplies J,Brettar I,H A, HirschN’Guyen PE, Adrian T MiyaFukunaga M, SatoY, Meixler NE, MS, RL(2011) McLaughlin Webbasedwatershed Mandrak atlas forfishes ofGreat the Lakes Great Lakes. Metcalfe 2013 Series Research Aquatic 2013. B. Schmidt N, Jones S, Melles ML, Jones RL, McLaughlin McKee fishes the of status and biology, distribution, The (1982) BJ Parker PM, McKee Lehto N, Esau C, Gurney CD, Matheson A Maruyama Marson D, EJ(1992)Mandrak NE, Crossman Achecklist Royal Ontario fishes. Toronto,Ontario freshwater of Museum, 176pp. Maho X,HanJ, FanLi Z, G,Wang Y Huang Laramie MB,Pillio Kwok S, Kellogg DE,N McKinney KornisMS KornisMS

Accepted HC, Middleditches BC, Maddison DJ Article from fishes: Detectionfrom fishes: 230subtropical morethan of marine species. Commission.Fishery River, Ontario, Canada. Ontariotechnical ofNatural Resources.52pp. proposal. Ministry Decisions Passage.Movement and Concerning Fish Great Lakes Commission.Fishery 76. samples. DNA environmental of inhibition and precision, accuracy, the on column Zoology elongates,photogenis Notropis Inhibition Journal juvenile and adult f Canadian ManuscriptFisheries Reports of andAquatic Sciences, controlled fieldexperiments. and 198 theinference: of Acase Grand study River Watershed inOntario, Canada. DNA environmental analysis. Human immunodeficiency v melanostomus Library. for invasion lessons biology. (Doctoraldissertat EcologyResources DNAenvironmental and samples assimilation aPhenol into review ofeDNA asurveytoolas inecology. Notes, DNA. environmental Invasions tributariesLakes species forendangered and atrisk freshwater potentialspecies. newconcerns hotspots: waytoanalyzenew biodiversity. multi DNA and amphibian. DNA. 17 for sensitiveand quantitative determination ofthe integrating priorities ofscientistsdecision contributions and and makers. n AR,M CL,Galaska Jerde

Team (2015) DevelopmentTeam forR.RStudio, RStudio: MA.URL: Integrated http://www.rstudio.com/ Inc.,Boston, , 1 -

- Smith JL, Di Maio J, Staton SK, De Solla SR (2003) Status of the freshwater mussel communities of the Sydenham Sydenham the of communities mussel freshwater the of Status (2003) SR Solla De SK, Staton J, Maio Di JL, Smith , Mercado‐Silva 210.

(2011) - Mandrak , Spe , 14 Copeia,

7 , ,

. , 355

aaua , aaaa , odh , iaoo T Minamoto M, Kondoh H, Yamanaka K, Nakamura 60 ,

ar SF, Pierson TW (2015) TW Pierson SF, ar 12

, 1347 MolecularR Ecology Distribution,in Laurentian Lakesimpact, the lifetheir histories Great and gobies ofround tributaries: d DS, Goldberg CS d DS,Goldberg , 1269

- 104 364. 364.

- NE ecologicalbiology,and ) spread implications. scale habitat data. , , 78

(2009) , 3 1358.

- ish. 21 ,

1284. N. Vander Zanden MJ N. VanderZanden

38 Molecular Ecology - Mandrak NE, Stacey D (2010) FishMaP On FishMaP (2010) D Stacey NE, Mandrak 82. , 2045 et al. - PLoS ONE -

The AmericanMid Kalchhauser I,BurkhardtKalchhauser -

45. et al.

MaracciniOC

Survey of the ofthe fish in theassemblages non Survey

et al et al

öfle MG (2017) Development oföfle MG(2017)Development agenus (2015) MiFish, a set ofuniversal(2015)a set MiFish, PCR formetabarcoding primers DNAenvironmental et al. irus -

2050. (2011). Metabarcoding, une nouvelle facon d’analyser la d’analyser nouvelle facon biodiversité/Metabarcoding(2011). une Metabarcoding, a

BiologicalConservation (2017). Decline of a a (2017). ofa giant salamander Decline (2016)

. (2013) (2015) .

(Cyprinidae), and and (Cyprinidae), esources type (1990) ,

Biofutur et al.

(2016) enigmatic environmental an Detectionsalamander of using plethodontid PLoS ONE 9 Freshwater Biology

e114639. The effect of dilution and the use of a post a of use the and dilution of effect The (2014) Impacts of future climate onriverof future hydrological change basedon discharge Impacts R

1 model studies.1 model Characterizing the distribution the salmonidCharacterizing endangered an using of

et al Validation o Validation (2014) (2010) , Effects of primerEffects of

25 , ,

14 land Naturalist (2010) ( 319 . , 2012

JournalApplied of Ecology Factors influencing detection Factors of astream influencing eDNA from

527 (2016) , 8

109

, The detection The aquatic of animalusing DNA species environmental ,

sesn PR niiin rm ui substances. humic from inhibition PCR Assessing

e58316. ion). Retrieved from The University Retrievedion). fromThe ofWisconsin 30 - ) - 541.

. Twenty years of invasion: years . Twenty areview of Holm P(2016 Secondary invasion of the invasionof Secondary – Fundulus notatus Fundulusnotatus - 116. 21.

f eDNA f eDNA surveillance sensitivitydetectioncarpsin fortheAsian of Assessing vertebrate biodiversityvertebrate Assessing ecosystem inakelpforest using Legionella ,

, 183

Nucleic Acids Resources 62

- , template mismatches on thepolymerasechain template mismatches re , 967 , 150

29 - Chloroform Journal – , 37 - microbiomein freshwatersystems.

37. ) Improving invasive ) Improvinginvasive species bymanagement 976. 21) h r The (2014)

- 2916 5 Autc Ecosystem Aquatic 05: -

Line: A Web Application Supporting Science Supporting Application Web A Line: -

50. -

wadeable Riverthe Sydenham in watersof 2003. (Cyprinodontidae) in Canada. Canada. in (Cyprinodontidae) of Fish Biology - specific generation next approac sequencing Royal OpenScience Society ssessed with historical : v + 21p. : v+

, www.barcodinglife.org 51 - Isoamyl alcoholIsoamyl DNA extraction. Ambio , 1450 Science Totalof the Environment Round Goby e es rate lease , apsoa anomalum Campostoma

18 - , 1459. 45 - , extraction nucleic acid purification acid nucleic extraction

, 999

80 , 280 Biological Conservation Biological

235 1005.

Round Goby

of environmental DNA from from DNA environmental of - intodiversity high Great lsiiain o Otro a Ontario: for Classification 289. -

285. records, environmental records, environmental

MolecularEcology , -

Madison Limnology - 2 Canadian Journal of of Journal Canadian dwelling

BMC Microbiology , 150088. h Oe Enzyme Open The

( Neogobius , Molecular Clinostomus Clinostomus Biological action: ,

548 183

- Based Based - – : 70 : 549

a , , -

This article isThis article by protected copyright. All rights reserved. A,XiongW,Zhan HJ HeS,MacIsaac(2014) artifact of Influence removal onrare species recovery in natural complex Ye J, CoulourisG, Zaretskaya I,Cutcutach Ya WrightJ (2001) J, Imhof Technicalb Wilcox KS, Young McKelvey TM,MK Veech (2013) foranalyzingco Aprobabilisticspecies model Valentini A, Taberlet P, C Miaud Turner CR, UyKL, Tucker WL, AJ,Chadderton CL, Jerde Tréguier A,Paillisson J Thomse Thomsen goby, HA, inround Diet SimonTP(2014)Thompson response shift T,Takahara T,Minamoto H Doi T, Takahara T,Minamoto Taberlet E P, Coissac S, Groves Spear JD, WilliamsLA, Waits LP(2015) St. ClairConservation Authority RegionWat (SCRCA) St. Clair Region A,MetcalfeStaton SK,Dextrase atR Species atRiskSpecies 1(Subsections Act(SARA).Schedule 2016. atRiskSpecies Act(SARA).Section 1 2016. Smith JL SN,Singer SoSK M,Simmons Tucker WL A,Chadderton EE,Sigsgaard Carl H,M JLA,ClarkeShaw TC,Weyrich LJ,Wedderburn SD,A(2016) Barnes Comparisonofenvironmental LS, Cooper DNA Ruetz IIICR, MR, predation Reneski in goby Dreissena DG(2012) on of Uzarski Lake Round coastalareas eastern Michigan.

Accepted H, T manaka Minamoto Article Molecular Ecology and habitat in thewestern basin of Lake Erie. p PLoS ONE ( hellbender Sydenham.pdf Report Card2013.http://www.scrca.on.ca/wp River.pdf Report Card2013.http://www.scrca.on.ca/wp atrisk.to aquatic species sararegistry.gc.ca/ http://www.registrelep at http://laws Paper 5052. Current Branch, theOntarioEnvironment. Ministryofthe species. on environmentalbased DNA from watersamples. conventional methodsinmetabarcoding river and survey a system. fish JournalFreshwater Ecolo of communities high using chainprimers reaction. forpolymerase connectivity. Conservation Author importance ofprimer specificity. metabarcoding. water. ( Ruffe 51 technical todetectcrayfish invasive limitations biodiversity. onds. onds. n PF, Willerslev E

, 871 (2014)

PF, Kielgast J, LL Iversen isk 3(Section Act(SARA).Schedule 130 2016. Gymnocephaluscernua Biological PLoS ONE - 879. Methods and Future Future and Needs Methods Canadian JournalFisheries of andAquatic Sciences

, Conservation Authority ReportWatershed Sydenham (SCRCA) Upper (2013a). Card. River: Watershed Female Female

7 (1980)

Everhart RC , Cryptobranchus

Biological e35868. Ecological Indicators -

lois , Hajibaba - Molecular Ecology , M, Dejean T øller PR, Conservation

Round Goby Characterization, magnitude and impactinCharacterization, and magnitude River runoff Grand ofurban the Water basin. Re - 8 , species/schedules_e.cfm?id=3 justice.gc.ca

, 21 ( Yamanaka H,Yamanaka ZI H, Doi Kawabata

2015 e56 ( ity,the Ontario Ministry ofNaturalResources. 2016 ,

Conservation 2565 - -

sararegistry.gc.ca/species/schedules_e.cfm?id=1 584. (2015) throughput sequencing. ei M,ei RiesebergLH

) Environmental Monitoring andAssessment (2013) Using environmental DNA thefish(2013) toestimate Usingenvironmental distribution invasive species in an of - Thom

) et al. Smith JL Environmental DNA

gy The useofenvironmentalThe DNA of an fishes as efficient habitat ofdetermining method

– et al alleganiensis

2573. et al. ackground , ) spread inNorth America.) spread

, et al. (

27 et al. Fish environmental DNA ismoreFish environmental concentratedthan inaquaticsurface sediments Neogobius melanostomusNeogobius

183 sen PF sen (2016) Next . PLoS ONE et al , 171 , (

2012) , 62 e I, Rozen S, Madden TL S, Madden (2012)e I,Rozen Primer (2014)Environmental DNA surveillance for invertebrate species: advantages and , et al

. 25

(2013)Robust detection rareenvironmental of using species DNA:the

, 93 - (2016) Asensitiveenvironmental(2016) leadsinsights tonew DNA(eDNA)assay on

(Master’sDissertation) 2, by Interpretation.MinisterPublished the ofJustice. Accessed April 26, 2016 183 , . (2016)

, 929 - 147 (2015) - 184. BMC Bioinformatics . 102.

r (2003) Monitoring endangered freshwaterMonitoring biodiversity endangered environmental using DNA. , ) monitoring program. eport for the Grand RiverGrand eport forthe

4 - Using environmental DNAmethods toimp , 153.

- -

- (2012) 8 942.

18. generation monitoring environmen ofaquatic biodiversity using

, e59520.

JournalApplied Ichthyology of Monitoring the near Monitoring the Active and passive environmental Active DNA passive surveillance and invasive aquatic of ershed Reportershed LowerEastSydenham: Watershed(2013b). Card. - - –

content/uploads/2013/09/Report content/uploads/2013/09/Report Procambarusclarkia

Status and and ofOntario’sRiverStatus trends Sydenham in ecosystem relation

An emerging tool present inconservationmonitoringand past for PLoS ONE,

Environmental DNA. Environmental ). Accessed on Ap ). Accessedon Biological Conservation

2(1), April on Accessed 42(2), 68(2)). and 19, 2016at

(2012) - occurrence.

Biological Invasions ) Movement Responses toPheromones: Responses Movement An ) Investigation of , ,

Estimation of fish biomass usingEstimation biomass DNA. fish environmental of 9 73 Retrieved Retrieved Universitfrom The 13 Neogobius melanostomus ,

e96928. e96928.

, 134, 76 Biological Conservation - - 83. Global Ecology andBiogeography extinctweather European loach in Denmark

fisheries management p

in freshwater ponds. ponds. in freshwater , ril 25 doi:10.1186/1471

Molecular Ecology Biological Conservation ,

- 283 , 2016 BLAST: Atooltarget BLAST: todesign ,

183 , , 30 - 18 310. , 955 ,

, 3205 , http://www.registrelep 46 - - Card Card

- 52. - 961. rove detectability in a - - - , based onsize, sex, depth, , based -

3222. 2013 2013 , 2105

183 y of

JournalApplie of ,

21 lan. Grand Riverlan. Grand - - , -

Lower Upper 13 Windsor Library Leddy 38 ,

1789 , - – 197 134 45. - - , - East , 131 Sydenham .

1793.

22 , 252 - - - specific - 138. d Ecology

- tal DNA sources sources 260.

, .

This article isThis article by protected copyright. All rights reserved. Sydenham River Grand River from 44 dueto exclusionof site S20 River In total,170 Grand River samples SummaryeDNA of NGS data for Table 2. Note: PS1 PS1 Name Primer ampliconsize (bp). common native G Table 1 Ta input files and parameters u Information Supporting SAMN07659297 on available be will sequences NGS Data Accessibility editedDDH andprovidedfeedback for the manuscript,and sequence f samples and equipment contributed DDH and NEM, RPW, Contributions roup

Accepted Articleb - - les R F

samples

Uni - specific primer

- database, and analyzed NGS data. KDB wrote the first draft of the manuscript, and RPW, NEM, and and NEM, RPW, and manuscript, the of draft first the wrote KDB data. NGS analyzed and database, A No. ofeDNAsequences No. ofeDNAsequences No. ofBottom Samples No. ofBottom Samples No. ofSurface Samples No. ofSurface Samples

tail attached to5’ endofforwardprimers.

( 1 fish ) 09surface, 72

ACGCCACCGAGC ACCTGCCTGCCG 5’Sequence

Annealing temperature used for species from environmental DNA. Associated

(PS1) ( No. Sites No. Sites Supplementary

set sequences sed inthis study - 3’

bottom, river3 controls TATTTGGYGCYTGRGCCGGRATAGT

primer CARAARCTYATRTTRTTYATTCG

( 108 surface, 58 bottom,

Eastern Sand DarterEastern

because of NCBI (

Ammocrypta PS1 pellucida Table

1 developedin this study SRA database (BioProject ID: PRJNA407636 ID: (BioProject database SRA 961 for samples wit

118 4 2 2 4 4 1

will available be onDryad

possible DNA S1, )

S2 the primer set A

) Uni ,

from 43 S2B, S2 S2B,

- Silver Shiner Silver h ≥ h eDNA3 sequence matchestarget to 4 photogenis B

made necessarychanges (

river controls or eDNA analysis. KDB designed the custom the designed KDB analysis. eDNA or Notropis

tail attached to 5’endof reverse primers. contamination 2

720 C, 0 0 0 0 3 1 3 a

were analyzed. 247 Size (bp) Fragment average melting temperature

S3A, S3B, S3C, and S3 and S3C, S3B, S3A, for was 52

)

the detectionof rare, invasive,and

doi:10.5061/dryad.d52q0

o )

Northern MadtomNorthern C

from 43sites and184 Sydenham . .

62.3 85.0 T stigmosus M ( Noturus

(

1 a o

C) 635 total sites reduced to 43 7 3 4 1 1 0

; BioSample Accesssion: BioSample ; )

D) as well as additional as well as

melanostomus Round Goby (T (

Neogobius M 513 208 167

fish ) , 42 99 65 38 70 43 and and

100

species

river river

)

This article isThis article by protected copyright. All rights reserved. Methods Capture Grand River species methods for the Grand River and the Sydenham River. Comparison Table 4 Total S41 S27 S21 S15 S14 S8 S4 Total G6 Sites detected sites. Number Table

Accepted Article

NorthernMadtom

. using bothmethods across bothrivers. -

Based 499 15 363 14 107 0 Bottom of

eDNAsequences detected in bottom andsurface samples for each target

the number of species detected (yes) andnot detected(no) between eDNAand capture

Total 1 1 3 9 48 48 Surface Yes No

136 124

Yes 50 12 38 eDNA Total S40 S39 S29 S4 Total G23 G10 G9 G1 Sites

32 24 EasternSand Darter

423 239 184 5 5 Bottom

9 9 Total

82 36 46

695 489 206 902 673 113 116 Surface Methods Capture Sydenham River

The totalnumber of species (82

- Based

Total Total G40 G10 G7 Sites

Silver Shiner 0 2 1 1 Bottom Total

711 011 700 Yes No

Yes 54 19 35 0 9 9 Surface

fish

eDNA

) is sumof the detected

speciesrisk at in No

28 21

Total 82 26 56

- based

The

number of number

in custom database in custom

joined by the solid solid line bythe joined PS1 PS1 primer mismatches (base pairs, bp) for forward primer (dark grey) and reverse primer (light (light primer reverse grey) primer(dark and forward bp) pairs, for (base mismatches primer ) .

indicate the total number of primer mismatches. The ‘x’ above certain species indicate a primer mismatch for for mismatch primer a indicate certain species ‘x’above The mismatches. ofprimer number total the indicate

reverse primer reverse

mismatch. N = 82 N= mismatch.

species

detected

from both eDNA and capture and eDNA both from grey)

for the eDNA detected detected theeDNA for - based methods based

( out out

This article isThis article by protected copyright. All rights reserved. Accepted detection. the of limit ng·µL ng·µL template with X The species. Lakes fish ArticleFigure PS1. Mean C Mean PS1. - - 1 1

2 for Northern Madtom. Shaded region represents the plateau of the dilution curve a curve thedilution of plateau the represents region Shaded Madtom. Northern for ng·µL Goby, 35.4 Round for . - Sensitivity analysis of the group the of analysis Sensitivity control shown as zero as shown control T

(± SEM) is shown for each dilution (qRT each dilution for isshown SEM) (±

- axis shows the shows axis

(box on Y on (box - 1

for Silver Shiner, 46.4 ng·µL Silver Shiner, for 10 - specific COI specific COI - axis) - fold PCRtemplate fold . Initial DNA template concentrations were 38.4 were38.4 concentrations DNAtemplate Initial . PCR PCR - primer PCR done in triplicate), including theno inincluding triplicate), done PCR

DNA - 1

(PS1) for Eastern Sand Darter, and 30.0 Darter,and EasternSand for

dilution series us series dilution

designed to amplify Great to amplify designed ed for

qRT nd hence hence nd - PCR PCR -

Grand River (43 sites) (43sites) Grand River ( Ammocrypta pellucida Ammocrypta . The ) )

and theinva s patial distri

follow AEC follow sive sive bution in southern Ontario in southern Round G Round ) , Northern Madtom ( Madtom Northern

based on the eDNA detection theeDNA based on

protocol (Melles et al. 2013). et (Melles al. protocol oby ( oby Neogobius melanostomus Neogobius .

Stream class and characteristics and class Stream Noturus stigmosus Noturus

of three species at speciesat three of

)

), in Silver Shiner Silver Sydenham River Sydenham

are shown in colour in are shown risk (

( Notropis Notropis Eastern Sand Eastern

(44

sites)

This article isThis article by protected copyright. All rights reserved. co ( expectations fromrandom not differ co random are interactions species other All than expected. s squares) are (black negativeinteractions and expected, often than co speciesthat squares) are grey (dark interactions eDNA. Positive and(B) methods Figure 4. -

Accepted values). occurrences Article Species co - occurrence matrix for significant co significant for matrix occurrence * Indicates target target species. Indicates P

> 0.05; see Supp. > 0.05;see

- occurrences ( occurrences

Tables S Tables - occurrences (light grey squares and do grey squares (light occurrences

3 A, S pecies that co that pecies P 3

B, S B, < 0.05) for (A) capture for 0.05) < 3 C, andS C, - occur less often occur lessoften - occur more occur 3 D for species species D for - based based

, T ) and the Sydenham River (S River theSydenham and ) Notropis photogenis Notropis he he percent total percent

in eDNA sample sites. Graphs display sites display Graphs sites. eDNA sample in

of of eDNA , and , and

Noturus stigmosus Noturus next -- ) for target species. Panel species. fortarget ) - generation sequences sequences generation , and , and arranged arranged Panel Panel

recovered from sites in the Grand intheGrand sites from recovered

(A) (A) S (B) from upstream to downstream. to upstream from

invasive invasive pecies at pecies Neogobius Neogobius R isk ; Ammocrypta Ammocrypta

This article isThis article by protected copyright. All rights reserved. Number o co "cooccur"). package for54 data presence/absence S Table Supplementary sp Number of co "cooccur"). package for50 data presence/absence S Table Supplementary N co co (negative observed often than River using detected species for56 data presence/absence S Table Supplementary 371. N was analyzed pairs(N) species of Number observed. co (negative "cooccur"). package v.0.99.892, using detected species for47 data presence/absence Supplementa sites. sample with eDNA capture using River), Sydenham S= River, Grand (G= site the sample at caught ofliveindividuals are thenumber given Values FishMa on based total) species (N= 82 River Sydenham S Table Supplementary < eDNA sequences of ornumber detection no indicate cells Blank site. the sample for obtained sequences ofeDNA number thetotal by divided species fora ofeDNAsequences number the as calculated River), River, S=Sydenham thespecies returned for sequences eDNA of are theproportion given Values FishMa on based total) species (N= 82 River Sydenham Supplementary of number or detection contamination. to eDNA due removed Site S20 no <3. eDNA sequences indicate cells Blank River). Sydenham = S River, Grand = (G site sample the are given Values study. this in = (N River Sydenham the and S Table Supplementary S1 Table Supplementary Information Supplementary positive - - -

Accepted and occurrence) and occurrence) 581. N was analyzed pairs(N) species of Number observed. than often more occur Article (R Studio v.0.99.892, package "cooccur"). "cooccur"). package v.0.99.892, (R Studio = 49,andN f sp - occurrence) and and occurrence) ry Table S ry Table ecies pairs (N) analyzed was 294 was (N) analyzed ecies pairs ecie

T able S s pairs (N) analyzed was 278 was (N) analyzed s pairs negative 3. Site S20 removed due to eDNA contamination. to eDNA due removed Site S20 3. b b a a -

is the probability that the species pair is likely to co pairislikely that the species the probability is to co pairislikely that the species the probability is based methods. Blank cells indicate no live individuals captured. Sites included overlap overlap included Sites captured. liveindividuals no cells Blankindicate methods. based is the probability that the species pairco the species that theprobability is is the probability that the species pairco the species that theprobability is 3 3 3 2 2 3

= 7. D. C. B. A C B. . A. List of fish species used in creating the increating speciesused offish List . .

Statistically significant co species significant Statistically Rive the Grand to inhabit known orhistorically currently Fish species Statistically significant species co species Statistically significant Fish Statistically significant species co species Statistically significant Statistically significant species co species Statistically significant

Fish species currently or historically known to inhabit the Grand River River Grand the inhabit to known historically or currently species Fish

82 species total) based on FishMa on based total) species 82 species detected using using detected species species detected using using detected species

is the probability that the species pair is likely to co to islikely the pair species that probability is the species currently or historically known to inhabit the Grand Rive Grand the to inhabit known currently historically or species a

- is the probability that the the that the probability is occurrence) and and occurrence) total total number of eDNA sequences returned for the species at the at species the for returned sequences eDNA of number . N . N a

is random random

b the probability that the species pairco the species that probability the

is the probability that the species pair is likely to islikelyto pair the species that the probability is eDNA for the Sydenha eDNA for River the Grand eDNA for capture capture

= 229 = 236 P. * Indicates specific target species in thisstu in target species specific Indicates P. * thisstudy. in target species specific Indicates P. * species pair co pair species random - - , N , N - - occurrences ( occurrences occurrences (56 pairs; pairs; (56 occurrences occurrences (24 pairs; pairs; (24 occurrences occurrences ( occurrences - -

based methods for the Sydenham Sydenham the for methods based River Grand the for methods based - - positive positive occurs less often than observed (negative (negative observed than often less occurs (negative observed than often less occurs

P. * Indicates specific target species species target specific Indicates * P. custom COI database. COI custom = 347,N

= 65 = 42 - - , and N , and N , and occur more often than observed. observed. than more often occur observed. than more often occur positive - 42 65 occurs less often than observed observed oftenthan less occurs m River m

at the sample site (G = Grand Grand (G= the site sample at pairs; pairs; pairs; pairs; = 13, and N = 13,and

(R Studio v.0.99.892, v.0.99.892, (R Studio negative negative - occur more often than than often more occur P P P P (R Studio v.0.99.892, v.0.99.892, (R Studio

< 0.05) us < 0.05) < 0.05) using using < 0.05) < 0.05) using using < 0.05) < 0.05) us < 0.05) = 0. = 0. random

occurs less less occurs nega

= 492, tive ing ing

r and the r and r and the the r and = 11. (R Studio (R Studio dy. dy.