Alcohol Dehydrogenase) from Cylindrospermopsis Raciborskii T3 by Zymography and Mass Spectrometry

Investigation of the Putative Enzyme Function of SxtL (GDSL-lipase) and SxtU (Alcohol dehydrogenase) from Cylindrospermopsis raciborskii T3 by Zymography and Mass Spectrometry

by Kulbhushan N Ugemuge z3274021

Supervisor: Prof. Brett A. Neilan Co supervisors: Dr. Sohail Siddiqui and Dr. Michelle Gehringer

UNSW 21 April 2011 A.D.

In Partial Fulfilment of the Requirements for the Award of Master of Philosophy (Research)

School of Biotechnology and Biomolecular Sciences Centre for Cyanobacteria and Astrobiology

The University of New South Wales, Sydney, Australia

Acknowledgement

I would like to thank my supervisor Brett Neilan for giving me this wonderful opportunity to learn and prosper in the field of cyanobacterial research as an MPhil student. I couldn’t have gotten a better supervisor. Long back I dreamed of becoming a scientist and was seeking a role model. Thank you for being that inspiration for me. I am thankful for your support and guidance during the research, your knowledge in the field of cyanobacteria is extraordinary. I am grateful for your friendship during the ups and downs of my life and also for guiding me throughout. Thank you so much.

I am grateful to my co-supervisors Michelle Gehringer and Sohail Siddiqui who have been the heart of my project. This thesis wouldn’t have been the same without your tremendous knowledge and expertise in the field. Thank you for all the discussions and valuable inputs while trying to solve the mysteries in the project. Your ideas and suggestions have been remarkable. Thank you for all the technical support and also for making this thesis presentable.

I would like to present a special appreciation to Sohail sir, who has been a fatherly figure for me. Thank you so much for being there for me during my fall backs and bringing alive the hopes in me from time to time in this project. Things took a boost when you joined the project for protein work. One idea led to another, and we never knew how things were going to end up. You have always inspired me to find the true researcher in me. You have not only been the soul behind some of the important findings in this project, but also made the environment so friendly and exciting while working with you. Thank you for being the support during the funny as well as intense moments during my thesis. I have never come across a mind in my life which is so active in research.. Having you around has always reminded me of my father.

Peptide mass fingerprinting was an important need for this project. I would like to appreciate Anne Poljak from The Bioanalytical Mass Spectrometry Facility, UNSW, who has patiently analyzed all the protein samples used in this study. I would also like to thank Menuk Jayawardena from The Centre for Marine Bio-innovations, UNSW, for his expert inputs in esterase activity assays.

A special thanks to Young Jae Jeon, Troco Kaan Mihali, Leanne Pearson, Sarah Ongley and Julia Muenchhoff for sharing your experiences and timely contributions. Thank you so much Sarah, for sharing your knowledge in cloning experiments. We went through difficult times trying to make the cloning work. You share a special contribution in helping me understand the background in cloning which will help me the next time I try it again. I will miss the long and funny discussions. Thank you very much.

This thesis has been based on the PhD contributions of Ralf Kellman and Kenlee Nagasuki in cyanobacterial research. I am grateful for knowing their work.

iii

Last but not least, thank you Chris Marquis for your generosity while helping me get settled in BABS and marking important points during my reviews.

A special thanks to my special friends from BGGM group - Jeffrey Noro, Alfonsus Alvin, John Kalaitzis, Maria Wiese, Rati Sinha, Gurjeet Singh Kohli, Alper Yasar, Jamal al Tebrineh, Rocky Chau, Ivan Wong, Bhumika Azad, Toby Mills, Angela Chilton, Marie Dahl, Nathan Dunn, Ashish Srivastav, Bhargavi Veppalla and Sreekanth Dasari for being there for me. Jeff bro, you have an iconic personality. Alvin, thanks for sharing so many chocolates. John, you are a supercool post-doc. Maria, you have always looked after your trouble maker. Jamal, your skills in soccer are amazing. Alper, thanks for the nice pictures and helping me get things around in the lab. Ivan, thanks for helping me with endnote. Gurjeet, your cooking lessons and other moments were fun times. Ashish sir, I missed you a lot. You made me laugh and also stood by me. Rocky, you are the best bench buddy; sorry for leaving the bench messy at times!! Angie, Rati, Bhumika, Bhargavi and Marie, I hope you were not annoyed by my pranks. Rati, you have been a lovely sister. Toby and Sreekanth, we shared great friendship. All of you have inspired me a lot, not just to be a better researcher but also to be a better person.

Ismah Kamil, Lennon Bk Lim and Ameen Kamal, we shared good friendship. My best wishes for your future endeavours.

I would like to thank everyone else from BBGM group for sharing all the moments in the lab as well as fun times on the beach. Thank you all for cheering up, when I climbed a tree once.

Penny Hamilton and Kylie Jones, thanks for your quick inputs towards official formalities in the university and also towards the submission of this dissertation.

I would like to dedicate this thesis to my family, which has sacrificed a lot in the process of getting me up to this stage. My love and friends from India, this is a special gift for you.

Thank you everyone for being so patient with me.

It has been a great journey so far with so many emotions attached to this thesis. I wish I had a time machine to go back in life and rectify some of the things. Nevertheless, I have a whole new beginning ahead.

These 2 years of my experience, will be treasured in my life forever.

Abstract

The recent discovery of the saxitoxin (sxt) gene cluster and studies involving the in vitro production of paralytic shellfish toxins (PSTs) has helped predict the complex mechanism of the biosynthesis of saxitoxin (STX) in particular strains of toxic bloom forming fresh water cyanobacteria like Cylindrospermopsis raciborskii T3, Anabaena circinalis AWQC131C and Aphanizomenon sp. NH-5. The sxt gene cluster which spans up to a region of about 40000 base pairs, consists of around 26 open reading frames, each representing a bioinformatically deduced putative enzyme. This gene cluster attributes the involvement of some putatively identified tailoring enzymes which govern the formation of STX and its analogues in these organisms.

SxtL is a putative GDSL lipase which is predicted to be involved in the hydrolytic conversion of STX and its other carbamoylated analogues to form decarbamoylated compounds (dcSTX). Two commercially available substrates, 4-methylumbilleferyl butyrate and 1-naphthyl acetate, were used to investigate the esterase activity of E. coli BL21 overexpressed SxtL protein in zymography studies.

SxtU is a putative short chain alcohol dehydrogenase, ideal for the reduction of the terminal aldehyde group at C-1 of the STX precursor to form the tricyclic alcohol intermediate in the post-PKS reactions during the biosynthesis of STX. The recombinant SxtU protein, obtained by overexpression in E. coli Rosetta cells was found to be active on ethanol and clavulanic acid in a zymography study involving the alcohol dehydrogenase activity assay.

In addition to overexpression studies, zymography of both activity assays were also performed in order to detect these putative enzymes in crude protein extracts of C. raciborskii T3 and A. circinalis AWQC131C. In the zymogram of alcohol dehydrogenase activity, two proteins from the sxt gene cluster, SxtN and SxtC were identified in A. circinalis AWQC131C via peptide mass fingerprinting of bands in the zymogram. In case of C. raciborskii T3, a similar short-chain alcohol dehydrogenase was also detected.

In a separate experiment, an integrative approach was also implemented to clone the sxtL gene from C. raciborskii T3 into a Synechocystis integrative vector with a final purpose of heterologous expression of soluble SxtL protein in Synechocystis PCC6803.

Table of Contents

CHAPTER 1- A BIOCHEMICAL ACCOUNT OF SAXITOXIN 1.1 GENERAL INTRODUCTION ...... 1 1.2 DEVELOPMENT OF SAXITOXIN RESEARCH...... 3 1.2.1 Adverse effects on marine environment ...... 4 1.2.2 Economical losses and health effects ...... 5 1.2.3 Mechanism of action: Contributions in unlocking the sodium channel mystery ...... 6 1.2.3.1 Architecture of sodium channel as described by neurotoxins ...... 6 1.3 BIOCHEMICAL PERSPECTIVE OF SAXITOXIN ...... 9 1.3.1 Putative biosynthetic pathway of Saxitoxin ...... 9 1.4 SAXITOXIN GENE CLUSTER ...... 12 1.4.1 Tailoring enzymes ...... 16 1.4.1.1 SxtL (putative GDSL lipase) ...... 16 1.4.1.2 SxtU (putative short-chain alcohol dehydrogenase) ...... 17 1.5 AIMS OF THE PROJECT ...... 19

CHAPTER 2- INVESTIGATION OF PUTATIVE ENZYME FUNCTION OF SXTL (GDSL-LIPASE) FROM CYLINDROSPERMOPSIS RACIBORSKII T3 BY ZYMOGRAPHY AND MASS SPECTROMETRY 2.1 INTRODUCTION...... 21 2.2 MATERIALS AND METHODS ...... 22 2.2.1 Over-expression in Escherichia coli strains ...... 22 2.2.1.1 Bacterial strains, plasmids and culture conditions ...... 22 2.2.1.2 Plasmid extraction, amplification and transformation ...... 23 2.2.1.2.1 Plasmid extraction ...... 23 2.2.1.2.2 PCR amplification ...... 23 2.2.1.2.3 Transformation ...... 23 2.2.1.3 Protein expression and purification parameters ...... 24 2.2.1.3.1 SxtL protein expression ...... 24 2.2.1.3.2 Purification of SxtL protein ...... 24 2.2.1.4 Protein Quantification and zymography ...... 25 2.2.1.5 Protein refolding for SxtL ...... 26 2.2.2 Materials and methods for cyanobacterial protein extracts ...... 27 2.2.2.1 Cyanobacterial strains and preparation of protein extract ...... 27 2.2.3 Materials and methods for lipase (esterase) Zymography assays ...... 28 2.2.3.1 Substrates for zymograms (activity staining) ...... 28 2.2.3.2 SDS-PAGE zymography ...... 28 2.2.3.3 NATIVE-PAGE zymography ...... 29 2.2.3.4 Zymography on 2D-PAGE ...... 29 2.2.4 Peptide mass fingerprinting and Bioinformatics ...... 30

...Table of contents

2.3 RESULTS AND DISCUSSIONS ...... 31 2.3.1 Analysis of sxtL gene ...... 31 2.3.2 Expression of sxtL ...... 31 2.3.2.1 Early observations ...... 31 2.3.2.2 SxtL protein quantification ...... 32 2.3.2.3 Esterase zymography and Refolding of SxtL ...... 34 2.3.3 SDS-PAGE zymogram from cyanobacterial crude extracts ...... 36 2.3.4 2D Native-SDS PAGE zymography and mass spectrometry ...... 37 2.3 CONCLUSIONS ...... 39

CHAPTER 3- INTEGRATIVE APPROACH FOR GENOMIC EXPRESSION OF A PUTATIVE GDSL LIPASE, SXTL, FROM CYLINDROSPERMOPSIS RACIBORSKII T3, IN NON-TOXIC CYANOBACTERIUM SYNECHOCYSTIS SP. PCC6803 3.1 INTRODUCTION...... 40 3.2 MATERIALS AND METHODS ...... 43 3.2.1 Bacterial cultures, Plasmids and Transformation ...... 43 3.2.1.1 Standard transformation ...... 44 3.2.1.2 Plasmid extraction ...... 44 3.2.2 Primer designing, Polymerase chain reaction (PCR) and Sequencing ... 45 3.2.2.1 Designing primers KB1-F and KB1-R ...... 45 3.2.2.2 PCR parameters ...... 45 3.2.2.3 Precipitation of PCR and sequencing products ...... 46 3.2.2.4 Sequencing ...... 46 3.2.3 DNA quantification ...... 46 3.2.4 Gel extraction ...... 47 3.2.5 Cloning parameters ...... 47 3.2.5.1 Standard ligation reaction ...... 47 3.2.5.2 Cloning sxtL into pRL439 ...... 47 3.2.5.3 Cloning Kanamycin from pSCR9 into pET15b::sxtL ...... 48 3.2.5.4 Cloning Kanamycin gene from pKW1188 into pRL439 ...... 49 3.2.5.5 Cloning sxtL::knr into pRL439 ...... 49 3.3 RESULTS AND DISCUSSIONS ...... 51 3.3.1 Gradient PCR with new primers for sxtL ...... 51 3.3.2 Cloning sxtL into pRL439 ...... 51 3.3.3 Cloning Kanamycin resistance gene from pSCR9 into pET15b::sxtL .... 53 3.3.4 Cloning Kanamycin resistance gene from pKW1188 into pRL439 ...... 54 3.3.5 Cloning of sxtL::knr into pRL439 ...... 55 3.4 CONCLUSION ...... 56

vii

...Table of contents

CHAPTER 4 - INVESTIGATION OF THE PUTATIVE ENZYME, SXTU (ALCOHOL DEHYDROGENASE), FROM CYLINDROSPERMOPSIS RACIBORSKII T3, REVEALS THE FUNCTION OF THIS ENZYME. 4.1 INTRODUCTION...... 57 4.2 MATERIALS AND METHODS ...... 58 4.2.1 Over-expression in Escherichia coli strains ...... 58 4.2.1.1 Bacterial strains, plasmids and culture conditions ...... 58 4.2.1.2 Plasmid extraction, amplification and transformation ...... 59 4.2.1.2.1 Plasmid extraction ...... 59 4.2.1.2.1 PCR amplification ...... 59 4.2.1.2.3 Transformation ...... 59 4.2.1.3 Protein expression and purification parameters ...... 60 4.2.1.3.1 SxtU protein expression ...... 60 4.2.1.3.2 Purification of SxtU protein ...... 60 4.2.1.4 Protein Quantification and zymography ...... 61 4.2.2 Materials and methods for cyanobacterial protein extracts ...... 61 4.2.2.1 Cyanobacterial strains and preparation of protein extract ...... 61 4.2.3 Materials and methods for zymography assays ...... 62 4.2.3.2 Zymography for Alcohol dehydrogenase (ADH) activity ...... 62 4.2.4 Peptide mass fingerprinting and Bioinformatics ...... 62 4.2.4.1 Bioinformatics ...... 63 4.3 RESULTS AND DISCUSSIONS ...... 64 4.3.1 Analysis of sxtU gene ...... 64 4.3.2 Expression of SxtU protein ...... 64 4.3.3 Alcohol dehydrogenase zymography ...... 65 4.3.4 Peptide mass fingerprinting and Bioinformatics ...... 67 4.3.5 Other saxitoxin related proteins found ...... 69 4.4 CONCLUSION ...... 71

GENERAL DISCUSSION & FUTURE DIRECTIONS ...... 72 APPENDIX A Media, buffers and recepies ...... 75 APPENDIX B Primers, Bioinformatics, Sequencing and Vector maps ...... 76 REFERENCES ...... 87

viii

List of Tables

Chapter 2-

TABLE 2.1. BACTERIAL STRAINS AND PLASMIDS...... 22 TABLE 2.2. PCR AMPLIFICATION OF SXTL...... 23 TABLE 2.3. OVEREXPRESSION OF SXTL...... 24 TABLE 2.4. SXTL REFOLDING WITH UREA AND ARGININE...... 26 TABLE 2.5. CYANOBACTERIAL STRAINS AND FEATURES...... 27

Chapter 3-

TABLE 3.1. PLASMIDS AND KEY FEATURES...... 43 TABLE 3.2. PCR PARAMETERS FOR PRIMERS...... 45 TABLE 3.3. SEQUENCING...... 46 TABLE 3.4. CLONING SXTL INTO PRL439- RESTRICTION DIGESTION PARAMETERS...... 48 TABLE 3.5. CLONING KNR FROM PSCR9 INTO PET15B::SXTL- RESTRICTION DIGESTION PARAMETERS...... 48 TABLE 3.6. CLONING KNR FROM PKW1188 INTO PRL439- RESTRICTION DIGESTION PARAMETERS...... 49 TABLE 3.7. CLONING SXTL::KNR INTO PRL439- RESTRICTION DIGESTION PARAMETERS...... 50

Chapter 4-

TABLE 4.1. BACTERIAL STRAINS AND PLASMIDS...... 58 TABLE 4.2. PCR AMPLIFICATION OF SXTU...... 59 TABLE 4.3. OVEREXPRESSION OF SXTU...... 60 TABLE 4.4. CYANOBACTERIAL STRAINS AND FEATURES...... 61 TABLE 4.5. ADH SUBSTRATE STAINING SOLUTION RECIPE...... 62

List of Figures

Chapter 1-

FIGURE 1.1. THE STRUCTURE OF SAXITOXIN. (MIHALI ET AL., 2009; SCHANTZ, ET AL., 1975) ...... 3 FIGURE 1.2. THE SECONDARY STRUCTURE OF SODIUM CHANNEL...... 7 FIGURE 1.3. SEGMENTS 1 TO 6 WHICH FORMS INDIVIDUAL DOMAINS OF ǹ-SUBUNIT IN SODIUM CHANNEL...... 8 FIGURE 1.4. HYPOTHETICAL PATHWAY FOR SAXITOXIN BIOSYNTHESIS...... 10 FIGURE 1.5. THE SAXITOXIN GENE CLUSTER FROM CYLINDROSPERMOPSIS RACIBORSKII T3...... 13 FIGURE 1.6. THE PUTATIVE FUNCTIONS OF ORF FROM THE SXT GENE CLUSTER OF C. RACIBORSKII T3...... 14 FIGURE 1.7. THE PROPOSED BIOSYNTHESIS OF SAXITOXIN IN CYANOBACTERIA...... 15

Chapter 2-

FIGURE 2.1. PCR CONFIRMATION OF SXTL FROM PET15B VECTORS...... 31 FIGURE 2.2. DIFFERENCE IN THE GROWTH PATTERN OF CONTROL AND E. COLI BL21 CELLS...... 32 FIGURE 2.3. OVEREXPRESSION OF SXTL...... 33 FIGURE 2.4. PEPTIDE FRAGMENTS OF SXTL PROTEIN...... 33 FIGURE 2.5. AMINO ACID SEQUENCE OF RECOMBINANT SXTL...... 34 FIGURE 2.6. ZYMOGRAPHY AND REFOLDING OF SXTL PROTEIN...... 35 FIGURE 2.7. SDS-PAGE ZYMOGRAPHY OF TOXIC AND NON-TOXIC CYANOBACTERIAL PROTEIN EXTRACTS. 36 FIGURE 2.8. PEPTIDE SIGNALS OF PROTEIN CORRESPONDING TO ~ 48.8 KDA...... 37 FIGURE 2.9. (LEFT) COMMASSIE STAINED 2D GEL...... 38 FIGURE 2.10. (RIGHT) ESTERASE ZYMOGRAM ON THE 2D GEL...... 38

Chapter 3-

FIGURE 3.1. AMPLIFICATION OF SXTL GENE USING KB1 (F&R) PRIMERS...... 51 FIGURE 3.2. CLONING SXTL INTO PRL439...... 52 FIGURE 3.3. COLONY PCR OF CLONES...... 52 FIGURE 3.4. OBTAINING SXTL::KNR CONSTRUCT...... 53 FIGURE 3.5. CLONING KNR FROM PKW1188 INTO PRL439...... 54 FIGURE 3.6. CLONING SXTL::KNR INTO PRL439...... 55

Chapter 4-

FIGURE 4.1. PCR CONFIRMATION OF SXTU AND CONTROL FROM PET15B VECTORS...... 64 FIGURE 4.2. OVEREXPRESSION OF SXTU...... 65 FIGURE 4.3. ADH ACTIVITY ASSAYS WITH ETHANOL AND POTASSIUM CLAVULANATE...... 66 FIGURE 4.4. EXPERIMENTAL MASSES OF PEPTIDE FRAGMENTS FROM OVEREXPRESSED SXTU...... 67 FIGURE 4.5. PEPTIDE FRAGMENTS OF RECOMBINANT SXTU AS DETECTED BY FTMS...... 67 FIGURE 4.6. CLUSTAL W, MULTIPLE SEQUENCE ALIGNMENT OF SHORT-CHAIN ALCOHOL DEHYDROGENASES (SDRS) FROM DIFFERENT CYANOBACTERIAL STRAINS...... 68 FIGURE 4.7. PEPTIDE FRAGMENTS OF SXTC FOUND IN ANABAENA CIRCINALIS AWQC131C...... 69 FIGURE 4.8. PEPTIDE FRAGMENTS OF SXTN FOUND IN ANABAENA CIRCINALIS AWQC131C...... 70

Abbreviations

ACP acyl-carrier protein ADH alcohol dehydrogenase Amp ampicilin CARBP carbamoylphosphate dNTPs deoxynucleotide triphosphate dcGTX decarbamoyl-gonyautoxin doGTX deoxycaramoyl-gonyautoxin doSTX deoxycaramoyl-saxitoxin GDSL Gly-Asp-Ser-Leu motif glnA glutamine synthetise A promoter GTX gonyautoxin HAB harmful algal bloom HGT horizontal gene transfer IPTG isopropyl ȕ-D-1-thiogalactopyranoside KAN kanamycin knr kanamycin resistance gene cassette LB Luria Bertani mediu, LC MS MS Liquid chromatography/mass spectrometry MS mass spectrometry MUB 4-methylumbelliferyl butyrate NAD nicotinamide adenine dinucleotide NADP nicotinamide adenine dinucleotide phosphate NBT nitroblue tetrazolium chloride monohydrate neoSTX neosaxitoxin NRPS non-ribosomal peptide synthetase ORF open reading frame PAPS 3’-phosphate 5’-phosphosulfate PCR polymerase chain reaction PKS polyketide synthase PMS phenazine methosufate

PSP paralytic shellfish poisoning PST pralytic shellfish toxin SAM S-adenosyl methionine SDR short chain alcohol dehydrogenase SDS PAGE sodium dodecyl sufate polyacrylamide gel electrophoresis STX saxitoxin TTX tetrodotoxin

xii

Chapter 1- A Biochemical Account of Saxitoxin

1.1 General introduction

Cyanobacteria or “blue-green algae” are known to be one of the oldest group of bacteria that inhabit the earth. The Oscillatoreacean fossil records from the Apex chert deposits in Western Australia shows that cyanobacteria have evolved over 3.5 billion years. These organisms are capable of carrying out oxygenic photosynthesis, similar to algal and plant chloroplasts. There is also evidence to believe that the eukaryotic chloroplasts may have evolved from some ancestral cyanobacteria, as a result of primary endosymbiotic event during evolution (Awramik, 1992; Giovannoni et al., 1988; Miyagishima & Nakanishi, 2010). Based on their characteristic blue pigment “phycocyanin”, and photoautotrophism, cyanobacteria are currently classified into five orders- Chroococcales, Pleurocapsales, Oscillatoriales, Nostacales and Stigonematales (Waterbury, 2006). Today, these organisms exhibit a diverse morphology in wide range of terrestrial and aquatic environments around the globe. As symbionts, they can be found fixing nitrogen for plants and fungi, or live in association with heterotrophic bacteria and archaea in stromatolite communities. These organisms are also known for their incredible ability to survive in extreme niches such as nutrient limitations in oceans, hot springs, Antarctica cold and high salinities in tidal pools (Whitton & Potts, 2000).

Cyanobacteria play an important role in maintaining a balanced ecosystem; however, the same balance is adversely affected when algal blooms are formed. In nutrient rich favourable conditions, some cyanobacteria can grow rapidly to form dense biological aggregates (blooms), especially in freshwater lakes and rivers (Paerl et al., 2001). Although bloom occurrence is a natural phenomenon, they are often correlated to eutrophication of water bodies caused by extensive utilization of fertilizers in farming (Anderson et al., 2002; Ansari et al., 2011). They pose a detrimental effect on the biological oxygen demand and also cause change in odour and taste in aquatic environment, due to organic matter pollution (Wnorowski, 1992). For water industry, bloom management has always been a significant problem; however, a major challenge remains in counteracting the contamination of water with toxic secondary metabolites produced by certain bloom forming cyanobacterial species (Dixon et al., 2011).

Cyanobacterial natural products (also referred as secondary metabolites or bioactive compounds) which have harmful effects on plants, humans, animal or other organisms are collectively known as ‘cyanotoxins’. Toxicologically, these toxins are categorised as hepatotoxins (microcystin and nodularin), neurotoxins (anatoxin and saxitoxin),

Page | 1

Chapter 1- A biochemical account of saxitoxin cytotoxins (cylindrospermopsin) and dermatotoxins (lipopolysaccharides and lyngbyatoxin-a) (Dittmann & Wiegand, 2006; Funari & Testai, 2008). However, structurally they are very diverse, where the most common are the alkaloids (cylindrospermopsin, anatoxin-a, anatoxin-as, homoanatoxin and saxitoxin) and the oligo-peptide hybrids (microcystin and nodularin) (Pearson et al., 2010; Zegura et al., 2011).

Structurally and evolutionarily similar, the non-ribosomal cyclic peptides microcystin and nodularin are produced by a number of cyanobacterial genera which includes Microcystis, Nostoc, Anabaena, Phormidium, Chroococcus, Planktothrix and Nodularia. The backbone amino acids in the heptapeptide microcystins can be modified, resulting in the formation of its large variety of analogues with variable toxicities (Kaebernick & Neilan, 2001; Pearson, et al., 2010). The hepatotoxicity of both compounds is caused due to the inhibition of protein phosphatases 1 (PP1) and 2A (PP2A) and severe hepatocytosis. There is also evidence that links the effect of these cyclic peptides as liver tumour promoters (An & Carmichael, 1994). The alkaloid derived neurotoxins saxitoxin (STX), anatoxin-a, -as and homoanatoxin- a are produced by a range of freshwater and marine cyanobacterial genera which includes Anabaena, Aphanizomenon, Planktothrix and Lyngbya (Carmichael et al., 1997; Kellmann et al., 2008b). These compounds act by irreversibly binding and disrupting the voltage gated sodium receptors on neuron cells, preventing the neuronal signal transfer. As compared to anatoxin-a and homoanatoxins, anatoxin-as is a structurally unrelated organophosphate but shows similar neurotoxic effects (Dittmann & Wiegand, 2006; Osswald et al., 2007). STX and its wide variety of analogues share a tricyclic perhydropurine structure which can be substituted at various positions (Wiese et al., 2010). These neurotoxin alkaloids comprise of one the most potent toxins ever known to man. Cylindrospermopsin is a newly discovered cyanotoxin and known to be produced by Cylindrospermopsis raciborskii, Aphanizomenon ovalisoprum, Umezakia natans, Rhaphidiopsis curvata, Raphidiopsis mediterranea, Aphanizomenon flos-aquae, Anabaena bergii, Anabena lapponica, Lyngbya wollei, and several strains of Oscillatoria sp.(McGregor et al., 2011; Pearson, et al., 2010). Along with its general cytotoxicity, this compound has also shown hepatotoxic and nephrotoxic effects and is a potential carcinogenic compound as well.

NRPSs (non-ribosomal peptide synthetases) and polyketide synthases (PKSs) are the two molecular systems involved in the synthesis of majority of cyanobacterial natural products. Often the screening of NRPSs and PKSs gene clusters in environmental samples indicates the presence of a medicinally important natural product in a prokaryote (Gross, 2009; Li et al., 2009; Lik Tong, 2007). That is indeed the reason why in recent years, cyanotoxin research has been shifted towards understanding the genetic and biochemical mechanism by which the toxic secondary metabolites are synthesized in different cyanobacterial species (Kalaitzis et al., 2009). The biosynthetic pathways and related gene clusters for the most common cyanotoxins

Page | 2

Chapter 1- A biochemical account of saxitoxin like microcystin, nodularin and saxitoxin have been recently elucidated (Pearson, et al., 2010). Their gene clusters have provided an excellent opportunity not only to design molecular tools to monitor toxic cyanobacterial blooms, but also been useful in deducing the mechanism involved in transcriptional regulation of the toxin biosynthetic pathways (Pearson, et al., 2010; Pearson & Neilan, 2008). It has also brought insight to the genetic framework of unique enzymes of evolutionary importance. Several tailoring enzymes involved in the formation of numerous analogues of cyanotoxin molecules have pharmaceutical potential for combinatorial biosynthesis towards anticancer, antimalarial, immunosuppressant and antibiotic drug development (Rastogi & Sinha, 2009; Sainis et al., 2010; Wiese, et al., 2010).

1.2 Development of saxitoxin research

Saxitoxin (STX), a chemical compound named after the shellfish Saxidomus giganteus, is a lethal neurotoxin that specifically blocks ion-influx through the voltage-gated sodium channels in nerve and muscle cells; leading to flaccid paralysis of the victim (Catterall, 1980; Hall & Strichartz, 1990; Schantz et al., 1957). However, in recent years, STX has also been shown to block calcium channels and prolong the gating of potassium channels in cardiac muscle cells (Llewellyn, 2006; Su et al., 2004; Wang et al., 2003). This compound is chemically related to alkaloids (Figure 1.1) and is the best studied candidate amongst several other paralytic shellfish toxins (PSTs) (Bordner et al., 1975; Schantz et al., 1975). Strangely, PSTs (as they have similar structures) are found in several species of marine eukaryotic dinoflagellates and the freshwater prokaryotic cyanobacteria, despite the fact that these micro-organisms are known to be phylogenetically so distinct. Such unique feature might be possible as a result of some common ancestral origin (Cembella, 1998); and equally liable could be horizontal gene transfer (HGT) events amongst these micro-organisms during evolution (Plumley, 1997). Hence, the mechanism involved in their biosynthesis is supposed to be governed by set of enzymes common or similar in these organisms (Kellmann, et al., 2008b).

Figure 1.1. The structure of saxitoxin. (Mihali et al., 2009; Schantz, et al., 1975)

Page | 3

Chapter 1- A biochemical account of saxitoxin

1.2.1 Adverse effects on marine environment

A string of sudden die-offs pertaining to humpback whales and several other fishes alarmed marine scientists in 1987 (Anderson, 1989, 2004). Although, the early indications concluded pollution as the cause for these deaths, a mass poisoning of humans at the end of the same year, opened the case again (Gulland & Hall, 2007; Morris Jr, 1999). Eventually, the source of these incidences was tracked down to biotoxins produced by several species of dinoflagellates belonging to the genera Alexandrium, Gymnodinium and Pyrodinium (Anderson, 2004; Lefebvre et al., 2008; Oshima et al., 1993; Usup et al., 1994). PSTs are one of the groups of several other bio-toxins that enter the marine food chain when they bio-accumulate within invertebrates such as bivalve shellfish (oysters, scallops, clams and mussels); which primarily feed by filtering large amounts of water (Cembella et al., 1993; Deeds et al., 2008). Shellfish itself is not affected by these toxins, but when consumed, humans or other predators get poisoned; and the effect as a result of intoxication is known as paralytic shellfish poisoning (PSP) (Gainey & Shumway, 1988; Shumway et al., 1988).

In marine or more dominantly coastal environments, dinoflagellates (also known as phytoplankton or planktonic algae) under favourable conditions can surpass other organisms and grow into a phenomenon called ‘Red tides’, or more significantly ‘Harmful algal blooms (HABs)’ (Maso & Garces, 2006). This poses a great deal of threat on marine inhabitants, as now they are stressed by the depleted supply of nutrients, dissolved oxygen and energy from sunlight (Kremp et al., 2008). HABs themselves can cause great deal of ecological damage, but when their formation involves toxin producing dinoflagellate species, mass die-offs are likely to occur due to poisoning effects (Van Dolah, 2000). A frequent and global occurrence of HABs in both southern and northern hemisphere has vexed marine scientists in recent years (Hallegraeff, 2010). Thus, leading to the closure of vast fisheries and shellfish farming areas, especially in nations like United States, Japan, Europe and Australia; due to the possibility of deadly PST contaminated marine products entering the food markets of common people (Anderson, 1989; Bienfang et al., 2011; Kin-chung & Hodgkiss, 2009).

In prokaryotic cyanobacteria (blue green algae), some species of the genera Anabaena, Aphanizomenon, Cylindrospermopsis, Planktothrix, Raphidiopsis and Lyngbya are also known to biosynthesize PSTs (Carmichael, et al., 1997; Lagos et al., 1999; Pereira et al., 2000). Like eukaryotic dinoflagellates, these photosynthetic micro-organisms are also capable of forming HABs when excess nutrients like phosphorus are available in the environment (Epstein et al., 1993). The ecological damage in this case is also similar, and the global occurrence of this phenomenon is surprising as well (Glibert et al., 2005; Van Apeldoorn et al., 2007). Cyanobacteria themself don’t secret toxins, but when they die, small amounts are always released in their inhabited areas (Codd, 1995; Dittmann & Wiegand, 2006). As a result, PSTs like STX get introduced in drinking and recreational water sources, when toxic algal

Page | 4

Chapter 1- A biochemical account of saxitoxin blooms are formed in fresh water bodies like lakes and dams (Berry & Lind, 2010; Hoeger et al., 2004; Molica et al., 2005) .

1.2.2 Economical losses and health effects

The oceans occupy nearly 71% of our planet’s surface and more than 97% of water in our world is contained in oceans, while the remaining 3% around the land mass which we call ‘freshwater’, becomes our precious water resource (Rapoport, 1994; Shiklomanov & Rodda, 2003). It is a fact that we stress marine organisms for our global food consumption, and with today’s commercial and industrial demands, it becomes important to conserve oceans for our economic sustainability in long terms (Assessment, 2005; Bard, 1999; Garcia & de Leiva Moreno, 2003). When it comes to economical perspective in terms of human welfare, HABs could top as one of the nature’s deadliest weapons that affect international markets (Hoagland et al., 2002; Hoagland & Scatasta, 2006). But in a much wider perspective, they pose threats to some of the endangered species like humpback whales and also to marine ecology and mortality (Vitousek et al., 1997). Despite the fact that less than a hundred of around 4000 known species of microalgae produce toxins, their world-wide distribution and dominance in algal blooms, makes them destructive on a global scale (Zingone & Oksfeldt Enevoldsen, 2000). Millions of dollars of economic losses has occurred in past due to closure of aquatic farms and death of livestock, birds and wild mammals, in the HAB infected areas (Hoagland, et al., 2002; Shumway, 1990; Stewart et al., 2008). In addition, PSP epidemics have also affected tourism whilst the toxin scrutinizing expenditures are no exceptions (Albertano et al., 2008; Johnson et al., 2010).

In the last three decades, majority of epidemic outbreaks related to algal toxins have been reported through different sources around the world (Hallegraeff, 2010; Hallegraeff et al., 1995). The first medical report describing the symptoms of PSP can be traced back to 1689 (Chevalier & Duchesne, 1851a; Chevalier & Duchesne, 1851b). Poisoning due to consumption of drinking water can be associated with cyanobacterial species which produce freshwater HABs (Hoeger, et al., 2004). PST intoxication in humans after ingestion results in initial symptoms like numbness or slight tingling sensation around the lips, tongue and fingertips followed by muscular weakness, numbness of neck and motor in-coordination (Hall & Strichartz, 1990; Rodrigue et al., 1990). During early stages, symptoms such as nausea, vomiting and diarrhoea could also be a warning sign. If untreated, death of the victim can occur in 2-12 hours, due to flaccid paralysis and respiratory dysfunction (Botana, 2000). Direct exposure in environment or laboratory can cause instant irritation to eyes, skin and lungs. So deadly is STX that a dose as little as 1 mg can cause the death of a human being (Halstead & Schantz, 1984). Knowing these facts, no wonder when the first chemical synthesis of saxitoxin was published in 1977 by Tanino and group (Tanino et al., 1977), government agencies around the globe started fearing for its

Page | 5

Chapter 1- A biochemical account of saxitoxin potential use as chemical weapon in warfare (Franz, 1997). In 1996, 4-aminopyridine - a drug, was noted to reverse cardiorespiratory depression caused by the effects of STX and tetrodotoxin (TTX) without any convincing side effects in chronically instrumented guinea pigs (Chang et al., 1996; Chang et al., 1997). Fifteen years since then, there is still no clinically approved antidote for STX. Meanwhile, early stage treatments like artificial respiration and use of activated charcoal have been proven only temporary solutions for moderately affected victims (Schantz, 1986).

1.2.3 Mechanism of action: Contributions in unlocking the sodium channel mystery

Saxitoxin discovery opened ways for many pharmaceutical companies and medical researchers to investigate how this compound affected human physiology. It has not only contributed in scientific knowledge about sodium channels, but also helped in mapping channel distribution and density in cells, tissues and organs (Cest le & Catterall, 2000; Feigenspan et al., 2010; Khosla & Keasling, 2003; Zhang & Tang, 2008).

Based on the structural and functional group similarity with tetrodotoxin (TTX), Henderson et al. in 1974 demonstrated how STX mimics metal cations to exert its physiological action on the principal coordination site for sodium ions (Na+), in a nerve membrane (Henderson et al., 1974). Their work also elucidated the nature of the channel involved with TTX and STX, revealing that one of its important components was a cation binding site. Soon after unlocking the structure of STX in 1975, medical researchers realised that this deadly chemical was actually a perfect tool to study neural transmissions (Schantz, et al., 1975). In 1979 and 1980, Catterall and group lead their ongoing research on binding mechanism of neurotoxins that affected sodium channels, to further isolate a soluble fraction of saxitoxin binding receptor (Receptor Site I) from the rat neuroblastoma cells and brain synaptosomes (Catterall, 1977; Catterall & Morrow, 1978; Catterall et al., 1979). Both STX and TTX shared this specific interaction, while none of the other toxins they used showed any affinity to this unique receptor site I. Experimental works later elucidated that the receptor site I of Na+ channel in nerve membrane contains a negatively charged carboxyl group which interacted with the cationic guanidinium group of STX; as envisaged by Henderson et al. in 1974 (Cest le & Catterall, 2000)

1.2.3.1 Architecture of sodium channel as described by neurotoxins

During the period of early 50’s to mid 70’s of the 20th century, most of the experiments which offered mechanistic models of sodium channels, used voltage clamp techniques, applied on myelinated nerve fibres of vertebrates and the invertebrate axons (Armstrong, 1981; Henderson, et al., 1974; Hodgkin & Huxley,

Page | 6

Chapter 1- A biochemical account of saxitoxin

1952). These experiments helped comprehend some of the important properties of the sodium channels; like the selective ion conductance, rapid inactivation and the voltage-dependent activation. After the mid 70’s, new biochemical techniques emerged to develop molecular background of the channels. One of the key features that indeed lead to the discovery of sodium channel proteins (its inner pore, outer pore and selective filters), was the high affinity and binding specificity of TTX, STX and Į-scorpion toxin (Catterall, 1980; Ritchie & Rogart, 1977). The 80’s and 90’s involved series of purification studies pertaining to soluble proteins bound to these toxins, which also revealed the linker amino acid residues. Initial purifications used a photo-reactive derivative of Į-scorpion toxin (Beneski & Catterall, 1980). Subsequent isolations from electric eel electroplax and neurons from mammalian brain and skeletal muscles then involved TTX and STX (Agnew et al., 1980; Furman et al., 1986; Hartshorne & Catterall, 1981; Hartshorne et al., 1982; Miller et al., 1983). Based on all the evidences collected, it was deduced that the sodium channel in mammalian brain is a protein complex composed of one or more small ‘ȕ’ subunits (ȕ1, ȕ2 and/or ȕ3 33-36 kDa) auxiliary to a large principal ‘Į’ subunit (260 kDa) (see Figure 1.2).

Figure 1.2. The secondary structure of sodium channel.

The core Į-subunit is at the centre and the two supporting ȕ-subunits on its each side. I, II, III and IV are the domains of the Į-subunit core made from S1-S6 segments (1-6). (Wiese, et al., 2010; Yu & Catterall, 2003)

Page | 7

Chapter 1- A biochemical account of saxitoxin

Figure 1.3. Segments 1 to 6 which forms individual domains of Į-subunit in sodium channel.

The voltage sensing segment 4 (yellow). Red arrow indicates the binding site for saxitoxin. (Wiese, et al., 2010; Yu & Catterall, 2003)

Presently, no 3D structure of the voltage-gated sodium channel is yet available; but based on the primary structure and the resemblance of ‘ȕ’ subunits to immunoglobulin folding patterns (Isom et al., 1992; Ratcliffe et al., 2001); a predicted model has been suggested since the time when X-ray crystallography uncovered the structure of potassium channel (Jiang et al., 2003). The selective sodium pore is supposed to be build when the ‘Į’ subunit folds into its four homologous and functional domains (I-IV), where each domain is a hexamer of Į-helical transmembrane segments (S1-S6) (Claes et al., 2001). All segments and four domains are sequentially bound to each other by intra and extra cellular loops, while the extended extracellular loops in domain I and IV are postulated to interact with ‘ȕ’ subunits. Adjacent to the voltage sensing S4 segment, a re-entrant transmembrane loop (P-loop) connecting S5 and S6 is also found. In each domain, this loop contains an inner set of amino-acid residues (Asp, Glu, Lys and Ala), which gives the outer half of the pore its Na+ selective filter (Schild et al., 1997); and consequently the primary binding site for the guanidinium group of STX and TTX (Cest le & Catterall, 2000; Fozzard & Lipkind, 2010) (see Figure 1.3). Early findings concluded identical mode of interaction of both toxins with the sodium channel, because both compounds contained critically similar components meant for binding, such as a diol and one or two guanindinium groups. However, point mutations particularly in superficial amino acids of the ‘Į’ domains revealed explicit differences (Penzotti et al., 1998). Although the functional group’s interaction relevant to the Asp400, Glu755 and Lys1237 residues in the selectivity filter was found to be identical, mutagenesis of amino acids in Na+ channel’s outer vestibule showed variations in their binding affinity. For example, TTX lost affinity for the channel twice as much as STX when Tyr401 was mutated to Cys; while neutralization of Glu758 and Asp1532 residues greatly affected STX binding. This suggested that unlike TTX, STX interacts more strongly with superficial set of aligned residues in the domains I-IV of the known voltage-gated Na+ channel (Penzotti, et al., 1998).

Page | 8

1.3 Biochemical perspective of Saxitoxin

Structurally tricyclic, the molecular formula of pure STX is C10H17N7O4 with the molecular weight of 299 and contains one positively charged (1, 2, 3-guanidino) and another deprotonated (7, 8, 9-guanidino) guanidino group, which makes this compound highly polar in nature (Fleming et al., 2007). Since 1976, the understanding of these toxins has greatly advanced, and to date, 57 new analogues of STX have been discovered in a range of microbial sources (Wiese, et al., 2010). Depending on the R-group variations, STX and neosaxitoxin (neoSTX) are the non-sulfated compounds while other analogues include mono-sulfated (GTXs 1-6), di-sulfated (C1-4) and the decarbamoyl-gonyautoxins (dcGTXs 1-4), and 13-deoxy- decarbamoyl derivatives (doSTX, doGTX 2, 3) (Llewellyn, 2006; Oh et al., 2010; Turrell et al., 2008). All of the above contain a hydrophilic side chain, however, six analogues of STX, LWTX 1, 2, 3, 4, 5, and 6, were found in fresh water cyanobacterium Lyngbya wollei, which contained a hydrophobic substituent (Onodera et al., 1997)

1.3.1 Putative biosynthetic pathway of Saxitoxin

After the discovery of saxitoxin in Saxidomus giganteus, almost 20 years of arduous studies later, its crystal structure was finally unveiled in 1975 (Schantz, et al., 1975). In the same year, a group of scientists found structurally similar PSTs from the dinoflagellate Gonyaulax tamarensis and named them gonyautoxins (GTXs) (Shimizu et al., 1975). Subsequently, several new analogues were also isolated from different sources and based on the structural and stereo-chemical variations of the sulphate groups, these toxins were divided into two groups- saxitoxin and neosaxitoxin. In spite of all these findings, nothing was known about the mechanism by which these compounds were produced in different organisms (Shimizu, 1986).

With the knowledge of saxitoxin structure (Figure 1.1), various concepts were later proposed by different sources, which in turn seeded the early ideas about the putative mechanism for the biosynthesis of these toxins. or e.g., one of the schemes viewed arginine as the starting chemical for STX production while the others linked the tetrahydropurine resemblance of STX to purine metabolism (Shimizu, 1986). However, finding the actual raw materials or the primary precursors needed more practical approach than just mere speculations. Thus, feeding experiments involving 13C- and 14C radio-labelled precursors were implemented on the dinoflagellate G. Tamarensis (Shimizu et al., 1984). Success with 90% isotope incorporation into different parts of gonyautoxins (GTXs) by [2-13C]glycine and [guanido-14C] uptake indicated the least expected concept of arginine pathway. Unfortunately, such externally provided substrates were not easily absorbed by the dinoflagellates, and hence the direction of substrate feeding was then diverted to cyanobacterial species. Much more success was achieved when feeding of [2-13C]acetate and [2- 13C, 2- 15N]ornithine to Aphanizomenon glos-aquae was found practical (Shimizu et al.,

Page | 9

Chapter 1- A biochemical account of saxitoxin

1985; Shimizu, et al., 1984). This explained that the loss of carboxylate carbon along the arginine pathway was via Claisen type condensation and rejected the lysine scheme for the formation of neosaxitoxin (neoSTX) and GTXs (Shimizu, et al., 1984). Subsequent studies also showed that arginine was the precursor of STX. S-adenosyl methionine (SAM) involvement in the pathway as an alkylating agent was clarified with isotope incorporation at C-13 in neoSTX via [methyl- 13C]methionine substrate feeding (Gupta et al., 1989; Shimizu, et al., 1985; Shimizu, et al., 1984). To elaborate the findings, a hypothetical pathway for the biosynthesis of saxitoxin was further developed (see Figure 1.4). This pathway suggested that the tricyclic ring formation of saxitoxin happens via intramolecular oxidative condensations and begins when arginine and acetyl-CoA undergo Claisen type condensation to form the first intermediate of the reaction. The guanidino functional group in the 2nd reaction is then transferred to the Į-amino group of the decarboxylated arginine of the 1st intermediate 13 2 to form the tricyclic backbone. Detailed analysis of [methyl- C, H3]methionine feeding suggested that a methyl-derived side chain from SAM is introduced into the tricyclic structure at step 4, which involves loss of one methionine methyl hydride prior to its epoxidation at step 5. This is followed by opening of the epoxide to form the aldehydic intermediate, which in turn is further reduced. Finally, the methyl derived side chain is carbamoylated and the two hydroxyl groups are attached to from the final structure of STX (Figure 1.4).

Figure 1.4. Hypothetical pathway for saxitoxin biosynthesis. (Gupta, et al., 1989; Kellmann, et al., 2008b; Shimizu, et al., 1984).

Despite considerable efforts, this pathway upholds several missing loops and lacked the precise understanding of sub biochemical reactions (Kellmann & Neilan, 2007). It was controversial whether the synthesis started with (4-aminobutyl)guanidine - a decarboxylation product of arginine or via Claisen-condensation of arginine to

Page | 10

Chapter 1- A biochemical account of saxitoxin acetate? The dihydroxlation of the compound at C-12 was also not understood. The exact sequence of reactions in the mechanism of synthesis was a mystery and needed detailed research (Kellmann & Neilan, 2007).

The knowledge about types of enzymes and minimal natural machinery required was essential for better insight into reaction mechanisms involved in PST biosynthesis. In 2004, a group of scientists then started exploring the missing intermediates and cofactors to revise the known hypothetical pathway (Kellmann & Neilan, 2007; Pomati et al., 2004). Their idea involved comparative in-vitro synthesis of PST molecules using cytosolic and membrane fractions of toxic and non toxic strains of cyanobacteria, viz. C. raciborskii T3 and C.raciborskii AWT205 respectively. They developed a standard reaction for PST production by optimizing parameters such as pH, buffer and temperature conditions. The known precursors – arginine, acetyl-CoA, SAM and carbamoylphosphate (CARBP), were initially supplemented to variable sets of cytosolic and membrane fractions and PST production was measured after particular time durations by High pressure liquid chromatography (HPLC) and liquid chromatography/mass spectrometry (LC-MS-MS) (Kellmann & Neilan, 2007). It was found that toxin synthesis was stimulated only in the presence of all of the known precursors and the essential elements for biosynthesis of PSTs were confirmed to be present in the cytosol (Kellmann & Neilan, 2007). However, a polar and heat stable unknown cofactor exclusively present in membrane fraction was found to boost PST production. The inhibitory activity of agmatine i.e. (4-aminobutyl)guanidine, ornithine and hydroxylamine supported the 1st step of Claisen type condensation between arginine and acetate which is a rare reaction catalyzed by class II aminotransferases, followed by amidination of the precursors by associated pyridoxal phosphate (PLP)-dependent enzymes (Gupta, et al., 1989; Kellmann & Neilan, 2007; Shimizu, 1986). Interestingly, light provided instant activation of toxin synthesis while on the other hand, stimulatory activity of carbon monoxide, methylviolgen and reduced nucleotides suggested the involvement of flavin-dependent oxygenases in the pathway; thus disqualifying cytochrome P450 and Į-ketoglutarate-dependent oxygenases as candidate enzymes (Kellmann & Neilan, 2007). The participation of CARBP in toxin synthesis as an important element also suggested the involvement of a carbamoyltransferase. To justify these evidences, a revised biochemical pathway for STX was then proposed to accommodate the old and new findings.

The sedimentation of cytosolic enzymes responsible for PST biosynthesis in the bottom and middle layers of soluble fractions also indicated that the candidate enzymes could be large or form a multienzyme complex (Kellmann & Neilan, 2007). Based on the types of enzymes suggested from this data, viz. class II aminotransferases, carbamoyl transferases, methyl transferases etc, it became possible to locate the signature genes unique to the PST producing organisms; and subsequently in the following year, a large gene cluster was discovered to complete the putative biosynthetic pathway of saxitoxin (Kellmann, et al., 2008b).

Page | 11

1.4 Saxitoxin gene cluster

N-ST, a sulfotransferase from the dinoflagellate Gymnodinium catenatum, was the first ever functionally characterised enzyme proved to be directly related to saxitoxin synthesis (Sako et al., 2001). This enzyme actively converted STX and GTX 1 and 2 into GTX 5 and GTX-2/3 respectively. In the following year, the conversion of an artificial analogue of STX (11-hydroxysaxitoxin) into GTX-2/3 by another sulfotransferase was reported from the same dinoflagellate species (Yoshida et al., 2002). However, due to low yield and instability, the peptide sequence of these enzymes remained unrevealed. Interestingly, Cylindrospermopsis raciborskii T3 and Anabaena circinalis AWQC131C are also known to produce N- and O-sulfated compounds of STX, which suggests the involvement of similar sulfotransferases in their formation (Kellmann, et al., 2008b).

Biochemical reactions illustrated for the saxitoxin pathway are rare in nature. The formation of carbamoylated analogues of STX in several species of cyanobacteria suggested the involvement of a carbamoyltransferase. Thus, degenerative primers based on functional motifs of known cyanobacterial O-carbamoyltransferases led to the identification of the first gene sequence, ‘sxt1’, that was uniquely present in PST producing organisms (Kellmann et al., 2008a). A naturally occurring mutant of this gene was found in Lyngbya wollei which was unable to form carbamoylated analogues of STX. Genome walking up- and down-stream of this gene in C. raciborskii T3 revealed a complete set of 31 open reading frames (ORF’s) spanning a total of 38000 base pairs in both directions (Kellmann, et al., 2008b; Kellmann, et al., 2008a). A close bioinformatic observation based on the identity of conserved motifs classified the translated amino acid sequence from each ORF into their putative functional enzyme (see Figure 1.5 & 1.6). These genes were found to encode different enzymes such as class II aminotransferases, sulfotransferases, methyltransferase and amidinotransferases, which were previously predicted for STX biosynthesis (Kellmann, et al., 2008b). Similar sets of genes were also found in PST producing organisms, viz. A. circinalis AWQC131C and Aphanizomenon sp. NH-5 (Ballot et al., 2010). The previous hypothetical pathway had suggested that the first step of saxitoxin biosynthesis starts as a result of Clasien type condensation of acetate to arginine, while the methyl side chain derived from SAM was introduced at a later step (Gupta, et al., 1989; Shimizu, 1986; Shimizu, et al., 1985; Shimizu, et al., 1984). However, the proposed intermediate compounds of such reactions were not detected by LC-MS-MS studies (Kellmann, et al., 2008b). The primary structure of sxtA - a multienzyme complex, highly similar to polyketide syntase (PKS) complex, suggested that the catalytic activity of its four domains (sxtA1, sxtA2, sxtA3, and sxtA4) govern the first step of the reaction instead (Kellmann, et al., 2008b; Kellmann, et al., 2008a) (see Figure 1.7).

Page | 12

Chapter 1- A biochemical account of saxitoxin

The reaction starts with loading of acyl-carrier protein (ACP) with acetate from acetyl-CoA, followed by transfer of methyl side-chain of SAM to the acetyl-ACP to form propionyl-ACP, which further undergoes Clasien condensation with arginine. The expected ionic fragments from the putative product (4-amino-3-oxo- guanidinoheptane) of this reaction were identified by MS-MS spectra; thus it became evident that the first step of STX biosynthesis was controlled by enzymatic domains of sxtA. Similarly, other intermediate compounds detected by LC-MS-MS supported the role of several other genes from the cluster to explain the putative biosynthetic pathway (Kellmann, et al., 2008b). Subsequently, sxtG (amidinotransferase) is supposed to load an amidino group from arginine to 4-amino-3-oxo-guanidinoheptane to form 4, 7-diguanidino-3-oxoheptane in 3rd step of the reaction. The rapid heterocyclization in step 4 takes place by sxtB/C (cytidine deaminase/unknown), which is followed by formation of double bond between C-1 and C-5 by sxtD (steole desaturase-like protein) in step 5. The following reaction involves a multifunctional enzyme sxtS (2-Oxoglutarate dependent dioxygenase) that performs the oxidative formation of new double bonds in the heterocylic intermediate from previous step. The terminal aldehyde group attached to this modified intermediate is then reduced by sxtU (oxidoreductase / alcohol dehydrogenase) in step 8. Finally, the carboxyl group from CARBP is transferred to the free hydroxyl group of step 9 intermediate by sxtI (O-carbamoyltransferase), and subsequent hydroxylation of the C-12 in step 10 by sxtW, sxtH/T and sxtV results in the formation of STX (Kellmann, et al., 2008b).

Figure 1.5. The Saxitoxin gene cluster from Cylindrospermopsis raciborskii T3. (Kellmann, et al., 2008b)

Page | 13

Chapter 1- A biochemical account of saxitoxin

Figure 1.6. The Putative functions of ORF from the sxt gene cluster of C. raciborskii T3. (Kellmann, et al., 2008b)

Page | 14

Chapter 1- A biochemical account of saxitoxin

Figure 1.7. The Proposed biosynthesis of saxitoxin in cyanobacteria.

Dotted lines indicate possible but not necessary reactions. (Kellmann, et al., 2008b; Mihali, et al., 2009)

Page | 15

Chapter 1- A biochemical account of saxitoxin

1.4.1 Tailoring enzymes

The structural diversity of naturally occurring analogues of marine alkaloids and the recent discovery of the saxitoxin gene cluster has progressively recaptured the interest of pharmaceutical companies towards combinatorial biosynthesis for drug development (Menzella & Reeves, 2007; Pomati et al., 2006; Rix et al., 2002). It has been widely accepted that polyketide synthases (PKS) and non-ribosomal polypeptide synthetases (NRPS) are involved in the early steps of catalysing the production of diverse groups of secondary metabolites in a myriad of eukaryotic and prokaryotic organisms on our planet (Collemare et al., 2008; Rix, et al., 2002; Wiegand & Pflugmacher, 2005). However, understanding the role of tailoring enzymes in post- PKS and NRPS modifications in giving the alkaloid secondary metabolites their functional and structural identities has only been recently advanced (Banik et al., 2010; Lutz, 2010; Rix, et al., 2002).

The analysis of sxt gene cluster found in saxitoxin producing cyanobacterial species like C. raciborskii T3, Aphanizomenon sp. NH-5, L. wollei and A. circinalis AWQC131C has opened insights into post-PKS mechanisms in the formation of PSTs that are putatively governed by several tailoring enzymes (Kellmann, et al., 2008b; Mihali et al., 2011; Mihali, et al., 2009). For instance, SxtX protein, which is highly similar to cephalosphorin hydroxylase, is co-related with N-1 hydroxylation of STX as it is exclusively absent in A. circinalis AWQC131C which is unable to produce neoSTX (Kellmann, et al., 2008b; Mihali, et al., 2009). Similarly, the absence of carbamoylated analogues of STX in Lyngbya wollei can be related to the truncated sxtI gene which is a putative O-carbamoyltransferase (Kellmann, et al., 2008a; Mihali, et al., 2011). As previously mentioned, two 3’-phosphate 5’-phosphosulfate (PAPS) - dependent sulfotransferases from the dinoflagellate G. catenatum have been characterised for the formation of N-21 and O22 sulfated analogues of STX (Sako, et al., 2001; Yoshida, et al., 2002). Two putative ORF from saxitoxin gene cluster- sxtN and sxtO, highly similar to sulfotransferases, have been annotated for the formation of monosulfated GTXs and disulfated C-toxins in cyanobacteria (Kellmann, et al., 2008b).

1.4.1.1 SxtL (putative GDSL lipase)

GDSL-lipases/esterases are a newly characterized family of lypolytic enzymes having broad substrate specificity with multifunctional properties of thioesterase, arylesterase, protease and lysophospholipase (Akoh et al., 2004). Normal lipases can be recognised by the presence of the Gly-X-Ser-X-Gly, a conserved motif situated towards the centre of their structure, which gives these enzymes their characteristic nucleophillic elbow (Fu et al., 1997; Grochulski et al., 1994; Pleiss et al., 2000). This fold is uniquely absent in GDSL lipases, and the flexible active site ‘serine’ which contains the Gly-Asp-Ser-Leu (GDSL) motif of these enzymes is located closer

Page | 16

Chapter 1- A biochemical account of saxitoxin to their N-terminus (Akoh, et al., 2004; Arpigny & Jaeger, 1999; Sharp et al., 1994; Upton & Buckley, 1995).

SGNH-hydrolases, a subgroup of GDSL lipases is characterized by the presence of highly conserved Ser-Gly-Asn-His residues in the conserved blocks I, II, III and V (Akoh, et al., 2004). Ser in block I, His and Asp together form the catalytic triad, while the Gly from block II and Asn residue from III donate protons to the oxyanion hole along with the Ser from block I (Akoh, et al., 2004). The conserved regions in all blocks arrange themselves in confirmatory folds to give the final structure its catalytic role (active site) (Akoh, et al., 2004). The secondary structure of the core regions of GDSL lipases has been suggested and closely resembles to the Į/ȕ hydrolase superfamily that are commonly found in normal lipases (Nardini & Dijkstra, 1999). Thus, GDSL are typically made up of their active site embedded between alternately arranged ȕ-strands and Į-helices. The conformational change for broad substrate specificity comes with the flexibility in the substrate binding site within the ȕ-strands and Į-helices. The arylesterase activity of GDSL lipase TEP-I from E. coli was observed on range of aromatic esters, along with hydrolysis of acyl-CoAs, esters and amino acid derivatives (Ling et al., 2006; Robertson et al., 1992). These enzymes can also act as thioesterases by releasing fatty acids from acyl derived thiol compounds (Hilton et al., 1990). Additionally, lysophospholipase activity of TesA of E. coli has also been demonstrated (Cho & Cronan, 1993; Lo et al., 2003).

The putative tailoring enzyme, SxtL, from saxitoxin gene cluster, shares three out of four conserved blocks found in SGNH-hydrolase superfamily of GDSL lipases. The multifunctional characteristic of this superfamily, makes SxtL an ideal enzyme to catalyse the synthesis of decarbamoylated analogues of STX (Kellmann, et al., 2008b; Mihali, et al., 2009). A recent anlaysis of complete sxt gene cluster from L. wollei has predicted that the lack of a functional sxtI gene lead to the evolutionary deletion of sxtL in this organism (Mihali, et al., 2011). Thus, further indicating the putative function of sxtL in STX biosynthesis to be the hydrolytic cleavage of the carbamoyl side chain from the carbamoylated products of sxtI in C. raciborskii T3 and other STX producing cyanobacterial spp. (see Figure 1.7 step 10). Alternatively, the role of this enzyme is also predicted to be the internal condensation involving guanidine amine to form the third ring of saxitoxin (Kellmann, et al., 2008b; Mihali, et al., 2009).

1.4.1.2 SxtU (putative short-chain alcohol dehydrogenase)

Short chain alcohol dehydrogenases/reductases (SDR) are a large family of oxidoreductases that are known for their catalytic activity to oxidize small aliphatic alcohols into their corresponding aldehydes or ketones (Gonzalez-Guzman et al., 2002; Krozowski, 1994). These enzymes are mostly active as a dimer or tetramer and contain two active domains, one binding the substrate and the other which binds to the

Page | 17

Chapter 1- A biochemical account of saxitoxin coenzyme NAD+ or NADP+ to perform the oxidation (Joernvall et al., 1995). It is widely accepted that long chain ethanol oxidizing alcohol dehydrogenase ADH-I share a common ancestral origin and have evolved via genetic duplications of ADHIII followed by mutational events for generations, in all organisms (Jornvall et al., 1999; Ladenstein et al., 2008). On the contrary, SDR family enzymes have evolved divergently from a similar ethanol-oxidizing system ancestral to Drosophila sp. of the order Diptera (Gasperi et al., 1994; Ladenstein, et al., 2008). All SDRs posses their characteristic Į/ȕ fold where the Į-helices surround and flank the central ȕ-sheet which is made up of at least 1 antiparallel ȕ strand and several other parallel ones (Filling et al., 2002; Ladenstein, et al., 2008). It is observed that SDR’s and ADH may not share high sequence similarities, but the characteristic NAD(H)-binding motif or the Rossmann domain is remarkably conserved and gives these convergent enzyme families the same enzymatic function in nature (Ladenstein, et al., 2008; Lesk, 1995; Oppermann et al., 2003).

The primary structure of SxtU has high sequence similarity to short-chain alcohol dehydrogenases and hence the predicted function of this enzyme is to reduce the terminal aldehyde group at C-1 of the STX precursor to form the tricyclic alcohol intermediate in step 8 of the biosynthesis of STX (see Figure 1.7) (Kellmann, et al., 2008b; Mihali, et al., 2011; Mihali, et al., 2009). This enzyme shows sequence similarity to other putative SDR’s from cyanobacterial origin, however, the most relevant is a functionally characterised enzyme- clavaldehyde dehydrogenase, which catalyses the formation of an alcohol by reducing the terminal group of clavulanate-9- aldehyde (Fulston et al., 2001; Kellmann, et al., 2008b).

Page | 18

1.5 Aims of the project

SxtL and SxtU are two putative tailoring enzymes found in C. raciborskii T3, predicted to be involved in step 8 and step 10 of the biosynthesis of saxitioxin (see section 1.4 and Figure 1.7). Using NCBI protein blast and sequence alignment tools like Clustal X and Clustal W, these proteins have been designated into GDSL lipase and short chain dehydrogenase/reductase families respectively (see sections 1.4.1.1 and 1.4.1.2) (Kellmann, et al., 2008b). However, the functions of these enzymes have not been biochemically determined to date.

In case of sxtL, of the closely related matches as found in using NCBI blast, none have been functionally attributed as an esterase or a GDSL lipase (see Figure 1.6). The primary structure of this enzyme shows similarities in three out of four conserved domains of SGNH superfamilies of GDSL lipases (see section 1.4.1.1). As a result, SxtL becomes the most suitable enzyme to catalyse the hydrolytic cleavage of the carbamoyl side chain of STX and its other carbamoylated analogues, to form decarbaramoylated compunds (Figure 1.7, tailoring step 8). Lipases are known to catalyse the hydrolysis of ester bonds in two commercially available substrates MUB (4-methylumbelliferyl butyrate) and 1-naphthyl acetate (Hsu et al., 2011; Roberts, 1985). This makes these compounds as ideal substrates to perform activity assays using zymography (Dherbécourt et al., 2008), in order to biochemically characterize and confirm the predicted function of sxtL as lipase.

On the other hand, the primary structure of SxtU shows high sequence similarity to short chain alcohol dehydrogenase family (SDR) and closely resembles to clavaldehyde dehydrogenase (see section 1.4.1.2 and Figure 1.6) (Kellmann, et al., 2008b). This enzyme is predicted to be involved in the reduction of the terminal aldehyde group at C-1 of the STX precursor to form the tricyclic alcohol intermediate in step 8 of the biosynthesis of STX (see section 1.4, 1.4.1.2 and Figure 1.7) (Kellmann, et al., 2008b; Mihali, et al., 2009). It is widely known that ethanol is the substrate for majority of ADH, and also that the conversion of alcohol to aldehyde is a bidirectional reaction when the appropriate cofactor is present (Jornvall, et al., 1999; May & Landgraff, 1976). A standard biochemical activity assay for potential alcohol dehydrogenases using zymography has been previously described. (Chavez-Pacheco et al., 2010; Fibla & Gonz lez-Duarte, 1993). Ethanol and various other substrates can be used in the combination with Nitroblue tetrazolium chloride monohydrate (NBT) and Phenazine Methosuflate (PMS) to detect ADH activity.

Thus, the aim of chapter 2 and chapter 4 was to investigate the functional aspects of the two putative proteins, SxtL and SxtU, by heterologous expression in E. coli strains BL21 (DE3) and Rosetta, respectively. Zymograms of both activity assays were performed for overexpressed proteins as well as for crude protein extracts from the saxitoxin producing cyanobacterial strain C. raciborskii T3. The substrates used for esterase activity assays for SxtL were MUB and 1-naphthyl acetate. For ADH activity

Page | 19

Chapter 1- A biochemical account of saxitoxin assays, in case of SxtU, ethanol and clavulanic acid were used as substrates. The resultant bands during activity staining were analysed by mass spectrometry in order to identify the relevant enzymes. In addition to C. raciborskii T3, ADH activity of crude protein extracts from saxitoxin producing A. circinalis AWQC131C was also analysed. Bioinformatics was performed using the multiple alignment tool,Clustal W, for sequence comparaion of proteins that were found.

The amenability of Synechocystis sp. PCC6803 towards uptake of foreign genes via integrative and conjugative plasmids like pKW1188 and pVZ322 respectively (Nakasugi & Neilan, 2005; Nakasugi et al., 2006; Sielaff et al., 2003), can be used for heterologous expression and characterization of putative genes from the sxt gene cluster, in this organism. Thus, the aim of chapter 3 was to achieve genomic integration of the putative GDSL lipase, sxtL, from sxt gene cluster of Cylindrospermopsis raciborskii T3 in non-toxic Synechocystis sp. PCC6803, using integrative vector pKW1188, for the purpose of expressing soluble SxtL protein. The cloning strategies involved attempts to clone sxtL ORF downstream to the strong light inducible promoter, psbA, in the intermediate vector pRL439, for the purpose of building a final construct in pKW1188. More details on the recent advances in gene transfer in Synechocystis sp. has been reviewed in the introduction of chapter 3.

Page | 20

Chapter 2- Investigation of putative enzyme function of SxtL (GDSL-lipase) from Cylindrospermopsis raciborskii T3 by zymography and mass spectrometry

2.1 Introduction

The recent discovery of the saxitoxin (sxt) gene cluster has provided insights into the complex mechanism of pharmaceutically important tailoring enzymes that are putatively involved in the biotransformation of PSTs in saxitoxin producing cyanobacterial species like Cylindrospermopsis raciborskii T3, Anabaena circinalis AWQC131C, Aphanizomenon sp. NH-5 and Lyngbya wollei (Kellmann, et al., 2008b; Kellmann & Neilan, 2007; Mihali, et al., 2011; Mihali, et al., 2009; Wiese, et al., 2010). The complete ORF of sxtI, a gene which encodes a putative carbamoyltransferease, is exclusively present in the sxt gene cluster of cyanobacterial species which are capable of producing carbamoylated PSTs (Kellmann, et al., 2008a). The decarbamoylation of carbamoylated PSTs is predicted to be the catalytic function of SxtL, a putative multifunctional enzyme - GDSL lipase (Kellmann, et al., 2008a; Mihali, et al., 2011). However, the functions of these enzymes in the saxitoxin biosynthesis are based on the bioinformatics analysis only (Kellmann, et al., 2008b; Mihali, et al., 2011; Mihali, et al., 2009). Although, the putative enzymes deduced from the sxt gene cluster seem likely to be true to their functions, there is no biochemical or proteomic evidence, neither to support their predicted function nor for their presence in the derived organisms.

The goal of this study was to increase the knowledge regarding the role of SxtL in the formation of decarbamoylated analogues after the biosynthesis of STX in C. raciborskii T3. The first half of this chapter investigates the predicted function of the SxtL protein that was overexpressed in E. coli BL21 (DE3) cells, using zymography as a tool to detect the its hydrolytic/esterase/lipase activity on two commercially available substrates, viz. 4-methylumbelliferyl butyrate (MUB) and 1-naphthyl acetate. The latter half details the use of esterase zymography in an attempt to detect SxtL in crude protein fractions obtained from C. raciborskii T3.

Page | 21

2.2 Materials and Methods

2.2.1 Over-expression in Escherichia coli strains

2.2.1.1 Bacterial strains, plasmids and culture conditions

The Escherichia coli strains relevant to this study are listed below in Table 2.1. The recombinant pET15b plasmid harbouring sxtL ORF from C. raciborskii T3 was kindly provided by Dr. Mihali from The School of Biotechnology and Biomolecular Sciences, UNSW, Sydney, Australia. Competent E. coli Dh5Į cells were transformed with this plasmid. Overexpression of sxtL was carried out in BL21 (DE3) while expression of pET15b plasmid without any recombinant gene was used as a negative control. All cultures were selectively grown, either in Luria-Bertani (LB) agar/broth or Tryptone phosphate broth depending on plasmid extraction, PCR screening or protein expression needs.

Table 2.1. Bacterial strains and plasmids.

E.coli Strains Characteristic Plasmid Antibiotic Reference for Features resistance E. coli strains - BL21(DE3) F , ompT, hsdSB pET15b::sxtL Ampicillin - - (rB mB ) gal dcm (DE3) (100 μg/ml) (Derman et al., - BL21(DE3) F , ompT, hsdSB pET15b:: Ampicillin 1993) - - (rB mB ) gal dcm (DE3) (100 μg/ml)

DH5Į F-f80dlacZDM15 pET15b::sxtL Ampicillin D(lacZYA-argF)U169 (100 μg/ml) deoR recA1 endA1 - - hsdR17(rK ,mK ) phoA supE44_-thi-1 gyrA96 relA1 (Hanahan, 1983)

DH5Į F-f80dlacZDM15 pET15b:: Ampicillin D(lacZYA-argF)U169 (100 μg/ml) deoR recA1 endA1 - - hsdR17(rK ,mK ) phoA supE44_-thi-1 gyrA96 relA1

Page | 22

Chapter 2- Materials and Methods

2.2.1.2 Plasmid extraction, amplification and transformation

2.2.1.2.1 Plasmid extraction

Plasmids pET15b::sxtL and pET15b::sxtL were extracted and purified from E. coli Dh5Į cells. Cultures were grown in 5 ml and 10 ml LB-broth overnight, collected by centrifugation and then suspended in eppendorf. The plasmids were isolated using the traditional alkali lysis protocol and purified on a column according to the manufacturer’s instructions for the PureLInkTM Quick Plasmid Miniprep Kit (Invitrogen, Carlsbad, USA).

2.2.1.2.2 PCR amplification

PCR cycling conditions with respect to different primers are shown in Table 2.2. The presence of sxtL in pE15b plasmid was confirmed by the polymerase chain reaction (PCR) using the stxL forward & reverse primers specific for the sxtL gene. The T7 promoter and terminator primers of the pET15b plasmid, flanking the sxtL gene, were also used to get the overall amplification of all samples including the negative controls.

The PCR reaction mixture of 20 μl contained 1x Taq polymerase buffer (New

England biolabs, NEB), 2.5 mM MgCl2, 0.2mM deoxynucleotide triphosphate (dNTPs), 10 pmol of forward and reverse primers each, about 40 ng to 60 ng plasmid DNA and 0.25 units of Taq polymerase (New England biolabs, NEB). (* refer to Appendix B, 1 for primer sequences)

Table 2.2. PCR amplification of sxtL.

Denaturation Denaturation Annealing Extension Final Incubation 30 s 2 mins 20 s 45 s Extention Primers 7mins 94oC 94oC 72oC 72oC 4oC stxL (F&R) 60oC T7 (F&R) 55oC 30x cycles

2.2.1.2.3 Transformation

o All competent cells (50 μl / 0.6 OD600, previously stored in -80 C), were thawed for 15 mins on ice. After adding ~ 40 ng of plasmid, the cells were incubated for another 30 mins on ice. This was followed by a 90s heat shock at 42oC, and a further incubation at 37oC (shaking/dark) for 1 hr after the addition of 500 μl of LB broth. The incubated cells were concentrated by removing 350 μl of excess media via centrifugation (15, 000 x g for 20 s) and gently resuspending the pellets in the

Page | 23

Chapter 2- Materials and Methods remaining 200 μl broth. All samples were spread plated on Ampicillin (100 μg/ml) selective LB agar plates. Plates were incubated overnight at 37oC (dark), and the next day, selected colonies were subcultured. Subcultured colonies were tested for presence of inserts and plasmids by colony PCR, with PCR parameters as mentioned in Table 2.2.

2.2.1.3 Protein expression and purification parameters

2.2.1.3.1 SxtL protein expression

Expression of recombinant SxtL protein was performed in BL21 (DE3) E. coli host strains (Novagen) and tryptone phosphate media supplemented with Ampicillin (100 Pg/mL), and 1% sterile glucose was used. Residual ȕ-lactamase was removed from 0.5 ml of overnight starter culture by concentrating the cells with low speed centrifugation for ~1 min. Cells were resuspended in equal amount (0.5 ml) of fresh media and transferred to 50 ml of expression cultures in 250 ml conical flask.

All cultures were grown with vigorous shaking (160 rpm) at 37qC to reach a value of

1 at OD650, were subsequently induced with 0, 0.1, 0.2 and 0.4 mM IPTG for 1, 2 and 4 hrs each at 37qC (see Table 2.3). After induction, cultures were transferred to 50 ml falcon tubes and incubated on ice for 15 mins. Cells were further harvested via centrifugation (5,000 g for 10 min at 4qC), then washed with 50 ml of cold phosphate binding buffer (Appendix A, 1.3), and stored at -20oC until required.

Table 2.3. Overexpression of sxtL.

Recombinant Culture volume IPTG induction Duration Temperature Ecoli strains per sample (mM) (hr) BL21 (DE3) 50 ml 0.0, 0.1, 0.2, 0.4 1, 2 and 4 for all 37oC + pET15b::sxtL BL21 (DE3) 50 ml 0.0, 0.1, 0.2, 0.4 1, 2 and 4 for all 37oC +pET15b::

2.2.1.3.2 Purification of SxtL protein

For purification of recombinant SxtL protein, cell pellets were thawed on ice and resuspended in 2% of the original volume of cold phosphate binding buffer. Ten microlitres of 50 mg/ml lysozyme solution was added and the pellets were gently resuspended without foaming, passed through an 18 gauge needle several times and incubated on ice for 1-3 hrs until lysis was evident. This was followed by brief sonication to shear the DNA (Branson Sonifier 250, amplitude 19, 50% duty cycle, pulsed). Finally, soluble and insoluble protein fractions were separated in sterile 1.5ml eppendorf tubes after centrifugation (20 000 g for 30 min at 4qC). Both fractions were

Page | 24

Chapter 2- Materials and Methods store a -20oC until further use. Glycerol was added to the soluble fractions to a final concentration of 40%.

This procedure was repeated for the expression of E. coli BL21 (DE3) strains containing pET15b: plasmid with no recombinant genes to obtain soluble and insoluble protein fractions as negative controls.

2.2.1.4 Protein Quantification and zymography

2.2.1.4.1 Protein concentrations were measured using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), following manufacturers protocol. The extinction coefficients of SxtL at 280nm: 66140 M-1cm-1 and 65890 M-1cm-1 as computed using ExPASy ProtParam tool, was used as reference to quantify the absorbance measurements (Appendix B, 2.1).

2.2.1.4.2 SDS-Polyacrylamide gel (12%) was used to resolve denatured protein samples based on their subunit molecular weights. Sodium-dodecyl-sufate polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described by Sambrook et al., using Mini-PROTEAN 3® system (Bio-Rad, Hercules, CA, USA). Protein aliquots (125 μg of all) were mixed with 4x SDS gel-loading dye and subjected to denaturation for 5 mins at 94oC. Broad range protein markers (2-212 kDa), from New England Biolabs, were used as standards to quantify their subunit protein sizes. After loading, the sample proteins were allowed to stack at 100 V and run at 180V during migration in the resolving gel until the dye reached bottom of the gel or completely ran off. Resolving gel was stained for ~1 hour and proteins were visualised after destaining the gel for another 30mins. (Appendix A, section 3 for buffers and reagents recepies)

Band corresponding to recombinant SxtL protein size (~ 50.98 kDa) was analysed by mass spectrometry. (* orginial size of SxtL protein is ~ 48.8 kDa. It is ~ 50.98 kDa with his.tag; see Appendix B, 2.1)

2.2.1.4.3 Esterase activity for soluble and insoluble protein fractions of SxtL was compared with negative controls on both SDS and NATIVE-PAGE zymograms (* refer further to section 2.2.3 for esterase zymography methods)

Page | 25

Chapter 2- Materials and Methods

2.2.1.5 Protein refolding for SxtL

The use of urea and arginine to refold insoluble proteins to their functional structures has been described previously (Tsumoto et al., 2010; Tsumoto et al., 2003). To assist refolding of 0.4 mM IPTG expressed SxtL protein, insoluble fractions were incubated with 3, 5 and 8 M Urea and 1 M arginine solutions. To confirm refolding, samples were analysed by Native PAGE zymography for esterase activity. (* Native-PAGE gel electrophoresis was performed as described by Sambrook et al.)

Arginine (1 M) and Urea solutions (3 M, 5 M and 8 M) were prepared in 50 mM Tris/HCl (pH6.8), to which a pinch of bromophenol blue was added. Insoluble fractions (pellets) were gently resuspended in 5 ml of each solution. Three mixtures with arginine were incubated at 4oC, 22oC and 37oC (12 hrs, gentle shaking) whereas, all samples prepared with urea solutions were incubated at 22oC (2 hrs, no shaking).

Negative controls of the same set (i.e. pET15b:: overxpressed at 0.4 mM IPTG), were prepared with 1 M arginine and Urea solutions (3 M and 5 M) using same conditions.

Proteins were allowed to refold and then processed for esterase activity using Native PAGE Zymography, 4-methylumbelliferyl butyrate was used as substrate. (* refer further to section 2.2.3 for zymography methods)

Pig lipase (5 mg/ml) was used as positive control for the assay.

Table 2.4. SxtL refolding with Urea and Arginine.

Samples Urea Arginine Concentration Temperature Time Concentration Temperature Time (moles) (moles) Insoluble 3 M 4oC o fraction- 5 M 22 C 2 hrs 1 M 22oC 12 hrs SxtL 8 M 37oC Insoluble o fraction- 3 M, 22 C 2 hrs 1 M 22oC 12 hrs Negative 5 M, control Pig lipase ------(5 mg/ml)

Page | 26

Chapter 2- Materials and Methods

2.2.2 Materials and methods for cyanobacterial protein extracts

2.2.2.1 Cyanobacterial strains and preparation of protein extract

As listed in Table 2.5, the static batch cultures of toxic and non toxic strains of cyanobacteria, originally grown in Jaworski medium at 26oC, were kindly provided by Dr. Mihali from School of Biotechnology and Biomolecular Sciences, UNSW, Sydney, Australia. Cell pellets were harvested by centrifugation (5,000 g for 20 min at 4qC), washed with sterile 10 mM Tris (pH 7.4) and resuspended in 500 μl of the same buffer. All 500 μl aliquots of resuspended cells were subjected to several cycles of freezing in liquid nitrogen followed by thawing at 22oC. Further protein extraction was aided by 5 cycles of beadbeat at max speed using a beadbeater. Beads were removed by centrifugation at high speed for 20 min. Any visible cell debris was further separated by centrifugation (16,000 g for 30 mins, 4oC).

Table 2.5. Cyanobacterial strains and features.

Cyanobacterial strains Toxicity sxtL accession n.o (ncbi protein database)

Cylindrospermopsis Saxitoxin ABI75102.1 raciborskii T3

Cylindrospermopsis Non-toxic - raciborskii CS509

Cylindrospermopsis Non-toxic - raciborskii CS510

Cylindrospermopsis Cylindrospermopsin - raciborskii AWT205

Page | 27

Chapter 2- Materials and Methods

2.2.3 Materials and methods for lipase (esterase) Zymography assays

2.2.3.1 Substrates for zymograms (activity staining)

1) 4-methylumbelliferyl butyrate (MUB) as substrate – 2.5 mg of MUB (Sigma- Aldrich) was dissolved in 1 ml of acetone. This solution was then added to 99 ml of 50 mM Tris HCl (pH7.4). Gels were immediately incubated in the substrate for 10 mins (dark) and visualized under UV for fluorescent bands of activity. The hydrolytic activity of lipases breaks the ester bond giving 4-Methylumbelliferone (fluorescent) and butyric acid. Fluorescent bands thus represent presence of lipases and esterase.

2) 1-naphthyl acetate as substrate – 2.5 mg of 1-napthyl acetate (from Sigma- Aldrich) was dissolved in 1 ml of acetone and the volume was made up to 10 ml with 50 mM Tris-HCl (pH 7.4). To this, 0.5 mg of Fast Blue B salt (Sigma-Aldrich) was added and then the volume was made up to 50 ml by 50 mM Tris-HCl, pH 7.4 buffer. Gels were immediately incubated in the prepared substrate for 10 mins in dark or until the bands of esterase activities were visible. Lipases and esterases convert 1-naphthyl acetate into naphthol which reacts with Fast Blue B salt. Red or blackish appearance of bands marks the location of the lipase or esterase.

2.2.3.2 SDS-PAGE zymography

Samples were prepared with final concentration of 1x SDS sample buffer. Proteins were allowed to denature at 45oC for 45 mins in water bath, instead of 94oC for 5 mins (like in normal SDS-PAGE as described by Sambrook et al.). This allows denaturing without extensive damage to the peptides along with binding of SDS. Samples were loaded on the 12% gel, allowed to stack from 30 V to 50 V and resolved with a max of 100 V at room temperature (22oC). At all times, the current in the tank was not allowed to increase above 20 mA (this assists in keeping the temperature of the process as low as possible; alternatively, the gel can also be run at 4oC).

After the SDS-PAGE, the proteins were allowed to renatured by incubating the gel in 2.5% w/v Triton X 100 for 30 mins, and rapidly washed with 50 mM Tris-HCl (pH7.5) at 22oC. Finally, the renaturated SDS-polyacrylamide gels were overlaid with either fluorescent substrate 4-methylumbelliferyl-butyrate (MU-butyrate/MUB) or 1-napthol acetate to visualize esterase activity (* refer back to section 2.2.3.1 for substrate preparation).

Page | 28

Chapter 2- Materials and Methods

2.2.3.3 NATIVE-PAGE zymography

Protein samples were prepared with final concentration of 1x Native sample buffer and loaded on the 10% Native-PAGE gel (Native-PAGE gel was prepared as described by Sambrook et al.). Samples were allowed to stack from 30V to 50V and resolved with a max of 80V at room temperature (22oC). At all times, the current in the tank was not allowed to increase above 20 mA (this assists in keeping the temperature of the process as low as possible; alternatively, the gel can also be run at 4oC). (* refer to Appendix A 3.4 for 4x native sample buffer recipe)

After Native-PAGE, the polyacrylamide gels were overlaid with either fluorescent substrate 4-methylumbelliferyl-butyrate (MU-butyrate/MUB) or 1-naphthyl acetate to visualize esterase activity (* refer back to section 2.2.3.1 for substrate preparation).

2.2.3.4 Zymography on 2D-PAGE

Three identical samples of crude extracts from Cylindrospermopsis raciborskii T3 were first run on a normal Native-PAGE gel. After resolving, lanes of the samples were cut. The zymogram of was obtained by 1-naphthyl acetate activity assay. The remaining two were allowed to soak in 1% SDS buffer for 10mins. The soaked gel stripes were carefully placed between two glass plates, aligning the horizontal side to the top edge. Enough space was allowed to pour resolving gel solution. A complete SDS-PAGE gel was cast with stacking gel around the gel stripes. Single well was also carved along the gel for running sample crude extract in one and a broad range protein marker (2-212 kDa), from New England Biolabs in another identically cast gel.

Both gels were allowed to stack proteins at 50V and a maximum of 100V for resolving at 22oC. To get the complete picture, from the set of identical 2D’s, one gel was stained with commassie blue while the other one was processed for zymography with 1-naphthyl acetate as substrate (refer back to section 2.2.3.2 for SDS-PAGE zymography)

Protein spots corresponding to lipase activity were subjected to Mass- Spectrometry analysis.

Page | 29

Chapter 2- Materials and Methods

2.2.4 Peptide mass fingerprinting and Bioinformatics

All bands corresponding to expected molecular weights in SDS, and 2D zymography, were excised and subjected to peptide mass fingerprinting at Bioanalytical Mass Spectrometry Facility, UNSW. The proteins were destained, extracted from the gel and digested with trypsin into peptide fragments. The resulting fragments were processed by Matrix Assisted Laser Desorption Ionisation Time-of-Flight Mass Spectrometry (MALDI-TOF-MS) to obtain the molecular weights.

For more sensitive detection or peptides in particular samples, FTMS (Fourier transform mass spectrometry) and LC-MSMS (Liquid chromatography-mass spectrometry) was used.

The peptide masses were blast on NCBI protein database (National Center for Biotechnology Information website – http://www.ncbi.nlm.nih.gov/), to achieve closest possible matches.

Page | 30

2.3 Results and discussions

2.3.1 Analysis of sxtL gene

Before proceeding to expression studies, transformed plasmids were confirmed for the presence of the recombinant genes. The PCR products were run on a 1% agarose gel to visualize the correct size. Lanes, Sx1 and Sx2 (Fig. 2.1) show amplification of the sxtL gene using the T7 primers (promoter and terminator) and sxtL specific primers (stx-f and stx-r), respectively. The expected sizes were ~1500 and 1296 base pairs resepctively. In lanes C1 and C2, amplification with T7 primers clearly shows that the control plasmids did not have any of the recombinant genes.

C1 C2 L1 Sx1 L2 Sx2

1.5 kb

1.2 kb 200 bp

100 bp

Figure 2.1. PCR confirmation of sxtL from pET15b vectors.L1 and L2 are ladders. Sx1 and Sx2 are sxtL amplifications with T7F&R and StxF&R primers respectively. C1 and C2 are products of empty pET15b vectors using the T7F&R primers.

2.3.2 Expression of sxtL

2.3.2.1 Early observations

The recombinant E. coli BL21 cells containing the pET15b::sxtL plasmid showed delayed growth when compared to the non-recombinant controls (Figure 2.2). By the end of 3 hrs, the control cells had already reached the value of 1 at OD650 while the recombinant ones grew only half that amount. Hence, we predict that the presence of the sxtL gene was putting stress on the transformed E. coli cells. Also, the recombinant bacteria were more easily lysed than their non-recombinant controls

Page | 31

Chapter 2- Results and discussions during the extraction of cellular proteins. The T7 promoters are not completely inactivated in E. coli BL21 cells, which would suggest that a small amount of protein was been expressed in the recombinant cells, even before induction by IPTG, potentially causing the cells stress.

Pre induction growth rate 1.5

after 3 hrs control 650 1 sxtL 0.5

0 Optical density OD

Figure 2.2. Difference in the growth pattern of control and E. coli BL21 cells.

2.3.2.2 SxtL protein quantification

Recombinant SxtL protein was successfully expressed in 0.1, 0.2 and 0.4 mM IPTG induced conditions. However, it was found in insoluble fractions in the form of inclusion bodies. All wells show crude protein extracts from both control and recombinant BL21 strains where no significant difference was found at the expected position of ~ 50.98 kDa (Figure 2.3). InS represents the crude extract of 0.4 mM induced insoluble fraction from overexpressed SxtL. The expressed protein was clearly seen at a molecular weight of ~ 50 kDa position. To support this finding, the insoluble SxtL band from InS was excised from the gel and analysed by peptide mass fingerprinting. The observed masses of peptide fragments by tryptic digestion corresponded to the expected values of translated SxtL protein fragments (Figure 2.4). The complete amino acid sequence of SxtL protein has been shown Figure 2.5, where the red or underlined letters in the sequence indicate the experimentally observed peptides.

Page | 32

Chapter 2- Results and discussions

1 2 3 4 5 6 7 L 8 9 InS L

55.6 kDa Insoluble sxtL

42.7 kDa

Figure 2.3. Overexpression of sxtL.

Odd and even numbered wells represent expression in control and recombinant E. coli BL21 cells respectively. L is the broad range protein ladder. InS is the insoluble fraction from recombinant cells subjected to 0.4 mM IPTG induction of sxtL gene for 1 hour. Double headed arrow in left side picture shows ~ 50.0 kDa position where the recombinant protein was missing in soluble fractions. Insoluble fraction (InS) clearly showed overexpressed protein at the same position.

Figure 2.4. Peptide fragments of SxtL protein.Peptide mass fingerprinting of the excised band corresponding to the predicted recombinant protein.

Page | 33

Chapter 2- Results and discussions

Figure 2.5. Amino acid sequence of recombinant SxtL.

Highlighted letters indicate peptide fragments detected by peptide mass fingerprinting.

2.3.2.3 Esterase zymography and Refolding of SxtL

Native and SDS-PAGE zymography was successfully performed for both soluble and insoluble fractions of recombinant cells expressed with SxtL protein and studied against the background activity of lipases native to the cells (Figure 2.6, a, b and d). It was observed that the activity of lipases from soluble fractions of control cells was more prominent than the activity possessed by lipases from recombinant cells in which sxtL gene was expressed (Figure 2.6, a & b). The proteins from insoluble fractions of recombinant and controls did not show any Lipase/esterase activity (Figure 2.6 d). However, after incubation with 5M Urea solution at 22oC, some activity was shown by insoluble proteins of control cells (Figure 2.6 c, lane 2). No activity was found for insoluble SxtL protein fractions; neither with urea (3, 5 or 8M) nor with arginine (1M) (Figures 2.6 c, lanes 4 to 9). This suggests that the recombinant protein was somehow damaging or interfering with the proteins native to the E. coli cells; which may also explain the slow growth of recombinant cells at early stages when compared to the growth of controls (see earlier observations for Figure 2.2)

Page | 34

Chapter 2- Results and discussions

S1 xS1 S2 xS2 S3 xS3 xS4 1 2 3 4 5 6 7 8 9

A C

C1 C2 1 2 3 4 C1 C2 1 2 3 4

B D

Figure 2.6. Zymography and Refolding of SxtL protein.

A) Native-PAGE esterase zymography of soluble protein fractions of control and recombinant BL21 strains showing activity on 1-naphthyl acetate. S1, S2 and S3 represent soluble fractions from control, while xS1, xS2, xS3 and xS4 represent the ones from recombinant BL21 cells.

B) SDS-PAGE esterase zymography of insoluble fractions from control and SxtL. C1 is pig lipase while C2 is lipase from Candia antartica. Substrate used for activity staining was 4-methylumbelliferyl-butyrate (MUB)

C) Urea-PAGE zymography. Lanes 1, 2 and 3 are insoluble fractions incubated with arginine (1M) and urea (3 M and 5 M) respectively. Lanes 4 5 and 6 are insoluble fractions incubated with Urea 3M, 5M and 8M respectively. Lanes 7, 8 and 9 are insoluble fractions incubated with 1M arginine at 4oC, 22oC and 37oC respectively.

D) Native-PAGE zymography of untreated insoluble fractions of both control and SxtL zymography, with 1-naphthyl acetate as substrate. C1 is pig lipase while C2 is lipase from Candia antartica. Lanes 1 and 2 are insoluble fractions from control. Lanes3 and 4 are insoluble fractions of SxtL.

(* marked arrows indicate lipase/esterase bands, as seen in only control E. coli BL21 samples)

Page | 35

Chapter 2- Results and discussions

2.3.3 SDS-PAGE zymogram from cyanobacterial crude extracts

Overexpression of sxtL gene in E. coli formed inclusion bodies of the protein even in the presence of minute amount of IPTG induction. Therefore, to detect naturally produced SxtL, SDS-PAGE zymography was performed on crude protein extracts of Cylinderospermopsis raciborskii T3. The evidence of saxitoxin biosynthesis genes specifically in saxitoxin producing organisms has been reviewed in previous studies. Hence, zymography was performed on non-saxitoxin producing strains of Cylindrospermopsis raciborskii (strains CS510, CS509 and AWT205) to get a background activity of native lipases.

Two bands representing esterase activity were found unique to the saxitoxin producing cyanobacteria, one of which showed a faint band of activity and corresponded to ~ 48.8 kDa. The other activity at position > 212 kDa was quite significant as compared to the non toxic strains (see Figure 2.7). The zymogram pattern also shows that the profiles of uncharacterized or unknown lipases in this organism are very unique.

Surprisingly, LC/MS/MS of the band corresponding to ~ 48.8 kDa did not reveal presence of any relevant esterase or lipase enzyme. However, peptide signals for S-adenosyl-L-homocysteine hydrolase [Cylindrospermopsis raciborskii CS-505] were detected at this position. This enzyme has no relevance with the putative GDSL lipase (SxtL) and moreover many other proteins were also detected. If SxtL was present in traces, then the proteins needed to be more resolved on the gel.

L T3 CS510 CS509 AWT205 T3 > 212 kDa

~ 48.8 kDa

Figure 2.7. SDS-PAGE Zymography of toxic and non-toxic cyanobacterial protein extracts.

Right hand side picture shows-Esterase zymogram of non toxic and toxic strains of Cylinderospermopsis raciborksii. (Non-toxic CS510 and CS509 and Toxic AWT205 and T3) (*AWT205 produces cylindrospermopsin). Left hand side picture- SDS-PAGE of crude protein extract from Cylindrospermopsis raciborskii T3. L is broad range protein ladder.

(* comparing both pictures, same shaped arrows represent same bands on different gels)

Page | 36

Chapter 2- Results and discussions

2.3.4 2D Native-SDS PAGE zymography and mass spectrometry

The putative GDSL lipase/esterase, ‘SxtL’ could be present in traces or may have been associated with other enzymes. Hence, 2D zymography was successfully performed in order to detect this protein in Cylindrospermopsis raciborkii T3 (Figures 2.9 and 2.10). Two dimensional gave high resolution of proteins which corresponded to esterase activity. Peptide fingerprinting of proteins from activity stained bands corresponding to ~ 48.8 kDa revealed S-adenosyl-L-homocysteine hydrolase (Raphidiopsis raciborskii D9/Cylindrospermopsis raciborskii CS-505) (refer to Figure 2.8 and compare Figure 2.9 and 2.10 for more details).

Figure 2.8. Peptide signals of protein corresponding to ~ 48.8 kDa.

Peptide fragments of S-adenosyl-L-homocystein hydrolase retrieved from activity stained 2D gel at position ~48.8 kDa. The conceptual mass of this protein from Raphidiopsis brokii D9 is 45880daltons.

A high intensity spot of esterase activity was seen at position > 212 kDa even after resolving the proteins in 2D. When compared to the commassie stained 2D gel, no intense spots of proteins can be observed at the same position (compare Figure 2.9 and 2.10). This prominent band was found uniquely in Cylindrospermopsis raciborskii T3 (section 2.3.3) and also seen in Native-PAGE of the same sample (Figure 2.10 B). The activity of lipase at this position in Native-PAGE may indicate that SxtL could be associated with other proteins as in a multienzyme complex; this can explain why this protein was not detected at position ~ 48.8 kDa by mass spectrometry analysis.

Page | 37

Chapter 2- Results and Discussions

A B L B L

B B

212kDa

55.6kDa

42.7kDa

27.0kDa

Figure 2.9. (Left) Commassie stained 2D gel.

Crude protein extract from Cylindrospermopsis raciborskii T3 as analysed on 2D gel. In comparison with the next figure - L) Broad range protein ladder. B) Position of lipases in Native-PAGE before SDS-PAGE. All arrows proceeding downwards indicate the direction of proteins being resolved in SDS- PAGE. Spots are the stained proteins after resolution. All arrows and circle correspond to their counterparts in Figure 2.9. Horizontal line segment indicates ~ 48.8 kDa for the predicted SxtL protein.

Figure 2.10. (Right) Esterase Zymogram on the 2D gel.

In comparison to commassie stained duplicate gel- L) Broad range protein ladder. A) SDS-PAGE zymogram of crude extract from Cylindrospermopsis raciborskii T3. B) Position of lipases in Native-PAGE before SDS-PAGE. Spots represent resolved proteins showing lipase/esterase activity. Horizontal line segment indicates ~ 48.8 kDa. Circle indicates intense activity from trace proteins at molecular size >212 kDa when compared to previous Figure. (* Inclined arrows indicate protein stops at ~ 48.8 kDa position showing esterase activity which were analyzed by peptide mass fingerprinting. Fragments representing S-adenosyl-L-homocysteine hydrolase were detected in sample from left deflected arrow.)

Page | 38

2.3 Conclusions

The putative GDSL lipase ORF, sxtL, of the sxt gene cluster from Cylindrospermopsis raciborskii T3, was successfully analyzed by sequencing and overexpressed in the E. coli BL21 (DE3) cells under the influence of the IPTG inducible T7 promoter. However, heterologous expression of this gene, even when induced with low concentrations of IPTG, did not show any unique lipase activity, as inferred by zymography. The expressed protein was found in the insoluble protein fraction and was confirmed to be SxtL by peptide mass fingerprinting. The insoluble recombinant protein did not show any lipase activity on 1-naphthyl acetate and 4-methylumbelliferyl-butyrate (MUB). There was no unique activity found in both soluble and insoluble protein fractions even after attempts at protein refolding using urea and arginine. This confirmed that the expressed protein had formed inclusion bodies and was improperly folded.

The presence of the sxtL gene seemed to be negatively affecting the normal metabolic functions in E. coli BL21as the recombinant strain exhibited a reduced growth rate. A depleted or complete loss of the activity of normal lipases in the recombinant E. coli cells, as observed from their lipase activity zymograms, also supported the previous assumption.

When the lipase activity assay was performed for closely related non-toxic and toxic strains of Cylindrospermopsis raciborskii, two bands showing a unique activity were observed at ~ 48.8 kDa and >212 kDa positions on the SDS-PAGE zymogram of the C. raciborskii T3. Although, no peptide fragments resembling SxtL were detected in any of the lipase bands, an intense activity from an untraceable spot at >212 kDa on 2D gel was unexpected. This lead to a hypothesis, that the sxtL gene might be expressing lipase activity in association with other proteins, as a part of a multienzyme complex in the host organism, unable to enter into the gel. Could this be the reason why this enzyme failed to show lipase activity when overexpressed?

In order to tackle the problem with insolubility of SxtL protein in E. coli, an integrative approach for its in vivo expression in non-toxic cyanobacterium Synechocystis sp. PCC6803 was investigated further in chapter 3.

Page | 39

Chapter 3- Integrative approach for genomic expression of a putative GDSL lipase, sxtL, from Cylindrospermopsis raciborskii T3, in non-toxic cyanobacterium Synechocystis sp. PCC6803

3.1 Introduction

Synechocystis sp. PCC6803 is a naturally transformable, non-toxic unicellular cyanobacterium (Nakasugi, et al., 2006). The discovery of natural transformation in cyanobacteria dates back to 1974 (Orkwiszewski & Kaney, 1974); whereas the first evidence which described transformation in Synechocystis sp. PCC6803 was published in the year of 1982 (Grigorieva & Shestakov, 1982). Since then, the knowledge related to DNA binding and uptake process in this organism has greatly advanced with the progress in mutational experiments, leading to the discovery of a putative gene cluster that controls its phototactic motility and competence factors (Barten & Lill, 1995; Yoshihara et al., 2002; Yoshihara et al., 2001). Recently, a new competence gene comF, of this strain was characterized for its role in the uptake of foreign DNA; which also showed little sequence similarity to competence proteins that are usually found in other transformable bacteria (Nakasugi, et al., 2006). Although, most of the Synechocystis sp. PCC6803 stains exhibit natural competence for the uptake of DNA, due to the fact that some of its strains have shown loss in natural competency as a result of spontaneous sub-culturing during mutational experiments, electroporation technique has always been the preferred choice for the transfer of foreign genes in this organism (Ikeuchi & Tabata, 2001).

Gene transfer techniques have also aided the molecular characterisation of toxin gene clusters in cyanobacterial species like Microcystis aeruginosa and Planktothrix agardhii, which can also be attributed to the natural transformation tendency of these organisms (Christiansen et al., 2003; Tillett et al., 2000). The function of a putative aspartate racemase from microcystin producing Microcystis aeruginosa PCC7806, has been determined in recent studies (Sielaff, et al., 2003). The characterization of this enzyme was achieved by autonomous expression of the mcyF ORF from

Page | 40

Chapter 3-Introduction microcystin (mcy) gene cluster, in Synechocystis sp. PCC6803; under the control of light inducible psbA2 promoter in a conjugative construct of pVZ322. In recent studies on the identification and characterization of putative Type IV pili (Tfp) gene, pilT, of the same toxic strain, genomic integration of this into Synechocystis sp. PCC6803 (Nakasugi & Neilan, 2005). It involved the use of an integrative vector pKW1188, suited with glutamine synthetase A (glnA) promoter upstream to the gene, which was subjected to transfer via electroporation. Later, the same approach was also implemented to characterize comF gene. (Nakasugi, et al., 2006). However, in this case, to build the final construct in pKW1188, a strong light inducible psbA promoter from Synechocystis sp. PCC6803 was preferred instead.

Several bloom-forming species of marine eukaryotic dinoflagellate and freshwater prokaryotic cyanobacteria produce lethal bioactive secondary metabolites, such as hepatotoxins and paralytic shellfish toxins (PSTs) (McElhiney & Lawton, 2005; Schantz, 1986). PSTs like saxitoxin (STX) and its analogues are a group of perhydropurine alkaloid neurotoxins (Wiese, et al., 2010). In nature, these compounds are capable of causing mass destruction of marine and terrestrial life forms, as a result of paralytic shellfish poisoning (PSP) and intake of toxin contaminated water (Anderson, 1989, 2004; Berry & Lind, 2010; Deeds, et al., 2008). PSP outbreaks in humans have been recorded for more than a century now, and also claimed thousands of lives in the past (Botana, 2000; Chevalier & Duchesne, 1851a; Hallegraeff, 2010; Hallegraeff, et al., 1995). A global and recurrent occurrence of dinoflagellate and cyanobacterial blooms has raised major concerns towards public health in recent years (Hallegraeff, 2010); thus increasing the need for toxin monitoring and scrutinizing expenditures in adversely affected countries around the world (Hoagland, et al., 2002; Hoagland & Scatasta, 2006; Johnson, et al., 2010).

The use of gene transfer techniques to characterize the biochemistry of phycotoxins have high economic and environmental implementations on the management of toxic cyanobacterial blooms (Baker et al., 2002). The recent discovery of saxitoxin (sxt) gene cluster in saxitoxin producing Cylindrospermopsis raciborskii T3, Anabaena circinalis AWQC131C, Aphanizomenon sp. NH-5 and Lyngbya wollei, has putatively indentified different enzymes that are involved in the biosynthesis of saxitoxin (Kellmann, et al., 2008b; Mihali, et al., 2011; Mihali, et al., 2009). This has helped design a molecular screening technique, which is more efficient and highly cost- effective than the traditional monitoring methods for the identification of saxitoxin producing organisms in environmental samples (Al-Tebrineh et al., 2010a, 2010b). However, the application of the identified genes is not limited to monitoring toxic cyanobacteria only. It has also contributed towards new possibilities of combinatorial biosynthesis for the development of new drugs (Dittmann et al., 2001; Kellmann, et al., 2008b; Wiese, et al., 2010). In recent years, pharmaceutical potential of STX and its analogues has also been highly attributed (Wiese, et al., 2010).

In order to develop combinatorial biosynthesis in future, for the production of unnatural STX analogues, it is important to functionally characterize the tailoring

Page | 41

Chapter 3-Introduction enzymes in STX biosynthetic pathway (Wiese, et al., 2010). The designated role of all enzymes in this pathway have been strictly based on the molecular characterization of the sxt gene cluster from different organisms, and efforts to isolate high concentrations of individual enzymes from the native organisms have been unsuccessful in previous attempts (Kellmann & Neilan, 2007; Pearson, et al., 2010; Yoshida, et al., 2002; Yoshihara, et al., 2001). Gene transfer techniques like natural transformation and electroporation can be utilized for overcoming these drawbacks by heterologous expression of ORF from saxitoxin gene cluster in transformable non- toxic cyanobacterial strains.

The goal of this chapter was to achieve homologous integration of sxtL gene from Cylindrospermopsis raciborskii T3 using integrative vector pKW1188, for future implementation of heterologous expression of soluble SxtL protein in non-toxic cyanobacterium Synechocystis sp. PCC6803.

Page | 42

3.2 Materials and Methods

3.2.1 Bacterial cultures, Plasmids and Transformation

Escherichia coli Dh5Į strain was used for all cloning procedures. All recombinant plasmids from previous studies, as listed in Table 3.1 were kindly supplied by Dr. Mihali and Dr. Gehringer from School of Biotechnology and Biomolecular Sciences (BABS), UNSW, Sydney, Australia. The sxtL gene had been cloned upstream to the 6his.tag, in its multiple cloning region of pET15b vector (Appendix B, 3.4). A resulting construct fused to the C-terminus His-tag helps in purification of recombinant protein by His-Trap affinity column chromatography. Vector pRL439 has a pUC18 backbone and contains a psbA promoter from Amaranthus hybridus that is recognisable in Synechocystis sp. (Appendix B, 3.1.2 & 3.3) (Elhai & Wolk, 1988; Liu et al., 1999). PKW1188 is kanamycin resistant integrative vector which facilitates double homologous recombination at the locus slr168 of Synechocystis sp. PCC6803 (Williams, 1988). The kanamycin resistance gene (knr) cassette from this plasmid can be removed by single digestion with EcoRI restriction enzyme (Appendix 3.2). PSCR9 also contains a knr cassette downstream to a psbA promoter and can be separated by single digestion with HindIII restriction enzyme, for downstream applications (Cohen & Meeks, 1997). (Refer to Table 3.1 for references and key features of all the plasmids used in this study).

Table 3.1. Plasmids and key features.

Plasmids Key features Antibiotic Primers Maps References resistance (Appendix B, 1) 5’- T7promoter: pET15b::sxtL :rbs: Ampicillin 1) T7 F&R Appendix BABS, UNSW (7004 bp) :6his.tag: (Amp) 2) SxLF&R B, 3.4 :sxtL: 3) KB1F&R :T7terminator-3’ pRL439 5’-M13F: Ampicillin M13 F&R Appendix (Elhai & Wolk, (2736 bp) :psbA: (Amp) B, 3.3 1988; Liu, et al., :M13R -3’ 1999) Synechocystis Kanamycin pKW1188 pcc6803 (Kan) - Appendix (Williams, 1988) (6600 bp) integrative B, 3.2 vector Kanamycin (Cohen & pSCR9 5’-psbA::knr-3’ (Kan) - - Meeks, 1997)

Page | 43

Chapter 3- Materials and Methods

knr from pSCR9 Ampicillin pET15b::sxtL attached to (Amp) 1) T7 F&R - r : :kn HindIII site of 2) StxLF&R This study pET15b::sxtL Kanamycin 3) KB1F&R (Kan) knr from Ampicillin r pRL439::kn pKW1188 (Amp) M13 F&R (3936 bp) attached to - This study EcoRI site of Kanamycin pRL439 (Kan)

3.2.1.1 Standard transformation

In order to transform the plasmids, competent cells (50 μl / 0.6 OD600) previously stored in -80oC were thawed for 15 min on ice. These cells were incubated for another 30 min after the addition of ~ 40 ng of plasmid DNA. This was followed by 90 s heat shock at 42oC and further incubation at 37oC (shaking/dark) for 1 hr after the addition of 500 μl of Luria-Bertani broth. Three hundred and fifty microlitres of excess media was removed from the incubated eppendorfs by concentrating the cells at 10, 000 x g centrifugation speed for 15 s. Cells were gently resuspended in the remaining 200 μl broth and spread on ampicillin (100 μg/ml) and kanamycin (50 μg/ml) selective LB agar plates, depending on the choice of plasmid. Plates were incubated overnight at 37oC (dark) and the next day, selected colonies were subcultured in fresh media. Subcultured colonies were screened for the presence of inserts and plasmids by colony PCR using PCR parameters as mentioned in Table 3.2 of section 3.2.2.2

3.2.1.2 Plasmid extraction

Whenever required, plasmids were extracted and column purified from E. coli Dh5Į cells. Five and 10 ml overnight cultures in LB-broth were suspended, lysed and neutralized all according to manufactures instruction for PureLInkTM Quick Plasmid Miniprep Kit (Invitrogen, Carlsbad, USA).

Page | 44

Chapter 3- Materials and Methods

3.2.2 Primer designing, Polymerase chain reaction (PCR) and Sequencing

3.2.2.1 Designing primers KB1-F and KB1-R

Primers KB1-F and KB1-R were designed to amplify the sxtL gene from pET15b::sxtL vector, and contained the restriction sites BamHI and EcoRI respectively, to facilitate sticky end cloning into the BamHI and EcoRI sites of the pRL439 vector. To design these primers the NCBI primer designing tool was used (http://www.ncbi.nlm.nih.gov/tools/primer-blast/); (Rozen & Skaletsky, 2000). As predicted from the primer designing tool, the optimum annealing temperature for this primer pair was obtained by setting a gradient between 60oC to 50oC. Thus, the product of these primers was –5’-BamHI-rbs-6his.tag-sxtL-EcoRI-3’-.

(* refer to Appendix B, 1 for primer sequences)

3.2.2.2 PCR parameters

The cycling conditions used for different primer pair combination is shown in Table 3.2. The PCR reaction mixtures of 20 μl contained 1x Taq polymerase buffer (New

England biolabs, NEB), 2.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphate (dNTPs), 10 pmol of forward and reverse primers each, about 40 ng to 60 ng plasmid DNA and 0.25 units of Taq polymerase. In case of a colony PCR, a small fraction of a colony was picked using a sterile tip and added to the PCR reaction. The volume was made up to 20 μl using sterile MQ water in all cases.

(* refer to Appendix B, 1 for primer sequences)

Table 3.2. PCR Parameters for primers.

Denaturation Denaturation Annealing Extension Final Incubation 30 s 2 mins 20 s 45 s Extention Primers 7mins 94oC 94oC 72oC 72oC 4oC

StxL (F&R) 60oC KB1 (F&R) 54oC T7 (F&R) 55oC M13 (F&R) 55oC 30x cycles

Page | 45

Chapter 3- Materials and Methods

3.2.2.3 Precipitation of PCR and sequencing products

For downstream applications for cloning experiments, DNA from PCR products was purified with 2 volumes of ice cold 100% ethanol and incubated on ice for 15 mins. This was followed by centrifugation at 16,000 x g for 20 mins at 4oC. After removing the supernatant, the DNA pellet was washed by adding 250 μl of room temperature 70% ethanol, followed by centrifugation at 16,000 x g for 15 mins at 4oC. The final supernatant was carefully removed without disturbing the pellet and air-dried for 10-15 mins. The DNA was resuspended in 20 μl sterile milliQ.

3.2.2.4 Sequencing

Plasmids and PCR products were verified for the expected DNA contents before proceeding to cloning experiments. Sequencing of the PCR products and subsequent purification steps were performed according to the protocol for ABI 3730 Capillary Sequencer (Applied Biosystems Inc, Foster City, CA, USA). Each 20 μl reaction contained 10 μl Big Dye terminator version 3.1, sequencing buffer, 40 ng of DNA, and 3.2 pmol primer (see Table 3.3 sequencing details). Automated sequencing was performed on ‘Applied Biosystems 3730 DNA Analyzer (Applied biosystem Inc, Foster City, CA, USA)’ at ‘The Ramaciotti Centre for Gene function Analysis’, UNSW. NCBI nucleotide database was used to confirm all sequences received.

Table 3.3. Sequencing.

Plasmid Primer Sequence verified pET15b::sxtL T7 promoter and terminator Appendix B, 3.1 KB1 F and R pRL439 M13F and M13R Appendix B, 3.3

3.2.3 DNA quantification

DNA concentrations were measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), following the manufacturers protocol. Agarose gel (1%) was also used to judge the concentration of the DNA against the molecular weight marker of known concentration (GeneRuler™ 1 kb DNA Ladder, 250-10,000 bp; Fermentas, Hanover, MD , USA) , for approximate values.

Page | 46

Chapter 3- Materials and Methods

3.2.4 Gel extraction

The desired inserts and digested vectors used in all cloning experiments were cut from 1% agarose gel and purified using the Bioline Isolate PCR and Gel Kit (Cat. n.o BIO- 52030). Sterile milliQ water was used for all elution steps. Eluted DNA was kept at -20oC storage for up to 3months and not more than two weeks in 4oC for frequent use.

3.2.5 Cloning parameters

3.2.5.1 Standard ligation reaction

Sticky end ligation for all experiments was carried out overnight at 4oC in a reaction volume of 10 μl containing 1 μl of the 10x ligation buffer (Promega, Madison, WI, USA), 3 units of T4 DNA ligase (Promega, Madison, WI, USA), and insert and vector DNA at a ratio of 3:1. The reaction was stopped by heat inactivation of T4 DNA ligase (65oC for 10 mins) and ligated plasmids were immediately transformated into competent E. coli Dh5Į cells.

3.2.5.2 Cloning sxtL into pRL439

Primers KB1F and KB1R were used to amplify the sxtL gene upstream to the rbs and 6his.tag from the pET15b::sxtL vector (see Appendix B, 3.4 for vector map). It is known that the Pfu DNA polymerase from Pyrococcus furiosus exhibits the lowest error rate of any thermostable DNA polymerase and rapidly excises any base misinsertions that may occur during polymerization (Cline et al., 1996). Hence, for PCR amplification, Pfu was used instead of Taq, in order to achieve a complete and correct amplification. The product was then purified and sequenced for confirmation before proceeding. Both, the amplified insert and pRL439 vector were double digested with restriction enzymes BamHI and EcoRI-HF™ (New England Biolabs) at 37oC for 3 hrs.

This was followed by purification of the digested insert (–5’-BamHI-rbs-6his.tag- sxtL-EcoRI-3’-) using the QIAquick® PCR purification kit, and gel extraction of double digested pRL439 vector (* refer back to section 3.2.4 for gel extraction method). The gel extracted pRL439 was treated with and later column purified from Shrimp Alkaline Phosphatase (SAP, Promega) which catalyzes the dephosphorylation of 5' and 3' termini, leaving a digested DNA unable to relegate. After DNA quantification, the standard ligation, transformation and colony PCR was followed as described in sections 3.2.5.1, 3.2.1.1 and 3.2.2.2 respectively.

Page | 47

Chapter 3- Materials and Methods

Table 3.4. Cloning sxtL into pRL439- Restriction digestion parameters.

KB1F&R pRL439::knr pRL439::knr PCR DNA (1 μg) DNA (1 μg) purified product after BamHI digestion. (1 μg) 10x 4 μl 4 μl 4 μl NEBuffer 2 BamHI 0.3 units 0.3 units -

EcoRI - HF™ 0.5 units - 0.5 units

BSA 50 μg 50 μg 50 μg

Sterile Made up Made up Made up milliQ water to 50 μl to 50 μl to 50 μl

3.2.5.3 Cloning Kanamycin from pSCR9 into pET15b::sxtL

Both pSCR9 and pET15b::sxtL vectors were digested with the restriction enzymes o HindIII (New England Biolabs.) at 37 C for 3 hrs. This was followed by gel purification of both insert (knr from pSCR9) and digested vector (pET15b::sxtL). After quantification of DNA content, standard ligation and transformation was followed.

The goal of inserting the knr cassette upstream of the sxtL gene in pET15b::sxtL was to achieve the insert sxtL with the kanamycin reporter to ease screening in subsequent cloning experiments.

Table 3.5. Cloning knr from pSCR9 into pET15b::sxtL- Restriction Digestion Parameters.

pSCR9 pET15b::sxtL DNA (1 μg) DNA (1 μg) 10x NEBuffer 2 4 μl 4 μl

HindIII 0.5 units 0.5 units

BSA 50 μg 50 μg

Sterile milliQ Made up Made up water to 50 μl to 50 μl

Page | 48

Chapter 3- Materials and Methods

3.2.5.4 Cloning Kanamycin gene from pKW1188 into pRL439

In the multiple cloning sites of Vector pRL439, downstream of the psbA promoter, BamHI and EcoRI regions are only 4 base pair (bp) apart. As a result, the double digestion of this vector is not visible on gel. In order to overcome this problem, it was decided to clone a reporter gene into the EcoRI site, to increase the distance between the two restriction enzymes sites. This would allow for subsequent digestion using both BamHI and EcoRI and subsequently the insertion of the sxtL containing fragment. Insertion of a gene other than sxtL (in subsequent studies) also verifies that cloning at these sites with used parameters was achievable.

Both, the pKW1188 and pRL439 vectors were digested with restriction enzymes ™ o EcoRI-HF (New England Biolabs.) at 37 C for 3 hrs. This was followed by gel purification of both, the insert (knr from pkW1188) and digested vector (pRL439). After quantification of DNA concentration using 1% agarose gel, the standard ligation and transformation protocols (section 3.2.5.1 and 3.2.1.1) were performed.

Table 3.6. Cloning knr from pKW1188 into pRL439- Restriction Digestion Parameters.

pKW1188 pRL439 DNA DNA (1 μg) (1 μg) 10x 4 μl 4 μl NEBuffer 2 EcoRI - HF™ 0.5 units 0.5 units

BSA 50 μg 50 μg

Sterile Made up Made up milliQ water to 50 μl to 50 μl pH- 7.0

3.2.5.5 Cloning sxtL::knr into pRL439

The gel extracted insert sxtL::knr (5’-BglII-T7promoter-rbs-6his.tag-sxtL-T7terminator -knr-EcoRI-3’) was excised from the pET15b::sxtL::knr vector by double digestion with BglII and EcoRI-HF™ restriction enzymes. (*note: BglII site is compatible with BamHI)

To prepare the vector, pRL439::knr was sequentially double digested with the restriction enzymes, BamHI and EcoRI-HF™. First, DNA was digested with BamHI and purified using the QIAquick® PCR purification kit. The eluted DNA was then digested with EcoRI-HF™ and gel purified using the Bioline Isolate PCR and Gel Kit.

Page | 49

Chapter 3- Materials and Methods

The concentration of the DNA fragments was determined, and the sxtL::knr was processed to ligate with double digested pRL439, by standard ligation reaction as described in section 3.2.5.1. The incubation temperature was changed to 16oC to assist ligation of the ~3.2 kb insert into the ~2.7 kb plasmid).

Table 3.7. Cloning sxtL::knr into pRL439- Restriction Digestion Parameters.

KB1F&R pRL439::knr pRL439:: knr PCR DNA (1 μg) DNA (1 μg) product purified after (1 μg) BamHI digestion. 10x 4 μl 4 μl 4 μl NEBuffer 2 BamHI 0.3 units 0.3 units -

EcoRI - HF™ 0.5 units - 0.5 units

BSA 50 μg 50 μg 50 μg

Sterile Made up Made up Made up milliQ water to 50 μl to 50 μl to 50 μl

Page | 50

3.3 Results and Discussions

3.3.1 Gradient PCR with new primers for sxtL

SxL L1 L2 1 2 3 4 5 6 7 8

1500bp

Figure 3.1. Amplification of sxtL gene using KB1 (f&r) primers.

Right hand side picture – Lanes 1 to 8 are PCR products of KB1 (f&r) primers achieved with a gradient between 60oC to 50oC. From left to right annealing temperatures in degree celcius are 60.0, 59.2, 58.0, 56.1, 53.7, 51.9 50.7 and 50.0. Left hand side picture – Lane SxL shows successful amplification of sxtL gene from pET15b::sxtL vector using KB1F&R primers. The size was expected to be 1440 bp. Lanes L1 and L1 are the GeneRulerTM 1kb DNA ladders

To clone the sxtL gene downstream to the psbA promoter of vector pRL439, KB1 (forward and reverse) primers were designed to flank the BamHI and EcoRI restriction sites at 5’ and 3’ sites, upstream and downstream to the sxtL in pET15b An annealing temperature of 54oC was identified to provide optimal PCR products (see Figure 3.1). Sequencing confirmed that the PCR product contained the sxtL gene in addition to a 6his.tag. (Refer to Appendix B, 1, 3.1 and 3.4 for primer sequences, sequencing data and pET15b::sxtL vector map).

3.3.2 Cloning sxtL into pRL439

No successful clones were achieved in spite of several efforts to ligate the sxtL in the multiple cloning site of vector pRL439. The amplified sxtL and the intermediate vector were subjected to restriction double digestion with BamHI and EcoRI restriction enzymes. Both, digested vector and the insert were processed for overnight, ligation after gel purification. Several optimizations were also performed to get the ligation to work at 37, 16, 22 and 4oC. Screening of the resultant transformations did

Page | 51

Chapter 3- Results and Discussions

not reveal any sxtL carrying positive clones (see Figure 3.3). It was thus postulated that the plasmid or the insert may not be completely digested, possibly as both restriction sites on pRL439 were so closely located to one another. It was decided to increase the distance between the BamHI and EcoRI sites by inserting a kanamycin resistance gene (knr)into the EcoRI of pRL439 (refer further to section 3.3.4).

L1 1 L2 2 3 L3 4 5

Figure 3.2. Cloning sxtL into pRL439.

Lane 1 is the purified sxtL amplicon of KB1 (f&r) primers. Lane 2 and 3 are restriction double digestion of pRL439 and sxtL insert respectively. Lanes 4 and 5 are double digested pRL439 and sxtL insert purified by gel extraction.

Lane L1, L2 and L3 are GeneRulerTM 1kb DNA ladders (*from left to right curved arrows represent progress of the experiment)

L 1 2 3 4 5 6 L 7 8 9 10 11 L

Figure 3.3. Colony PCR of clones.

Lanes 1 is the positive control for pRL439 vector. Lanes 2 to 11 are colony PCR of clones using M13 (f&r) primers. All amplified products are of religated pRL439.

Lane L is the GeneRulerTM 1kb DNA ladder.

Page | 52

Chapter 3- Results and Discussions

3.3.3 Cloning Kanamycin resistance gene from pSCR9 into pET15b::sxtL

To attach a reporter upstream to the sxtL, the kanamycin resistance gene cassette from pSCR9 was excised using the HindIII. The gel purified insert was then successfully ligated into the gel purified HindIII digested pET15b::sxtL vector and transformed in E. coli DH5Į cells. The incorporation of the reporter kanamycin cassette was confirmed as the clones obtained were resistant to kanamycin (refer to section 3.2.1.1 for transformation methods and concentration of kanamycin used for selection). DNA was isolated from positive colonies and double digested BgIII and EcoRI to confirm the presence of the sxtL::knr construct and the residual pET15b vector (Figure 3.4, lane 4).

L 1 L 2 L 3 L 4

Figure 3.4. Obtaining sxtL::knr construct.

Lane 1: HindIII digested pSCR9. Straight arrow indicates knr cassette ~ 1.7 kb size. Lane 2 and 3 are HindIII digested pET15b::sxtL plasmid before and after gel purification. Lane 4 is pET15b::sxtL::knr double digested with BgIII and EcoRI, where arrow indicates sxtL::knr construct.

Lane L is the GeneRulerTM 1kb DNA ladder

(*From left to right, pictures and curved arrows represent progress of the experiment. Undotted circle represents ligation while dotted circle indicates restriction digestion and confirmation of ligated products.

Page | 53

Chapter 3- Results and Discussions

3.3.4 Cloning Kanamycin resistance gene from pKW1188 into pRL439

The kanamycin resistance gene from pKW1188 was successfully cloned into the multiple cloning site of pRL439, thereby increasing the distance between the BamHI and EcoRI sites. The plasmid DNA from positive clones were screened using a double digestion and shown to carry a fragment of the correct size.

L 12 L34 L 5

Figure 3.5. Cloning knr from pKW1188 into pRL439.

Lane 1 and Lane 3 is EcoRI digested pRL439 vector, before and after gel purification. Lane 2 is EcoRI digested pKW1188. Straight arrow indicates knr (1.2 kb) Lane 4 is knr from pKW1188 after gel purification. Lane 5 is double digestion of the pRL439::knr construct with BamHI and EcoRI, where straight arrow represents pRL439 vector and the residual knr.

Lane L is the GeneRulerTM 1kb DNA ladder

(*From left to right, curved arrows indicate progress of the experiment. Circle represents ligation of the two products. Dotted arrow represents restriction double digestion)

Page | 54

Chapter 3- Results and Discussions

3.3.5 Cloning of sxtL::knr into pRL439

Recombinant plasmids pET15b::sxtL::knr and pRL439::knr, constructed as result of previous cloning procedures (section 3.3.3 and 3.3.4) were double digested using BamHI and EcoRI. Both the insert and the plasmid were successfully purified by gel extraction (Figure 3.6). As the insert was obtained with kanamycin reporter and the pRL439 vector is ampicillin resistant, for transformed E. coli Dh5Į cells kanamycin selection was used. No colonies were observed in spite of several optimizations with incubation temperatures and changes to the vector to insert ratios for the standard ligation reaction.

L 1 L 2 3 L L 4

Figure 3.6. Cloning sxtL::knr into pRL439.

Lane 1- Double digestion of pET15b::sxtL::knr with BamHI and EcoRI. Lane 2- The construct sxtL::knr after gel extraction as indicated by the curved arrow.

Lane 3- Vector pRL439, as purified from double digested pRL439::knr from lane 4.

(*curved arrows indicate progress of the experiment. Dotted circle with end spots indicate unsuccessful ligation of insert and plasmid, as no recombinant colonies were observed after transformation)

Page | 55

3.4 Conclusion

The designed primers KB1-F and KB1-R successfully reamplified sxtL from pET15b::sxtL vector. The new sxtL insert as a result of amplification was used to facilitate its sticky end ligation, downstream to the psbA promoter at BamHI and EcoRI sites of the intermediate vector pRL439. However, the transformation of the ligated product into E. coli Dh5Į did not result in success. In another attempt to clone sxtL, the distance between BamHI and EcoRI of the pRL439 vector was increased with a 1.2 kb knr gene from pKW1188, to visualize the correct digestion of the vector. The gel extracted plasmid was then reattempted to ligate with the sxtL gene. In order to achieve proper screening of recombinant clones, a kanamycin resistance gene from pSCR9 was attached as a reporter to the sxtL ORF. In spite of this, the transformation of pRL439::sxtL::knr insert did not result in any recombinant E. coli Dh5Į clones on kanamycin resistant plates. It is evident from previous studies that the light inducible psbA promoter is recognised in E. coli without the need of chemical induction (Boyer & Mullet, 1986; Brixey et al., 1997; Shibato et al., 1998). It was thus concluded that either the sxtL and sxtL::knr inserts in our experiments failed to ligate into pRL439 vector; or perhaps the sxtL gene was being expressed in vivo when ligated in frame, downstream to the psbA promoter in pRL439 vector. As a result, for unknown reasons leading to the failure in survival of recombinant E. coli Dh5Į cells.

Page | 56

Chapter 4 - Investigation of the putative enzyme, SxtU (Alcohol dehydrogenase), from Cylindrospermopsis raciborskii T3, reveals the function of this enzyme.

4.1 Introduction

The sequence analysis of different ORFs from sxt gene cluster, and the in vitro PST production studies, suggests the involvement of enzymes like hydroxylase, di-oxygenase and oxidoreductases in the biosynthetic pathway of STX. Such group of enzymes are frequently found in post-PKS modifications of naturally occurring bioactive compounds (Kellmann, et al., 2008b; Kellmann & Neilan, 2007; Mihali, et al., 2011; Mihali, et al., 2009). SxtU is a putative oxidoreductase which catalyzes the reduction of terminal aldehyde group of the STX precursor to form the subsequent intermediate alcohol in the step 8 of the STX biosynthetic pathway (Kellmann, et al., 2008b). The primary structure of this enzyme shows conserved domains resembling short chain alcohol dehydrogenases (SDR superfamily) and is highly similar the functionally characterized clavaldehyde dehydrogenase (Kellmann, et al., 2008b; Mihali, et al., 2009).

In this chapter, the predicted function of SxtU protein was investigated on two different substrates, viz. ethanol and clavulanic acid. The gene was overexpressed in E. coli Rosetta cells, and its function was determined using alcohol dehydrogenase (ADH) activity assay and zymography. ADH activity was also observed in the zymogram of crude protein extracts of saxitoxin producing C. raciborskii T3 and A. circinalis AWQC 131C. Surprisingly, Peptide mass fingerprinting revealed the presence of SxtC (unknown function) and SxtN (putative sulfotransferease) in A. ciricinalis AWQC131C; and also detected a short chain dehydrogenase/reductase which is similar in function to SxtU protein from C. raciborskii T3.

Page | 57

4.2 Materials and Methods

4.2.1 Over-expression in Escherichia coli strains

4.2.1.1 Bacterial strains, plasmids and culture conditions The Escherichia coli strains relevant in this study are listed below Table 4.1. Recombinant pET15b plasmid harbouring sxtU ORF from C. raciborskii T3 was kindly provided by Dr. L. A. Pearson from School of Biotechnology and Biomolecular Sciences, UNSW, Sydney, Australia. Competent E. coli Dh5Į cells were transformed with this plasmid and used as maintenance strains. Rosetta strains of E. coli were used for overexpression of sxtU, while pET15b plasmid without any recombinant gene was used as a negative control. All cultures were selectively grown, either in Luria-Bertani (LB) agar/broth or Tryptone phosphate broth depending on plasmid extraction, PCR screening or protein expression needs.

Table 4.1. Bacterial strains and plasmids.

E.coli Characteristic Plasmid Antibiotic Reference for Strains Features resistance E. coli strains

- Rosetta F ,ompT, hsdSB pET15b::sxtU Ampicillin - - (rB mB ) gal dcm (100ug/ml), lacY1(DE3), pRARE Chloramphenicol (50 μg/ml) (Baca & Hol, 2000) - Rosetta F ,ompT, hsdSB pET15b:: Ampicillin - - (rB mB ) gal dcm (100 μg/ml), lacY1(DE3), pRARE Chloramphenicol (50 μg/ml)

DH5Į F-f80dlacZDM15 pET15b::sxtU Ampicillin D(lacZYA-argF)U169 (100 μg/ml) deoR recA1 endA1 - - hsdR17(rK ,mK ) phoA supE44_-thi-1 gyrA96 (Hanahan, 1983) relA1

DH5Į F-f80dlacZDM15 pET15b:: Ampicillin D(lacZYA-argF)U169 (100 μg/ml) deoR recA1 endA1 - - hsdR17(rK ,mK ) phoA supE44_-thi-1 gyrA96 relA1

Page | 58

Chapter 4 – Materials and Methods

4.2.1.2 Plasmid extraction, amplification and transformation

4.2.1.2.1 Plasmid extraction Plasmids pET15b::sxtU and pET15b were extracted and purified from E. coli Dh5Į cells. Cultures were grown in 5 ml and 10 ml LB-broth for overnight, and then suspended, lysed, neutralized and purified, using binding columns; all according to manufactures instruction for PureLInkTM Quick Plasmid Miniprep Kit (Invitrogen, Carlsbad, USA).

4.2.1.2.1 PCR amplification PCR cycling conditions with respect to different primers are shown in Table 4.2. The presence of sxtU in pET15b plasmid was confirmed by polymerase chain reaction (PCR) using stxU forward & reverse primers specific for sxtU gene amplification. T7 promoter and terminator primers of pET15b plasmid were also used to get the overall amplification of all samples including negative controls.

The PCR reaction mixture of 20 μl contained 1x Taq polymerase buffer, 2.5 mM

MgCl2, 0.2 mM deoxynucleotide triphosphate (dNTPs), 10 pmol of forward and reverse primers each, about 40 ng to 60 ng plasmid DNA and 0.25 units of Taq polymerase. (* refer to Appendix B, 1 for primer sequences)

Table 4.2. PCR amplification of sxtU.

Denaturation Denaturation Annealing Extension Final Incubation 30 s 2 mins 20 s 45 s Extention Primers 7 mins 94oC 94oC 72oC 72oC 4oC stxU (F&R) 62oC T7 (F&R) 55oC 30x cycles

4.2.1.2.3 Transformation

o All competent cells (50 μl / 0.6 OD600, previously stored in -80 C), were thawed for 15mins on ice. After adding ~ 40ng of plasmids, cells were incubated for another 30mins. This was followed by 90s heat shock at 42oC, and a further incubation at 37oC (shaking/dark) for 1 hr after adding 500 μl of LB broth. Incubated cells were concentrated by removing 350 μl of excess media via centrifugation (15, 000 x g for 20s) and gently resuspending the pellets in the remaining 200 μl broth. All samples were spread plated on Ampicillin (100 μg/ml) selective LB agar plates. Plates were incubated overnight at 37oC (dark), and the next day, selected colonies were subcultured. Subcultured colonies were tested for presence of inserts and plasmids by colony PCR, with PCR parameters as mentioned in Table 4.2.

Page | 59

Chapter 4 – Materials and Methods

4.2.1.3 Protein expression and purification parameters

4.2.1.3.1 SxtU protein expression

Expression of recombinant SxtU peptides was performed in E. coli Rosetta host strain (Novagen) and tryptone phosphate media supplemented with Ampicillin (100 Pg/ml), Chloramphenicol (50 Pg/ml) and 1% sterile glucose was used. Residual ȕ-lactamase was removed from 0.5 ml of overnight starter culture by concentrating the cells with low speed centrifugation for ~1 min. Cells were resuspended in equal amount (0.5 ml) of fresh media and transferred to 50 ml expression cultures in conical flask measuring 250 ml.

All cultures were grown with vigorous shaking (160 rpm) at 37qC to reach the value of 1 at OD650, and subsequently induced with 0.4 mM IPTG for 2 hrs at 37qC (see Table 4.3). After induction, cultures were removed to 50 ml falcon tubes and incubated on ice for 15 mins. Cell pellets were further harvested via centrifugation (5,000 g for 10 min at 4qC), then washed with 50 ml of cold phosphate binding buffer, and stored at -20oC until required.

Table 4.3. Overexpression of sxtU.

Recombinant Culture volume IPTG induction Duration Temperature Ecoli strains per sample (mM) (hr) Rosetta 50 ml 0.4 2 37oC +pET15b::sxtU Rosetta 50 ml 0.4 2 37oC +pET15b::

4.2.1.3.2 Purification of SxtU protein

For purification of recombinant SxtU protein, cell pellets were thawed on ice and resuspended in 2% of the original volume of cold phosphate binding buffer. Ten microlitres of 50 mg/ml lysozyme solution was added and the pellets were gently resuspended without foaming. Then passed through an 18 gauge needle several times and incubated on ice for 1-3 hrs until lysis was evident. This was followed by brief sonication to shear DNA (Branson Sonifier 250, amplitude 19, 50% duty cycle, pulsed). Finally, soluble protein fractions were separated to sterile 1.5 ml eppendorf tubes after centrifugation (20 000 g for 30 min at 4qC). The protein samples were stored in -20oC until further use. Glycerol was added to a final concentration of 40% before storage.

This procedure was repeated for expression of E. coli Rosetta strains containing pET15b: plasmid with no recombinant genes to obtain soluble protein fractions as negative controls.

Page | 60

Chapter 4 – Materials and Methods

4.2.1.4 Protein Quantification and zymography

4.2.1.4.1 Protein concentrations were measured using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), following manufacturers protocol. The extinction coefficient of SxtU at 280 nm: 9970 M-1cm-1 as computed using ExPASy ProtParam tool, was used as reference to quantify the absorbance measurements (* refer to Appendix B, 2.2 for more details).

4.2.1.4.2 SDS-PAGE (same method used as mentioned in chapter 2, section 2.2.1.4.2)

4.2.2 Materials and methods for cyanobacterial protein extracts

4.2.2.1 Cyanobacterial strains and preparation of protein extract

As listed in Table 4.4, the static batch cultures of toxic and non toxic strains of cyanobacteria, originally grown in Jaworski medium at 26oC, were kindly provided by Dr. Mihali from School of Biotechnology and Biomolecular Sciences, UNSW, Sydney, Australia. Cell pellets were harvested by centrifugation (5,000 g for 20 min at 4qC), washed with sterile 10 mM Tris (pH 7.4) and resuspended in 500 μl of the same buffer. All 500 μl aliquots of resuspended cells were subjected to several cycles of freezing in liquid nitrogen followed by thawing at 22oC. Further protein extraction was aided by 5 cycles of beadbeat at max speed using a beadbeater. Beads were removed by centrifugation at high speed for 20 min. Any visible cell debris was further separated by centrifugation (16,000 g for 30 mins, 4oC).

Table 4.4. Cyanobacterial strains and features.

Cyanobacterial strains Toxicity sxtU accession n.o (ncbi protein databse) Cylindrospermopsis Saxitoxin ABI75108.1 raciborskii T3 Anabaena Saxitoxin ABI75134.1 circinalis AWQC131C

Page | 61

Chapter 4 – Materials and Methods

4.2.3 Materials and methods for zymography assays

4.2.3.2 Zymography for Alcohol dehydrogenase (ADH) activity Native-PAGE of 160 μg of all protein samples (crude extracts from saxitoxin producing cyanobacteria- Cylindrospermopsis raciborskii T3 and Anabaena circinalis AWQC131C, and E. coli over expressed SxtU and negative control) were incubated (in dark) with ADH substrate staining solution; where the substrate used was ethanol.

A duplicate gel was also incubated (in dark) with another ADH staining solution. However, in this case negative control for SxtU was not used and the substrate compund in staining solution was Potassium Clavulanate (Sigma).

Table 4.5. ADH substrate staining solution recipe.

Ethanol as Clavulanate as substrate substrate Tris-HCl pH 8.0 (100 mM) 49.925 ml 49.925 ml NADP+ (Nicotinamide adenine 5 mg 5 mg dinucleotide phosphate) Ethanol (100%) 500 μl - Potassium Clavulanate - 25 mg NBT (Nitroblue tetrazolium chloride 75 μl 75 μl monohydrate) PMS (Phenazine Methosulfate) 1 mg (pinch) 1 mg (pinch)

Alcohol dehydrogenases convert alcohol into aldehydic compounds in which ‘NAD(P)’ accepts the H+ released and becomes ‘NAD(P)H’. This co-factor ‘NAD(P)H’, then reacts with NBT in the presence of PMS to produce an insoluble product formazane which is purple blue in colour. As a result protein bands stained bluish-purple on gels represent the presence of alcohol dehydrogenase. All protein bands stained were immediately cut and sent for Mass-Spectrometry analysis.

4.2.4 Peptide mass fingerprinting and Bioinformatics

Bands corresponding to ADH activity in zymogram activity were excised and subjected to peptide mass fingerprinting at Bioanalytical Mass Spectrometry Facility, UNSW. The proteins were destained, extracted from the gel and digested with trypsin into peptide fragments. The resulting fragments were processed by FTMS (Fourier transform mass spectrometry)

The peptide masses were blast on NCBI protein database (National Center for Biotechnology Information website – http://www.ncbi.nlm.gov/)

Page | 62

Chapter 4 – Materials and Methods

4.2.4.1 Bioinformatics The data from peptide mass fingerprinting was used to identify any protein with significant ADH properties. All peptide fragments obtained were analysed for any conserved domains same or relatively similar to any genes from saxitoxin gene cluster. Multiple alignment tool (ClustalW) was used to align proteins of interest, particularly in relation to saxitoxin biosynthetic pathway. The best results have been reported.

Page | 63

4.3 Results and Discussions

4.3.1 Analysis of sxtU gene

Before proceeding to expression studies, transformed plasmids were confirmed for the presence of recombinant genes. The product of PCR amplifications was run on 1% agarose gel to visualize the correct size. Lane SxU shows the correct amplification of sxtU from plasmid pET15b::sxtU using T7 promoter and T7 terminator primers. The expected size was 949 bp. In lanes C1 and C2, amplification with T7 primers clearly shows that the control plasmids didn’t have any of the recombinant genes.

L2 SxU C1 C2 L1

1kb

200bp

100bp

Figure 4.1. PCR confirmation of sxtU and control from pET15b vectors.

L2 and L1 are ladders. SxU represents the amplification of sxtU gene with T7 F&R primers. C1 and C2 are products of empty pET15b vectors.

4.3.2 Expression of SxtU protein

SxtU protein was overexpressed in 0.4 mM IPTG induced E. coli Rosetta cells. The expected mass of recombinant SxtU is ~28.320 kDa (Appendix B, 2.2). However, no significant difference was seen between recombinant and control proteins, when separated with SDS-PAGE. The SxtU protein may have been expressed in low concentrations or partially lost in insoluble fractions. Peptide mass fingerprinting after ADH zymography, later revealed that the protein was indeed present in the soluble fraction (next section)

Page | 64

Chapter 4 – Results and Discussions

L S1 US1 S1 US1

27.7kDa

Figure 4.2. Overexpression of SxtU.

Lane L is broad range protein ladder. S1 and US1 indicate soluble protein fractions from control and recombinant strains.

4.3.3 Alcohol dehydrogenase zymography

Alcohol dehydrogenase activity assay, using ethanol and potassium clavulanate (clavulanic acid) as substrates succeded in detecting ADH activity in soluble fractions of recombinant SxtU, and also in crude protein extracts of the saxitoxin producing cyanobacteria Cylindrospermopsis raciborskii T3 and Anabaena circinalis 131C (Figure 4.3). The bands corresponding to the activity stain on the Native-PAGE were analysed by peptide mass fingerprinting (next section 4.3.4).

FTMS analysis revealed that the ADH activity was due to the presence of recombinant SxtU protein in the soluble protein extracts of recombinant E. coli strains (Figure 4.3 B, lane SU, and Figure 4.4 of next section 4.3.4). No ADH activity was observed in control protein fractions (Figure 4.3 A, lane 3).

In Cylindrospermopsis raciborskii T3, peptide fragments matching a short-chain dehydrogenase/reductase SDR from saxitoxin producing cyanobacterium Raphidiopsis brookii D9 were detected. Multiple sequence alignment of this protein with SxtU from various cyanobacterial strains showed high similarities in their sequences (section 4.3.3, Figure 4.6). The strong resemblance of this hypothetical protein with SxtU suggests that they might be sharing similar functions in the native cyanobacterium. The activity assay implies that both putative proteins are true to their predicted functions (Figure 4.3 A, lane 1, 3 and 4.3 B, lane T3 and SU); however, individually they might be specific for other unknown substrates as well.

Surprisingly, in all three cases, activity was observed at the same position on the gel (Figure 4.3). Even the overexpressed SxtU failed to completely enter the gel. The theoretical pI of recombinant SxtU, 6.09, suggests that it should have entered

Page | 65

Chapter 4 – Results and Discussions further in the gel (Appendix B, 2.2). Mishandling of experimental buffers can be rejected, as the ADH from baker’s yeast, appears to enter the gel with ease (Figure 4.3 B, lane C). Although, SxtU was not directly detected in any of the cyanobacterial strains, the activity may have been a contribution of this protein, which remained untraceable. In this case, the failure to run further in the gel may also imply its association in multi-enzyme complex in host cell (Kellmann & Neilan, 2007).

The observed activity was quite prominent when potassium clavulante was used as substrate. Bioinformatically deduced SxtU protein had been aligned in Short chain alcohol dehydrogenase family and closely resembles to a previously characterised clavadehyde dehydrogenase (Kellmann, et al., 2008b). This supports the experimental observation of low colouration in the ethanol assay, implying higher binding affinity towards clavulanic acid which shares more similarity with the predicted intermediate compound in sxt biosynthetic pathway. However this conclusion cannot be implied at this stage, as liquid assays with purified SxtU protein were not implied in this study, however, observation predicts the same.

C T3 131C SU 1234

A B

Figure 4.3. ADH activity assays with ethanol and potassium clavulanate.

A) With Ethanol as substrate- Lanes 1 and 2 are crude protein extracts from Cylindrospermopsis raciborskii T3 and Anabaena circinalis AWQC131C. Lanes 3 and 4 are soluble protein fractions from control and recombinant E. coli Rosetta cells.

B) With potassium clavulanate as substrate- T3 and 131C are strains of Cylindrospermopsis raciborksii T3 and Anabaena circinalis AWQC131C respectively. SU is the soluble fraction of overexpressed SxtU. Activity stained bands from all three samples were subjected to peptide mass fingerprinting. C is baker’s yeast used as +ve control.

(* Yellow arrows indicate +ve activity. Blue arrow indicates activity in trace amount. Black arrow indicates –ve activity)

Page | 66

Chapter 4 – Results and Discussions

4.3.4 Peptide mass fingerprinting and Bioinformatics

Figure 4.4. Experimental masses of peptide fragments from overexpressed SxtU.

These peptide fragments were identified by FTMS analysis from the ADH activity zymogram of recombinant SxtU, which was overexpressed in E. coli Rosetta.

Figure 4.5. Peptide fragments of recombinant SxtU as detected by FTMS.

The experimental masses, as shown in figure 4.4, represent the highlighted sequences from the recombinant SxtU.

Page | 67

Chapter 4 – Results and Discussions

Notes SxtU (short-chain alcohol dehydrogenase) [Anabaena circinalis AWQC131C] sxt gene cluster SxtU [Aphanizomenon sp. NH-5] ‘’ SxtU (Short-chain dehydrogenase/reductase SDR) [Raphidiopsis brookii D9] ‘’ SxtU (short-chain alcohol dehydrogenase ) [Cylindrospermopsis raciborskii T3] ‘’ Short-chain dehydrogenase/reductase SDR [Cylindrospermopsis raciborskii CS- - 505] Short-chain dehydrogenase/reductase SDR [Raphidiopsis brookii D9] - Signals detected by FTMS from ADH activity staining in Cylindrospermopsis raciborskii T3 Peptides fragments representing the masses found in Cylindrospermopsis ADH+ raciborskii T3 Peptides fragments retrieved from overexpressed SxtU in E. coli Rosetta strains. ADH+

Figure 4.6. Clustal W, multiple sequence alignment of short-chain alcohol dehydrogenases (SDRs) from different cyanobacterial strains.

Marked as (*), are the alignments representing exact match in all sequences. Underlined are respective peptide fragments found in E. coli overexpressed SxtU and in C. raciborskii T3 extracts. Boxes in the aligned sequences show regions with similarities.

Page | 68

Chapter 4 – Results and Discussions

4.3.5 Other saxitoxin related proteins found

Surprisingly, the peptide mass fingerprinting of the band that was observed as a result of clavaldehyde dehydrogenase assay of Anabaena circinalis AWQC131C, revealed peptide fragments of two putative proteins, SxtN and SxtC, form sxt biosynthetic pathway (Figure 4.7 and 4.8). The sxtC is a unique putative ORF, and no closely related domains have been found for this enzyme to determine its putative function. (Kellmann, et al., 2008b; Mihali, et al., 2009). Recently, a phylogenetic analysis of this enzyme predicted it to be a possible enzyme of amidohydrolase family (Moustafa et al., 2009). On the other hand, SxtN, is a putative sulfotransferase enzyme which catalyzes the formation of monosulfated analogues of STX in the Anabaena strain, as well as in C. raciborskii T3 (Kellmann, et al., 2008b; Mihali, et al., 2009). The importance of this finding is that, it marks the first proteomic evidence, which has been produced for a putative enzyme from the saxitoxin biosynthetic pathway; directly detected in the native organism. In previous studies, two 3’-phosphate 5’- phosphosulfate (PAPS) – dependent sulfotransferases form the dinoflagellate G. catenatum have been characterized for the formation of N-21 and O-22 sulfated analogues of STX in this organism (Yoshida, et al., 2002). However, due to low yield and instability of the enzymes, their peptide sequences could not be revealed. In the previous in vitro PST production studies, determining the minimum factors required for the production of PST in cyanobacterium has also been a challenging task (Kellmann & Neilan, 2007). Since the discovery of saxitoxin gene cluster, more efforts have been put for the molecular characterisation of the enzymes that putatively involved in the saxitoxin biosynthesis in various cyanobacteria (Kellmann, et al., 2008b; Kellmann, et al., 2008a; Mihali, et al., 2011; Mihali, et al., 2009). With the combined knowledge of the putative enzymes in gene cluster and the current findings, more sophisticated assays for zymography can be designed in future, for successful detection and isolation of the mentioned as well as other enzymes from native organism.

Figure 4.7. Peptide fragments of SxtC found in Anabaena circinalis AWQC131C.

Highlighted letters in the SxtC protein sequence represents the peptide fragments, as detected by FTMS. The sxtC gene from Aphanizomenon sp. NH-5 is 99% similar to sxtC from Anabaena circinalis AWQC131C. The sxtC from Anabaena circinalis AWQC131C is not reported in ncbi protein database. Hence, it showed the similar match. The sxt gene profiles in these two organisms are also much conserved.

Page | 69

Chapter 4 – Results and Discussions

Figure 4.8. Peptide fragments of SxtN found in Anabaena circinalis AWQC131C.

Highlighted letters in the SxtN protein sequence represents the peptide fragments, as detected by FTMS. SxtN is the same sulfotransferase.

Page | 70

4.4 Conclusion

The results have revealed that the sxtU ORF from sxt gene cluster of Cylindrospermopsis racbiorskii T3 encodes a short chain alcohol dehydrogenase family enzyme. The enzyme was overexpressed in E. coli Rosetta cells and its catalytic function was investigated with a comprehensive alcohol dehydrogenase activity assay. This enzyme was active on ethanol and clavulanic acid, as inferred from the activity assay zymograms of the soluble protein fractions. The activity seemed to be more efficient on clavulanic acid than ethanol which further supports its sequence similarity to other clavaldehyde dehydrogenases. A further investigation to detect this protein in saxitoxin producing cyanobacterial strains, surprisingly revealed peptide fingerprints of SxtN (putative sulfotransferase) and SxtC (unknown function/amidohydrolase) in Anabaena circinalis AWQC131C from the same band where clavaldehyde dehydrogenase acitivity was observed.

The predicted function of sxtU in the hypothetical biosynthetic pathway of STX is to reduce the terminal aldehyde group at the C-1 of the intermediate compound in step 8 of the synthesis (Kellmann, et al., 2008b). This study also supports the possible existence of the linked intermediate compounds, as predicted by Kellmann & Neilan in 2007. Along with the functional characterization of SxtU protein, this data also represents the first proteomic evidence of two putative enzymes SxtN and SxtC, predicted in the sxt gene cluster.

Page | 71

General discussion & Future directions

For cloning and expression of foreign genes, E. coli has always been a favoured host, due to the scientific achievements in past decades that has helped understand this organism in excruciating details (Baneyx, 1999; Kane, 1995; Lilie et al., 1998). However, not all proteins are capable of folding in their confirmatory functional structures when expressed in heterologous hosts (Dobson, 2003; Sitia & Molteni, 2004). The overexpression of sxtL ORF from C. raciborskii T3 in E. coli BL21 cells lead to the formation of inclusion bodies of the protein (Chapter 2); while that of sxtU ORF showed activity in E. coli Rosetta (Chapter 4).

When efforts to achieve soluble proteins of recombinant sxtL, through heterologus expression in E. coli BL21 were unsuccessful, an intergrative approach for genomic integration in more closely related cyanobacterium strain Synechocystis sp. PCC6803 was followed (Chapter 3). However, the approach remained unsuccessful when successive efforts with sticky end ligation of sxtL in frame with the psbA promoter of pRL439 vector failed to provide any recombinant colonies (Chapter 3, 3.3.1 & 3.3.5). It is known that the psbA promoter which was favourable for expression in the Synechocystis sp. PCC6803 is also recognisable in E. coli and expresses 12 folds higher than the T7 promoter without the need of a chemical induction (Brixey, et al., 1997). It was anticipated that, if the the new constructs pRL439::sxtL::kn or pRL439::sxtL were formed, then after transformation, the psbA promoter might be expressing this protein in the E. coli DH5Į cells at high concentrations, which in turn was inhibiting the growth of any plausible recombinant cells. An unexpected fall in growth of the recombinant E. coli BL21 cells during the pre IPTG induction period in the overexpression studies for sxtL (Chapter 2, 2.3.2.1) supported the hypothesis of this gene being toxic to E. coli cells. Although the gene was maintained in pET15b plasmid in an unexpressed state, expression seems to be somehow causing damage to the cells. It should be noted that even when IPTG is not been employed for induction, a leaky expression by T7 RNA polymerases is usually observed in E. coli (Baneyx, 1999). The esterase zymography analysis of soluble protein fractions from control and sxtL overexpressed cells also showed depletion in the activity of other esterases native to the E. coli cells (Figure 2.6, A). Thus, speculating that the toxicity of this protein seems to be associated with damaging the activity of normal esterases in E. coli. GDSL lipases are multifunctional enzymes that can show thioesterase and protease activity as well. The toxicity, when overexpressed in E. coli, may be associated with the protease activity of this enzyme. However, no further investigations have been made and more research is needed to solve this puzzling matter. A possible way to start with another integrative approach of cloning sxtL could be by using a different promoter, like glutamine synthetase promoter (glnA) (Nakasugi & Neilan, 2006; Nakasugi & Neilan, 2005; Nakasugi, et al., 2006). Screening the effects of SxtL protein in E. coli could also help in better understanding for future experimentation in this area.

Page | 72

General discussion and future directions

Zymography had been a useful tool in detecting esterase and alcohol dehydrogenase (ADH) activity in experiments where crude protein extracts from C. raciborskii T3 (Chapter 2 & 4) and A. circinalis AWQC131C (Chapter 4) were used. These experiments in the respective chapters were meant with a purpose to detect SxtL and SxtU protein signals based on their predicted activity assays (Kellmann, et al., 2008b).

The unique lipase activity, > 212 kDa, as a result of 2D zymography and comparative analysis with non-toxic cyanobacterial strains, was anticipated to contain SxtL protein, which could be associated in a multiple enzyme complex with other sxt related domains (Chapter 2, Figure 2.7, 2.9 & 2.10). A bright lipase activity was also observed in the Native-PAGE of the crude protein extract from C. raciborskii (Figure 2.10 B). At the same suspected position, ADH activity was also observed for the same strain, as well as in A. circinalis AWQC131C protein extracts (Chapter 4, Figure 4.3), which revealed the presence of a short chain-alcohol dehydrogenase and two proteins from sxt gene cluster respectively. Thus, a hypothesis was made suggesting that in the native organisms these enzymes could be associated in a multi-enzyme complex (Kellmann & Neilan, 2007).

The two proteins, directly detected in A. circinalis AWQC131C ADH zymography assay were SxtN and SxtC. Recently, sxtC has been predicted to be an amidrohydrolase which catalyzes the hydrolytic cleavage of the carbamoyl side chain from STX and its analogues to form decarbamoylated compounds (dcSTX) (Moustafa, et al., 2009). This prediction coincides with the predicted function of sxtL (Kellmann, et al., 2008b; Mihali, et al., 2011; Mihali, et al., 2009). The detection of SxtC in A. circinalis strain, at the same position where the suspected >212 kDa activity was found in C. raciborskii T3 (Chapter 4, Figure 4.7 and Chapter 2, Figure 2.10 B), and as the profiles of sxt gene cluster in these organisms are very similar (Mihali, et al., 2009; Murray et al., 2011), our results may suggest that SxtC could be that hydrolase enzyme which is involved in the formation of dsSTX and its analogues instead of sxtL. It can be postulated that, if SxtC catalyzes the decarbamoylation, then SxtL may not be a lipase and could be performing one of its other multifunctional catalytic activities; further supporting the earlier speculation of SxtL to be a protease (Chapter 1, 1.3.1.1) (Moustafa, et al., 2009). However, in previous studies, the same sxtC, as detected in A. circinalis strain has been found in Lyngbya wollie which does not produce dsSTX analogues (Kellmann, et al., 2008a; Mihali, et al., 2011). The sxtL ORF from this organism is predicted to be selectively removed due to the presence of a truncated sxtI ORF usually found in association with sxt I, J, K and sxtL (Mihali, et al., 2009; Murray, et al., 2011). This may indicate that these proteins could be forming a multi-enzyme complex, or perhaps SxtL could be functionally associated with SxtC. It is quite possible that the recombinant SxtL protein may not be folding properly to produce lipase activity in E. coli BL21 cells because of the need of other enzymes, or key elements from the native cyanobacterial cell. Also, SxtL could be

Page | 73

General discussion and future directions specific for the saxitoxin and hence does not catalyze the hydrolysis of the two substrates (MUB and 1-Naphthyl acetate) which were used in the lipase activity assays (Chapter 2)

A possible explanation for such questions can be experimentally achieved by co-expressing multiple genes in E. coli or other transformable organisms. For example: co-expression of sxtC or sxt I, J& K with sxtL. Nevertheless, the substrate requirement of these protein profiles could also be specific for activity assays.

In this study, crude protein extracts from cyanobacterial strains were used (Chapter 2 and Chapter 4, sections 2.2.2 and 4.2.2 respectively). For any future application concerning zymography assays, with a purpose of detecting Sxt proteins, performing further purification steps as implemented in the in vitro PST production studies or in general will be a good idea (Kellmann & Neilan, 2007). As SxtN was detected in the A. circinalis strain, activity assay specific for sulfotransferase detection as followed during the characterization of the two sulfotransferases related to STX analogues in previous studies, can be employed for better outcomes in further research (Sako, et al., 2001; Yoshida, et al., 2002).

Page | 74

Appendix A

Media, buffers and recepies

1. Media and buffers for cell culturing

1.1 Luria-Bertani (LB) broth: 10 g/l tryptone, 5 g/l yeast extract, 5 g/l NaCl. Add 15 g/l agarose to make plates.

1.2 Tryptone Phosphate broth: 20 g/l tryptone, 2 g/l Na2HPO4, 1 g/l of KH2PO4, 8 g/l Nacl, 15 g/l yeast extract

1.3 Phosphate buffer: 125 g/l K2HPO4 (final concentration 0.72 M), 38 g/l KH2PO4 (final concentration 0.28 M), 900 ml to dissolve and bring up to 1 litre.

2. Agarose Gel electrophoresis buffers and reagents

2.1 Agarose solution (1%) in 1x TAE buffer: 10 g/l molecular grade agarose

2.2 Ethidium bromide solution (in milliQ water): 0.5 μg/ml ethidium bromide

2.3 Gel loading buffer (in milliQ water): 300 g/l glycerol, 2.5 g/l bromophenol blue, 2.5 g/l xylene cyanol FF.

2.6 50x TAE buffer: 242 g/l Tris base, 57.1 ml glacial acetic acid, 100 ml 0.5 M EDTA (pH 8.0). Bring up to 1 litre with milliQ.

3. SDS and Native-PAGE buffers and reagents

3.1 4x gel loading buffer: 450 ml methanol, 100 ml glacial acetic acid, 450 ml water.

3.2 10x Tris-glycine buffer: 30.2 g/l Tris-base, 186 g/l glycine (pH 8.3), 100 ml 10% SDS. Make up to 1 litre with milliQ.

3.3 Coomassie stain: 2.5 g/l Coomassie Brilliant Blue R250, 900 ml methanol: H2O (1:1 v/v), 100 ml glacial acetic acid. Filter through Whatman n.o 1 filter to remove particulate matter.

3.4 4x native sample buffer: 1 ml 0.5 M Tris/HCl pH 6.8, 7.5 ml Glycerol, 1.5 ml milliQ and pinch of Bromophenol blue.

Page | 75

Appendix B

Primers, Bioinformatics, Sequencing and Vector maps

1. Primers

1.1 M13F 5'-GTAAAACGACGGCCAG-3' 1.2 M13R 5'-CAGGAAACAGCTATGAC-3' 1.3 T7 promoter 5'-TAATACGACTCACTATAGGG-3' 1.4 T7 terminator 5'-GCTAGTTATTGCTCAGCGGT-3' 1.5 KB1F 5'-cgcGGATCCTGTGAGCGGATAACAATT - 3' 1.6 KB1R 5'-ccgGAATTCCCTCGAGTTATTGGATCAC-3' 1.7 stxU (F) 5'-cgcgCATATGGCAGGTAAATTGGATGG-3' 1.8 stxU (R) 5'-cggCTCGAGTTAATTATCTTCTGCAGTCGG-3' 1.9 stxL (F) 5'-gcgCATATGAGTAACTTCAAGGGTTCGG-3' 1.10 stxL (R) 5'-cggCTCGAGTTATTGGATCACTGATTGGG-3'

2. ExPASy Prot Param primiary structure analysis of:

2.1 Recombinant SxtL:

6His.tag 20 SxtL 40 50 60 MGSSHHHHHH SSGLVPRGSH MSNFKGSVKI ALMGILIFCG LIFGVAFVEI GLRIAGIEHI

70 80 90 100 110 120 AFHSIDEHRG WVGRPHVSGW YRTEGEAHIQ MNSDGFRDRE HIKVKPENTF RIALLGDSFV

130 140 150 160 170 180 ESMQVPLEQN LAAVIEGEIS SCIALAGRKA EVINFGVTGY GTDQELITLR EKVWDYSPDI

190 200 210 220 230 240 VVLDFYTGND IVDNSRALSQ KFYPNELGSL KPFFILRDGN LVVDASFINT DNYRSKLTWW

250 260 270 280 290 300 GKTYMKIKDH SRILQVLNMV RDALNNSSRG FSSQAIEEPL FSDGKQDTKL SGFFDIYKPP

310 320 330 340 350 360 TDPEWQQAWQ VTEKLISSMQ HEVTAKKADF LVVTFGGPFQ REPLVRQKEM QELGLTDWFY

370 380 390 400 410 420 PEKRITRLGE DEGFSVLNLS PNLQVYSEQN NACLYGFDDT QGCVGHWNAL GHQVAGKMIA

430 440 450 SKICQQQMRE SILPHKHDPS SQSSPITQSV IQ

Page | 76

Appendix B

Number of amino acids: 452

Molecular weight: 50984.7

Theoretical pI: 6.09

Amino acid composition:

Ala (A) 22 4.9% Arg (R) 21 4.6% Asn (N) 19 4.2% Asp (D) 25 5.5% Cys (C) 05 1.1% Gln (Q) 25 5.5% Glu (E) 28 6.2% Gly (G) 37 8.2% His (H) 19 4.2% Ile (I) 32 7.1% Leu (L) 36 8.0% Lys (K) 23 5.1% Met (M) 11 2.4% Phe (F) 24 5.3% Pro (P) 18 4.0% Ser (S) 39 8.6% Thr (T) 18 4.0% Trp (W) 09 2.0% Tyr (Y) 11 2.4% Val (V) 30 6.6% Pyl (O) 00 0.0% Sec (U) 00 0.0%

(B) 00 0.0% (Z) 00 0.0% (X) 00 0.0%

Total number of negatively charged residues (Asp + Glu): 53 Total number of positively charged residues (Arg + Lys): 44

Atomic composition:

Carbon C 2280 Hydrogen H 3513 Nitrogen N 629 Oxygen O 671 Sulfur S 16

Formula: C2280H3513N629O671S16

Page | 77

Appendix B

Total number of atoms: 7109

Extinction coefficients:

Extinction coefficients are in units of M-1 cm-1, at 280 nm measured in water.

Ext. coefficient 66140 Abs 0.1% (=1 g/l) 1.297, assuming all pairs of Cys residues form cystines

Ext. coefficient 65890 Abs 0.1% (=1 g/l) 1.292, assuming all Cys residues are reduced

Estimated half-life:

The N-terminal of the sequence considered is M (Met).

The estimated half-life is: 30 hours (mammalian reticulocytes, in vitro). >20 hours (yeast, in vivo). >10 hours (Escherichia coli, in vivo).

Instability index:

The instability index (II) is computed to be 40.57 This classifies the protein as unstable.

Aliphatic index: 82.79

Grand average of hydropathicity (GRAVY): -0.326

Page | 78

Appendix B

2.2 Recombinant SxtU

6His.tag 20 SxtU 40 50 60 MGSSHHHHHH SSGLVPRGSH MAGKLDGKVA IITGASSGIG EATAFALAAE GAKVAIAARR

70 80 90 100 110 120 AELLHALAKR IEASGGQALP IVTDITDESQ VNHLVQKTKV ELGHVDILVN NAGIGVFGAI

130 140 150 160 170 180 DTGNPADWRR AFDVNVLGVL YAIHAVLPLL KAQKSGHIVN ISSVDGRIAQ SGAVVYSAAK

190 200 210 220 230 240 SGVNALSEAL RQEVSLDNIR VTIIEPGLVD TPFNDLISDP ITKQLSKEQL STITPLQSED

250 260 IARAIIYAVT QPDHVNVNEI LIRPTAEDN

Number of amino acids: 269

Molecular weight: 28320.1

Theoretical pI: 6.09

Amino acid composition:

Ala (A) 34 12.6% Arg (R) 11 4.1% Asn (N) 12 4.5% Asp (D) 15 5.6% Cys (C) 00 0.0% Gln (Q) 10 3.7% Glu (E) 13 4.8% Gly (G) 22 8.2% His (H) 13 4.8% Ile (I) 25 9.3% Leu (L) 24 8.9% Lys (K) 11 4.1% Met (M) 02 0.7% Phe (F) 04 1.5% Pro (P) 10 3.7% Ser (S) 21 7.8% Thr (T) 13 4.8% Trp (W) 01 0.4% Tyr (Y) 03 1.1% Val (V) 25 9.3% Pyl (O) 00 0.0% Sec (U) 00 0.0%

(B) 00 0.0%

Page | 79

Appendix B

(Z) 00 0.0% (X) 00 0.0%

Total number of negatively charged residues (Asp + Glu): 28 Total number of positively charged residues (Arg + Lys): 22

Atomic composition:

Carbon C 1247 Hydrogen H 2032 Nitrogen N 362 Oxygen O 385 Sulfur S 2

Formula: C1247H2032N362O385S2 Total number of atoms: 4028

Extinction coefficients:

Extinction coefficients are in units of M-1 cm-1, at 280 nm measured in water.

Ext. coefficient 9970 Abs 0.1% (=1 g/l) 0.352

Estimated half-life:

The N-terminal of the sequence considered is M (Met).

The estimated half-life is: 30 hours (mammalian reticulocytes, in vitro). >20 hours (yeast, in vivo). >10 hours (Escherichia coli, in vivo).

Instability index:

The instability index (II) is computed to be 38.61 This classifies the protein as stable.

Aliphatic index: 110.63

Grand average of hydropathicity (GRAVY): 0.076

Page | 80

Appendix B

3. Sequences and Vector Maps

3.1 Sequences

3.1.1The sxtL gene

Clone 1 ATGAGTAACTTCAAGGGTTCGGTAAAGATAGCATTGATGGGAATATTGATTTTTTGTGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 15937 ATGAGTAACTTCAAGGGTTCGGTAAAGATAGCATTGATGGGAATATTGATTTTTTGTGGG 15996

Clone 61 CTAATCTTTGGCGTAGCATTTGTTGAAATTGGGTTACGTATTGCCGGGATCGAACACATA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 15997 CTAATCTTTGGCGTAGCATTTGTTGAAATTGGGTTACGTATTGCCGGGATCGAACACATA 16056

Clone 121 GCATTCCATAGCATTGATGAACACAGGGGGTGGGTAGGGCGACCTCATGTTTCCGGGTGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16057 GCATTCCATAGCATTGATGAACACAGGGGGTGGGTAGGGCGACCTCATGTTTCCGGGTGG 16116

Clone 181 TATAGAACCGAAGGTGAAGCTCACATCCAAATGAATAGTGATGGCTTTCGAGATCGAGAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16117 TATAGAACCGAAGGTGAAGCTCACATCCAAATGAATAGTGATGGCTTTCGAGATCGAGAA 16176

Clone 241 CACATCAAGGTCAAACCAGAAAATACCTTCAGGATAGCGCTGTTGGGAGATTCCTTTGTA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16177 CACATCAAGGTCAAACCAGAAAATACCTTCAGGATAGCGCTGTTGGGAGATTCCTTTGTA 16236

Clone 301 GAGTCCATGCAAGTACCGTTGGAGCAAAATTTGGCAGCAGTTATAGAAGGAGAAATCAGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16237 GAGTCCATGCAAGTACCGTTGGAGCAAAATTTGGCAGCAGTTATAGAAGGAGAAATCAGT 16296

Clone 361 AGTTGTATAGCTTTAGCTGGACGAAAGGCGGAAGTGATTAATTTTGGAGTGACTGGTTAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16297 AGTTGTATAGCTTTAGCTGGACGAAAGGCGGAAGTGATTAATTTTGGAGTGACTGGTTAT 16356

Page | 81

Appendix B

Clone 421 GGAACAGACCAAGAACTAATTACTCTACGGGAGAAAGTTTGGGACTATTCACCTGATATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16357 GGAACAGACCAAGAACTAATTACTCTACGGGAGAAAGTTTGGGACTATTCACCTGATATA 16416

Clone 481 GTAGTGCTAGATTTTTATACTGGCAACGACATTGTTGATAACTCCCGTGCGCTGAGTCAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16417 GTAGTGCTAGATTTTTATACTGGCAACGACATTGTTGATAACTCCCGTGCGCTGAGTCAG 16476

Clone 541 AAATTCTATCCTAATGAACTAGGTTCACTAAAGCCGTTTTTTATACTTAGAGATGGTAAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16477 AAATTCTATCCTAATGAACTAGGTTCACTAAAGCCGTTTTTTATACTTAGAGATGGTAAT 16536

Clone 601 CTGGTGGTTGATGCTTCGTTTATCAATACGGATAATTATCGCTCAAAGCTGACATGGTGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16537 CTGGTGGTTGATGCTTCGTTTATCAATACGGATAATTATCGCTCAAAGCTGACATGGTGG 16596

Clone 661 GGCAAAACTTATATGAAAATAAAAGACCACTCACGGATTTTACAGGTTTTAAACATGGTA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16597 GGCAAAACTTATATGAAAATAAAAGACCACTCACGGATTTTACAGGTTTTAAACATGGTA 16656

Clone 721 CGGGATGCTCTTAACAACTCTAGTAGAGGGTTTTCTTCTCAAGCTATAGAGGAACCGTTA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16657 CGGGATGCTCTTAACAACTCTAGTAGAGGGTTTTCTTCTCAAGCTATAGAGGAACCGTTA 16716

Clone 781 TTTAGTGATGGAAAACAGGATACAAAATTGAGCGGGTTTTTTGATATCTACAAACCACCT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16717 TTTAGTGATGGAAAACAGGATACAAAATTGAGCGGGTTTTTTGATATCTACAAACCACCT 16776

Clone 841 ACTGACCCTGAATGGCAACAGGCATGGCAAGTCACAGAGAAACTGATTAGCTCAATGCAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16777 ACTGACCCTGAATGGCAACAGGCATGGCAAGTCACAGAGAAACTGATTAGCTCAATGCAA 16836

Clone 901 CACGAGGTGACTGCGAAGAAAGCAGATTTTTTAGTTGTTACTTTTGGCGGTCCCTTTCAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16837 CACGAGGTGACTGCGAAGAAAGCAGATTTTTTAGTTGTTACTTTTGGCGGTCCCTTTCAA 16896

Clone 961 CGAGAACCTTTAGTGCGTCAAAAAGAAATGCAAGAATTGGGTCTGACTGATTGGTTTTAC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16897 CGAGAACCTTTAGTGCGTCAAAAAGAAATGCAAGAATTGGGTCTGACTGATTGGTTTTAC 16956

Page | 82

Appendix B

Clone 1021 CCAGAGAAGCGAATTACACGTTTGGGTGAGGATGAGGGGTTCAGTGTACTCAATCTCAGC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 16957 CCAGAGAAGCGAATTACACGTTTGGGTGAGGATGAGGGGTTCAGTGTACTCAATCTCAGC 17016

Clone 1081 CCAAATTTGCAGGTTTATTCTGAGCAGAACAATGCTTGCCTATATGGGTTTGATGATACT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 17017 CCAAATTTGCAGGTTTATTCTGAGCAGAACAATGCTTGCCTATATGGGTTTGATGATACT 17076

Clone 1141 CAAGGCTGTGTAGGGCATTGGAATGCTTTAGGACATCAGGTAGCAGGAAAAATGATTGCA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 17077 CAAGGCTGTGTAGGGCATTGGAATGCTTTAGGACATCAGGTAGCAGGAAAAATGATTGCA 17136

Clone 1201 TCGAAGATTTGTCAACAGCAGATGAGAGAAAGTATATTGCCTCATAAGCACGACCCTTCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SxtL 17137 TCGAAGATTTGTCAACAGCAGATGAGAGAAAGTATATTGCCTCATAAGCACGACCCTTCA 17196

Clone 1261 AGCCAAAGCTCACCTATTACCCAATCAGTGATCCAATAA 1299 ||||||||||||||||||||||||||||||||||||||| SxtL 17197 AGCCAAAGCTCACCTATTACCCAATCAGTGATCCAATAA 17235

3.1. 2 psbA promoter in pRL439

gb|S67731.1| psbAAh promoter [Amaranthus hybridus, Chloroplast]

Length=61 Score = 113 bits (61), Expect = 5e-23, Identities = 61/61 (100%), Gaps = 0/61 (0%)

Query 1 GATCTCAATGAATATTGGTTGACACGGGCGTATAAGACATGTTATACTGTTGAATAACAAG 61

Subject 1 GATCTCAATGAATATTGGTTGACACGGGCGTATAAGACATGTTATACTGTTGAATAACAAG 61

Page | 83

Appendix B

3.2 pKW1188

EcoRI EcoRI

Page | 84

Appendix B

3.3 pRL439 vector map

Page | 85

Appendix B

3.4 pET15b+sxtL

Page | 86

References

Agnew, W., Moore, A., Levinson, S., & Raftery, M. (1980). Identification of a large molecular weight peptide associated with a tetrodotoxin binding protein from the electroplax of Electrophorus electricus. Biochemical and biophysical research communications, 92(3), 860

Akoh, C. C., Lee, G. C., Liaw, Y. C., Huang, T. H., & Shaw, J. F. (2004). GDSL family of serine esterases/lipases. Progress in Lipid Research, 43(6), 534-552

Al-Tebrineh, J., Mihali, T. K., Pomati, F., & Neilan, B. A. (2010a). Detection of Saxitoxin-Producing Cyanobacteria and Anabaena circinalis in Environmental Water Blooms by Quantitative PCR. Applied and environmental microbiology, 76(23), 7836

Al-Tebrineh, J., Mihali, T. K., Pomati, F., & Neilan, B. A. (2010b). Quantitative PCR detection of saxitoxin-producing cyanobacteria and Anabaena circinalis in environmental water blooms. Applied and environmental microbiology, AEM. 00174- 00110v00171

Albertano, P., Congestri, R., Micheli, L., Moscone, D., & Palleschi, G. (2008). Development of Sensors to Trace Toxins from Dinoflagellates and Other Algae to Seafood. Algal Toxins: Nature, Occurrence, Effect and Detection, 301-310

An, J., & Carmichael, W. W. (1994). Use of a colorimetric protein phosphatase inhibition assay and enzyme linked immunosorbent assay for the study of microcystins and nodularins. Toxicon, 32(12), 1495-1507

Anderson, D. M. (1989). Toxic algal blooms and red tides: a global perspective. Red Tides: Biology, Environmental Science, and Toxicology (Okaichi T, Anderson DM, Nemoto T, eds) New York: Elsevier, 11–16

Anderson, D. M. (2004). The growing problem of harmful algae. Oceanus Magazine, 43(1), 1-5

Anderson, D. M., Glibert, P., & Burkholder, J. (2002). Harmful algal blooms and eutrophication: Nutrient sources, composition, and consequences. Estuaries and Coasts, 25(4), 704-726

Ansari, A. A., Gill, S. S., & Khan, F. A. (2011). Eutrophication: Threat to Aquatic Ecosystems. In A. A. Ansari, S. Singh Gill, G. R. Lanza & W. Rast (Eds.), Eutrophication: causes, consequences and control pp. 143-170: Springer Netherlands.

Armstrong, C. (1981). Sodium channels and gating currents. Physiological reviews, 61(3), 644

Arpigny, J. L., & Jaeger, K. E. (1999). Bacterial lipolytic enzymes: classification and properties. Biochemical Journal, 343(Pt 1), 177

Assessment, M. E. (2005). Ecosystems and human well-being (Vol. 5): Island Press.

Page | 87

References

Awramik, S. M. (1992). The oldest records of photosynthesis. Photosynthesis research, 33(2), 75-89

Baca, A. M., & Hol, W. G. J. (2000). Overcoming codon bias: a method for high-level overexpression of Plasmodium and other AT-rich parasite genes in Escherichia coli. International journal for parasitology, 30(2), 113-118

Baker, J. A., Entsch, B., Neilan, B. A., & McKay, D. B. (2002). Monitoring changing toxigenicity of a cyanobacterial bloom by molecular methods. Applied and environmental microbiology, 68(12), 6070

Ballot, A., Fastner, J., & Wiedner, C. (2010). Paralytic shellfish poisoning toxin- producing cyanobacterium Aphanizomenon gracile in northeast Germany. Applied and environmental microbiology, 76(4), 1173

Baneyx, F. (1999). Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology, 10(5), 411-421

Banik, J. J., Craig, J. W., Calle, P. Y., & Brady, S. F. (2010). Tailoring Enzyme-Rich Environmental DNA Clones: A Source of Enzymes for Generating Libraries of Unnatural Natural Products. Journal of the American Chemical Society

Bard, S. M. (1999). Global transport of anthropogenic contaminants and the consequences for the Arctic marine ecosystem. Marine pollution bulletin, 38(5), 356- 379

Barten, R., & Lill, H. (1995). DNA uptake in the naturally competent cyanobacterium, Synechocystis sp. PCC 6803. FEMS Microbiology Letters, 129(1), 83-87

Beneski, D. A., & Catterall, W. A. (1980). Covalent labeling of protein components of the sodium channel with a photoactivable derivative of scorpion toxin. Proceedings of the National Academy of Sciences of the United States of America, 77(1), 639

Berry, J., & Lind, O. (2010). First evidence of “paralytic shellfish toxins” and cylindrospermopsin in a Mexican freshwater system. Lago Catemaco, and apparent bioaccumulation of the toxins in “tegogolo” snails (Pomacea patula catemacensis) Toxicon

Bienfang, P., DeFelice, S., Laws, E., Brand, L., Bidigare, R., Christensen, S., Trapido- Rosenthal, H., Hemscheidt, T., McGillicuddy Jr, D., & Anderson, D. (2011). Prominent Human Health Impacts from Several Marine Microbes: History, Ecology, and Public Health Implications. International Journal of Microbiology, 2011

Bordner, J., Thiessen, W. E., Bates, H. A., & Rapoport, H. (1975). The structure of a crystalline derivative of saxitoxin. The structure of saxitoxin. Journal of the American Chemical Society, 97(21), 6008-6012

Botana, L. M. (2000). Seafood and freshwater toxins:Pharmacology, physiology, and detection. Spain: CRC Press.

Page | 88

References

Boyer, S. K., & Mullet, J. E. (1986). Characterization of P. sativum chloroplast psbA transcripts produced in vivo, in vitro and in E. coli. Plant molecular biology, 6(4), 229-243

Brixey, P., Guda, C., & Daniell, H. (1997). The chloroplast psbA promoter is more efficient in Escherichia coli than the T7 promoter for hyperexpression of a foreign protein. Biotechnology letters, 19(4), 395-400

Carmichael, W., Evans, W., Yin, Q., Bell, P., & Moczydlowski, E. (1997). Evidence for paralytic shellfish poisons in the freshwater cyanobacterium Lyngbya wollei (Farlow ex Gomont) comb. nov. Applied and environmental microbiology, 63(8), 3104

Catterall, W. A. (1977). Membrane potential-dependent binding of scorpion toxin to the action potential Na+ ionophore. J biol Chem, 252, 8660-8668

Catterall, W. A. (1980). Neurotoxins that act on voltage-sensitive sodium channels in excitable membranes. Annual Reviews Pharmacology and Toxicology, 20, 15-43

Catterall, W. A., & Morrow, C. S. (1978). Binding to saxitoxin to electrically excitable neuroblastoma cells. Proceedings of the National Academy of Sciences of the United States of America, 75(1), 218

Catterall, W. A., Morrow, C. S., & Hartshorne, R. P. (1979). Neurotoxin binding to receptor sites associated with voltage-sensitive sodium channels in intact, lysed, and detergent-solubilized brain membranes. Journal of Biological Chemistry, 254(22), 11379

Cembella, A. (1998). Ecophysiology and metabolism of paralytic shellfish toxins in marine microalgae. In Anderson DM, Cembella AD & H. GM (Eds.), Physiological Ecology of Harmful Algal Blooms pp. 381-403. Berlin: Springer-Verlag.

Cembella, A., Lewis, N., & Shumway, S. (1993). An interspecific comparison of paralytic shellfish poisons in marine bivalves: Anatomical and spatio-temporal variation in toxin composition. Journal of Shellfish Research, 12(1), 141

Cest le, S., & Catterall, W. A. (2000). Molecular mechanisms of neurotoxin action on voltage-gated sodium channels. Biochimie, 82(9-10), 883-892

Chang, F. C. T., Bauer, R. M., Benton, B. J., Keller, S. A., & Capacio, B. R. (1996). 4-Aminopyridine antagonizes saxitoxin-and tetrodotoxin-induced cardiorespiratory depression. Toxicon, 34(6), 671-690

Chang, F. C. T., Spriggs, D. L., Benton, B. J., Keller, S. A., & Capacio, B. R. (1997). 4-Aminopyridine reverses saxitoxin (STX)-and tetrodotoxin (TTX)-induced cardiorespiratory depression in chronically instrumented guinea pigs. Toxicological Sciences, 38(1), 75

Chavez-Pacheco, J., Contreras-Zentella, M., Membrillo-Hernandez, J., Arreguín- Espinoza, R., Mendoza-Hernandez, G., Gómez-Manzo, S., & Escamilla, J. (2010). The quinohaemoprotein alcohol dehydrogenase from Gluconacetobacter xylinus: molecular and catalytic properties. Archives of Microbiology, 1-11

Page | 89

References

Chevalier, A., & Duchesne, E. A. (1851a). Brief history on poisoning by oysters,mussels, crabs, fish and some sea and river. Annals of Public Hygiene Vol. 45, pp. 387-437. (Paris).

Chevalier, A., & Duchesne, E. A. (1851b). Brief history on poisonings by oysters,mussels, crabs, fish and some sea and river. Annalsof Public Hygiene Vol. 46, pp. 108-147. Paris.

Cho, H., & Cronan, J. (1993). Escherichia coli thioesterase I, molecular cloning and sequencing of the structural gene and identification as a periplasmic enzyme. Journal of Biological Chemistry, 268(13), 9238

Christiansen, G., Fastner, J., Erhard, M., Borner, T., & Dittmann, E. (2003). Microcystin biosynthesis in Planktothrix: genes, evolution, and manipulation. Journal of bacteriology, 185(2), 564

Claes, L., Del-Favero, J., Ceulemans, B., Lagae, L., Van Broeckhoven, C., & De Jonghe, P. (2001). De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy. The American Journal of Human Genetics, 68(6), 1327-1332

Cline, J., Braman, J. C., & Hogrefe, H. H. (1996). PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Research, 24(18), 3546

Codd, G. (1995). Cyanobacterial toxins: occurrence, properties and biological significance. Water Science and Technology, 32(4), 149-156

Cohen, M. F., & Meeks, J. C. (1997). A hormogonium regulating locus, hrmUA, of the cyanobacterium Nostoc punctiforme strain ATCC 29133 and its response to an extract of a symbiotic plant partner Anthoceros punctatus. Molecular plant-microbe interactions, 10(2), 280-289

Collemare, J., Billard, A., Bohnert, H. U., & Lebrun, M. H. (2008). Biosynthesis of secondary metabolites in the rice blast fungus Magnaporthe grisea: the role of hybrid PKS-NRPS in pathogenicity. Mycological research, 112(2), 207-215

Deeds, J. R., Landsberg, J. H., Etheridge, S. M., Pitcher, G. C., & Longan, S. W. (2008). Non-traditional vectors for paralytic shellfish poisoning. Marine Drugs, 6(2), 308

Derman, A. I., Prinz, W. A., Belin, D., & Beckwith, J. (1993). Mutations that allow disulfide bond formation in the cytoplasm of Escherichia coli. Science, 262(5140), 1744

Dherbécourt, J., Falentin, H., Canaan, S., & Thierry, A. (2008). A genomic search approach to identify esterases in Propionibacterium freudenreichii involved in the formation of flavour in Emmental cheese. Microbial Cell Factories, 7(1), 16

Dittmann, E., Neilan, B., & Börner, T. (2001). Molecular biology of peptide and polyketide biosynthesis in cyanobacteria. Applied microbiology and biotechnology, 57(4), 467-473

Page | 90

References

Dittmann, E., & Wiegand, C. (2006). Cyanobacterial toxins–occurrence, biosynthesis and impact on human affairs. Molecular nutrition & food research, 50(1), 7-17

Dixon, M. B., Falconet, C., Ho, L., Chow, C. W. K., O’Neill, B. K., & Newcombe, G. (2011). Removal of cyanobacterial metabolites by nanofiltration from two treated waters. Journal of Hazardous Materials, 188(1-3), 288-295

Dobson, C. M. (2003). Protein folding and misfolding. Nature, 426(6968), 884-890

Elhai, J., & Wolk, C. (1988). Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology, 167, 747

Epstein, P. R., Ford, T. E., & Colwell, R. R. (1993). Marine ecosystems. Lancet, 342(8881), 1216-1219

Feigenspan, A., Dedek, K., Schlich, K., Weiler, R., & Thanos, S. (2010). Expression and biophysical characterization of voltage-gated sodium channels in axons and growth cones of the regenerating optic nerve. Investigative Ophthalmology & Visual Science, 51(3), 1789

Fibla, J., & Gonz lez-Duarte, R. (1993). Colorimetric assay to determine alcohol dehydrogenase activity. Journal of biochemical and biophysical methods, 26(1), 87- 93

Filling, C., Berndt, K. D., Benach, J., Knapp, S., Prozorovski, T., Nordling, E., Ladenstein, R., Jörnvall, H., & Oppermann, U. (2002). Critical residues for structure and catalysis in short-chain dehydrogenases/reductases. Journal of Biological Chemistry, 277(28), 25677

Fleming, J. J., McReynolds, M. D., & Du Bois, J. (2007). (+)-saxitoxin: A first and second generation stereoselective synthesis. Journal of the American Chemical Society, 129(32), 9964-9975

Fozzard, H. A., & Lipkind, G. M. (2010). The tetrodotoxin binding site is within the outer vestibule of the sodium channel. Marine Drugs, 8(2), 219

Franz, D. R. (1997). Defense against toxin weapons. Medical aspects of chemical and biological warfare, 607

Fu, Y., Ibrahim, A. S., Fonzi, W., Zhou, X., Ramos, C. F., & Ghannoum, M. A. (1997). Cloning and characterization of a gene (LIP1) which encodes a lipase from the pathogenic yeast Candida albicans. Microbiology, 143(2), 331

Fulston, M., Davison, M., Elson, S., Nicholson, N., Tyler, J., & Woroniecki, S. (2001). Clavulanic acid biosynthesis; the final steps. Journal of the Chemical Society, Perkin Transactions 1(9), 1122-1130

Funari, E., & Testai, E. (2008). Human Health Risk Assessment Related to Cyanotoxins Exposure. Critical Reviews in Toxicology, 38(2), 97-125

Furman, R., Tanaka, J., Mueller, P., & Barchi, R. (1986). Voltage-dependent activation in purified reconstituted sodium channels from rabbit T-tubular

Page | 91

References membranes. Proceedings of the National Academy of Sciences of the United States of America, 83(2), 488

Gainey, L., & Shumway, S. (1988). A compendium of the responses of bivalve molluscs to toxic dinoflagellates. Journal of Shellfish Research, 7(4), 623-628

Garcia, S. M., & de Leiva Moreno, I. (2003). 1 Global Overview of Marine Fisheries. Responsible fisheries in the marine ecosystem, 1

Gasperi, G., Kafetzopoulos, D., Christodoulidou, A., Bouriotis, V., & Savakis, C. (1994). Isolation and partial characterization of two alcohol dehydrogenase isozymes from the medfly Ceratitis capitata. Insect biochemistry and molecular biology, 24(1), 87-94

Giovannoni, S. J., Turner, S., Olsen, G. J., Barns, S., Lane, D. J., & Pace, N. R. (1988). Evolutionary relationships among cyanobacteria and green chloroplasts. J Bacteriol, 170(8), 3584-3592

Glibert, P. M., Anderson, D. M., Gentien, P., Graneli, E., & Sellner, K. G. (2005). The global, complex phenomena of harmful algal blooms.

Gonzalez-Guzman, M., Apostolova, N., Belles, J. M., Barrero, J. M., Piqueras, P., Ponce, M. R., Micol, J. L., Serrano, R., & Rodriguez, P. L. (2002). The short-chain alcohol dehydrogenase ABA2 catalyzes the conversion of xanthoxin to abscisic aldehyde. The Plant Cell Online, 14(8), 1833

Grigorieva, G., & Shestakov, S. (1982). Transformation in the cyanobacterium Synechocystis sp. 6803. FEMS Microbiology Letters, 13(4), 367-370

Grochulski, P., Bouthillier, F., Kazlauskas, R. J., Serreqi, A. N., Schrag, J. D., Ziomek, E., & Cygler, M. (1994). Analogs of reaction intermediates identify a unique substrate binding site in Candida rugosa lipase. Biochemistry, 33(12), 3494-3500

Gross, H. (2009). Genomic mining--a concept for the discovery of new bioactive natural products. Curr Opin Drug Discov Devel, 12(2), 207-219

Gulland, F. M. D., & Hall, A. J. (2007). Is marine mammal health deteriorating? Trends in the global reporting of marine mammal disease. EcoHealth, 4(2), 135-150

Gupta, S., Norte, M., & Shimizu, Y. (1989). Biosynthesis of saxitoxin analogues: the origin and introduction mechanism of the side-chain carbon. J Chem Soc, Chem Commun, (19), 1421-1424

Hall, S., & Strichartz, G. (1990). Marine toxins: Origin, Structure, and Molecular Pharmacology. In M. J. Comstock (Ed.), ACS Symposium Series, American Chemical Society, Washington, DC.

Hallegraeff, G. M. (2010). On the global increase of harmful algal bloom. Wetlands (Australia), 12(1), 2-15

Page | 92

References

Hallegraeff, G. M., Anderson, D., & Cembella, A. D. (1995). Manual on harmful marine microalgae. In H. Enevoldsen (Ed.), pp. 566. Paris: Unesco, Intergovernmental Oceanographic Commission.

Halstead, B. W., & Schantz, E. J. (1984). Paralytic shellfish poisoning. WHO Offset Publication(79), 1-59

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. Journal of molecular biology, 166(4), 557-580

Hartshorne, R. P., & Catterall, W. A. (1981). Purification of the saxitoxin receptor of the sodium channel from rat brain. Proceedings of the National Academy of Sciences of the United States of America, 78(7), 4620

Hartshorne, R. P., Messner, D. J., Coppersmith, J. C., & Catterall, W. A. (1982). The saxitoxin receptor of the sodium channel from rat brain. Evidence for two nonidentical beta subunits. Journal of Biological Chemistry, 257(23), 13888

Henderson, R., Ritchie, J., & Strichartz, G. (1974). Evidence that tetrodotoxin and saxitoxin act at a metal cation binding site in the sodium channels of nerve membrane. Proceedings of the National Academy of Sciences of the United States of America, 71(10), 3936

Hilton, S., McCubbin, W. D., Kay, C. M., & Buckley, J. T. (1990). Purification and spectral study of a microbial fatty acyltransferase: activation by limited proteolysis. Biochemistry, 29(38), 9072-9078

Hoagland, P., Anderson, D., Kaoru, Y., & White, A. (2002). The economic effects of harmful algal blooms in the United States: estimates, assessment issues, and information needs. Estuaries and Coasts, 25(4), 819-837

Hoagland, P., & Scatasta, S. (2006). The economic effects of harmful algal blooms. Ecology of Harmful Algae, 391-402

Hodgkin, A. L., & Huxley, A. F. (1952). A quantitative description of membrane current and its application to conduction and excitation in nerve. The Journal of physiology, 117(4), 500

Hoeger, S. J., Shaw, G., Hitzfeld, B. C., & Dietrich, D. R. (2004). Occurrence and elimination of cyanobacterial toxins in two Australian drinking water treatment plants. Toxicon, 43(6), 639-649

Hsu, J. C., Feng, H. T., Haymer, D. S., & Chen, Y. H. (2011). Molecular and biochemical mechanisms of organophosphate resistance in laboratory-selected lines of the oriental fruit fly (Bactrocera dorsalis). Pesticide Biochemistry and Physiology

Ikeuchi, M., & Tabata, S. (2001). Synechocystis sp. PCC 6803—a useful tool in the study of the genetics of cyanobacteria. Photosynthesis research, 70(1), 73-83

Isom, L., De Jongh, K., Patton, D., Reber, B., Offord, J., Charbonneau, H., Walsh, K., Goldin, A., & Catterall, W. (1992). Primary structure and functional expression of the beta 1 subunit of the rat brain sodium channel. Science, 256(5058), 839

Page | 93

References

Jiang, Y., Lee, A., Chen, J., Ruta, V., Cadene, M., Chait, B. T., & MacKinnon, R. (2003). X-ray structure of a voltage-dependent K+ channel. Nature, 423(6935), 33-41

Joernvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J., & Ghosh, D. (1995). Short-chain dehydrogenases/reductases (SDR). Biochemistry, 34(18), 6003-6013

Johnson, P. T. J., Townsend, A. R., Cleveland, C. C., Glibert, P. M., Howarth, R. W., McKenzie, V. J., Rejmankova, E., & Ward, M. H. (2010). Linking environmental nutrient enrichment and disease emergence in humans and wildlife. Ecological Applications, 20(1), 16-29

Jornvall, H., Hoog, J. O., & Persson, B. (1999). SDR and MDR: completed genome sequences show these protein families to be large, of old origin, and of complex nature. FEBS letters, 445(2-3), 261-264

Kaebernick, M., & Neilan, B. A. (2001). Ecological and molecular investigations of cyanotoxin production. FEMS Microbiology Ecology, 35(1), 1-9

Kalaitzis, J. A., Lauro, F. M., & Neilan, B. A. (2009). Mining cyanobacterial genomes for genes encoding complex biosynthetic pathways. Nat Prod Rep, 26(11), 1447-1465

Kane, J. F. (1995). Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Current Opinion in Biotechnology, 6(5), 494-500

Kellmann, R., Mihali, T. K., Jeon, Y. J., Pickford, R., Pomati, F., & Neilan, B. A. (2008b). Biosynthetic intermediate analysis and functional homology reveal a saxitoxin gene cluster in cyanobacteria. Applied and environmental microbiology, 74(13), 4044-4053

Kellmann, R., Mihali, T. K., & Neilan, B. A. (2008a). Identification of a saxitoxin biosynthesis gene with a history of frequent horizontal gene transfers. Journal of molecular evolution, 67(5), 526-538

Kellmann, R., & Neilan, B. A. (2007). Biochemical characterization of paralytic shellfish toxin biosynthesis in vitro1. Journal of Phycology, 43(3), 497-508

Khosla, C., & Keasling, J. D. (2003). Metabolic engineering for drug discovery and development. Nature Reviews Drug Discovery, 2(12), 1019-1025

Kin-chung, H., & Hodgkiss, I. (2009). Red tides in subtropical waters: an overview of their occurrence. Asian Marine Biology 8 (1991), 8, 11

Kremp, A., Tamminen, T., & Spilling, K. (2008). Dinoflagellate bloom formation in natural assemblages with diatoms: nutrient competition and growth strategies in Baltic spring phytoplankton. Aquatic microbial ecology, 50(2), 181

Krozowski, Z. (1994). The short-chain alcohol dehydrogenase superfamily: variations on a common theme. The Journal of Steroid Biochemistry and Molecular Biology, 51(3-4), 125-130

Page | 94

References

Ladenstein, R., Winberg, J. O., & Benach, J. (2008). Structure-function relationships in short-chain alcohol dehydrogenases. Cellular and molecular life sciences, 65(24), 3918-3935

Lagos, N., Onodera, H., Zagatto, P. A., Andrinolo, D., Azevedo, S. M. F. Q., & Oshima, Y. (1999). The first evidence of paralytic shellfish toxins in the freshwater cyanobacterium Cylindrospermopsis raciborskii, isolated from Brazil. Toxicon, 37(10), 1359-1373

Lefebvre, K. A., Bill, B. D., Erickson, A., Baugh, K. A., O’Rourke, L., Costa, P. R., Nance, S., & Trainer, V. L. (2008). Characterization of intracellular and extracellular saxitoxin levels in both field and cultured Alexandrium spp. samples from Sequim Bay, Washington. Marine Drugs, 6(2), 103

Lesk, A. M. (1995). NAD-binding domains of dehydrogenases. Current Opinion in Structural Biology, 5(6), 775-783

Li, M., Ung, P., Zajkowski, J., Garneau-Tsodikova, S., & Sherman, D. (2009). Automated genome mining for natural products. BMC Bioinformatics, 10(1), 185

Lik Tong, T. (2007). Bioactive natural products from marine cyanobacteria for drug discovery. Phytochemistry, 68(7), 954-979

Lilie, H., Schwarz, E., & Rudolph, R. (1998). Advances in refolding of proteins produced in E. coli. Current Opinion in Biotechnology, 9(5), 497-501

Ling, H., Zhao, J., Zuo, K., Qiu, C., Yao, H., Qin, J., Sun, X., & Tang, K. (2006). Isolation and Expression Analysis of a GDSL-like Lipase Gene from. Journal of Biochemistry and Molecular Biology, 39(3), 297-303

Liu, F., Zhang, H., Shi, D., Shang, Z., Lin, C., Shao, N., Peng, G., Zhang, X., & Wu, J. (1999). Construction of shuttle, expression vector of human tumor necrosis factor alpha (hTNF- ) gene and its expression in a cyanobacterium, Anabaena sp. PCC 7120. Science in China Series C: Life Sciences, 42(1), 25-33

Llewellyn, L. E. (2006). Saxitoxin, a toxic marine natural product that targets a multitude of receptors. Natural Product Reports, 23(2), 200-222

Lo, Y. C., Lin, S. C., Shaw, J. F., & Liaw, Y. C. (2003). Crystal structure of Escherichia coli thioesterase I/protease I/lysophospholipase L1: consensus sequence blocks constitute the catalytic center of SGNH-hydrolases through a conserved hydrogen bond network. Journal of molecular biology, 330(3), 539-551

Lutz, S. (2010). Reengineering Enzymes. Science, 329(5989), 285

Maso, M., & Garces, E. (2006). Harmful microalgae blooms (HAB); problematic and conditions that induce them. Marine pollution bulletin, 53(10-12), 620-630

May, S. W., & Landgraff, L. M. (1976). Cofactor recycling in liquid membrane- enzyme systems. Biochemical and biophysical research communications, 68(3), 786- 792

Page | 95

References

McElhiney, J., & Lawton, L. A. (2005). Detection of the cyanobacterial hepatotoxins microcystins. Toxicology and applied pharmacology, 203(3), 219-230

McGregor, G. B., Sendall, B. C., Hunt, L. T., & Eaglesham, G. K. (2011). Report of the cyanotoxins cylindrospermopsin and deoxy-cylindrospermopsin from Raphidiopsis mediterranea Skuja (Cyanobacteria/Nostocales). Harmful Algae, 10(4), 402-410

Menzella, H. G., & Reeves, C. D. (2007). Combinatorial biosynthesis for drug development. Current Opinion in Microbiology, 10(3), 238-245

Mihali, T. K., Carmichael, W. W., Neilan, B. A., & Hofmann, A. (2011). A Putative Gene Cluster from a Lyngbya wollei Bloom that Encodes Paralytic Shellfish Toxin Biosynthesis. PLoS One, 6(2), 583-598

Mihali, T. K., Kellmann, R., & Neilan, B. A. (2009). Characterisation of the paralytic shellfish toxin biosynthesis gene clusters in Anabaena circinalis AWQC131C and Aphanizomenon sp. NH-5. BMC Biochemistry, 10(1), 8

Miller, J. A., Agnew, W. S., & Levinson, S. R. (1983). Principal glycopeptide of the tetrodotoxin/saxitoxin binding protein from Electrophorus electricus: isolation and partial chemical and physical characterization. Biochemistry, 22(2), 462-470

Miyagishima, S.-Y., & Nakanishi, H. (2010). The Chloroplast Division Machinery: Origin and Evolution Red Algae in the Genomic Age. In J. Seckbach & D. J. Chapman (Eds.), Vol. 13, pp. 3-23: Springer Netherlands.

Molica, R. J. R., Oliveira, E. J. A., Carvalho, P. V. V. C., Costa, A. N. S. F., Cunha, M. C. C., Melo, G. L., & Azevedo, S. M. F. O. (2005). Occurrence of saxitoxins and an anatoxin-a (s)-like anticholinesterase in a Brazilian drinking water supply. Harmful Algae, 4(4), 743-753

Morris Jr, J. G. (1999). Harmful algal blooms: an emerging public health problem with possible links to human stress on the environment. Annual review of energy and the environment, 24(1), 367-390

Moustafa, A., Loram, J. E., Hackett, J. D., Anderson, D. M., Plumley, F. G., & Bhattacharya, D. (2009). Origin of saxitoxin biosynthetic genes in cyanobacteria. PLoS One, 4(6), 5758

Murray, S. A., Mihali, T. K., & Neilan, B. A. (2011). Extraordinary Conservation, Gene Loss, and Positive Selection in the Evolution of an Ancient Neurotoxin. Molecular Biology and Evolution, 28(3), 1173

Nakasugi, K., & Neilan, B. (2006). Gene transfer in cyanobacteria Recent Developments in Nucleic Acids Research Vol. 2, pp. 83-114.

Nakasugi, K., & Neilan, B. A. (2005). Identification of pilus-like structures and genes in Microcystis aeruginosa PCC7806. Applied and environmental microbiology, 71(11), 7621

Page | 96

References

Nakasugi, K., Svenson, C. J., & Neilan, B. A. (2006). The competence gene, comF, from Synechocystis sp. strain PCC 6803 is involved in natural transformation, phototactic motility and piliation. Microbiology, 152(12), 3623

Nardini, M., & Dijkstra, B. W. (1999). Į/ȕ Hydrolase fold enzymes: the family keeps growing. Current Opinion in Structural Biology, 9(6), 732-737

Oh, S. J., Matsuyama, Y., Yoon, Y. H., Miyamura, K., Choi, C. G., Yang, H. S., & Kang, I. J. (2010). Comparative Analysis of Paralytic Shellfish Toxin Content and Profile Produced by Dinoflagellate Gymnodinium Catenatum Isolated from Inokushi Bay, Japan. Journal of the Faculty of Agriculture, Kyushu University, 55(1), 47-54

Onodera, H., Satake, M., Oshima, Y., Yasumoto, T., & Carmichael, W. W. (1997). New saxitoxin analogues from the freshwater filamentous cyanobacterium Lyngbya wollei. Natural toxins, 5(4), 146-151

Oppermann, U., Filling, C., Hult, M., Shafqat, N., Wu, X., Lindh, M., Shafqat, J., Nordling, E., Kallberg, Y., & Persson, B. (2003). Short-chain dehydrogenases/reductases (SDR): the 2002 update. Chemico-biological interactions, 143, 247-253

Orkwiszewski, K. G., & Kaney, A. R. (1974). Genetic transformation of the blue- green bacterium, Anacystis nidulans. Archives of Microbiology, 98(1), 31-37

Oshima, Y., Blackburn, S., & Hallegraeff, G. (1993). Comparative study on paralytic shellfish toxin profiles of the dinoflagellate Gymnodinium catenatum from three different countries. Marine Biology, 116(3), 471-476

Osswald, J., Rellan, S., Gago, A., & Vasconcelos, V. (2007). Toxicology and detection methods of the alkaloid neurotoxin produced by cyanobacteria, anatoxin-a. Environment International, 33(8), 1070-1089

Paerl, H. W., Fulton, R. S., 3rd, Moisander, P. H., & Dyble, J. (2001). Harmful freshwater algal blooms, with an emphasis on cyanobacteria. Scientific World Journal, 1, 76-113

Pearson, L., Mihali, T., Moffitt, M., Kellmann, R., & Neilan, B. (2010). On the Chemistry, Toxicology and Genetics of the Cyanobacterial Toxins, Microcystin, Nodularin, Saxitoxin and Cylindrospermopsin. Marine Drugs, 8(5), 1650-1680

Pearson, L., & Neilan, B. (2008). The molecular genetics of cyanobacterial toxicity as a basis for monitoring water quality and public health risk. Current Opinion in Biotechnology, 19(3), 281-288

Penzotti, J. L., Fozzard, H. A., Lipkind, G. M., & Dudley Jr, S. C. (1998). Differences in saxitoxin and tetrodotoxin binding revealed by mutagenesis of the Na+ channel outer vestibule. Biophysical journal, 75(6), 2647-2657

Pereira, P., Onodera, H., Andrinolo, D., Franca, S., Araújo, F., Lagos, N., & Oshima, Y. (2000). Paralytic shellfish toxins in the freshwater cyanobacterium Aphanizomenon flos-aquae, isolated from Montargil reservoir, Portugal. Toxicon, 38(12), 1689-1702

Page | 97

References

Pleiss, J., Fischer, M., Peiker, M., Thiele, C., & Schmid, R. D. (2000). Lipase engineering database:: Understanding and exploiting sequence-structure-function relationships. Journal of Molecular Catalysis B: Enzymatic, 10(5), 491-508

Plumley, F. (1997). Marine algal toxins - biochemistry, genetics, and molecular biology. Limnology & Oceanography, 42, 1252-1264

Pomati, F., Kellmann, R., Cavalieri, R., Burns, B. P., & Neilan, B. A. (2006). Comparative gene expression of PSP-toxin producing and non-toxic Anabaena circinalis strains. Environment International, 32(6), 743-748

Pomati, F., Moffitt, M. C., Cavaliere, R., & Neilan, B. A. (2004). Evidence for differences in the metabolism of saxitoxin and C1+ 2 toxins in the freshwater cyanobacterium Cylindrospermopsis raciborskii T3. Biochimica et Biophysica Acta (BBA)-General Subjects, 1674(1), 60-67

Rapoport, E. (1994). Remarks on marine and continental biogeography: an areographical viewpoint. Philosophical Transactions: Biological Sciences, 343(1303), 71-78

Rastogi, R. P., & Sinha, R. P. (2009). Biotechnological and industrial significance of cyanobacterial secondary metabolites. Biotechnology Advances, 27(4), 521-539

Ratcliffe, C. F., Westenbroek, R. E., Curtis, R., & Catterall, W. A. (2001). Sodium channel 1 and 3 subunits associate with neurofascin through their extracellular immunoglobulin-like domain. The Journal of Cell Biology, 154(2), 427

Ritchie, J. M., & Rogart, R. (1977). The binding of saxitoxin and tetrodotoxin to excitable tissue. Ergebnisse der Physiologie, biologischen Chemie und experimentellen Pharmakologie, 79(-1), 1-50

Rix, U., Fischer, C., Remsing, L. L., & Rohr, J. (2002). Modification of Post PKS Tailoring Steps Through Combinatorial Biosynthesis. ChemInform, 33(52), 255-255

Roberts, I. M. (1985). Hydrolysis of 4-methylumbelliferyl butyrate: a convenient and sensitive fluorescent assay for lipase activity. Lipids, 20(4), 243-247

Robertson, D. L., Hilton, S., & Buckley, J. T. (1992). Stereochemical and positional specificity of the lipase/acyltransferase produced by Aeromonas hydrophila. Biochemistry, 31(21), 4974-4980

Rodrigue, D. C., Etzel, R. A., Hall, S., de Porras, E., Velasquez, O. H., Tauxe, R. V., Kilbourne, E. M., & Blake, P. A. (1990). Lethal paralytic shellfish poisoning in Guatemala. American Journal of Tropical Medicine and Hygiene, 42(3), 267-271

Rozen, S., & Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology, 132(3), 365-386

Sainis, I., Fokas, D., Vareli, K., Tzakos, A. G., Kounnis, V., & Briasoulis, E. (2010). Cyanobacterial cyclopeptides as lead compounds to novel targeted cancer drugs. Mar Drugs, 8(3), 629-657

Page | 98

References

Sako, Y., Yoshida, T., Uchida, A., Arakawa, O., Noguchi, T., & Ishida, Y. (2001). Purification and characterization of a sulfotransferase specific to N-21 of saxitoxin and gonyautosin 2+ 3 from the toxic dinoflagellate Gymnodinium catenatum(Dinophyceae). Journal of Phycology, 37(6), 1044-1051

Schantz, E. J. (1986). Chemistry and biology of saxitoxin and related toxins. Annals of the New York Academy of Sciences, 479(1), 15-23

Schantz, E. J., Ghazarossian, V. E., Schnoes, H. K., Strong, F. M., Springer, J. P., Pezzanite, J. O., & Clardy, J. (1975). Letter: The structure of saxitoxin. Journal of the American Chemical Society, 97(5), 1238

Schantz, E. J., Mold, J. D., Stanger, D. W., Shavel, J., Riel, F. J., Bowden, J. P., Lynch, J.M., Wyler, R.S, Riegel, B, & Sommer, H. (1957). Paralytic shellfish poison. VI. A procedure for the isolation and purification of the poison from toxic clam and mussel tissues. Journal of the American Chemical Society, 79(19), 5230-5235

Schild, L., Schneeberger, E., Gautschi, I., & Firsov, D. (1997). Identification of amino acid residues in the , , and subunits of the epithelial sodium channel (ENaC) involved in amiloride block and ion permeation. The Journal of General Physiology, 109(1), 15

Sharp, J. D., Pickard, R. T., Chiou, X. G., Manetta, J. V., Kovacevic, S., Miller, J. R., Varshavsky, A. D., Roberts, E. F., Strifler, B. A., & Brems, D. N. (1994). Serine 228 is essential for catalytic activities of 85-kDa cytosolic phospholipase A2. Journal of Biological Chemistry, 269(37), 23250

Shibato, J., Asayama, M., & Shirai, M. (1998). Specific recognition of the cyanobacterial psbA promoter by RNA polymerases containing principal sigma factors. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression, 1442(2-3), 296-303

Shiklomanov, I. A., & Rodda, J. C. (2003). World water resources at the beginning of the twenty-first century: Cambridge University Press.

Shimizu, Y. (1986). Toxigenesis and biosynthesis of saxitoxin analogues. Pure Appl Chem, 58(2), 257–262

Shimizu, Y., Alam, M., Oshima, Y., & Fallon, W. E. (1975). Presence of four toxins in red tide infested clams and cultured cells. Biochemical and biophysical research communications, 66(2), 731-737

Shimizu, Y., Gupta, S., Norte, M., Hort, A., Genenah, A., & Kobayashi, M. (1985). Biosynthesis of paralytic shellfish toxins. Anderson, DM, AW White, and DG Baden Toxic Dinoflagellates New York Elsevier, 271–274

Shimizu, Y., Norte, M., Hori, A., Genenah, A., & Kobayashi, M. (1984). Biosynthesis of saxitoxin analogs: the unexpected pathway. Journal of the American Chemical Society, 106(21), 6433-6434

Shumway, S. E. (1990). A review of the effects of algal blooms on shellfish and aquaculture. Journal of the World Aquaculture Society, 21(2), 65-104

Page | 99

References

Shumway, S. E., Hurst, J., & Sherman-Caswell, S. (1988). Paralytic shellfish poisoning in Maine: Monitoring a monster. Journal of Shellfish Research, 7(1), 175

Sielaff, H., Dittmann, E., De Marsac, N. T., Bouchier, C., Von Döhren, H., Börner, T., & Schwecke, T. (2003). The mcyF gene of the microcystin biosynthetic gene cluster from Microcystis aeruginosa encodes an aspartate racemase. Biochemical Journal, 373(Pt 3), 909

Sitia, R., & Molteni, S. N. (2004). Stress, protein (mis) folding, and signaling: the redox connection. Science's STKE: signal transduction knowledge environment, 2004(239), 27

Stewart, I., Seawright, A. A., & Shaw, G. R. (2008). Cyanobacterial poisoning in livestock, wild mammals and birds–an overview. Cyanobacterial Harmful Algal Blooms: State of the Science and Research Needs, 613-637

Su, Z., Sheets, M., Ishida, H., Li, F., & Barry, W. H. (2004). Saxitoxin blocks L-type ICa. Journal of Pharmacology and Experimental Therapeutics, 308(1), 324

Tanino, H., Nakata, T., Kaneko, T., & Kishi, Y. (1977). A stereospecific total synthesis of d,l-saxitoxin. Journal of the American Chemical Society, 99(8), 2818- 2819

Tillett, D., Dittmann, E., Erhard, M., von Dohren, H., Borner, T., & Neilan, B. A. (2000). Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC7806: an integrated peptide-polyketide synthetase system. Chemistry & Biology, 7(10), 753-764

Tsumoto, K., Abe, R., Ejima, D., & Arakawa, T. (2010). Non-Denaturing Solubilization of Inclusion Bodies. Current Pharmaceutical Biotechnology, 11(3), 309-312

Tsumoto, K., Ejima, D., Kumagai, I., & Arakawa, T. (2003). Practical considerations in refolding proteins from inclusion bodies. Protein Expression and purification, 28(1), 1-8

Turrell, E., Stobo, L., Lacaze, J. P., Piletsky, S., & Piletska, E. (2008). Optimization of hydrophilic interaction liquid chromatography/mass spectrometry and development of solid-phase extraction for the determination of paralytic shellfish poisoning toxins. Journal of AOAC International, 91(6), 1372-1386

Upton, C., & Buckley, J. T. (1995). A new family of lipolytic enzymes? Trends in biochemical sciences, 20(5), 178-179

Usup, G., Kulis, D. M., & Anderson, D. M. (1994). Growth and toxin production of the toxic dinoflagellate Pyrodinium bahamense var. compressum in laboratory cultures. Natural toxins, 2(5), 254-262

Van Apeldoorn, M. E., Van Egmond, H. P., Speijers, G., & Bakker, G. (2007). Toxins of cyanobacteria. Molecular nutrition & food research, 51(1), 7

Page | 100

References

Van Dolah, F. M. (2000). Marine algal toxins: origins, health effects, and their increased occurrence. Environmental Health Perspectives, 108(Suppl 1), 133

Vitousek, P. M., Mooney, H. A., Lubchenco, J., & Melillo, J. M. (1997). Human domination of Earth's ecosystems. Science, 277(5325), 494

Wang, J., Salata, J. J., & Bennett, P. B. (2003). Saxitoxin is a gating modifier of HERG K+ channels. The Journal of General Physiology, 121(6), 583-598

Waterbury, J. (2006). The Cyanobacteria—Isolation, Purification and Identification The Prokaryotes. In M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer & E. Stackebrandt (Eds.), pp. 1053-1073: Springer New York.

Whitton, B. A., & Potts, M. (2000). The ecology of cyanobacteria: their diversity in time and space. Dordrect:Kluwer Academic.

Wiegand, C., & Pflugmacher, S. (2005). Ecotoxicological effects of selected cyanobacterial secondary metabolites a short review. Toxicology and applied pharmacology, 203(3), 201-218

Wiese, M., D’Agostino, P. M., Mihali, T. K., Moffitt, M. C., & Neilan, B. A. (2010). Neurotoxic Alkaloids: Saxitoxin and Its Analogs. Marine Drugs, 8(7), 2185

Williams, J. G. K. (1988). Construction of specific mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. Methods in Enzymology, 167, 766-778

Wnorowski, A. U. (1992). Tastes and odours in aquatic environment: A review. Water SA [WATER SA], 18(3), 203-214

Yoshida, T., Sako, Y., Uchida, A., Kakutani, T., Arakawa, O., Noguchi, T., & Ishida, Y. (2002). Purification and characterization of sulfotransferase specific to O-22 of 11- hydroxy saxitoxin from the toxic dinoflagellate Gymnodinium catenatum (dinophyceae). Fisheries Science, 68

Yoshihara, S., Geng, X., & Ikeuchi, M. (2002). pilG gene cluster and split pilL genes involved in pilus biogenesis, motility and genetic transformation in the cyanobacterium Synechocystis sp. PCC 6803. Plant and Cell Physiology, 43(5), 513

Yoshihara, S., Geng, X. X., Okamoto, S., Yura, K., Murata, T., Go, M., Ohmori, M., & Ikeuchi, M. (2001). Mutational Analysis of Genes Involved in Pilus Structure, Motilityand Transformation Competency in the Unicellular Motile CyanobacteriumSynechocystis sp. PCC6803. Plant and Cell Physiology, 42(1), 63

Yu, F. H., & Catterall, W. A. (2003). Overview of the voltage-gated sodium channel family. Genome Biol, 4(3), 207

Zegura, B., Straser, A., & Filipic, M. (2011). Genotoxicity and potential carcinogenicity of cyanobacterial toxins – a review. Mutation Research/Reviews in Mutation Research, 727(1-2), 16-41

Page | 101

References

Zhang, W., & Tang, Y. (2008). Combinatorial biosynthesis of natural products. Journal of medicinal chemistry, 51(9), 2629-2633

Zingone, A., & Oksfeldt Enevoldsen, H. (2000). The diversity of harmful algal blooms: a challenge for science and management. Ocean & coastal management, 43(8-9), 725-748

Page | 102

Today’s Science is Tomorrow’s Basics