The Small Gtpase RAB1B Promotes Antiviral Innate Immunity by Interacting with TNF Receptor– Associated Factor 3 (TRAF3)

JBC Papers in Press. Published on August 2, 2019 as Manuscript RA119.007917 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.RA119.007917

The small GTPase RAB1B promotes antiviral innate immunity by interacting with TNF receptor– associated factor 3 (TRAF3)

Dia C. Beachboard1, Moonhee Park1, Madhuvanthi Vijayan1, Daltry L. Snider1. Dillon J. Fernando1, Graham D. Williams1, Sydney Stanley1, Michael J. McFadden1, and Stacy M. Horner1,2

From the Departments of Molecular Genetics and Microbiology1 and Medicine2, Duke University Medical Center, Durham, North Carolina, 27710

Downloaded from Running Title: RAB1B positively regulates antiviral innate immunity

To whom correspondence should be addressed: Stacy M. Horner, Ph.D., Department of Molecular Genetics http://www.jbc.org/ and Microbiology, Duke University Medical Center, 213 Research Dr., Box 3053 DUMC, Durham, NC USA 27710, Telephone: 919-684-1921, Fax: 919-613-8646, E-mail: [email protected]

at Duke University on August 19, 2019 Keywords: RAB1B member RAS oncogene family (RAB1B), interferon, innate immunity, RNA virus, antiviral agent, TNF receptor–associated factor 3 (TRAF3), flavivirus, PAMP signaling, mitochondrial antiviral signaling protein (MAVS), retinoic acid-inducible gene I (RIG-I)

ABSTRACT Innate immune detection of viral nucleic acids that the GTPase-trafficking protein RAB1B up- during viral infection activates a signaling cascade regulates RIG-I pathway signaling and thereby that induces type I and type III interferons (IFNs), promotes IFN-β induction and the antiviral as well as other cytokines, to generate an antiviral response. We observed that RAB1B over- response. This signaling is initiated by pattern expression increases RIG-I-mediated signaling to recognition receptors, such as the RNA helicase IFN-β and that RAB1B deletion reduces signaling retinoic acid-inducible gene I (RIG-I), that sense of this pathway. Additionally, loss of RAB1B viral RNA. These sensors then interact with the dampened the antiviral response, indicated by adaptor protein mitochondrial antiviral signaling enhanced Zika virus infection of cells depleted of protein (MAVS), which recruits additional RAB1B. Importantly, we identified the mechanism signaling proteins, including TNF receptor– of RAB1B action in the antiviral response, finding associated factor 3 (TRAF3) and TANK-binding that it forms a protein complex with TRAF3 to kinase 1 (TBK1), to form a signaling complex that facilitate the interaction of TRAF3 with MAVS. activates IFN regulatory factor 3 (IRF3) for We conclude that RAB1B regulates TRAF3 and transcriptional induction of type I IFNs. Here, using promotes the formation of innate immune signaling several immunological and biochemical complexes in response to nucleic acid sensing approaches in multiple human cell types, we show during RNA virus infection.

1 RAB1B positively regulates antiviral innate immunity

Previously, we have found that during viral Viruses are detected in the infected cell by infection many cellular proteins change their the antiviral innate immune system. This system is localization to and from MAMs (15). One of these activated when specific pattern recognition proteins is the GTPase RAB1B, which is recruited receptors sense pathogen-associated molecular into MAMs to interact with the MAVS signaling patterns (PAMPs) that are unique to viruses. These complex following RIG-I activation (15). RAB1B, viral PAMPs include cytosolic nucleic acids which is functionally distinct from the related derived from either RNA or DNA viruses. RAB1A protein, regulates ER-to-Golgi trafficking Specifically, RIG-I and MDA5 sense viral RNA in by binding to effector proteins that tether ER- the cytoplasm, while cGAS and IFI16 sense viral derived vesicles to the cytoskeleton to facilitate the DNA (1,2). Upon sensing of viral nucleic acids, movement of these vesicles to the Golgi (16,17). these sensor proteins become activated, allowing Interestingly, a known RAB1B effector protein them to signal to their respective adaptor proteins, called p115 has previously been shown to interact MAVS and STING (3,4). These adaptors then with TRAF3 and is required for TRAF3 trafficking recruit the downstream signaling molecules that from the Golgi to the MAVS signaling complex ultimately drive the transcriptional induction of (13), suggesting that RAB1B may be required for Downloaded from type I and type III interferons (IFNs) (5), leading to TRAF3 interaction with MAVS during RIG-I the production of hundreds of IFN-stimulated genes signaling. (ISGs), many of which have antiviral functions (6). Here, we have identified a role for RAB1B The antiviral innate immune response is in positively regulating RIG-I pathway signaling carefully regulated to inhibit viral infection without for the induction of type I IFN. We show that http://www.jbc.org/ causing excessive inflammation in host tissues. RAB1B interacts with TRAF3 to promote the This regulation can occur in several ways, including interaction of TRAF3 with the signaling adaptor post-translational modification of signaling protein MAVS during induction of the antiviral proteins, unique protein-protein interactions innate immune response. Ultimately, this work between signaling proteins and their regulators, and reveals that the known cellular trafficking protein at Duke University on August 19, 2019 through changes in localization of signaling RAB1B interacts with TRAF3 to facilitate the proteins and regulators to different subcellular assembly of innate immune signaling complexes, compartments. The RNA sensor RIG-I is regulated providing a new example of a trafficking protein by all three of these mechanisms. Before viral that is repurposed to regulate the host response to infection, RIG-I resides in the cytoplasm in an virus infection. inactive state (7). During RNA virus infection, both Riplet and TRIM25 ubiquitinate RIG-I with K63- RESULTS linked ubiquitin chains (8-10). This ubiquitination RAB1B positively regulates RIG-I pathway allows RIG-I to interact with the chaperone protein signaling to IFN-β and the antiviral response. 14-3-3ε. Subsequently, 14-3-3ε translocates RIG-I Previously, we found that in response to RIG-I into membranes to interact with MAVS and induce signaling the GTPase protein RAB1B localizes to downstream signaling (11). In addition to RIG-I, the MAM and is in a complex with MAVS (15). To other antiviral signaling proteins are regulated by determine if this MAVS-interacting protein also changes in their localization during antiviral innate regulates RIG-I/MAVS pathway signaling to IFN- immune induction. For example, both the β, we measured Sendai virus (SenV)-mediated serine/threonine kinase TBK1 and the E3 ubiquitin signaling to the IFN-β promoter following over- ligase TRAF3 have been shown to relocalize upon expression of RAB1B in 293T cells. SenV is a nucleic acid sensing (12,13) to interact with the negative-strand RNA virus that potently induces MAVS signaling complex at mitochondria and ER RIG-I/MAVS signaling to IFN-β (18,19). We contact sites, otherwise known as mitochondrial- found that while over-expression of RAB1B on its associated ER membranes (MAMs) (14). The own did not significantly induce signaling to IFN- mechanism(s) by which these proteins relocalize β, it did augment SenV-mediated signaling to IFN- upon nucleic acid sensing and the consequences of β, as measured by an IFN-β promoter luciferase this relocalization are not fully understood. assay and by real time quantitative PCR (RT- qPCR) for IFNB1 (Fig. 1A-B). Importantly, over-

2 RAB1B positively regulates antiviral innate immunity expression of RAB1B also enhanced the levels of supernatant using a focus-forming assay. In IFNB1 transcripts following transfection of a RIG- RAB1B depleted cells, ZIKV titer was increased by I agonist (the hepatitis C virus (HCV) 5’ppp- approximately fifty percent as compared to the containing polyU/UC RNA) (20) in both 293T cells control cells (Fig. 2E). To test whether the increase and Huh7 cells (Fig. 1C), suggesting that RAB1B in ZIKV titer in the RAB1B depleted cells was directly regulates RIG-I pathway signaling. We dependent on induction of IFN signaling, we also found that RAB1B over-expression enhanced measured ZIKV titer in Huh7-STAT1 KO cells SenV-mediated induction of IFNB1 transcripts in generated by CRISPR/Cas9. As expected, since the human monocyte THP1 cells (Fig. 1D). ZIKV is known to be IFN-sensitive, we found that Collectively, these data suggest that while RAB1B loss of STAT1 trended towards increased levels of does not induce signaling on its own, it does infectious ZIKV as compared to the parental cells enhance RIG-I pathway signaling to IFN-β. (Fig. 2E). However, the levels of infectious ZIKV To determine whether loss of RAB1B in the Huh7-STAT1 KO cells were not altered by decreased RIG-I pathway signaling to IFN-β, we depletion of RAB1B (Fig. 2E). This, along with the depleted RAB1B in 293T cells using an siRNA. fact that the Huh7-STAT1 KO cells do not produce

Depletion of RAB1B resulted in a decrease in the ISGs in response to IFN-β (Fig. 2F), suggests that Downloaded from induction of IFNB1 transcripts following SenV during ZIKV infection, the loss of RAB1B in Huh7 infection (Fig. 2A). To confirm this result, we WT cells results in decreased levels of IFN generated two cell lines deficient in RAB1B by signaling and ISG induction leading to increased using CRISPR/Cas9 with two different sets of levels of infectious ZIKV. Collectively, these data guide RNAs that targeted different regions of the reveal that RAB1B positively regulates the antiviral http://www.jbc.org/ RAB1B locus to make two independent knockout response. (KO) lines: RAB1B KO-1 and RAB1B KO-2. Then we measured SenV-induced signaling to IFN- RAB1B is required for phosphorylation of β by RT-qPCR in the parental or RAB1B KO-2 IRF3 and TBK1. The induction of IFN-β in cells. Loss of RAB1B resulted in decreased response to viral infection requires the kinase at Duke University on August 19, 2019 induction of IFNB1 transcripts following SenV TBK1. Upon activation, TBK1 becomes infection. Importantly, over-expression of RAB1B autophosphorylated and phosphorylates the in these RAB1B KO-2 cells restored the SenV- transcription factor IRF3 at multiple residues, mediated increase in IFNB1 transcripts, confirming resulting in IRF3 translocation to the nucleus where that RAB1B positively regulates IFN-β induction it cooperates with NF-κB to transcriptionally (Fig. 2B). Next, to determine if RAB1B also induce IFN-β (5,23,24). To determine if RAB1B is regulates activation of NF-κB, we measured the required to activate this signaling cascade, we first mRNA levels of A20, a known NF-κB target gene, measured the phosphorylation of IRF3 at S396 (p- in the presence and absence of RAB1B (21). We IRF3) in response to SenV infection in the parental found that A20 transcripts were induced in response and RAB1B KO-1 293T cells by immunoblot to SenV at similar levels in both the WT and analysis. We found that the phosphorylation of RAB1B KO cells (Fig. 2C-D), revealing that loss of IRF3 in response to SenV was decreased in the RAB1B does not prevent induction of the NF-κB RAB1B KO-1 cells as compared to the parental signaling pathway. cells, revealing that RAB1B activates innate Since RAB1B positively regulated immune signaling upstream of IRF3 induction of IFN-β, we hypothesized that it would phosphorylation (Fig. 3A). Next, to test whether also be required for antiviral responses driven by RAB1B is required for the activation and IFN. Therefore, we tested if loss of RAB1B resulted autophosphorylation of TBK1, we measured in higher levels of viral infection by Zika virus phosphorylation of TBK1 at S172 (p-TBK1) after (ZIKV), a virus known to be susceptible to type I SenV infection in the parental and RAB1B KO-1 IFN (22). We treated Huh7 cells with either an 293T cells by immunoblot analysis. We found that siRNA to RAB1B or a control siRNA, infected TBK1 phosphorylation in response to SenV was these cells with ZIKV (multiplicity of infection decreased in the RAB1B KO-1 cells as compared to (MOI) 0.01), and then 48 hours later measured the the parental cells (Fig. 3B). Taken together, these production of infectious ZIKV particles in the data suggest that RAB1B promotes signaling that

3 RAB1B positively regulates antiviral innate immunity leads to TBK1 autophosphorylation and subsequent promote the interaction of either TRAF2 or TRAF3 IRF3 phosphorylation in response to RIG-I with MAVS in response to RIG-I signaling. We signaling. measured the interaction of endogenous MAVS and TRAF3 or MAVS and TRAF2 during a time course RAB1B interacts with TRAF3. As RAB1B of SenV infection by co-immunoprecipitation. We is required for TBK1 activation, this suggested to found that MAVS and TRAF3 interacted at six us that in response to RIG-I signaling, RAB1B may hours post-SenV infection in 293T cells; however, act on a protein that promotes TBK1 activation. The this interaction was reduced in the RAB1B KO-1 TRAF proteins, specifically TRAF2, TRAF3, and 293T cells (Fig. 4E). TRAF2 also interacted with TRAF6, are well-known regulators of TBK1 MAVS at six hours post-SenV infection in WT cells activation (25). We decided to focus on TRAF3 (Fig. 4F). However, in the RAB1B-KO-1 cells, first because the known RAB1B effector protein TRAF2 interacted with MAVS in both the presence p115 has previously been shown to regulate TRAF3 and absence of SenV (Fig. 4F). These data function during RIG-I signaling (13). We tested if demonstrate that while RAB1B can interact with RAB1B interacts with TRAF3 in response to both TRAF2 and TRAF3 during over-expression, activation of antiviral innate immune signaling RAB1B facilitates the interaction of TRAF3, but Downloaded from following either RIG-I or MAVS over-expression. not TRAF2, with MAVS in response to activation First, we over-expressed HA-RAB1B and Myc- of innate immune signaling. TRAF3 in cells in which we did or did not activate RIG-I signaling by over-expressing the DISCUSSION constitutively active form of RIG-I (RIG-I-N) (26). Although many of the signaling proteins http://www.jbc.org/ We found that Myc-TRAF3 co- that function in cytosolic nucleic acid sensing immunoprecipitated with HA-RAB1B only upon pathways have been well studied, the molecular activation of RIG-I signaling (Fig. 4A). To mechanisms by which these proteins are turned on determine whether TRAF3 interacts with the and off in response to nucleic acid sensing are less RAB1B-MAVS complex (15), we over-expressed defined. Previously, we identified proteins that may at Duke University on August 19, 2019 HA-RAB1B and GFP-TRAF3 along with Flag- regulate the assembly of the MAVS signaling MAVS. We found that GFP-TRAF3 co- complex at membrane contact sites between ER, immunoprecipitated with HA-RAB1B only in the mitochondria, and peroxisomes by using presence of over-expressed MAVS, which was also proteomics to identify the proteins that relocalize detected in the complex, suggesting these proteins into these contacts sites during RIG-I activation form a complex in response to signaling (Fig. 4B). (15). Some of these proteins with differential Next, to determine whether RAB1B can also membrane association upon RIG-I signaling interact with TRAF2 or TRAF6 in response to included GTPase proteins, such as RAB1B. Here, MAVS signaling, we over-expressed HA-RAB1B we have shown that RAB1B positively regulates with Myc-TRAF2 or Myc-TRAF6, along with RNA sensing by promoting RIG-I signaling to IFN- Flag-MAVS. We found that Myc-TRAF2 (Fig. β through interactions with the E3 ubiquitin ligase 4C), but not Myc-TRAF6 (Fig. 4D), co- TRAF3. This interaction facilitates TRAF3 immunoprecipitated with HA-RAB1B in response recruitment to MAVS, leading to phosphorylation to MAVS over-expression. This suggests that of TBK1 and IRF3 for the transcriptional induction RAB1B can form a complex with either MAVS- of IFN-β. In summary, our work reveals that the TRAF3 or MAVS-TRAF2 but not with TRAF6, known cellular trafficking protein RAB1B interacts suggesting that RAB1B could facilitate the with TRAF3 to facilitate the assembly of the formation of the MAVS-TRAF2/3 complexes for MAVS signaling complex, providing a new downstream signaling. example of a trafficking or chaperone protein that is repurposed to regulate the host response to virus RAB1B is required for TRAF3 to interact infection (see model in Fig. 5). with MAVS. As MAVS interaction with TRAF Our results suggest that the interaction of proteins has been shown to be is required for its RAB1B with TRAF3, but not TRAF2 or TRAF6, is interaction with TBK1 and downstream signaling important for IFN-induction. While TRAF2, (27,28), we next tested if RAB1B was required to TRAF3, and TRAF6 have all been shown to

4 RAB1B positively regulates antiviral innate immunity interact with MAVS and have roles in regulating be required for TRAF3 recruitment to the MAVS IFN-induction in response to viral infection, they do signaling complex (13). Thus, it is likely that have distinct functions that likely mediate each of RAB1B interacts with p115, or another effector their regulatory roles in IFN-induction (25). In protein, to facilitate the movement of TRAF3 on response to viral infection, TRAF3 and TRAF2 vesicles from the Golgi apparatus to sites of MAVS have been shown to activate TBK1-IRF3 signaling, signaling (see model in Fig. 5, steps 3-5). There is while TRAF2 and TRAF6, but not TRAF3, have evidence that Golgi and other intracellular been shown to activate NF-κB signaling (25,27- membranes rearrange during MAVS signaling to 29). We found that over-expressed RAB1B bring MAVS in contact with the Golgi-associated interacts with TRAF2 and TRAF3, but not TRAF6 TRAF3 (13,14). As we were unable to detect (Fig. 4). However, as we found that RAB1B is not relocalization of RAB1B to MAVS-signaling sites required for induction of the NF-κB pathway (Fig. (data not shown), this suggests that only a small 2C) and the fact that of these TRAFs, only TRAF3 proportion of RAB1B, likely the p115-bound form, is localized to the Golgi (13), where RAB1B can be interacts with TRAF3 at any given time. Indeed, localized, we conclude that the function of RAB1B RAB1B has multiple effector proteins (16,32), in promoting IFN-induction is a result of the which suggests that different pools of RAB1B in Downloaded from interaction (either direct, or more likely, indirect) the cell may have different functions that could be with TRAF3. It is interesting that loss of RAB1B activated by interactions with specific effector resulted in TRAF2 interaction with MAVS in the proteins. absence of stimulus. As we did find that over- The mechanisms by which RAB1B would expressed RAB1B can bind to TRAF2 (Fig. 4F), it interact with a unique set of effectors during http://www.jbc.org/ is possible that some population of RAB1B binds cytosolic nucleic acid sensing are not entirely clear. to TRAF2 to prevent it from interacting with While the overall localization of RAB1B does not MAVS in the absence of stimulus. While RAB1B change in the cell during innate immune signaling, regulates TRAF3, other RAB or GTPase proteins it is possible that specific post-translational may regulate TRAF2 or TRAF6 to promote IFN- modifications are altered (either added or removed) at Duke University on August 19, 2019 induction. on RAB1B, which may facilitate interactions with It is unclear if RAB1B directly regulates a new set of effectors. Indeed, post-translation TRAF3 or if this regulation is indirect and mediated modification of small GTPase proteins does alter by RAB1B effector proteins. We know that small their association with effector proteins and GTPase proteins such as RAB1B regulate therefore their biological functions. For example, intracellular membrane trafficking by interacting the GTPase RALB is ubiquitinated by K63- with effector proteins (16). RAB1B, similar to other ubiquitin linkages to switch from its role in GTPase proteins, cycles between an inactive GDP- autophagy to a role in innate immune signaling bound state and an active GTP-bound state that (33,34). This ubiquitination prevents RALB from associates with intracellular membranes (16). binding to its autophagy effector protein EXO84 Importantly, this GTP-bound, membrane- and instead allows RALB to bind to the Sec5 associated RAB1B facilitates COPI recruitment effector protein for interaction with TBK1 to and cargo transport between the ER and the Golgi regulate innate immunity. Similarly, ubiquitination by interactions with specific effector proteins (30). of the ARF domain of TRIM23 activates the GTP These effector proteins include tethering factors hydrolysis activity of TRIM23 to regulate the that link organelles and vesicles prior to fusion, function of TBK1 in autophagy (35). Therefore, it adaptors for motor proteins that direct organelle is possible that changes in post-translational trafficking, and regulators of other GTPases that are modification of RAB1B allows it to interact with recruited to the specific subcellular compartments TRAF3 for innate immune signaling. Other innate of those GTPases (31). Therefore, RAB1B effector immune signaling proteins are also known to be proteins are critical for RAB1B trafficking activated by specific post-translational functions and are likely important for mediating the modifications (36). The addition and removal of role of RAB1B in antiviral innate immunity. these post-translational modifications on signaling Indeed, the RAB1B effector protein p115 has chaperone or trafficking proteins may be a general previously been shown to interact with TRAF3 and cellular mechanism to repurpose these proteins into

5 RAB1B positively regulates antiviral innate immunity innate immune signaling regulators, and future hemagglutination units/mL. SenV infections were studies will examine this possibility for RAB1B. performed in serum-free media for 1 h, after which Our work adds RAB1B to a growing list of complete media was replenished. ZIKV-Dakar GTPase proteins that have been shown to regulate (DAK; Zika virus/A.africanus- innate immune signaling, either by regulating tc/SEN/1984/41525-DAK) (GenBank accession trafficking of innate immune signaling proteins or #KU955591) was provided by Dr. Scott Weaver at specific effector protein interactions. For example, University of Texas Medical Branch. Stocks were cytosolic DNA-induced innate immune responses prepared as previously described (43). ZIKV mediated by cGAS have been shown to be regulated infections were performed at a MOI of 0.01 for 48 by RAB2B and its effector protein GARIL5 (37). h in Huh7 cells. Signaling from the bacterial LPS sensor TLR4 is Focus forming assay for ZIKV titer. also regulated by RAB proteins (38-41). Supernatants were harvested from ZIKV-infected Specifically, both RAB10 and RAB11A positively cells at 48 h post infection, serially diluted, and regulate TLR4 signaling (38), with RAB10 used to infect naïve Vero cells in triplicate wells of promoting TLR4 recycling to the plasma a 48-well plate for 2 h before overlay with membrane, and RAB11B promoting TLR4 methylcellulose. After 48 h, plates were fixed in Downloaded from localization to the Escherichia coli phagosome methanol acetone. Cells were blocked (10% FBS in (40,41). Conversely, RAB7B negatively regulates PBS) and then immunostained with the mouse anti- TLR4 signaling by promoting lysosomal 4G2 antibody, generated from the D1-4G2-4-15 degradation of TLR4 (39). As intracellular innate hybridoma cell line against the flavivirus Envelope immunity is so often regulated at the cell biological protein (ATCC). Infected cells were visualized http://www.jbc.org/ level (42), it is likely that other RAB proteins will following incubation with a horseradish control specific intracellular trafficking events that peroxidase-conjugated secondary antibody (1:500; regulate nucleic acid-induced innate immunity and Jackson ImmunoResearch) and VIP Peroxidase viral infection. Substrate Kit (Vector Laboratories). Titer (focus- forming units (FFU)/mL) was calculated from the at Duke University on August 19, 2019 EXPERIMENTAL PROCEDURES average number of 4G2 positive foci at 10X Cell culture. 293T, Huh7, T-REx-293, and magnification, relative to the amount and dilution Vero cells were grown in Dulbecco’s modification of virus used. of Eagle’s medium (DMEM; Mediatech) Plasmids. The following plasmids have supplemented with 10% fetal bovine serum (FBS; been previously described: pEF-TAK-Flag (44), HyClone), and 25 mM 4-(2-hydroxyethyl)-1- pEF-TAK-Flag-RAB1B (15), pEF-BOS-Flag- piperazineethanesulfo-nic acid (HEPES; Thermo- RIG-I-N (26), pIFN-β-luc (45), pGL4.74 Fisher). THP1 cells (gift of Dr. Dennis Ko, Duke [hRluc/TK] (Promega), pcDNA-Blast (46), pX459 University, who obtained them from the American (Addgene), pEF-TAK-Myc-MAVS (47), pEF- Type Culture Collection (ATCC)) were grown in TAK-Flag-MAVS (47), and plEGFP-N1-TRAF3 Roswell Park Memorial Institute medium 1600 (gift from Dr. Soman Abraham, Duke University) (RPMI; Thermo-Fisher) supplemented with 10% (48). The following plasmids were generated FBS (HyClone), and 25 mM HEPES (Thermo- during this study: pEF-TAK-HA-RAB1B, pcDNA- Fisher). The identity of the Huh7 cells in this study Myc-TRAF3, pEF-TAK-Myc-TRAF2, pEF-TAK- were verified using the GenePrint STR Kit Myc-TRAF6, pX330-sgRAB1B, pX459- (Promega, Duke University DNA Analysis sgRAB1B-2, pX459-sgRAB1B-3, and pX330- Facility). The 293T and Vero (CRL-3216 and CCL- sgSTAT1. pEF-TAK-HA-RAB1B was generated 81) cells were obtained from ATCC; the Huh7 cells by PCR amplification of RAB1B from pEF-TAK- were a gift of Dr. Michael Gale at the University of Flag-RAB1B and insertion into the EcoRI-XbaI Washington; the T-REx-293 cells were a gift of Dr. digested pEF-vector using InFusion cloning Matthias Gromeier at Duke University (Thermo- (Clontech). The pcDNA-Myc-TRAF3 plasmid was Fisher). Cells were verified as mycoplasma-free generated by cloning PCR-amplified TRAF3 using the LookOut PCR detection Kit (Sigma). (plEGFP-N1-TRAF3) into pcDNA-Myc using SalI Viruses. SenV Cantell strain was obtained and KpnI. The pEF-TAK-Myc-TRAF2 and pEF- from Charles River Laboratories and used at 200 TAK-Myc-TRAF6 plasmids were generated by

6 RAB1B positively regulates antiviral innate immunity cloning PCR-amplified TRAF2 or TRAF6 as per manufacturer’s instructions. This genomic (pcDNA-Myc-TRAF2 or pcDNA-Myc-TRAF6, DNA was then amplified using primers across gift of Dr. Zhijie Chang at Tsinghua University) RAB1B exon 4 (RAB1B KO-1), RAB1B exon 1 into pEF-TAK-Myc using AgeI and PmeI. To (RAB1B KO-2), or STAT1 exon 2 (see Table 1). generate the CRISPR guide RNA plasmids, sgRNA For the RAB1B KO-2, the PCR-amplified genomic oligonucleotides were annealed and inserted into DNA was subjected to agarose gel electrophoresis the BbsI-digested pX330 or pX459 (49,50). The to identify a size shift from a product size of 509 bp oligonucleotide sequences used for cloning are to a size of 258 bp, the expected size if both guides listed in Table 1. The plasmid sequences were targeted this exon. RAB1B KO-1 and STAT1 KO verified by DNA sequencing and are available upon genomic DNA was cloned into the pCR4-TOPO request. TA vector (Invitrogen), and Sanger sequenced. For Generation of RIG-I agonist. Annealed RAB1B KO-1, eleven resulting genomic DNA oligonucleotides containing the sequence of the subclones were sequenced, and nine clones had a HCV 5’ppp poly-U/UC region (Table 1) (20) were 27 bp deletion at the end of exon 4 that extended to in vitro transcribed using the Megashortscript T7 the intron junction and two clones had a 1 bp transcription kit (Ambion) followed by ethanol insertion in exon 4 that resulted in a frame shift that Downloaded from precipitation, with the resulting RNA resuspended lead to a premature stop codon within exon 5. For at 1 µg/µL for use in experiments. STAT1 KO, seven resulting genomic DNA Transfection. DNA transfections were subclones were sequenced, and all had a 1 bp performed using FuGENE6 (Promega) or insertion in exon 2 that resulted in a premature stop Lipofectamine 3000 (Invitrogen). RIG-I agonist codon four amino acids downstream. STAT1 KO http://www.jbc.org/ transfections were done using the TransIT-mRNA cells were validated by immunoblot after treatment Transfection kit (Mirus Bio). The siRNA with 50 U/mL human IFN-β (PBL Assay Science). transfections were done using Lipofectamine RNA Analysis. Total cellular RNA was RNAiMax (Invitrogen). The IFN-β-promoter extracted using the Purelink RNA mini kit (Life luciferase assays were performed as previously Technologies). RNA was then reverse transcribed at Duke University on August 19, 2019 described at 12 or 16 h post Mock or SenV infection using the iScript cDNA synthesis kit (BioRad), as and normalized to the Renilla luciferase per the manufacturer’s instructions. The resulting transfection control (18). cDNA was diluted 1:3 in ddH2O. RT-qPCR was Generation of KO cells lines. RAB1B KO performed in triplicate using the Power SYBR cells were generated by CRISPR/Cas9, using a Green PCR master mix (Thermo-Fisher) and the single guide targeting exon 4 designed using the Applied Biosystems Step One Plus or QuantStudio CRISPR design tool (http://crispr.mit.edu) or two 6 Flex RT-PCR systems. The oligonucleotide guides targeting exon 1 using UCSC Genome sequences used are listed in Table 1. Browser (51). STAT1 KO cells were generated Immunoblotting. Cells were lysed in a using a single guide targeting exon 2 (52). pX330- modified radioimmunoprecipitation assay (RIPA) sgRAB1B-1 (RAB1B KO-1) or pX330-sgSTAT1 buffer (10 mM Tris [pH 7.5], 150 mM NaCl, 0.5% were transfected into 293T or Huh7 cells, sodium deoxycholate, and 1% Triton X-100) respectively, along with pcDNA containing supplemented with protease inhibitor cocktail blasticidin resistance (pcDNA-Blast) for 24 h. (Sigma) and Halt Phosphatase Inhibitor (Thermo- pX459-sgRAB1B-2 and pX459-sgRAB1B-3 Fisher), and post-nuclear lysates were isolated by (RAB1B KO-2) were co-transfected into T-REx- centrifugation. Quantified protein (between 5-15 293 cells for 24 h. Cells were then replated at µg) was resolved by SDS/PAGE, transferred to limiting dilutions into 15 cm dishes with 10 µg/mL nitrocellulose or polyvinylidene difluoride (PVDF) blasticidin (RAB1B KO-1 and STAT1 KO) or 2 membranes in a 25 mM Tris-192 mM glycine- µg/mL puromycin (RAB1B KO-2) treatment for 3 0.01% SDS buffer and blocked in StartingBlock days. Single cell colonies were then amplified and (Thermo-Fisher) buffer, 5% milk in phosphate- screened for RAB1B or STAT1 expression by buffered saline containing 0.01% Tween-20 (PBS- immunoblot. Genomic DNA was extracted from T), or 3% BSA in Tris-buffered saline containing candidate RAB1B KO or STAT1 KO cells using 0.01% Tween-20 (TBS-T). After washing with QuickExtract DNA Extraction Solution (Lucigen), PBS-T or TBS-T (for phosphoproteins) buffer,

7 RAB1B positively regulates antiviral innate immunity membranes were incubated with species-specific Signaling Technology) in lysis buffer at 4°C horseradish peroxidase-conjugated antibodies overnight with head over tail rotation. The (Jackson ImmunoResearch, 1:5000) followed by lysate/antibody mixture was then incubated with treatment of the membrane with ECL+ (GE either Protein A or G Dynabeads (Invitrogen) for 2 Healthcare) or Clarity Western ECL substrate h. Beads were washed 3X in PBS or modified RIPA (BioRad) and imaging on X-ray film or a LICOR buffer for immunoprecipitation and eluted in 2X Odyssey FC. The following antibodies were used Laemmli Buffer (BioRad) supplemented with 5% for immunoblotting: anti-RAB1B (R-Santa Cruz, 2-Mercaptoethanol at 95°C for 10 min. Proteins 1:1000 or M-Sigma, 1:500), R-anti-SenV (MBL, were resolved by SDS/PAGE and immunoblotting, 1:1000), M-anti-Flag M2 (Sigma, 1:5000), R-anti- as above. GFP (Thermo-Fisher, 1:1000), M-anti-Tubulin Statistical Analysis. Student’s unpaired t- (Sigma, 1:5000), M-anti-STAT1 (BD, 1:1000), M- test and two-way ANOVA with Tukey’s post hoc anti-IFIT3 (Abcam, 1:1000), M-anti-ISG15 (Santa test were used for statistical analysis of the data Cruz, 1:1000), R-anti-p-IRF3 (Cell Signaling using GraphPad Prism software. Graphed values Technology, 1:1000), M-anti-IRF3 ((53), 1:1000), are presented as mean ± SD or SEM (n = 3 or as R-anti-p-TBK1 (Cell Signaling Technology, indicated); *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ Downloaded from 1:1000), R-anti-TBK1 (Cell Signaling Technology, 0.001. 1:1000), anti-HA (mouse-Abcam and rabbit- Sigma, 1:1000), anti-TRAF3 (mouse-Santa Cruz or Acknowledgements: We thank all members of the rabbit-Cell Signaling Technology, 1:1000), R-anti- Horner lab for discussion and reading of the TRAF2 (Abcam, 1:1000), anti-MAVS (mouse- manuscript. We would also like to thank Dr. Vineet http://www.jbc.org/ AdipoGen or rabbit-Bethyl Laboratories, 1:1000), Menachery of University of Texas Medical Branch R-anti-GAPDH (Cell Signaling Technology, for helpful discussion. We thank the following 1:1000), and anti-Myc (mouse-Santa Cruz or people for reagents and equipment use: Dr. Michael rabbit-Cell Signaling Technology, 1:1000). Gale Jr. of University of Washington, Dr. Scott Quantification of immunoblots. Weaver of University of Texas Medical Branch, Dr. at Duke University on August 19, 2019 Immunoblots imaged using the LICOR Odyssey Zhijie Chang at Tsinghua University, and from FC were quantified by ImageStudio software, and Duke University: Dr. Dennis Ko, Dr. Soman raw values were normalized to relevant controls for Abraham, Dr. Matthias Gromeier; and the Duke each antibody. Immunoblots developed on film, Functional Genomics Core Facility. This work was were quantified using FIJI, which normalizes the supported by funds from the NIH: K22 AI100935 signal to relevant controls for each antibody (54). (S.M.H.); T32-CA009111 (D.C.B.). Additional ImageStudio and FIJI give similar quantification funding sources include the American Cancer results when compared directly. Phosphoprotein Society Postdoctoral fellowship 131321-PF-17- values were normalized to Tubulin and displayed as 188-01-MPC (D.C.B.); the Burroughs Wellcome the percentage of signal from WT. Fund (S.M.H); and a Duke Bridge Award (S.M.H). Immunoprecipitation. Cells were lysed as above but in RIPA with 10% glycerol or a modified Conflicts of interest: The authors declare that they RIPA buffer for immunoprecipitation (25 mM Tris have no conflicts of interest with the contents of this [pH 7.5], 150 mM NaCl, 1% sodium deoxycholate, article. The content is solely the responsibility of 10% glycerol, and 1% Triton X-100). Quantified the authors and does not necessarily represent the protein (between 200-500 µg) was incubated with official views of the National Institutes of Health. protein-specific or isotype control antibody (Cell

REFERENCES

1. McFadden, M. J., Gokhale, N. S., and Horner, S. M. (2017) Protect this house: cytosolic sensing of viruses. Curr Opin Virol 22, 36-43

8 RAB1B positively regulates antiviral innate immunity

2. Almine, J. F., O'Hare, C. A., Dunphy, G., Haga, I. R., Naik, R. J., Atrih, A., Connolly, D. J., Taylor, J., Kelsall, I. R., Bowie, A. G., Beard, P. M., and Unterholzner, L. (2017) IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes. Nat Commun 8, 14392

3. Kumar, H., Kawai, T., Kato, H., Sato, S., Takahashi, K., Coban, C., Yamamoto, M., Uematsu, S., Ishii, K. J., Takeuchi, O., and Akira, S. (2006) Essential role of IPS-1 in innate immune responses against RNA viruses. J Exp Med 203, 1795-1803

4. Sun, L., Wu, J., Du, F., Chen, X., and Chen, Z. J. (2013) Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786-791

5. Liu, S., Cai, X., Wu, J., Cong, Q., Chen, X., Li, T., Du, F., Ren, J., Wu, Y. T., Grishin, N. V., and Chen, Z. J. (2015) Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science 347, aaa2630 Downloaded from 6. Schoggins, J. W., and Rice, C. M. (2011) Interferon-stimulated genes and their antiviral effector functions. Curr Opin Virol 1, 519-525

7. Kolakofsky, D., Kowalinski, E., and Cusack, S. (2012) A structure-based model of RIG-I

activation. RNA 18, 2118-2127 http://www.jbc.org/

8. Gack, M. U., Shin, Y. C., Joo, C. H., Urano, T., Liang, C., Sun, L., Takeuchi, O., Akira, S., Chen, Z., Inoue, S., and Jung, J. U. (2007) TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG- I-mediated antiviral activity. Nature 446, 916-920 at Duke University on August 19, 2019 9. Oshiumi, H., Matsumoto, M., Hatakeyama, S., and Seya, T. (2009) Riplet/RNF135, a RING finger protein, ubiquitinates RIG-I to promote interferon-beta induction during the early phase of viral infection. J Biol Chem 284, 807-817

10. Oshiumi, H., Miyashita, M., Inoue, N., Okabe, M., Matsumoto, M., and Seya, T. (2010) The ubiquitin ligase Riplet is essential for RIG-I-dependent innate immune responses to RNA virus infection. Cell Host Microbe 8, 496-509

11. Liu, H. M., Loo, Y. M., Horner, S. M., Zornetzer, G. A., Katze, M. G., and Gale, M., Jr. (2012) The mitochondrial targeting chaperone 14-3-3epsilon regulates a RIG-I translocon that mediates membrane association and innate antiviral immunity. Cell Host Microbe 11, 528-537

12. Pourcelot, M., Zemirli, N., Silva Da Costa, L., Loyant, R., Garcin, D., Vitour, D., Munitic, I., Vazquez, A., and Arnoult, D. (2016) The Golgi apparatus acts as a platform for TBK1 activation after viral RNA sensing. BMC Biol 14, 69

13. van Zuylen, W. J., Doyon, P., Clement, J. F., Khan, K. A., D'Ambrosio, L. M., Do, F., St-Amant- Verret, M., Wissanji, T., Emery, G., Gingras, A. C., Meloche, S., and Servant, M. J. (2012) Proteomic profiling of the TRAF3 interactome network reveals a new role for the ER-to-Golgi transport compartments in innate immunity. PLoS Pathog 8, e1002747

14. Horner, S. M., Liu, H. M., Park, H. S., Briley, J., and Gale, M., Jr. (2011) Mitochondrial-associated endoplasmic reticulum membranes (MAM) form innate immune synapses and are targeted by hepatitis C virus. Proc Natl Acad Sci U S A 108, 14590-14595

9 RAB1B positively regulates antiviral innate immunity

15. Horner, S. M., Wilkins, C., Badil, S., Iskarpatyoti, J., and Gale, M., Jr. (2015) Proteomic analysis of mitochondrial-associated ER membranes (MAM) during RNA virus infection reveals dynamic changes in protein and organelle trafficking. PLoS One 10, e0117963

16. Hutagalung, A. H., and Novick, P. J. (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91, 119-149

17. Plutner, H., Cox, A. D., Pind, S., Khosravi-Far, R., Bourne, J. R., Schwaninger, R., Der, C. J., and Balch, W. E. (1991) Rab1b regulates vesicular transport between the endoplasmic reticulum and successive Golgi compartments. J Cell Biol 115, 31-43

18. Sumpter, R., Jr., Loo, Y. M., Foy, E., Li, K., Yoneyama, M., Fujita, T., Lemon, S. M., and Gale, M., Jr. (2005) Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J Virol 79, 2689-2699

19. Cantell, K., Hirvonen, S., Kauppinen, H. L., and Myllyla, G. (1981) Production of interferon in Downloaded from human leukocytes from normal donors with the use of Sendai virus. Methods Enzymol 78, 29-38

20. Saito, T., Owen, D. M., Jiang, F., Marcotrigiano, J., and Gale, M., Jr. (2008) Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature 454, 523-

527 http://www.jbc.org/

21. Verstrepen, L., Verhelst, K., van Loo, G., Carpentier, I., Ley, S. C., and Beyaert, R. (2010) Expression, biological activities and mechanisms of action of A20 (TNFAIP3). Biochem Pharmacol 80, 2009-2020 at Duke University on August 19, 2019 22. Ma, J., Ketkar, H., Geng, T., Lo, E., Wang, L., Xi, J., Sun, Q., Zhu, Z., Cui, Y., Yang, L., and Wang, P. (2018) Zika Virus Non-structural Protein 4A Blocks the RLR-MAVS Signaling. Front Microbiol 9, 1350

23. Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., Coyle, A. J., Liao, S. M., and Maniatis, T. (2003) IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol 4, 491-496

24. Yoneyama, M., Suhara, W., and Fujita, T. (2002) Control of IRF-3 activation by phosphorylation. J Interferon Cytokine Res 22, 73-76

25. Xie, P. (2013) TRAF molecules in cell signaling and in human diseases. J Mol Signal 8, 7

26. Yoneyama, M., Kikuchi, M., Matsumoto, K., Imaizumi, T., Miyagishi, M., Taira, K., Foy, E., Loo, Y. M., Gale, M., Jr., Akira, S., Yonehara, S., Kato, A., and Fujita, T. (2005) Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175, 2851-2858

27. Paz, S., Vilasco, M., Werden, S. J., Arguello, M., Joseph-Pillai, D., Zhao, T., Nguyen, T. L., Sun, Q., Meurs, E. F., Lin, R., and Hiscott, J. (2011) A functional C-terminal TRAF3-binding site in MAVS participates in positive and negative regulation of the IFN antiviral response. Cell Res 21, 895-910

10 RAB1B positively regulates antiviral innate immunity

28. Fang, R., Jiang, Q., Zhou, X., Wang, C., Guan, Y., Tao, J., Xi, J., Feng, J. M., and Jiang, Z. (2017) MAVS activates TBK1 and IKKepsilon through TRAFs in NEMO dependent and independent manner. PLoS Pathog 13, e1006720

29. Saha, S. K., Pietras, E. M., He, J. Q., Kang, J. R., Liu, S. Y., Oganesyan, G., Shahangian, A., Zarnegar, B., Shiba, T. L., Wang, Y., and Cheng, G. (2006) Regulation of antiviral responses by a direct and specific interaction between TRAF3 and Cardif. EMBO J 25, 3257-3263

30. Alvarez, C., Garcia-Mata, R., Brandon, E., and Sztul, E. (2003) COPI recruitment is modulated by a Rab1b-dependent mechanism. Mol Biol Cell 14, 2116-2127

31. Galvez, T., Gilleron, J., Zerial, M., and O'Sullivan, G. A. (2012) SnapShot: Mammalian Rab proteins in endocytic trafficking. Cell 151, 234-234 e232

32. Gillingham, A. K., Sinka, R., Torres, I. L., Lilley, K. S., and Munro, S. (2014) Toward a

comprehensive map of the effectors of rab GTPases. Dev Cell 31, 358-373 Downloaded from

33. Simicek, M., Lievens, S., Laga, M., Guzenko, D., Aushev, V. N., Kalev, P., Baietti, M. F., Strelkov, S. V., Gevaert, K., Tavernier, J., and Sablina, A. A. (2013) The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response. Nat Cell Biol 15, 1220-1230 http://www.jbc.org/ 34. Chien, Y., Kim, S., Bumeister, R., Loo, Y. M., Kwon, S. W., Johnson, C. L., Balakireva, M. G., Romeo, Y., Kopelovich, L., Gale, M., Jr., Yeaman, C., Camonis, J. H., Zhao, Y., and White, M. A. (2006) RalB GTPase-mediated activation of the IkappaB family kinase TBK1 couples innate immune signaling to tumor cell survival. Cell 127, 157-170 at Duke University on August 19, 2019 35. Sparrer, K. M. J., Gableske, S., Zurenski, M. A., Parker, Z. M., Full, F., Baumgart, G. J., Kato, J., Pacheco-Rodriguez, G., Liang, C., Pornillos, O., Moss, J., Vaughan, M., and Gack, M. U. (2017) TRIM23 mediates virus-induced autophagy via activation of TBK1. Nat Microbiol 2, 1543-1557

36. Chiang, C., and Gack, M. U. (2017) Post-translational Control of Intracellular Pathogen Sensing Pathways. Trends Immunol 38, 39-52

37. Takahama, M., Fukuda, M., Ohbayashi, N., Kozaki, T., Misawa, T., Okamoto, T., Matsuura, Y., Akira, S., and Saitoh, T. (2017) The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses. Cell Rep 20, 2944-2954

38. Wang, D., Lou, J., Ouyang, C., Chen, W., Liu, Y., Liu, X., Cao, X., Wang, J., and Lu, L. (2010) Ras-related protein Rab10 facilitates TLR4 signaling by promoting replenishment of TLR4 onto the plasma membrane. Proc Natl Acad Sci U S A 107, 13806-13811

39. Wang, Y., Chen, T., Han, C., He, D., Liu, H., An, H., Cai, Z., and Cao, X. (2007) Lysosome- associated small Rab GTPase Rab7b negatively regulates TLR4 signaling in macrophages by promoting lysosomal degradation of TLR4. Blood 110, 962-971

40. Husebye, H., Aune, M. H., Stenvik, J., Samstad, E., Skjeldal, F., Halaas, O., Nilsen, N. J., Stenmark, H., Latz, E., Lien, E., Mollnes, T. E., Bakke, O., and Espevik, T. (2010) The Rab11a GTPase controls Toll-like receptor 4-induced activation of interferon regulatory factor-3 on phagosomes. Immunity 33, 583-596

11 RAB1B positively regulates antiviral innate immunity

41. Miao, Y., Bist, P., Wu, J., Zhao, Q., Li, Q. J., Wan, Y., and Abraham, S. N. (2017) Collaboration between Distinct Rab Small GTPase Trafficking Circuits Mediates Bacterial Clearance from the Bladder Epithelium. Cell Host Microbe 22, 330-342 e334

42. Brubaker, S. W., Bonham, K. S., Zanoni, I., and Kagan, J. C. (2015) Innate immune pattern recognition: a cell biological perspective. Annu Rev Immunol 33, 257-290

43. Quicke, K. M., Bowen, J. R., Johnson, E. L., McDonald, C. E., Ma, H., O'Neal, J. T., Rajakumar, A., Wrammert, J., Rimawi, B. H., Pulendran, B., Schinazi, R. F., Chakraborty, R., and Suthar, M. S. (2016) Zika Virus Infects Human Placental Macrophages. Cell Host Microbe 20, 83-90

44. Saito, T., Hirai, R., Loo, Y. M., Owen, D., Johnson, C. L., Sinha, S. C., Akira, S., Fujita, T., and Gale, M., Jr. (2007) Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proc Natl Acad Sci U S A 104, 582-587

45. Fredericksen, B., Akkaraju, G. R., Foy, E., Wang, C., Pflugheber, J., Chen, Z. J., and Gale, M., Jr. Downloaded from (2002) Activation of the interferon-beta promoter during hepatitis C virus RNA replication. Viral Immunol 15, 29-40

46. Kennedy, E. M., Whisnant, A. W., Kornepati, A. V., Marshall, J. B., Bogerd, H. P., and Cullen, B.

R. (2015) Production of functional small interfering RNAs by an amino-terminal deletion mutant http://www.jbc.org/ of human Dicer. Proc Natl Acad Sci U S A 112, E6945-6954

47. Loo, Y. M., Owen, D. M., Li, K., Erickson, A. K., Johnson, C. L., Fish, P. M., Carney, D. S., Wang, T., Ishida, H., Yoneyama, M., Fujita, T., Saito, T., Lee, W. M., Hagedorn, C. H., Lau, D. T.,

Weinman, S. A., Lemon, S. M., and Gale, M., Jr. (2006) Viral and therapeutic control of IFN-beta at Duke University on August 19, 2019 promoter stimulator 1 during hepatitis C virus infection. Proc Natl Acad Sci U S A 103, 6001-6006

48. Miao, Y., Wu, J., and Abraham, S. N. (2016) Ubiquitination of Innate Immune Regulator TRAF3 Orchestrates Expulsion of Intracellular Bacteria by Exocyst Complex. Immunity 45, 94-105

49. Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., and Zhang, F. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823

50. Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308

51. Kent, W. J., Sugnet, C. W., Furey, T. S., Roskin, K. M., Pringle, T. H., Zahler, A. M., and Haussler, D. (2002) The human genome browser at UCSC. Genome Res 12, 996-1006

52. Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelson, T., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G., and Zhang, F. (2014) Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87

53. Rustagi, A., Doehle, B. P., McElrath, M. J., and Gale, M., Jr. (2013) Two new monoclonal antibodies for biochemical and flow cytometric analyses of human interferon regulatory factor-3 activation, turnover, and depletion. Methods 59, 225-232

54. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., Hartenstein, V., Eliceiri, K.,

12 RAB1B positively regulates antiviral innate immunity

Tomancak, P., and Cardona, A. (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682

Downloaded from http://www.jbc.org/ at Duke University on August 19, 2019

13 RAB1B positively regulates antiviral innate immunity

Primer Name Primer Sequence

HA-RAB1B F 5’- GGTGGAATTCATGTACCCATACGACGTCCCAGACTACGCTTAACCCCGAATATGACTACC -3’ HA-RAB1B R 5’- GATCTAGACTATCAGCAACAGCCACC -3’ Myc-TRAF3 F 5’- GGAGGCCCGAATTCGGTCGACCATGGAGTCGAGTAAAAAGATGGACTCTC -3’ Myc-TRAF3 R 5’- GATCCCCGCGGCCGCGGTACCTATCACTCGCTGTAAATGAAGGATTTTGG -3’ My-TRAF2 F 5’- GATCTGAATATGCATACCGGTGCTGCAGCTAGCGTGACC -3’ Myc-TRAF2 R 5’- GAGGCTGATCAGCGGGTTTAAACTTAGAGCCCTGTCAGGTCCAC -3’ Myc-TRAF6 F 5’- GATCTGAATATGCATACCGGTAGTCTGCTAAACTGTGAAAACAG-3’ Myc-TRAF6 R 5’- GAGGCTGATCAGCGGGTTTAAACACTATACCCCTGCATCAGTACTTC -3’ pHCV- 5’- TAATACGACTCACTATAGGCCATCCTGTTTTTTTCCCTTTTTTTTTTTCTTTTTTTT NeoPolyUS TTTTTTTTTTTTTTTTTTTTTTTTTCTCCTTTTTTTTTCCTCTTTTTTTCCTTTTCTTTCCTTT-3’ pHCV- 5’AAAGGAAAGAAAAGGAAAAAAAGAGGAAAAAAAAAGGAGAAAAAAAAAAAAAAAAAAAAAA NeoPolyUA AAAAAAAAAAAAGAAAAAAAAAAAGGGAAAAAAACAGGATGGCCTATAGTGAGTCGTATTA-3’ sgRAB1B-1 F 5’- CACCGGGGGGCTCATGGCATCATCG -3’ sgRAB1B-1 R 5’- AAACCGATGATGCCATGAGCCCCCC-3’ sgRAB1B-2 F 5’- CACCGGTCGACTGGGAGCGACCGAG -3’ Downloaded from sgRAB1B-2 R 5’- AAACCTCGGTCGCTCCCAGTCGACC -3’ sgRAB1B-3 F 5’- CACCGGGGCTCGGGGTTTTGAGCCG -3’ sgRAB1B-3 R 5’- AAACCGGCTCAAAACCCCGAGCCCC -3’ sgSTAT1 F 5’- CACCGATTGATCATCCAGCTGTGAC -3’ http://www.jbc.org/ sgSTAT1 R 5’- AAACGTCACAGCTGGATGATCAAT C -3’ RAB1B E1 F 5’- GAGCGGCCACCATCTTGG -3’ RAB1B E1 R 5’- GCCTGGTAGGACCGATGTCTC -3’ RAB1B E4 F 5’-CTCAGCTGACCTGCTCCTCT-3’ RAB1B E4 R 5’-GGTGCCCAGAAGGTCTACAA-3’ at Duke University on August 19, 2019 STAT1 F 5’- AAGGCTGCCCTGATATGTTG -3’ STAT1 R 5’- GCATAGCAAGGACCTGAACC -3’ GAPDH F 5’- AAGGTGAAGGTCGGAGTCAAC-3’ GAPDH R 5’- GGGGTCATTGATGGCAACAATA -3’ IFNB1 F 5’- CTTTGCTATTTTCAGACAAGATTCA-3’ IFNB1 R 5’- GCCAGGAGGTTCTCAACAAT-3’ RAB1B F 5’- GGACCATCACTTCCAGCTAC-3’ RAB1B R 5’- ACCAGGAGCTTATTGACGTTC-3’ A20 F 5’- TTGTCCTCAGTTTCGGGAGAT-3’ A20 R 5’- ACTTCTCGACACCAGTTGAGTT-3’ Table 1: Primers used for cloning and RT-qPCR.

14 RAB1B positively regulates antiviral innate immunity

Downloaded from

http://www.jbc.org/ Figure 1. RAB1B positively regulates RIG-I pathway signaling to IFN-β. A, IFN-β promoter reporter luciferase expression from 293T cells transfected with indicated plasmids and then Mock- or SenV-infected (16 h). RLU, relative luciferase units. Immunoblot for Flag-RAB1B, SenV, and Tubulin. B-D, RT-qPCR analysis of RNA from 293T (B-C left), Huh7 (C right), or THP1 (D) cells expressing Flag-RAB1B or

Vector and stimulated with SenV (12 h) or a RIG-I agonist (8 h). IFNB1 transcript levels were measured at Duke University on August 19, 2019 relative to GAPDH and normalized to the Vector, Mock condition. RAB1B expression was verified by immunoblot analysis of extracts from paired samples in (A-C) and by RT-qPCR for RAB1B relative to GAPDH in (D). Individual dots represent technical replicates with bars displaying the mean ± SD (n=3) of one of three representative experiments. * P≤0.05, ** P ≤0.01, *** P ≤0.001, by an unpaired Student’s t-test comparing the activated samples.

15 RAB1B positively regulates antiviral innate immunity

Downloaded from

http://www.jbc.org/

Figure 2. RAB1B is required for full induction of IFN-β in response to RIG-I pathway activation by SenV. A, RT-qPCR analysis of IFNB1, relative to GAPDH and normalized to the Vector, Mock sample, in 293T cells treated with control (CTL) or RAB1B siRNAs for 24 h and then Mock- or SenV-infected (8 h), along

with immunoblot analysis for RAB1B expression. B, RT-qPCR analysis for IFNB1, relative to GAPDH and at Duke University on August 19, 2019 normalized to the WT, Mock sample, in WT or RAB1B KO-2 cells infected with SenV (12 h) with immunoblot for RAB1B, SenV, and Tubulin. C, RT-qPCR analysis for IFNB1 and A20, relative to GAPDH and normalized to the WT, Mock sample, in WT or RAB1B KO-1 cells infected with SenV (12 h). D, Immunoblot analysis of WT or RAB1B KO-1 cells that were mock or SenV infected (12 h). E, Focus forming assay of ZIKV focus-forming units (FFU) from supernatants of WT or STAT1 KO Huh7 cells infected with ZIKV (48 hours post infection, MOI 0.01) after transfection of CTL or RAB1B siRNAs (48 h), measured as the percentage of FFU relative to WT cells with siCTL. Immunoblot showing expression of RAB1B, STAT1, and GAPDH. F, Immunoblot analysis of WT or STAT1 KO Huh7 cells treated with IFN-β (18 h). Individual dots represent technical replicates for (A-C) with bars displaying the mean ± SD of one of three representative experiments or biological replicates for (E) with bars displaying the mean ± SEM (n=3). ** P ≤0.01, *** P ≤0.001, ns: not significant, by an unpaired Student’s t-test (A, C, E) comparing SenV samples (A and C) or siRAB1B to siCTL (E) or two-way ANOVA with Tukey’s post hoc (B).

16 RAB1B positively regulates antiviral innate immunity

Downloaded from

Figure 3. RAB1B is required for phosphorylation of IRF3 and TBK1 in response to RIG-I pathway activation by SenV. A-B, Immunoblot analysis of WT and RAB1B KO-1 293T cells that were Mock- or SenV-infected (A, 20 h; B, 6 h). Right panels show quantification of p-IRF3 or p-TBK1 induction, relative to Tubulin, in response to SenV, with the WT condition set to 100%. Individual dots represent biological http://www.jbc.org/ replicates (n = 3-4), with the bars displaying the mean ± SEM. * P≤0.05, ** P ≤0.01, by an unpaired Student’s t-test.

at Duke University on August 19, 2019

17 RAB1B positively regulates antiviral innate immunity

Downloaded from http://www.jbc.org/

Figure 4. RAB1B interacts with TRAF3 during RIG-I signaling. A, Immunoblot analysis of anti-HA immunoprecipitated extracts and whole cell lysates (WCL) from 293T cells expressing HA-RAB1B, Myc- TRAF3, and Flag-RIG-I-N. Representative of three biological replicates. B, Immunoblot analysis of anti- at Duke University on August 19, 2019 HA immunoprecipitated extracts and WCL from 293T cells expressing HA-RAB1B, GFP-TRAF3, and Flag-MAVS. Representative of three biological replicates. C-D, Immunoblot analysis of anti-HA immunoprecipitated extracts and WCL from 293T cells expressing HA-RAB1B with either Myc-TRAF2 (C) or MYC-TRAF6 (D), and Flag-MAVS. Representative of two (C) or four (D) biological replicates. E- F, Immunoblot analysis of anti-MAVS immunoprecipitated (or anti-IgG) extracts and WCL from WT or RAB1B KO-1 293T cells that were Mock- or SenV-infected for the indicated times. Representative of three independent experiments.

18 RAB1B positively regulates antiviral innate immunity

Downloaded from

Figure 5. Model of RAB1B regulation of IFN-β-induction. RNA viruses are sensed in the cytoplasm by http://www.jbc.org/ RIG-I or MDA5 (Step 1). After sensing viral RNA, RIG-I translocates to ER-mitochondrial contact sites at mitochondrial-associated ER membranes where it interacts with MAVS (Step 2). RAB1B, normally involved in ER-Golgi trafficking, then forms a complex with TRAF3 (Step 3) to likely facilitate relocalization of TRAF3 (Step 4), allowing for TRAF3 interaction with MAVS (Step 5). This interaction may be facilitated by re-arrangements in intracellular membranes of the Golgi and/or ER. TRAF3-MAVS at Duke University on August 19, 2019 interaction results in activation and autophosphorylation of TBK1 (Step 6), which then phosphorylates IRF3 (Step 7), resulting in IRF3 dimerization and translocation to the nucleus, where it cooperates with NF-κB to induce IFN-β transcription and the subsequent antiviral response (Step 8).

19 The small GTPase RAB1B promotes antiviral innate immunity by interacting with TNF receptor−associated factor 3 (TRAF3) Dia C. Beachboard, Moonhee Park, Madhuvanthi Vijayan, Daltry L. Snider, Dillon J. Fernando, Graham D. Williams, Sydney Stanley, Michael J. McFadden and Stacy M. Horner J. Biol. Chem. published online August 2, 2019

Access the most updated version of this article at doi: 10.1074/jbc.RA119.007917

Alerts: • When this article is cited

• When a correction for this article is posted Downloaded from

Click here to choose from all of JBC's e-mail alerts http://www.jbc.org/ at Duke University on August 19, 2019