Delineating the Molecular Mechanisms of KIF7 in
Vertebrate Hedgehog Signal Transduction.
By
Yulu Cherry Liu
A thesis submitted in conformity with the requirements for
degree of Doctor of Philosophy
Graduate Department of Pharmaceutical Sciences
University of Toronto
© Copyright by Yulu Cherry Liu 2015
Delineating the molecular mechanisms of KIF7 in vertebrate Hedgehog signal transduction.
Yulu Cherry Liu
Doctor of Philosophy
Graduate Department of Pharmaceutical Sciences University of Toronto
2015
Abstract
The Hedgehog (Hh) signalling pathway plays important roles in embryonic development and for adult tissue homeostasis and regeneration of multi-cellular organisms. Mutations in components of this pathway often result in human developmental disorders and cancer. The primary cilium, a microtubule based extension from the cell surface is required for Hh signalling in vertebrates.
Hh ligand binding to the Patched (Ptch1) receptor leads to the ciliary accumulation and activation of the seven transmembrane protein Smoothened (Smo) and changes the localization of several pathway components within primary cilia subdomains. How Smo activation affects the localization of effector proteins in cilia and how this relates to the activation of target genes is unclear. Genetic and biochemical analysis revealed that the kinesin family protein 7 (Kif7) trafficks to the primary cilia upon pathway activation and fulfills dual positive and negative roles during mouse Hh signalling. Through proteomic and biochemical analysis, we aim to better understand the molecular mechanisms underlying the functions of Kif7 in vertebrate
Hedgehog signalling. Using a mass spectrometry-based proteomic approach, we identified
Liprin-α1 (PPFIA1) and the PP2A phosphatase as Kif7-interacting proteins, and showed that these proteins regulate Kif7 phosphorylation and its activity. We further identified DYRK2 as a
ii protein kinase that phosphorylates Kif7. Overall, our study identified phosphorylation as a post- translational modification that dictates Kif7 localization within primary cilia and its control of
Gli transcriptional activity. Lastly, through biochemical assays we examined the relationship between SuFu and Kif7, two key regulators of the Hh pathway. Collectively, these studies highlight the importance of Kif7 in vertebrate Hh signalling.
iii
Acknowledgments
My doctoral study has been a journey filled with ups and downs. I could not have survived without my wonderful family and friends who have been there every step of the way. I am truly grateful for all their support.
First and foremost, I want to thank my supervisor Dr. Stephane Angers for taking me on as a student even though I had no experience in molecular biology. I thank my committee members, Drs. C-C.Hui, A-C.Gingras, and J.Henderson for their many helpful discussions on my project. In particular, I want to thank members of the Hui lab for all their help over the years. I also want to thank Drs. Amber Couzen, Ian Scott, Ashsih Deshwar, Brenden Hurley and Darrell Desveaux for their collaborations.
Lastly, I want to thank my labmates who have always been there for me. I'm very grateful to, Drs. Avais Daulat, Mukhtar Ahmed, and Melanie Robitaille whom not only taught me all the basic techniques of the lab, but more importantly for their friendship and guidance. Finally, what I will miss most about my time in graduate school will be the friendships forged here. I will always treasure our daily coffee routine, movie nights, trips we took together, and all the silly and wonderful discussions we had. I will miss you guys so much.
iv
Table of Contents
Chapter 1: Introduction
1.1 Hedgehog Signalling Pathway
1.1.1 Overview of Hedgehog signalling
1.1.2 Hedgehog signalling in Drosophila
1.1.3 Hedgehog signalling in vertebrates
1.1.4 Evolutionary differences in Hh signalling
1.1.5 Hedgehog signalling in zebrafish
1.1.6 Hedgehog signalling and developmental disorders
1.1.7 Hedgehog signalling and cancer
1.1.8 Small molecules regulating Hedgehog signalling
1.2 Primary cilium
1.2.1 General introduction
1.2.2 Primary cilium structure
1.2.3 Primary cilium and signalling
1.2.4 Protein trafficking in primary cilium
1.2.5 Ciliopathies
1.2.6 Kinesins and cilia
1.3 KIF7
1.3.1 Kinesins, classification and overall function
1.3.2 Costal-2, the Drosophila homolog of Kif7
v
1.3.3 Kif27, the paralog of Kif7
1.3.4 Kif7 in vertebrate
1.3.4.1. Kif7 structure and motor activity
1.3.4.2. Requirement of cilia for Kif7 function
1.3.4.3. Kif7 knockout mice
1.3.4.4. Kif7 in zebrafish
1.3.4.5. Kif7 and binding partners
1.3.4.6. Kif7 in chondrocytes
1.3.4.7. Kif7 in skin cells
1.3.5 Kif7 in ciliopathies and genetic disorders
1.3.6 Kif7 in other contexts
1.4 PPFIA1
1.4.1 Liprin family, general introduction and function
1.4.2 PPFIA1
1.4.3 PPFIA1 and kinesins
1.4.4 Liprin and phosphatases
1.4.5 Liprin and primary cilia
1.5 Protein Phosphatase 2A (PP2A)
1.5.1 Phosphatase classification and function
1.5.2 PP2A and Hedgehog signalling
1.6 Dual Specific Tyrosine Kinase 2 (DYRK2)
vi
1.6.1 DYRKs general classification and function
1.6.2 DYRK1A and DYRK1B and Hedgehog signalling
1.6.3 DYRK2 and Hedgehog signalling
1.7 Mass spectrometry-based proteomic approach
1.7.1 General introduction
1.7.2 Affinity purification coupled LC-MS/MS work flow
1.7.3 Sample preparation for AP-MS
1.7.4 Data acquisition methods
1.7.5 Multiple Reaction Monitoring (MRM)
1.7.6 Sequential window acquisition of all theoretical spectra (SWATH)
1.8 Objectives of thesis
Chapter 2. Kif7 phosphorylation regulates its ciliary trafficking and Hedgehog signalling
2.1 Abstract
2.2 Introduction
2.3 Experimental procedures
2.3.1 Antibodies and reagents
2.3.2 Tissue culture, transfections, and lentiviral transductions
2.3.3. shRNAs
2.3.4. Plasmids
2.3.5 Generation of C3H10T1/2 knockout cell lines with CRISPR-Cas9 system
2.3.6 RT-PCR and quantitative real-time PCR
vii
2.3.7 Affinity purification, immunoprecipitation, and Western blot analysis
2.3.8 Zebrafish morpholino experiments
2.3.9 Immunofluorescence microscopy and image acquisition
2.3.10 FLAG Affinity purification protocol for mass spectrometry
2.3.11 Mass spectrometry data acquisition and analysis
2.3.12 MRM- Affinity purification for mass spectrometry
2.3.13 MRM- Mass spectrometry data acquisition
2.3.14 SWATH
2.3.15 Statistical analysis
2.4 Results
2.4.1 Kif7 promotes Gli ciliary localization and Hh signalling
2.4.2 Proteomic analysis of Kif7 identifies PPFIA1 and PP2A as novel interactors
2.4.3 PPFIA1 is required for efficient trafficking of Kif7, Gli2 and Gli3 to the tips of
cilia and for Hh signalling
2.4.4 Loss of Kif7 or PPFIA1 results in somite angle defect in zebrafish embryos
2.4.5 The PP2A inhibitor okadaic acid inhibits Kif7 and Gli trafficking in cilia and
blocks Hh signalling
2.4.6 Kif7 de-phosphorylation promotes its localization at the tip of primary cilium and
Hh signalling.
2.4.7 Increased PPFIA- Kif7 association in Kif7 ciliopathy mutant
2.5 Discussion
2.6 Supplementary Data
Chapter 3: DYRK2 regulates Hedgehog signalling through phosphorylation of Kif7
3.1 Abstract viii
3.2 Introduction
3.3 Experimental procedures
3.3.1 Antibodies and reagents
3.3.2 Tissue culture, transfections, and lentiviral transductions
3.3.3 Plasmids
3.3.4 Generation of knockout cell lines with CRISPR-Cas9 system
3.3.5 RT-PCR and quantitative real-time PCR.
3.3.6 Affinity purification, immunoprecipitation, and Western blot analysis
3.3.7 Immunofluorescence microscopy and image acquisition
3.3.8 Statistical analysis
3.4 Results
3.4.1 Kif7 physically interacts with DYRK2
3.4.2 Loss of Dyrk2 promotes Kif7 cilia tips trafficking and Hedgehog signalling
3.4.3 Overexpression of DYRK2 inhibits Kif7 cilia tips trafficking and Hedgehog
signalling
3.4.4 Loss of DYRK2 impairs Kif7 phosphorylation
3.5 Discussion
3.6 Supplementary Data
Chapter 4: Biochemical study of Kif7-SuFu interaction
4.1 Abstract
4.2 Introduction
4.3 Experimental procedures
4.3.1 BioID or proximity labeling mass spectrometry ix
4.3.2 Antibodies and reagents
4.3.3 Plasmids
4.3.4 Tissue culture, transfections, and lentiviral transductions
4.3.5 shRNAs
4.3.6 Generation of knockout cell lines with CRISPR-Cas9 system
4.3.7 RT-PCR and quantitative real-time PCR
4.3.8 Immunofluorescence microscopy and image acquisition
4.3.9 Statistical analysis
4.4 Results
4.4.1 BioID analysis of Kif7 and SuFu
4.4.2 Kif7 is required for accumulation of SuFu at the tips of cilia during Hh signalling
4.4.3 Gain and loss of function of Kif7 in SuFu -/- MEFs
4.5 Discussion
4.6 Supplementary Data
Chapter 5: General discussions and conclusions
5.1 Summary of key findings and significance
5.2 Discussions
5.3 Future directions and perspectives
References
Appendices
Copyright Acknowledgments
x
List of Figures
Figure 1-1. Drosophila Hh signal transduction.
Figure 1-2. Schematic representation of vertebrate Hh signal transduction.
Figure 1-3. Schematic representation of the primary cilium.
Figure 1-4. Kif7 domain structure.
Figure 1-5. Schematic representation of the protein domains of PPFIA1.
Figure 1-6. Model of Liprin-Kinesin interaction.
Figure 1-7. PP2A is a heterotrimer consisting of a structural A subunit, a regulatory B subunit, and a catalytic C subunit.
Figure 1-8. Mass spectrometry work flow.
Figure 2-1. Loss of Kif7 impairs Gli trafficking and Gli1 mRNA induction.
Figure 2-2. Mass spectrometry analysis of Kif7, Gli3, and PPFIA1 protein complexes.
Figure 2-3. PPFIA1 is required for localization of Kif7 and Gli proteins to the tips of cilia and for Hh signalling.
Figure 2-4. Loss of Kif7 or Ppfia1 results in somite angle defects.
Figure 2-5. The protein phosphatase PP2A promotes Hh signalling through control of Kif7 and
Gli proteins localization at the tips of cilia.
Figure 2-6. Kif7 phosphorylation dictates its ciliary tips localization and Hh signalling.
Figure 2-7. Disease causing Kif7 mutations lead to increased interaction of Kif7 with the
PPFIA1-PP2A complex.
Figure 2-8. PPFIA1 and Kif7 interact through their coiled-coil domains.
Figure 2-9. Control experiments for Figure 2-3.
Figure 2-10. Control experiments for Figure 2-6.
xi
Figure. 2-11. SWATH-MS analysis of Kif7 mutants.
Figure 3-1. Kif7 physically interacts with DYRK2.
Figure 3-2. Loss of Dyrk2 promotes Kif7 cilia tips trafficking and Hedgehog signalling
Figure 3-3. Overexpression of DYRK2 inhibits Kif7 cilia tips trafficking and Hedgehog signalling.
Figure 3-4. DYRK2 controls Kif7 phosphorylation.
Figure 3-5. Control experiments for this chapter.
Figure 4-1. BioID analysis of Kif7 and SuFu.
Figure 4-2. Kif7 is required for accumulation of SuFu at the tips of cilia during Hh signalling.
Figure 4-3. Gain and loss of function of Kif7 in SuFu -/- MEFs.
Figure 4-4. Control experiments for this chapter.
Figure 4-5. Full list of SuFu & Kif7 BioID mass spectormetry. Figure 5. Working model.
xii
List of Tables
Table 1. List of KIF7 mutations found in ciliopathies.
Table 2-1. IP-MS/MS high confidence dataset reported in this study.
Table 2-2. List of Kif7 peptides quantified by MRM-HR and their corresponding m/z ratio.
xiii
Appendix
Table S1. List of primers used in this thesis.
xiv
Abbreviations
Hh Hedgehog
Shh Sonic Hedgehog
Ihh Indian Hedgehog
Dhh Desert Hedgehog
Smo Smoothened
SuFu Suppresor of Fused
Fu Fused
Cos2 Costal-2
Ptch1 Patched1
Kif7 Kinesin family 7
Kif27 Kinesin family 27
PPFIA1 Liprin-α1
PPFIA2 Liprin-α2
PPFIA3 Liprin-α3
PPFIA4 Liprin-α4
LAR LAR receptor protein tyrosine phosphatase
OA Okadic acid
NT Non-treated
PP2A protein phosphatase 2A
MRM Multiple reaction monitoring
SWATH Sequential window acquisition of all theoretical fragment ion spectra
AP Affinity purification
xv
MS Mass spectrometry
DIA Data-independent acquisition
DDA Data-dependent acquisition
CAMK2 Calcium/calmodulin-dependent protein kinase II
DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A
DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Ihog Interference Hedgehog
BOI Brother of Ihog
BOC brother of CDO
CDO CAM-related/downregulated by oncogenes
GAS1 Growth arrested 1
xvi 1
Chapter 1 Introduction
1.1 Hedgehog Signalling Pathway
1.1.1 Overview of Hedgehog signalling
The Hedgehog (Hh) signalling pathway plays important roles in the embryonic development of multi-cellular organisms. In adults, the Hh pathway is required for tissue homeostasis and regeneration but is often abnormally activated in diseases (Beachy et al. 2004). The Drosophila hedgehog (hh) gene was first discovered from genetic mutations studies in Drosophila embryogenesis. It was found to be one of several genes important for body segmentation in flies. The Drosophila gene was named after the mutant larval phenotype which resembled a hedgehog (Nusslein-Volhard and Wieschaus 1980). Three vertebrate Hedgehog genes, Indian Hh (Ihh ), Desert Hh (Dhh) and Sonic Hh (Shh) were identified years later to have conserved role in body organization. Hh proteins are morphogens that form a concentration gradient to direct tissue patterning. Their general physiological functions are the same but they differ in their pattern of expression. Ihh is important for bone and cartilage development, while Dhh is important for germ cell development in the testis and peripheral nerve sheath formation. Shh is the most studied and best characterized gene of this family. It is important for the specification of neuronal identities along the dorsal-ventral axis in the neural tube, as well as for the proper patterning of limbs (Briscoe and Therond 2013). Disruption of the Hh signalling cascade leads to neural tube development disorders, limb malformations, as well as tumourigenesis (Jacob and Briscoe 2003, Motoyama 2006). For example, the Hh pathway is mutationally activated in almost all basal cell carcinomas (BCC) and in the Shh subtype of medulloblastoma. Recent reports have also shown the importance of the tumour microenvironment and paracrine Hh signalling in promoting tumourigenesis in endodermal tissues (Beachy, Karhadkar et al. 2004, Yauch et al. 2008).
2
1.1.2 Hedgehog signalling in Drosophila
In Drosophila embryos, Hh signalling is required for the patterning of several tissues. Misregulation of Hh signalling leads to the duplication of segmental boundaries and mis- patterning of wing discs (Briscoe and Therond 2013, Hartl and Scott 2014). The intracellular signalling events triggered following Hh binding to its receptor leading to target gene activation are integral to the cellular response. The hh gene encodes a 45-kDa protein that undergoes autocatalytic cleavage and modification to give a 20-kDa, active N-terminal fragment covalently bound to cholesterol and a palmitoyl adduct (Briscoe and Therond 2013). Post-translational modifications of Hh proteins are necessary for their secretion from cells and for their function as morphogens (Briscoe and Therond 2013). Hh binds to the 12-transmembrane protein Patched (Ptch), and to the single transmembrane co-receptors Interference Hedgehog (Ihog) and Brother of Ihog (Boi) to initiate intracellular signalling (Yao et al. 2006, Camp et al. 2010). In addition, Hh also interacts with glypicans, such as Dally-like to promote signalling but the mechanism of this interaction is unclear (Yan and Lin 2009). In the resting state, Ptch restricts the activity of seven transmembrane protein Smoothened (Smo) by inhibiting its phosphorylation and promoting its endocytosis and degradation. The kinesin-like protein Costal 2 (Cos2) acts as a scaffolding protein in the cytoplasm to recruit PKA, GSK3, and CKI to Cubitus Interuptus (Ci) (155kDa), a zinc finger protein recognized as the main transcriptional effector of the pathway. Recruitment of kinases to Ci leads to the phosphorylation of multiple sites within its carboxy terminus. When highly phosphorylated, Ci is recognized by the E3 ubiquitin ligase Slimb leading to its partial degradation to generate Ci R a truncated (75kDa) transcriptional repressor form (Figure 1-1 left). During the activation of the pathway, Hh secreted from producing cells binds to its cognate Ptch receptor on the surface of responding cells. This leads to the phosphorylation of Smo on several serine residues within its carboxy terminal tail that results in conformational changes promoting its membrane localization. This phosphorylation of Smo by PKA, CK1, and GRK2 (Gprk2) kinases enhances its association with Cos2 and thereby leads to its sequestration away from Ci. This change in localization of Cos2 inhibits the processing of Ci by the proteasome and allows Ci to become a transcriptional activator Ci A (Figure 1-1 right). Ci A is unstable, and is degraded post-transcriptionally by Hh-induced MATH and BTB protein (Hib) a nuclear Cul3 E3 ubiquitin ligase (Zhang et al. 2006, Briscoe and Therond 2013). The cellular integration of an extracellular Hh gradient into an intracellular Ci gradient establishes
3 distinct cell fates. In Drosophila , SuFu negatively regulates signalling by tethering full length Ci in the cytoplasm and participating in Ci R formation. In contrast, the serine/threonine kinase Fused (Fu) is important for high level of Hh signalling and acts to antagonize SuFu (Methot and Basler 2000, Lefers et al. 2001, Ruel et al. 2007, Aikin et al. 2008).
O Hh On Plasma Hh membrane Ihog Boi Ihog Boi Glypican Ptc Glypican Ptc Gprk2 Microtubules P Smo Pka P Pka Cos2 CkIα Smo Hh P CkIα Fu Gsk3β Cos2 SuFu Ci Fu P P P SuFu Ci Degradation Proteolytic Degradation processing CiA CiR
Nucleus Nucleus Figure 1-1. Drosophila Hh signal transduction. In Drosophila , the transmembrane proteins Interference Hedgehog (Ihog) and Brother of Ihog (Boi) promote Hedgehog (Hh)–Patched (Ptc) binding. Hh also interacts with glypicans. Ligand-free Ptc represses Smo by triggering its rapid degradation and/or its confinement to an intracellular compartment (left panel, ‘off’). Furthermore, in the absence of Hh, Costal 2 (Cos2), Fused (Fu), Suppressor of Fu (SuFu) and Cubitus interruptus (Ci) form a complex in association with microtubules. This complex promotes, through the activity of protein kinase A (PKA), casein kinase I α (CkI α) and glycogen synthase kinase 3 β (GSK3 β), the formation of the Ci repressor form (Ci R). Binding of Hh to Ptc relieves Smo repression. Smo translocates to the membrane and is activated by phosphorylation on its carboxy terminal tail, by PKA, CkI α and G protein-coupled receptor kinase 2 (Gprk2), which induces a conformational change compatible with plasma membrane localization. Smo phosphorylation also promotes its association with the Cos2-Fu-SuFu protein complex and results in the sequential activation of Fu and Cos2, which leads to activation of full length Ci A. Adopted from Briscoe & Thérond 2013 Rev Mol Cell Biol.
4
1.1.3 Hedgehog signalling in vertebrates
Of the three Hh vertebrate genes, Shh is the most broadly expressed and best studied. Deletion of Shh leads to defects in neural tube and limb patterning (Chiang et al. 1996, Litingtung et al. 1998, Pepicelli et al. 1998). One important difference for vertebrate Hh signalling is the requirement of primary cilia. The primary cilium is a microtubule based non-motile protrusion from the cell membrane. The structure and roles of primary cilia in Hh signalling will be explained in more details in the next section. In the absence of Hh ligand, the pathway is inactive and the receptor Ptch1 localizes within primary cilia where it actively represses the accumulation of Smo (Rohatgi et al. 2007). Upon Hh binding to Ptch1 on the receiving cells, Ptch1 is activated and de-represses Smo. This de-repression results in Smo translocation into the primary cilia hereby initiating a signal transduction cascade that leads to the activation of Gli family of transcription factors, the homolog of Drosophila Ci (Corbit et al. 2005). In addition to Ptch1, Fibronectin type III and immunoglobulin repeat-containing surface proteins BOC and CDO ( Drosophila homologues of iHog and Cdo, respectively), and the GPI-linked cell surface protein Gas1 are Hh co-receptors that act together to bind Hh on receiving cells (Briscoe and Therond 2013). There are three members in the Gli family proteins in vertebrates: Gli1, Gli2 and Gli3. Gli1 functions primarily as a transcriptional activator (Aza-Blanc et al. 2000, Bai and Joyner 2001). Since Gli1 is also a universal target gene of the pathway, it functions in a positive feedback loop amplifying the transcriptional response. In contrasts, Gli2 and Gli3 exist in two forms: a full-length (190kDa) activator (Gli A) and a truncated (85kDa) transcriptional repressor (Gli R) that lacks the C-terminal activation domain. In most contexts, Gli2 is the main transcriptional activator and Gli3 is the main transcriptional repressor (Wang et al. 2000). The repressor activity of Gli3 is especially important in embryonic patterning of the neural tube and limbs (Jiang and Hui 2008). In the development of limb buds, Gli3 R exhibits an anterior- posterior gradient inversely proportional to Shh levels, which suggests that regulation of Gli3 processing into Gli3 R is a direct readout of dose-dependent signalling by Shh. In the neural tube, Gli3 is also critical to establish a double Gli gradient with opposite polarities of activators (high to low from ventral to dorsal) and repressors (high to low from dorsal to ventral) to regulate sets of Shh responsive genes important for the specification of individual neural subtypes (Jiang and Hui 2008, Briscoe and Therond 2013). Overall, three vertebrate Gli transcription factors act
5 together in responding cells to integrate Hh signalling inputs, resulting in the regulation of tissue pattern, size and shape (Ruiz i Altaba et al. 2007, Wang et al. 2007, Hui and Angers 2011). The exact mechanism of how Smo leads to inhibition of Gli processing and promotes their activation remains poorly understood. Recent studies have shown that during pathway activation, Smo triggers the dissociation of SuFu from Gli in the primary cilia (Humke et al. 2010, Tukachinsky et al. 2010). The dissociation of SuFu from Gli proteins prevents the formation of Gli R. Additionally, SuFu also plays important roles in the absence of Hh ligand when the pathway is in its resting state. SuFu restricts Gli3 in the cytoplasm and promotes its processing by multiple kinases (PKA, CKI, and GSK3 β) (Humke, Dorn et al. 2010). Extensive sequential phosphorylation of serines by these kinases on the C-terminus of Gli3 is recognized and bound by the E3 ubiquitin ligase component beta-TrCP. The binding of beta-TrCP leads to ubiquitination of Gli3. Similar to Ci, Gli3 is not fully degraded but instead is specifically processed and cleaved by the proteasome. The mechanism of partial proteolysis is poorly understood, but results in the degradation of the C-terminal activation domain to form a potent transcriptional repressor (Wang, Fallon et al. 2000, Pan and Wang 2007). Activation of the Hh pathway inhibits beta-TrCP binding, thus preventing ubiquitination and proteolysis of the full length Gli3 protein (Tempe et al. 2006, Wang and Li 2006). The Gli A translocates to the nucleus and activates the transcription of several target genes including Gli1 , for positive feedback or Ptch1 for negative feedback signalling events. Another target gene Hhip (Hh-interacting protein), is a transmembrane protein that functions within a negative regulatory feedback loop to attenuate signalling by binding and restricting the diffusion of Hh proteins (Chuang and McMahon 1999). When Gli A is in the nucleus it is not stable and subjected to ubiquitin- mediated degradation by the proteasome through SPOP, a subunit of an E3-ubiquitin ligase and mammalian homolog of Drosophila hib (Figure 1-2) (Zhang, Zhang et al. 2006, Chen et al. 2009).
1.1.4 Evolutionary differences in Hh signalling Although the requirement for Hh signalling is conserved in all multicellular organisms, the molecular mechanisms underlying the intracellular signalling pathways differ between Drosophila and mice (Aikin, Ayers et al. 2008). Main differences lie in the functions of Smo, Fu and SuFu. The differences in signalling might in part be attributed to the specific requirement of
6 primary cilia for Hh signalling in vertebrates. Firstly, unlike dSmo ( Drosophila Smoothened), which is phosphorylated by PKA and CK1, vertebrate Smo does not have conserved PKA and CKI phosphorylation sites. Rather, vertebrate Smo is phosphorylated by G-protein-coupled receptor kinase 2 (GRK2 or Gprk2) (Chen et al. 2004). Furthermore the small molecule antagonist cyclopamine inhibits vertebrate Smo activity but is ineffective in blocking dSmo(Chen et al. 2002). This suggests important differences between the mechanism of action of Drosophila and vertebrate Smo. Secondly, the kinase Fu, which is an important negative regulator of Hh signalling in flies, is dispensable for vertebrate Hh signalling. Knockout of Stk36 , the mouse homolog of Fu, exhibits no Hh signalling defects (Chen et al. 2005, Merchant et al. 2005). However, careful examination of the Stk36 -/- animals unveiled that Fu is important for motile cilia formation (Wilson et al. 2009). Lastly, whereas SuFu is dispensable for Drosphila Hh signalling (Cooper et al. 2005), its function is required for mouse Hh signalling. Loss of SuFu in vertebrates leads to ectopic activation of the pathway and to strong Hh defects similar to phenotypes observed in Ptch1 deficient animals. Overall, in Drosophila the complex of Fu-Cos2 plays important role in regulating Ci processing, whereas in mice it is the complex of SuFu-Kif7 that regulates Gli processing and activity. Although the functional relationship between SuFu and Kif7 remains poorly understood, current evidence suggests that Kif7 is important for Gli R formation under resting conditions and functions to antagonize SuFu during pathway activation. Kif7 functions will be discussed in more details in later sections.
7
Figure 1-2. Schematic representations of vertebrate Hh signal transduction. In the pathway OFF state, without ligand binding to Ptch1 receptor, Ptch1 inhibits the ciliary accumulation of Smo, this results in cytoplasmic retention of Gli proteins by SuFu and sequential phosphorylation of Glis by multiple kinases. Phosphorylated Glis are then partially degraded by the proteasome forming Gli R that translocates to the nucleus and represses Hh-dependent transcription. In the pathway ON state, Shh ligand binds to Ptch1, which releases its inhibition on Smo, allowing Smo to accumulate in cilia. Pathway activation also leads to accumulation of Kif7, SuFu and Gli at ciliary tips. However, during pathway activation Gli dissociates from SuFu within the cilia, becoming Gli A and translocates to the nucleus to activate Hh-dependent target genes. Nuclear Glis are eventually degraded by the proteasome through Spop-mediated ubiquitination.
8
1.1.5 Hedgehog signalling in zebrafish
In zebrafish, Hh signalling is best characterized in the context of neural tube and muscle development (Stickney et al. 2000, Ochi and Westerfield 2007). During myotome development, Shh signalling is required to specify the fate of individual cells in the myotome. High level of Shh signalling is required to form muscle pioneer cells, a slow twitch muscle cell type, while lower concentrations of Shh specify the non-pioneer slow twitch muscle fibers. Defects in Shh signalling during myotome development lead to characteristic U-shaped somites instead of the normal chevron-shaped somites. Somites are segmented mesodermal muscle and bone precursors boundaries. Defects in somite angle and shape are an indication of defect in muscle pioneer migration and consequently developmental delays. These phenotypes are observed in zebrafish loss of function mutant of shh , smo , gli2 , and ptch1 (van Eeden et al. 1996, Karlstrom et al. 1999, Barresi et al. 2000, Kawakami et al. 2005, Woods and Talbot 2005, Hollway et al. 2006). In term of signal transduction, zebrafish Hh signalling shares similarities with both Drosophila and mouse Hh signalling, with the expectation that there are five Hh genes: Shh A , Shh B , Ihh A , Ihh B , Dhh in fish. The basic pathway components and mechanisms of pathway activation are also conserved in zebrafish, from ligand binding to Ptch receptor to Smo translocation in cilia and activation of Gli proteins. Zebrafish Shh signalling therefore requires primary cilia and SuFu (also required in mouse), as well as Fu (required in Drosophila ) for maximum signalling (Wolff et al. 2003). Despite core components of Hh signalling being conserved in zebrafish, differences between fish and mouse have been observed. For example Gli1 rather than Gli2 is the principal activator of Hh signalling in early zebrafish embryos (Karlstrom et al. 2003). Hence gli1 is not only expressed as a function of pathway activation as it is observed in other cells from other vertebrate animals (Karlstrom, Tyurina et al. 2003, Ninkovic et al. 2008). A recent genetic study has also revealed important functions of Kif7 in zebrafish Hh signalling (Maurya et al. 2013). This will be discussed in details in later sections.
1.1.6 Hedgehog signalling and developmental disorders
Loss of Hh signalling activity during vertebrate embryogenesis leads to multiple developmental disorders including holoprosencephaly (HPE), polydactyly, craniofacial defects, and skeletal malformations (Muenke and Beachy 2000, McMahon et al. 2003, Zhang et al. 2006, Sweeney et
9 al. 2014). In HPE, mutations have been found in SHH (Nanni et al. 1999), PTCH1 (Ming et al. 2002), and GLI2 (Roessler et al. 2003). For example patients with SHH loss of function mutations exhibit abnormal development of the forebrain. HPE included phenotypes ranging from pituitary abnormalities, polydactyly, craniofacial defects to skeletal malformations. Furthermore, mutations in GLI3 have been found in disorders associated with congenital malformations such as Greig cephalopolysyndactyly, Pallister–Hall syndrome, postaxial polydactyly type-A, autosomal dominant preaxial polydactyly type-IV, and acrocallosal syndrome(Nieuwenhuis and Hui 2005). All these patients exhibit a common phenotype of digit malformation. Lastly, Gorlin syndrome also known as Nevoid basal cell carcinoma syndrome (NBCC) is an autosomal dominant disorder with germline mutation in PTCH1 . Patients carrying this mutation are pre-disposed to develop basal cell carcinoma (BCC), other tumours, as well as congenital anomalies of the brain and skeletal system (Johnson et al. 1996, Wicking and Bale 1997, Ming et al. 1998). These developmental disorders further highlight the importance of Hh signalling for embryonic development and adult tissue homeostasis.
1.1.7 Hedgehog signalling and cancer
Inappropriate activation of Hh pathway can lead to various cancers. Hh signalling related cancers can be divided between cancers with mutations in pathway components and cancers with deregulated Hh signalling through paracrine/autocrine mechanisms. Firstly, mutations within Hh pathway components that result in cell autonomous ligand-independent activation of the pathway have been found in basal cell carcinomas (BCC), Shh-subtype of medulloblastomas, and rhabdomyosarcomas (Gailani et al. 1996, Goodrich et al. 1997, Xie et al. 1998, Kappler et al. 2004, Yang et al. 2008). In BCC, 90% of patients have loss-of-function mutation in PTCH1 (Unden et al. 1996) or gain-of-function mutation in SMO (Xie, Murone et al. 1998), whereas in medulloblastomas, mutations in PTCH1 (Raffel et al. 1997), SMO (Yauch et al. 2009), and SUFU (Taylor et al. 2002) have been identified. In all cases, mutations result in hyperactivation of the pathway and uncontrolled proliferation of progenitor cells (Petrova and Joyner 2014). However, in cancers with increased Hh signalling (autocrine or paracrine) there is ligand-dependent deregulation of Hh pathway activity. This has been observed in various cancers such as lung, stomach, esophagus, pancreas, prostate, breast, liver and brain (Berman et al. 2003, Thayer et al. 2003, Watkins et al. 2003, Karhadkar et al. 2004, Kubo et al. 2004,
10
Sicklick et al. 2006, Clement et al. 2007). Several of these tumours have elevated expression of Hh ligands and/or ectopic Glis expression without apparent mutation within pathway components. Dysregulation in autocrine/paracrine Hh signalling that contributes to tumour growth can be suppressed by pathway inhibitors. Paracrine Hh signalling appears to play an especially important role in endodermal cancers. In this setting, tumour cells activate Hh signalling in the surrounding stroma, resulting in the expression of soluble factors and extracellular matrix components that, in turns, act upon the tumour epithelium to promote tumour growth (Yang, Ellis et al. 2008, Theunissen and de Sauvage 2009). Understanding Hh secretion and activation in a given tumour microenvironment is critical for the rational design of new therapies. Overall, Hh signalling plays important role in adult life and misregulation of the pathway can give rise to tumours.
1.1.8 Small molecules regulating Hedgehog signalling
Given the implication of Hh pathway in human diseases such as cancer, there has been vast interest in identifying small molecule modulators of the pathway. The first compounds identified to regulate the Hh pathway were the naturally occurring alkaloids, cyclopamine and jervine extracted from the plant Veratrum californicum. These compounds function by inhibiting the activity of Smo, but they have poor pharmacokinetics properties (Taipale et al. 2000, Chen et al. 2002). Further screening campaigns to identify Smo inhibitors identified several classes of antagonists, including cyclopamine analogs as well as other inhibitors that bind to different Smo binding sites. The structural similarity between cyclopamine and sterols led to the further findings that sterols like oxysterols can modulate Smo activity (Nachtergaele et al. 2012, Myers et al. 2013, Nachtergaele et al. 2013, Nedelcu et al. 2013). Currently, only one Smo inhibitor GDC-449/Vismodgib is FDA approved for the treatment of advanced BCC (Von Hoff et al. 2009, Sekulic et al. 2012). Vismodegib and other Smo inhibitors are still in different clinical trials for the treatments of other Hh-related cancers. However, resistance to Smo inhibitors rapidly arises (Yauch, Dijkgraaf et al. 2009) and efforts to develop Smo inhibitors with different mode of actions or drugs targeting downstream pathway components are underway. GANT-58 and GANT-61 for example have shown to be inhibitors of Gli activity in cell-based assays (Lauth et al. 2007).
11
1.2 Primary cilium
1.2.1 General introduction The primary cilium is a microtubule-based protrusion emanating from the plasma membrane of most eukaryotic cells during interphase. There are two types of cilia, motile and non-motile cilia. Motile cilia are better studied, they are important for fluid flow, mechanosensing and motility. Non-motile cilia, on the other hand, are less characterized. Non-motile cilia were first observed by Zimmerman in 1898 (Zimmermann 1898), and was later termed primary cilia in 1968 by Sorokin (Sorokin 1968) because the primary cilium was the first "cilium" to form in a cell. For the longest time, primary cilium was believed to be vestigial organelle with no important biological roles (Garcia-Gonzalo and Reiter 2012). However, research from the past 10 years has highlighted the importance of primary cilia for cell signalling, cell cycle entry, migration and differentiation during development. Specifically, they are important for chemosensing in olfactory neurons, photo-sensing in rods and cones, and mechanosensing in renal epithelia. Defects in cilia proteins or cilia structure contribute to ciliopathies, a group of genetic disorders with multi-organ defects (Quinlan et al. 2008, Hildebrandt et al. 2011). How such a small organelle came to be so important for signalling and development is only starting to be understood.
1.2.2 Primary cilium structure Primary cilium originates from the basal body derived from the mother centriole, and is enclosed in ciliary membrane, a bilayer lipid membrane that is continuous with the plasma membrane of the cell. Ciliogenesis starts with the docking of basal body to the plasma membrane. Vesicles containing structural proteins dock at the basal body and move toward the distal tip of the cilium where axoneme elongation occurs. The axoneme is a microtubule-based cytoskeletal structure that is enclosed by the ciliary membrane. Within cilia, microtubules orient with their plus-ends pointing in the direction of the cilium tip. The basal body anchors the minus ends of microtubules and connects the axoneme to the rest of the cell (Kozminski et al. 1993, Scholey 2008). A mature cilium is made of 9 pairs of peripheral microtubules without a central pair, forming a 9+0 axoneme structure. This is different from motile cilium that are of 9+2 in structure, with a central pair of microtubule. Structurally, the primary cilium is comprised of 2 large intraflagellar transport complexes, (IFT) A and B. IFT proteins transport cargos along the
12 axoneme. Heterotrimeric microtubule motor kinesin II (KIF3) family of proteins facilitates anterograde (toward the tip) transport in association with IFT-B, whereas dynein mediates retrograde transport (toward the basal body) with IFT-A. Disruption of kinesin II eliminates the primary cilium, resulting in diverse developmental and cell signalling defects (Huangfu and Anderson 2005, Liu et al. 2005, Houde et al. 2006, Ocbina and Anderson 2008). Mutations in proteins implicated in retrograde transport such as dynein result in abnormal stumpy cilia with ciliary proteins accumulating at the tip of the cilium including proteins involved in Hedgehog signalling (Huangfu and Anderson 2005, May et al. 2005). This indicates that Hh pathway components are dynamically transported in primary cilia. Recent work has further identified a compartment near the base of the cilium, termed the transition zone (TZ) as an important region for ciliary gating and signalling. TZ is the region between the basal body and the axoneme, it is composed of transition fibers, ciliary necklace, and Y-fibers (Figure 1-3). The TZ houses multiple protein complexes that are implicated in ciliopathies, such as the Meckel– Nephronophthisis-Joubert syndrome complexes (Garcia-Gonzalo et al. 2011, Novarino et al. 2011, Chih et al. 2012, Czarnecki and Shah 2012). Lastly, the ciliary tip is a specialized segment of membrane that extends from the axoneme that appears to have specific signalling roles, in particular in Hh signalling.
‘Ciliary gate’
Basal body Transition zone Evc zone
Ciliary membrane Plasma membrane
Distal tip
Axoneme
Ciliary necklace Transition fibers Y-shaped link Figure 1-3. Schematic representation of the primary cilium. Modified from Reiter, Blacque, Leroux EMBO reports 2012.
13
1.2.3 Primary cilium and signalling
In 2003, Kathryn Anderson’s lab published results of a forward genetic screen in mouse that identified several mutations within cilia genes leading to phenotypes consistent with defective Hh signalling (Huangfu et al. 2003). This was the first study to implicate primary cilia in Hh signalling. Four mutants, wimple ( Ift172 ), Polaris ( Ift88 ), Kif3A , and Dhc2 were identified with characteristics of Shh signalling defects (neural tube and limb defects and changes in Gli transcriptional activity) and impairment in the formation of primary cilia (Huangfu, Liu et al. 2003). This study led to the realization that primary cilia could be important for vertebrate Hh signalling. Further studies showed that several Hh pathway components including Ptch1, Smo, SuFu, Kif7, Gli2 and Gli3 localize or accumulate in and out of cilia during signalling and that this is important for the control of pathway activity. Additional research established that Ptch1 localizes to cilia in the absence of Hh ligand and moves out of cilia after ligand binding(Rohatgi, Milenkovic et al. 2007). In contrast, upon pathway activation, Smo, SuFu, Kif7, and Glis are enriched in the cilium. A recent study has also demonstrated that the balance between anterograde and retrograde movement controls the overall ciliary architecture, which in turn controls proper Shh signalling (Ocbina et al. 2011). However, the exact role of the primary cilium and ciliary proteins in Gli processing and Hh signal transduction is still unclear but current data suggests that cilia act as a signalling centre where Hh proteins concentrate and interact to integrate the downstream signalling response. Since the publication of the landmark paper from the Anderson lab, other signalling pathways have been found to involve cilia such as Notch and Wnt signalling (Ross et al. 2005, Gerdes et al. 2007, Corbit et al. 2008, Ferrante et al. 2009), and platelet-derived growth factor signalling (Schneider et al. 2005). GPCRs such as Rhodopsin have long been known to localize in cilia of photoreceptors. Other GPCRs like, Somatostatin receptor 3 (SSTR3), melanin-concentrating hormone receptor 1(Mchr1), and serotonin subtype 6 receptor (5HTR6) localize to the cilia in neurons (Handel et al. 1999, Brailov et al. 2000, Berbari et al. 2008). These GPCRs play a role in hormonal regulation and feeding behaviors. Defects in cilia structure results in mis-localization and function of these proteins which often leads to obesity related disorders (Hildebrandt, Benzing et al. 2011).
14
Recently, orphan GPCR, Gpr161 was shown to localize in cilia and to play roles in Hh signalling (Mukhopadhyay et al. 2013). Similarly, Gpr39, was identified in a screen for chemical inhibitors of the Hh pathway, and was found to act downstream of Smo to inhibit Gli activity (Bassilana et al. 2014). Overall, primary cilia are essential for proper Hh signalling in vertebrates.
1.2.4 Protein trafficking in cilia Given that there is no protein synthesis within the cilia, all ciliary proteins are translocated to the cilia. The transition zone functions in part as a gate for recognition of ciliary proteins. In general, there are three ways proteins can enter the cilia. First, small proteins (<60kD) can enter through diffusion, whereas larger proteins are kept out because of size limitation (Kee et al. 2012). The ciliary diffusion barrier was found to behave like a molecular sieve that regulates entry of proteins based on size. Second, membrane protein can enter the cilia through lateral diffusion from plasma membrane to ciliary membrane. Smo was found to enter the cilia in part through lateral diffusion (Milenkovic et al. 2009). Third, larger protein with the correct ciliary localization sequence (CLS) traffic into the cilia via transporter proteins such as IFTs. IFT complexes with the cargo destined for the cilium localize at the base of the cilium where they connect with ciliary motor proteins. Only cargos with CLS are targeted into the cilia. Although no universal CLS exists, few common CLS have been identified. For example polycystin-2, a ciliary protein mutated in polycystic kidney disease (Geng et al. 2006), has an amino terminal RVxP motif whereas the GPCR Rhodopsin (Tam et al. 2000) has a c-terminal VxPx sequence that were characterized as CLS. Other GPCRs (SSTR3, 5HTR6, and Mchr1) localizing to cilia in neurons have AxS/AxQ motifs that is required for ciliary trafficking (Berbari, Johnson et al. 2008). The recently identified orphan GPCR GPR161 also localizes to cilia and a CLS within its third intracellular loop, (I/V)KARK, that was previously identified in other GPCRs was found to be important (Berbari, Johnson et al. 2008). Smo on the other hand has a conserved FR motif in the c-terminal cytoplasmic region that was characterized as a CLS (Corbit, Aanstad et al. 2005). Similarly, FR motifs have also been reported to mediate cilia localization of other GPCRs (Dwyer et al. 2001, Corbit, Aanstad et al. 2005). Lastly, nuclear localization motifs have also been recognized as another class of ciliary localization signal in other contexts (Dishinger et al.
15
2010). Kinesin-17 (Kif17) for instance requires the classical nuclear localization signal KRKK for ciliary localization. When mutated within this sequence, Kif17 fails to localize in the cilia. Interestingly, a Ran-GTP gradient known to control nuclear import similarly acts in a gating mechanism for ciliary proteins (Kee, Dishinger et al. 2012). Several distinct mechanisms have thus been uncovered to direct localization of proteins to cilia.
1.2.5 Ciliopathies Ciliopathies comprise a group of polygenic disorders that result from defects in cilia ontogeny or function. Examples of ciliopathies include Bardet-Biedl syndrome (BBS), Meckel-Gruber syndrome (MKS), Joubert syndrome (JBTS) and Ellis-van Creveld syndrome (Evc). BBS is characterized by obesity, retino-degeneration, renal abnormalities, polydactyly and cognitive impairment. In BBS, patients have mutations within genes coding for proteins belonging to a protein complex called the BBSome. To date, 12 BBSome proteins (BBS1-12) have been identified. Some BBS (e.g. BBS1 and BBS3) proteins localize to the basal body and are implicated in trafficking cargo to the ciliary base (Su et al. 2014). In MKS, patients exhibit occipital encephalocele, kidney cysts and polydactyly. MKS is considered one of the more severe ciliopathies and involves genes implicated in TZ function and ciliogenesis. In JBTS, patients exhibit cerebellar and brainstem malformations, ataxia, cognitive impairment, renal and retinal symptoms (Hildebrandt, Benzing et al. 2011). Mutations in KIF7 have been identified in JBTS patients (Dafinger et al. 2011). Lastly, Evc patients have mutation in EVC/EVC2 proteins. Evc proteins localize in a region distal to the TZ, termed the Evc-zone. Evc proteins are positive regulator of Hh signalling, they are required for proper Smo localization in the Evc zone. Mutated forms of EVC/EVC2 found in patients act as dominant negative proteins, disrupt normal Hh signalling and consequently lead to a subset of Hh-dependent ciliopathy phenotypes, most prominently skeletal abnormalities (Dorn et al. 2012, Yang et al. 2012, Caparros-Martin et al. 2013). Overall, ciliopathies exhibit extensive allelism and pleiotropy. Different recessive mutations in many different ciliopathy genes cause a wide spectrum of phenotypes, from renal cysts, retinal degeneration, and mental retardation to polydactyly. Severity of ciliopathy depends on whether ciliogenesis is affected or not. Disease is more severe if cilia architecture is impaired. Defects in cilia indirectly affects Hh signalling, hence, a subset of disease phenotypes
16 are due to defective Hh signalling. More on Kif7 and ciliopathy will be discussed in later sections.
1.2.6 Kinesins and cilia Kinesin motor proteins such as Kif7, Kif3, Kif17, and Kif19 have been found to contribute to cilia structure and trafficking. Kinesins in general and Kif7 more specifically will be covered extensively in the next section. First, Kif3 is part of the kinesin-2 family, are heterotrimeric kinesin comprised of Kif3A, Kif3B, and KAP3. Kif3s are the only known kinesins to heterodimerize to form a functioning complex. Kif3A and B have NH2 ‐terminal motor domain and form a complex with the non ‐motor protein KAP3 . Kif3 functions with IFT-B complex in anterograde trafficking in the primary cilia (Reiter et al. 2012, Bhogaraju et al. 2013). Kif17 is also part of the kinesin-2 family, but it is a homodimeric motor protein. It was first found to be involved in the transport of cargos (cyclic nucleotide-gated channels, NMDA receptor subunit 2B) in the cilia of sensory neurons (Jenkins et al. 2006). Kif17 has further been shown to function as a ciliary motor in zebrafish photoreceptors and mammalian olfactory sensory neurons (Jenkins, Hurd et al. 2006, Insinna et al. 2008, Insinna et al. 2009). Kif17 is not needed for ciliogenesis or cilia structure maintenance. Lastly, Kif19, which is part of the kinesin-8 family, was recently showed to localize to the tips of cilia and function as a microtubule depolymerizing kinesin involved in ciliary length control (Niwa et al. 2012). Overall, it has long been recognized that kinesins play important roles in cellular function, however their roles in primary cilia is just starting to be understood. More research is needed to examine if other kinesins localize and/or contribute to primary cilia functions.
1.3 KIF7
1.3.1 Kinesins, classification and overall function The Kinesin (KIF) family of motor proteins is an essential part of cellular transport. In mammals, there are more than 40 KIF genes (Miki et al. 2005, Hirokawa et al. 2009) categorized in 15 families based on sequence alignment (Miki, Okada et al. 2005). Structurally, kinesins typically have a globular kinesin motor/head domain for ATP-dependent hydrolysis and microtubule binding, a neck/stalk region that allows for flexibility of the motor domain and plays a role in directionality. Lastly, the tail region is composed of 2 coiled-coil helices where
17 cargos typically bind. The motor domain is highly conserved within each kinesin family, whereas the neck and tail regions are highly diverse, likely to accommodate various cargos in several intracellular processes. Kinesins convert chemical energy to mechanical work by coupling ATP binding and hydrolysis to conformational changes in order to transport cargo along microtubules (Hirokawa, Noda et al. 2009). Many kinesins function as homo-dimer, with the motor domain serving as the site of homo-dimerization, or heterodimerization as in the case of Kif3 (Kif3A dimerizes with Kif3B). Most Kinesins have their motor domain at the N- terminus and have microtubule plus end directed motility (e.g. Kif3, Kif7). However some kinesins, such as c-kinesins, Kif1C, have motor domain on the C-terminus and moves toward the microtubule minus end. Furthermore, kinesins are phospho-proteins, where phosphorylation dictates the ability of kinesin to associate or dissociate with their cargos or regulate their binding to microtubules (Hirokawa, Noda et al. 2009). For example Kif17, which localizes in primary cilia, is phosphorylated by Calcium/calmodulin-dependent protein kinase II (CaMKII). In this case, phosphorylation disrupts the binding of Kif17 from an adaptor protein leading to release of cargo vesicles (Guillaud et al. 2008). Recently, Liang et al showed that in Chlamydomonas , the KIF3B homolog FLA8 is phosphorylated on the tail domain at Ser 663 by CaMKII. This phosphorylation inhibits KIF3B binding to its cargo IFT-B, and prevents the unloading of IFT-B at the tips of the cilia (Liang et al. 2014). These two studies highlight the importance of post- translational modification for kinesins activity and for their function within cilia.
1.3.2 Costal-2, the Drosophila homolog of Kif7 Costal2 (Cos2), the Drosophila homolog of Kif7 plays multiple roles in Drosophila Hh signalling (Robbins et al. 1997, Sisson et al. 1997, Lum et al. 2003). Cos2 mutants are zygotic lethal and they display a similar cuticle phenotype as ptc homozygous embryos. They also exhibit expanded transcription domains of Hh target genes, and mirror image pattern duplications in the wing (Grau and Simpson 1987). Genetic studies suggest Cos2 is a negative regulator of the pathway, however, Cos2 has both positive and negative functions in the pathway to regulate Ci R and Ci A activity (Lum, Zhang et al. 2003, Zhou and Kalderon 2010). In the absence of Hh ligands when the signalling pathway is in the resting state, Cos2 serves as a scaffolding protein anchoring Ci and the proteins kinases PKA and CK1. Cos2 thereby promotes Ci phosphorylation and this leads to increase Ci proteolytic processing into Ci R and repression
18 of target genes. In this context Cos2 serves a negative regulatory role (Lum and Beachy 2004). In the presence of Hh ligands however, Cos2 is phosphorylated by Fu (on Ser 572 & Ser 931 ) and this changes Cos2 distribution from the cytoplasm to the plasma membrane, where it associates with Smo (Ranieri et al. 2012). This association with Smo sequesters Cos2 away from Ci and promotes the formation of Ci A, its translocation to the nucleus and transcriptional activation of target genes. Therefore, during Hh pathway activation, Cos2 plays a positive regulatory role. Overall, in Drosophila , Cos2 performs dual negative and positive functions dependent on the state of pathway activation.
1.3.3 Kif27, the vertebrate paralog of Kif7 In vertebrates, there are two orthologs of Cos2, Kif7 and Kif27, and both belong to the kinesin-4 family of motor proteins. Kif7 and Kif27 share 43.6% of sequence homology (Katoh and Katoh 2004). In vertebrates, Kif27 was shown to be dispensable for Hh signalling or primary cilia function. In contrast, Kif27 was found to mediate important roles in motile cilia formation. Kif27 is involved with STK36, the vertebrate homolog of Drosophila Fu, to assemble the central pair of microtubules in motile cilia. Similar to Kif27, Stk36 is also dispensable for mammalian Hh signalling (Chen, Gao et al. 2005, Merchant, Evangelista et al. 2005, Wilson, Nguyen et al. 2009).
1.3.4 Vertebrate Kif7 1.3.4.1 Kif7 structure and motor activity Structurally, Kif7 has a motor domain at its N-terminus that exhibits nucleotide and microtubule binding functions. Kif7 also has a neck region that is thought to be the site mediating homodimerization, and a C-terminal tail domain (He et al. 2014) (Figure 1-4). Like most kinesins, the motor domain of Kif7 exhibits the highest sequence homology with the other kinesins (Klejnot and Kozielski 2012). Studies have shown that Kif7 requires its motor domain for function (Liem et al. 2009, He, Subramanian et al. 2014). Forward genetic screens identified mouse embryos with mutation in the Kif7 motor domain (L130P)(motor dead mutant) that exhibited similar phenotypes as Kif7 knock-out mice. In addition, the motor dead Kif7 mutant failed to accumulate at the tips of cilia upon pathway activation, and instead accumulated in the
19
TZ. This suggests that the motor domain is needed for Kif7 trafficking to the distal tip compartments of the cilia. Despite the functional importance of the motor domain, Kif7 does not exhibit any movement along microtubules in vitro , suggesting it may not have a functional motor domain (He, Subramanian et al. 2014). However, He et al showed in both Kif7 -/- MEFs and in cells expressing the L130P mutant, that cilia are longer in length and are unstable, suggesting that the motor domain is needed for the control of cilia length and stability. The increased microtubules catastophe at distal cilia was taken as evidence that Kif7 is important for primary cilia integrity by regulating microtubule growth at the distal tip.
Motor Neck Coiled-coil Tail KIF7
Figure 1-4. Kif7 domain structure.
1.3.4.2. Requirement of cilia for Kif7 functions Studies of Kif7 null mice crossed with Ift172 null mice (which have no cilia since IFT172 is an integral protein of the IFT-B complex) showed that Kif7's activity depends on IFT proteins in that double mutant mice exhibited the same phenotype as Ift172 mutant embryos. This result suggests that Kif7 requires cilia for its function. However, Kif7 may also have cilia independent functions. A s tudy of Kif7 in retinal epithelial cells, a non-Hh responsive human cell line showed that loss of Kif7 by siRNA result in centrosome duplication, Golgi fragmentation, abnormal tubulin acetylation and microtubular dynamic defects, all of which depends on Kif7's motor domain (Dafinger, Liebau et al. 2011). Kif7 may therefore have roles in many cellular processes in addition of Hedgehog signalling.
1.3.4.3 Kif7 knockout mice Kif7 was first implicated in mouse Hh signalling in 2009, when three independent studies reported the characterization of Kif7 mutant mice (Cheung et al. 2009, Endoh-Yamagami et al. 2009, Liem, He et al. 2009). Kif7 knockout mice die at birth and exhibit phenotypes consistent with impaired Hh signalling such as polydactyly and exencephaly, similar to phenotypes observed in Gli3 -/- mice. Loss of Kif7 leads to modest increase in Shh signalling in the neural
20 tube and decreased Gli3 R formation. While these results support a negative function for Kif7, further analysis of the role of Kif7 in development showed that Kif7 also fulfills a positive regulatory role. In Ptch1 -/-; Kif7 -/- double knock-out mice, the strong gain of function phenotypes observed upon deletion of Ptch1 are largely rescued(Liem, He et al. 2009). This suggests that Kif7 has a positive role in Shh signalling. Specifically, Kif7 appears to be crucial for Shh signalling in the floor plate, where highest levels of Shh signalling are needed. Thus, in the developing neural tube, Kif7 fulfils a positive role in cells with high levels of Shh signalling whereas it plays a negative role in cells of low signalling activity or when the pathway is not activated.
1.3.4.4 Kif7 in Zebrafish Zebrafish Kif7 was first characterized in 2005 (Tay et al. 2005) and was found expressed at low level throughout development. At the cellular level, zebrafish Kif7 exhibits cytoplasmic localization and co-localization with microtubules. Knockdown of kif7 using morpholino antisense oligonucleotides leads to de-repression of Hh target genes in the myotome leading to characteristics defects in somite morphogenesis, which are typical of Hh signalling deregulation (Tay, Ingham et al. 2005, Putoux et al. 2011). In the original study, Kif7 was characterized as a negative regulator of Hh signalling in zebrafish embryo. In a follow-up study in 2013, Phil Ingham's group generated maternal zygotic kif7 knockout in zebrafish using zinc finger nuclease and further characterized the function of fish kif7 (Maurya, Ben et al. 2013). Knockout of kif7 leads to de-repression of Hh target genes in the myotome but not in the neural tube, indicating a tissue-specific requirement for Kif7. Furthermore, in contrast to mice where Kif7 is essential for normal development, kif7 -/- fish are viable. Maurya et al. further showed that Kif7 localizes in the primary cilia and within cytoplasmic puncta and physically interacts with Gli1 and Gli2. In this context, Kif7 is needed to potentiate Gli2 A activity in a Smo-dependent fashion by promoting Gli2 dissociation from SuFu. Loss of Kif7 impairs Gli2 accumulation at the tips of cilia and affects Gli2 processing in younger embryos. These results are consistent with Kif7 fulfilling a positive role for Hh signalling in zebrafish. Overall, the dual positive and negative roles of Kif7 are therefore evolutionarily conserved.
21
1.3.4.5 Kif7 and binding partners Through binding assays, it was found that Gli proteins bind to Kif7 on the N-terminal motor domain (Cheung, Zhang et al. 2009). In addition, data from co-immunoprecipitation experiments suggest that Kif7 interacts directly with SuFu and Smo, when proteins are overexpressed (Endoh-Yamagami, Evangelista et al. 2009, Chong et al. 2015). These results are similar to what is observed in Drosophila since Cos2 binds to Smo (Jia et al. 2003). Intriguingly, the Cos2 binding site on dSmo does not appear to be conserved in vertebrate Smo suggesting that an alternative mode of binding exist or that Kif7 does not interact directly with Smo. Recently, Evc and Evc2 proteins were described to interact with activated and phosphorylated Smo in primary cilia to enable the recruitment of Kif7 within this complex and to promote Gli protein trafficking and Hh signalling (Yang, Chen et al. 2012). Mechanistically how Evc couples Smo to Gli trafficking and in turns contributes to pathway activation is unknown. Whether Evc proteins are required for Kif7 trafficking in cilia during pathway activation remains to be determined. Considering that Evc expression is highly tissue dependent, a general role for Hedgehog signalling is unlikely. Whether other ciliary proteins serve similar functions in regulating Kif7 activity in the cilia also remains to be determined. Recently, Discs large5 (Dlg5), a scaffolding protein localized at the basal body, and an interactor of activated Smo was found to be important for Kif7 ciliary tips accumulation (Chong, Mann et al. 2015). However, the precise role of Dlg5 on Kif7 trafficking was not studied.
1.3.4.6 Kif7 in chondrocytes In chondrocytes, Ihh is the main Hh ligand (Hsu et al. 2011). It is needed for the proliferation of chondrocytes and normal bone growth. Kif7 has both positive and negative function on Ihh signalling. In the growth plate, loss of Kif7 in chondrocytes results in reduced Hh pathway activity and increased SuFu protein levels as a possible compensatory mechanism. In proliferating chondrocytes, when the Hh pathway is active, Kif7 localizes at the tips of the cilia, but SuFu and Gli are excluded from the tips. Since loss of Kif7 in this context leads to increase SuFu-Gli localization to the tips of cilia, Kif7 therefore functions to actively prevent SuFu-Gli complexes from accumulating (Hsu, Zhang et al. 2011). Ciliary localization of SuFu, Gli and Kif7 in chondrocytes differs from other cells such as MEFs, where Kif7, SuFu, and Glis all
22 show basal level of cilia accumulation but are enriched in cilia tips in response to pathway activation. The reasons for this difference in distribution remain to be uncovered.
1.3.4.7 Kif7 and skin cells In embryonic skin cells, Kif7 is predominantly expressed in proliferating keratinocytes of the basal layer and hair follicles, where Kif7 functions to promote Hh pathway activity during hair follicle development (Li et al. 2012). Loss of Kif7 results in reduction of hair follicle number and delays their development. In keratinocytes, Kif7 promotes the dissociation of SuFu-Gli2 complexes and increases the nuclear accumulation of Gli2 A. Hence, Kif7 is a positive regulator of Gli activity in hair follicles when the Hh pathway is activated (Li, Nieuwenhuis et al. 2012).
Overall, the precise molecular and biochemical mechanisms underlying the positive and negative roles of Kif7 are poorly understood. More work is needed to further understand how Hh pathway activation and Smo influence Kif7 trafficking in cilia and how this, in turn, affects Gli localization, processing and function to regulate expression of target genes.
1.3.5 Kif7 in ciliopathies and other genetic disorders. Recent genetic studies have identified KIF7 mutations in patients with ciliopathies. Frameshift or missense mutations in KIF7 were reported to cause hydrolethalus (HLS), acrocallosal (ACLS), Joubert (JBTS) and Bardet-Biedl (BBS) syndromes (Dafinger, Liebau et al. 2011, Putoux, Thomas et al. 2011, Putoux et al. 2012, Walsh et al. 2013). In 2011, Putoux et al. identified KIF7 mutations in in patients with HLS and ACLS, two rare genetic recessive disorders characterized with polydactyly, brain abnormalities and cleft palate. In the study by Putoux et al., authors identified deletion or frameshift mutations within KIF7 exons resulting in ACLS or HLS, and identified eight other missense changes within the KIF7 coiled-coil domain contributing to other ciliopathies. Consistent with the roles of Kif7 in Gli trafficking and Hh signal transduction, cells from patient with mutation in KIF7 had de-regulation of Gli target genes and impaired Gli3 processing. Other KIF7 mutations have since been identified in ACLS patients (Putoux, Nampoothiri et al. 2012, Walsh, Shalev et al. 2013, Karaer et al. 2015). KIF7 mutations have also been identified in JBTS, an autosomal recessive ciliopathy disorder characterized by brain malformation, cerebellar hypoplasia, ataxia, psychomotor delay, retinal
23 degeneration, renal cyst, and skeletal abnormalities. Ciliary proteins such as NPHP1, CEP290, MKS3, ARL13B are also known to contribute to JBTS (Dafinger, Liebau et al. 2011). Three different deletions in KIF7 exons were found in JBTS, and were characterized to cause instability of cilia and microtubules, Golgi fragmentation and centrosome duplications. This suggests that KIF7 may have additional Hh-independent roles contributing to disease (Dafinger, Liebau et al. 2011). In addition, a homozygous p.N1060S missense KIF7 mutation was identified in a patient with a rare autosomal recessive syndrome leading to macrocephaly and multiple epiphyseal dysplasia, a clinical condition characterized with defect in cartilage formation that results in skeletal abnormalities and short stature (Ali et al. 2012). Lastly, a recent genetic study of copy number variation in patients with typical orofacial clefts found KIF7 to be one of the contributing genes (Simioni et al. 2015). All human KIF7 mutations identified to date are listed in Table 1. How these disease-causing mutations perturb KIF7 functions is still largely unknown, more research is thus needed to understand the molecular mechanisms of Kif7 to better understand the impact of disease causing mutations. Table 1. List of Kif7 mutations found in ciliopathies Mutation Description Ciliopathy Other mutated Citation allele(s) p.Arg33X truncation, c.67C>T ACLS Poutex et al, 2011 p.Leu78ProfxX2 frameshift, ACLS Poutex et al, c233_234del, 2011 pArg154X truncation c.460C>T ACLS Poutex et al, 2011 pGlu197GlyfsX19 frame shift , c.587dupT ACLS Poutex et al, 2011 pArg230AlafsX92 frame shift , c.687delG ACLS Poutex et al, 2011 pGly547SerfsX5 frame shift, ACLS Poutex et al, c.1639_1640delinsT 2011 p.Ala966Profs*81 frame shift, HLS Poutex et al, c.2896_2897del, 2011 homozygous deletion of the first two base-pairs of exon 15 pGln1001X truncation, c.3001C>T ACLS Poutex et al,
24
2011 pPro632Leu, heterozyous variation PHS Pallister-Hall Poutex et al, c.1895C>T 2011 pArg641Gly, heterozyous variation BBS BBS1, pM390R Poutex et al, c.1921A>G homozyous 2011 pArg702Gln, heterozyous variation ACLS Poutex et al, c.2105G>A 2011 pLeu759Pro, heterozyous variation BBS Poutex et al, c.2276T>C 2011 pGln834Arg, heterozyous variation OFDVI (Oro- BBS10: Poutex et al, c.2501A>G facio digital type p.C91fsX95 hets, 2011 VI), BBS BBS7: p.Q293P hets pGln994Arg, heterozyous variation BBS Poutex et al, c.2981A>G 2011 pArg1068Trp, heterozyous variation BBS BBS1: p.M390R Poutex et al, c.3202C>T + p.R419X 2011 pHis1115Gln, heterozyous variation MKS, HLS Poutex et al, c.3345C>G 2011 p.A73PfsX109 c.217delG exon1, JBTS Dafinger et al, truncation 2011 p.E271RfsX51 c.811delG exon3, JBTS Dafinger et al, truncation 2011 p.R1329_S1332del c.3986-3997del12 JBTS TMEM67, Dafinger et al, exon18, truncation p.P358L, p.I833T 2011 p.218-221del c.653_662del, in frame ACLS AHI1 p.R830W, Walsh et al, deletion BBS2, p.N70S, 2013 BBS4, p.M472V p.N1060S c.3179A>G homozyous, Macrocephaly, Ali et al, 2012 missense multiple epiphyseal dysplasia (MED) c.529+2T>C at donor splice site, ACLS Poutex et al, intron 3, 2014 c.1019dupT, T insertion in exon 17, ACLS Poutex et al, p.Asn341GlnfsX122, frameshift, premature 2014 termination
25
c.3331C>T, non-sense mutation in ACLS Poutex et al, p.Arg1111X exon 17 2014 c.2593-3C>G substitution at acceptor ACLS Poutex et al, splice site at intron 12, 2014 c.3001C>T, non-sense mutation in ACLS Poutex et al, pGln1001X exon 15 2014 c.1054_1061del 8bp deletion exon 5 ACLS Poutex et al, p.Arg352GlyfsX108 2014 c.1167_1204del, 38bp deletion exon 5 ACLS Poutex et al, p.Arg390HisfsX60 2014 c.2593-2A>C, acceptor ACLS Karaer et al, splice site of intron 12 2015 (IVS12-2A>C).
1.3.6 Kif7 in other contexts In addition to Kif7's role in cilia and Hh signalling, Kif7 has been implicated in other diseases. Recently Kif7 and Gli proteins were found to be down regulated in choriocarcinoma cell lines, and loss of Kif7 resulted in increased migration of the trophoblast cell line (Ho et al. 2014). Furthermore, Kif7 was found to interact with toxin ExoS secreted from P. aeruginosa , leading to bronchial epithelial cells cytotoxicity (Okuda et al. 2014). In addition, Kif7 has been implicated in congenital diaphragmatic hernia through regulation of retinoic acid (Coles and Ackerman 2013). Lastly, in a study of kinesins in breast cancer, Kif7 expression was found to be linked to estrogen levels in estrogen receptor positive breast cancer cells (Zou et al. 2014). Overall, since kinesins have pervasive roles in cell function and signalling, it is predictable that Kif7 may have multiple ceullar functions other than Hh signalling.
1.4 PPFIA1
1.4.1 Liprin family: general introduction and function Liprin proteins are also known as transmembrane tyrosine-phosphatase LAR-interacting proteins. Liprin-α was originally identified as a cytosolic binding partner of the LAR family of
26 receptor protein tyrosine phosphatases (LAR) and acts as a scaffold for their focal adhesion recruitment (Serra-Pages et al. 1995). In vertebrates, the Liprin family consists of Liprin-α (1, 2, 3, 4), and Liprin-β (1, 2). C. elegans and Drosophila have only one Liprin gene, SYD-2 or dLiprin , respectively. In vertebrates, the 4 Liprin-α genes show differential expression, with Liprin-α2 (PPFIA2) and α3 (PPFIA3) expressed exclusively in mammalian brains, whereas Liprin-α1 (PPFIA1) and α4 (PPFIA4) are found in multiple tissues. Of the four, PPFIA1 shows the broadest expression across many tissue types (Serra-Pages et al. 1998). Liprin-α are well conserved with 50% amino acid identify between human Liprin-α and worm SYD-2. Liprin proteins are characterized by an N-terminal coiled-coil region that mediates homo- and hetero- multimerization and C-terminal SAM domains. Liprin-α proteins also have a carboxy-terminal PDZ-binding domain, and a PEST sequence important to regulate protein degradation that is present between the coiled-coil and the SAM motifs (Serra-Pages, Medley et al. 1998, Spangler and Hoogenraad 2007) (Figure 1-5). Liprin-α are best characterized in synapse formation, where they are required for the assembly of presynaptic active zone and postsynaptic sites, as well as synaptic cargo transport (Spangler and Hoogenraad 2007, de Curtis 2011).
PPFIA1 Coiled-coil SAM SAM SAM
Figure 1-5. Schematic representation of the protein domains of PPFIA1.
1.4.2 PPFIA1 Of the Liprin-α genes, PPFIA1 is the best studied. PPFIA1 is important for synaptic formation in the nerves system. In C. elegans , Syd-2 (Liprin-α homolog) is needed for pre-synaptic development. Loss of Syd-2 function results in mis-localized sympatic vesicles and pre-synaptic structural defects (Zhen and Jin 1999). In Drosophila , dLiprin is also needed for synaptic function since dLiprin mutants show defect in active zone (site of neurotransmitter release) morphology (Kaufmann et al. 2002). In vertebrates, PPFIA has also been shown to regulate synapse formation and function. One study showed that PPFIA1 is negatively regulated by Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) in synapse morphogenesis. PPFIA1 is degraded in response to CaMKII phosphorylation, and this in turn regulates synaptic vesicles level (Hoogenraad et al. 2007). In non-neuronal contexts, PPFIA1 is best characterized in cell
27 migration and motility. PPFIA1 is needed for cell motility and spreading, partly through regulation of integrins. Loss of PPFIA1 results in unstable lamellipodia, inhibits cell spreading, and reduces the degradation of ECM (Asperti et al. 2009, Asperti et al. 2010, Asperti et al. 2011, Astro et al. 2014). PPFIA1 is highly expressed in human breast cancer cells and it has been suggested that PPFIA1 may be required for migration and invasion of tumour cells (Astro et al. 2011). Overall, the Liprin-α family of scaffolding proteins have diverse functions in cellular signalling.
1.4.2 Liprin and kinesins PPFIA1 plays important roles in transporting cargoes in neurons. Research from mammalian cells, Drosophila , and C. elegans all showed that PPFIA1 interacts with the neuron specific motor protein Kif1A and stimulates the trafficking of synaptic vesicles (Shin et al. 2003, Miller et al. 2005, Sieburth et al. 2005). The coiled-coil domain of PPFIA1 binds Kif1A and acts as an adaptor protein linking synaptic cargos to kinesins (Shin, Wyszynski et al. 2003) (Figure 1-6). In Drosophila , dLiprin is also implicated in Kif1A-depedent trafficking in neurons. Fly mutant for dLiprin exhibits defective synaptic vesicle movement, characterized by a decrease in anterograde movement, and an increase in retrograde movement of synaptic vesicles (Miller, DeProto et al. 2005). Similarly, in C. elegans , Syd-2 (Liprin-α) is required for the bidirectional movement of UNC-104 (Kif1A). In Syd-2 mutant, anterograde movement is reduced, resulting in reduced cargo transport (Sieburth, Ch'ng et al. 2005, Wagner et al. 2009). A recent study further showed that Liprin ( α, β) interacts with Kif21A to regulate cortical microtubule growth.(van der Vaart et al. 2013). In this context, Liprin acts as a scaffolding protein for protein clustering, whereas Kif21A functions to inhibit cortical microtubule growth. Overall, PPFIA1 acts as a molecular adaptor to link vesicles and cargos to kinesins.
Cargo
Liprin
Kinesin
Microtubule Figure 1-6. Model of kinesin and Liprin interaction.
28
1.4.3 PPFIA1 and protein phosphatases The interaction between Liprin-α and protein phosphatase was first identified in proteomic studies. In a proteomic screen of Liprin-α interacting proteins in Drosophila , the PP2A subunit B' (Wrd, Drosophila homolog) was identified. Liprin-α and PP2A interact in the synapse and PP2A subunit mutants phenocopie Liprin-α mutants with defects in synaptic vesicles accumulation. The Liprin-α:wrd protein complex was described to antagonize Gsk3b kinase activity and to prevent ectopic accumulation of synaptic materials (Li et al. 2014). Proteomic- based screens in mammalian systems have also identified the interaction between PP2A and PPFIA1. Mass spectrometry analysis identified PPFIA1 in immunoprecipitates of PP2A regulatory subunit (B56 γ or B') from HEK293T cell lysates (Arroyo et al. 2008). Two other large scale proteomic analysis of PP2A structural (A) and catalytic (C) subunits in human cell lines, revealed PPFIA1 interacts preferentially with PPP2R1A, PPP2CB, PPP2CA (Glatter et al. 2009, Goudreault et al. 2009). Although a physical interaction between PPFIA1 and the PP2A phosphatase is well established, the specific roles of this complex are poorly understood and further biochemical and functional analysis are required.
1.4.5 PPFIA1 and primary cilia Large scale mass spectrometry based proteomic analysis in kidney cells (Ishikawa et al. 2012), or in sensory cilium of rod and cone photoreceptor cells of the mouse retina (Liu et al. 2007) both identified PPFIA1 as part of the primary cilia proteome. PPFIA1 was also identified in a RNAi functional genomics screen performed in human retinal pigmented epithelial cells to identify human genes involved in ciliogenesis (Kim et al. 2010). These large-scale studies highlight the possible role of PPFIA1 in primary cilia.
1.5 PP2A Phosphatases
1.5.1 Family, classification and general function The Serine/threonine phosphoprotein phosphatase family has 7 members (PP1, PP2A, PP2B, PP3, PP4, PP5, PP6, and PP7). PP1 and PP2 are the most abundant and ubiquitous phosphatases in this family. In the PP2 family, Protein phosphatase 2A (PP2A) regulates many key physiological processes, including mRNA translation, cell cycle progression, apoptosis and
29 differentiation (Janssens and Goris 2001). Each PP2A is a heterotrimer that consists of a structural A subunit (PPP2R1A, PPP2R1B), a regulatory B subunit, and a catalytic C subunit (PPP2CA, PPP2CB) (Figure 1-7). The PP2A catalytic (PP2Ac) subunit binds directly to the A subunit to form the PP2A dimeric core. The core serves as platform to associate with regulatory B subunit to form a trimeric complex. Human genome encodes at least 15 known regulatory B subunits that allows for many different combinations of trimeric complexes (Janssens and Goris 2001, Lechward et al. 2001). Hence, it is the B subunit that determines the specificity of each PP2A complex. The B subunits are classified into four families based on sequence homology: B (B55), B' (B56), B'', and B''' (striatins). B' (B56) family further consists of 5 members PPP2R5A (B56 α), PPP2R5B (B56 β), PPP2R5C (B56 γ), PPP2R5D (B56 δ), and PPP2R5E (B56 ε).
Given the diverse function of PP2A in cellular activities, it is not surprising that mis-regulation or mutation in PP2A results in human diseases. Mutations in PP2A have been found in various cancers, such as ovarian (Nagendra et al. 2012) and uterine cancers (Shih Ie et al. 2011). PP2A itself is a tumour suppressor. Simian virus 40 (SV40) is known to inhibit PP2A leading to malignant transformation of normal human cells (Yang et al. 1991). In addition, PP2A is also involved in the de-phosphorylation of oncogenes such as Myc and Akt and inhibition of PP2A activity is known to induce cancer cell death (Arnold and Sears 2006, Sablina et al. 2010). However, given the ubiquitous function of PP2A, a major drawback of inhibiting PP2A is lack of specificity to cancer cells, resulting in too much cytotoxicity. Currently, all PP2A inhibitors target the phosphatase catalytic subunit and cannot distinguish between different holoenzyme complexes. Okadaic acid (OA), a polyether fatty acid produced by marine dinoflagellates, is one of the most potent inhibitor of PP2A. It is widely used in research to inhibit PP2A function. OA acts through direct binding to PP2Ac via a hydrophobic cage that is not conserved in other Ser/Thr phosphatases providing OA with high affinity for PP2A. However, at higher dose OA can inhibit PP1 (Mumby and Walter 1993, Virshup 2000, Janssens and Goris 2001).
30
B A C
Figure 1-7. PP2A is a heterotrimer consisting of a structural A subunit, a regulatory B subunit, and a catalytic C subunit.
1.5.2 PP2A and Hh signalling Multiple kinases have been identified to play important roles in Drosophila and vertebrate Hh signalling. However, the roles of protein phosphatases in Hh signal transduction have been underscrutinized. In Drosophila , PP2A has been identified as a positive regulator of Hh signalling (Nybakken et al. 2005, Casso et al. 2008). PP2A was first identified as an important regulator of Hh signalling in a genome wide RNAi screen performed in Drosophila cells (Nybakken, Vokes et al. 2005). Loss of the Drosophila gene microtubule star (mts), which encodes the PP2A catalytic subunit, results in reduced Hh signalling (Casso, Liu et al. 2008). Furthermore, loss of B subunit of PP2A ( Widerborst Wdb ) in flies also reduced Hh signalling (Nybakken, Vokes et al. 2005). In 2009, Ci was shown to be a direct substrate of PP2A in flies. PP2A acts to de-phosphorylate Ci to prevent its processing to Ci R (Jia et al. 2009). Additional studies revealed that PP2A functions in conjunction with PP1 to de-phosphorylate Smo. Specifically, PP2A dephosphorylates PKA primed, CKI-phosphorylated Smo (Su et al. 2011). In mammalian systems, the role of PP2A in the context of Hh signalling is less studied. In Xenopus, B56e, the vertebrate ortholog of Wdb, was found to be important for Hh signalling in Xenopus eye field separation (Rorick et al. 2007). PP2A also appears to be required for Hh- dependent activation of COUP-TFII. In this case, PP2A is needed to dephosphorylate an unknown target that is required for activation of COUP-TFII and Gli response element– dependent gene expression (Krishnan et al. 1997).
1.6 Dual Specific Tyrosine Kinase 2 (DYRK2)
31
1.6.1 DYRKs general classification and function
The dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family is part of the CMGC family of serine/threonine kinases with sequence similarity to cyclin-dependent kinases. DYRKs have conserved catalytic kinase domain and DYRK-characteristic DYRK homology (DH) box. In vertebrate cells, there are 5 members of the DYRK family (1A, 1B, 2, 3, and 4). DYRK1A and DYRK1B belong to class I DYRKs, and DYRK2, DYRK3, and DYRK4 belong to class II. DYRKs have conserved YXY activation sequence, they are known to auto- phosphorylate their own tyrosines for activation. DYRKs are proline directed serine-threonine kinases, with a preference for proline at the P+1 position on the substrate (Campbell and Proud 2002, Aranda et al. 2011). For example, DYRK1A has a consensus phosphorylation sequence of (RPXS/TP) (Himpel et al. 2000) and DYRK2 has a consensus of (RXS/TP) (Campbell and Proud 2002). DYRKs in general have broad cellular functions but they have been most characterized in the context of cell death (Aranda, Laguna et al. 2011). DYRK1A was the first DYRK protein implicated in Hh signalling in 2002 (Mao et al. 2002), since then, DYRK1B (Lauth et al. 2010) and DYRK2 (Varjosalo et al. 2008) have been implicated in vertebrate Hh signalling with different roles.
1.6.2 DYRK1A and DYRK1B and Hedgehog signalling DYRK1A was first implicated in Hh signalling in 2002 when the kinase activity of DYRK1A was found to promote the transcriptional activity of Gli1 in reporter assays. DYRK1A promoted phosphorylation of Gli transcriptional activity was also shown to be mediated through nuclear retention (Mao, Maye et al. 2002). In 2010, Lauth et al showed that DYRK1B is also important for Hh signalling in the context of pancreatic cancer. DYRK1B functions as a negative regulator of Hh signalling in this context since overexpression of DYRK1B inhibits, whereas knockdown of DYRK1B increases pathway activity. A working model by which autocrine Hh signalling in pancreatic cancer cells is suppressed by a KRAS-DYRK1B signalling axis was proposed (Lauth, Bergstrom et al. 2010). Recently, a genetic study identified a DYRK1B mutation in patients with early onset coronary artery disease and metabolic syndrome (an inherited disease). The adipocytes of these patients exhibit lower Gli2 protein levels, suggesting a further role of DYRK1B and Hh signalling (Keramati et al. 2014). Overall, the exact roles that DYRK1 family
32 kinases play during Hh signalling are still unclear. Similarly, the substrates regulated by DYRK1 are incompletely defined.
1.6.3 DYRK2 and Hedgehog signalling
DYRK2 was first identified as a negative regulator of Hh signalling in a functional expression screen designed to identify kinases regulating Gli luciferase reporter activity (Varjosalo, Bjorklund et al. 2008). Overexpression of DYRK2 inhibits Shh-induced Gli reporter activity and blocks the expression of Hh-dependent neural tube marker in vivo . Knock-down of DYRK2 activates the Shh pathway in the absence of ligand stimulation. DYRK2 was shown to phosphorylate Gli2 and to promote Gli2 degradation by the proteasome. DYRK2 therefore regulates cytoplasmic Gli2 stability (Varjosalo, Bjorklund et al. 2008). In this thesis, I will further investigate the role of DYRK2 within the Hh pathway, specifically in the regulation of Kif7 function.
1.7 Mass Spectrometry
1.7.1 General introduction Affinity purification coupled mass spectrometry (AP-MS) based proteomic study is the study of protein complexes or protein-protein interactions by isolating target proteins and their complexes by immuno- or affinity- purification and analyzing them by liquid chromatography followed by mass spectrometry. This method allows for unbiased screen of protein-protein interactions. In addition to protein complex identification, MS can also be used to identify post- translational modifications. This has been very useful in examining targets of kinases and phosphatases (Knight et al. 2013). Recently, quantitative and data independent MS analysis has been used to study the entire cell proteome under different treatments (Collins, Gillet et al. 2013, Lambert, Ivosev et al. 2013). With the advances in MS technology and data processing software, proteome level analysis is becoming possible and affordable.
1.7.2 Affinity purifications-coupled LC-MS/MS work flow
33
The basic work flow of mass spectrometry is: (1) ionization, (2) mass analyzer, and (3) detection. However, given the complexity of peptide mixtures, samples are usually separated through a liquid chromatography (LC) before ionization. A commonly used LC method is reversed-phase liquid chromatography that separates peptides based on their hydrophobicity. By running organic solvents (e.g acetonitrile) through the chromatography column, the polarity of the mobile phase of the column is gradually reduced, leading to "release" of peptides from the support in decreasing order of hydrophobicity. Resolution is further enhanced through the use of tandem mass spectrometry (MS/MS). Tandem MS is directly coupled to high performance liquid chromatography using nano-scale reversed-phase columns. Peptide mixtures in liquid phase are loaded on HPLC columns, eluted during the LC, and then ionized by electrospray as they enter the mass spectrometer. Raw MS/MS spectra are then analyzed by database search engines to identify peptides and proteins present in the sample (Figure 1-8). Further data analysis by statistical software can help identify which of these proteins are likely interactors. Each step of the LC-MS/MS will be explained in more details below.
Firstly, in the ionization step, peptides are ionized into the gas phase. In general there are two ways of ionization, electrospray ionization (ESI) and matrix assisted laser desorption/ionization (MALDI). ESI is the conversion of liquid containing peptides to gas phase through high electrical field at the tip of a capillary. Ions are then analyzed in the mass spectrometer. In contrast, MALDI generates ions from samples on a solid phase. The sample is pulsed with UV laser thus vaporizing the solid support together with the analytes to gaseous ions, which can then be analyzed by the mass spectrometer.
After the ionization process, ionized molecules are separated and resolved in mass analyzers according to their mass to charge ( m/z) ratio. Specifically, the mass spectrometer measures the molecular weight of ions based on their m/z ratios. Commonly used mass analyzers are ion trap, time-of-flight (TOF), and orbitrap. In ion trap, ions are captured because of surrounding electric or magnetic fields. An electrical current orthogonal to the flight-path of the charged molecules expel them to the detector. From the detection of an expelled peptide, the m/z can be determined. Ions are filtered base on their m/z ratio and sequentially ejected for MS/MS. Time- of-flight (TOF) analyzers use electric fields to accelerate ionized molecules and measure the time it takes for a charged molecule to move through a high vacuum flight tube and to reach the
34 detector. The measured velocity of the ion correlates with its m/z ratio. Orbitraps trap ions in an orbital motion around a central electrode. m/z values are measured from the frequency of harmonic ion oscillations along the axis of the electric field.
In tandem MS, after the first MS mass scan, ions with given m/z are selected and fragmented by collision induced dissociation (CID), where peptide ions are bombarded with neutral gas (e.g helium), breaking peptide ions along their backbone into small fragments. Then a second MS will scan and analyze the m/z of the fragmented ions. This generates a CID spectrum or MS/MS spectrum that is used for identification of the peptide.
Once the experimental mass spectra are generated, they are compared with theoretical peptide fragment masses in sequence databases such as Mascot to find the best matching peptide. The degree of matches is translated into a probability score. However, these databases are known to produce incorrect peptide assignments. Therefore, statistical models such as PeptideProphet are used for validation of peptide assignments (Nesvizhskii et al. 2003).
The mass spectrometer used for the studies described in this thesis is the LTQ-XL ion trap, coupled to nano-RPLC-ESI, and C18 reverse phase column (fused silica capillary column packed with C18 reverse phase material). The mass spectrometer is programmed to acquire MS/MS spectra in a data-dependent mode where the first MS scan records all the different ion species within a specific mass window of 400-1400 m/z, followed by MS/MS analysis of the five most abundant ions at a given time point. This sequence is repeated over 2 hours of the HPLC gradient. All data collected are uploaded to ProHits (Protein High-throughput Solution), an open source software package for MS data storage and analysis (Liu et al. 2010). ProHits allows users to compare multiple AP-MS analyses and to identify background contaminants. In ProHits, MS spectra are searched against Mascot and Comet databases, searches are individually processed, and results are scored by TransProteomics pipeline (TPP) where all hits with a probability of P>0.05 (significance threshold) are selected. The accuracy of searches is estimated by the PeptideProphet TM and ProteinPhophet TM statistical softwares (Keller et al.
2002). ProteinProphet TM provides a probability score that denotes the likelihood of the given protein being correctly or incorrectly identified (Nesvizhskii, Keller et al. 2003). Next, Significance analysis of INTeractome or SAINT analysis was used to calculate the probability
35 for each protein-protein interaction. SAINT uses statistical modeling based on spectral counts to calculate the probability of true interaction. Lastly, background contaminants of the APs were manually removed after comparison to CRAPome (a web-based contaminant repository for affinity purification). These are proteins that are not real-interactors of the bait protein but interacts non-specifically with the solid-phase support, the antibody or the epitope tag (Peng and Gygi 2001, Keller, Nesvizhskii et al. 2002, Gingras et al. 2005, Gingras et al. 2007, Deutsch et al. 2010, Choi et al. 2011, Choi et al. 2012, Dunham et al. 2012, Eng et al. 2013, Mellacheruvu et al. 2013).
A6ni ty Trypsin digestion HPCL column MS
Sample Protein Peptide Peptide separation complexes mixture and ionization
Database y t CID searching ensi t n I Intensity
m/z m/z m/z MS survey scan MS/MS scan In silico digestion acquired spectrum Theoretical spectrum Figure 1-8. MS work flow. The biological sample is subjected to affinity purification to isolate proteins and interacting proteins. The isolated protein complexes are then eluted and digested with MS grade trypsin. The peptides mixture is then loaded on a HPLC column for reverse- phase liquid chromatography followed by ESI-MS/MS. Ions are then subjected to MS1 scan and the 5 most abundant peptides are selected for CID and MS2 scans. The MS2 acquired spectrum is recorded and compared to database to identify peptides and associated proteins.
1.7.3 Sample preparation for AP-MS The basic work-flow for sample preparation for MS from mammalian cells are (1) generate cell lines that express an epitope-tagged protein of interest, (2) purification of protein complexes, (3) proteolyic digestion of the isolated sample and (4) identification of co-precipitating proteins by MS. Protein complexes are purified through affinity purification methods via immuno- or affinity purifications (i.e. using antibodies directed against an epitope tag such as FLAG). Epitope tagging allows for standardization of the purification protocol without the need to
36 optimize for every antibody. Background contaminants are also more consistent across all purifications. Epitope tags such as FLAG are conjugated to the protein of interest and expressed in cells. Cell lysates are extracted and tagged proteins are purified with their associated proteins. The purified precipitates are treated with trypsin to digest the proteins to peptides, and the resultant peptides are analyzed by LC-MS/MS. The use of reciprocal purifications, using the identified proteins as baits, can then be used to validate the interactions (Dunham, Mullin et al. 2012, Kean et al. 2012).
1.7.4. Data acquisition methods As mentioned above, traditional affinity-purification coupled MS (AP-MS) is performed using data-dependent acquisition (DDA), where peptides are ionized and selected for fragmentation based on signal intensity, usually 4 or 5 most intense precursor ions are selected for fragmentation. In contrast, in data independent acquisition (DIA), many peptide ions are concurrently selected and fragmented, and all the spectra are recorded. An example of DIA is Sequential window acquisition of all theoretical spectra (SWATH) MS where peptide ions are sequentially isolated in smaller mass windows and fragmented so that virtually all ions are recorded. Another acquisition method is targeted data acquisition where a pre-determined peptide ion is selected and fragmented, and the intensities of this ion are recorded. An example of targeted data acquisition is multiple reaction monitoring (MRM). MRM and SWATH MS are used in this thesis and will be covered in more details in the following sections (Mann and Jensen 2003).
1.7.5 Multiple Reaction Monitoring (MRM) MS has long been used to identify phosphorylation sites because the addition of a phosphate group changes the mass of the protein by 80 Da. Recent advances in targeted MS has allowed for label-free phospho-proteomic studies. MRM has been applied for the targeted detection and quantification of phosphopeptides. By inhibiting kinases or phosphatases, with either RNAi mediated knockdown or with chemical inhibitors, changes in ion abundance corresponding to a specific potential phospho-peptide can be monitored (Mann and Jensen 2003). MRM is a label- free MS2 targeted quantification approach. In MRM mode, first MS scans the full mass range
37 and this is followed by full MS2 scans on a fixed precursor, to quantify the abundance of the target ion of interest. MRM allows for high selectivity and sensitivity for the target ion, however, it requires manual input (initial discovery phase) in precursor selection and it can only quantify what is expected to be present in the sample. After data acquisition, the chromatographs of sequence specific ions are collected, and by comparing the chromatographic peak ratios between different treatments the relative abundance of a peptide can be assessed. (Mann and Jensen 2003, Domon and Aebersold 2006).
1.7.6 Sequential window acquisition of all theoretical spectra (SWATH) In SWATH acquisition mode, fragment ion spectra of all precursor ions are collected. Data are then mined retrospectively using data-dependent acquisition spectra of bait of interest (also called reference spectral libraries). SWATH employs a wider mass-isolation range at MS step but a tighter extraction window at the MS2 step to maintain high specificity. SWATH-MS offers higher throughput but lower sensitivity as compared to MRM. It allows for high proteomic coverage from a single LC-MS run and requires no assay development at the MS steps. All data is acquired and targets are mined post-acquisition. Data generated provides a permanent record of the whole sample, enabling future re-analysis. SWATH is especially ideal for study of protein-protein interactions associated with disease-associated mutations on a systematic level. It allows the monitoring of changes in protein interaction in a quantitative manner. In traditional AP-MS/MS used for identifying protein interaction (data dependent approach) peptide ions sequenced are selected based on the relative abundance of precursor ions in a given sample (from MS1 to MS2, the top 5 most abundant ions are usually selected). In contrast, SWATH is not limited to abundance of ions in MS1. In this thesis, SWATH was used to study changes in protein-protein interactions for KIF7 mutations that have been associated with human diseases. Statistical analysis used for SWATH in this thesis is based on the protocol from Lambert et al. (Gillet et al. 2012, Collins et al. 2013, Lambert et al. 2013).
38
1.8 Objectives of thesis
In vertebrates, Kif7 has been described to have both negative and positive roles during Hh signalling for neural tube patterning, limb morphogenesis, chondrogenesis and hair follicle development. Mutations in KIF7 have been identified in various human ciliopathies and developmental disorders. However, the precise molecular mechanisms underlying the positive and negative roles of Kif7, its biochemical and regulatory mechanisms and how the disease causing mutations affect Kif7-dependent processes are poorly understood. More work is thus needed to further understand how Hh pathway activation influences Kif7 trafficking in the cilia and how this, in turn, affects Gli localization, processing and function to regulate Hh-target genes expression. The overall aim of this thesis project is to better understand how Kif7 and its associated proteins function within the vertebrate Hh signalling pathway. A mass spectrometry- based proteomic analysis was first conducted to identify novel proteins associated with Kif7. Novel interactors of Kif7, Liprin-α1 (PPFIA1) and PP2A were identified. Biochemical and functional characterization of the Kif7-PPFIA1-PP2A interaction was subsequently carried out to better understand the role PPFIA1 and PP2A in controlling Kif7 localization in primary cilia and Hh pathway activation. Furthermore, comparative proteomic analyses were conducted to determine whether disease causing KIF7 mutations led to change in the interaction with interacting proteins. Secondly, through a candidate identification approach, we identified DYRK2 as a kinase that plays a role in Kif7 function. Through biochemical assays, we further examined gain and loss of functions of DYRK2 on Kif7 function. Lastly, we examined the functional relationship between Kif7 and SuFu, two key negative regulators of the pathway. Overall, this thesis aims to study Kif7 functions using proteomic and biochemical approaches.
39
Chapter 2: Kif7 phosphorylation regulates its ciliary trafficking and Hedgehog signalling
Majority of the figures in this chapter are reproduced from Yulu C. Liu, Amber L. Couzens, Ashish R. Deshwar, Linda D. B. McBroom-Cerajewski, Xiaoyun Zhang, Vijitha Puviindran, Ian C. Scott, Anne-Claude Gingras, Chi-chung Hui, and Stephane Angers. The PPFIA1-PP2A protein complex promotes Kif7 ciliary trafficking and Hedgehog Signalling. Science Signalling. 7, ra117 (2014).
All experiments and data analysis were performed by Y.C Liu except for the following. MRM and SWATH mass spectrometry analysis were performed by A.L Couzens and A-C Gingras. L.D.B. McBroom-Cerajewski and A-C Gingras performed LC-MS/MS on PPFIA1. A.R. Deshwar and I.C Scott performed the in vivo Zebrafish work. X. Zhang, V. Puviindran, and C-C Hui generated plasmids, cell lines and antibodies, and participated in discussion of data. Y.C Liu and S. Angers wrote the manuscript together with input from all authors.
40
2.1 Abstract
The Hedgehog (Hh) signalling pathway is most studied in flies and mice through genetic analysis. The biochemical and molecular mechanism of how the pathway functions is poorly defined. One key effector of the pathway Kif7 was shown to have both positive and negative functions through genetic studies. To better study Kif7’s function in mechanistic detail, we used a mass spectrometry based proteomic approach and identified Liprin- α1 (PPFIA1) and the PP2A protein phosphatase as Kif7-interacting proteins. We further showed that PPFIA1-PP2A function to regulate Kif7 phosphorylation, a modification that is important for the trafficking of Kif7 and Gli to the tips of cilia and for the transcriptional output of Hh signalling. Furthermore, mutations in KIF7 have been identified in ciliopathies. Using mass spectrometry based proteomic approach we examined the defects in protein interactions in disease mutations. We found one mutation of KIF7 exhibited defects in PPFIA1 binding, Kif7 ciliary trafficking and Hh target gene activation. Collectively, these studies highlight the importance of Kif7 and ciliary trafficking in mammalian Hh signalling and in human diseases.
2.2 Introduction
Kinesin family member 7 (Kif7) was first identified as important for mammalian Hh signalling in 2009 with genetic studies published from three labs showing Hh defects in Kif7 knock-out mice (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009). Subsequently, KIF7 mutations affecting Hh signalling and cilia functions were found in human ciliopathies (Dafinger, Liebau et al. 2011, Putoux, Thomas et al. 2011). Genetic studies suggest Kif7 has both positive and negative roles in neural tube patterning, limb morphogenesis (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009, Law et al. 2012), chondrogenesis (Hsu, Zhang et al. 2011) and hair follicle development (Li, Nieuwenhuis et al. 2012). These studies revealed that Kif7 interacts with Gli proteins and accumulates at the tips of primary cilia when the Hh pathway is active. Examination of Kif7 -/- mouse embryonic fibroblasts (MEFs) revealed reduced Gli3 R (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009) and decreased Hh-promoted accumulation of Gli at the tips of primary cilia (Endoh-Yamagami, Evangelista et al. 2009)
41 suggesting that Kif7 may be important for these processes. The precise molecular mechanisms underlying the positive and negative roles of Kif7, its biochemical and regulatory mechanisms and how the disease causing mutations affect Kif7 dependent processes are poorly understood. More work is thus needed to further understand how pathway activation influences Kif7 trafficking in cilia and how this, in turn, affects Gli localization and Hh-target genes expression.
Here we used Kif7 -/- and Ptch1 -/- MEFs to study the mechanisms of Kif7 during Hh signalling. We report that in MEFs, Kif7 fulfilled a predominantly positive role downstream of Smo activation as it promoted the ciliary tips accumulation of Gli proteins and the induction of Gli target genes. We identified post-translational modification, phosphorylation on Kif7 as important for its function. We further identified PPFIA1 and PP2A as proteins involved in Kif7 phosphorylation. Our results indicated that Kif7 phosphorylation dictated its subcellular localization at the tips of primary cilia and determined whether it inhibited or activated Hh signalling. Our findings are consistent with a model in which Smo activation is coupled to the trafficking of Kif7 and Gli proteins at cilia tips and to their transcriptional output through the de- phosphorylation of Kif7 mediated by PP2A.
2.3 Methods
2.3.1 Antibodies and reagents
Antibodies were purchased from the following vendors: mouse anti-HA.11 clone 16B12 (Covance); mouse anti-FLAG, mouse anti–beta-Tubulin clone TUB 2.1, mouse anti-acetylated- Tubulin clone 6-11B-1, anti-gamma Tubulin clone GTU-88 (Sigma-Aldrich); rabbit anti-Gli3 (Santa Cruz, Sc20688, for immunofluorescence), rabbit anti-GFP (Santa Cruz , Sc8334), goat anti-PPFIA1 (Santa Cruz, Sc54039), goat anti-Vangl1 (sc-46557, Santa Cruz) was used as IgG control. Goat anti-Gli3 (EMD Millipore, AF3690, for Western blot); rabbit anti-Pericentrin (Abcam, ab4448); rabbit anti-Smo (LSBio, LS-A2668). Goat anti-Gli2 (R&D AF3635, for Western blot). Rabbit anti-Kif7 (Cheung, Zhang et al. 2009). Rabbit anti-Gli2 (for immunofluorescence) (Li, Nieuwenhuis et al. 2012). Rat anti-PPP2AC (Abcam ab77830). Rabbit anti-PPP2R1A (Cell Signalling, #2041). Secondary antibodies conjugated to Alexa
42
Fluor 488, 594, and 647 were purchased from Life Technologies. Secondary antibodies conjugated to horseradish peroxidase were purchased from Jackson ImmunoResearch Laboratories, Inc. Okadaic acid sodium salt was purchased from Bioshop Canada Inc (209266- 80-8) and was used at 50nM for 3h for all experiment, except for MRM experiments where cells were treated at 150nM for 2.5h. GANT-61 (Tocris) was used at 5µM for 6h, Cyclopamine was used at 1µM for 24h, and SAG (Sc-212905 Santa Cruz) was used at 200nM for 24h for all experiments except for endogenous co-immunoprecipitation experiment where SAG was added for 1.5h. Phos-tag Acrylamide Aqueous solution (Wako, 304-93526) was used according to manufacturer’s instructions.
2.3.2 Tissue culture, transfections, and lentiviral transductions
HEK293T, HEK293-Flp-in-Trex, MEF, and C3H10T1/2 cells were cultured in DMEM supplemented with 10% FBS (Sigma-Aldrich), and penicillin/streptomycin. HEK293T and HEK293-Flp-in-Trex cells were transfected using PEI (Polysciences Inc. Cat #23966). All lentiviral particles were produced in HEK293T cells by cotransfection of VSV-G (3 µg), psPAX2 (8 µg), and lentiviral plasmids (8 µg) in 30–40% confluent monolayer cell culture grown in 10-cm plates. Media containing virus particles were collected after 24 and 48h. C3H10T1/12 or MEF cells were subsequently transduced in the presence of 10 µg/ml polybrene (Sigma- Aldrich). 24h after infection the viral media was replaced with fresh DMEM 10% FBS media where appropriate cells were selected with puromycin (2 µg/ml) or hygromycin (0.2mg/ml) 48h after viral infection. For experiments with MEF or C3H10T1/2 cells, cells were grown to confluency then serum starved with 0.5% FBS in DMEM to induce ciliogenesis for 24-48h. Primary Kif7 -/- MEFs were immortalized through overexpression of SV40 large T antigen by retroviral transduction.
2.3.3 shRNAs
MISSION shRNA clones in the lentiviral plasmid pLKO.1-puro were acquired from Sigma- Aldrich. Kif7 shRNA clones TRCN0000090438 and TRCN0000090439 labeled as Kif7
43 shRNAs #1 and #2 respectively. PPFIA1 shRNA clones TRCN0000251544 and TRCN0000251546 labeled as PPFIA1 #1 and #2. Smo shRNA clone TRCN0000026312 labeled as Smo was also from Sigma-Aldrich. Sequences of shRNAs used are listed in Table S3.
2.3.4 Plasmids pEGPF-mKif7, pEGFP-mKif7delN (647-1348), and pEGFP-mKif7delC(1-724) have been previously described (Cheung, Zhang et al. 2009). Kif7GFP was cloned into the pLenti-puro plasmid. Human Kif7 delN (674-1349) was PCR-amplified from a brain cDNA library and was cloned into the pIRES-puro-FLAG plasmid. The Lenti-mKif7GFP and Lenti-FLAG-mKif7 mutants were generated by QuikChange PCR mutagenesis. Ciliopathy mutations are named according to human KIF7 mutations; for the corresponding mouse Kif7 mutations see Table S3. pCDNA5.1-FLAG-hPPFIA1 and FLAG-PPP2R1A were obtained from the Gingras Lab. The respective cDNAs were PCR amplified from Mammalian Gene Collection clones and Gateway cloned into pDEST 5’ Triple FLAG and pcDNA5/FRT/TO. hPPFIA1 was also subcloned into the pIRES-puro-Strep-HA plasmid. For truncation mutations of Kif7 and PPFIA1 see Table S3. All PCR-amplified regions were verified by sequencing. pBABE-neo largeT cDNA was obtained from Addgene and used to immortalize the Kif7 -/- MEFs. Primers used for cloning are listed in Table S1. Detailed descriptions of the different plasmids and sequences are provided upon request.
2.3.5 Generation of C3H10T1/2 knock-out cell lines with CRISPR-Cas9 system sgRNAs targeting mKif7 and mPpfia1 were selected and cloned in px330 according to instructions from (http://www.genome-engineering.org/crispr/) (Cong et al. 2013). Kif7 or PPFIA1 homology arms surrounding the predicted sgRNA cut location were amplified by PCR from mouse genomic DNA and cloned into a donor plasmid designed to introduce a puromycin resistance expression cassette through homologous recombination (HR). C3H10T1/2 cells were transfected with px330 and the HR donor plasmid with Lipofectamine 2000 (Life Technologies). Cells were selected with puromycin 48h post transfection. Single-cells were
44 isolated by serial dilution and screened by PCR for homozygous disruption of the targeted alleles. Sequences for the sgRNA and the primers used for cloning are listed in Table S1.
2.3.6 RT-PCR and quantitative real-time PCR
Total RNA was extracted from cells using TRIzol (Life Technologies) according to the manufacturer’s instructions. For cDNA synthesis, 2 µg of total RNA was reverse transcribed using random primers and Superscript II reverse transcription (Life Technologies). Real-time PCR was performed in a 7900HT Fast Real-Time PCR system using 2.5 µl of the synthesized cDNA product plus the SYBR Green and primers mix in a final volume of 20 µl (Life Technologies). SYBR gene expression assays (Applied Biosystems) were used to measure the mRNA expression of genes in triplicate. Mean relative gene expression was determined using the ∆∆ Ct method normalized to Cyclophilin mRNA (Bookout et al. 2006). Primers used are listed in Table S1. qPCR figures present averages and SEM of 3 independent experiments.
2.3.7 Affinity purification, immunoprecipitation, and Western blot analysis
Cells were lysed and protein complexes affinity purified using Streptavidin sepharose beads (GE Healthcare) or anti-FLAG M2 agarose beads (Sigma-Aldrich), or immunoprecipitated with the indicated antibodies. In brief, cells were solubilized in lysis buffer containing 0.1% NP-40, 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 10 mM NaF, 0.25 mM Na 3VO 3, 100 mM β-glycerophosphate, and protease inhibitor cocktail (Sigma) for 1h at 4°C. Lysates were spun down at 20,000g for 10min at 4°C. Supernatants were collected and affinity purified with antibodies or with appropriate affinity resins for 24h, followed by extensive washing of the beads with lysis buffer. Co-purified proteins were eluted from the beads at 95°C for 10min using 4× Laemmli buffer containing β-mercaptoethanol (Sigma-Aldrich), resolved by SDS- PAGE, and transferred onto nitrocellulose or PVDF membranes (Pall) for Western blot analysis.
2.3.8 Zebrafish morpholino experiments
45
Zebrafish microinjection and handling were carried out using standard techniques. Translation blocking morpholinos were obtained for both Kif7 (5’ GCCGACTCCTTTTGGAGACATAGCT 3’) and PPFIA1 (5’ GGTGGGCATCACCTCGCACATCATC 3’) from Gene-Tools. The Kif7 MO has been previously characterized (Putoux, Thomas et al. 2011). 8ng of either Kif7 or Ppfia1 MO were injected per embryo. Embryos were imaged at 30hpf and for each embryo a single somite in the middle of the yolk extension was chosen for quantification. Somite angles were measured using ImageJ software. Two batches of embryos were analyzed.
2.3.9 Immunofluorescence microscopy and image acquisition
Cells grown on coverslips were fixed with cold 100% methanol for 5 min. Coverslips were covered with antibodies in 1% normal donkey serum in PBS overnight at 4°C. Slides were mounted on coverslips using Vectashield mounting media (Vector Laboratories). Laser scanning confocal images were acquired using a Plan-Apochromat 63×/1.4 NA oil immersion objective on a confocal microscope (LSM700; Carl Zeiss) operated ZEN software. eGFP/Alexa Fluor 488, Alexa Fluor 594, and Alexa Fluor 647 fluorophores were excited individually with 488- , 543-, 638-nm lasers, respectively, with appropriate filter sets. Uncompressed images were processed with Zeiss ZEN software Black edition. To quantify cilium tip localization, images were taken as Z-stacks and rendered as 3D projections. Cilia with Kif7 or Gli at the tips were counted (30 cells in 10-15 independent images were used for each condition). Cilia tips localization was expressed as the percentage of cilia exhibiting Kif7 or Gli proteins localization at the tips. Average and SEM were calculated from 3 independent experiments. % of protein of interest at cilium tip was analyzed with Fisher's Exact Test.
2.3.10 FLAG Affinity purification protocol for mass spectrometry
Lysates of HEK293T cells expressing FLAG-hKif7, FLAG- hPPFIA1, FLAG-hGli3 were processed as previously described using the M2-FLAG magnetic bead affinity purification protocol and on-bead-digest (Kean, Couzens et al. 2012). 25% of the volume of the digested sample was analyzed on a TripleTOF 5600 (AB SCIEX), using a Nanoflex cHiPLCsystem at 200 nL/min (Eksigent ChromXP C18 3 µm x 75µm x 15 cm column chip). Buffer A was 0.1%
46 formic acid in water; buffer B was 0.1% formic acid in ACN. The HPLC delivered an acetonitrile gradient over 120 min (2-35% buffer B over 85 min, 40-60% buffer B over 5 min, 60-90% buffer B over 5 min, hold buffer B at 90% 8 min, and return to 2% B at 105 min). The parameters for acquisition were 1 MS scan (250 ms; mass range 400-1250) followed by up to 50 MS/MS scans (50 ms each). Candidate ions between charge states 2-5 and above a minimum threshold of 200 counts per second were isolated using a window of 0.7 amu. Previous candidate ions were dynamically excluded for 20 sec with a 50 mDa window.
2.3.11 Mass spectrometry data acquisition and analysis
TripleTOF 5600 .wiff files were converted to .mgf format using ProteinPilot software before being saved into ProHits (Liu, Zhang et al. 2010). Files were analyzed with the iProphet pipeline (Shteynberg et al. 2011) implemented within ProHits as follows. The database consisted in the human and adenovirus complements of the RefSeq protein database (version 57) supplemented with “common contaminants” from the Max Planck Institute (http://maxquant.org/downloads.htm) and the Global Proteome Machine (GPM; http://www.thegpm.org/crap/index.html). The search database consisted of forward and reverse sequences (labeled “gi|9999” and more recently “DECOY”); in total 72226 entries were searched. The search engines used were Mascot (2.3.02; Matrix Science) and Comet (2012.01 rev.3), with trypsin specificity (2 missed cleavages were allowed) and deamidation (NQ) and oxidation as variable modifications. Charges +1, +2 and +3 were allowed, and the precursor mass tolerance was set at 50ppm while the fragment bin tolerance was set at 0.6 amu. The resulting Comet and Mascot search results were individually processed by PeptideProphet (Keller, Nesvizhskii et al. 2002), and combined into a final iProphet output using the Trans- Proteomic Pipeline (Linux version, v0.0 Development trunk rev 0, Build 201303061711). TPP options were as follows: general options are -p0.05 -x20 -d"gi|9999", iProphet options are – ipPRIME and PeptideProphet options are –OpdP. The general TPP options were -p0.05 -x20 - PPM -d"DECOY". All proteins with a minimal iProphet probability of 0.05 were parsed to the relational module of ProHits. Note that for analysis with SAINT, only proteins with iProphet protein probability > 0.95 are considered. This corresponds to an estimated FDR of ~0.5%. To identify significant interaction partners from the affinity purification data, the data were
47 subjected to SAINT analysis (Choi et al. 2012) implemented in ProHits using SAINTexpress Proteins with average SAINT score (AvgP) greater than 0.98 were considered to be statistically significant. Artifact proteins (such as trypsin and keratin) were manually curated from the final interaction partner list (Table 2-1).
2.3.12 MRM- Affinity purification for mass spectrometry
Affinity purification was performed as described above using the on-bead-digest protocol, with minor modifications. Briefly, cell pellets were lysed by resuspension in 1:4 (pellet weight/volume) ratio of lysis buffer (50mM HEPES-KOH (pH 8.0), 100mM KCl, 2mM EDTA, 0.1% NP40, 10% glycerol, 1mM PMSF, 1mM DTT, 15nM Ca, 15nM OA and 1X protease inhibitor cocktail (Sigma; P8340) followed by two freeze/thaw cycles. Clarified lysate was immunoprecipitated with 25µL of magnetic anti-FLAG M2 beads (Sigma) for 2 hours at 4°C. One wash with 1mL of lysis buffer was then performed followed by an additional wash with
1mL of 20mM Tris-HCl pH8 2mM CaCl 2. For mass spectrometry analysis, 7.5µL of 20mM Tris-HCl pH8 containing 750ng of trypsin (Sigma; resuspended at 100ng/µl in Tris buffer) was added, and the mixture was incubated at 37°C with agitation for 15 hours. The next morning, the tubes were quickly centrifuged, the beads the magnetized and the partially digested sample transferred to a fresh tube before addition of an extra 2.5µL of 20mM Tris-HCl pH8 containing 250ng trypsin. The samples were incubated for 3 hours at 37°C before addition of 1µL of 50% formic acid. The samples were stored at -80°C until analysis.
2.3.13 MRM- Mass spectrometry data acquisition
Samples were analyzed on the 5600 TripleTOF in two phases: (i) Data dependent acquisition (DDA) and (ii) high resolution multiple reaction monitoring (MRM HR ) using the same gradient conditions and the same amounts of sample. For DDA, one quarter of the volume of the digested sample was analyzed using a packed tip emitter at 200 nL/min. Buffer A was 0.1% formic acid in water; buffer B was 0.1% formic acid in ACN. The HPLC delivered an acetonitrile gradient over 120 min (2-35% buffer B over 85 min, 40-60% buffer B over 5 min, 60-90% buffer B over
48
5 min, hold buffer B at 90% 8 min, and return to 2% B at 105min). The DDA parameters for acquisition on the TripleTOF 5600: were 1 MS scan (250ms; mass range 400-1250) followed by up to 20 MS/MS scans (50ms each). Candidate ions between a 2-5 charge state and above a minimum threshold of 200 counts per second were isolated using a window of 0.7amu. Previous candidate ions were dynamically excluded for 20sec with a 50mDa window. Data from the DDA analysis were searched with (2.3.02; Matrix Science) with trypsin specificity (3 missed cleavages were allowed) and deamidation (NQ), oxidation and phosphorylation (STY) as variable modifications. Charges +2, +3 and +4 were allowed, and the parent mass tolerance was set at 50 ppm while the fragment bin tolerance was set at 0.15Da, Kif7 peptides containing sites of phosphorylation, along with several control peptides (Table S1) were included in a subsequent targeted MRM HR analysis. MS/MS resulting from the MRM HR acquisition was used to quantify intensities between OA treated and control samples.
2.3.14 SWATH
SWATH sample preparation and data analysis were done according to Lamert et al (Lambert, Ivosev et al. 2013). Briefly, 2x15cm plates of HEK293T cells stably expressing FLAG-mKif7 wild-type or point mutant were collected. FLAG-GFP cells were used as control.
2.3.15 Statistical analysis
The quantification of cilium tip localization was analyzed by Fisher's Exact Test. qPCR and somite angles data were analyzed by Student's T test (GraphPad). All statistical analysis was considered significant at p < 0.05.
49
2.4 Results
2.4.1 Kif7 promotes Gli ciliary localization and Hh signalling
Previous work has shown that Kif7 accumulates at the tips of primary cilia upon Hh pathway activation, and that in Kif7 -/- MEFs there is a decreased Hh-promoted accumulation of Gli3 at the tips of primary cilia. This suggests that Kif7 may be required for the ciliary trafficking of Gli proteins (Endoh-Yamagami, Evangelista et al. 2009). To directly test this, we showed that upon activation of Hedgehog signalling with the Smo agonist SAG, the trafficking of Gli2 and Gli3 to the tips of cilia, but not the accumulation of Smo, was decreased in Kif7 -/- MEFs (Figure 2-1A). The lentiviral delivery of Kif7-GFP in Kif7 -/-MEFs rescued Kif7 and Gli ciliary localization to the tips of cilia upon SAG treatment (Figure 2-1B, C). In the absence of stimulation with SAG, overexpression of Kif7GFP was not sufficient to promote localization of Gli proteins to the tips of cilia or to induce Gli1 mRNA expression (Figure 2-1B, D). In Kif7 -/-MEFs, the basal expression of the Hh target gene Gli1 was minimally affected but its induction by SAG treatment was compromised when compared to MEFs reconstituted with Kif7 (Figure 2-1E). This result suggested that the formation of Gli A is impaired in the absence of Kif7. We conclude that, during Hh pathway activation, Kif7 promotes the localization of Gli proteins at the tips of cilia and that in MEFs Kif7 chiefly exerts a positive signalling role.
50
A -/- B Kif7 MEFs Kif7 -/- MEFs + Kif7GFP NT NT SAG 80 SAG Acet Tub Gli2 Acet Tub Gli3 Acet Tub Smo 90 * * Acet Tub Kif7GFP Acet Tub Gli2 Acet Tub Gli3 80 70 70 60 * * 60 50 - SAG
50 -SAG 40 40 30 30 20 20 10 10 +SAG
+SAG 0 % of% cellswith Gli cilia in Smo or NT SAG NT SAG NT SAG 0 NT SAG NT SAGNT SAG
Gli2 Gli3 Smo of% cellswith Kif7Gli or tips at the of cilia Kif7 Gli2 Gli3 C D
)
)
% 300
(
R
12
C
n
P -/- -/- -/- o MEFs Kif7 MEFs + i Kif7 MEFs Kif7 MEFs+ q 250
s ( 10
s
s
Kif7GFP Kif7GFP e
e
r
u
p
l 8 200
x a - Kif7GFP WB: α-GFP e -180kDa v
A T 6 WB: α-Kif7 150
C - Kif7 N
R
∆
4 m A 100
WB: α-Tubulin -50kDa 1 N
i
l
R -50kDa
2 WB: α-Tubulin G
m
e 50
v
7
N.D i
f
i 0 t
K a -/- -/- l 0 Kif7 Kif7 e -/- R MEFs Kif7 MEFs MEFs + MEFs + Kif7GFP E Kif7GFP 120 Kif7 -/- MEFs Kif7 -/- MEFs+Kif7GFP 100
80
60
40
20 Relative mRNA Gli1 expression (%) 0 SAG (hr): 0 4 6 12 24
Figure 2-1. Loss of Kif7 impairs Gli trafficking and Gli1 mRNA induction. A) The SAG- induced accumulation of Gli2 and Gli3 at the tips of cilia is impaired in Kif7 -/- MEFs, whereas the SAG-induced ciliary accumulation of Smo is unaffected. B) Stable expression of Kif7-GFP in Kif7 -/-MEFs ( Kif7 -/-MEFs+Kif7GFP) rescues the normal localization of Kif7, Gli2 and Gli3 to the tips of cilia following SAG treatment. C) Western blot confirming expression of Kif7GFP in the rescued cells (Left) and qPCR confirming absence of Kif7 mRNA in Kif7 -/- MEFs and rescued levels in Kif7 -/- MEFs + Kif7GFP (Right). D) Western blot comparing expression level of endogenous Kif7 in MEFs and overexpression of Kif7GFP in Kif7 -/- MEFs (Left) and qPCR comparing expression level of Gli1 mRNA in MEFs and in overexpression of Kif7GFP in Kif7 -/- MEFs (Right). E) The time and SAG dependent induction of the Hh target gene Gli1 is impaired in Kif7 -/-MEFs but is rescued in Kif7 -/-MEFs+Kif7GFP. Gli1 mRNA expression was calculated relative to that in Kif7 -/- MEFs + Kif7GFP treated with SAG for 24 h. ∆CT value is calculated by subtracting CT value of cyclophilin from CT value of Kif7. qPCR data are represented as mean + SEM across 3 biological replicates. Western blot figures are representative of 3 independent repeats. N.D, not detectable. Quantification of ciliary tips localization and qPCR
51 data are presented as mean + SEM across 3 biological replicates. NT: non-treated control. *p<0.05. Scale bars, 1µm.
2.4.2 Proteomic analysis of Kif7 identified PPFIA1 and PP2A as novel interactors
To further understand the regulation and functional importance of protein trafficking during Hh signalling, we used mass spectrometry to sample the composition of Gli3- and Kif7-containing protein complexes purified from mammalian cells (Figure 2-2A, B and Table 2-1). Gli3 interacted with the Hh signalling regulators SuFu and Kif7. Consistent with the localization of Kif7 in cilia, several centrosome and basal body proteins were identified in Kif7 complexes. We also identified Liprin-α1 (PPFIA1), a member of the Liprin family of scaffolding proteins previously recognized for their role in synaptogenesis, in Kif7 purifications (Stryker and Johnson 2007). In support of this finding, Kif7 was detected in PPFIA1 immunoprecipitates by LC-MS/MS and endogenous Kif7 and PPFIA1 coimmunoprecipitated (Figure 2-2 C). Stimulation of cells with the Smo agonist SAG increased the interaction between PPFIA1 and Kif7 (Figure 2-2C), hinting that formation of this complex is important during Hh signalling. Domain mapping experiments using different Kif7 and PPFIA1 mutants showed that these proteins interacted through their coiled-coil domains (Figure 2-8). Consistent with previous reports (Arroyo, Lee et al. 2008, Glatter, Wepf et al. 2009, Goudreault, D'Ambrosio et al. 2009), several peptides assigned to regulatory and catalytic subunits of PP2A were identified in PPFIA1 immunoprecipitates. Endogenous regulatory PP2A subunit PPP2R1A could only be co- immunoprecipitated together with FLAG-Kif7 when PPFIA1 was over-expressed in cells (Figure 2-2 D). These results suggested that Kif7 interacts indirectly with the PP2A phosphatase through binding to PPFIA1. We conclude that PPFIA1 and the PP2A phosphatase form a protein complex with Kif7.
52
53
Figure 2-2. Mass spectrometry analysis of Kif7, Gli3, and PPFIA1 protein complexes. A) Heat map representation of high-confidence Kif7, Gli3, and PPFIA1 interacting proteins identified by FLAG IP-MS. Sum of the spectral counts across two biological replicates for each of the bait is represented as a colour code and sorted from highest to lowest spectral counts for the PPFIA1 bait. B) Cytoscape representation of Kif7, Gli3, and PPFIA1 interactomes. Red edges indicate that the protein-protein interaction has been previously reported. See the inset for the legend. C) Co-immunoprecipitation of endogenous Kif7 with PPFIA1 from lysates of MEFs treated or not with SAG. Right, quantification of 3 independent experiments. D) Co- immunoprecipitation of regulatory subunit of PP2A (PPP2R1A) and FLAG-Kif7 with or without overexpression of Strep-HA-PPFIA1. The interaction of Kif7 with PPP2R1A was only detected by western blot when PPFIA1 was overexpressed. Western blots are representative of 3 biological replicates. NT: non-treated.
2.4.3 PPFIA1 is required for efficient trafficking of Kif7, Gli2 and Gli3 to the tips of cilia and for Hh signalling
PPFIA1 plays important roles in transporting cargoes in neurons (Wyszynski et al. 2002). In this context, PPFIA1 interacts with and recruits cargo vesicles to the neuron specific kinesin motor protein Kif1A (Shin et al. 2003). Drosophila and C. elegans PPFIA1 homologs stimulate kinesins by promoting their activity and/or specific subcellular localization (Miller et al. 2005, Wagner et al. 2009, Hsu et al. 2011). This led us to hypothesize that PPFIA1 could promote Kif7 trafficking in cilia and consequently impinge on the localization of Gli proteins and on Hh signalling. Consistent with this notion and confirming previous large-scale proteomic results (Liu, Tan et al. 2007, Ishikawa et al. 2012), we found that PPFIA1 localized to the basal body and to the cilia axoneme (Figure 2-3A). Specificity of the PPFIA1 antibody is shown in Figure Figure 2-9A. PPFIA1 basal body/cilia localization did not change in response to Smo modulation, suggesting its localization is not Hh responsive (Figure 2-3B).
We found that 42% of MEFs stably expressing Kif7GFP and stimulated with SAG exhibited Kif7 localization at the tips of cilia (Figure 2-3C and D, left panel). We next determined that, of the four Liprin-alpha genes ( Ppfia1-Ppfia4 ), MEFs express predominantly Ppfia1 with trace
54 amounts of the other 3 Ppfia genes (Figure 2-9B). Depletion of Ppfia1 using two independent shRNAs (Figure 2-9C) significantly reduced the percentage of cells with Kif7 localization at the tips of cilia upon stimulation of the pathway with SAG (Figure 2-3C, quantification in D). Knockdown of Smo resulted in a similar reduction in ciliary tips localization of Kif7 (Figure 2- 3C and D). To rule out off-target effects, we stably expressed human PPFIA1 following infection of cells with the shRNA that targets mouse Ppfia1 , which rescued Kif7 trafficking to the tips of cilia (Figure 2-3H, left). Efficiency of rescue is shown in Figure 2-9D. We also introduced Kif7-GFP into MEF cells derived from Ptch1 -/- knockout mice ( Ptch1 -/-.MEFs), which exhibit constitutive Hh pathway activity (Vorechovsky et al. 1997), and found that 57% of cells had constitutive Kif7 localization at the tips of cilia (Figure 2-3C and D, right panel). Depletion of Ppfia1 or Smo using shRNAs or inhibition of pathway activity using the Smo antagonist cyclopamine similarly decreased the proportion of Ptch1 -/- MEFs with Kif7 at the tips of cilia (Figure 2-3D, right panel). These results suggest that PPFIA1 promotes the localization of Kif7 to the tips of cilia during Hh signalling.
Our results demonstrated that Kif7 was required for robust ciliary trafficking of Gli proteins and target gene induction during activation of the Hh pathway (Figure 2-1). Since depletion of Ppfia1 inhibited Kif7 trafficking to the tips of cilia during pathway activation, we predicted that this would also affect Gli2 and Gli3 localization and consequently Hh target gene activation. Knockdown of Kif7 or Ppfia1 in MEFs and Ptch1 -/-MEFs both repressed the SAG-induced and the constitutive localization of Gli2 and Gli3 to the tips of cilia in these cells, respectively (Figure 2-3E and quantification in F). Depletion of Ppfia1 inhibited the SAG-induced Gli1 mRNA expression in MEFs and its constitutive activation in Ptch1 -/- MEFs to similar amounts obtained with Kif7 knockdown (Figure 2-3G), and this was rescued upon overexpression of hPPFIA1 (Figure 2-3H, right), thereby supporting a requirement for PPFIA1 during Hh pathway activation. Furthermore, C3H10T1/2 cell lines with homozygous disruption of Ppfia1 or Kif7 using the CRISPR-Cas9 (Cong, Ran et al. 2013) gene editing system showed an attenuated response to SAG that was partially rescued upon expression of cDNAs encoding PPFIA1 or Kif7 (Figure 2-3I). Ppfia1 -/- cells exhibited a reduction in Gli3 R formation similar to that seen in Kif7 -/- cells (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009)(Figure 2-3J).
55
A B C D Ptch1 -/- MEFs Ptch1 -/- MEFs MEFs NT Kif7GFP Acet Tub Pericentrin SAG 70 60 50 PPFIA1 Acet Tub Pericentrin 50 60
F
E 40
40 M 50
F E 30 M 30 * 40 the cilia 20 G A * S * + 30 * 10 F 20 E * % % of cells with PPFIA1 in
M * 0 20
F 10 e E T in N M 10
E
m -
/ a - *
p 1
o % of cells with Kif7 cilia at the tips of % of cells with Kif7 cilia at the tips of l h
c c 0 y t 0
C P shRNA: 1 shRNA: 1 2 e d d # #2 o ed # # o n le le 1 m l 1 1 m i b b A 1 S b IA A S m m FI IA m F I a a am P F ra P F p cr cr P P c P PP lo S S P S yc C E F NT -/- 90 MEFs 90 Ptch1 MEFs Acet Tub Gli2 Acet Tub Gli3 SAG 80 80
F 70
E 70
M 60 60
50 * 50 G * * A * S * 40 * + *
40 * *
F
E * * * 30 * * M 30 * * * 20 20 * *
F
E
M
- 10
/ - 10
1
h % % of cells with Gli3atGli2 or the tips cilia of % of cells with Gli3atGli2 or the tips cilia of
c t 0 P 0 * 1 1 1 2 1 2 1 e shRNA: d d #1 2 # 2 d ed 1 2 # 2 shRNA: d # # # 2 e d 1 # # #2 n le le # 1 # le l # # 1 # le 7 7 1 # in le # 1 i b b f7 f7 1 b b f7 7 1 b if if 1 b 7 if7 1 m i i IA A m i if IA A m K K IA A m if K IA IA a am am K K F FI am a K K F FI a F FI a m K F F p P P r cr P P cr P P op a P P lo Scr Scr P P Sc S P P S P P l cr P P c yc S y C C Gli2 Gli3 Gli2 Gli3
G MEFs NT Ptch1 -/- MEFs H MEFs MEFs NT
SAG s 200 SAG p 70
i
120 t
120
e 60
h
t 160 100 100
t
a 50
7
a
f 80 80 i i 120
l
i K 40
c
(%)
h
f t *
60 60 i * o 30
w 80 *
* * s
* * l 40 * 40 l 20
e
expression (%) expression *
c expression (%) expression 40 * f Relative Gli1 mRNA 20 20 10
o Relative Gli1 mRNA
% 0 0 0 Relative mRNA Gli1 expression 0 1 2 shRNA: d d 1 2 1 2 shRNA: d 1 2 1 2 shRNA d 2 shRNA d d # 1 e le # # # # e # # # # le # IA le le IA l b 1 l 7 1 b 1 F b b 1 F b f7 f7 A 1 b if f7 A 1 + cDNA A P + cDNA IA m i i I IA m i I IA m I P m m F P am a K K F F a K K F F ra F h ra ra P P r cr P r P P c P c c P h c S P P c P P S P + S S + S P S 2 2 # # 1 1 IA IA F F P P I J P P C3H10T1/2 C3H10T1/2 NT 1) C3H10T1/2 WT 120 120 SAG 2) C3H10T1/2 Ppfia1 KO 3) C3H10T1/2 Kif7 KO 100 100 1 2 3 80 80 WB: α-Gli2 60 60 - Gli3FL
40 40 * 20 20 WB: α-Gli3
Relative mRNA Gli1 expression (%) Relative mRNA Gli1 expression (%) * 0 0 T T O f7 T T O 1 W W K i W W K IA 7 k 1 F - Gli3R if + a P k fi P O p h K p 7 + if O k K WB: α-Tubulin 1 a fi p 1. WT 1. WT p 2. Kif7 KO 2. ppfia1KO 3. Kif7 KO + Kif7 3. ppfia1 KO + hPPFIA1 1 2 3 1 2 3 WB: α-Kif7 WB: α-PPFIA1
WB: α-Tubulin WB: α-Tubulin
56
Figure 2-3. PPFIA1 is required for localization of Kif7 and Gli proteins to the tips of cilia and for Hh signalling. A) PPFIA1 localizes to the primary cilium. Indirect immunofluorescence images of MEFs stained for PPFIA1 (green), acetylated Tubulin (red) and Pericentrin (blue). B) PPFIA1 cilia localization quantification in Ptch1 -/-MEFs, treated or not with cyclopamine. C) Immunofluorescence images of MEFs (top and middle) and Ptch1 -/- MEFs (bottom) expressing Kif7GFP (green) stained for acetylated Tubulin (red) and Pericentrin (blue). D) shRNA-mediated knockdown of Ppfia1 or Smo impaired the ciliary tips localization of Kif7 during activation of the Hh pathway in MEFs (left) and in Ptch1 -/-MEFs (right). E) Immunofluorescence images of fixed MEFs and Ptch1 -/- MEFs stained for Gli2 and Gli3 (green) and acetylated Tubulin (red). F) Knockdown of Kif7 or Ppfia1 with shRNAs impaired the SAG- promoted and constitutive localization of Gli2 and Gli3 at the tips of cilia in MEFs (left) cells and in Ptch1 -/-MEFs (right) respectively. G) shRNA-mediated depletion of Kif7 or Ppfia1 impairs Gli1 mRNA induction by SAG (left) or in Ptch1 -/- MEFs (right). Control is the max activation of Gli1 by SAG. H) The Kif7 ciliary tips localization defects seen upon knockdown of mPpfia1 are rescued upon over-expression of hPPFIA1 (left). Decrease in SAG-promoted Gli1 mRNA expression in cells expressing knockdown of mPpfia1 is rescued upon overexpression of hPPFIA1 (Right). I) CRISPR-Cas9 mediated knockout (KO) of Kif7 (left) or Ppfia1 (right) in C3H10T1/2 cells impaired Gli1 mRNA induction with SAG. Gli1 mRNA expression was calculated relative to that in SAG-treated wild-type cells. Wester blots showing expressing of Kif7 or PPFIA1 are at the bottom. J) Western blot for Gli2 and Gli3 in C3H10T1/2 WT, Kif7 KO and Ppfia1 KO. Quantification of ciliary tips localization, qPCR data are presented as mean + SEM across 3 biological replicates. *p<0.05. Bars, 1µm. Western blots are representative of 3 biological replicates.
2.4.4 Loss of Kif7 or PPFIA1 results in somite angle defect in zebrafish embryos
Lastly, to further examine the role of PPFIA1 in Hh signal transduction, we asked if morpholino-mediated knockdown of Ppfia1 in zebrafish would phenocopy the somitogenesis defects caused by interference with Kif7 function or with other Hh pathway components (Wolff et al. 2003, Putoux, Thomas et al. 2011). In zebrafish the amount of Hh signalling influences the
57 fates of skeletal muscle cells. High amounts of Hh signalling is required for specification of muscle pioneer cells, slow muscle cells require intermediate amounts of Hh activity, and fast muscle cells form in the absence of Hh activity (Wolff, Roy et al. 2003). Improper regulation of Hh signalling therefore leads to defective somitogenesis with individual somite losing their characteristic chevron shape. Injection of morpholinos targeting Kif7 or Ppfia1 into embryos led to similar phenotypes (Figure 2-4, quantification on the right) with morphant embryos having significantly wider somite angles ( Kif7 : 96.6°, Ppfia1: 104.6°) than control morpholino-injected embryos (83.7°). Our data suggest that loss of Ppfia1 phenocopies loss of Kif7 in vivo . We conclude that PPFIA1 positively affects Hh signalling by promoting the localization of Kif7 and Gli proteins in the tips of cilia.
Control Kif7 Ppfia1 120 * 110 * 100
90 Somite Angle Somite 80
70 Control kif7 Ppfia1 Morpholinos
Figure 2-4. Loss of Kif7 or PPFIA1 results in somite angle defects. Representative images of whole embryos (top) or magnified views of dotted area (bottom) injected with control, Kif7 , or Ppfia1 morpholinos at the 1 cell stage. Images were taken at 30h post-fertilization. In control- injected embryos, somites have a stereotypic chevron shape whereas they are abnormal in Kif7 or Ppfia1 morphant embryos. Quantification of somite angles (bottom panel). n=20 embryos per condition, two batches of embryos were analyzed. Data are presented as mean + SEM, *p<0.05.
2.4.5 The PP2A inhibitor okadaic acid inhibits Kif7 and Gli trafficking in cilia and blocks Hh signalling
Endogenous PPFIA1 coimmunoprecipitated with the catalytic subunit of PP2A (PP2Ac) from MEF lysates (Figure 2-5A), thus supporting our mass spectrometry data. We used okadaic acid, an inhibitor of the PP1 and PP2A-family of serine threonine phosphatases, to test for the
58 potential involvement of PP2A in ciliary trafficking of Kif7, Gli2, and Gli3 as well as for Hh pathway activity. Okadaic acid treatment inhibited the SAG-induced or constitutive accumulation of Kif7 (Figure 2-5B) and Gli2 and Gli3 (Figure 2-5C) at the tips of cilia in MEFs and Ptch1 -/-MEFs respectively. As a control, we showed that the ciliary accumulation of Smo was not affected by okadaic acid in both Ptch1 -/-MEF (left) and MEF (right) cells (Figure 2-5D). Consistent with a requirement of Kif7 and Gli proteins trafficking in cilia for pathway activation, okadaic acid treatment inhibited the induction of Gli1 mRNA in response to SAG treatment (Figure 2-5E). Consistent with the role of Kif7 in Gli R formation, okadaic acid treatment slightly decreased Gli3 R abundance without altering the amount of the full-length forms of Gli2 or Gli3 (Figure 2-5F). These results suggest the possibility that PP2A activity is required during Hh signalling to promote the ciliary tip trafficking of Kif7 and Gli proteins.
59
A IP Input PPFIA1IgG WB: α-PPFIA1
WB: α-PP2Ac B C MEFs Ptch1 -/- MEFs MEFs Ptch1 -/- MEFs NT NT SAG SAG 60 70 80 100 70 50 60 80 60 50 40 50 60 40 30 40 30 30 * 40 * 20 * at the tips of the tipscilia at of 20 * the cilia at of tips * * * 20
% % of cellswith Gli2/Gli3 of% cells withGli2/Gli3 20 10 10 10
% of% cells with Kif7 the tipscilia at of 0 of% cells with Kif7 the tipscilia at of 0 0 0 Okadaic Acid: - + - + Okadaic Acid: - + Okadaic Acid: - - + - - + Okadaic Acid: - + - + Gli2 Gli3 Gli2 Gli3 D NT Ptch1 -/- MEFs MEFs SAG 10 0 80
a
a
i i
l l
i 80 i
c c 60
n n
i i
o 60 o
m m
S
S
40
h h
t t i 40 i
w w
s s
l l
l
l
e e 20 c 20 c
f f
o o
% % 0 0 le id 1 1 le id le id ic e c # # ic c ic c h in a A A h a h a e m ic N N e ic e ic V a a R R V a V a p d h h d d o a s s a a cl k f7 1 k k y O i A O O C K FI P P E F Ptch1 -/- MEFs MEFs Vehicle Okadaic acid NT WB: α-Gli2 -Gli2FL 120 SAG 120 -Gli3 FL 100 100 WB: α-Gli3 80 80 60 60 40 40 * 20 20 * * -Gli3R 0 0 Relative Gli1 mRNA(%) expression Relative Gli1 mRNA(%) expression le e id Okadaic Acid: - + - + ic in c WB: α-Tubulin h m a e a ic V p a lo d c a y k C O
60
Figure 2-5. The protein phosphatase PP2A promotes Hh signalling through control of Kif7 and Gli proteins localization at the tips of cilia. A) Co-immunoprecipitation of PPFIA1 and the catalytic subunit of PP2A (PP2Ac) from MEF lysate. The PP2A inhibitor okadaic acid inhibits the localization of Kif7 (B) or Gli2 and Gli3 (C) to the tips of cilia in SAG-treated MEFs or in Ptch1 -/- MEFs. D) Treatment of Ptch1 -/- MEFs with okadaic acid, Kif7 shRNA #1 or PPFIA shRNA #1 has no effect on the constitutive localization of Smo in cilia (left), okadaic acid does not inhibit the SAG-induced ciliary localization of Smo in MEFs (right). E) Okadaic acid inhibits the activation of the Hh target gene Gli1 by SAG in MEFs or its constitutive activation in Ptch1 -/-MEFs. Gli1 mRNA expression was calculated relative to that in SAG- treated MEFs or untreated Ptch1 -/-MEFs. F) Western blot of Gli2 and Gli3 in MEF cells treated with okadaic acid. Okadaic acid treatment slightly inhibits Gli3 R formation. Quantification of cilia tips or Smo cilia localization and qPCR data are presented as mean + SEM across 3 biological replicates. Western blot is representative of 3 biological replicates. NT: non- treated.*p<0.05.
2.4.6 Kif7 de-phosphorylation promotes its localization at the tip of primary cilium and Hh signalling.
The above results identify Kif7 as a putative target of PP2A and suggest that post-translational control of Kif7 phosphorylation may be important for its localization at the tips of cilia and for Hh signalling. Stimulation of C3H10T1/2 cells with SAG resulted in a decrease in Kif7 phosphorylation as determined by faster migration of the Kif7 immunoreactive band on phos- tag-containing gels (Figure 2-6A, left). In contrast, treatment of Ptch1 -/-MEFs with the Smo antagonist cyclopamine led to an upward shift of Kif7, suggesting that Kif7 is phosphorylated when the pathway is inhibited (Figure 2-6A, right). Mass spectrometry of FLAG-Kif7 immunopurified from HEK293T cells identified 3 phosphorylation sites that corresponded to mouse Ser 897 , Ser 969 , and Ser 1337 . We then designed a targeted high-resolution multiple reaction monitoring (MRM HR ) mass spectrometry method to quantify the abundance of each of these phosphopeptides in FLAG-Kif7 immunoprecipitates. The abundance of the C-terminal 1330- 1339 phosphopeptide that contains phosphorylated Ser 1332 (which corresponds to phosphorylated Ser 1337 in mouse Kif7) was the only phosphopeptide that showed varying
61 abundance according to okadaic acid treatment suggesting that phosphorylation of this residue might be dependent on PP2A (Figure 2-6B, Table 2-2). The abundance of the non- phosphorylated version of these peptides and of three other non-phosphorylated control peptides used as internal standards did not substantially vary (Figure 2-6B, 2-10A and Table 2-2). We then expressed Kif7-wild-type and Kif7-S1337A in MEFs and determined that the electrophoretic mobility of the Kif7-S1337A mutant was faster than Kif7-wild-type when using phos-tag-containing gels suggesting that this site was indeed targeted by phosphorylation (Figure 2-6C).
To investigate the functional importance of phosphorylation of Ser 1337 for Kif7 function, we generated MEFs stably expressing the Kif7-S1337A-GFP or Kif7-S1337D-GFP point mutants that mimic the un-phosphorylated and phosphorylated states of this residue respectively. Expressions of the GFP fusion proteins are shown in Figure 2-10B. A large proportion of cells (~44%) exhibited constitutive, ligand-independent localization of Kif7-S1337A to the tips of cilia (Figure 2-6D, quantification on the right). Conversely, Kif7-S1337D did not localize at the tips of cilia in a ligand-independent fashion but its localization to cilia tips was impaired in SAG-treated MEFs when compared to wild type Kif7 (Figure 2-6F). Since we showed that Gli proteins were cargoes of Kif7 in cilia (Figure 2-1), we reasoned that their ciliary tips localization should also be affected in cells expressing the Kif7 mutants. Expression of Kif7-S1337A was indeed sufficient to induce the accumulation of Gli2 and Gli3 at the tips of cilia (Figure 2-7D, middle graph), whereas expression of Kif7-S1337D reduced the localization of Gli2 and Gli3 at the tips of cilia in SAG-stimulated MEFs (Figure 2-7F, second panel).
Because the Kif7-S1337A mutant is constitutively at the tips of cilia, a localization that correlates with the state of activation of the Hh pathway, we next tested whether its expression is sufficient to activate Hh signalling. In MEFs, stable expression of Kif7-S1337A, but not wild- type Kif7, led to robust 30 fold induction of Gli1 mRNA abundance (Figure 2-7D, third panel). Other Hh target genes, such as Ptch1 and Hhip , were also induced upon Kif7-S1337A expression (Figure 2-6E). Moreover, the constitutive ciliary localization of Kif7-S1337A (left) and its ability to activate Hh signalling (right) were Smo-independent since the Smo antagonist cyclopamine had no effect (Figures 2-6G). However, the Gli inhibitor GANT-61 (Lauth, Bergstrom et al. 2007) partially inhibited the Kif7-S1337A dependent Gli1 mRNA induction (Figure 2-6G left). Reciprocally, expression of Kif7-S1337D decreased SAG-induced
62 localization of Gli proteins at the tips of cilia and Gli1 mRNA induction (Figure 2-6F, middle and right panel). A form of Kif7 with similar mutations at another phosphosite Ser 969 did not show altered ciliary tips localization and expression of this mutant did not affect the induction of Gli1 (Figure 2-10C and D). Furthermore, expression of Kif7-S1337A in either Kif7 -/- or Ppfia1 -/- cells was also sufficient to increase Gli1 mRNA (Figure 2-6H).
Our mass spectrometry analysis thus identified Ser 1337 as an okadaic acid-sensitive Kif7 phosphorylation site. Since Hh signalling is inhibited by okadaic acid and Kif7-S1337D expression and activated by Kif7-S1337A expression, we surmised that PP2A inhibition could lead to phosphorylation of Ser 1337 and that PP2A-mediated de-phosphorylation of Kif7 at this residue could be required for Kif7 localization to the tips of cilia and Hh target gene activation. Our results showed that Kif7-S1337A-mediated activation of Gli1 transcription or its ligand- independent localization at the tips of cilia were unaffected by okadaic acid treatment (Figure 2- 6I). Thus, Kif7-Ser 1337 de-phosphorylation appears to be a key step in Kif7 trafficking to the tips of cilia and our results suggest that PP2A-mediated de-phosphorylation of this residue is required for Gli-mediated transcriptional output.
63
Non-t reated A B 1.00E+07 C3H10T1/2 Ptch1 -/- MEF 150nM Okadaic acid Non-phospho peptide NT SAG NT Cyclopamine 1.00E+06 Phospho peptide WB: α-Kif7
1.00E+05
y t
i 1.00E+04
s
n e
t 1.00E+03
C n MEF I Kif7: WT S1337A 1.00E+02 WB: α-Kif7 1.00E+01
1.00E+00
hKif7 peptide Sequence D E
MEFs MEFs n n
o 700 100 0
o i
60 * i
60 3000 s
s s * s GFP Acet Tub Pericentrin * e
600 e
* r * 50 r
50 * 2500 p 800
p
x x
e 500 40 e 40 2000 A
A 600 N
400 N )
GFP
) R
- R
30 30 % 1500 %
A
m
(
m (
300
1 400
1
p i
20 20 1000 h
c h
200 t H P 200
at the tips of cilia at the tips of e at the tips of cilia the tips at of
10 10 500 e v % of % cells with Kif7
if7-S1337 100
v
i
i t
K t
% of % cells withGli2/Gli3
a
a l
0 0 0 0 l 0
e
e R Kif7: T A Kif7: T A T A T A R W 7 W 7 W 7 Kif7: W 7 Kif7: T A Kif7: T A
3 3 3 Relative mRNA Gli1 (%) expression 3 3 3 3 3 W 37 W 37 S1 S1 S1 S1 3 3 S1 S1 Gli2 Gli3 F G
MEFs MEFs MEFs a Kif7-S1337A Kif7-S1337A i
) l
NT i c 140
%
60
( f
60 120 SAG o
n
60
o s 120
i p
50 s i
s
50 100 t
50 e
r e 100
p h
t 40
x
40 80 t
40 e
a 80
A
7 f
30 N 30 30 60 i *
* R K 60
m h
* t i 20 20 40 * 20 1
i
l
w 40
G s
at the tips of thecilia at tips of l at the tips of thecilia at tips of
e l
% of % cellswith Kif7 10 10 * 20 10
v e
i 20 c
t
% of % cells with Gli2/Gli3 f
a
l
0 0 o
0 0 e 0 Relative mRNA Gli1 expression (%)
R
T T D D % Kif7: W W 7 7 Kif7: T T D D T T D D Kif7: T T D 1 e 1 e 3 3 W W 7 7 W W 7 7 W 7 T 6 n T 6 n 3 3 3 3 3 3 W 3 N T- i N T- i S1 S1 3 3 3 3 3 m m S1 S1 S1 S1 1 N a N a S A p A p G lo G lo c c Gli2 Gli3 y y C C H I Ppfia1 KO C3H10T1/2 Kif7 -/- MEFs Kif7-S1337A Kif7-S1337A
n
n
o
o
i i 140 0 1400 150
* s 50
s
s * s
e
e
r r 1200 1200
p
p
x 40
x
e e 1000 1000
A
A 100
)
N
) N 800 30
800 R
R
%
%
(
(
m
m
600 600 1 1
i
i
l l 20
G G 400 50
400 e
e at the tips of thetipscilia at of
v
v
i % of cells with Kif7
i
t t 200 10 200 a a
l
l
e
e
R R 0 0 Relative mRNA Gli1 (%) expression 0 0 Kif7:T A Kif7: T A W 7 W 7 Okadaic Acid: - + Okadaic Acid: - + 33 33 S1 S1
64
Figure 2-6. Kif7 phosphorylation dictates its ciliary tip localization and Hh signalling. A) Western blots of lysates from C3H10T1/2 cells treated or not with SAG (Left), or from Ptch1 -/- MEFs treated or not with cyclopamine (Right) using phos-tag gels and anti-Kif7 antibodies. B) The abundance of three Kif7 phosphorylation sites was quantified by MRM HR in cells treated or not with okadaic acid. Both the non-phosphorylated (grey) and phosphorylated peptides (blue) were quantified. Numbering refers to the amino acid positions in human Kif7. The dashed box indicates the only peptide (containing Ser 1332 in human and Ser 1337 in mouse Kif7) whose abundance was increased by okadaic acid treatment. *Denotes phospho serine. The amounts indicated are from a representative MRM experiment; for the results of the second experiment see Table 2-2. C) Western blots of lysates from MEFs over-expressing Kif7-WT or Kif7- S1337A mutant using phos-tag gel and anti-Kif7 antibodies. D) Kif7-S1337A mutant exhibits constitutive localization at the tips of cilia in MEFs (first and second panels). Expression of Kif7-S1337A also leads to ligand-independent localization of Gli2 and Gli3 to the tips of cilia (third panel). Kif7-S1337A expression is sufficient to induce Gli1 mRNA expression, which was calculated relative to that in cells expressing wild-type Kif7 (fourth panel). E) Kif7-S1337A expression activates Hh target genes Hhip1 and Ptch1 . F) The Kif7-S1337D mutant displays impaired ciliary tips localization in response to SAG treatment compared to Kif7 wild-type (left). Expression of this mutant inhibits the ciliary tips localization of Gli proteins (middle) and the SAG-mediated activation of Gli1 mRNA expression, which was calculated relative to SAG- treated cells expressing wild-type Kif7 (right). G) Kif7-S1337A ciliary tips localization is independent of Gli signalling (no effect of GANT-61) or Smo activation (no effect of cyclopamine) (left), activation of Hh signalling by Kif7-S1337A expression requires Gli (inhibited by GANT-61) but not Smo (cyclopamine has no effect)(right). H) Kif7-S1337A expression activates Gli1 mRNA in Ppfia1 -/- C3H10T1/2 (left) and in Kif7 -/- MEFs (right). I) Okadaic acid treatment does not inhibit the induction of Gli1 mRNA expression in cells expressing the Kif7-S1337A mutant (left) or its constitutive ciliary tips localization (right) suggesting that PP2A could be modifying this residue. Gli1 mRNA expression was calculated relative to untreated cells. Quantification of ciliary tips localization and qPCR data are presented as means + SEM across 3 biological replicates. Western blot figure is representative of 3 biological replicates. NT: non-treated control. *p<0.05. Bar, 1µm.
65
2.4.7 Increased PPFIA- Kif7 association in Kif7 ciliopathy mutant
Mutations in Kif7 have been identified in various human ciliopathies including acrocallosal syndrome, Bardet–Biedl syndrome, Meckel syndrome and hydrolethalus (Putoux, Thomas et al. 2011, Putoux, Nampoothiri et al. 2012). Some of these mutations occur in the coil-coiled domain of Kif7 that we mapped as the PPFIA1 binding site. We derived stable cell lines expressing four randomly selected coiled-coil mutant Kif7 proteins and performed data dependent (FLAG-AP/MS) and data independent SWATH-MS to determine whether the mutations affected the association of Kif7-interacting proteins (Figure 2-7A). The immunoprecipitates for Kif7-L759P (mouse Kif7-L764P), a mutation found in Bardet–Biedl syndrome, contained an increased number of peptides corresponding to PPFIA1 and PP2A subunits as compared to wild type kif7 suggesting increased association of this mutant Kif7 for the PPFIA1-PP2A complex (Figure 2-7B). This result was further confirmed by SWATH-MS (Lambert, Ivosev et al. 2013), cells stably expressing Kif7-L759P showed increase peptide abundance of Liprin and PP2A family proteins as compare to wild-type Kif7 or other Kif7 mutants (Figure 2-7C & Figure 2-11). I hypothesized that in the mutant L759P cell line, Kif7- PPFIA1 interaction might be enhanced. Indeed, by immunoprecipitation, Kif7-L759P showed increased precipitation of endogenous PPFIA1 when compared to wild-type Kif7 (Figure 2-7D). We hypothesized that enhanced binding of Kif7-L759P to the PPFIA1-PP2A complex would promote its de-phosphorylation and localization at ciliary tips. 32% of MEFs expressing Kif7- L759P-GFP exhibited ligand-independent localization of Kif7-L759P at the tips of cilia (Figure 2-7E). Expression of Kif7-L759P was sufficient to induce Gli1 expression 7-fold compared to wild-type although it was expressed at lower amounts (Figure 2-7F). Disease-causing Kif7 mutations result in decreased Gli3 R production (Putoux, Thomas et al. 2011) and we found that cells expressing the L759P mutant also exhibited decreased Gli3 R abundance (Figure 2-7G). Together these results suggest that some of the Kif7 human mutations may directly or indirectly affect ciliary tips localization and activity by altering its phosphorylation state.
66
A B C Kinesin Motor Hit WT P632L R641G R702Q L759P Liprin
KIF7 617 + 160 580 + 182 635+ 331 651 + 130 378 + 93 P632L R641G R702Q L759P Phosphatase Neck Tail PPFIA1 40 + 4 45 + 4 36 + 4 60 + 11 100 + 11 KIF7 Confidence PPP2R1A 7 + 2 12 + 0.3 10 + 4 17 + 3 28 + 2 PPFIBP1 Fold change PPP2CA 4 +1 6 +1 6 + 0.3 8 + 3 15 + 3 PPFIA1 P632L R641G R702Q L759P PPFIA3 3 +2 4 + 2 5 + 4 3 + 2 19 + 7 fold change (log10) PPFIBP1 3 + 0.3 13 +7 10 + 2 25 + 10 35 + 4 PPP2CA −1.2 confidence 1.2 PPP2R2A 2 +1 1 + 1 3 + 2 0 + 0 2 + 1 PPP2R5C PPP2R5C 0 + 0 3 + 1 2 + 1 10 + 4 17 + 3 PPP2R1A 0 1 D E F G
1. HEK293T FLAG Kif7-WT * 40 2000 Kif7: WT S1337A S1337D L759P Kif7: WT S1337A S1337D L759P 2. HEK293T FLAG Kif7-L759P * - Gli3FL 30 1500 WB: α-Gli2 1 2 WB: α-Gli3 IP: FLAG WB: α-PPFIA1 20 1000 WB: α-Tubulin
(%) - Gli3R IP: FLAG cilia of WB: α-FLAG 10 500 Input WB: α-Tubulin WB: α-PPFIA1 0 0 % of% cells with Kif7 thetips at
RelativemRNA Gli1 expression P T P T A 9 Kif7: 9 Kif7: W 37 5 W 5 3 7 7 1 L L S WB: α-GFP (Kif7) WB: α-Tubulin
Figure 2-7. Disease causing Kif7 mutations lead to increased interaction of Kif7 with the PPFIA1-PP2A complex. A) Four disease causing KIF7 mutants found in human ciliopathies. B) The protein-protein interaction profiles of the Kif7 mutants were compared to Kif7-WT using FLAG AP-MS. More peptides attributed to PPFIA1 and subunits of PP2A were identified in Kif7-L759P immunoprecipitates than in Kif7-WT immunoprecipitates. Mean sum of total peptide +SEM across 3 independent experiments are listed in the table. C) SWATH-MS analysis of 293T cells expressing FLAG-Kif7-WT and four disease causing mutants. Data were mined in retrospective using FLAG-Kif7 spectra reference libraries generated before. D) Lysates of cells stably expressing FLAG-Kif7-WT or FLAG-Kif7-L759P were immunoprecipitated with FLAG antibodies and probed with anti-PPFIA1 antibodies using western blotting. E) The Kif7-L759P mutant stably expressed in MEFs localizes to the tips of primary cilia in a ligand-independent manner. F) Kif7-L759P expression leads to intermediate amounts of ligand independent Gli1 activation compared to the phosphorylation-deficient Kif7- S1337A mutant. G) Western blots of Gli2 (right) and Gli3 (left) in Kif7 WT, S1337A, S1337D, and L759P mutants in MEFs. Gli1 mRNA expression was calculated relative to that in cells expressing wild-type Kif7. Quantification of ciliary tip localization and qPCR data are presented as mean + SEM across 3 independent experiments. Western blot figures are representative of 3 biological replicates. *p<0.05.
67
2.5 Discussion
How the signalling information carried by Hh ligands is transduced from active Smo to regulation of Gli proteins is poorly understood. Trafficking of Gli proteins from the base to the tip of the primary cilium, a process thought to involve Kif7, leads to dissociation of Gli proteins from the negative regulator SuFu to allow for their nuclear translocation and activation of target genes. Kif7 is important for the localization of Gli proteins at the tips of cilia during pathway activation (Endoh-Yamagami, Evangelista et al. 2009), although it has been unclear whether Kif7 is directly required for Hh-ligand activation of Gli signalling. In the present study, we found that in Kif7 -/-MEFs or Kif7 -/-C3H10T1/2 cells, the ability of SAG to promote the accumulation of Gli proteins at the tips of cilia and to induce expression of the Hh target gene Gli1 is compromised. In the absence of ligand, Kif7 promotes Gli R formation and redundantly functions with SuFu to repress Gli activity (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009). The dual negative and positive roles of Kif7 thus reflect its function in trafficking Gli proteins in cilia under resting conditions and during Hh- dependent activation to underlie Gli R and Gli A formation respectively. We note that Kif7 deficiency in Kif7 -/-MEFs or Kif7 -/-C3H10T1/2 cells does not result in increased ligand- independent pathway activation suggesting that Kif7 principally fulfills a positive role in these contexts and that SuFu amounts are likely sufficient to inhibit Gli. The use of these cell systems enabled us to specifically study the mechanisms by which Kif7 positively promotes Hh signalling. Our results differ from similar experiments that suggest the induction of Gli1 expression by Hh is relatively normal in MEFs derived from Kif7 -/- mice (Endoh-Yamagami, Evangelista et al. 2009). The reason for this discrepancy is unclear but could be due to heterogeneity in Hh responsiveness of different MEF cultures (wild type MEFs compared to Kif7 -/- MEFs) or differences in Shh compared to SAG treatment. Nevertheless, our results that Gli protein trafficking to tips of cilia and robust SAG-induced Gli1 activation were restored when Kif7 was reintroduced into Kif7 -/- MEFs combined with the blunting of the SAG-mediated response when we knock out Kif7 in C3H10T1/2 cells indicate that Kif7 is required for efficient Hh signal transduction in these contexts. However, since the ligand-promoted response is not completely eliminated, possible redundant mechanisms supporting Gli activation may exist. Kif7 has been implicated in the organization of the cilium tip (He, Subramanian et al. 2014). In this study, loss of Kif7 results in redistribution of Gli2 from the cilium tip to the axoneme.
68
Although we observed a strong reduction of Gli2 and Gli3 localization at the tips of cilia in Kif7 mutant cells, we do not observe a localization of these proteins to the axoneme. A difference in antibody sensitivity is a possible explanation for these differences.
Using mass spectrometry, we identified PPFIA1 and PP2A as Kif7-interacting proteins. Using loss of function experiments, we showed that PPFIA1 is required for Kif7 function. Indeed, in addition to inhibiting localization of Kif7 at the cilium tip during pathway activation, knockdown of Ppfia1 phenocopied several defects seen upon loss of Kif7 function, including reduced accumulation of Gli proteins at the tips of cilia, lower induction of the Gli1 target gene and defective somitogenesis in zebrafish embryos.
The protein phosphatase PP2A has previously been linked to Hh signalling in Drosophila where it appears to have multiple roles in dictating signalling output. For instance mts, which encodes the PP2A catalytic subunit in flies, has been identified as a gene required for Hh signalling in a siRNA screen (Casso, Liu et al. 2008). Subsequent studies have shown that mts interacts with and de-phosphorylates Smo (Su et al. 2011) and Ci (Jia, Liu et al. 2009), leading to inhibition and activation of Hh signalling respectively. PP2A also appears to be required for mammalian Hh signalling as it is required for Hh-dependent activation of COUP-TFII (Krishnan, Pereira et al. 1997). In the present study, treatment of MEFs with the PP1 and PP2A inhibitor okadaic acid inhibited the trafficking of Kif7 and Gli proteins to the tips of primary cilia, and the activation of Hh-dependent target genes without affecting Hh-dependent localization of Smo in cilia. These results suggest that PP2A acts downstream of Smo but upstream of Gli to activate vertebrate Hh signalling . Whether other phosphatases are involved in Hh signalling and Kif7 trafficking remain to be tested. Combined with the identification of the Kif7-PPFIA1-PP2A interaction, this led us to test Kif7 as a possible substrate of PP2A. PPFIA1 interacts with the neuron specific motor protein Kif1A (Shin, Wyszynski et al. 2003, Hsu, Moncaleano et al. 2011) and stimulates the trafficking of synaptic vesicles (Miller, DeProto et al. 2005, Wagner, Esposito et al. 2009). Our discovery that the phosphorylation dictates localization of Kif7 raises the possibility that this may represents a more general mechanism that controls kinesin function in diverse contexts. Similar to Kif7, the C-terminus of Kif1A contains a serine residue flanked by several arginine amino acids, suggesting that a similar regulation may occur. However, unlike conventional kinesins, which directionally move along microtubule tracks, the motor domain of Kif7 inhibits microtubule growth by influencing microtubule plus-end dynamics (He, Subramanian et al.
69
2014). Whether Kif7 phosphorylation influences its tubulin dynamics activity remains to be evaluated.
Although several aspects are conserved between Drosophila and vertebrate Hh signalling, differences exist. The evolutionary adaptation of the primary cilium as a hub directing Gli proteins processing and Hh signalling in vertebrate is likely a reason underlying these differences. In flies, the Kif7 homologue Cos2 also mediates both positive and negative functions during Hh signalling (Lum, Zhang et al. 2003, Zhou and Kalderon 2010). Upon pathway activation, Cos2 is rapidly phosphorylated by Fused, a phosphorylation event that triggers the redistribution of Cos2 from the cytoplasm to the plasma membrane, as well as the magnitude of pathway activation through Ci nuclear translocation and transcriptional activity (Ranieri et al. 2012). Analogous to Drosophila Hh signalling, we report here that Kif7 phosphorylation also directs its subcellular localization and the transcriptional output of the pathway. Unlike flies however, vertebrate Kif7 is phosphorylated under basal conditions and is de-phosphorylated during Hh signalling; thus, phosphorylation is a post-translational modification that controls Kif7 accumulation at the tips of primary cilia. Since Fused is dispensable for mammalian Hh signalling, the kinase that is responsible for Kif7 phosphorylation remains to be determined.
Genetic studies have identified several KIF7 mutations in patients with hydrolethalus, Joubert, Bardet-Biedl and Acrocallosal syndromes. Defects in Gli target gene expression and impaired Gli3 processing confirm that Hh signalling is defective in these disorders. KIF7 mutations also induce Golgi fragmentation, centrosome duplications and ciliogenesis defects suggesting that Kif7 may also have additional Hh-independent roles contributing to disease (Dafinger, Liebau et al. 2011). How these disease-causing mutations perturb Kif7 functions is unknown. Results from our study suggest that in the case of at least one mutation Kif7-L759P, found in Bardet- Biedl Syndrome, the association with the PPFIA1-PP2A complex is promoted and this leads to increased localization of Kif7 at the cilium tip and ligand-independent activation of Gli1 transcription. In the light of these findings, whether other disease-causing mutations affect Hh pathway activity by influencing protein-protein interactions, Kif7 phosphorylation and/or ciliary localization needs to be examined.
70
2.6 Supplementary Data
A B
mKif7 Strep-HA-PPFIA1 binding hKif7 Strep-HA-PPFIA1 binding ++ ++ Lane 1 Kif7 FL (1-1348) Motor domain Coiled-coil domain Lane 1 Kif7 (542 -1343) Coiled-coil domain
Lane 2 Kif7delN (647-1348) + Lane 2 Kif7 (698 -1343) ++
Lane 3 Kif7delC (1-724) - Lane 3 Kif7 (1057 -1343)
Lane 4 Kif7 (1109 -1343)
Strep-HA-PPFIA1 + + + + + + + Kif7GFP + - - Strep-HA-PPFIA1 Strep-HA-PPFIA1 + - + - Kif7delNGFP - + - FLAG-Kif7 (542 -1343) FLAG-Kif7 (1057 -1343) FLAG-Kif7 (698 -1343) - + FLAG-Kif7 (1109 -1343) - + Kif7delCGFP - - + 1 2 3 Lane: 1 2 Lane 3 4 Lane - 95 kDa - 180 kDa AP: Strep-HA Kif7 AP: Strep-HA Kif7 WB: α-FLAG AP: Strep-HA WB: α-FLAG WB: α-GFP AP: Strep-HA - 180 kDa AP: Strep-HA PPFIA1 - 180 kDa Kif7delN WB: α-HA PPFIA1 WB: α-HA AP: Strep-HA - 180 kDa - 95 kDa Lysates Kif7 - 35 kDa WB: α-HA Lysates WB: α-FLAG - 180 kDa WB: α-FLAG Lysates WB: α-GFP
C D
Kif7GFP binding Kif7GFP binding
Coiled-coil domain SAM SAM SAM ++ Lane 1 PPFIA1 FL (1-1202) Coiled-coil domain SAM SAM SAM ++ Lane 1 PPFIA1 FL (1-1202)
++ Lane 2 PPFIA1 del1 (1-1051) + Lane 2 PPFIA1 delN1 (215-1202)
Lane 3 PPFIA1 del2 (1-1027) + Lane 3 PPFIA1 delN2 (522-1202) -
Lane 4 PPFIA1 del3 (1-944) + Lane 4 PPFIA1 delN3 (700-1202) -
Lane 5 PPFIA1 del4 (1-847) - Lane 5 PPFIA1 delN4 (830-1202) -
Strep-HA-PPFIA1 FL + - - - - Kif7GFP + + + + + Strep-HA-PPFIA1 del1 - + - - - Strep-HA-PPFIA1 FL + - - - - Strep-HA-PPFIA1 del 2 - - + - - Strep-HA-PPFIA1 delN1 - + - - - Strep-HA-PPFIA1 del 3 - - - + - Strep-HA-PPFIA1 delN2 - - + - - Strep-HA-PPFIA1 del 4 - - - - + Strep-HA-PPFIA1 delN3 - - - + - + + + + + Strep-HA-PPFIA1 delN4 - - - - + Lane 1 2 3 4 5 Lane: 1 2 3 4 5 - 180kDa AP: Strep-HA AP: Strep-HA Kif7 - 180kDa WB: α-GFP Kif7 WB: α-GFP PPFIA1 - 180kDa - 180kDa PPFIA1 AP: Strep-HA AP: Strep-HA WB: α-HA WB: α-HA
Lysates - 180kDa Lysates - 180kDa WB: α-GFP WB: α-GFP Kif7
71
Figure 2-8. PPFIA1 and Kif7 interact through their coiled-coil domains. HEK293T cells were transfected with the indicated expression plasmids and cell lysates were affinity purified using Streptavidin beads followed by Western blotting. A) PPFIA1 interacts with the C-terminal domain (647- 1348) of Kif7 that contains coiled-coil domains. B) PPFIA1 interacts with amino acids 698-1057 of Kif7 C-terminal domain. C) Deletion of PPFIA1 C-terminal SAM domains does not interfere with Kif7 binding. D) Deletion of PPFIA1 N-terminal coiled-coil domain impairs Kif7 binding. All figures are representative of 3 independent repeats.
72
A B 200
MEF Pppfia1 shRNA )
%
( Merge PPFIA1 only
n
o
i
s
s 150
e Acet tubulin r
p
x
Pericentrin e
PPFIA1 A N 100
R
m
1
a
i
f
p
P 50
e
v
i
t
a
l
e R 0 Liprin-alpha: Ppfia1 Ppfia2 Ppfia3 Ppfia4 Ppfia1 Ppfia2 Ppfia3 Ppfia4
C C3H10T1/2 MEF
MEFs 120 120 120 100 100 100 80 80 80 60 60 60 * 40 * 40 * 40 * 20 20 * 20
0 0 Relative mRNA Smo (%) expression 0 Relative mRNA Ppfia1 (%) expression d 1 Relative mRNA Kif7 (%) expression shRNA:e # 2 shRNA:d 1 2 shRNA: d o l # le # # le b 1 1 7 7 m IA b if f b S m F IA m K i m ra P F a K a c P P cr cr S P S S
Ptch1 -/- MEFs 140 140 120 120 120 100 100 100 80 80 80 60 60 60 40 * 40 40 * * * 20 * 20 20 0 RelativemRNA Ppfia1 expression (%) RelativemRNA Kif7 expression (%) 0 Relative mRNA Smo (%) expression 0 1 2 shRNA:d # 2 shRNA:d 1 # shRNA: d o le # le # le m b 1 1 7 f7 S IA b if i b m F IA m K K m a P F a a cr P P cr cr S P S S
D
140 7 120 6 100 5 1. Scrambled 80 4 2. PPFIA1 shRNA #2 3. PPFIA1 shRNA #2 + hPPFIA1 60 3 1 2 3 40 * * 2 WB: α-PPFIA1
20 1 WB: α-Tubulin RelativemRNA Ppfia1 expression (%) ∆CT mRNA hPPFIA1 (qPCR) values N.D N.D 0 shRNA 0 shRNA d 2 1 d 2 1 le # IA le # IA + cDNA b 1 F + cDNA b 1 F IA P IA P am F P am F P cr P h cr P h S P + S P + 2 2 # # 1 1 IA A F FI P P P P
73
Figure 2-9. Control experiments for Figure 2-3. A) Immunofluorescent staining of PPFIA1 (green) in MEF cells with shRNA knock down of Ppfia1 . Acetylated Tubulin(red) and Pericentrin (blue). B) mRNA expression of Ppfia isoforms in C3H10T1/2 and MEF cells. Control is the expression of Ppfia1 . C) shRNA-mediated depletion of Kif7 or Ppfia1 impairs Gli1 mRNA induction by SAG (left) or in Ptch1 -/- MEFs (right). Control is the max activation of Gli1 by SAG. D) Validation of efficiencies of knock-down by shRNAs and rescue by qPCR(left) and Western blot (right). qPCR are represented as mean + SEM across 3 biological replicates. Western blot is representative of 3 independent experiments. Scale bar, 1.5µm. *p<0.05.
74
A non-t reated B 150nM Okadaic acid Kif7: WT-GFP S1337A-GFP S1337D-GFP 1.00E+07 WB: α-GFP 1.00E+06 WB: α-Tubulin
1.00E+05
y
t
i s
n 1.00E+04
e
t n I 1.00E+03 1.00E+02 1.00E+01 1.00E+00
hKif7 peptide sequences C MEFs MEFs Ptch1 -/- MEFs NT 60 60 SAG 60 50 * 50 50
40 40 40 * 30 30 * 30 20 20 20
10 10 10 % of% cells with Kif7 cilia the tips at of % of cells with Kif7 cilia the tips at of 0 % of cells with Kif7 cilia the tips at of 0 0 Kif7: WT S1337 A S969 A Kif7: WT WT S1337 DS1337 DS969 D S969 D Kif7: WT S1337 D S969 D
D
MEFs MEFs Ptch1 -/- MEFs NT 350 160 SAG 14 0 300 140 120 250 120 100 100 200 80 80 150 60 60 * 100 40 40 50 20 20 Relative mRNA Gli1 expression (%) Relative mRNA Gli1 expression (%) Relative mRNA Gli1 expression (%) 0 0 0 Kif7:WT S969A Kif7: WTWT S969D Kif7: WTS1337D S969D
75
Figure 2-10. Control experiments for Figure 2-6. A) Kif7 tryptic peptides used as internal controls for MRM experiment show no change in abundance following okadaic acid treatment. B) a phospho residue in Kif7 (Ser 969) that showed no modulation by okadaic acid do not influence the ciliary tips localization of Kif7 (C) or Hh signalling as measured with Gli1 mRNA level (D). Cilia tips counts and qPCR are represented as mean + SEM across 3 biological replicates. Western blot is representative of 3 independent experiments. *p<0.05.
76
Liprin P632L R641G R702Q L759P P632L R641G R702Q L759P P632L R641G R702Q L759P Kinesin FUBP2 HNRNPA1 YWHAE Phosphatase
APEX1 NONO EEF1B2
GART PRPSAP1 PRMT5
PPFIBP1 PPP2CA RPSA
IF4H IVNS1ABP RAN
PTBP1 HIST1H1C HMGN1
KIF5B YWHAG GCN1L1
PPP2R1A EIF5A PSMA2
SDCCAG3 PLSY GDI2
ACTN4 FUS RCC2
KRT14 LUC7L3 HNRNPH1
TRIM27 MDH2 GATAD2A
RPL7A PRPSAP2 LUC7L2
SNRNP200 PTMA CKB
CS MTHFD1L PRDX3
CAP1 KRT10 RPS16
RLP18 SFPQ RBM3
PTPN13 RS27 P4HB
TJP2 CSNK2A1 STK38
UBP15 HIST1H2BM SUB1
ALYREF S E R B P1 KPNB1
ALDH18A1 LRPPRC ANKFY1
PDIA3 RPSC CAND1
THRAP3 SLIRP CCT2
RBM10 RBM39 WARS
SND1 IRS4 PSMC6
NEFM HSPA1A SERA Confidence KRT1 NCAPD2 MCM3
PYCR1 CALR SSBP1 Fold change
VIM HSPD1 AT5F1
KIF7 G3BP1 CIRBP fold change (log10) P80C HNRNPK IMDH2
PHLDB2 PPIB KRT2 −1.2 1.2 NOLC1 RPS14 XRCC6
ACTG1 EWSR1 EIF3I confidence
HSPH1 CAMSAP3 EIF3G 0 1 PPFIA1 RPL38 MYL6
HIST4H4 RPS7 DDX1
CTNNB1 PDIA4 PPP2R5C
EIF4B FAIM3 KRT9 ACTR1A
Figure 2-11. SWATH-MS analysis of Kif7 mutants. Data are normalized to Kif7-WT.
77
Table 2-1. IP-MS/MS high confidence dataset reported in this study.
The "Bait", "Prey ", "Prey Gene" are from NCBI. "Spectra" are the individual spectral counts across biological replicates ("|" serves as a delimiter between experiments), and "SumSpec" is the sum of the spectral counts and "AvgSpec" is the spectral count averaged for the prey across the highest two purifications of the bait. The spectral counts in negative controls are used for scoring purposes with SAINT. Bait-prey interactions have passed at least one of the following filters: SAINT FDR ≤1% or SAINT (AvgP) ≥ 0.98. Dashes within the SAINT columns represent values that can’t be calculated.
PreyGen SpecSu AvgSp NumRep Saint Bait Prey e Specta m ec licates ctrlCounts AvgP Score BFDR
1193938 54|151|15 Gli3 99 GLI3 6 361 120.33 3 0|0|0|0|0|0|0|0 - - -
1992347 Gli3 9 SUFU 17|84|76 177 59 3 0|0|0|0|0|0|0|0 1 1 0
4128179 Gli3 8 TAB1 21|25|24 70 23.33 3 0|3|0|6|5|7|7|11 1 1 0
HIST1H1 Gli3 4885379 E 36|0|20 56 18.67 3 0|0|0|0|0|0|0|0 1 1 0
2136143 Gli3 7 HTATSF1 15|21|18 54 18 3 0|0|2|0|0|0|2|3 1 1 0
1415017 Gli3 1 THOC3 3|5|5 13 4.33 3 0|0|0|0|0|0|0|0 1 1 0
1992340 Gli3 3 EXOSC2 6|3|3 12 4 3 0|0|1|0|0|0|0|0 0.99 0.99 0.01
1312906 Gli3 8 NOC4L 3|4|5 12 4 3 0|0|0|0|0|0|0|0 1 1 0
1537919 Gli3 10 ALG13 0|6|5 11 3.67 3 0|0|0|0|0|0|0|0 1 1 0
Gli3 6912638 RSU1 5|0|4 9 3 3 0|0|0|0|0|0|0|0 1 1 0
5833126 Gli3 8 ERCC6L 4|3|2 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
C20orf1 Gli3 8923557 1 4|2|3 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
4135033 Gli3 5 TCEA3 3|2|3 8 2.67 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
3981222 Gli3 9 KPNA5 5|3|0 8 2.67 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
78
1479033 Gli3 02 MAP7D3 0|5|3 8 2.67 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
1707634 Gli3 79 MMS19 3|1|3 7 2.33 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
2944892 Gli3 16 HDX 0|3|4 7 2.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
1034720 Gli3 05 MKI67 0|3|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
2030968 Gli3 56 KIF7 3|0|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
2235559 Gli3 17 MTDH 0|3|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
2030968 529|618|4 56 KIF7 53 1147 573.5 3 0|0|0|0|0|0|0|0 - - -
2136136 ALDH18 22|23|22|17|14|9|1 KIF7 8 A1 92|136|74 302 100.67 3 5|23 1 1 0
1714609 KIF7 14 DNM1L 22|60|122 204 68 3 9|0|2|5|0|2|2|0 1 1 0
KIF7 4505983 PPFIA1 79|64|74 217 72.33 3 0|0|0|0|0|0|0|0 1 1 0
1341428 KIF7 26 PCM1 49|63|48 160 53.33 3 0|0|0|0|0|0|0|0 1 1 0
4128179 KIF7 8 TAB1 23|25|26 74 24.67 3 0|3|0|6|5|7|7|11 1 1 0
1500106 KIF7 39 USP22 15|24|27 66 22 3 0|0|0|0|0|0|0|0 1 1 0
5678835 KIF7 6 TFIP11 9|26|30 65 21.67 3 0|0|0|0|0|0|1|0 1 1 0
8935327 SDCCAG KIF7 8 3 15|22|20 57 19 3 0|0|0|0|0|0|0|0 1 1 0
3120324 KIF7 67 PPFIBP1 18|13|16 47 15.67 3 0|0|0|0|0|0|0|0 1 1 0
2136143 KIF7 7 HTATSF1 15|11|20 46 15.33 3 0|0|2|0|0|0|2|3 1 1 0
1205870 KIF7 19 ZNF318 3|32|11 46 15.33 3 0|0|0|0|0|0|0|0 1 1 0
5716494 KIF7 2 CKAP5 8|16|20 44 14.67 3 0|0|0|4|1|3|2|5 1 1 0
1099482 KIAA146 KIF7 92 8 16|17|9 42 14 3 0|0|0|0|0|0|0|0 1 1 0
79
1161747 KIF7 78 CSPP1 5|21|11 37 12.33 3 0|0|0|0|0|0|0|0 1 1 0
1973137 KIF7 28 PHLDB2 15|9|11 35 11.67 3 0|0|0|0|0|0|0|0 1 1 0
1092552 KIF7 28 CEP170 6|14|14 34 11.33 3 0|0|0|0|0|0|0|0 1 1 0
2053608 KIF7 38 DNAJA3 8|15|10 33 11 3 0|2|3|0|0|0|0|0 0.99 0.99 0.01
2408493 KIF7 53 PPP2R5C 12|7|11 30 10 3 0|0|0|0|0|0|0|0 1 1 0
2138950 KIF7 1 SPICE1 5|15|7 27 9 3 0|0|0|0|0|0|0|0 1 1 0
4318223 KIF7 75 DOCK7 7|8|6 21 7 3 0|0|0|0|0|0|0|2 0.98 0.98 0.02
KIF7 4758220 FAM50A 7|7|7 21 7 3 0|1|0|1|0|0|0|2 0.99 0.99 0.01
1462293 KIF7 40 MCC 3|8|9 20 6.67 3 0|0|0|0|0|0|0|0 1 1 0
1825091 KIF7 78 ZBTB1 3|10|7 20 6.67 3 0|0|0|0|0|0|0|0 1 1 0
1415017 KIF7 1 THOC3 6|8|6 20 6.67 3 0|0|0|0|0|0|0|0 1 1 0
KIF7 5031653 BCAS2 3|9|6 18 6 3 0|0|0|0|0|0|0|0 1 1 0
1537913 KIF7 84 RPL22L1 8|4|6 18 6 3 1|0|2|0|0|0|0|0 0.98 0.98 0.02
KIF7 5730009 TRIM27 3|10|4 17 5.67 3 0|0|0|0|0|0|0|0 1 1 0
3156350 KIF7 7 GCC2 3|9|4 16 5.33 3 0|0|0|0|0|0|0|0 1 1 0
1119550 KIF7 84 AZI1 4|9|3 16 5.33 3 0|0|0|0|0|0|0|0 1 1 0
1238306 KIF7 2 KLC2 12|4|0 16 5.33 3 0|0|0|0|0|0|0|0 1 1 0
4685217 KIF7 4 KIF3A 3|7|5 15 5 3 0|0|0|0|0|0|0|0 1 1 0
4492161 KIF7 5 EXOC8 7|0|8 15 5 3 0|0|0|0|0|0|0|0 1 1 0
KIF7 4885455 SH2B3 6|6|3 15 5 3 0|0|0|0|0|0|0|0 1 1 0
3850521 KIF7 8 ACAD11 8|4|3 15 5 3 0|0|0|0|0|0|0|0 1 1 0
KIF7 2136165 IPO9 7|0|6 13 4.33 3 2|0|1|0|0|0|0|0 0.98 0.98 0.02
80
9
3940256 KIF7 72 PSMD5 6|3|4 13 4.33 3 0|0|0|0|0|0|0|0 1 1 0
3763191 KIF7 99 USP39 4|3|6 13 4.33 3 0|0|0|0|0|0|0|0 1 1 0
4006805 KIF7 9 CIR1 0|10|3 13 4.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
5263237 MAGED KIF7 7 1 5|4|3 12 4 3 0|0|0|0|0|0|0|0 1 1 0
5576958 KIF7 7 NOP14 1|7|4 12 4 3 0|0|1|0|0|0|0|0 1 1 0
2395827 KIF7 41 FRMPD1 4|4|4 12 4 3 0|0|0|0|0|0|0|0 1 1 0
KIF7 6912638 RSU1 8|0|4 12 4 3 0|0|0|0|0|0|0|0 1 1 0
1243780 KIF7 39 SEC16A 6|4|2 12 4 3 0|0|0|0|0|0|0|0 1 1 0
KIF7 7661788 MED4 2|7|3 12 4 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
2173541 KIF7 7 BICD2 0|6|4 10 3.33 3 0|0|0|0|0|0|0|0 1 1 0
1707634 KIF7 79 MMS19 4|2|4 10 3.33 3 0|0|0|0|0|0|0|0 1 1 0
2238902 KIF7 52 GRIP1 4|1|4 9 3 3 0|0|0|0|0|0|0|0 1 1 0
1537919 KIF7 10 ALG13 0|5|4 9 3 3 0|0|0|0|0|0|0|0 1 1 0
2618784 KIF7 78 DHX40 2|3|4 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
2944892 KIF7 16 HDX 3|6|0 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
2911677 KIF7 60 KIF21A 4|2|3 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
4134949 KIF7 5 PRIM2 3|2|4 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
5833126 KIF7 8 ERCC6L 5|3|0 8 2.67 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
3549398 KIF7 7 UBE2I 4|1|3 8 2.67 3 1|0|0|0|0|0|0|0 0.99 0.99 0.01
3034895 KIF7 4 MIB1 3|4|0 7 2.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
KIF7 1979274 WDR6 0|3|4 7 2.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
81
48
1097158 KIF7 52 CEP85L 3|4|0 7 2.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
5485972 KIF7 2 NUP160 0|3|4 7 2.33 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
2319999 KIF7 1 CSNK1E 1|3|3 7 2.33 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
2618784 KIF7 69 SSX2IP 0|3|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
3218936 KIF7 2 PPFIA3 3|0|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
5752973 KIF7 7 PDZRN3 0|3|3 6 2 3 0|0|0|0|0|0|0|0 0.98 0.98 0.02
PPFIA 596|893|4 1 4505983 PPFIA1 99 1489 744.5 3 0|0|0|0|1|0|0|1 - - -
PPFIA 1341428 204|309|1 1 26 PCM1 93 706 235.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2136139 PPP2R1 149|258|1 27|34|31|36|36|31| 1 9 A 71 578 192.67 3 34|35 1 1 0
PPFIA 1119550 73|114|10 1 84 AZI1 4 291 97 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1 4506017 PPP2CA 74|80|73 227 75.67 3 3|3|4|6|4|6|7|7 1 1 0
PPFIA 2408493 1 53 PPP2R5C 76|17|91 184 61.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 3120324 1 67 PPFIBP1 135|18|9 162 54 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 3108328 PPP2R5 1 0 D 46|61|53 160 53.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2030968 1 56 KIF7 33|32|41 106 35.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2099698 1 12 KANK2 21|40|18 79 26.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1 4506127 PRPS1 17|26|27 70 23.33 3 4|0|3|1|2|1|11|5 0.99 0.99 0.01
PPFIA 1161747 1 78 CSPP1 21|29|16 66 22 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 3034895 1 4 MIB1 12|23|23 58 19.33 3 0|0|0|0|0|0|0|0 1 1 0
82
PPFIA 2138950 1 1 SPICE1 17|16|16 49 16.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1 4503179 OFD1 16|19|13 48 16 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1092552 1 28 CEP170 13|18|16 47 15.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 5576958 1 3 PIBF1 15|17|13 45 15 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1231737 1 66 TPGS1 11|13|21 45 15 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2264427 1 29 KLHL15 11|9|21 41 13.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 3218936 1 2 PPFIA3 4|23|12 39 13 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1992397 1 1 HAUS1 6|22|8 36 12 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2618784 1 69 SSX2IP 9|14|12 35 11.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2238902 1 52 GRIP1 5|14|10 29 9.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2947745 1 74 PPP2R1B 8|0|20 28 9.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1711844 1 51 CEP350 8|6|11 25 8.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2618240 1 35 HAUS4 4|8|11 23 7.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 3628711 FGFR1O 1 0 P 5|3|11 19 6.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 8129580 1 9 PCNT 5|6|8 19 6.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1 7661788 MED4 6|8|3 17 5.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2230058 1 57 WDR67 4|3|10 17 5.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1 4507729 TUBB2A 7|8|0 15 5 3 0|0|0|1|0|1|1|1 0.99 0.99 0.01
PPFIA 4006805 1 9 CIR1 4|6|4 14 4.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 6289906 1 5 CEP72 3|9|2 14 4.67 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
83
PPFIA 3913533 1 92 CCDC61 2|3|6 11 3.67 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
PPFIA 1092552 1 34 CEP290 2|5|4 11 3.67 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 1501197 ARHGEF 1 4 2 6|0|4 10 3.33 3 0|0|0|0|0|0|0|0 1 1 0
PPFIA 2612450 1 61 CEP120 2|3|4 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
PPFIA 1876085 1 37 CEP55 0|3|6 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
PPFIA 1 5803177 SNTB2 1|3|5 9 3 3 0|0|0|0|0|0|0|0 0.99 0.99 0.01
84
Table 2-2. List of Kif7 peptides quantified by MRM-HR and their corresponding m/z ratio.
N=1 N=2
Non- Okadaic Non- Okadaic Peptide Sequence Observed treated acid treated acid
893 - 907 unmod SGSNGSVVSLEQQQK 774.4 2.68E+05 1.25E+05 1.27E+06 5.41E+04
893 - 907 dea SGSNGSVVSLEQQQK[Dea] 774.87
P-S895 SGS[Pho]NGSVVSLEQQQK 814.4 3.29E+04 1.20E+05 7.24E+04 1.86E+05
893 - P- 907 S895/deam SGS[Pho]NGSVVSLEQQQK[Dea] 814.9
892- 907 unmod RSGSNGSVVSLEQQQK 568.62
892- 907 dea RSGSNGSVVSLEQQQK[Dea] 568.95
892- 907 P-S895 RSGS[Pho]NGSVVSLEQQQK 892.41
892- P- 907 S895/deam RSGS[Pho]NGSVVSLEQQQK[Dea] 892.9
cntrl LSYLSSSETR 571.8 4.29E+05 1.98E+06 2.11E+06 6.95E+06
1134 - 1144 cntrl LVYWLEVALER 695.89 1.60E+05 1.17E+06 8.97E+05 3115000
8-17 cntrl LPGAEEAPVR 519.77 2.48E+04 4.86E+04
217 - 228 cntrl SHTVFTVTLEQR 473.24
963 - 973 unmod SSQALNEDIVR 616.31 not in exp 3.40E+06 4.63E+06
963 - 973 P-S964 SS[Pho]QALNEDIVR 656.3 1.99E+04 156152
1041 - 1066 unmod TLFQLDEAIEALDAAIEYKNEAITCR 980.82 not in exp n/a n/a
1041 - 1066 P-T1041 T[Pho]LFQLDEAIEALDAAIEYKNEAITCR 1007.48 n/a n/a
1072 - unmod ASASLLSQCEMNLMAK 848.9
85
1087
1072 - 1087 P-S1073 AS[Pho]ASLLSQCEMNLMAK 888.88
unmod RASPGMIDVR n/a n/a
1330 - 1339 P-S1332 RAS[Pho]PGMIDVR 591.27 undetected 6.27E+03 n/a 13657
1331- 1339 unmod ASPGMIDVR 473.24 2.96E+03 5.67E+03 2718.7 2106
86
Chapter 3: DYRK2 regulates Hedgehog signalling through phosphorylation of Kif7
All experiments and data analysis in this chapter were performed by Y.C Liu.
87
3.1 Abstract
Kinesin family member 7 (Kif7) is required for proper Hedgehog (Hh) signalling in vertebrates. Along with several pathway members, Kif7 localizes to primary cilia and accumulates at the tips of cilia upon pathway activation. This pathway activity dependent localization is crucial for the activation of the Gli family of transcription factors and for regulation of target genes. We previously uncovered a role for the post-translational phosphorylation of Kif7 for the control of its ciliary localization and the activation of Hedgehog signalling. The PPFIA1-PP2A protein complex regulates the de-phosphorylation of Kif7. Herein, we identified Dual specificity tyrosine-phosphorylation-regulated kinase 2 (DYRK2) as a protein kinase regulating Kif7 phosphorylation. Our results indicate that DYRK2 functions to inhibit the Hedgehog pathway through Kif7 phosphorylation.
3.2 Introduction
Genetics studies of Kif7 in mice have revealed its dual roles during vertebrate Hh signalling (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009, Hsu, Zhang et al. 2011, Law, Makino et al. 2012, Li, Nieuwenhuis et al. 2012, Zhulyn et al. 2014). Under resting conditions, Kif7 is required for the formation of the Gli repressor Gli R (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009) whereas during Hh pathway activation Kif7 is required to activate Gli (formation of Gli A) (Liu et al. 2014, Chong, Mann et al. 2015). The dual nature of Kif7 function is tightly linked to its ability to interact with and traffick Gli proteins in cilia. Indeed, Kif7 is required for Gli localization at the tips of cilia during Hh signalling (Endoh-Yamagami, Evangelista et al. 2009, Liu, Couzens et al. 2014).
Previous work from our group unconverted an important role for Kif7 phosphorylation in dictating its subcellular localization within primary cilia and to regulate Hh pathway activity. Our results showed that, de-phosphorylation of Kif7 by the PPFIA1-PP2A complex is sufficient to promote the localization of Kif7 and Gli proteins at the tips of cilia and to activate Hh target
88 genes (Liu, Couzens et al. 2014). The nature of the kinase that phosphorylates Kif7 and inhibits its trafficking to the distal ends of cilia in the absence of ligands is still unknown.
Dual-specificity tyrosine phosphorylation-regulated kinase 2 (DYRK2) was previously identified as a negative regulator of Gli transcriptional activity in a cDNA overexpression screen (Varjosalo, Bjorklund et al. 2008). DYRK2 was shown to phosphorylate Gli proteins and to regulate Gli stability. The DYRK family kinases are part of the CMGC family of serine/threonine kinases. DYRKs have conserved catalytic kinase domain and characteristic DYRK homology (DH) box. In vertebrates, the DYRK family is composed of 5 members (1A, 1B, 2, 3, and 4). DYRK 1A and DYRK1B belong to class I DYRKs whereas DYRK2, DYRK3 and DYRK4 belong to class II. DYRK1A and DYRK1B have previously been implicated in Hh signalling (Mao, Maye et al. 2002, Lauth, Bergstrom et al. 2010). DYRKs have conserved YXY activation sequence, they are known to auto-phosphorylate their own tyrosines for activation. DYRKs are proline directed kinases, with a preference for proline at the P+1 position on the substrate (Campbell and Proud 2002, Aranda, Laguna et al. 2011). In this study, we identified Kif7 as a DYRK2 substrate and showed that DYRK2 inhibits Hh signalling by restraining Kif7 trafficking in cilia.
3.3 Methods
3.3.1 Antibodies and reagents
Antibodies were purchased from the following vendors: mouse anti-FLAG, mouse anti–beta- Tubulin clone TUB 2.1, and mouse anti-acetylated-Tubulin clone 6-11B-1, gamma-Tubulin (Sigma-Aldrich); rabbit anti-Gli3 (Santa Cruz, Sc20688, for immunofluorescence), rabbit anti- GFP (Santa Cruz , Sc8334), anti-DYRK2 (Sc-66867, for Western blot use 1:50). Goat anti-Gli2 (R&D AF3635, for Western blot). Goat anti-Gli3 (EMD Millipore, AF3690, Western blot). Secondary antibodies conjugated to Alexa Fluor 488, 594, and 647 were purchased from Life Technologies. Secondary antibodies conjugated to horseradish peroxidase were purchased from Jackson ImmunoResearch Laboratories, Inc. SAG (Sc-212905 Santa Cruz) [200nM] was treated for 24h for all experiments. Bio (50nM) was treated overnight (BT-1870199, R&D). Phos-tag
89
Acrylamide Aqueous solution (Wako, 304-93526) was used according to manufacturer instructions. pIMAGO was purchased from Tymora Analytical (#1807) and used according to manufacturer instructions.
3.3.2 Tissue culture, transfections, and lentiviral transductions
HEK293T, MEF, and C3H10T1/2 cells were cultured in DMEM supplemented with 10% FBS (Sigma-Aldrich), and penicillin/streptomycin. HEK293T cells were transfected using PEI (Polysciences Inc. Cat #23966). All lentiviral particles were produced in HEK293T cells by cotransfection of VSV-G (3 µg), psPAX2 (8 µg), and lentiviral plasmids (8 µg) in 30–40% confluent monolayer cell culture grown in 10-cm plates. Media containing virus particles were collected after 24 and 48h. MEF cells were subsequently transduced in the presence of 10 µg/ml polybrene (Sigma-Aldrich). 24h after infection the viral media was replaced with fresh DMEM 10% FBS media where appropriate cells were selected with puromycin (2 µg/ml) 48h after viral infection. All experiments done with MEF or C3H10T1/2 cells, cells were grown to confluency then serum starved with 0.5% FBS in DMEM to induce ciliogenesis for 24-48h. Primary Kif7 -/- MEFs were immortalized by over-expressing SV40 large T antigen.
3.3.3 Plasmids pEGPF-mKif7 was a gift from C-C Hui (Hospital for Sick Children, Toronto, Canada). mKif7GFP was then subcloned into the pLenti-puro plasmid. FLAG-hDYRK2 and FLAG- hDYRK1B were obtained from the Gingras Lab. The respective cDNAs were PCR amplified from Mammalian Gene Collection clones and cloned into Lenti-FLAG vectors. PcDNA5.1- FLAG-hDYRK1A as obtained from Durocher Lab. Lenti-FLAG-hDYRK2 kinase dead (KD) (K251R) mutant was generated by QuikChange PCR mutagenesis. All PCR-amplified regions were verified by sequencing. Primers used for cloning are listed in Table S1.
90
3.3.4 Generation of knock-out cell lines with CRISPR-Cas9 system sgRNAs targeting mDyrk1A , mDyrk1B , mDyrk2 and hDYRK2 were selected and cloned in px459 according to instructions from ( http://www.genome-engineering.org/crispr/ )(Cong, Ran et al. 2013). MEF or C3H10T1/2 cells were transfected with px459 with Lipofectamine 2000 (Life Technologies). Cells were selected with puromycin 48h post transfection. Single-cells were isolated by serial dilution and screened by T7 endonuclease assay for homozygous disruption of the targeted alleles. Sequences for the sgRNA and the primers used for cloning are listed in Table S1.
3.3.5 RT-PCR and quantitative real-time PCR
Total RNA was extracted from cells using TRIzol (Life Technologies) according to the manufacturer’s instructions. For cDNA synthesis, 2 µg of total RNA was reverse transcribed using random primers and Superscript II reverse transcription (Life Technologies). Real-time PCR was performed in a 7900HT Fast Real-Time PCR system using 2.5 µl of the synthesized cDNA product plus the SYBR Green and primers mix in a final volume of 20 µl (Life Technologies). SYBR gene expression assays (Applied Biosystems) were used to measure the mRNA expression of genes in triplicate. Mean relative gene expression was determined using the ∆∆ Ct method normalized to Cyclophilin mRNA. Primers used are listed in Table S1. qPCR figures represent average and SEM of 3 independent experiments.
3.3.6 Affinity purification, immunoprecipitation, and Western blot analysis
Cells were lysed and protein complexes affinity purified using anti-FLAG M2 agarose beads (Sigma-Aldrich). In brief, cells were solubilized in lysis buffer containing, 50 mM Hepes-NaOH pH 8.0, 100 mM KCl, 2 mM EDTA, 0.1% NP40, 10% glycerol, 1 mM PMSF, 1 mM DTT and Sigma protease inhibitor cocktail for 1h at 4°C. Lysates were spun down at 20,000g for 10min at 4°C. Supernatants were collected and affinity purified for 2h, followed by extensive washing of the beads in lysis buffer. Co-purified proteins were eluted from the beads at 95°C for 10min
91 using 4× Laemmli buffer containing beta-mercaptoethanol (Sigma-Aldrich), resolved by SDS- PAGE, and transferred onto nitrocellulose or PVDF membranes (Pall) for Western blot analysis.
3.3.7 Immunofluorescence microscopy and image acquisition
Cells grown on coverslips were fixed with cold 100% methanol for 5 min. Coverslips were covered with antibodies in 1% normal donkey serum in PBS overnight at 4°C. Slides were mounted on coverslips using Vectashield mounting media (Vector Laboratories). Laser scanning confocal images were acquired using a Plan-Apochromat 63×/1.4 NA oil immersion objective on a confocal microscope (LSM700; Carl Zeiss) operated ZEN software. eGFP/Alexa Fluor 488, Alexa Fluor 594, and Alexa Fluor 647 fluorophores were excited individually with 488- , 543-, 638-nm lasers, respectively, with appropriate filter sets. Uncompressed images were processed with Zeiss ZEN software Black edition. To quantify cilium tip localization, numbers of cilia with Kif7 or Gli3 at the tips were counted (~100 cilia per experiment) and were normalized to total number of cilia counted. Average and SEM were calculated from 3 independent experiments. % of protein of interest at cilium tip was analyzed with Fisher's Exact Test. Fluorescence intensity was calculated using ImagJ, where fluorescence intensity = integrated density - (area of selected cell * mean fluorescence of background). Average intensity was then calculated from 3 independent repeats, significance was analyzed with Student's T test.
3.3.8 Statistical analysis
The quantification of cilium tip localization was analyzed by Fisher's Exact Test. qPCR and average fluorescence intensity data were analyzed by Student's T test (GraphPad). All statistical analysis was considered significant at p < 0.05.
92
3.4 Results
3.4.1. Kif7 physically interacts with DYRK2.
We previously identified Ser 1337 of Kif7 as a functionally relevant phosphorylation site controlling the ciliary localization of Kif7 and Hh pathway activity (Liu, Couzens et al. 2014) (Figure 3A). Using a candidate approach, we hypothesized that DYRK2 could be a Kif7 kinase since it is a proline directed kinase with a consensus sequence (RXS/TP) (Campbell and Proud 2002) that matches the context of Ser 1337 (RRTSP) on Kif7. Furthermore, DYRK2 was previously recognized as a negative regulator of the Hedgehog pathway in a kinase expression screen (Varjosalo, Bjorklund et al. 2008). Since we showed that Kif7 phosphorylation inhibits Hedgehog signalling, DYRK2 was an ideal candidate. Using co-immunoprecipitation, we first confirmed that DYRK2 interacted with Kif7 when the proteins are co-expressed in HEK293T cells. In contrast, no association could be detected between DYRK2 and Gli2 or Gli3 under the same conditions (Figure 3-1B). A B ATP binding site 1) FLAG-DYRK2 + empty GFP vector K251 2) FLAG-DYRK2 + Venus-Gli2 3) FLAG-DYRK2 + Venus-Gli3 DYRK2 DH Kinase 4) FLAG-DYRK2 + Kif7GFP Lane: 1 2 3 4 AP: FLAG DYRK2 consensus sequence: RXS/TP - Kif7 WB: GFP mKIF7: 1330 - RWEP RRTSPGM IDVRKNPL -1348 AP: FLAG WB: FLAG Input - Gli2/3 WB: GFP - Kif7
Figure 3-1. Kif7 physically interacts with DYRK2. A) Schematic representation of DYRK2 (top) and Kif7 phosphorylation site (bottom in red). B) Co-immunoprecipitation of FLAG- DYRK2 with Kif7GFP, Venus-Gli2, and Venus-Gli3 in HEK293T cells. Western blots are representative of 3 independent experiments.
93
3.4.2. Loss of Dyrk2 promotes trafficking of Kif7 to the tips of cilia and Hedgehog signalling.
To study the role of Dyrk2 in vertebrate Hedgehog signalling we generated Dyrk2 -/- MEFs cells expressing Kif7GFP using the CRISPR-Cas9 technology. We found that loss of Dyrk2 was sufficient to induce ligand-independent Kif7 trafficking to the tips of cilia and to activate expression of the Hedgehog target gene Gli1 (Figure 3-2A & 3-5A). Given that loss of Dyrk2 promoted Kif7 cilia tips accumulation, we predicted that Gli3 would also be found constitutively at the tips of cilia since its trafficking depends on Kif7 (Endoh-Yamagami, Evangelista et al. 2009, Liu, Couzens et al. 2014). Using Dyrk2 -/- C3H10T1/2 cells (generated through CRISPR- Cas9), we found that endogenous Gli3 showed increased accumulation at the tips of cilia in the absence of any ligand (Figure 3-2B). Similar to MEFs, Gli1 mRNA levels were also increased in Dyrk2 -/- C3H10T1/2 cells (Figure 3-5B). At the protein level, loss of Dyrk2 did not change SuFu or Kif7 expression, but led to a weak increase in Gli2 and a reduction in Gli3 R, which is consistent with a de-repression of Hedgehog signalling (Figure 3-2C). A B MEF Kif7GFP MEF Kif7GFP C3H10T1/2 50 25 100 4000 * * 80 * * 40 20 3000 30 15 60 2000 20 10 40 1000 10 5 20
0 0 0 0 T O T O T O intesnsity flourescence Relative T O K Relative of expression mRNA Gli1 K % with cells Kif7 at ofthetips cilia W - W - %Gli3 with cells atthe oftips cilia K K 2 2 W 2- W 2- K K K K R R R R Y Y Y Y D D D D
C MEF Kif7GFP MEF Kif7GFP WT DYRK2-KO WT DYRK2-KO WB: α-Gli2 -FL WB: α-GFP (Kif7) WB: α-SuFu
WB: α-Tubulin WB: α-Gli3
-R WB: α-Tubulin
94
Figure 3-2. Loss of DYRK2 promotes Kif7 cilia tips trafficking and Hedgehog signalling. A) Dyrk2 -/- MEFs cells exhibit increased cilia tips trafficking of Kif7GFP (left), and increased Gli1 mRNA levels (right). B) Dyrk2 -/- C3H10T1/2 cells show increased Gli3 accumulation at the tips of cilia. Quantification of % of Gli3 at the tips of cilia (left), and average relative fluorescence intensities (right). C) Western blot of Kif7 (GFP), SuFu, Gli2 and Gli3 levels in Dyrk2 -/- MEFs cells expressing Kif7GFP. Western blots are representative of 2 independent experiments. RT-qPCR, Quantification of ciliary tips localization and relative fluorescence intensity are presented as mean + SEM of 3 independent experiments. *p<0.05.
3.4.3. Gain of DYRK2 function inhibits Kif7 ciliary trafficking and Hedgehog signalling. Previous results implicated DYRK2 as a negative regulator of Hedgehog signal transduction (Varjosalo, Bjorklund et al. 2008) but the mechanism by which DYRK2 function remains incomplete. We first confirmed these findings using over-expression experiments. Expression of DYRK2 partly inhibited the SAG-promoted pathway activation and the constitutive pathway activation observed in Ptch1 -/- MEFs as measured by a reduction in the expression of the Hh target gene Gli1. The kinase activity of DYRK2 is required for this inhibitory activity since expression of a DYRK2 kinase dead mutant (K251R) (KD) (Gwack et al. 2006) at similar levels had no impact on Gli1 levels (Figure 3-3A & 3-5C). Since Kif7 contains a consensus DYRK2 phosphorylation site and these proteins interact, we hypothesized that the negative function of DYRK2 could be mediated, in part, through inhibition of Kif7 trafficking in cilia. Confirming this, DYRK2 overexpression inhibited Kif7 accumulation to the tips of cilia promoted by Hh pathway activation whereas catalytically inactive DYRK2 had no effect (Figure 3-3B & 3-5C).
95
A Ptch1 -/- MEFs MEFs Control 1.4 120 SAG 1.2 100 1 80 0.8 60 0.6 40 0.4 * 0.2 20 * 0 0 l 2 l l 2 o K D o o K D tr R -K tr tr R -K Relative of expression mRNA Gli1 n 2 Relative of expression mRNA Gli1 n n 2 o Y K o o Y K D R D R C Y C C Y D D B Ptch1 -/- MEFs MEFs Control 80 60 SAG
60 40 40 * * 20 20
0 0 l 2 D l l 2 D % with cells Kif7 of at the tips cilia o K % with cells Kif7 of at the tips cilia o o K tr R -K tr tr R -K n Y 2 n n Y 2 o K o o K C D R C C D R Y Y D D Figure 3-3. Overexpression of DYRK2 inhibits Kif7 cilia tips trafficking and Hedgehog signalling. A) Overexpression of DYRK2 inhibits the SAG promoted in MEFs (right) or constitutive activation of the Hedgehog pathway observed in Ptch1 -/- MEFs (left) as quantified by measuring levels of the Hh target gene Gli1 by qPCR. Kinase dead mutant (KD) of DYRK2 had no effect on Gli1 level. B) Overexpression of FLAG-DYRK2 inhibits the accumulation of Kif7 to the tips of cilia observed upon pathway activation, whereas the kinase-dead mutant did not. Control is empty vector. Quantification of ciliary tips localization and qPCR data are presented as mean + SEM across 3 independent experiments. *p<0.05.
3.4.4. DYRK2 controls Kif7 phosphorylation. We previously showed that the PPFIA1-PP2A protein complex interacts with Kif7 and de- phosphorylates Kif7 on Ser 1337 . De-phosphorylation of Kif7 is required for the accumulation of Kif7 and Gli proteins at the tips of cilia and for the activation of Hh target genes. To determine if Kif7 phosphorylation is affected upon loss of DYRK2, we used phos-tag gels and western blots to analyze Kif7 phosphorylation status in lysates extracted from wild-type and Dyrk2 -/- MEFs and Dyrk2 -/- HEK293T cells (generated using CRISPR-Cas9 gene editing). In the absence of DYRK2, immunoreactive bands corresponding to Kif7 have faster mobility when compared to Kif7 extracted from wild-type cells (Figure 3-4A&B). This suggests that Kif7 may be a DYRK2 substrate. The electrophoretic mobility of Kif7 in Dyrk2 -/- MEFs was similar to Kif7-
96
S1337A, mutated within a residue previously identified to be a functionally relevant KIF7 phosphorylation site targeted by the PPFIA1-PP2A complex (Liu, Couzens et al. 2014), suggesting that without DYRK2 Kif7 is hypo-phosphorylated (Figure 3-4A). To confirm these findings, we used the pIMAGO reagent that specifically detects phospho-proteins (Iliuk et al. 2012). Briefly, we immunoprecipitated FLAG-Kif7 from wild-type or DYRK2 -/- HEK293T lysates and separated proteins using SDS-PAGE. Detection using the pIMAGO reagent (a non- antibody based, phospho-specific nanopolymer conjugated to avidin) revealed a phospho-Kif7 band in the wild-type cells that was inhibited in the DYRK2 mutant cells (Figure 3-4B). These data are consistent with DYRK2 being a protein kinase that phosphorylates Kif7. A B 1) Kif7 -/- MEF 1) Control 2) MEF KIF7GFPWT 2) FLAG-Kif7 3) MEF KIF7GFP - Dyrk2 KO 3) FLAG-Kif7 DYRK2-KO 4) MEF KIF7GFP-S1337A AP: FLAG 1 2 3 WT DYRK2 KO 1 2 3 4 WB: phos-Kif7 WB: α-DYRK2 WB: α-Kif7 WB: α-Tubulin WB: α-FLAG
Figure 3-4. Loss of DYRK2 impairs Kif7 phosphorylation. A) Proteins were extracted from the indicated cells and were separated by SDS-PAGE gels containing the phos-tag reagent. Kif7 in DYRK2 -/- MEFs shows similar electrophoretic mobility as the Kif7-S1337A mutant, which is mutated at a phosphorylation site important for the ciliary trafficking of Kif7 during pathway activation. B) Detection of Kif7 phosphorylation using the pIMAGO reagent (left). FLAG-Kif7 was immunoprecipitated from wild-type or DYRK2 -/- HEK293T cells and the immunoprecipitated were analysed by SDS-PAGE and pIMAGO detection. Western blot showing loss of DYRK2 in HEK293T cells is on the right. Western blots are representative of 2 independent experiments.
3.5 Discussion
Our previous findings identified an important role for the post-translational control of Kif7 phosphorylation for determining its localization within primary cilia and for regulating Hedgehog signalling. This study also uncovered that the PP2A protein phosphatase regulates phosphorylation of Kif7 at Ser 1337 and that this was sufficient to promote its localization at the tips of cilia. Expression of the Kif7-S1337A mutant is also sufficient to promote the localization
97 of Gli proteins at the tips of cilia and to activate Hedgehog signalling. The nature of the protein kinase regulating phosphorylation of this site was however undetermined.
DYRK2 is a kinase that was previously identified as a negative regulator of the Hedgehog pathway (Varjosalo, Bjorklund et al. 2008) that has a consensus phosphorylation site matching the context of Ser 1337 in Kif7. We therefore hypothesized and confirmed that DYRK2 functions as a negative regulator of the pathway through regulation of Kif7 phosphorylation and cilia localization.
A previous study established Gli2 as a DYRK2 substrate and showed that Gli2 phosphorylation controls its cytoplasmic stability and therefore decreased its transcriptional activity (Varjosalo, Bjorklund et al. 2008). Although we confirmed that gain and loss of DYRK2 function inhibited and activated Gli transcription respectively, we failed to demonstrate an interaction of DYRK2 with Gli proteins. It is however possible that the DYRK2-Gli interaction is transient and that DYRK2 regulates both Kif7 and Gli proteins during Hedgehog signal transduction.
In addition to DYRK2, DYRK1A (Mao, Maye et al. 2002) and DYRK1B (Lauth, Bergstrom et al. 2007) have also been implicated in Hh signalling. We therefore also derived Dyrk1A-/- and Dyrk1B-/- MEFs (through CRISPR-Cas9) and found that Kif7 cilia tips trafficking and Gli1 mRNA levels were not significantly altered (Figure 3-5D). In some contexts DYRK kinases are known to be priming kinases for GSK3 phosphorylation (Aranda, Laguna et al. 2011), we therefore tested whether GSK3 could be involved in Kif7 trafficking. Treatment with Bio, a known GSK3 inhibitor did not change Kif7 cilia tips trafficking in MEFs (Figure 3-5E). In Dyrk2 -/- cells, Kif7 shows increased accumulation at the tips of cilia, additional treatment with Bio did not result in any additive effect on Kif7 trafficking as compared to non-treated Dyrk2 -/- cells (Figure 3-5E). This suggests that GSK3 may not be involved in for Kif7 traffikcing. Overall, our current results are consistent with a role for DYRK2 in regulating Kif7 ciliary tips trafficking by regulating its phosphorylation.
98
3.6 Supplementary Data
A B MEFs - Kif7GFP C3H10T1/2 C3H10T1/2 1.4 14 * 12 1.2 12 10 1 10 8 0.8 8 6 mRNA 0.6 6 mRNA mRNA 4 0.4 4 0.2 * 2 2 N.D Relative of expression Dyrk2
Relative of expression Dyrk2 0 0 Relative of expression Gli1 0
WT WT WT -KO -KO -KO 2 2 yrk yrk yrk2 D D D C MEFs Ptch1 -/- MEFs 1) Control 1) Control 2) FLAG-DYRK2-WT 2) FLAG-DYRK2-WT 3) FLAG-DYRK2-KD 3) FLAG-DYRK2-KD 1 2 3 1 2 3 WB: α-FLAG WB: α-FLAG
WB: α-Tubulin WB: α-Tubulin
D MEFs - Kif7GFP MEFs - Kif7GFP MEFs - Kif7GFP MEFs - Kif7GFP 20 1.6 1.6 1.2 1.4 1.4 1 1.2 1.2 1 1 0.8 10 0.8 0.8 0.6 mRNA mRNA
of cilia 0.6
mRNA 0.6 0.4 0.4 0.4 0.2 0.2 0.2 * 0 Relative of expression Dyrk1B Relative of expression Dyrk1A * Relative of expression Gli1 0 0 % of with cells Kif7 at the tips 0 T T WT W W WT KO B-KO A-KO 1 1A-KO 1B-KO 1 rk rk rk1B- Dyrk1A-KO yrk y Dyrk Dy Dy D D E MEFs - Kif7GFP 40
30
20
tips oftips cilia 10
% of withh cells Kif7 at the 0 T io io W -KO B WT B -KO Dyrk2 yrk2 D
99
Figure 3-5. Control experiments for this chapter. A) Relative expression of Dyrk2 mRNA in MEFs. B) Relative expression of Gli1 (left) or Dyrk2 (right) mRNAs in C3H10T1/2 cells. C) Western blots showing expressing of FLAG-DYRK2 or KD in MEFs (left) or Ptch1 -/-MEFs (right). D) Kif7 cilia tips localization and Gli1 mRNA levels in Dyrk1A and Dyrk1B knock-out MEFs. Relative expression of Dyrk1A or Dyrk1B mRNA are showhn in the last two panels. E) Quantification of % cells with Kif7GFP at the tips of cilia in Dyrk2 -/- MEFs with or without treatment with Bio. Cilia tips quantifications and qPCR are represented as mean + SEM across 3 biological replicates. Western blot is representative of 3 independent experiments. *p<0.05.
100
Chapter 4 Biochemical study of Kif7-SuFu interaction
All experiments and data analysis in this chapter were performed by Y.C Liu.
101
4.1 Abstract
Kif7 and SuFu are two conserved negative regulators of the Hh pathway. Studies in mice have revealed a genetic interaction between Kif7 and SuFu however the mechanistic interplay between these proteins is still unclear. Using proximity-based protein labeling and mass spectrometry analysis (BioID), Kif7 and SuFu were found biotinylated in cells expressing SuFu- BirA and Kif7-BirA respectively, suggesting that these proteins exist in close proximity. Further biochemical analysis showed that SuFu localization at the tips of cilia during Hh pathway activation depends on Kif7, but Kif7 trafficks in cilia independently of SuFu. In addition, experiments performed in MEF knockout cells revealed that loss of Kif7 in SuFu -/- MEFs further activated the pathway when compared to SuFu -/- MEF cells. These results suggest that Kif7 functions as a negative regulator in the absence of SuFu and that it has SuFu-independent function in the Hh pathway.
4.2 Introduction SuFu is an essential negative regulator of the vertebrate Hh pathway. Loss of SuFu results in derepression of the pathway and ligand-independent activation of Gli transcription (Ding et al. 1999, Kogerman et al. 1999, Pearse et al. 1999, Stone et al. 1999, Chen, Wilson et al. 2009, Jia et al. 2009). Under resting conditions SuFu constitutively trafficks in and out of primary cilia and accumulates at the tips of cilia upon pathway activation (Tukachinsky, Lopez et al. 2010, Zeng et al. 2010). SuFu trafficking in cilia has been shown to be dependent on Gli3 (Zeng, Jia et al. 2010).
Genetic studies uncovered a functional interplay between Kif7 and SuFu in bone (Hsu, Zhang et al. 2011), skin (Li, Nieuwenhuis et al. 2012) and neural tube development (Law, Makino et al. 2012). These studies highlight the dual functions of Kif7, in particular the negative function of Kif7 in the absence of SuFu. Although SuFu and Kif7 were previously shown to physically interact when overexpressed (Endoh-Yamagami, Evangelista et al. 2009), how they functionally interact remains unknown. We previously performed mass spectrometry analysis of Kif7 immunoprecipiates (Liu, Couzens et al. 2014) and failed to identify SuFu as a stable interactor of Kif7. Similarly, mass spectrometry analysis of SuFu immunoprecipitates, carried in our
102 laboratory, also failed to show Kif7 as an interactor (data not shown). In addition, Kif7 and SuFu fail to interact in endogenous co-immunoprecipitation (Hui lab, personal communication). However, since Kif7 and SuFu both interact with Glis and localize to the primary cilia, we further examined the biochemical and functional link between these two regulators of the Hedgehog pathway. In this study, we used a novel proximity labeling method combined with mass spectrometry and show that Kif7 and SuFu exist in close proximity possibly within a transient protein complex. Functional analysis demonstrated that Kif7 is required for SuFu accumulation at the tips of primary cilia upon Hh pathway activation. Our data further highlights the important interaction between Kif7 and SuFu during Hh signal transduction.
4.3 Experimental procedures
4.3.1 BioID or proximity labeling Mass spectrometry mKif7 and hSuFu cDNAs were subcloned into PcDNA5/FRT/TO-hBirA, with BirA fused at the N-terminus. The plasmid (1µg) containing the bait of interest was transfected with POG44 (9µg) in HEK293-Flp-in-Trex tetracyclin inducible cell line. Stable cell lines were generated with hygromycin B selection (0.1mg/ml). Sample preparation was similar to Lambert et al (Lambert et al. 2014) with some modification. Briefly, after selection, cells were incubated for 24h in complete media supplemented with 1 µg/ml tetracycline (Sigma), 50 µM biotin (BioShop). Cells were collected and pelleted (500g, 5 min), the pellet was washed with PBS, and dried pellets were snap frozen. Pellets were lysed in RIPA lysis buffer (1:4 pellet weight/volume) (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.1% SDS, 1:500 protease inhibitor cocktail (Sigma-Aldrich), 250U for 10ml Benzonase (Sigma)) at 4 °C for 1h, then sonicated for 30 seconds. The lysate was centrifuged at 16,000 rpm for 10 min. Clarified supernatants were incubated with 30 µl packed, pre-equilibrated Streptavidin- sepharose beads (GE) at 4°C for 3 h. Beads were collected by centrifugation (2,000 rpm, 1 min), washed 3 times with 50 mM ammonium bicarbonate pH 8.2, and treated with trypsin (Promega, overnight at 37°C). The supernatant containing the tryptic peptides was then collected and lyophilized. Peptides were resuspended in 0.1% formic acid, 95% water and 5% ACN. Samples
103 were analyzed with LTX Ion Trap (Thermo Scientific). Data files were uploaded on to ProHits and analyzed with TPP and SAINT as previously described (Liu, Couzens et al. 2014).
4.3.2 Antibodies and reagents Antibodies were purchased from the following vendors: anti-acetylated-Tubulin clone 6-11B-1 (Sigma-Aldrich); rabbit anti-Pericentrin (Abcam, ab4448); Goat anti-SuFu (Santa Cruz, sc- 10933). Secondary antibodies conjugated to Alexa Fluor 488, 594, and 647 were purchased from Life Technologies. Secondary antibodies conjugated to horseradish peroxidase were purchased from Jackson ImmunoResearch Laboratories, Inc. SAG (Sc-212905 Santa Cruz) was used at 200nM for 24h for all experiments.
4.3.3 Plasmids hSuFu was further subcloned into the pLenti-Venus plasmid to generate pLenti-Venus-hSuFu. pEGPF-mKif7 was previously described (Cheung, Zhang et al. 2009). Kif7GFP was cloned into the pLenti-puro plasmid. The pLenti-mKif7GFP mutants (S1337A & S1337D) were generated by QuikChange PCR mutagenesis.
4.3.4 Tissue culture, transfections, and lentiviral transductions
HEK293T, HEK293-Flp-in-Trex, and MEF cells were cultured in DMEM supplemented with 10% FBS (Sigma-Aldrich), and penicillin/streptomycin. HEK293T and HEK293-Flp-in-Trex cells were transfected using PEI (Polysciences Inc. Cat #23966). All lentiviral particles were produced in HEK293T cells by cotransfection of VSV-G (3 µg), psPAX2 (8 µg), and lentiviral plasmids (8 µg) in 30–40% confluent monolayer cell culture grown in 10-cm plates. Media containing virus particles were collected after 24 and 48h. MEF cells were subsequently transduced in the presence of 10 µg/ml polybrene (Sigma-Aldrich). 24h after infection the viral media was replaced with fresh DMEM 10% FBS media where appropriate cells were selected with puromycin (2 µg/ml) or hygromycin (0.2mg/ml) 48h after viral infection. To study Hh
104 signalling, cells were grown to confluency then serum starved with 0.5% FBS in DMEM to induce ciliogenesis for 24-48h.
4.3.5 shRNAs
MISSION shRNA clones in the lentiviral plasmid pLKO.1-puro were acquired from Sigma- Aldrich. Kif7 shRNA clone TRCN0000090438 labeled as Kif7 shRNAs #1. PPFIA1 shRNA clone TRCN0000251544 labeled as PPFIA1 #1. Smo shRNA clone TRCN0000026312 labeled as Smo was also from Sigma-Aldrich. Sequences of shRNAs used are listed in Table S1.
4.3.6 Generation of knock-out cell lines with CRISPR-Cas9 system sgRNAs targeting mKif7 and mPtch1 were selected and cloned in px330 according to instructions from ( http://www.genome-engineering.org/crispr/) (Cong, Ran et al. 2013). Kif7 or Ptch1 homology arms surrounding the predicted sgRNA cut location were amplified by PCR from mouse genomic DNA and cloned into a donor plasmid designed to introduce a puromycin resistance expression cassette through homologous recombination (HR). SuFu -/- MEFs were transfected with px330 and the HR donor plasmid with Lipofectamine 2000 (Life Technologies). Cells were selected with puromycin 48h post transfection. Single-cells were isolated by serial dilution and screened by PCR for homozygous disruption of the targeted alleles. Sequences for the sgRNA and the primers used for cloning are listed in Table S3.
4.3.7 RT-PCR and quantitative real-time PCR
Total RNA was extracted from cells using TRIzol (Life Technologies) according to the manufacturer’s instructions. For cDNA synthesis, 2 µg of total RNA was reverse transcribed using random primers and Superscript II reverse transcription (Life Technologies). Real-time PCR was performed in a 7900HT Fast Real-Time PCR system using 2.5 µl of the synthesized cDNA product plus the SYBR Green and primers mix in a final volume of 20 µl (Life
105
Technologies). SYBR gene expression assays (Applied Biosystems) were used to measure the mRNA expression of genes in triplicate. Mean relative gene expression was determined using the ∆∆ Ct method normalized to Cyclophilin mRNA (Bookout, Cummins et al. 2006). Primers used are listed in Table S3.
4.3.8 Immunofluorescence microscopy and image acquisition
Cells grown on coverslips were fixed with cold 100% methanol for 5 min. Coverslips were covered with antibodies in 1% normal donkey serum in PBS overnight at 4°C. Slides were mounted on coverslips using Vectashield mounting media (Vector Laboratories). Laser scanning confocal images were acquired using a Plan-Apochromat 63×/1.4 NA oil immersion objective on a confocal microscope (LSM700; Carl Zeiss) operated ZEN software. Venus/eGFP/Alexa Fluor 488, Alexa Fluor 594, and Alexa Fluor 647 fluorophores were excited individually with 488- , 543-, 638-nm lasers, respectively, with appropriate filter sets. Uncompressed images were processed with Zeiss ZEN software Black edition. To quantify cilium tip localization, images were taken as Z-stacks and rendered as 3D projections. Cilia with Kif7 or SuFu at the tips were counted (30 cells in 10-15 independent images were used for each condition). Cilia tips localization was expressed as the percentage of cilia exhibiting Kif7 or SuFu proteins localization at the tips. Average and SEM were calculated from 3 independent experiments. % of protein of interest at cilium tip was analyzed with Fisher's Exact Test.
4.3.9 Statistical analysis
The quantification of cilium tip localization was analyzed by Fisher's Exact Test. qPCR data were analyzed by Student's T test (GraphPad). All statistical analysis was considered significant at p < 0.05.
106
4.4 Results
4.4.1. BioID analysis of Kif7 and SuFu. To further characterize Kif7 and SuFu interacting proteins, we used the recently developed proximity-dependent labeling of proteins termed BioID (proximity dependent biotin identification)(Roux et al. 2012) method coupled to mass spectrometry (MS). Briefly, for the BioID method, a protein of interest is fused to a mutated form of the E.coli biotin protein ligase BirA (R118G), this mutation results in the promiscuous biotinylation of proteins that are near the bait fusion protein (Roux, Kim et al. 2012). The biotinylated proteins are then isolated by Streptavidin affinity purification and identified by MS. HEK293 cells stably expressing BirA- Kif7 and BirA-SuFu were derived and BioID MS was conducted as previously described (Lambert, Tucholska et al. 2014). Full list of interactors found in Kif7 and SuFu BioID are listed in Figure 4-5. In contrast to previous MS results performed on FLAG immunoprecipiates, BioID revealed SuFu and Kif7 peptides in Kif7 and SuFu pull-downs respectively (Figure 4-1A &B). These results raise a few possibilities: 1) the SuFu-Kif7 interaction is transient in nature 2) SuFu and Kif7 interact in a subcellular domain not extracted by the gentle lysis conditions used when performing FLAG immunoprecipitation but revealed with the harsher conditions used for BioID 3) SuFu and Kif7 are not part of the same protein complex but are found in close enough proximity during the biotin labeling period required for BioID.
107
A Kif7-BioID SuFu-BioID Hit Total peptide Hit Total peptide Kif7 336 + 37 SuFu 65 + 2 SuFu 5 + 1 Kif7 4 + 1
B KIF7 SuFu
SUFU CEP55 Hedgehog pathway proteins HAUS3 Centrosomal proteins AZI1 CEP85 CSPP1 TUBA4A TUBA1A OFD1 TUBB2B PCM1 MCCC1 HSPA1B PCCA PCCB PC MCCC2 ACACA TUBB TUBB4B HSPA8 FLNA FASN IRS4 CTTN HSPA5 EEF1A1 ATP5A1 HSPA9 VIM ENO1 E1B55K TUBA1B KIF7 HAUS6 KRT1 XRN1 PRKDC DDX3X KRT8 DVL2 EIF2C2 CEP170 CYLD DVL3 CEP192 0 10 20 30 40 50
Total peptide # Figure 4-1. BioID of Kif7 and SuFu. A) Mean total peptides + S.D of 2-3 independent MS of Kif7 and SuFu peptides identified. B). Heatmap representation of some of the interactors identified. For full list of interactors see Figure 4-5. BioID MS for BirA-Kif7 (N=3) and BirA- SuFu (N=2).
4.4.2 Kif7 is required for accumulation of SuFu at the tips of cilia during Hh signalling. It is known that Kif7 is required for trafficking Gli proteins to the tips of cilia during Hh signalling (Endoh-Yamagami, Evangelista et al. 2009, Liu, Couzens et al. 2014). Since SuFu
108 also localizes with Gli proteins at the tips of cilia (Tukachinsky, Lopez et al. 2010, Zeng, Jia et al. 2010), we next were interested to determine whether Kif7 was involved in this process. To monitor SuFu localization we expressed Venus-SuFu in SuFu -/- MEF cells and showed that the fusion protein rescued the constitutive activation of Gli1 mRNA observed in these cells validating the proper functioning of the fusion protein (Figure 4-3A, 4-4A). We then knock- down Kif7 expression using shRNA and determined whether this modulated the efficiency of the Smoothened agonist SAG to promote SuFu accumulation at the tips of cilia. Whereas SAG treatment led 56% of cells expressing scrambled shRNA to accumulate Venus-SuFu at the tips of cilia, knock-down of Kif7 or Ppfia1 reduced the percentage of cells to 16% and 14% respectively, which is similar to what is seen upon Smo depletion (Figure 4-2A; 4-4B). Reciprocally, we assessed the requirement of SuFu for the Kif7 translocation to the tips of cilia upon SAG treatment. To do so, we expressed Kif7-GFP into SuFu -/- MEFs and determined the percentage of cells exhibiting Kif7 localization at the tips of cilia under resting conditions or upon SAG treatment for 24h. Stimulation of SuFu -/- MEFs with SAG led to 37% of cells with Kif7 at the tips of cilia, levels that are similar to what is obtained in wild-type MEFs (Figure 4- 2B). We conclude that Kif7 is required for the accumulation of SuFu at the tips of cilia in response to pathway activation but that SuFu is dispensable for Kif7 cilia tips trafficking. A B SuFu-/- MEF Venus-SuFu SuFu-/- MEF Kif7GFP MEF Kif7GFP VenusSuFuPericen AcetTub 70 NT 50 60 NT SAG SAG 60 50 40 50
NT 40 40 30 cilia 30 30 * 20 20 20 * * 10 10 10 SAG % of SuFu with cells of at the tips 0 0 0 1 1 % of with cells Kif7 at theof tips cilia % of with cells Kif7 at theof tips cilia shRNA: d d # # o NT SAG e e NT SAG l l f7 1 m b b i IA S m m K F a a P cr cr P S S Figure 4-2. SuFu and Kif7 ciliary tips trafficking. A) Immunofluorescence images of Venus- SuFu in SuFu -/- MEFs. Venus-SuFu (green), acetylated Tubulin (red) and Pericentrin (blue). SAG promoted trafficking of Venus-SuFu to the tips of cilia is reduced upon shRNA-mediated knock-down of Kif7 , Ppfia1 or Smo . Quantification is on the right. B) Trafficking of Kif7 to the tips of cilia is normal in SuFu -/- MEFs (left) with or without SAG treatment. Trafficking of Kif7GFP in wild type MEFs is on the right. Quantification of ciliary tips localization is presented as mean + SEM across 3 independent experiments. *p<0.05. Scale bar: 1µm.
109
4.4.3 Gain and loss of function of Kif7 in SuFu -/- MEFs
Previous genetic studies in mice showed that compound SuFu -/-;Kif7 -/- double mutant mice exhibit more pronounced de-repression of the Hh pathway and more severe phenotypes in the neural tube and in the skin than either single mutant mice (Law, Makino et al. 2012, Li, Nieuwenhuis et al. 2012). These results suggest non-redundant functions of Kif7 and SuFu as negative regulators of Hh signalling. How these two negative regulators cooperate to repress Gli-mediates signalling is still poorly understood. As previously demonstrated, expression of Venus-SuFu in SuFu -/- cells rescues the constitutive activation of the pathway (Figure 4- 3A)(Varjosalo, Bjorklund et al. 2008, Lauth, Bergstrom et al. 2010). In contrast expression of Kif7-WT or of the S1337A or S1337D Kif7 mutants did not have any significant effect on Gli1 mRNA level (Figure 4-3A). Since Kif7 overexpression cannot rescue the loss of SuFu function, we conclude that Kif7 activity is upstream or at the level of SuFu. Using CRISPR-Cas9, we then knocked-out Kif7 in SuFu -/- MEF cells, and found a weak increase in Gli1 mRNA (Figure 4-3B) when compare to SuFu -/- MEFs. This recapitulates what is seen in mouse tissues and suggests that Kif7 has SuFu-independent function, as a weak negative regulator of Hedgehog signalling in the absence of ligands.
A B SuFu-/- MEFs SuFu-/- MEFs 4 4
3 3 *
2 2
1 (qPCR) mRNA 1 mRNA (qPCR) mRNA
0 Relative of expression Gli1 0 Relative of expression Gli1 T u T T u O N F A D N F O K u -W 7 7 u K - S 7 3 3 S - 1 - if 3 3 - 7 h s 1 1 s if tc u K -S -S u K P n 7 7 n e if if e V K K V
Figure 4-3. Gain and loss of function of Kif7 in SuFu -/- MEFs. A) Gli1 mRNA levels in SuFu -/- MEFs overexpressing Venus-SuFu, Kif7-WT, Kif7-S1337A, or Kif7-S1337D. B) Gli1 mRNA levels in SuFu -/- MEFs with knockout of Kif7 or Ptch1 . qPCR data are presented as mean + SEM across 3 independent experiments. *p<0.05.
110
4.5 Discussions
Overall, our BioID study revealed that Kif7 and SuFu exist in close proximity to each other in resting cells, an interaction that we were unable to capture using conventional immunoprecipitation/mass spectrometry methods. Our current understanding of Hedgehog signalling suggests that Kif7 promotes Gli repressor formation under resting conditions (Cheung, Zhang et al. 2009, Endoh-Yamagami, Evangelista et al. 2009, Liem, He et al. 2009). Interestingly, overexpression of Kif7 in SuFu -/- cells was not sufficient to rescue the constitutive Gli signalling activity observed in the cells (Figure 4-3A). Kif7 knockout in SuFu -/- cells , on the other hand, potentiated Gli-mediated signalling indicating that Kif7 inhibits Gli-mediated transcription independently of SuFu. How Kif7 and SuFu cooperate to maintain low levels of Hedgehog signalling under resting conditions remains to be precisely determined.
Previous studies indicated that the localization of SuFu at the tips of cilia during Hh signalling depends on Gli proteins since these proteins appear to be tightly associated (Tukachinsky, Lopez et al. 2010, Zeng, Jia et al. 2010). It is in fact at the tips of cilia that Gli is thought to dissociate from SuFu when the pathway is active to generate Gli A and translocate to the nucleus (Humke, Dorn et al. 2010, Tukachinsky, Lopez et al. 2010). Since we and others have shown that Kif7 is required for trafficking of Gli proteins to the tips, we predicted and confirmed that Kif7 is also required for SuFu localization in cilia (Figure 4-2A). SuFu on the other hand is dispensable for the trafficking of Kif7 to cilia tips upon pathway activation (Figure 4-2B). Kif7 therefore acts downstream of Smo and upstream of the SuFu-Gli complex in Hedgehog signal transduction.
These findings raise a number of important questions. Does Kif7 interact simultaneously with Gli and SuFu proteins to traffick these proteins to the tips of cilia? Why are Hh pathway components (Smo, Kif7, SuFu and Gli) all enriched at the tips of cilia at steady state when the pathway is activated? How is Smo activation leading to Kif7 translocation to the tips of cilia? How is Kif7 then acting to promote the dissociation of Gli from SuFu when Hh ligands are present? These questions may be answered by real-time imaging studies and/or biophysical approaches to further understand the kinetics of protein dynamics and the nature of protein- protein interaction in the absence or presence of Hh ligands.
111
4.6 Supplementary Data
A B 1) SuFu-/- MEF SuFu-/- MEF + Venus-SuFu 2) SuFu-/- MEF+ Venus-SuFu 1 2 150 150 150 WB: α-SuFu 100 100 100 WB: α-Tubulin 50 50 50 * expression(%) expression(%) expression(%) Relative mRNA Ppfia1 RelativemRNA Smo RelativemRNA Kif7 0 0 0 shRNA: d 1 shRNA:d shRNA: d o le # le 1 le b 7 b # b m if 1 S m K m a m a a fi a cr cr p cr S S P S
Figure 4-4. Control experiments for this chapter. A) Western blot confirm the expression of Venus-SuFu in SuFu -/- MEFs. B) Knock-down efficiencies of shRNAs in SuFu -/- + Venus-SuFu. qPCR are represented as mean + SEM across 3 biological replicates. Western blot is representative of 3 independent experiments. *p<0.05.
112
KIF7 Su Fu KIF7 Su Fu KIF7 Su Fu
113
114
0 50
FDR≤1%
1% 5% Relative abundance Figure 4-5. Full list of SuFu & Kif7 BioID mass spectormetry. 115 Chapter 5: General discussions and future directions 5.1 Summary of key findings and significance In summary, this thesis focuses on the molecular mechanisms underlying Kif7 functions in vertebrate Hedgehog signalling. I found that in MEFs, Kif7 fulfills predominantly a positive regulatory role downstream of Smo activation as it promotes the ciliary tips accumulation of Gli proteins and the induction of Gli target genes. I further described a protein complex, consisting of Liprin-α1 (PPFIA1) and the serine threonine protein phosphatase PP2A, which interacts with Kif7. My results indicate that the PPFIA1-PP2A complex regulates Kif7 phosphorylation and promotes the Hh signalling dependent localization of Kif7 and Gli proteins at the tips of cilia and the activation of Hh target genes (Chapter 2). In addition, I identified DYRK2 as one kinase responsible for Kif7 phosphorylation and showed that this post-translational modification dictates its subcellular localization at the tips of primary cilia and determine whether Kif7 inhibits or activates Hedgehog signalling (Chapter 3). These findings are consistent with a model in which Smo activation is coupled to the trafficking of Kif7 and Gli proteins in primary cilia via the regulation of Kif7 phosphorylation (Figure 5). Of significance, some KIF7 mutations found in human developmental syndromes were found to affect the interaction with the PPFIA1-PP2A complex. These mutations lead to ligand-independent localization of Kif7 and Gli proteins to the tips of cilia and constitutively activated Hedgehog signalling. Lastly, we examined Kif7 function in relation to SuFu, and found that SuFu depends on Kif7 for ciliary tips accumulation upon pathway activation, and that Kif7 has SuFu independent functions in the pathway (Chapter 4). 116 7 if Legend: K Gli3 IFT complex IFT complex Kif7 PPFIA1 Gli2 GliR P Phosphate GliA PP2A Smo Primary cilium Primary cilium DYRK2 No ligand Ptch1 With ligand PPFIA1 Basal PP2A Body 7 if P Smo Ptch1 K Gli3 P DYRK2 P PPFIA1 7 Gli2 if P K P DYRK2 PP2A P P P Gli2 Gli3R Gli3R nucleus nucleus Gli3R +Gli1 Gli2 * +Gli1 Figure 5. Working model. When the Hedgehog pathway is inactive, DYRK2 phosphorylates Kif7 and inhibits its ciliary trafficking and consequently prevents Gli proteins accumulation at cilia tips. At steady state Kif7 and Gli proteins are therefore enriched at the base of cilia but a basal flux of Kif7-Gli trafficking in cilia occurs to allow processing of Gli3 into Gli3 R (Left). During pathway activation, Smo accumulates in cilia and promotes the recruitment of the PPF1A-PP2A complex to Kif7. This leads to increased de-phosphorylation of Kif7 on Ser 1337 and increased localization of Kif7 and Gli proteins at the cilia tips leading to SuFu dissociation from Gli2 and Gli3 proteins resulting in Gli2 activation and reduction of Gli3 R (Right). 5.2 General discussions This work provides important new insights into the function of Kif7 in Hedgehog signal transduction but also raises new questions. For example, we found that Kif7 functions to promote Gli and SuFu accumulation at the distal tips of cilia, a process that is crucial for the activation of downstream target genes but work from He et al. showed that Kif7 has no motor activity in vitro (He, Subramanian et al. 2014). It is therefore unclear how Kif7 promotes ciliary trafficking of Gli and SuFu during pathway activation. Recent work demonstrates that Gli proteins form a complex with Kif3A (Carpenter et al. 2015) and our own work identified Kif3A in Kif7 immunoprecipitates by MS. This raises the possibility that Kif3A may contribute to 117 ciliary localization of the Kif7-SuFu-Gli protein complex. Other kinesins may also play a role in ciliary trafficking of Hh proteins and this remains to be systematically tested. Additionally, we identified protein phosphatase PP2A as a key regulator of Kif7 function. In flies, PP2A was found to regulate Ci phosphorylation (Jia, Liu et al. 2009). Whether PP2A also plays a role in Gli phosphorylation has not been directly demonstrated. We identified the Kif7 phosphorylation site (Ser 1337 ) as a PP2A sensitive site following treatment of cells with okadaic acid (OA). OA is known to inhibit both PP2A and PP1 (at higher dose). Although we consistently used low dose of OA in our experiments, and we only identified subunits of PP2A in Kif7 AP-MS, we can’t rule out that PP1 or another phosphatase contribute to Kif7 function. Furthemore, similar to flies where multiple phosphorylation sites were identified on Cos2 (Ranieri, Ruel et al. 2012) we also identified at least three additional Kif7 phosphorylation sites that could be targeted by other phosphatase and be important for Kif7 function. In this thesis we also identified DYRK2 as a kinase implicated in the functional regulation of Kif7. In Drosophila , Cos2 is phosphorylated by Fused but STK36 the vertebrate homolog of Fused is not involved in vertebrate Hh signalling (Chen, Gao et al. 2005, Merchant, Evangelista et al. 2005). Another kinase with sequence homology to Fused is Ulk3, which was found to positively regulate Gli (Maloverjan et al. 2010, Maloverjan et al. 2010). Whether Ulk3 or other kinases also contribute to Kif7 regulation in addition to DYRK2 remains to be tested. Furthermore, through biochemical approaches, we identified the phosphatase and the kinase regulating Kif7 phosphorylation. However, how Kif7 phosphorylation occurs temporally with changes in pathway activity is still unknown. Additional experiments examining Kif7 phosphorylation in vivo is also needed. Developing a phospho-specific Kif7 antibody against the Ser 1337 site will be one way to address these questions. Finally, many mutations in KIF7 have been identified in ciliopathies and other rare genetic disorders, how these mutations affect Kif7 function remains to be elucidated. We identified one Kif7 mutant Kif7-L759P showing increased association with PP2A-PPFIA1. Whether phosphorylation and/or binding to DYRK2 are affected in this mutant remain to be further tested. In addition, we analyzed three other point mutants of KIF7 using SWATH-MS. The KIF7 -P632L mutation found in patients with Pallister-Hall syndrome shows decreased binding to Kif5B. Whether Kif5B is involved in protein trafficking in the cilia or Hh signalling 118 represents an interesting possibility. Lastly, given that Kif7 and SuFu are two key regulators of vertebrate Hh signalling, understanding the formation and dissociation of Kif7-Gli-SuFu complex within the cilia, especially at the distal tips of cilia will be important to continue understand signal transduction in the Hh pathway. Overall, this thesis provides novel insights into the regulation of Kif7 activity during Hedgehog signalling. 5.3 Future directions and perspectives Over the past 20 years, details of Hh signal transduction have been revealed through genetic and biochemical analysis. Evolutionarily conserved Hh signalling components were discovered between Drosophila , zebrafish and mice. Divergence between these model organisms was also observed. However, much is still unknown about the pathway. Firstly, the biochemical underpinnings of many steps in the pathway are still poorly defined. For example, the central question of how Ptch1 regulates Smo in the absence and presence of Hh ligands is still unknown. In addition, how Hh pathway activation is transmitted from Smo to Kif7, the process triggering dissociation of SuFu from Gli during pathway activation and the nature of Gli modifications required for Gli A formation are all poorly answered questions. Secondly, given the importance of primary cilia in cell signalling, more work is needed to better understand how Hh pathway components flux in and out of the cilia during Hh signalling. Lastly, Hh signalling is activated in many cancers, both via ligand-dependent and independent mechanisms. Recent studies showing paracrine activation of Hh signalling in the stroma from Hh ligands secreted by tumour cells shed new light on the complexity of the pathway in tumourigenesis (Yauch, Gould et al. 2008). Enormous efforts have been placed in developing Hh pathway inhibitors, most commonly Smo antagonists, to treat tumours exhibiting Hh pathway activation. Mutations in Smo leading to resistance to Smo inhibitors rapidly arise and therefore in order to develop more effective therapeutics, the molecular basis underlying Hh pathway activation in non-cancerous cells and in tumour cells needs to be determined. Addressing the missing questions in pathway signal transduction is the first step towards understanding this pathway and for developing therapeutics. 119 References Aikin, R. A., K. L. Ayers and P. P. Therond (2008). "The role of kinases in the Hedgehog signalling pathway." EMBO Rep 9(4): 330-336. Ali, B. R., J. L. Silhavy, N. A. Akawi, J. G. Gleeson and L. Al-Gazali (2012). "A mutation in KIF7 is responsible for the autosomal recessive syndrome of macrocephaly, multiple epiphyseal dysplasia and distinctive facial appearance." Orphanet J Rare Dis 7: 27. Aranda, S., A. Laguna and S. de la Luna (2011). "DYRK family of protein kinases: evolutionary relationships, biochemical properties, and functional roles." Faseb j 25 (2): 449-462. Arnold, H. K. and R. C. Sears (2006). "Protein phosphatase 2A regulatory subunit B56alpha associates with c-myc and negatively regulates c-myc accumulation." Mol Cell Biol 26 (7): 2832-2844. Arroyo, J. D., G. M. Lee and W. C. Hahn (2008). "Liprin alpha1 interacts with PP2A B56gamma." Cell Cycle 7(4): 525-532. Asperti, C., V. Astro, E. Pettinato, S. Paris, A. Bachi and I. de Curtis (2011). "Biochemical and functional characterization of the interaction between liprin-alpha1 and GIT1: implications for the regulation of cell motility." PLoS One 6(6): e20757. Asperti, C., V. Astro, A. Totaro, S. Paris and I. de Curtis (2009). "Liprin-alpha1 promotes cell spreading on the extracellular matrix by affecting the distribution of activated integrins." J Cell Sci 122 (Pt 18): 3225-3232. Asperti, C., E. Pettinato and I. de Curtis (2010). "Liprin-alpha1 affects the distribution of low- affinity beta1 integrins and stabilizes their permanence at the cell surface." Exp Cell Res 316 (6): 915-926. Astro, V., C. Asperti, M. G. Cangi, C. Doglioni and I. de Curtis (2011). "Liprin-alpha1 regulates breast cancer cell invasion by affecting cell motility, invadopodia and extracellular matrix degradation." Oncogene 30 (15): 1841-1849. Astro, V., S. Chiaretti, E. Magistrati, M. Fivaz and I. de Curtis (2014). "Liprin-alpha1, ERC1 and LL5 define polarized and dynamic structures that are implicated in cell migration." J Cell Sci 127 (Pt 17): 3862-3876. Aza-Blanc, P., H. Y. Lin, A. Ruiz i Altaba and T. B. Kornberg (2000). "Expression of the vertebrate Gli proteins in Drosophila reveals a distribution of activator and repressor activities." Development 127 (19): 4293-4301. Bai, C. B. and A. L. Joyner (2001). "Gli1 can rescue the in vivo function of Gli2." Development 128 (24): 5161-5172. 120 Barresi, M. J., H. L. Stickney and S. H. Devoto (2000). "The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity." Development 127 (10): 2189-2199. Bassilana, F., A. Carlson, J. A. DaSilva, B. Grosshans, S. Vidal, V. Beck, B. Wilmeringwetter, L. A. Llamas, T. B. Showalter, P. Rigollier, A. Bourret, A. Ramamurthy, X. Wu, F. Harbinski, S. Plonsky, L. Lee, H. Ruffner, P. Grandi, M. Schirle, J. Jenkins, A. W. Sailer, T. Bouwmeester, J. A. Porter, V. Myer, P. M. Finan, J. A. Tallarico, J. F. Kelleher, 3rd, K. Seuwen, R. K. Jain and S. J. Luchansky (2014). "Target identification for a Hedgehog pathway inhibitor reveals the receptor GPR39." Nat Chem Biol 10 (5): 343-349. Beachy, P. A., S. S. Karhadkar and D. M. Berman (2004). "Tissue repair and stem cell renewal in carcinogenesis." Nature 432 (7015): 324-331. Berbari, N. F., A. D. Johnson, J. S. Lewis, C. C. Askwith and K. Mykytyn (2008). "Identification of ciliary localization sequences within the third intracellular loop of G protein- coupled receptors." Mol Biol Cell 19 (4): 1540-1547. Berman, D. M., S. S. Karhadkar, A. Maitra, R. Montes De Oca, M. R. Gerstenblith, K. Briggs, A. R. Parker, Y. Shimada, J. R. Eshleman, D. N. Watkins and P. A. Beachy (2003). "Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours." Nature 425 (6960): 846-851. Bhogaraju, S., B. D. Engel and E. Lorentzen (2013). "Intraflagellar transport complex structure and cargo interactions." Cilia 2(1): 10. Bookout, A. L., C. L. Cummins, D. J. Mangelsdorf, J. M. Pesola and M. F. Kramer (2006). "High-throughput real-time quantitative reverse transcription PCR." Curr Protoc Mol Biol Chapter 15 : Unit 15 18. Brailov, I., M. Bancila, M. J. Brisorgueil, M. C. Miquel, M. Hamon and D. Verge (2000). "Localization of 5-HT(6) receptors at the plasma membrane of neuronal cilia in the rat brain." Brain Res 872 (1-2): 271-275. Briscoe, J. and P. P. Therond (2013). "The mechanisms of Hedgehog signalling and its roles in development and disease." Nat Rev Mol Cell Biol 14 (7): 416-429. Camp, D., K. Currie, A. Labbe, D. J. van Meyel and F. Charron (2010). "Ihog and Boi are essential for Hedgehog signaling in Drosophila." Neural Dev 5: 28. Campbell, L. E. and C. G. Proud (2002). "Differing substrate specificities of members of the DYRK family of arginine-directed protein kinases." FEBS Lett 510 (1-2): 31-36. Caparros-Martin, J. A., M. Valencia, E. Reytor, M. Pacheco, M. Fernandez, A. Perez-Aytes, E. Gean, P. Lapunzina, H. Peters, J. A. Goodship and V. L. Ruiz-Perez (2013). "The ciliary Evc/Evc2 complex interacts with Smo and controls Hedgehog pathway activity in chondrocytes by regulating Sufu/Gli3 dissociation and Gli3 trafficking in primary cilia." Hum Mol Genet 22 (1): 124-139. 121 Carpenter, B. S., R. L. Barry, K. J. Verhey and B. L. Allen (2015). "The heterotrimeric kinesin- 2 complex interacts with and regulates GLI protein function." J Cell Sci 128 (5): 1034-1050. Casso, D. J., S. Liu, D. D. Iwaki, S. K. Ogden and T. B. Kornberg (2008). "A screen for modifiers of hedgehog signaling in Drosophila melanogaster identifies swm and mts." Genetics 178 (3): 1399-1413. Chen, J. K., J. Taipale, M. K. Cooper and P. A. Beachy (2002). "Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened." Genes Dev 16 (21): 2743-2748. Chen, J. K., J. Taipale, K. E. Young, T. Maiti and P. A. Beachy (2002). "Small molecule modulation of Smoothened activity." Proc Natl Acad Sci U S A 99 (22): 14071-14076. Chen, M. H., N. Gao, T. Kawakami and P. T. Chuang (2005). "Mice deficient in the fused homolog do not exhibit phenotypes indicative of perturbed hedgehog signaling during embryonic development." Mol Cell Biol 25 (16): 7042-7053. Chen, M. H., C. W. Wilson, Y. J. Li, K. K. Law, C. S. Lu, R. Gacayan, X. Zhang, C. C. Hui and P. T. Chuang (2009). "Cilium-independent regulation of Gli protein function by Sufu in Hedgehog signaling is evolutionarily conserved." Genes Dev 23 (16): 1910-1928. Chen, W., X. R. Ren, C. D. Nelson, L. S. Barak, J. K. Chen, P. A. Beachy, F. de Sauvage and R. J. Lefkowitz (2004). "Activity-dependent internalization of smoothened mediated by beta- arrestin 2 and GRK2." Science 306 (5705): 2257-2260. Cheung, H. O., X. Zhang, A. Ribeiro, R. Mo, S. Makino, V. Puviindran, K. K. Law, J. Briscoe and C. C. Hui (2009). "The kinesin protein Kif7 is a critical regulator of Gli transcription factors in mammalian hedgehog signaling." Sci Signal 2(76): ra29. Chiang, C., Y. Litingtung, E. Lee, K. E. Young, J. L. Corden, H. Westphal and P. A. Beachy (1996). "Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function." Nature 383 (6599): 407-413. Chih, B., P. Liu, Y. Chinn, C. Chalouni, L. G. Komuves, P. E. Hass, W. Sandoval and A. S. Peterson (2012). "A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain." Nat Cell Biol 14 (1): 61-72. Choi, H., B. Larsen, Z. Y. Lin, A. Breitkreutz, D. Mellacheruvu, D. Fermin, Z. S. Qin, M. Tyers, A. C. Gingras and A. I. Nesvizhskii (2011). "SAINT: probabilistic scoring of affinity purification-mass spectrometry data." Nat Methods 8(1): 70-73. Choi, H., G. Liu, D. Mellacheruvu, M. Tyers, A. C. Gingras and A. I. Nesvizhskii (2012). "Analyzing protein-protein interactions from affinity purification-mass spectrometry data with SAINT." Curr Protoc Bioinformatics Chapter 8 : Unit8 15. Choi, H., G. Liu, D. Mellacheruvu, M. Tyers, A. C. Gingras and A. I. Nesvizhskii (2012). "Analyzing protein-protein interactions from affinity purification-mass spectrometry data with SAINT." Curr Protoc Bioinformatics Chapter 8 : Unit8.15. 122 Chong, Y. C., R. K. Mann, C. Zhao, M. Kato and P. A. Beachy (2015). "Bifurcating action of Smoothened in Hedgehog signaling is mediated by Dlg5." Genes Dev 29 (3): 262-276. Chuang, P. T. and A. P. McMahon (1999). "Vertebrate Hedgehog signalling modulated by induction of a Hedgehog-binding protein." Nature 397 (6720): 617-621. Clement, V., P. Sanchez, N. de Tribolet, I. Radovanovic and A. Ruiz i Altaba (2007). "HEDGEHOG-GLI1 signaling regulates human glioma growth, cancer stem cell self-renewal, and tumorigenicity." Curr Biol 17 (2): 165-172. Coles, G. L. and K. G. Ackerman (2013). "Kif7 is required for the patterning and differentiation of the diaphragm in a model of syndromic congenital diaphragmatic hernia." Proc Natl Acad Sci U S A 110 (21): E1898-1905. Collins, B. C., L. C. Gillet, G. Rosenberger and H. L. Rost (2013). "Quantifying protein interaction dynamics by SWATH mass spectrometry: application to the 14-3-3 system." 10 (12): 1246-1253. Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffini and F. Zhang (2013). "Multiplex genome engineering using CRISPR/Cas systems." Science 339 (6121): 819-823. Cooper, A. F., K. P. Yu, M. Brueckner, L. L. Brailey, L. Johnson, J. M. McGrath and A. E. Bale (2005). "Cardiac and CNS defects in a mouse with targeted disruption of suppressor of fused." Development 132 (19): 4407-4417. Corbit, K. C., P. Aanstad, V. Singla, A. R. Norman, D. Y. Stainier and J. F. Reiter (2005). "Vertebrate Smoothened functions at the primary cilium." Nature 437 (7061): 1018-1021. Corbit, K. C., A. E. Shyer, W. E. Dowdle, J. Gaulden, V. Singla, M. H. Chen, P. T. Chuang and J. F. Reiter (2008). "Kif3a constrains beta-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms." Nat Cell Biol 10 (1): 70-76. Czarnecki, P. G. and J. V. Shah (2012). "The ciliary transition zone: from morphology and molecules to medicine." Trends Cell Biol 22 (4): 201-210. Dafinger, C., M. C. Liebau, S. M. Elsayed, Y. Hellenbroich, E. Boltshauser, G. C. Korenke, F. Fabretti, A. R. Janecke, I. Ebermann, G. Nurnberg, P. Nurnberg, H. Zentgraf, F. Koerber, K. Addicks, E. Elsobky, T. Benzing, B. Schermer and H. J. Bolz (2011). "Mutations in KIF7 link Joubert syndrome with Sonic Hedgehog signaling and microtubule dynamics." J Clin Invest 121 (7): 2662-2667. de Curtis, I. (2011). "Function of liprins in cell motility." Exp Cell Res 317 (1): 1-8. Deutsch, E. W., L. Mendoza, D. Shteynberg, T. Farrah, H. Lam, N. Tasman, Z. Sun, E. Nilsson, B. Pratt, B. Prazen, J. K. Eng, D. B. Martin, A. I. Nesvizhskii and R. Aebersold (2010). "A guided tour of the Trans-Proteomic Pipeline." Proteomics 10 (6): 1150-1159. 123 Ding, Q., S. Fukami, X. Meng, Y. Nishizaki, X. Zhang, H. Sasaki, A. Dlugosz, M. Nakafuku and C. Hui (1999). "Mouse suppressor of fused is a negative regulator of sonic hedgehog signaling and alters the subcellular distribution of Gli1." Curr Biol 9(19): 1119-1122. Dishinger, J. F., H. L. Kee, P. M. Jenkins, S. Fan, T. W. Hurd, J. W. Hammond, Y. N. Truong, B. Margolis, J. R. Martens and K. J. Verhey (2010). "Ciliary entry of the kinesin-2 motor KIF17 is regulated by importin-beta2 and RanGTP." Nat Cell Biol 12 (7): 703-710. Domon, B. and R. Aebersold (2006). "Mass spectrometry and protein analysis." Science 312 (5771): 212-217. Dorn, K. V., C. E. Hughes and R. Rohatgi (2012). "A Smoothened-Evc2 complex transduces the Hedgehog signal at primary cilia." Dev Cell 23 (4): 823-835. Dunham, W. H., M. Mullin and A. C. Gingras (2012). "Affinity-purification coupled to mass spectrometry: basic principles and strategies." Proteomics 12 (10): 1576-1590. Dwyer, N. D., C. E. Adler, J. G. Crump, N. D. L'Etoile and C. I. Bargmann (2001). "Polarized dendritic transport and the AP-1 mu1 clathrin adaptor UNC-101 localize odorant receptors to olfactory cilia." Neuron 31 (2): 277-287. Endoh-Yamagami, S., M. Evangelista, D. Wilson, X. Wen, J. W. Theunissen, K. Phamluong, M. Davis, S. J. Scales, M. J. Solloway, F. J. de Sauvage and A. S. Peterson (2009). "The mammalian Cos2 homolog Kif7 plays an essential role in modulating Hh signal transduction during development." Curr Biol 19 (15): 1320-1326. Eng, J. K., T. A. Jahan and M. R. Hoopmann (2013). "Comet: an open-source MS/MS sequence database search tool." Proteomics 13 (1): 22-24. Ferrante, M. I., L. Romio, S. Castro, J. E. Collins, D. A. Goulding, D. L. Stemple, A. S. Woolf and S. W. Wilson (2009). "Convergent extension movements and ciliary function are mediated by ofd1, a zebrafish orthologue of the human oral-facial-digital type 1 syndrome gene." Hum Mol Genet 18 (2): 289-303. Gailani, M. R., M. Stahle-Backdahl, D. J. Leffell, M. Glynn, P. G. Zaphiropoulos, C. Pressman, A. B. Unden, M. Dean, D. E. Brash, A. E. Bale and R. Toftgard (1996). "The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas." Nat Genet 14 (1): 78-81. Garcia-Gonzalo, F. R., K. C. Corbit, M. S. Sirerol-Piquer, G. Ramaswami, E. A. Otto, T. R. Noriega, A. D. Seol, J. F. Robinson, C. L. Bennett, D. J. Josifova, J. M. Garcia-Verdugo, N. Katsanis, F. Hildebrandt and J. F. Reiter (2011). "A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition." Nat Genet 43 (8): 776-784. Garcia-Gonzalo, F. R. and J. F. Reiter (2012). "Scoring a backstage pass: mechanisms of ciliogenesis and ciliary access." J Cell Biol 197 (6): 697-709. Geng, L., D. Okuhara, Z. Yu, X. Tian, Y. Cai, S. Shibazaki and S. Somlo (2006). "Polycystin-2 traffics to cilia independently of polycystin-1 by using an N-terminal RVxP motif." J Cell Sci 119 (Pt 7): 1383-1395. 124 Gerdes, J. M., Y. Liu, N. A. Zaghloul, C. C. Leitch, S. S. Lawson, M. Kato, P. A. Beachy, P. L. Beales, G. N. DeMartino, S. Fisher, J. L. Badano and N. Katsanis (2007). "Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response." Nat Genet 39 (11): 1350-1360. Gillet, L. C., P. Navarro, S. Tate, H. Rost, N. Selevsek, L. Reiter, R. Bonner and R. Aebersold (2012). "Targeted data extraction of the MS/MS spectra generated by data-independent acquisition: a new concept for consistent and accurate proteome analysis." Mol Cell Proteomics 11 (6): O111.016717. Gingras, A. C., R. Aebersold and B. Raught (2005). "Advances in protein complex analysis using mass spectrometry." J Physiol 563 (Pt 1): 11-21. Gingras, A. C., M. Gstaiger, B. Raught and R. Aebersold (2007). "Analysis of protein complexes using mass spectrometry." Nat Rev Mol Cell Biol 8(8): 645-654. Glatter, T., A. Wepf, R. Aebersold and M. Gstaiger (2009). "An integrated workflow for charting the human interaction proteome: insights into the PP2A system." Mol Syst Biol 5: 237. Goodrich, L. V., L. Milenkovic, K. M. Higgins and M. P. Scott (1997). "Altered neural cell fates and medulloblastoma in mouse patched mutants." Science 277 (5329): 1109-1113. Goudreault, M., L. M. D'Ambrosio, M. J. Kean, M. J. Mullin, B. G. Larsen, A. Sanchez, S. Chaudhry, G. I. Chen, F. Sicheri, A. I. Nesvizhskii, R. Aebersold, B. Raught and A. C. Gingras (2009). "A PP2A phosphatase high density interaction network identifies a novel striatin- interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein." Mol Cell Proteomics 8(1): 157-171. Grau, Y. and P. Simpson (1987). "The segment polarity gene costal-2 in Drosophila. I. The organization of both primary and secondary embryonic fields may be affected." Dev Biol 122 (1): 186-200. Guillaud, L., R. Wong and N. Hirokawa (2008). "Disruption of KIF17-Mint1 interaction by CaMKII-dependent phosphorylation: a molecular model of kinesin-cargo release." Nat Cell Biol 10 (1): 19-29. Gwack, Y., S. Sharma, J. Nardone, B. Tanasa, A. Iuga, S. Srikanth, H. Okamura, D. Bolton, S. Feske, P. G. Hogan and A. Rao (2006). "A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulators of NFAT." Nature 441 (7093): 646-650. Handel, M., S. Schulz, A. Stanarius, M. Schreff, M. Erdtmann-Vourliotis, H. Schmidt, G. Wolf and V. Hollt (1999). "Selective targeting of somatostatin receptor 3 to neuronal cilia." Neuroscience 89 (3): 909-926. Hartl, T. A. and M. P. Scott (2014). "Wing tips: The wing disc as a platform for studying Hedgehog signaling." Methods 68 (1): 199-206. 125 He, M., R. Subramanian, F. Bangs, T. Omelchenko, K. F. Liem, Jr., T. M. Kapoor and K. V. Anderson (2014). "The kinesin-4 protein Kif7 regulates mammalian Hedgehog signalling by organizing the cilium tip compartment." Nat Cell Biol 16 (7): 663-672. Hildebrandt, F., T. Benzing and N. Katsanis (2011). "Ciliopathies." N Engl J Med 364 (16): 1533-1543. Himpel, S., W. Tegge, R. Frank, S. Leder, H. G. Joost and W. Becker (2000). "Specificity determinants of substrate recognition by the protein kinase DYRK1A." J Biol Chem 275 (4): 2431-2438. Hirokawa, N., Y. Noda, Y. Tanaka and S. Niwa (2009). "Kinesin superfamily motor proteins and intracellular transport." Nat Rev Mol Cell Biol 10 (10): 682-696. Ho, J., Y. Du, O. G. Wong, M. K. Siu, K. K. Chan and A. N. Cheung (2014). "Downregulation of the gli transcription factors regulator Kif7 facilitates cell survival and migration of choriocarcinoma cells." PLoS One 9(9): e108248. Hollway, G. E., J. Maule, P. Gautier, T. M. Evans, D. G. Keenan, C. Lohs, D. Fischer, C. Wicking and P. D. Currie (2006). "Scube2 mediates Hedgehog signalling in the zebrafish embryo." Dev Biol 294 (1): 104-118. Hoogenraad, C. C., M. I. Feliu-Mojer, S. A. Spangler, A. D. Milstein, A. W. Dunah, A. Y. Hung and M. Sheng (2007). "Liprinalpha1 degradation by calcium/calmodulin-dependent protein kinase II regulates LAR receptor tyrosine phosphatase distribution and dendrite development." Dev Cell 12 (4): 587-602. Houde, C., R. J. Dickinson, V. M. Houtzager, R. Cullum, R. Montpetit, M. Metzler, E. M. Simpson, S. Roy, M. R. Hayden, P. A. Hoodless and D. W. Nicholson (2006). "Hippi is essential for node cilia assembly and Sonic hedgehog signaling." Dev Biol 300 (2): 523-533. Hsu, C. C., J. D. Moncaleano and O. I. Wagner (2011). "Sub-cellular distribution of UNC- 104(KIF1A) upon binding to adaptors as UNC-16(JIP3), DNC-1(DCTN1/Glued) and SYD- 2(Liprin-alpha) in C. elegans neurons." Neuroscience 176 : 39-52. Hsu, S. H., X. Zhang, C. Yu, Z. J. Li, J. S. Wunder, C. C. Hui and B. A. Alman (2011). "Kif7 promotes hedgehog signaling in growth plate chondrocytes by restricting the inhibitory function of Sufu." Development 138 (17): 3791-3801. Huangfu, D. and K. V. Anderson (2005). "Cilia and Hedgehog responsiveness in the mouse." Proc Natl Acad Sci U S A 102 (32): 11325-11330. Huangfu, D., A. Liu, A. S. Rakeman, N. S. Murcia, L. Niswander and K. V. Anderson (2003). "Hedgehog signalling in the mouse requires intraflagellar transport proteins." Nature 426 (6962): 83-87. Hui, C. C. and S. Angers (2011). "Gli proteins in development and disease." Annu Rev Cell Dev Biol 27 : 513-537. 126 Humke, E. W., K. V. Dorn, L. Milenkovic, M. P. Scott and R. Rohatgi (2010). "The output of Hedgehog signaling is controlled by the dynamic association between Suppressor of Fused and the Gli proteins." Genes Dev 24(7): 670-682. Iliuk, A., X. S. Liu, L. Xue, X. Liu and W. A. Tao (2012). "Chemical visualization of phosphoproteomes on membrane." Mol Cell Proteomics 11 (9): 629-639. Insinna, C., M. Humby, T. Sedmak, U. Wolfrum and J. C. Besharse (2009). "Different roles for KIF17 and kinesin II in photoreceptor development and maintenance." Dev Dyn 238 (9): 2211- 2222. Insinna, C., N. Pathak, B. Perkins, I. Drummond and J. C. Besharse (2008). "The homodimeric kinesin, Kif17, is essential for vertebrate photoreceptor sensory outer segment development." Dev Biol 316 (1): 160-170. Ishikawa, H., J. Thompson, J. R. Yates, 3rd and W. F. Marshall (2012). "Proteomic analysis of mammalian primary cilia." Current biology : CB 22 (5): 414-419. Ishikawa, H., J. Thompson, J. R. Yates, 3rd and W. F. Marshall (2012). "Proteomic analysis of mammalian primary cilia." Curr Biol 22 (5): 414-419. Jacob, J. and J. Briscoe (2003). "Gli proteins and the control of spinal-cord patterning." EMBO Rep 4(8): 761-765. Janssens, V. and J. Goris (2001). "Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling." Biochem J 353 (Pt 3): 417-439. Jenkins, P. M., T. W. Hurd, L. Zhang, D. P. McEwen, R. L. Brown, B. Margolis, K. J. Verhey and J. R. Martens (2006). "Ciliary targeting of olfactory CNG channels requires the CNGB1b subunit and the kinesin-2 motor protein, KIF17." Curr Biol 16 (12): 1211-1216. Jia, H., Y. Liu, W. Yan and J. Jia (2009). "PP4 and PP2A regulate Hedgehog signaling by controlling Smo and Ci phosphorylation." Development 136 (2): 307-316. Jia, J., A. Kolterud, H. Zeng, A. Hoover, S. Teglund, R. Toftgard and A. Liu (2009). "Suppressor of Fused inhibits mammalian Hedgehog signaling in the absence of cilia." Dev Biol 330 (2): 452-460. Jia, J., C. Tong and J. Jiang (2003). "Smoothened transduces Hedgehog signal by physically interacting with Costal2/Fused complex through its C-terminal tail." Genes Dev 17 (21): 2709- 2720. Jiang, J. and C. C. Hui (2008). "Hedgehog signaling in development and cancer." Dev Cell 15 (6): 801-812. Johnson, R. L., A. L. Rothman, J. Xie, L. V. Goodrich, J. W. Bare, J. M. Bonifas, A. G. Quinn, R. M. Myers, D. R. Cox, E. H. Epstein, Jr. and M. P. Scott (1996). "Human homolog of patched, a candidate gene for the basal cell nevus syndrome." Science 272 (5268): 1668-1671. 127 Kappler, R., R. Bauer, J. Calzada-Wack, M. Rosemann, B. Hemmerlein and H. Hahn (2004). "Profiling the molecular difference between Patched- and p53-dependent rhabdomyosarcoma." Oncogene 23 (54): 8785-8795. Karaer, K., Z. Yuksel, A. Ichkou, C. Calisir and T. Attie-Bitach (2015). "A novel KIF7 mutation in two affected siblings with acrocallosal syndrome." Clin Dysmorphol 24 (2): 61-64. Karhadkar, S. S., G. S. Bova, N. Abdallah, S. Dhara, D. Gardner, A. Maitra, J. T. Isaacs, D. M. Berman and P. A. Beachy (2004). "Hedgehog signalling in prostate regeneration, neoplasia and metastasis." Nature 431 (7009): 707-712. Karlstrom, R. O., W. S. Talbot and A. F. Schier (1999). "Comparative synteny cloning of zebrafish you-too: mutations in the Hedgehog target gli2 affect ventral forebrain patterning." Genes Dev 13 (4): 388-393. Karlstrom, R. O., O. V. Tyurina, A. Kawakami, N. Nishioka, W. S. Talbot, H. Sasaki and A. F. Schier (2003). "Genetic analysis of zebrafish gli1 and gli2 reveals divergent requirements for gli genes in vertebrate development." Development 130 (8): 1549-1564. Katoh, Y. and M. Katoh (2004). "Characterization of KIF7 gene in silico." Int J Oncol 25 (6): 1881-1886. Kaufmann, N., J. DeProto, R. Ranjan, H. Wan and D. Van Vactor (2002). "Drosophila liprin- alpha and the receptor phosphatase Dlar control synapse morphogenesis." Neuron 34 (1): 27-38. Kawakami, A., Y. Nojima, A. Toyoda, M. Takahoko, M. Satoh, H. Tanaka, H. Wada, I. Masai, H. Terasaki, Y. Sakaki, H. Takeda and H. Okamoto (2005). "The zebrafish-secreted matrix protein you/scube2 is implicated in long-range regulation of hedgehog signaling." Curr Biol 15 (5): 480-488. Kean, M. J., A. L. Couzens and A. C. Gingras (2012). "Mass spectrometry approaches to study mammalian kinase and phosphatase associated proteins." Methods 57 (4): 400-408. Kee, H. L., J. F. Dishinger, T. L. Blasius, C. J. Liu, B. Margolis and K. J. Verhey (2012). "A size-exclusion permeability barrier and nucleoporins characterize a ciliary pore complex that regulates transport into cilia." Nat Cell Biol 14 (4): 431-437. Keller, A., A. I. Nesvizhskii, E. Kolker and R. Aebersold (2002). "Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search." Anal Chem 74 (20): 5383-5392. Keramati, A. R., M. Fathzadeh, G. W. Go, R. Singh, M. Choi, S. Faramarzi, S. Mane, M. Kasaei, K. Sarajzadeh-Fard, J. Hwa, K. K. Kidd, M. A. Babaee Bigi, R. Malekzadeh, A. Hosseinian, M. Babaei, R. P. Lifton and A. Mani (2014). "A form of the metabolic syndrome associated with mutations in DYRK1B." N Engl J Med 370 (20): 1909-1919. Kim, J., J. E. Lee, S. Heynen-Genel, E. Suyama, K. Ono, K. Lee, T. Ideker, P. Aza-Blanc and J. G. Gleeson (2010). "Functional genomic screen for modulators of ciliogenesis and cilium length." Nature 464 (7291): 1048-1051. 128 Klejnot, M. and F. Kozielski (2012). "Structural insights into human Kif7, a kinesin involved in Hedgehog signalling." Acta Crystallogr D Biol Crystallogr 68 (Pt 2): 154-159. Knight, J. D., T. Pawson and A. C. Gingras (2013). "Profiling the kinome: current capabilities and future challenges." J Proteomics 81 : 43-55. Kogerman, P., T. Grimm, L. Kogerman, D. Krause, A. B. Unden, B. Sandstedt, R. Toftgard and P. G. Zaphiropoulos (1999). "Mammalian suppressor-of-fused modulates nuclear-cytoplasmic shuttling of Gli-1." Nat Cell Biol 1(5): 312-319. Kozminski, K. G., K. A. Johnson, P. Forscher and J. L. Rosenbaum (1993). "A motility in the eukaryotic flagellum unrelated to flagellar beating." Proc Natl Acad Sci U S A 90 (12): 5519- 5523. Krishnan, V., F. A. Pereira, Y. Qiu, C. H. Chen, P. A. Beachy, S. Y. Tsai and M. J. Tsai (1997). "Mediation of Sonic hedgehog-induced expression of COUP-TFII by a protein phosphatase." Science 278 (5345): 1947-1950. Kubo, M., M. Nakamura, A. Tasaki, N. Yamanaka, H. Nakashima, M. Nomura, S. Kuroki and M. Katano (2004). "Hedgehog signaling pathway is a new therapeutic target for patients with breast cancer." Cancer Res 64 (17): 6071-6074. Lambert, J. P., G. Ivosev, A. L. Couzens, B. Larsen, M. Taipale, Z. Y. Lin, Q. Zhong, S. Lindquist, M. Vidal, R. Aebersold, T. Pawson, R. Bonner, S. Tate and A. C. Gingras (2013). "Mapping differential interactomes by affinity purification coupled with data-independent mass spectrometry acquisition." Nat Methods 10 (12): 1239-1245. Lambert, J. P., M. Tucholska, C. Go, J. D. Knight and A. C. Gingras (2014). "Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes." J Proteomics . Lauth, M., A. Bergstrom, T. Shimokawa and R. Toftgard (2007). "Inhibition of GLI-mediated transcription and tumor cell growth by small-molecule antagonists." Proc Natl Acad Sci U S A 104 (20): 8455-8460. Lauth, M., A. Bergstrom, T. Shimokawa, U. Tostar, Q. Jin, V. Fendrich, C. Guerra, M. Barbacid and R. Toftgard (2010). "DYRK1B-dependent autocrine-to-paracrine shift of Hedgehog signaling by mutant RAS." Nat Struct Mol Biol 17 (6): 718-725. Law, K. K., S. Makino, R. Mo, X. Zhang, V. Puviindran and C. C. Hui (2012). "Antagonistic and cooperative actions of Kif7 and Sufu define graded intracellular Gli activities in Hedgehog signaling." PLoS One 7(11): e50193. Lechward, K., O. S. Awotunde, W. Swiatek and G. Muszynska (2001). "Protein phosphatase 2A: variety of forms and diversity of functions." Acta Biochim Pol 48 (4): 921-933. Lefers, M. A., Q. T. Wang and R. A. Holmgren (2001). "Genetic dissection of the Drosophila Cubitus interruptus signaling complex." Dev Biol 236 (2): 411-420. 129 Li, L., X. Tian, M. Zhu, D. Bulgari, M. A. Bohme, F. Goettfert, C. Wichmann, S. J. Sigrist, E. S. Levitan and C. Wu (2014). "Drosophila Syd-1, liprin-alpha, and protein phosphatase 2A B' subunit Wrd function in a linear pathway to prevent ectopic accumulation of synaptic materials in distal axons." J Neurosci 34 (25): 8474-8487. Li, Z. J., E. Nieuwenhuis, W. Nien, X. Zhang, J. Zhang, V. Puviindran, B. J. Wainwright, P. C. Kim and C. C. Hui (2012). "Kif7 regulates Gli2 through Sufu-dependent and -independent functions during skin development and tumorigenesis." Development 139 (22): 4152-4161. Liang, Y., Y. Pang, Q. Wu, Z. Hu, X. Han, Y. Xu, H. Deng and J. Pan (2014). "FLA8/KIF3B phosphorylation regulates kinesin-II interaction with IFT-B to control IFT entry and turnaround." Dev Cell 30 (5): 585-597. Liem, K. F., Jr., M. He, P. J. Ocbina and K. V. Anderson (2009). "Mouse Kif7/Costal2 is a cilia- associated protein that regulates Sonic hedgehog signaling." Proc Natl Acad Sci U S A 106 (32): 13377-13382. Litingtung, Y., L. Lei, H. Westphal and C. Chiang (1998). "Sonic hedgehog is essential to foregut development." Nat Genet 20 (1): 58-61. Liu, A., B. Wang and L. A. Niswander (2005). "Mouse intraflagellar transport proteins regulate both the activator and repressor functions of Gli transcription factors." Development 132 (13): 3103-3111. Liu, G., J. Zhang, B. Larsen, C. Stark, A. Breitkreutz, Z. Y. Lin, B. J. Breitkreutz, Y. Ding, K. Colwill, A. Pasculescu, T. Pawson, J. L. Wrana, A. I. Nesvizhskii, B. Raught, M. Tyers and A. C. Gingras (2010). "ProHits: integrated software for mass spectrometry-based interaction proteomics." Nat Biotechnol 28 (10): 1015-1017. Liu, Q., G. Tan, N. Levenkova, T. Li, E. N. Pugh, Jr., J. J. Rux, D. W. Speicher and E. A. Pierce (2007). "The proteome of the mouse photoreceptor sensory cilium complex." Mol Cell Proteomics 6(8): 1299-1317. Liu, Y. C., A. L. Couzens, A. R. Deshwar, B. M.-C. LD, X. Zhang, V. Puviindran, I. C. Scott, A. C. Gingras, C. C. Hui and S. Angers (2014). "The PPFIA1-PP2A protein complex promotes trafficking of Kif7 to the ciliary tip and Hedgehog signaling." Sci Signal 7(355): ra117. Lum, L. and P. A. Beachy (2004). "The Hedgehog response network: sensors, switches, and routers." Science 304 (5678): 1755-1759. Lum, L., C. Zhang, S. Oh, R. K. Mann, D. P. von Kessler, J. Taipale, F. Weis-Garcia, R. Gong, B. Wang and P. A. Beachy (2003). "Hedgehog signal transduction via Smoothened association with a cytoplasmic complex scaffolded by the atypical kinesin, Costal-2." Mol Cell 12 (5): 1261- 1274. Maloverjan, A., M. Piirsoo, L. Kasak, L. Peil, T. Osterlund and P. Kogerman (2010). "Dual function of UNC-51-like kinase 3 (Ulk3) in the Sonic hedgehog signaling pathway." J Biol Chem 285 (39): 30079-30090. 130 Maloverjan, A., M. Piirsoo, P. Michelson, P. Kogerman and T. Osterlund (2010). "Identification of a novel serine/threonine kinase ULK3 as a positive regulator of Hedgehog pathway." Exp Cell Res 316 (4): 627-637. Mann, M. and O. N. Jensen (2003). "Proteomic analysis of post-translational modifications." Nat Biotechnol 21 (3): 255-261. Mao, J., P. Maye, P. Kogerman, F. J. Tejedor, R. Toftgard, W. Xie, G. Wu and D. Wu (2002). "Regulation of Gli1 transcriptional activity in the nucleus by Dyrk1." J Biol Chem 277 (38): 35156-35161. Maurya, A. K., J. Ben, Z. Zhao, R. T. Lee, W. Niah, A. S. Ng, A. Iyu, W. Yu, S. Elworthy, F. J. van Eeden and P. W. Ingham (2013). "Positive and negative regulation of Gli activity by Kif7 in the zebrafish embryo." PLoS Genet 9(12): e1003955. May, S. R., A. M. Ashique, M. Karlen, B. Wang, Y. Shen, K. Zarbalis, J. Reiter, J. Ericson and A. S. Peterson (2005). "Loss of the retrograde motor for IFT disrupts localization of Smo to cilia and prevents the expression of both activator and repressor functions of Gli." Dev Biol 287 (2): 378-389. McMahon, A. P., P. W. Ingham and C. J. Tabin (2003). "Developmental roles and clinical significance of hedgehog signaling." Curr Top Dev Biol 53 : 1-114. Mellacheruvu, D., Z. Wright, A. L. Couzens, J. P. Lambert, N. A. St-Denis, T. Li, Y. V. Miteva, S. Hauri, M. E. Sardiu, T. Y. Low, V. A. Halim, R. D. Bagshaw, N. C. Hubner, A. Al-Hakim, A. Bouchard, D. Faubert, D. Fermin, W. H. Dunham, M. Goudreault, Z. Y. Lin, B. G. Badillo, T. Pawson, D. Durocher, B. Coulombe, R. Aebersold, G. Superti-Furga, J. Colinge, A. J. Heck, H. Choi, M. Gstaiger, S. Mohammed, I. M. Cristea, K. L. Bennett, M. P. Washburn, B. Raught, R. M. Ewing, A. C. Gingras and A. I. Nesvizhskii (2013). "The CRAPome: a contaminant repository for affinity purification-mass spectrometry data." Nat Methods 10 (8): 730-736. Merchant, M., M. Evangelista, S. M. Luoh, G. D. Frantz, S. Chalasani, R. A. Carano, M. van Hoy, J. Ramirez, A. K. Ogasawara, L. M. McFarland, E. H. Filvaroff, D. M. French and F. J. de Sauvage (2005). "Loss of the serine/threonine kinase fused results in postnatal growth defects and lethality due to progressive hydrocephalus." Mol Cell Biol 25 (16): 7054-7068. Methot, N. and K. Basler (2000). "Suppressor of fused opposes hedgehog signal transduction by impeding nuclear accumulation of the activator form of Cubitus interruptus." Development 127 (18): 4001-4010. Miki, H., Y. Okada and N. Hirokawa (2005). "Analysis of the kinesin superfamily: insights into structure and function." Trends Cell Biol 15 (9): 467-476. Milenkovic, L., M. P. Scott and R. Rohatgi (2009). "Lateral transport of Smoothened from the plasma membrane to the membrane of the cilium." J Cell Biol 187 (3): 365-374. Miller, K. E., J. DeProto, N. Kaufmann, B. N. Patel, A. Duckworth and D. Van Vactor (2005). "Direct observation demonstrates that Liprin-alpha is required for trafficking of synaptic vesicles." Current biology : CB 15 (7): 684-689. 131 Miller, K. E., J. DeProto, N. Kaufmann, B. N. Patel, A. Duckworth and D. Van Vactor (2005). "Direct observation demonstrates that Liprin-alpha is required for trafficking of synaptic vesicles." Curr Biol 15 (7): 684-689. Ming, J. E., M. E. Kaupas, E. Roessler, H. G. Brunner, M. Golabi, M. Tekin, R. F. Stratton, E. Sujansky, S. J. Bale and M. Muenke (2002). "Mutations in PATCHED-1, the receptor for SONIC HEDGEHOG, are associated with holoprosencephaly." Hum Genet 110 (4): 297-301. Ming, J. E., E. Roessler and M. Muenke (1998). "Human developmental disorders and the Sonic hedgehog pathway." Mol Med Today 4(8): 343-349. Motoyama, J. (2006). "Essential roles of Gli3 and sonic hedgehog in pattern formation and developmental anomalies caused by their dysfunction." Congenit Anom (Kyoto) 46 (3): 123- 128. Muenke, M. and P. A. Beachy (2000). "Genetics of ventral forebrain development and holoprosencephaly." Curr Opin Genet Dev 10 (3): 262-269. Mukhopadhyay, S., X. Wen, N. Ratti, A. Loktev, L. Rangell, S. J. Scales and P. K. Jackson (2013). "The ciliary G-protein-coupled receptor Gpr161 negatively regulates the Sonic hedgehog pathway via cAMP signaling." Cell 152 (1-2): 210-223. Mumby, M. C. and G. Walter (1993). "Protein serine/threonine phosphatases: structure, regulation, and functions in cell growth." Physiol Rev 73 (4): 673-699. Myers, B. R., N. Sever, Y. C. Chong, J. Kim, J. D. Belani, S. Rychnovsky, J. F. Bazan and P. A. Beachy (2013). "Hedgehog pathway modulation by multiple lipid binding sites on the smoothened effector of signal response." Dev Cell 26 (4): 346-357. Nachtergaele, S., L. K. Mydock, K. Krishnan, J. Rammohan, P. H. Schlesinger, D. F. Covey and R. Rohatgi (2012). "Oxysterols are allosteric activators of the oncoprotein Smoothened." Nat Chem Biol 8(2): 211-220. Nachtergaele, S., D. M. Whalen, L. K. Mydock, Z. Zhao, T. Malinauskas, K. Krishnan, P. W. Ingham, D. F. Covey, C. Siebold and R. Rohatgi (2013). "Structure and function of the Smoothened extracellular domain in vertebrate Hedgehog signaling." Elife 2: e01340. Nagendra, D. C., J. Burke, 3rd, G. L. Maxwell and J. I. Risinger (2012). "PPP2R1A mutations are common in the serous type of endometrial cancer." Mol Carcinog 51 (10): 826-831. Nanni, L., J. E. Ming, M. Bocian, K. Steinhaus, D. W. Bianchi, C. Die-Smulders, A. Giannotti, K. Imaizumi, K. L. Jones, M. D. Campo, R. A. Martin, P. Meinecke, M. E. Pierpont, N. H. Robin, I. D. Young, E. Roessler and M. Muenke (1999). "The mutational spectrum of the sonic hedgehog gene in holoprosencephaly: SHH mutations cause a significant proportion of autosomal dominant holoprosencephaly." Hum Mol Genet 8(13): 2479-2488. Nedelcu, D., J. Liu, Y. Xu, C. Jao and A. Salic (2013). "Oxysterol binding to the extracellular domain of Smoothened in Hedgehog signaling." Nat Chem Biol 9(9): 557-564. 132 Nesvizhskii, A. I., A. Keller, E. Kolker and R. Aebersold (2003). "A statistical model for identifying proteins by tandem mass spectrometry." Anal Chem 75 (17): 4646-4658. Nieuwenhuis, E. and C. C. Hui (2005). "Hedgehog signaling and congenital malformations." Clin Genet 67 (3): 193-208. Ninkovic, J., C. Stigloher, C. Lillesaar and L. Bally-Cuif (2008). "Gsk3beta/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity." Development 135 (18): 3137-3148. Niwa, S., K. Nakajima, H. Miki, Y. Minato, D. Wang and N. Hirokawa (2012). "KIF19A is a microtubule-depolymerizing kinesin for ciliary length control." Dev Cell 23 (6): 1167-1175. Novarino, G., N. Akizu and J. G. Gleeson (2011). "Modeling human disease in humans: the ciliopathies." Cell 147 (1): 70-79. Nusslein-Volhard, C. and E. Wieschaus (1980). "Mutations affecting segment number and polarity in Drosophila." Nature 287 (5785): 795-801. Nybakken, K., S. A. Vokes, T. Y. Lin, A. P. McMahon and N. Perrimon (2005). "A genome- wide RNA interference screen in Drosophila melanogaster cells for new components of the Hh signaling pathway." Nat Genet 37 (12): 1323-1332. Ocbina, P. J. and K. V. Anderson (2008). "Intraflagellar transport, cilia, and mammalian Hedgehog signaling: analysis in mouse embryonic fibroblasts." Dev Dyn 237 (8): 2030-2038. Ocbina, P. J., J. T. Eggenschwiler, I. Moskowitz and K. V. Anderson (2011). "Complex interactions between genes controlling trafficking in primary cilia." Nat Genet 43 (6): 547-553. Ochi, H. and M. Westerfield (2007). "Signaling networks that regulate muscle development: lessons from zebrafish." Dev Growth Differ 49 (1): 1-11. Okuda, J., A. Hanabusa and N. Gotoh (2014). "ExoS of Pseudomonas aeruginosa binds to a human KIF7 to induce cytotoxicity in cultured human bronchial epithelial cells." J Infect Chemother 20 (2): 121-127. Pan, Y. and B. Wang (2007). "A novel protein-processing domain in Gli2 and Gli3 differentially blocks complete protein degradation by the proteasome." J Biol Chem 282 (15): 10846-10852. Pearse, R. V., 2nd, L. S. Collier, M. P. Scott and C. J. Tabin (1999). "Vertebrate homologs of Drosophila suppressor of fused interact with the gli family of transcriptional regulators." Dev Biol 212 (2): 323-336. Peng, J. and S. P. Gygi (2001). "Proteomics: the move to mixtures." J Mass Spectrom 36 (10): 1083-1091. Pepicelli, C. V., P. M. Lewis and A. P. McMahon (1998). "Sonic hedgehog regulates branching morphogenesis in the mammalian lung." Curr Biol 8(19): 1083-1086. 133 Petrova, R. and A. L. Joyner (2014). "Roles for Hedgehog signaling in adult organ homeostasis and repair." Development 141 (18): 3445-3457. Putoux, A., S. Nampoothiri, N. Laurent, V. Cormier-Daire, P. L. Beales, A. Schinzel, D. Bartholdi, C. Alby, S. Thomas, N. Elkhartoufi, A. Ichkou, J. Litzler, A. Munnich, F. Encha- Razavi, R. Kannan, L. Faivre, N. Boddaert, A. Rauch, M. Vekemans and T. Attie-Bitach (2012). "Novel KIF7 mutations extend the phenotypic spectrum of acrocallosal syndrome." J Med Genet 49 (11): 713-720. Putoux, A., S. Thomas, K. L. Coene, E. E. Davis, Y. Alanay, G. Ogur, E. Uz, D. Buzas, C. Gomes, S. Patrier, C. L. Bennett, N. Elkhartoufi, M. H. Frison, L. Rigonnot, N. Joye, S. Pruvost, G. E. Utine, K. Boduroglu, P. Nitschke, L. Fertitta, C. Thauvin-Robinet, A. Munnich, V. Cormier-Daire, R. Hennekam, E. Colin, N. A. Akarsu, C. Bole-Feysot, N. Cagnard, A. Schmitt, N. Goudin, S. Lyonnet, F. Encha-Razavi, J. P. Siffroi, M. Winey, N. Katsanis, M. Gonzales, M. Vekemans, P. L. Beales and T. Attie-Bitach (2011). "KIF7 mutations cause fetal hydrolethalus and acrocallosal syndromes." Nat Genet 43 (6): 601-606. Quinlan, R. J., J. L. Tobin and P. L. Beales (2008). "Modeling ciliopathies: Primary cilia in development and disease." Curr Top Dev Biol 84 : 249-310. Raffel, C., R. B. Jenkins, L. Frederick, D. Hebrink, B. Alderete, D. W. Fults and C. D. James (1997). "Sporadic medulloblastomas contain PTCH mutations." Cancer Res 57 (5): 842-845. Ranieri, N., L. Ruel, A. Gallet, S. Raisin and P. P. Therond (2012). "Distinct phosphorylations on kinesin costal-2 mediate differential hedgehog signaling strength." Dev Cell 22 (2): 279-294. Ranieri, N., L. Ruel, A. Gallet, S. Raisin and P. P. Therond (2012). "Distinct phosphorylations on kinesin costal-2 mediate differential hedgehog signaling strength." Developmental cell 22 (2): 279-294. Reiter, J. F., O. E. Blacque and M. R. Leroux (2012). "The base of the cilium: roles for transition fibres and the transition zone in ciliary formation, maintenance and compartmentalization." EMBO Rep 13 (7): 608-618. Robbins, D. J., K. E. Nybakken, R. Kobayashi, J. C. Sisson, J. M. Bishop and P. P. Therond (1997). "Hedgehog elicits signal transduction by means of a large complex containing the kinesin-related protein costal2." Cell 90 (2): 225-234. Roessler, E., Y. Z. Du, J. L. Mullor, E. Casas, W. P. Allen, G. Gillessen-Kaesbach, E. R. Roeder, J. E. Ming, A. Ruiz i Altaba and M. Muenke (2003). "Loss-of-function mutations in the human GLI2 gene are associated with pituitary anomalies and holoprosencephaly-like features." Proc Natl Acad Sci U S A 100 (23): 13424-13429. Rohatgi, R., L. Milenkovic and M. P. Scott (2007). "Patched1 regulates hedgehog signaling at the primary cilium." Science 317 (5836): 372-376. Rorick, A. M., W. Mei, N. L. Liette, C. Phiel, H. M. El-Hodiri and J. Yang (2007). "PP2A:B56epsilon is required for eye induction and eye field separation." Dev Biol 302 (2): 477-493. 134 Ross, A. J., H. May-Simera, E. R. Eichers, M. Kai, J. Hill, D. J. Jagger, C. C. Leitch, J. P. Chapple, P. M. Munro, S. Fisher, P. L. Tan, H. M. Phillips, M. R. Leroux, D. J. Henderson, J. N. Murdoch, A. J. Copp, M. M. Eliot, J. R. Lupski, D. T. Kemp, H. Dollfus, M. Tada, N. Katsanis, A. Forge and P. L. Beales (2005). "Disruption of Bardet-Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates." Nat Genet 37 (10): 1135-1140. Roux, K. J., D. I. Kim, M. Raida and B. Burke (2012). "A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells." J Cell Biol 196 (6): 801-810. Ruel, L., A. Gallet, S. Raisin, A. Truchi, L. Staccini-Lavenant, A. Cervantes and P. P. Therond (2007). "Phosphorylation of the atypical kinesin Costal2 by the kinase Fused induces the partial disassembly of the Smoothened-Fused-Costal2-Cubitus interruptus complex in Hedgehog signalling." Development 134 (20): 3677-3689. Ruiz i Altaba, A., C. Mas and B. Stecca (2007). "The Gli code: an information nexus regulating cell fate, stemness and cancer." Trends Cell Biol 17 (9): 438-447. Sablina, A. A., M. Hector, N. Colpaert and W. C. Hahn (2010). "Identification of PP2A complexes and pathways involved in cell transformation." Cancer Res 70 (24): 10474-10484. Schneider, L., C. A. Clement, S. C. Teilmann, G. J. Pazour, E. K. Hoffmann, P. Satir and S. T. Christensen (2005). "PDGFRalphaalpha signaling is regulated through the primary cilium in fibroblasts." Curr Biol 15 (20): 1861-1866. Scholey, J. M. (2008). "Intraflagellar transport motors in cilia: moving along the cell's antenna." J Cell Biol 180 (1): 23-29. Sekulic, A., M. R. Migden, A. E. Oro, L. Dirix, K. D. Lewis, J. D. Hainsworth, J. A. Solomon, S. Yoo, S. T. Arron, P. A. Friedlander, E. Marmur, C. M. Rudin, A. L. Chang, J. A. Low, H. M. Mackey, R. L. Yauch, R. A. Graham, J. C. Reddy and A. Hauschild (2012). "Efficacy and safety of vismodegib in advanced basal-cell carcinoma." N Engl J Med 366 (23): 2171-2179. Serra-Pages, C., N. L. Kedersha, L. Fazikas, Q. Medley, A. Debant and M. Streuli (1995). "The LAR transmembrane protein tyrosine phosphatase and a coiled-coil LAR-interacting protein co- localize at focal adhesions." Embo j 14 (12): 2827-2838. Serra-Pages, C., Q. G. Medley, M. Tang, A. Hart and M. Streuli (1998). "Liprins, a family of LAR transmembrane protein-tyrosine phosphatase-interacting proteins." J Biol Chem 273 (25): 15611-15620. Shih Ie, M., P. K. Panuganti, K. T. Kuo, T. L. Mao, E. Kuhn, S. Jones, V. E. Velculescu, R. J. Kurman and T. L. Wang (2011). "Somatic mutations of PPP2R1A in ovarian and uterine carcinomas." Am J Pathol 178 (4): 1442-1447. Shin, H., M. Wyszynski, K. H. Huh, J. G. Valtschanoff, J. R. Lee, J. Ko, M. Streuli, R. J. Weinberg, M. Sheng and E. Kim (2003). "Association of the kinesin motor KIF1A with the multimodular protein liprin-alpha." J Biol Chem 278 (13): 11393-11401. 135 Shin, H., M. Wyszynski, K. H. Huh, J. G. Valtschanoff, J. R. Lee, J. Ko, M. Streuli, R. J. Weinberg, M. Sheng and E. Kim (2003). "Association of the kinesin motor KIF1A with the multimodular protein liprin-alpha." The Journal of biological chemistry 278 (13): 11393-11401. Shteynberg, D., E. W. Deutsch, H. Lam, J. K. Eng, Z. Sun, N. Tasman, L. Mendoza, R. L. Moritz, R. Aebersold and A. I. Nesvizhskii (2011). "iProphet: multi-level integrative analysis of shotgun proteomic data improves peptide and protein identification rates and error estimates." Mol Cell Proteomics 10 (12): M111 007690. Sicklick, J. K., Y. X. Li, A. Jayaraman, R. Kannangai, Y. Qi, P. Vivekanandan, J. W. Ludlow, K. Owzar, W. Chen, M. S. Torbenson and A. M. Diehl (2006). "Dysregulation of the Hedgehog pathway in human hepatocarcinogenesis." Carcinogenesis 27 (4): 748-757. Sieburth, D., Q. Ch'ng, M. Dybbs, M. Tavazoie, S. Kennedy, D. Wang, D. Dupuy, J. F. Rual, D. E. Hill, M. Vidal, G. Ruvkun and J. M. Kaplan (2005). "Systematic analysis of genes required for synapse structure and function." Nature 436 (7050): 510-517. Simioni, M., T. K. Araujo, I. L. Monlleo, C. V. Maurer-Morelli and V. L. Gil-da-Silva-Lopes (2015). "Investigation of genetic factors underlying typical orofacial clefts: mutational screening and copy number variation." J Hum Genet 60 (1): 17-25. Sisson, J. C., K. S. Ho, K. Suyama and M. P. Scott (1997). "Costal2, a novel kinesin-related protein in the Hedgehog signaling pathway." Cell 90 (2): 235-245. Sorokin, S. P. (1968). "Reconstructions of centriole formation and ciliogenesis in mammalian lungs." J Cell Sci 3(2): 207-230. Spangler, S. A. and C. C. Hoogenraad (2007). "Liprin-alpha proteins: scaffold molecules for synapse maturation." Biochem Soc Trans 35 (Pt 5): 1278-1282. Stickney, H. L., M. J. Barresi and S. H. Devoto (2000). "Somite development in zebrafish." Dev Dyn 219 (3): 287-303. Stone, D. M., M. Murone, S. Luoh, W. Ye, M. P. Armanini, A. Gurney, H. Phillips, J. Brush, A. Goddard, F. J. de Sauvage and A. Rosenthal (1999). "Characterization of the human suppressor of fused, a negative regulator of the zinc-finger transcription factor Gli." J Cell Sci 112 ( Pt 23) : 4437-4448. Stryker, E. and K. G. Johnson (2007). "LAR, liprin alpha and the regulation of active zone morphogenesis." J Cell Sci 120 (Pt 21): 3723-3728. Su, X., K. Driscoll, G. Yao, A. Raed, M. Wu, P. L. Beales and J. Zhou (2014). "Bardet-Biedl syndrome proteins 1 and 3 regulate the ciliary trafficking of polycystic kidney disease 1 protein." Hum Mol Genet 23 (20): 5441-5451. Su, Y., J. K. Ospina, J. Zhang, A. P. Michelson, A. M. Schoen and A. J. Zhu (2011). "Sequential phosphorylation of smoothened transduces graded hedgehog signaling." Science signaling 4(180): ra43. 136 Su, Y., J. K. Ospina, J. Zhang, A. P. Michelson, A. M. Schoen and A. J. Zhu (2011). "Sequential phosphorylation of smoothened transduces graded hedgehog signaling." Sci Signal 4(180): ra43. Sweeney, R. T., A. C. McClary, B. R. Myers, J. Biscocho and L. Neahring (2014). "Identification of recurrent SMO and BRAF mutations in ameloblastomas." 46 (7): 722-725. Taipale, J., J. K. Chen, M. K. Cooper, B. Wang, R. K. Mann, L. Milenkovic, M. P. Scott and P. A. Beachy (2000). "Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine." Nature 406 (6799): 1005-1009. Tam, B. M., O. L. Moritz, L. B. Hurd and D. S. Papermaster (2000). "Identification of an outer segment targeting signal in the COOH terminus of rhodopsin using transgenic Xenopus laevis." J Cell Biol 151 (7): 1369-1380. Tay, S. Y., P. W. Ingham and S. Roy (2005). "A homologue of the Drosophila kinesin-like protein Costal2 regulates Hedgehog signal transduction in the vertebrate embryo." Development 132 (4): 625-634. Taylor, M. D., L. Liu, C. Raffel, C. C. Hui, T. G. Mainprize, X. Zhang, R. Agatep, S. Chiappa, L. Gao, A. Lowrance, A. Hao, A. M. Goldstein, T. Stavrou, S. W. Scherer, W. T. Dura, B. Wainwright, J. A. Squire, J. T. Rutka and D. Hogg (2002). "Mutations in SUFU predispose to medulloblastoma." Nat Genet 31 (3): 306-310. Tempe, D., M. Casas, S. Karaz, M. F. Blanchet-Tournier and J. P. Concordet (2006). "Multisite protein kinase A and glycogen synthase kinase 3beta phosphorylation leads to Gli3 ubiquitination by SCFbetaTrCP." Mol Cell Biol 26 (11): 4316-4326. Thayer, S. P., M. P. di Magliano, P. W. Heiser, C. M. Nielsen, D. J. Roberts, G. Y. Lauwers, Y. P. Qi, S. Gysin, C. Fernandez-del Castillo, V. Yajnik, B. Antoniu, M. McMahon, A. L. Warshaw and M. Hebrok (2003). "Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis." Nature 425 (6960): 851-856. Theunissen, J. W. and F. J. de Sauvage (2009). "Paracrine Hedgehog signaling in cancer." Cancer Res 69 (15): 6007-6010. Tukachinsky, H., L. V. Lopez and A. Salic (2010). "A mechanism for vertebrate Hedgehog signaling: recruitment to cilia and dissociation of SuFu-Gli protein complexes." J Cell Biol 191 (2): 415-428. Unden, A. B., E. Holmberg, B. Lundh-Rozell, M. Stahle-Backdahl, P. G. Zaphiropoulos, R. Toftgard and I. Vorechovsky (1996). "Mutations in the human homologue of Drosophila patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms of PTCH inactivation." Cancer Res 56 (20): 4562-4565. van der Vaart, B., W. E. van Riel, H. Doodhi, J. T. Kevenaar, E. A. Katrukha, L. Gumy, B. P. Bouchet, I. Grigoriev, S. A. Spangler, K. L. Yu, P. S. Wulf, J. Wu, G. Lansbergen, E. Y. van Battum, R. J. Pasterkamp, Y. Mimori-Kiyosue, J. Demmers, N. Olieric, I. V. Maly, C. C. Hoogenraad and A. Akhmanova (2013). "CFEOM1-associated kinesin KIF21A is a cortical microtubule growth inhibitor." Dev Cell 27 (2): 145-160. 137 van Eeden, F. J., M. Granato, U. Schach, M. Brand, M. Furutani-Seiki, P. Haffter, M. Hammerschmidt, C. P. Heisenberg, Y. J. Jiang, D. A. Kane, R. N. Kelsh, M. C. Mullins, J. Odenthal, R. M. Warga, M. L. Allende, E. S. Weinberg and C. Nusslein-Volhard (1996). "Mutations affecting somite formation and patterning in the zebrafish, Danio rerio." Development 123 : 153-164. Varjosalo, M., M. Bjorklund, F. Cheng, H. Syvanen, T. Kivioja, S. Kilpinen, Z. Sun, O. Kallioniemi, H. G. Stunnenberg, W. W. He, P. Ojala and J. Taipale (2008). "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell 133 (3): 537-548. Virshup, D. M. (2000). "Protein phosphatase 2A: a panoply of enzymes." Curr Opin Cell Biol 12 (2): 180-185. Von Hoff, D. D., P. M. LoRusso, C. M. Rudin, J. C. Reddy, R. L. Yauch, R. Tibes, G. J. Weiss, M. J. Borad, C. L. Hann, J. R. Brahmer, H. M. Mackey, B. L. Lum, W. C. Darbonne, J. C. Marsters, Jr., F. J. de Sauvage and J. A. Low (2009). "Inhibition of the hedgehog pathway in advanced basal-cell carcinoma." N Engl J Med 361 (12): 1164-1172. Vorechovsky, I., O. Tingby, M. Hartman, B. Stromberg, M. Nister, V. P. Collins and R. Toftgard (1997). "Somatic mutations in the human homologue of Drosophila patched in primitive neuroectodermal tumours." Oncogene 15 (3): 361-366. Wagner, O. I., A. Esposito, B. Kohler, C. W. Chen, C. P. Shen, G. H. Wu, E. Butkevich, S. Mandalapu, D. Wenzel, F. S. Wouters and D. R. Klopfenstein (2009). "Synaptic scaffolding protein SYD-2 clusters and activates kinesin-3 UNC-104 in C. elegans." Proceedings of the National Academy of Sciences of the United States of America 106 (46): 19605-19610. Wagner, O. I., A. Esposito, B. Kohler, C. W. Chen, C. P. Shen, G. H. Wu, E. Butkevich, S. Mandalapu, D. Wenzel, F. S. Wouters and D. R. Klopfenstein (2009). "Synaptic scaffolding protein SYD-2 clusters and activates kinesin-3 UNC-104 in C. elegans." Proc Natl Acad Sci U S A 106 (46): 19605-19610. Walsh, D. M., S. A. Shalev, M. A. Simpson, N. V. Morgan, Z. Gelman-Kohan, J. Chemke, R. C. Trembath and E. R. Maher (2013). "Acrocallosal syndrome: identification of a novel KIF7 mutation and evidence for oligogenic inheritance." Eur J Med Genet 56 (1): 39-42. Wang, B., J. F. Fallon and P. A. Beachy (2000). "Hedgehog-regulated processing of Gli3 produces an anterior/posterior repressor gradient in the developing vertebrate limb." Cell 100 (4): 423-434. Wang, B. and Y. Li (2006). "Evidence for the direct involvement of {beta}TrCP in Gli3 protein processing." Proc Natl Acad Sci U S A 103 (1): 33-38. Wang, Y., A. P. McMahon and B. L. Allen (2007). "Shifting paradigms in Hedgehog signaling." Curr Opin Cell Biol 19 (2): 159-165. 138 Watkins, D. N., D. M. Berman, S. G. Burkholder, B. Wang, P. A. Beachy and S. B. Baylin (2003). "Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer." Nature 422 (6929): 313-317. Wicking, C. and A. E. Bale (1997). "Molecular basis of the nevoid basal cell carcinoma syndrome." Curr Opin Pediatr 9(6): 630-635. Wilson, C. W., C. T. Nguyen, M. H. Chen, J. H. Yang, R. Gacayan, J. Huang, J. N. Chen and P. T. Chuang (2009). "Fused has evolved divergent roles in vertebrate Hedgehog signalling and motile ciliogenesis." Nature 459 (7243): 98-102. Wolff, C., S. Roy and P. W. Ingham (2003). "Multiple muscle cell identities induced by distinct levels and timing of hedgehog activity in the zebrafish embryo." Current biology : CB 13 (14): 1169-1181. Wolff, C., S. Roy and P. W. Ingham (2003). "Multiple muscle cell identities induced by distinct levels and timing of hedgehog activity in the zebrafish embryo." Curr Biol 13 (14): 1169-1181. Woods, I. G. and W. S. Talbot (2005). "The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish." PLoS Biol 3(3): e66. Wyszynski, M., E. Kim, A. W. Dunah, M. Passafaro, J. G. Valtschanoff, C. Serra-Pages, M. Streuli, R. J. Weinberg and M. Sheng (2002). "Interaction between GRIP and liprin-alpha/SYD2 is required for AMPA receptor targeting." Neuron 34 (1): 39-52. Xie, J., M. Murone, S. M. Luoh, A. Ryan, Q. Gu, C. Zhang, J. M. Bonifas, C. W. Lam, M. Hynes, A. Goddard, A. Rosenthal, E. H. Epstein, Jr. and F. J. de Sauvage (1998). "Activating Smoothened mutations in sporadic basal-cell carcinoma." Nature 391 (6662): 90-92. Yan, D. and X. Lin (2009). "Shaping morphogen gradients by proteoglycans." Cold Spring Harb Perspect Biol 1(3): a002493. Yang, C., W. Chen, Y. Chen and J. Jiang (2012). "Smoothened transduces Hedgehog signal by forming a complex with Evc/Evc2." Cell Res 22 (11): 1593-1604. Yang, S. I., R. L. Lickteig, R. Estes, K. Rundell, G. Walter and M. C. Mumby (1991). "Control of protein phosphatase 2A by simian virus 40 small-t antigen." Mol Cell Biol 11 (4): 1988-1995. Yang, Z. J., T. Ellis, S. L. Markant, T. A. Read, J. D. Kessler, M. Bourboulas, U. Schuller, R. Machold, G. Fishell, D. H. Rowitch, B. J. Wainwright and R. J. Wechsler-Reya (2008). "Medulloblastoma can be initiated by deletion of Patched in lineage-restricted progenitors or stem cells." Cancer Cell 14 (2): 135-145. Yao, S., L. Lum and P. Beachy (2006). "The ihog cell-surface proteins bind Hedgehog and mediate pathway activation." Cell 125 (2): 343-357. Yauch, R. L., G. J. Dijkgraaf, B. Alicke, T. Januario, C. P. Ahn, T. Holcomb, K. Pujara, J. Stinson, C. A. Callahan, T. Tang, J. F. Bazan, Z. Kan, S. Seshagiri, C. L. Hann, S. E. Gould, J. 139 A. Low, C. M. Rudin and F. J. de Sauvage (2009). "Smoothened mutation confers resistance to a Hedgehog pathway inhibitor in medulloblastoma." Science 326 (5952): 572-574. Yauch, R. L., S. E. Gould, S. J. Scales, T. Tang, H. Tian, C. P. Ahn, D. Marshall, L. Fu, T. Januario, D. Kallop, M. Nannini-Pepe, K. Kotkow, J. C. Marsters, L. L. Rubin and F. J. de Sauvage (2008). "A paracrine requirement for hedgehog signalling in cancer." Nature 455 (7211): 406-410. Zeng, H., J. Jia and A. Liu (2010). "Coordinated translocation of mammalian Gli proteins and suppressor of fused to the primary cilium." PLoS One 5(12): e15900. Zhang, L., X. M. Chen, Z. J. Sun, Z. Bian, M. W. Fan and Z. Chen (2006). "Epithelial expression of SHH signaling pathway in odontogenic tumors." Oral Oncol 42 (4): 398-408. Zhang, Q., L. Zhang, B. Wang, C. Y. Ou, C. T. Chien and J. Jiang (2006). "A hedgehog-induced BTB protein modulates hedgehog signaling by degrading Ci/Gli transcription factor." Dev Cell 10 (6): 719-729. Zhen, M. and Y. Jin (1999). "The liprin protein SYD-2 regulates the differentiation of presynaptic termini in C. elegans." Nature 401 (6751): 371-375. Zhou, Q. and D. Kalderon (2010). "Costal 2 interactions with Cubitus interruptus (Ci) underlying Hedgehog-regulated Ci processing." Dev Biol 348 (1): 47-57. Zhulyn, O., D. Li, S. Deimling, N. A. Vakili, R. Mo, V. Puviindran, M. H. Chen, P. T. Chuang, S. Hopyan and C. C. Hui (2014). "A switch from low to high Shh activity regulates establishment of limb progenitors and signaling centers." Dev Cell 29 (2): 241-249. Zimmermann, K. W. (1898). "Beiträge zur Kenntniss einiger Drüsen und Epithelien." Archiv für Mikroskopische Anatomie 52 (3): 552-706. Zou, J. X., Z. Duan, J. Wang, A. Sokolov, J. Xu, C. Z. Chen, J. J. Li and H. W. Chen (2014). "Kinesin family deregulation coordinated by bromodomain protein ANCCA and histone methyltransferase MLL for breast cancer cell growth, survival, and tamoxifen resistance." Mol Cancer Res 12 (4): 539-549. 140 Appendices Table S1 List of primers used in this thesis Mouse Kif7 mutation base pair change Foward primer Reverse Primer gaaccccgaagaaccgccccaggga cttggggcttcttggcggggtccctacta S1337A AGC --> GCC tgatcga gct ggaaccccgaagaaccgacccaggg gtcgatcatccctgggtcggttcttcggg S1337D AGC --> GAC atgatcgac gttcc agcgcctgaggtccgcccaggcccta catttagggcctgggcggacctcaggc S969A AGC --> GCC aatg gct catttagggcctgggcggacctcagg catttagggcctgggcggacctcaggc S969D AGC --> GAC cgct gct Sequencing primers for Kif7 For S1337 atgaggcccggattcacgctct For S969 ttccagaggaagaggcgcag Mouse Kif7 mutation base pair change Foward primer Reverse Primer gaaccccgaagaaccgccccagggatgat S1337A AGC --> GCC cga cttggggcttcttggcggggtccctactagct ggaaccccgaagaaccgacccagggatg S1337D AGC --> GAC atcgac gtcgatcatccctgggtcggttcttcggggttcc agcgcctgaggtccgcccaggccctaaat S969A AGC --> GCC g catttagggcctgggcggacctcaggcgct S969D AGC --> GAC catttagggcctgggcggacctcaggcgct catttagggcctgggcggacctcaggcgct MISSION shRNA clones sequence CCGGGCCCAGAGTTCTGGAGATAATCTCGAGATTATCTCCAG mKif7 #1 TRCN0000090438 AACTCTGGGCTTTTTG 141 CCGGCGAGTACAAGAATGAGGCTATCTCGAGATAGCCTCATT mKif7 #2 TRCN0000090439 CTTGTACTCGTTTTTG CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCT mPPFIA1 #1 TRCN0000251544 GGATATACATTTTTTG CCGGTTGGACGAGACTTTCGATTTCCTCGAGGAAATCGAAAG mPPFIA1 #2 TRCN0000251546 TCTCGTCCAATTTTTG CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAA mSmo TRCN0000026312 TGAATGGATCTTTTT qPCR primer sequences Forward Reverse Gli1 TACCATGAGCCCTTCTTTAGGA GCATCATTGAACCCCGAGTAG Gli2 CAACGCCTACTCTCCCAGAC GAGCCTTGATGTACTGTACCAC Ptch1 GCCTTCGCTGTGGGATTAAAG CTTCTCCTATCTTCTGACGGGT Cyclophilin GGAGATGGCACAGGAGGAA GCCCGTAGTGCTTCAGCTT hHip CCACTTGATTGAACGCCTGTA ACTCGCAGTCATCCATAGCCT Kif7 GAGGCAGCCACATCCCTTAC GCATTCCCTCCCAGAGAGTCT mPPFIA1 ATGGCCGACCCCATTTG ATGTCCGTCTGCCACAGAGAA Smo CTGACTGGCGGAACTCCAA AATGCTGCCCACGAAGAAAC hPPFIA1 AAAAGGTGAGAGAGCGATTACG TGTCCAGCACTCCATCTGTTA LiprinA1 deletion Constructs primers N’ serial truncations of PPFIA1 PPFIA1 5'asc1 GAATTCGGCGCGCCAATGATGTGCGAGGTGATGCCGA PPFIA1 3'not1 GAATTCGCGGCCGCTTAGCAGGAGTAAGTCCTGACTG PPFIA1 delN1 215-1202 5'asc1 GAATTCGGCGCGCCAACTCTAACAGATGGAGTGCTG PPFIA1 delN2 522-1202 5'asc1 GAATTCGGCGCGCCACATCATGGCCGACCCCACTTGG 142 PPFIA1 delN3 700-1202 5'asc1 GAATTCGGCGCGCCAGACAATCTTGGTCGTTTTAGA PPFIA1 delN4 830-1202 5'asc1 GAATTCGGCGCGCCAACGGATAACTCATCTCAGGAT C' serial truncations of PPFIA1 PPFIA1 del1 1-1051 3'not1 GAATTCGCGGCCGCTTAAACAAGCACGTCTTTTATTT PPFIA1 del2 1-1027 3'not1 GAATTCGCGGCCGCTTACATGTCCCCATAGGCGAGTG PPFIA1 del3 1-944 3'not1 GAATTCGCGGCCGCTTATTGGGCAAAAGGTAAACCTT PPFIA1 del4 1-847 3'not1 GAATTCGCGGCCGCTTACTGCCCGCTGGGCGATAGCA hKif7 C' truncation constructs primers hKif7_542-1343_5'asc1 GAATTCGGCGCGCCACTAGAGCTGGCACAGCCTGG hkif7_542_1343_3'not1 GAATTCGCGGCCGCTAACAAGGGGTTTTTCCTGACGT hKif7_698-1343_5'asc1 GAATTCGGCGCGCCAGCCTCTGAGTGGCGACTGGC hKif7_1057-1343_5'asc1 GAATTCGGCGCGCCATACAAGAATGAGGCTATCACATGC hkif7_1109-1343_5'asc1 GAATTCGGCGCGCCAGTGACACTCCGAGAGGAGCAAC hKif7_698-1057_5'asc1 GAATTCGGCGCGCCAGCCTCTGAGTGGCGACTGGC hkif7_698-1057_3'not1 GAATTCGCGGCCGCTAACTCGATGGCAGCGTCCAGGG Kif7 ciliopathy mutations Human Mouse base pair Kif7 Kif7 Ciliopathies change Forward primer Reverse Primer Pallister- Hall CCA -- P632L P637L syndrome > CTA gaagaagaggagctacccaggcggacc gaagaagaggagctacccaggcggacc Bardet– Biedl AGA -- R641G R646G syndrome > GGA ggaccttatacttgcgcggaaatgggatcagcaac ggaccttatacttgcgcggaaatgggatcagcaac Acrocallosal CGA -- R702Q R707Q syndrome > CAA catgcggcgacggcaggggcagc gctgcccctgccgtcgccgcatg 143 Bardet– Biedl CTG -- L759P L764P syndrome > CCG cctctgagtggcaactggcccaggc gcctgggccagttgccactcagagg Cloning primers hDYRK2_for GAATTCGGCGCGCCATGTTAACCAGGAAACCTTCGG hDYRK2_rev GAATTCGCGGCCGCTCAGCTAACAAGTTTTGGCAACAC hDYRK1B_for GAATTCGGCGCGCCATGGCCGTCCCACCGGGCCATGGT hDYRK1B_rev GAATTCGCGGCCGTAATCACGAGCTGGCTGCTGTGC sgRNAs hDYRK2 CACCGCATGTCGGCAGCCACGCTCA AAACTGAGCGTGGCTGCCGACATGC mDYRK2 CACCGCCCAATGGGCTTACGACGG AAACCCGTCGTAAGCCCATTGGGC mDYRK1A CACCGGACGATTCCAGTCATAAGA AAACTCTTATGACTGGAATCGTCC mDYRK1B CACCGCCCGCTGCGCAAGCTCTCGG AAACCCGAGAGCTTGCGCAGCGGGC mPtch1 GCGGGAGGCGCAGACGGACC GGTCCGTCTGCGCCTCCCGC Mutagenesis DYRK2 - K251R CATTTCGCACCATCCTTAGGGCCACGTGCTG CAGCACGTGGCCCTAAGGATGGTGCGGAATG sequencing primer TGACAGGTGGGCCCAACAAT 144 Copyright Acknowledgements Figure 1-1 was adapted from: Briscoe, J. and P. P. Therond (2013). "The mechanisms of Hedgehog signalling and its roles in development and disease." Nat Rev Mol Cell Biol 14 (7): 416-429, with permission from Macmillan Publishers Ltd. Copyright 2013 doi: 10.1038/nrm3598. Figure 1-3 was adapted from: Reiter, J. F., O. E. Blacque and M. R. Leroux (2012). "The base of the cilium: roles for transition fibres and the transition zone in ciliary formation, maintenance and compartmentalization." EMBO Rep 13 (7): 608-618, with permission from European Molecular Biology Organization. Copyright 2012 doi: 10.1038/embor.2012.73.