Molecular Insight Into Mirabilis Rotundifolia (Greene) Standley to Improve Management Decisions

Home , Mirabilis (plant), Mirabilis coccinea, Mirabilis linearis

Molecular Insight into Mirabilis rotundifolia (Greene) Standley to Improve Management Decisions

A Master’s Thesis

Presented to the Faculty of the

College of Science and Mathematics

Colorado State University-Pueblo

Pueblo, Colorado

In Partial Fulfillment

of the Requirements for the Degree of

Master of Science in Biology

Sherie A. Caffey

Colorado State University-Pueblo

May 2016

Dedication

I would like to dedicate my work to a number of people, whose support was so

important to the completion of this thesis. My parents, brother and sister, grandparents, aunts, uncles, and cousins, and last but not least, Nick. Your love and

encouragement means the world.

Acknowledgements

I would like to acknowledge my thesis advisor, Dr. Brian Vanden Heuvel for guiding me through my research and writing. His expertise in the field and his advising skills were of great value to my education.

I also would like to acknowledge my thesis committee, Dr. Lee Anne Martinez and Dr. Helen

Caprioglio for assisting me through this process and developing my knowledge through coursework.

I would like to also acknowledge Dr. Dan Caprioglio for assisting me with some of my lab work, and Theresa Jiminez for helping me out in so many ways.

TABLE OF CONTENTS DEDICATION……………………………………………………………………… i ACKNOWLEDGEMENTS………………………………………………………… ii TABLE OF CONTENTS…………………………………………………………… iii ABSTRACT………………………………………………………………………… iv LIST OF TABLES…………………………………………………………………... v LIST OF FIGURES…………………………………………………………………. vi INTRODUCTION…………………………………………………………………… 1 SIGNIFICANCE…………………………………………………………………….. 19 BACKGROUND…………………………………………………………………….. 27 STATEMENT OF OBJECTIVE…………………………………………………….. 34 MATERIALS AND METHODS……………………………………………………. 36 RESULTS……………………………………………………………………………. 62 DISCUSSION……………………..…………………………………………………. 97 CONCLUSIONS………………………….………………………………………… 108 BIBLIOGRAPHY…………………………………………………………………… 115 APPENDIX A- ITS Sequence Alignment…………………………………………… 121 APPENDIX B- Sample ISSR Gel…………………………………………………… 122 APPENDIX C- ISSR Data Matrix…………………………………………………… 123 APPENDIX D- Conserved ISSR Data Matrix……………………………………….. 151 THESIS DEFENSE SLIDES…………………………………………………………. 158

iii

Abstract Mirabilis rotundifolia is a perennial wildflower, endemic to Pueblo and Fremont Counties in Southern Colorado. Due to the limited range of this species it has been listed as “at risk” of becoming endangered by the Department of Defense and local conservation groups. A large proportion of the known populations of M. rotundifolia are located on Ft. Carson Army base, where millions of dollars are spent each year to protect at risk species. Dr. Richard Spellenberg, an expert in the genus Mirabilis, once stated in The Flora of North America that Mirabilis rotundifolia may not be a genetically unique species, but a variant of the more widespread species, Mirabilis albida. It was hypothesized for this study that M. rotundifolia is a genetically unique species, based on phenotype and habitat differences. To analyze the genetic relationship between M. rotundifolia and M. albida, Internal Transcribed Spacer (ITS) sequences, and Inter Simple Sequence Repeat (ISSR) markers were isolated and compared. Other Mirabilis species were also included to get a wider view of the genetic makeup of the whole genus. The results all together did not show evidence that M. rotundifolia is genetically distinct from M. albida. Many of the Mirabilis species shared alleles, which lends evidence to the well-known fact that this genus has complicated genetic relationships between species. In the future, different molecular markers could be used to shed more light on this question. Also, sequencing chloroplast genomes of individuals could give a better look at the relationship between M. rotundifolia and M. albida.

List of Tables

Table 1. Summary of phenotypes of M. linearis, M. albida, and M. rotundifolia ...... 9

Table 2. The sequences of all PCR primers used in this study ...... 39

Table 3. Information for each individual sampled in this study ...... 46

Table 4. The alignment statistics from the ITS sequence alignment for Mirabilis species ...... 66

Table 5. All individuals for which ISSR profiles were obtained ...... 68

Table 6. All morphological data collected for each individual in the study...... 75

List of Figures Figure 1. A large Mirabilis rotundifolia individual found in Pueblo County in the summer of 2015...... 20 Figure 2. A large M. albida individual found in El Paso County in the fall of 2014 ...... 20

Figure 3. Mirabilis linearis from a population in Arizona ...... 25 Figure 4. Location of Fort Carson in Southern Colorado ...... 27 Figure 5. Mirabilis rotundifolia on Fort Carson ...... 29 Figure 6 The complicated relationships in the genus Mirabilis...... 8

Figure 7. Common leaf shapes ...... 14 Figure 8. Flow chart for defining species ...... 17 Figure 9. Diagram of the ITS region of nrDNA ...... 36 Figure 10. The theory of the ISSR technique...... 41 Figure 11. The general areas from which all populations orginated...... 53 Figure 12. An example of the pictures used to make leaf measurements...... 61 Figure 13. Maximum Likelihood phylogenetic tree constructed from ITS sequence alignment. 64 Figure 14. Maximum Likelihood phenogram constructed using ITS sequence data...... 65 Figure 15. Phylogenetic tree constructed from the full data matrix using the distance method. .. 69 Figure 16. Phylogenetic tree constructed from the full data matrix using the parsimony method...... 70 Figure 17. Phylogenetic tree constructed from the conserved data matrix using the distance method...... 72 Figure 18. Phylogenetic tree constructed from the conserved matrix using the parsimony method...... 73 Figure 19. Average leaf areas for all groups in the study...... 79 Figure 20. Average hair density of leaves for all groups in the study...... 80 Figure 21. Distance tree made with full data matrix color coded by hair density level in hairs/mm2...... 82 Figure 22. Parsimony tree constructed using the full data matrix color coded by hair density .... 83 Figure 23. Distance tree constructed from the conserved data matrix color coded by hair density...... 84

Figure 24. Parsimony tree constructed from the conserved data matrix color coded by hair density...... 85 Figure 25. Distance tree constructed from the full data matrix color coded by average leaf area 87 Figure 26. Parsimony tree constructed from the full data matrix color coded by average leaf area ...... 88 Figure 27. Distance tree constructed from the conserved data matrix color coded by leaf area .. 89 Figure 28. Parsimony tree constructed from the conserved data matrix color coded by leaf area 90 Figure 29. Distance tree constructed from the full data matrix and color coded by geographical area...... 93 Figure 30. Parsimony tree constructed from the full data matrix color coded by geographical area...... 94 Figure 31. Distance tree constructed from conserved data matrix color coded by geographical area...... 95 Figure 32. Parsimony tree constructed from conserved data matrix color coded by geographical area...... 96

vii

Introduction Mirabilis rotundifolia (Greene) Standley is a perennial wildflower that is endemic to the

Arkansas River Valley of Southern Colorado. The calcareous shale outcrops created by the erosion of the Arkansas River through the valley are the only known habitat of M. rotundifolia.

The habitat specificity that this species exhibits causes it to have small populations that cover only a small range. Due to the rare nature of M. rotundifolia, it is the focus of many conservation groups in the area. Habitat destruction on the shale outcrops could lead to an endangered species listing for M. rotundifolia.

Currently, M. rotundifolia is not listed as endangered under the Endangered Species Act, but has been federally recognized as “at risk” of becoming listed (Neid 2007). Nearly half of the known populations of M. rotundifolia are located on Fort Carson Army Base. In response to conservation concerns about the management of these rare populations, the Department of

Defense has spent a substantial amount of resources funding the management of populations of

Mirabilis rotundifolia and other “at risk” species found on the base.

It has been suggested by experts in the field that M. rotundifolia may not be a unique species (Spellenberg 2004), and this suggestion could have major impacts on the management of the species. Mirabilis rotundifolia is closely related to M. albida (Walter) Heimerl, and some think that it should be included within this much more widespread taxon (Spellenberg 2004). M. albida is also very closely related to Mirabilis linearis (Pursh) Heimerl, and they often are found in close proximity and have been known to interbreed. Although they are closely related, M. linearis is widely accepted as a genetically unique species.

Many taxonomists have taken a morphological approach in attempting to correctly classify species in the genus Mirabilis, but there are still many relationships that remain ambiguous. The morphological characteristics of the two species have been compared by many before, but still a clear species designation has yet to be agreed upon (Spellenberg 2004).

Comparing the molecular characteristics of M. rotundifolia and M. albida could be the key to resolving their relationship. Analyzing the genetic makeup of the plants will give insight into whether or not M. rotundifolia is a genetically unique species. This information will be critical in the future management of populations of M. rotundifolia on Ft. Carson, and the few other places this rare plant exists.

In order to analyze the genetic makeup of the closely related species, the Internal

Transcribed Spacer (ITS) region of nuclear ribosomal DNA (nrDNA) was sequenced from samples collected from the field, and compared to sequences previously published. Also, a

Polymerase Chain Reaction (PCR) based technique termed Inter Simple Sequence Repeats

(ISSR) was utilized to create genetic profiles for individual plants collected from populations of

M. rotundifolia, M. albida, and M. linearis. Relationships between species and between individuals were inferred from this molecular data in the form of phylogenetic trees. A morphological analysis of all individuals collected was also performed, and it was compared to the ISSR profiles, to determine if phenotype is an accurate parameter to use in species designation for the genus Mirabilis.

Taxonomy

Nyctaginaceae Mirabilis rotundifolia is a member of the family Nyctaginaceae. This family includes herbs, shrubs, and trees, and is commonly called the four o’clock family. There are 30 genera made up of 300 species included in this family. Many plants from this family have stems that crawl along the ground and tangle with other plants. The leaves of these plants are oppositely arranged and lack stipules. The leaf blades range in shape from linear to round. Leaf margins are either entire or have round notches and lobes. The leaves may be hairy or smooth. The inflorescence can be terminal, lateral, or in leaf axils, and always have bracts. The bracts often form involucres that can contain 1-80 flowers. The flowers of the family vary in many ways.

They may be unisexual or bisexual, and are sometimes cleistogamous. The flowers may be showy or modest. There are 5 connate sepals that can be small or large, and in some species are colorful and resemble petals. The stamens alternate with the sepals and are as numerous. The flowers have one carpel that has basal placentation. The unique brown colored fruits vary in shape but often exhibit ridges, and warty surfaces. In many of the genera the fruits produce a sticky secretion when they become wet. One seed is produced from each fruit in this family

(Spellenberg 2004). It is common in the family Nyctaginaceae to be tolerant of, or a specialist of gypsum soil. It has been shown that most Nyctaginaceae species found on gypsum soils are there because of mechanical reasons, such as seeds being able to penetrate the hard soil, rather than chemical reasons. Nearly half of the species in the family Nyctaginaceae are found on gypsum soils, but are not limited to it, suggesting that this ability to thrive on gypsum soils is in an early stage of evolution (Douglas 2007).

The family Nyctaginaceae was first described by Antoine Laurent de Jussieu in Genera

Plantarum edition 90 in 1789. There is strong molecular support that all North American desert genera in Nyctaginaceae are together in one clade (Douglas 2007). The monophyletic nature of the family is also highly supported by the unique fruit type seen in the family (Levin 2000). The monophyletic nature of the family as a whole is widely agreed upon, however within family classification has proven to be much more problematic for taxonomists. There has been disagreement for centuries dealing with how many tribes are included in this family, and half of the genera in the family contain only one species, which raises concern for many scientists researching the relationships within Nyctaginaceae (Spellenberg 2004). It appears that similar phenotypes have evolved many times independently within this family, which could be the source of the taxonomic confusion (Levin 2000). When splitting the family into genera, taxonomists typically take into account number of flowers per involucre, fruit shape, and how long after flowering the involucre continues to grow (Spellenberg and Tijerina 2001).

Mirabilis The genus Mirabilis is made up perennial herbs that often exhibit a woody base that does not die in the winter, called a caudice. These plants can be hairy or smooth, and some are sticky to the touch. Taproots are a common feature of the genus, however the shape can range from slender to swollen. The stems are always unarmed. Leaves in this genus are arranged oppositely and have a symmetric base, however the shape of the blade can vary. The inflorescences of

Mirabilis species originate from involucres on a peduncle which hold 1-16 flowers. Mirabilis can be separated from other genera in the family, because it is the only genus with involucres made of fused bracts. These involucres protect flower buds and fruits (Spellenberg and Tijerina 2001).

Many times the flowers are organized in the form of a cyme, where there is one central flower

that the other flowers grow around from lateral buds. The involucres sometimes exist individually in the leaf axils. The five bracts are usually connate and persist even after the flowers are gone. Most species have involucres that continue to grow to some extent after flowering. The flowers of Mirabilis species are bisexual, and they can either be open and be pollinated by other individuals (chasmogamous), or can be closed and self-pollinated

(cleistogamous). Cleistogamous flowers have a perianth that appears as a small dome.

Chasmogamous flowers are mostly radially symmetric and have the general shape of a bell or funnel. There are 5 petals on Mirabilis flowers and 3-6 stamens. The stamens protrude past the perianth, however the styles protrude even further. The stigmas end in a distinct head

(Spellenberg 2004). In most Mirabilis species found in the arid west, the stamens and style are very close, which could explain why self-fertilization is common in this genus. This self- fertilization combined with the genus’ tendency to hybridize leads to genetically uniform populations, but unique geographical variation is often apparent (Spellenberg and Tijerina 2001).

Most species in the genus have flowers that are mainly pollinated by hawk moths, although some species do rely on other pollinators, and others self-pollinate (Levin 2000). Fruits are radially symmetrical and often have 4-5 ribs separated by broad sulci, although sometimes the ribs are imperceptible. Species of the Mirabilis genus are mostly found in the Americas, with one exception, M. himalaicus, which is native to southern Asia. It is thought to be the product of a long distance dispersal event, since it falls in an otherwise strictly American clade (Douglas

2007). Mirabilis jalapa (marvel of Peru, four o,clock flower) has been introduced worldwide as a popular horticulture species (Spellenberg 2004). The fact that Mirabilis species inhabit such a broad range of habitats contributes to the great diversity of the species, and also to the existence of endemism in the genus. Mirabilis is well known for having many species that are gypsum

tolerant or gypsophilic. To be gypsophilic means that the plant requires soil with high levels of hydrated calcium sulfate, and to be gypsum tolerant means that the plant can survive just fine on this type of soil, but they do not require the specific soil composition. M. multiflora has been classified as being gypsum tolerant, and M. jalapa and M. albida being non-gypsophilic. M. linearis has been shown to be gypsum tolerant, which is strange because it is known to be closely related to M. albida which is non-gypsophilic. It was once hypothesized that M. rotundifolia was a gypsophile, however this hypothesis has since been refuted, and it is now believed to be gypsum tolerant (Spellenberg and Tijerina 2001).

The official name of the genus is Mirabilis L. and it was first described by Carl von

Linneaus in Species Plantarum edition 1: 177 on May 1, 1753, in which he named the genus

Oxybaphus. In 1931, Paul Standley formally changed the genus name from Oxybaphus to

Mirabilis, although the old name is still used in some floras (Douglas 2007). Mirabilis has the most species out of all the genera in the family Nyctaginaceae (45-60 species according to

Spellenberg in 2001). In 2000, Levin found strong molecular support for the monophyly of the genus Mirabilis based on nuclear and chloroplast genome comparisons. Prior to this study most of the taxonomic research of the genus had been based on morphological characteristics, and habitat differences. It has been suggested that more accurate phylogenies come from fruit characteristics than from vegetative characteristics. Keys to Texas species of Mirabilis that were developed using leaf shape and hair patterns have been criticized, although comparing these characteristics to geographical positions could be useful in defining relationships (Turner 1993).

Traditionally the morphological characteristics used to split the genus into species are the patterns of fruit surfaces, color of the flowers, and the hair patterns on the leaves and stems

(Spellenberg and Tijerina 2001).

That being said the phenotypic differences between some Mirabilis species are minimal, leading to ambiguity in species identification. Defining species within the genus can also be troublesome due to species that are phenotypically and ecologically different, showing a lack of unique reproductive characteristics that are often used in species designations. In recent years an inclusive approach has been the one most accepted by taxonomists when classifying species in the genus Mirabilis (Spellenberg 2004, Turner 1993). The approach is inclusive because it tends toward grouping species together rather than separating them. It is widely known that Mirabilis species hybridize, which complicates matters even further (Spellenberg and Tijerina 2001). The unique patterns of geographic variation lead to taxonomic decisions that are subjective. This subjectivity has led to disagreement when it comes to species boundaries.

Mirabilis rotundifolia The first treatment of Mirabilis rotundifolia (Greene) Standl. was published by Edward

Greene in Plantae Bakerianae (1901). Greene first described the species as Allonia rotundifolia.

The official name of the species was changed to Oxybaphus rotundifolia by Paul Standley, in the

Publications of the Field Museum of Natural History Botanical Series (1930). The current name was published just a year later by Standley in a different volume of the same publiin 1930. In the

2004 edition of The Flora of North America, Spellenberg treats the highly hairy, broad leaved form of M. albida as M. rotundifolia, although other treatments have recognized this form as M. hirsuta in other areas of the country.

A large M. rotundifolia individual found in Pueblo County can be seen in Figure 1. New vegetative stems of Mirabilis rotundifolia emerge in the summer from the thick woody caudice left from the previous winter. It is characteristic for new stems to sprout up from horizontal underground rhizomes (Kelso 2003). There is significant lateral branching from the woody part 7

of the stem underground, making it hard to determine the number of individuals present in a population, and this leads to the possibility of a potential overestimation of population size.

Analyzing populations is also made difficult by the fact that plant size and number, as well as flower number, vary greatly from year to year in response to moisture levels (Neid 2007). Late summer increases and rainfall can cause population surges late in the growing season. Yet even when rainfall is high, seed predation can limit the size of populations (Kelso 2003).

Figure 1: A large Mirabilis rotundifolia individual found in Pueblo County in the summer of 2015. Table 1 gives a summary of the phenotypes of M. rotundifolia, M. albida, and M. rotundifolia. Stems of Mirabilis rotundifolia individuals are typically erect and bear leaves mostly in the upper half. The stems are covered in soft spreading hairs throughout. The leaves ascend at 60-80° from the stem, and are suddenly reduced below the inflorescence. The leaves can be sessile, or on a small petiole up to 0.9 cm long. Leaves are green on the upper surface, and a dull gray green color on the bottom surface. The leaves are either oval shaped, or round, and sometimes have a somewhat triangular shape. The leaves are typically thick and leathery. The upper surface of the leaves can be smooth, or covered in soft hairs, while the lower surface is 8

almost always covered in soft spreading hairs. The inflorescences are terminal, on a peduncle that is 3-6 mm long. The involucres are covered in spreading pubescence and are bell shaped.

The involucres are usually a grayish green color. The lobes of the involucre are ovate and 40-

50% connate. The flowers are trumpet shaped, and start to appear in June. They typically open by mid-morning and close by mid-day (CPC 2011). There are 3 flowers per involucre, and the perianth is purple to deep pink. Fruits are evenly covered in short hairs and are a pale olive brown color. The ribs are round and only half as wide as the sulci, which are a darker color than the ribs. The fruits are usually slightly wrinkly (Spellenberg 2004). In the wild Mirabilis rotundifolia stops producing seed by mid-July, but in a controlled garden, the plant will produce seed well into September. Seed predation by harvester ants is a factor that often limits reproduction for Mirabilis rotundifolia. High disturbance levels have been shown to have little effect on the occurrence of M. rotundifolia. The most likely explanation for this resistance to disturbance is that underground tissue can regenerate even when the above ground plant is damaged, making it able to recover from disturbances (Kelso 2003).

Table 1: Summary of phenotypes of M. linearis, M. albida, and M. rotundifolia M. rotundifolia M. albida M. linearis

Leaf size 4-7x3-6 cm 1-11x0.6-2.5 cm 3-11.5x0.1-1.8 cm

Leaf shape round ovate lanceolate linear

Leaf color green/gray blue green/ gray blue green/gray blue

Hair type soft hirsute villous rarely hirsute

Hair level hairy varies light

M. rotundifolia M. albida M. linearis flowers per involucre 3 1 to 3 3 stem length 2-3 dm 0.8-15 dm 1-1.3 dm petiole length 0-0.9 cm 0-4 cm 0-1.5 cm inflorescence position terminal axillary or terminal axillary or terminal peduncle length 3-6 mm 1-25 mm 3-10 mm involucre size 4-6 mm 4-7 mm 3-6 mm flower color purplish pink white, pink, deep white to purple

red violet pink fruit color pale olive brown brown olive brown fruit size 4-5 mm 3.5-5.5 mm 3.1-5.5 mm

Mirabilis rotundifolia flowers in late spring to mid-summer in the Arkansas River Valley of Southern Colorado. The Arkansas River Valley is home to many unusual and rare plant species. The Niobrara chalk formation, which forms many chalky shale outcrops, is the specific location in the valley where many of these unique species can be found. Land on this formation faces strong development pressures, which are felt by the rare plant species that call it home. M. rotundifolia is one of the rare, endemic species found on this habitat. M. rotundifolia is restricted to the barren, shale outcrops on the Niobrara chalk formation at elevations between 4800 and

5600 feet (1600-1700 meters) (CPC 2011). The word barren refers to an area of exposed bedrock 10

(most often shale) that has little vegetation. Mostly all of the outcrops where Mirabilis rotundifolia is found are in Pueblo and Fremont Counties, where the Arkansas River has eroded through the sedimentary layers to expose calcareous shale soils. There are also a few populations on shale outcrops in Las Animas and Otero Counties. Unlike the shale outcrops found near the

Arkansas River, the populations in Las Animas County are found on outcrops that have been exposed due to regional uplift. Shale soils are very chalky in composition, and they tend to bind up the available ground water. When the soil binds ground water, it is less available for use by plants. Many species cannot survive in an environment where water is so scarce, and the ground can also be very hard, but M. rotundifolia thrives in this environment more than anywhere else

(Kelso 2003).

It was once hypothesized that M. rotundifolia is an edaphic endemic, meaning that it needs to live in a very specific area due to the unique soil composition. The original popular hypothesis to explain its endemic nature was that M. rotundifolia was likely a gypsophile. It has since been shown that gypsum is not a reliable indicator of M. rotundifolia occurrences, and that not all chalk barren species are gypsophiles (Kelso 2003). Furthermore, experiments done by the

Denver Botanical Garden have shown that M. rotundifolia thrives in normal potting soil with average levels of nutrients. Researchers have theorized that the most likely factor of endemism for M. rotundifolia is the limitation of water and nutrients for other species, and not any particular advantage that M. rotundifolia possesses (Kelso 2003). Currently the popular explanation is that M. rotundifolia is simply able to outcompete other species in an environment where water is scarce, and the soil can be very hard. A lack of competition due to less than perfect conditions makes M. rotundifolia a stronger competitor, and enables it to thrive in this unique environment.

Mirabilis rotundifolia is of conservation concern due to its narrow range and small population sizes. The unique habitat of this species is quickly being lost to development and industry in Southern Colorado (Kelso 2003). M. rotundifolia has a ranking by NatureServe of

G2, meaning it is imperiled across its entire range, and it is ranked S2 by The Colorado Natural

Heritage Program, which means that it is considered imperiled in the state of Colorado. There is no official federal ranking for the species, but it has been identified as “at-risk” of becoming endangered by the U.S. Fish and Wildlife Service (Mayo 2004). Some of the threats that this species faces, other than military activity on Fort Carson, are residential development, and limestone mining for cement production. Denver Botanical Garden grows M. rotundifolia in the endangered species garden, and has been monitoring populations located on land owned by the

Portland Cement Company in Fremont County since 1995. Those who have had experience with

M. rotundifolia agree that more research is needed to aid in designing and implementing an appropriate management plan, that will prevent M. rotundifolia from ever becoming listed as endangered (CPC 2011). The Arkansas Valley Barrens Conservation Action Plan protects populations of M. rotundifolia in a few places in Pueblo and Fremont counties. There has been a management plan developed by NatureServe for the U.S. Fish and Wildlife Service, that suggests monitoring of the 11 highest quality populations, most of which are on Ft. Carson (Mayo 2004).

Mirabilis albida Mirabilis albida is well known for its extremely variable phenotype. One individual found in Southern El Paso County can be seen in Figure 2. There are many stems on one individual, and they can either be standing, erect, or crawling along the ground. The stems may have few to many branches, and can be sparsely or densely covered in leaves. The leaves are either found only on the basal half of the stem or throughout the whole stem, however leaves are

never found just on the proximal end of the stem. The stems can either be completely smooth, or may be covered in soft hairs that are arranged in two lines, or spreading across the whole stem.

The stems can sometimes feel sticky to the touch. The angle that the leaf petiole comes off the stem ranges from 10-90°. The petiole itself may not be present, or may be up to 4 cm long. The leaf blades range in color from green, to a dull blue-gray color. The shape of the blade can range from linear-lanceolate, to ovate lanceolate, or can be ovate, or even deltate in shape (see Figure 4 for leaf shape examples). The leaves can either be thin and flesh-like or thick and leathery, or anywhere in between. The base of the leaves range from triangular, to heart shaped, or round, and in some cases the base is straight and flat. The surfaces of the blades can be completely smooth, sticky and covered in shaggy hairs, or covered in very soft hairs. The inflorescence is located either at the end of the stem or in the leaf axils. When the inflorescence is axillary, there is usually only a single involucre. When this is the case the flowers will likely be cleistogamous.

The peduncle can range from 1-25 mm, and is usually covered in hairs that can be soft and spreading, stiff and bristle like, or sticky and shaggy. The involucres are in the shape of a wide bell, and usually are pale green, but often have a purple hue when the plant is young. There is usually some level of hair coverage on the involucres, and often times they are sticky to the touch. The involucre is mostly connate, with lobes that are ovate. There can be 1-3 flowers per involucre and they have a perianth that is either white, pink, or deep red/violet. The fruits are brown and ovate in shape, with tapers at both ends. They are often covered in tufted hairs. There are ribs on the fruit that are mostly round and can be smooth or wrinkly. The grooves between the ridges often have small wart like projections (Spellenberg 2004).

Figure 2: A large M. albida individual found in El Paso County in the fall of 2014. M. albida is the most widespread, and the most phenotypically variable species of

Mirabilis in North America. The reason for this inconsistent nature is likely due to the high degree of phenotypic plasticity shown by the species, and also the fact that it tends to hybridize with sympatric Mirabilis species (Turner 1993). Individual phenotypes are highly variable but distinctions start to become apparent when populations are compared. Western populations of M. albida have diverged morphologically from eastern populations, mostly in the features of the fruits. Western individuals produce fruits that are less warty and more similar to fruits of M. 14

linearis. In typical years, M. albida flowers in late summer to early fall, in dry meadows, sandy prairies, hillsides, and rocky slopes. M. albida thrives naturally at elevations from sea level to

2,600 m (8,530 feet). This species is native to the lower 48 states as well as most of Canada

(Spellenberg 2004).

The first treatment of Mirabilis albida (Walter) Heimerl was published in the Annuaire du Conservatoire et Jardin Botaniques de Genève (1901) by Anton Heimerl. In Southern

Colorado, M. albida has been known to intergrade with M. linearis, made clear by overlapping phenotypic treatments (Spellenberg 2004). Narrow leaved forms of M. albida are treated as M. linearis in the Flora of North America. M. albida’s variable phenotype has led to no shortage of taxonomic questions. M. hirsuta (which is described by Spellenberg as being synonymous with

M. rotundifolia) has been suspected of being a form of M. albida. Turner of UT-Austin expressed with certainty that M. hirsuta was a varietal form of M. albida due to their highly overlapping habitats in Texas. This close association is seen by some as an intergrading (Turner

1993). In 1993 in “Texas Species of Mirabilis,” Turner suggested that M. dumetorum is a broad- leaved form of M. albida. Although others have considered M. dumetorum as a unique species, in Texas, Turner has observed many intermediate forms of characteristics that are used to tell these species apart, which he believes is reason to consider these two species to be one variable species. Turner took a very inclusive approach, accepting many different habitats, leaf shapes, and hair patterns to be included in the taxon M. albida (Turner 1993).

Mirabilis linearis Mirabilis linearis can be seen in Figure 3. It typically has stems that either lie flat or stand erect, and which are leafy either on the top one fifth of the stem or throughout the entire

stem. The stems may have small amounts of hairs arranged in two lines, or they may be covered in spreading pubescence, and very rarely they are smooth and hair free. The leaves can be sessile or on a petiole of up to 1.5 cm long. The leaves range from green to a blue gray color. The shape of the leaf is mostly linear or sometimes linear lanceolate. The surface of the leaves can range from smooth, to covered in short hairs. The inflorescences can be terminal or found in leaf axils.

The flowers are contained in involucres that are usually covered in hairs to some level. The involucres are usually pale green and sometimes have a hint of purple. The ovate lobes of the involucres are 40-70% connate and form a bell shape. There are 3 flowers per involucre and they range from white, to purple and pink. The fruits are olive brown and football shaped. They have hairs that are either arranged in tufts or evenly distributed across the surface. The fruits have ribs that are sometimes more pale than the ridges, and are just slightly raised from the surface. They are usually smooth but are sometimes wrinkly on the sides (Spellenberg 2004). This species has been found to have a variable phenotype, and a broad geographic range. As it does with M. albida, M. linearis lives closely with many other Mirabilis species in North America and forms hybrids with them (Turner 1993).

Figure 3: Mirabilis linearis from a population in Arizona, courtesy of SEInet. The first publication of Mirabilis linearis (Pursh) Heimerl as a species was in the

Annuaire du Conservatoire et Jardin Botaniques de Genève, (1901) by Anton Heimerl. As mentioned before, it is clear that M. linearis hybridizes with M. albida. In 1993, Turner justified the species designation of M. linearis from M. albida, by citing the consistent differences in the morphology of the anthocarps of the two species. M. linearis is widely accepted as a true species in North America and Canada.

The need for a molecular study involving these Mirabilis species is quite evident when the facts are laid out. Although there are some characteristics that are currently used to define species, there are still many questions left to answer. A molecular study will not only help to define the taxonomic rank of M. rotundifolia in comparison to M. linearis and M. albida, but this type of data can also tell which phenotypic characteristics, if any, correlate to molecular data.

Knowing which morphologies reflect genetic similarity will be immensely helpful in species identification as well as in conservation management efforts.

Mirabilis coccinea

Mirabilis coccinea (Torr.) Benth. & Hook. fil. is a species found in the Southwestern

United States. [Upon the completion of this study, it was found that M. coccinea is a closely related species to both M. albida and M. rotundifolia. Due to this close relationship at the molecular level, it is critical to introduce this species along with the other Mirabilis species of interest.] The common name for M. coccinea is the Scarlet Four O’clock. The Integrated

Taxonomic Information System lists M. coccinea as an accepted species (IT IS). This species was first named by American botanist John Torrey (Torr.) in Genera Plantarum (1880). Torrey first named the species Oxybaphus coccinea. In the Flora of North America, it states that M. coccinea is easily confused with M. linearis when the flowers are closed.

The stems of M. coccinea can be standing or ascending. The basal part of the stem is always smooth, and in rare occasions the distal portion of the stem can be slightly pubescent. The leaves are dark green and grayish. They are typically moderately thick. The petiole is either nonexistent or can be up to 0.3 cm in length. Like M. linearis, the leaf blades are linear to linear lanceolate in shape. The leaves are somewhere in the range of 4.5-10 cm long, and only about

0.1-0.5 cm wide. The leaves are typically smooth but can sometimes have a few small hairs on the upper surface of the leaf. The inflorescence is on a peduncle that can be 4-8 mm long. The involucres are dark green, and veiny. The bracts are about 40% connate with lobes that are ovate or triangular. The flowers are a bright red to purple color and are 1.3-2 cm in length. The fruit is pale olive brown, round, and has warty ribs that are larger than the sulci. This species flowers

late spring to early fall. It will typically be found in Arizona, California, New Mexico and

Sonora, Mexico. It is found on dry, open hillsides of igneous rock formations. It is associated with pinyon-juniper and mixed conifer woodlands at elevations of 1200-2000 meters

(Spellenberg 2004).

Significance The Endemism and Current Range of M. rotundifolia Fort Carson Army Base (Figure 4) falls within the narrow range that is home to Mirabilis rotundifolia (Figure 2). Roughly 45% of the known acres inhabited by M. rotundifolia are found on Ft. Carson, which makes the base and the Department of Defense (DoD) partially responsible for the management of this species. Eight out of the thirty distinct locations where M. rotundifolia can be found are on 1,191 acres of Ft. Carson’s land (Neid 2007). Due to such a large percentage of known populations of M. rotundifolia being found on the base, there has been pressure on the DoD from national, and local conservation groups such as NatureServe and

The Colorado Natural Heritage Program, to actively manage these populations.

Figure 4: Location of Fort Carson in Southern Colorado (Map from the Colorado Natural Heritage Program)

Figure 5: Mirabilis rotundifolia on Fort Carson (Image from Neid 2007) In response to conservation concerns the U.S. Fish and Wildlife Service has commissioned rare plant surveys not only for M. rotundifolia, but also other at risk plant species

on Fort Carson. The Colorado Natural Heritage Program completed field studies and rare plant mapping for 5 sensitive plant species on Fort Carson Army Base, including M. rotundifolia.

These species are considered “at risk,” by the DoD, of one day becoming listed under the

Endangered Species Act. The purpose of these surveys and studies was to help with natural resource planning on the base in order to protect at risk species, and also allow the base to operate in an efficient manner (Neid 2007).

In 2011, Fort Carson Army Base finalized conservation easements of 7,045 acres of land, which cost approximately 40 million dollars. The land purchased is within the narrow range of

M. rotundifolia, on the Southern edge of Fort Carson. The purpose of the easements was to create a buffer zone, and the purpose of the buffer zone is to limit development and protect natural resources, while at the same time allowing Ft. Carson to utilize training areas for military activities. The land easements are under the control of the Army Compatible Use Buffer Program

(ACUBP), which is an organization funded by the Department of Defense Readiness and

Environmental Protection Initiative and the Department of Army (Fort Carson 2011).

Other known occurrences of Mirabilis rotundifolia not on Fort Carson are found on private residential properties. Some populations are on land that is protected by the Land Trust of the Upper Arkansas (LTUA). The LTUA aims to protect natural resources, so populations on these lands are being managed on some level. There are a couple of populations on land owned by the Portland Cement Plant in Fremont County. These populations are monitored by the

Denver Botanical Garden and have been for many years. The populations of most concern would be the ones that are on public land, and also the ones on private land that could face pressures from residential development.

The efforts of conservation groups, as well as the action taken by the DoD are important steps in managing rare populations. However there is concern that the efforts could be excessive if M. rotundifolia is not truly a unique species. There has been question raised as to whether or not M. rotundifolia is actually a species, or just a variation of the more widespread Mirabilis species, Mirabilis albida (Spellenberg 2004). As a species M. albida does quite well and is not under any type of known ecological pressures, therefore its conservation is not of immediate concern.

Species Concept and the Genus Mirabilis It is very important to protect local natural resources for many reasons. The most tangible efforts that have been made to protect populations of M. rotundifolia have come from the DoD.

The response of the Army to conservation concerns is a positive one, but is all the money that has been spent actually needed? The genus Mirabilis has many species relationships that are ambiguous to say the least, and M. rotundifolia is no exception to this trend. There has been a hypothesis presented that perhaps M. rotundifolia is not an actual species at all, but merely a variety of another Mirabilis species, M. albida (Spellenberg 2004). M. albida is well known for having a variable phenotype, and also for hybridizing with other Mirabilis species that are in close range. One of these plants is the very similar M. linearis. M. linearis is another Mirabilis species that is also closely related to M. albida, but is commonly accepted as a true species. M. linearis will play a part in this study, serving as another Mirabilis species to compare genetic variation with. All three of these plants are found in Southern Colorado in a relatively close geographic setting. Knowing the taxonomic standing of M. rotundifolia, and the species that it is very closely related to, is very important in assessing the validity of the money and effort spent

on protecting populations of M. rotundifolia, not only on Fort Carson but on all private and public lands.

The Flora of North America is a compilation of information on virtually every plant found on the continent of North America. The accounts for each species include taxonomic information, species relationships, detailed phenotypic descriptions, and ecological information in the form of a dichotomous key. One of the main contributing authors of the Flora is Dr.

Richard Spellenberg, formerly of New Mexico State University’s Biology Department. In 2000,

Dr. Spellenberg retired from NMSU after 32 years of service. One of Dr. Spellenberg’s main specialties is the plant family Nyctaginaceae, which includes the genus Mirabilis. Spellenberg is the author of the treatment of M. rotundifolia, M. albida, and M. linearis in the most recent edition of the Flora. Reading his treatments of these three species gives the reader a clear idea of just how complicated this genus can be. Let us begin with the comments Dr. Spellenberg makes in the treatment of M. albida. He states that, on the western plains of the Rockies, M. albida intergrades with M. linearis. To intergrade means to move from one form to another by way of many intermediate forms. Hybridization is likely the cause for these intermediate forms, leading to individuals that possess genetic material from both M. albida and M. linearis. The effects of hybridization between M. albida and M. linearis are further described by Spellenberg, when he says that compared to plants from the eastern part of the country, the specimen of M. albida found here have a fruit morphology that is much more similar to the fruit morphology of M. linearis. The Flora states that narrow hairy leaved forms of M. albida from the plains of the

Southwest will be identified as M. linearis. It is also an interesting note that the Flora recognizes three varieties within the species M. linearis, suggesting that it too has a variable phenotype

(Spellenberg 2004). Many botanists would agree with Spellenberg’s statement in the treatment of

M. albida that individual phenotype is extremely variable, but when phenotype on the level of broad populations is analyzed, one can start to see geographic distinctions that appear to be consistent. Spellenberg also makes mention of M. rotundifolia in the treatment of M. albida.

According to the Flora, there is a form of Mirabilis located on the Eastern side of the Continental

Divide that is typically defined as M. hirsuta. This form has broad leaves and is excessively hairy, and in the Flora of North America is identified as M. rotundifolia (Spellenberg 2004). The thing that makes this interesting is that according to the Integrated Taxonomic Information

System (ITIS) website M. hirsuta is not currently an accepted species, but rather a synonym for

M. albida. Spellenberg only points out one taxonomic issue in the treatment of M. rotundifolia.

This one comment is the driving force behind this study. It is in the treatment of M. rotundifolia that Dr. Spellenberg wrote, “Mirabilis rotundifolia is clearly closely related to Mirabilis albida and may be only a variant” (Spellenberg 2004). The opinion of an expert in the field, as well as the reputation of misclassified species in the genus Mirabilis, combined with the fact that monetary efforts have been exerted on M. rotundifolia makes it critical that light is shed onto the taxonomic standing of this species.

This taxonomic issue with M. rotundifolia and M. albida is just one piece of the puzzle that exists in the family Nyctaginaceae. In a book called “Studies of American Plants” that was published in 1931, American botanist Paul Standley stated, “I know of few groups of plants in which specific differences are so unstable and so baffling…particularly in…Mirabilis, no single character seems to be constant” (quoted in Douglas 2007). Twenty years later, a Texas botanist by the name of Shinners agreed with Standley, stating that, “Mirabilis is surely one of the most troublesome of the Southwest genera, in nomenclature and taxonomy both” (quoted in

Spellenberg and Tijerina 2001). Many other Mirabilis species have had their designation and

relationships questioned. A very similar problematic relationship has been investigated before, the relationship between M. laevis and M. cedrosensis, and the possibility that they are the same species as M. californica (Spellenberg and Tijerina 2001). A schematic representation of the species designations from multiple sources is shown in Figure 6. Single headed solid arrows indicated that the organization or person in the heading believes that the two species could be genetically the same. Double headed solid arrows indicate that they believe the two species names are synonyms. Dashed arrows indicate that the two species are believed to hybridize. The difficult reputation of the genus Mirabilis warrants an investigation into the relatedness of M. rotundifolia and M. albida. To begin to compare and contrast the two species, morphological differences must first be discussed. Below, some of the major phenotypic differences and similarities between the two species are highlighted.

Figure 6: The complicated relationships in the genus Mirabilis. Single headed arrows represent genetic similarity, double headed arrows possible synonyms, and dashed lines hybridization. When it comes to the distribution of M. albida and M. rotundifolia, the obvious difference is the size of the range that they inhabit. It is clear that M. rotundifolia has a very small and specific habitat range, which is one of the main causes for conservation concern. In contrast, M. albida is one of the most widespread species of Mirabilis in North America. It is 25

spread throughout an entire continent, on many different substrates, and in many different microclimates (USDA Plant Database). The places that M. rotundifolia is found have a very specific soil composition, climate, and geographic location. Even though it has been shown that

M. rotundifolia is able to grow in “normal” soil, it never does so in the wild. This major distribution difference is one of the main reasons that M. rotundifolia is classified as a true species at this time. M. linearis is also a widespread species, although it is not quite as abundant as M. albida. M. linearis is considered native to the US and Canada, although it is virtually absent from the coastal East and the Pacific North West, in both countries. Although the habitats of the three species do vary greatly, it is interesting to note that the habitats of M. rotundifolia and M. linearis are confined within the broad habitat of M. albida (USDA Plant Database).

There are obvious phenotypic differences that are typically used to distinguish these three

Mirabilis species from each other. In the treatment of Mirabilis by C.F. Reed in the “Flora of

Texas” from 1969, he uses leaf shape, hair patterns, and habit to categorize Texas species of

Mirabilis (Turner 1993). Although these parameters have been criticized by some, their usefulness will once again be assessed here. One of the main phenotypic characteristics that seems to vary between the species is the shape of their leaves. Much like the rest of its morphological characteristics, the leaf shape of M. albida varies widely. Most of the specimen observed in this study have a lanceolate shaped leaf that is typically quite large. The leaf shape of

M. linearis is obvious, they are very narrow and long, most often being linear shaped. The leaves of M. rotundifolia are typically much broader than a typical M. albida leaf, and also much smaller in area. Figure 7 is from a publication by Radford and colleagues in 1974, and it shows many common leaf shapes including the ones mentioned here. The figure gives an idea of how different the shapes of the leaves really are. Another characteristic that could potentially be used

to designate species is the hair patterns of the plants. M. rotundifolia is usually always very hairy on the stems and leaves. M. linearis is less hairy in general, and of course the degree of hair cover of M. albida varies from individual to individual. These two characteristics could potentially be useful to distinguish between closely related Mirabilis species, although more research is needed to confirm their usefulness.

Figure 7: Common leaf shapes (from Radford et al. 1974) Background Plant Taxonomy One of the main questions that this study revolves around is, what makes a species a true species? Since the days of Plato the definition of the word has been debated. There are even some schools of thought that believe species do not exist at all. Charles Darwin himself admitted 27

before the end of his life that species boundaries were anything but cut and dry. It was in the days of Linnaeus that variation within species was first acknowledged, prior to this morphological varieties within species were largely ignored (Stuessy 1990). In an effort to solve this species dilemma, biologists have come up with many species concepts over the years to try and make sense of things. One of the simplest concepts is the morphological species concept, which says that a species is “the smallest group that is consistently and persistently distinct, and distinguishable by ordinary means” (Winston 1999). This concept is perhaps too simple to define a species whose taxonomic standing is perplexing, but the simplicity of the concept has served biologists well in the early days of taxonomy (Stuessy 1990). The most commonly accepted species concept is the biological species concept, which states that a species is “groups of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups”. This popular concepts can have downfalls because it is difficult to know if interbreeding is actually happening in nature. Furthermore, data on whether or not groups interbreed is rare, so this concept is often used more on the conceptual rather than practical level

(Stuessy 1990). The ecological species concept is closely tied to the evolutionary species concept. These concepts define species as “lineages that inhabit minimally different adaptive zones,” and “lineages of ancestor-descendent populations that have their own evolutionary tendencies” (Winston 1999). These concepts are often used hand in hand when attempting to make a species designation. This concept could be applicable to the situation with M. rotundifolia and M. albida. The adaptive zones that they inhabit are quite different, but have they diverged enough over time to have their own evolutionary tendencies? The genetic species concept defines a species as “the most inclusive population of individuals having mechanisms that limit population boundaries by the action of such basic forces as gene flow, natural

selection, and genetic drift” (Winston 1999). This species concept is actually very similar to the morphological species concept, only genetic characters are being stressed as opposed to phenotypic characters. With today’s available molecular genetic technology, this concept is gaining popularity in all fields of taxonomy. A very interesting order of operations for defining a species was developed by Doyen and Slobodchikoff in 1974. Their approach is summarized nicely in Figure 8. The chart gives the order in which each grouping method should be considered. The flow chart is great because it considers most all of the popular species concepts.

However for this study the chart needs one more element, and that is the element of genetic diversity.

Figure 8: Flow chart for defining species developed by Doyen and Slobodchikoff in 1974

Plants can be particularly tricky when it comes to defining species because they have what is known as an open genome, which means that almost any dividing cell has the potential to 29

become a reproductive cell (Winston 1999). Genetic material incorporated into the somatic cells of a plant has the potential to be passed on, most of the time through hybridization. Hybridization occurs when one species fertilizes another and the gametes fuse. In plants, hybridization often results in a different number of chromosomes. About 70% of angiosperm species have multiple copies of homologous chromosomes due to hybridization (Winston 1999). Plants can also back- hybridize with their parents. When this happens, species at different geographic extremes may look very different, but they all share genes because each one is hybridizing with its neighbors, including the parental plants. Pollination decreases as distance from the parent plant increases, however. Therefore individuals that live more closely together will generally be more closely related.

There are taxonomic rankings that are below species, and their designation can be just as problematic. A botanical subspecies is referred to as a population of individuals expressing a given genotype and forming a distinct regional subset of the species (Winston 1999). If characteristics vary gradually through different populations, it is difficult to define a group as a subspecies. It is much easier to define a subspecies when there is more of a distinct change of some characteristic when compared to other populations of the species. Ecological races occur when plants of the same species grow in different specific habitats within the same general geographic area. Soil characteristics can change in short distances, causing geographical races of the same plant species to emerge over time. When this occurs the species may interbreed at zones of contact, if there are any, but other than that the populations will tend to diverge

(Winston 1999). One concept that plant taxonomists have used to determine species boundaries is the presence or absence of phenotypic intermediates along the boundaries of the distributions

of the two species in question. If intermediate forms persist the two species will often be considered one single taxon (Turner 1993).

Endemism in plants Endemic plant species are often associated with soils of unusual composition. Species that are thought to be endemic because of soil preference are referred to as edaphic endemics

(Kelso 2003). Endemic species are typically of conservation concern because their habitat specificity inevitably results in restricted ranges and small populations. About 60% of edaphic endemics in Colorado are considered globally imperiled. It has been a topic of study whether endemics use the minerals of the soils they are found on, or if this environment merely restricts other species and allows for a low competition situation (Kelso 2003). It is likely that the answer to this question differs for each endemic plant species. Endemism presents a special challenge when it comes to establishing new populations, because they can only be established in specific areas that the species is restricted to in nature.

In Southern Colorado, the Arkansas River Valley is well known for being the home of many unusual and rare plants. Most all of the rare endemic species found in the Arkansas River

Valley between Pueblo and Canon City are on exposures of the Niobrara formation. This formation has calcareous soils high in chalk, shale, and limestone. These outcrops are plentiful in this area of the Valley, but most all of these edaphic endemics are rare and threatened species. In other locations there are many species of plants that are associated with other soil elements, such as gypsum or selenium. This phenomenon is well accepted, but not well understood by most botanists. It has been found that although Mirabilis rotundifolia is found on soils high in gypsum, it is likely not the factor causing this endemism, it is a correlate. The factors causing the

endemism are more likely physical or have more to do with competitor exclusion (Kelso et al.

1995). M. rotundifolia is not the only plant in the family that has edaphic endemic qualities.

The family Nyctaginaceae has many genera that include endemic species. One member of the family, Abronia ammophila (the Yellowstone sand verbena) is endemic to the rare conditions found at Yellowstone National Park (Saunders 2006). It is only found along the north shoreline of Yellowstone Lake, just above the maximum splash zone. All populations are found on similar soil conditions, loose sand with minimal organic matter. It was found that the limitation of this species to these sandy soils was likely due to the reduced amount of competition on a poor substrate (Whipple 2002), similar to what has been found for M. rotundifolia. Another endemic species in the family Nyctaginaceae is Pisonia sandwicensis. This species is an evergreen tree endemic to the Hawaiian Islands. This species is very unique.

Species that are restricted to islands do not usually have specialized symbiotic relationships with other organisms, but Pisonia sandwicensis has been shown to form unique relationships with ectomycorrhizal fungi (Hayward 2014).

The genus Mirabilis has many endemic species other than M. rotundifolia. MacFarlane’s four o’clock, or M. macfarlanei, is endemic to northeastern Oregon and West Central Idaho. The habitat of this species is very dry. The range is so small that M. macfarlanei is listed as threatened under the Endangered Species Act (Yates 2007). Mirabilis himalaica is another endemic species from the genus Mirabilis. This species is very interesting because it is the only member of the genus that is found in the Eastern Hemisphere. This species is only found on rough terrain in the cold, dry Trans-Himalayan range that stretches from China, to India, to

Nepal (Ranjitkar 2014). The trend of endemism is widely found in both the family

Nyctaginaceae and the genus Mirabilis. In most of the cases the endemics are limited to harsh 32

habitats that other species do not thrive in. It seems that many of these related plant species take advantage of low competition opportunities.

Gypsophily in plants

Soils high in gypsum are found in many arid and semi-arid regions around the world.

Gypsum soils are not typically home to generalist plants. Gypsum is not necessarily bad for generalist plants, however. In fact, a study done by Iowa State College in 1944 found that gypsum dust on crops actually increased the yield of oat plants, and did not adversely affect the yield of corn and soybean plants (Loomis 1944). That being said, the roots of generalist plants cannot penetrate gypsum soil very well, because it is mechanically unstable and lacks plasticity.

Many of the areas that have gypsum soils are home to rare plant species that are limited to these specialized soils. Plants that establish specifically on soils high in gypsum are called gypsophiles. Many gypsophiles have been found to be “refuge-model” endemics, meaning that they take advantage of a small area of a larger general habitat that has less competition (Escudero

1999). Even though gypsum soils cover over one million square kilometers of the world, the edaphic endemics that call these soils home have not been well studied. Many of the studies that have been done have found that the presence of gypsum is often not a factor influencing the presence of a certain species. One factor that has been found to correlate with the presence of these plants is that their seeds are able to penetrate the extremely hard surface of the gypsum crust at the time of emergence (Romão 2005). Mirabilis rotundifolia is a textbook example of a plant species that is restricted to gypsum soils in the wild, but grows just fine in normal garden soil under controlled conditions (Kelso 2003).

Statement of Objective Hypothesis It is hypothesized that Mirabilis rotundifolia is a genetically unique species, and not a variant of Mirabilis albida. To be supported, sufficient genetic variation must be present between the two species. If little to no genetic variation exists then the hypothesis will be refuted. The comparison of ISSR profiles, and the variation of ITS sequences, as well as the type of correlation the data have with morphology will be considered when examining the level of support of the hypothesis.

One of the main reasons this hypothesis was formulated is that the habitat specificity of the two species is so different. Not only is M. rotundifolia more “choosy” when it comes to habitat, but it is also found in unquestionably different substrates than M. albida. This obvious difference in typical habitat was a major factor in the formulation of the hypothesis.

Another reason that it is believed these two species will turn out to be separate is the phenotypic differences they show. Herbarium samples and observed specimen from the field show an obvious difference in leaf size and shape between the two. The phenotype of M. rotundifolia has been observed to be much more consistent, especially when it comes to the level of hairiness on the leaves and stems. These differences in morphology are another factor in generating the hypothesis that M. rotundifolia is a separate species from M. albida.

Specific Aims The main goal of the first part of the study is to show whether or not there is significant sequence variation in the ITS region of nrDNA of Mirabilis species. Analyzing variation in the

ITS region will show how far the two species have diverged over time, and where they fall within the genus as a whole. Comparing the evolutionary history of the two sequences will help 34

to decide whether the two species have diverged far enough over time to be considered separate species or not.

The aim of the second part of the study is to show whether or not significant variation in

ISSR profiles exists between M. rotundifolia, M. linearis, and M. albida. Comparing the ISSR profiles of individual plants assumed to be M. rotundifolia with those of individual plants assumed to be M. albida will show whether or not these two species have similar genomes.

There may be a high percentage of un-shared or shared alleles, which will give a close look at just how similar these species really are at the molecular level. Including Mirabilis linearis in this analysis will allow for the comparison of how similar M. rotundifolia is to M. albida, in relation to how different M. linearis, a commonly accepted species, is from M. albida.

Depending on the level of similarity, a conclusion can be drawn about whether or not M. rotundifolia should be considered a unique species.

The aim of the last part of this study is to show whether or not the ISSR data correlate with phenotypic characteristics and/or geographic location. The main goal of this aim is to determine if molecular phylogenetic patterns can be predicted by any other characteristics, in this case specific phenotypic characteristics or geographic location. It has traditionally been assumed in plant taxonomy that to a certain extent, morphological relationships correlate with genetic and reproductive relationships (Stuessy 1990). Knowing what factors influence the genetic makeup of individuals will allow for better management decisions via improved species boundaries and identification.

Methods

Internal Transcribed Spacer region The internal transcribed spacer (ITS) region is a section of nuclear ribosomal DNA

(nrDNA). The ITS region is present in thousands of copies in the angiosperm genome, and is arranged in tandem repeats. The ITS region is made up of three components, as shown in Figure

9. There are two spacer regions that sit between the 18S and 26S sections of nuclear ribosomal

DNA, called ITS 1 and ITS 2. ITS 1 is almost always longer than ITS 2, but in rare occasions it can be the same length (Baldwin 1995). In between the two spacers is the 5.8S subunit of nrDNA, a segment of nrDNA that has a very highly conserved sequence. The 5.8S subunit and the two spacers are present in transcriptional nrDNA, but only the 5.8S subunit is included in fully developed ribosomes. It is thought that the purpose of the ITS spacers is involved with the maturation of nrDNA. (Baldwin 1995). Most mutations that occur in this region are point mutations as opposed to insertion or deletion mutations that would change the length of the sequences. Studies in yeast have shown that mutations in the ITS 1 region often inhibited production of small and large subunit rRNA, and mutations in the ITS 2 region resulted in the reduction of processing of large subunit rRNA (Baldwin 1995).

Figure 1: Diagram of the ITS region of nrDNA (Baldwin 1995).

The ITS region shows a clocklike evolution pattern, which is a characteristic that is desirable for this type of study (Zhang 2001). It was shown by Levin in 2000 that in the family

Nyctaginaceae, the ITS region evolves much more quickly than commonly used chloroplast sequences. The quick and predictable evolution of the ITS region makes it much more phylogenetically informative for this plant family than chloroplast sequences. Sequence alignments have shown that the sequences of the ITS spacers have diverged more than the sequences of the nrDNA subunits at the level of the nucleotide, and that ITS 2 sequences show more divergence than ITS 1 sequences. ITS sequences are well known for being very easily aligned. The reason the ITS region shows such high alignability is that length appears to be highly conserved. High length conservation does not hinder the usefulness of the region because typically enough variation can be detected in the nucleotide sequences to make an evolutionary comparison (Baldwin 1995).

An ideal nucleotide sequence to use in lower level phylogenetic studies is easily amplifiable, rapidly evolving, and is able to be aligned unambiguously. The ideal sequence should provide enough variation between individuals, but should still be a relatively short sequence so that it is easy to work with. The ITS sequence has been the choice of many molecular taxonomists because it possesses many of these desired characteristics. The ITS region contains regions of sequence that are highly conserved mixed in with regions that are very variable, which promotes unambiguous alignment, but still allows sequence variation to be detected. Many variable sites in species of plants that are closely related have been shown to map to the ITS region. Moreover, the high copy number of the ITS region promotes detection of the sequence via PCR amplification. The small size (the region is always under 700 base pairs in flowering plants) of the ITS region and the fact that the nrDNA sequences that flank the region

are very highly conserved also make the ITS region a very good candidate for PCR based detection and amplification. The high nucleotide variability makes up for the fact that the sequences are relatively short. Typically longer sequences give more accurate phylogenetic analyses, but when variation is highly concentrated in a short sequence, as in the ITS region, the segment can still be very useful. The convenience of the region is taken one step further considering that there are universal primers available, designed by White and colleagues in 1990, and whose sequences can be found in Table 1. One of the most important features of the ITS region, taxonomically speaking, is the fact that it undergoes concerted evolution relatively rapidly. This type of evolution likely occurs through unequal crossing over and gene conversion, and promotes repeat units of the region to be homogenous in a single individual. Many studies have shown an accurate picture of species relationships drawn from analyzing ITS sequence variation. The ITS region has been shown to be particularly successful at resolving relationships between plants in the same genus. Recent studies have shown that the ITS region can be useful to examine relationships between allopatric populations. It was found that in the genus

Calycadenia, there was 3.7% ITS divergence between individuals from the same species, but different allopatric populations. It is good methodology to use phylogenetic evidence from two independent sources to enhance resolution of relationships. ITS sequences are an independent line of evidence that are ideal to compare to other molecular evidence, or even morphological characteristics (Baldwin 1995).

Table 2: The sequences of all PCR primers used in this study. Primer Name Sequence ITS 4 5’TCCTCCGCTTATTGATATGC3’ ITS 5a 5’GGAAGTAAAAGTCGTAACAAGG3’ M13 F 5’GTAAAACGACGGCCAGT3’ M13 R 5’AACAGCTATGACCATG3’ ISSR 842 5’GAGAGAGAGAGAGAGAGAGAGAYG3’

There are some characteristics of the ITS region that could be potential pitfalls in the experimental design of the study. One feature of the ITS region that could potentially complicate a phylogenetic analysis, is that changes in characters may not be independent if they are involved in the formation of secondary structures. For example, if a mutation occurs in a region that is involved with stem or loop formation, then another mutation may occur at the site opposite of the original mutation to maintain the correct secondary structure. Although these mutations are not independent within one molecule, they do not appear to be evolutionarily linked, so the ITS region can still be a useful phylogenetic tool. In the genus Mirabilis, it is known that species hybridize with each other. Hybrid species can be a problem in this phylogenetic analysis because they can be fixed for a certain ITS repeat type of specific parental origin (Baldwin 1995). This can be problematic because the true parentage of the hybrid individual may not be able to be detected by an analysis of the ITS region. For this particular application parentage is not a concern, therefore this pitfall should not affect the validity of the study.

What this study will gain from the comparison of ITS sequences of Mirabilis species is a look at the relationships between them, and where they fall in the genus as a whole, on a large scale evolutionary basis. Once the sequences are compared a phylogeny can be constructed using statistical methods. The tree will show where the two species in question fall in the genus

Mirabilis. Looking at the genus on a large scale will be helpful in this study because it can show 39

whether these species fall into a clade together. If they do group together in a phylogeny, we can assume that they are more related to each other than they are to other Mirabilis species. If they do not fall into a clade together this is also informative, because it shows that evolutionarily they have diverged over time, perhaps enough to be separate species.

Inter Simple Sequence Repeats Microsatellites, or simple sequence repeats (SSR) are tandemly repeated short sequence motifs that are spread throughout the genomes of eukaryotes. These repeats are present in distantly related eukaryotic species. Although these repeats are consistently found in the same general genomic location, the number of repeat units per microsatellite unit varies considerably even between individuals of the same species (Zietkiewicz 1994). The rate of change from an evolutionary standpoint is high in microsatellites, so the likelihood of detecting polymorphisms in these sequences is greater than in other types of DNA sequences. The source of this high rate of change is likely the slippage of DNA polymerase when replicating repetitive DNA segments, and the inability of the enzyme to repair mismatches (Reddy 2002).

The Inter-Simple Sequence Repeat (ISSR) technique takes advantage of SSR sequences as priming sites for a PCR reaction. A graphic of the technique is shown in Figure 10. ISSR amplification products are dominant markers that follow Mendelian inheritance (Reddy 2002).

The greatest benefit of using ISSRs as genetic markers is that no prior knowledge of sequences is necessary. The primers used in the PCR reaction are short and are made up of repeat motifs that have been known to make up SSR segments. This primer design allows for the simultaneous amplification of multiple random loci spread throughout the genome. When identical SSR sequences are found within a short distance from each other, and are oriented in opposite directions, one ISSR primers amplifies the DNA segment between the two SSRs. The segments 40

between the many oppositely oriented SSR loci are of different length, and result in a pattern of bands when separated by electrophoresis (Reddy 2002). Due to differences in the length of the segments between the repeats, and the fact that the primers are sensitive to mismatches, a unique genetic fingerprint can easily be created for many individuals (Zietkiewicz 1994).

Polymorphisms can come from any mutation in the SSR region that causes amplification to succeed or fail. If a specific sized band amplifies for any individual, it will be scored as present, and any specific sized band that does not amplify will be scored as absent. The frequency of SSR regions and their positions throughout the genome influence the banding patterns for an individual (Reddy 2002). Fine tuning the annealing temperature of the PCR reaction is the best way to optimize banding patterns. Typically ISSR primers have optimal annealing temperatures of 45 to 65° C, depending on the nature of the template DNA and the GC content of the primer

(Reddy 2002).

Figure 2: The ISSR technique amplifies segments between simple sequence repeats. Analyzing microsatellite regions themselves requires a prior knowledge of the sequences that flank them, in order to amplify the microsatellite region using PCR. The length variation of the microsatellites are then compared to reveal polymorphisms (Kantety 1995). Using this

technique to investigate genetic diversity is more difficult that analyzing ISSRs because of the requirement of prior sequence knowledge, and the fact that many times these sequences are proprietary. ISSR is an applicable technique for this study. The fact that no prior knowledge of sequences is needed, and that the loci isolated are random and spread throughout the genome make this technique easy to execute and suitable to the goals of the study (Zietkiewicz 1994).

The main benefits to the ISSR method are that it produces composite banding patterns that show high percentages of polymorphisms, it is a simple to perform technique, it requires very small amounts of template DNA, and it is relatively cost effective. One study on popcorn cultivars showed that 98% of all scoreable runs were reproducible across multiple PCR runs and DNA extractions (Kantety 1995). The same study was able to detect multiple polymorphisms between closely related sister lines in a very short time. It has been shown that different concentrations and quantities of DNA template produce the same banding patterns for the same individual, which shows that this technique is highly reproducible. Another benefit of using ISSR is that the sequence of the primers is not proprietary, as with SSR primer sequences, so anybody can synthesize and use the primers (Reddy 2002).

Microsatellite regions have been known to be selectively neutral, but linked to coding regions, so it is likely that ISSR regions are in gene rich areas (Reddy 2002). The ISSR technique has been used many times to resolve relationships between species and even closely related cultivars (Pharmawati 2005). This technique has revealed high levels of polymorphism in populations of rare and endangered plant species, for which other techniques failed to detect diversity (McGlaughlin 2002). ISSR has been used successfully to quantify diversity in many plant species such as rice, wheat, fingermillet, Vigna, sweet potato, and Plantago. The technique has also been used to test hypotheses of speciation and hybridization in the plant kingdom

(Reddy 2002). Studies have shown that the ISSR technique is more efficient than the RFLP

(Random Fragment Length Polymorphisms) or RAPD (Random Amplified Polymorphic DNA) techniques are in molecular studies of plants (Kantety 1995). ISSR patterns have been shown to be more complex than those produced by RAPD (Pharmawati 2005). ISSR primers are also technically more efficient due to their longer sequences and higher annealing temperatures

(Ming-qian 2011). There has been at least one study that was able to obtain enough genetic information from one ISSR primer to draw conclusions about cultivar boundaries (Pharmawati

2005). It has been shown that this technique produces amplification patterns that are unique for every individual, however patterns from individuals of the same species are very similar. This degree of similarity allows for the inference of evolutionary relationships using the amplification patterns (Zietkiewicz 1994).

Although the ISSR technique is very suitable for this study, there are some potential pitfalls to address. The information obtained from ISSR primers is slightly limited because they are dominant markers, which means they cannot reveal whether and individual is heterozygous or homozygous for a specific allele, and they only show di-allelic polymorphisms (McGlaughlin

2002). Although ISSR primers are limited in the information they provide, they have been shown to be more variable than similar techniques, and with one primer, a suitable genetic study can be performed. Primers that only prime from within a microsatellite locus can result in amplification of the same region with different lengths, which can create a smearing pattern as opposed to clear bands (Kantety 1995). This problem can be overcome by anchoring the primers on either the 3’ or 5’ ends with degenerate nucleotides that extend past the SSR repeat sequence and into the flanking sequence. Anchoring the primer also allows for better band resolution because only the SSR regions with the anchoring base will be amplified. This study will anchor the primers on

the 5’ end. As with many techniques analyzed via electrophoresis, it is possible that fragments that show the same mobility did not originate from a single homologous locus, which can result in a slight misrepresentation of genetic diversity. The only way to completely get around this pitfall would be to extract each band from the gel and sequence it, which would add time and cost to the study (Reddy 2002). Taking a conservative approach to band scoring can minimize this misrepresentation.

The information obtained from the ISSR analysis will show how large or small genetic diversity is both between individuals and between populations. A presence/absence matrix will be created from the ISSR profiles, and based on this matrix a phylogenetic tree will be created using statistical methods. This tree will show individuals from many different populations of M. rotundifolia, M. albida, and M. linearis, and how they group based on genetic characteristics.

The grouping of the individuals will tell a lot about the taxonomic standing of M. rotundifolia. If the individuals group by the inferred species identity, or by geographic populations, then it is likely that M. rotundifolia is a true species, because phenotype and habitat are having the most influence on genetic similarity. There is also a chance that the individuals will group all together, or in a random fashion. If this is the case then perhaps M. rotundifolia may not be genetically different enough to be considered a true species. Regardless of the grouping of the individuals, the tree should give a closer look at the relationship between these three Mirabilis species.

Specimen collection Plant samples were collected from multiple locations across southern Colorado. Some collection locations were chosen based on previous sightings of Mirabilis species. Other locations were found on the Southwest Environmental Information Network (SEINet) website.

The SEINet website has records of all the plant specimen found in herbariums throughout the 44

Southwest United States. Along with pictures and accession numbers, most herbarium entries also include GPS coordinates of where the particular specimen was found, as well as comments from the collectors. New GPS coordinates were recorded for each location that a sample was collected from.

Due to the possible imperiled nature of Mirabilis rotundifolia, no whole plant samples were collected. For all samples of Mirabilis rotundifolia, 1 to 2 leaves were collected from each individual. For samples of Mirabilis albida and Mirabilis linearis some whole plant samples were collected from populations that appeared to be in good health. If less than three individuals were found near each other then only leaves were collected from the individuals. Collected samples were stored at -20° C for up to 21 days before DNA extraction. Excess leaf material was kept at -20° C in airtight bags for the remainder of the study.

All plant samples used in this study came from southern Colorado. Table 2 shows the locations and dates of collection of all samples. Six of the M. rotundifolia populations were found on Lake Pueblo State Park property (Figure 11). Five of these populations (groups A, E, F,

K, and L) were found at the Juniper Breaks campground. The Juniper Breaks populations were split because there were three distinct areas in which individuals were found living closely.

Group A was found in Population 1 at Juniper Breaks. Individuals from Group A were typical M. rotundifolia individuals of expected morphology. Groups E and K were found in Juniper Breaks

Population 2. The reason that these plants were kept separate is because of the morphology differences in the two groups. Plants from Group E were smaller individuals, and Group K is made up of larger M. rotundifolia individuals. The purpose of keeping these groups separate is to determine if the larger individuals from the same population are genetically different from the smaller individuals. This comparison will show how much size difference is related to genetic 45

similarity. Groups F and L were collected from Juniper Breaks Population 3. Group F is made up

the typically sized individuals, and Group L is made up of the larger individuals from this

population. The last M. rotundifolia population, Group G was found at the most northwestern

end of the park’s property, near the Arkansas River. Group H is another group of M. rotundifolia

found in Fremont County along the side of State Highway 115, near the junction with State

Highway 50. Group I is a specimen of M. rotundifolia grown from seed at the Colorado State

University-Pueblo greenhouse, and Group J was grown from a seed obtained from Dr. Sylvia

Kelso of Colorado College, who has done research on M. rotundifolia. The origin of the seed

was the Colorado College outdoor garden. Samples of Mirabilis albida were collected from El

Paso County, comprise Groups B and D. Individuals from Group B were found in Southwestern

Colorado Springs, and Group D was found at North Cheyenne Canyon Park west of Colorado

Springs. Samples of M. linearis were collected from the same area as the individuals in Group B,

in Southwestern Colorado Springs. These individuals are the members of Group C. Individuals

from the Mirabilis species M. multiflora were collected from the Juniper Breaks Campground at

Lake Pueblo State Park. These individuals were found growing alongside individuals of M.

rotundifolia. M. multiflora is very common throughout Colorado. The purpose of analyzing these

individuals is to compare them to the M. rotundifolia individuals, and determine if hybridization

is occurring between these more distantly related Mirabilis species.

Table 3: Information for each individual sampled for this study.

Sample Species GPS Location Habitat Date ID coordinates Collected

A1 M. rotundifolia 38.276767, Lake Pueblo State Park Juniper Breaks Shale outcrop 7/1/2014 -104.754400 Campground Population 1

A2 M. rotundifolia 38.276671, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754368 Campground Population 1

Sample Species GPS Location Habitat Date ID coordinates Collected

A3 M. rotundifolia 38.276670, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754389 Campground Population 1

A4 M. rotundifolia 38.27671, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754401 Campground Population 1

A5 M. rotundifolia 38.276710, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754366 Campground Population 1

A6 M. rotundifolia 38.276744, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754384 Campground Population 1

B1 M. albida 38.813632, Southwest El Paso County Grassland 8/21/2014 -104.870348

B2 M. albida 38.813730, Southwest El Paso County Grassland 8/21/2014 -104.870335

B3 M. albida 38.813702, Southwest El Paso County Grassland 8/21/2014

-104.870276

B4 M. albida 38.813708, Southwest El Paso County Grassland 8/21/2014 -104.870332

B5 M. albida 38.813701, Southwest El Paso County Grassland 8/21/2014 -104.870126

B6 M. albida 38.813647, Southwest El Paso County Grassland 8/21/2014 -104.870461

B7 M. albida 38.813551, Southwest El Paso County Grassland 8/21/2014 -104.870431

B8 M. albida 38.813731, Southwest El Paso County Grassland 8/21/2014 -104.870295

B9 M. albida 38.813774, Southwest El Paso County Grassland 8/21/2014 -104.870002

B10 M. albida 38.813688, Southwest El Paso County Grassland 8/21/2014 -104.870230

B11 M. albida 38.813826, Southwest El Paso County Grassland 8/21/2014 -104.870450

Sample Species GPS Location Habitat Date ID coordinates Collected

B12 M. albida 38.813678, Southwest El Paso County Grassland 8/21/2014 -104.870442

B13 M. albida 38.813851, Southwest El Paso County Grassland 8/21/2014 -104.870072

B14 M. albida 38.813673, Southwest El Paso County Grassland 8/21/2014 -104.870123

B15 M. albida 38.813587, Southwest El Paso County Grassland 8/21/2014 -104.870128

B16 M. albida 38.813708, Southwest El Paso County Grassland 8/21/2014 -104.870490

B17 M. albida 38.813574, Southwest El Paso County Grassland 8/21/2014 -104.870383

B18 M. albida 38.813737, Southwest El Paso County Grassland 8/21/2014 -104.870619

B19 M. albida 38.813662, Southwest El Paso County Grassland 8/21/2014 -104.870318

B20 M. albida 38.813844, Southwest El Paso County Grassland 8/21/2014 -104.870565

B21 M. albida 38.813896, Southwest El Paso County Grassland 8/21/2014 -104.870458

B22 M. albida 38.813810, Southwest El Paso County Grassland 8/21/2014 -104.870275

B23 M. albida 38.813871, Southwest El Paso County Grassland 8/21/2014 -104.870399

B24 M. albida 38.813961, Southwest El Paso County Grassland 8/21/2014 -104.870297

B25 M. albida 38.813961, Southwest El Paso County Grassland 8/21/2014 -104.870297

C1 M. linearis 38.812614, Southwest El Paso County Grassland 8/20/2014 -104.864145

C2 M. linearis 38.812453, Southwest El Paso County Grassland 8/20/2014 -104.864242

Sample Species GPS Location Habitat Date ID coordinates Collected

C3 M. linearis 38.812616, Southwest El Paso County Grassland 8/20/2014 -104.863539

C4 M. linearis 38.812608, Southwest El Paso County Grassland 8/20/2014 -104.863856

C5 M. linearis 38.812687, Southwest El Paso County Grassland 8/20/2014 -104.864027

C6 M. linearis 38.812762, Southwest El Paso County Grassland 8/20/2014 -104.863480

C7 M. linearis 38.812612, Southwest El Paso County Grassland 8/20/2014 -104.863464

C8 M. linearis 38.812821, Southwest El Paso County Grassland 8/20/2014 -104.863646

C9 M. linearis 38.812604, Southwest El Paso County Grassland 8/20/2014 -104.863528

C10 M. linearis 38.812871, Southwest El Paso County Grassland 8/20/2014 -104.863372

C11 M. linearis 38.812871, Southwest El Paso County Grassland 8/20/2014 -104.863372

C12 M. linearis 38.812829, Southwest El Paso County Grassland 8/20/2014 -104.863925

C13 M. linearis 38.812641, Southwest El Paso County Grassland 8/20/2014 -104.864343

C14 M. linearis 38.812775, Southwest El Paso County Grassland 8/20/2014 -104.863673

C15 M. linearis 38.812557, Southwest El Paso County Grassland 8/20/2014 -104.863678

C16 M. linearis 38.812457, Southwest El Paso County Grassland 8/20/2014 -104.863737

D1 M. albida 38.791246, Cheyenne Canyon State Park Montane 8/26/2014 -104.903398 shrubland

D2 M. albida 38.790778, Cheyenne Canyon State Park Montane 8/26/2014 -104.905801 shrubland

Sample Species GPS Location Habitat Date ID coordinates Collected

D3 M. albida 38.790861, Cheyenne Canyon State Park Montane 8/26/2014 -104.903805 shrubland

D4 M. albida 38.791832, Cheyenne Canyon State Park Montane 8/26/2014 -104.902840 shrubland

D5 M. albida 38.791547, Cheyenne Canyon State Park Montane 8/26/2014 -104.905071 shrubland

D6 M. albida 38.790677, Cheyenne Canyon State Park Montane 8/26/2014 -104.904234 shrubland

D7 M. albida 38.793069, Cheyenne Canyon State Park Montane 8/26/2014 -104.900501 shrubland

D8 M. albida 38.793052, Cheyenne Canyon State Park Montane 8/26/2014 -104.902089 shrubland

D9 M. albida 38.792618, Cheyenne Canyon State Park Montane 8/26/2014 -104.903162 shrubland

D10 M. albida 38.791564, Cheyenne Canyon State Park Montane 8/26/2014 -104.904621 shrubland

D11 M. albida 38.790661, Cheyenne Canyon State Park Montane 8/26/2014 -104.907475 shrubland

D12 M. albida 38.790092, Cheyenne Canyon State Park Montane 8/26/2014 -104.906874 shrubland

D13 M. albida 38.790243, Cheyenne Canyon State Park Montane 8/26/2014 -104.905436 shrubland

E1 M. rotundifolia 38.278239, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.751939 Campground Population 2

E2 M. rotundifolia 38.278083, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.752209 Campground Population 2

E3 M. rotundifolia 38.277718, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.752986 Campground Population 2

E4 M. rotundifolia 38.277482, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.753978 Campground Population 2

E5 M. rotundifolia 38.278242, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.751716 Campground Population 2

Sample Species GPS Location Habitat Date ID coordinates Collected

F1 M. rotundifolia 38.278648, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.749825 Campground Population 3

F2 M. rotundifolia 38.278682, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.749868 Campground Population 3

F3 M. rotundifolia 38.278825, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.749107 Campground Population 3

F4 M. rotundifolia 38.278875, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.748227 Campground Population 3

F5 M. rotundifolia 38.278791, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.747851 Campground Population 3

G1 M. rotundifolia 38.289686, Northwest Lake Pueblo State Park Shale outcrop 7/17/2014 -104.834867

H1 M. rotundifolia 38.40735, Eastern Fremont County Shale outcrop 7/17/2014 -105.05368

I1 M. rotundifolia 38.307109, Colorado State University-Pueblo Indoor garden 5/1/2014 -104.579926 Greenhouse

J1 M. rotundifolia 38.849671, Colorado College Garden Outdoor 7/1/2015 -104.822677 garden

K1 M. rotundifolia 38.277956, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.752600 Campground Population 2

K2 M. rotundifolia 38.278239, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.752061 Campground Population 2

K3 M. rotundifolia 38.277692, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.752962 Campground Population 2

K4 M. rotundifolia 38.277808, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.753300 Campground Population 2

K5 M. rotundifolia 38.277818, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.753275 Campground Population 2

K6 M. rotundifolia 38.278008, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.753283 Campground Population 2

L1 M. rotundifolia 38.277730, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.753505 Campground Population 3

Sample Species GPS Location Habitat Date ID coordinates Collected

L2 M. rotundifolia 38.278138, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.752443 Campground Population 3

L3 M. rotundifolia 38.277583, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.753720 Campground Population 3

L4 M. rotundifolia 38.277608, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 (large) -104.752926 Campground Population 3

M1 M. multiflora 38.277934, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.752138 Campground

M2 M. multiflora 38.278293, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.755977 Campground

M3 M. multiflora 38.277059, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.754765 Campground

M4 M. multiflora 38.277240, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.752658 Campground

M5 M. multiflora 38.277097, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.752915 Campground

M6 M. multiflora 38.277232, Lake Pueblo State Park Juniper Breaks Shale outcrop 6/24/2015 -104.753524 Campground

Figure 3: The general areas in Southern Colorado from which all sampled populations originated. DNA extraction Genomic DNA was extracted from 50-100 mg of frozen leaf material using the Qiagen

DNeasy plant mini kit. Frozen leaf tissue was disrupted using a mortar and pestle along with 100

µL of Qiagen lysis buffer. The lysis buffer was added to facilitate the breaking up of the tissues, so that less mechanical force was needed, and the DNA remained intact. 1 µL of RNase was added to the disrupted leaf tissue to destroy any contaminating RNA molecules. The tissue was then combined with 400 µL of the lysis buffer and vortexed vigorously to mix. The mixture was incubated for 10 minutes at 65° C in order to lyse the cells. During incubation the tubes were inverted 3 times to insure full lysis. After the incubation, 130 µL of precipitation buffer was added to the tissue mixture, and it was incubated on ice for 5 minutes. This step allowed for the precipitation of polysaccharides and proteins, so they could be removed from the mixture.

Extraction of plant DNA can often be difficult due to the co-extraction of things like polysaccharides, proteins, and polyphenols (Gupta 2011). High quality genomic DNA must be 53

used in this type of study because cellular contaminants can hinder downstream reactions. Often amplification failures in plants are caused by these inhibitory compounds. It has been shown that relatively medium sized, and aged leaves are best suited for optimum DNA quality (Gupta 2011).

After the precipitation step, the lysate was centrifuged for 5 minutes at 13,600 rpm. This step pelleted the precipitate leaving a supernatant with the DNA in solution. This supernatant was pipetted into a QIAshredder Mini spin column contained in a 2 mL collection tube. The tube and column were centrifuged for 2 minutes at 13,600 rpm in order to remove any remaining contaminating precipitates. The flow through from this step was moved to a new tube where it was combined with binding buffer. The binding buffer is an ethanol based buffer that binds DNA molecules. 650 µL of the resulting solution was placed into a DNeasy Mini spin column that was inside of a 2 mL collection tube. The DNeasy mini spin column has a membrane, that at the right pH and salt level, binds DNA with all other molecules able to pass through. The spin column was centrifuged for 1 minute at 8,000 rpm and the flow through was discarded. Using the same spin column the previous step was repeated using the remainder of the sample. The spin column was then placed into a new 2 mL collection tube and 500 µL of wash buffer was added. The tube and column were centrifuged for 1 minute at 8,000 rpm. This step washed the membrane that had bound the DNA molecules and removed any remaining contaminants. The flow through was discarded and 500 more µL of wash buffer were added to the spin column. The column was then centrifuged for 2 minutes at 13,600 rpm in order to dry the spin column membrane. It was critical to dry the membrane thoroughly because any residual ethanol carried over into the elution step could interfere with downstream reactions. The spin column was then placed into a final collection tube and 50 µL of elution buffer was added to the spin column membrane. The elution buffer is a low salt buffer that binds DNA with a higher affinity than the spin column

membrane, allowing for the DNA to be eluted into solution. The elution buffer was incubated on the membrane for 5 minutes at room temperature to insure complete binding of DNA molecules.

The spin column and collection tube were centrifuged for 1 minute at 8,000 rpm to elute the

DNA. Genomic DNA was used immediately in PCR reactions when possible, and stored at -20°

C after use.

Internal Transcribed Spacer Analysis A diagram of the structure of the ITS region is shown in Figure 9. The figure also shows the locations that the primers used would anneal to the ITS region. The primers used were ITS 4 and ITS 5a, designed by White and associates (See Table 1 for sequences). The entire ITS region, including the ITS 1 spacer, 5.8s nrDNA region, and ITS 2 spacer, was amplified from genomic DNA of Mirabilis species using PCR. The forementioned primers were used at a 10 pmol/µL concentration for the PCR reaction. The PCR protocol used to amplify the ITS region is as follows: an initial denaturation step at 95° C for 3 minutes, followed by 39 cycles of 45 seconds at 95° C, 45 seconds at 50° C, and then 1 minute at 72° C. There was then a 7 minute final extension step at 72° C, after which the sample was held at 4° C. The PCR product was separated using electrophoresis on a 2% agarose gel with a low range DNA size standard from

Fischer Scientific. PCR reactions for which bands were detected in the 600-700 bp size range were used in the following steps.

The vector used to clone the ITS sequence was the plasmid vector, pCR-4-TOPO from

Invitrogen. This plasmid has a single 3’ T overhang on each end that match with the 3’ A overhang innately left on the PCR product by Taq DNA polymerase. The plasmid also has the enzyme topoisomerase covalently linked to each end. Topoisomerase catalyzed the ligation of the ITS PCR product into the vector by donating a phosphate group to the phosphodiester 55

backbone of the two segments. The enzyme disassociated from the vector once the ligation was catalyzed.

After the ITS region was inserted into the plasmid vector, it was taken up by competent

E. coli cells. The vector was inserted into the cells using a heat shock method. The cells were heated to 42° C in order to make the cell membranes permeable, allowing for the plasmid to enter the cells. The cells were then rapidly cooled, which hardened the membrane and trapped the plasmid inside. The media used to grow the E. coli cells that contained the plasmid vector was a Luria Broth (LB) agar with ampicillin added. The pCR-4-TOPO vector has a selectable marker included in its sequence that conveys ampicillin resistance to those cells that have acquired it. This characteristic causes only those cells that have successfully received the plasmid to be able to grow on the selective media. The cells that had received the vector were mixed with a small amount of liquid growth media, and then 100 μL was plated on the selective media plates using a glass spreader. The plates were incubated overnight at 37° C.

Random colonies were chosen from the plates to be screened for the ITS insert. The chosen colonies were touched with a sterile toothpick, and swirled into a solution that contained molecular grade water and primers ITS 4 and 5a. Mineral oil was added to the top of the solution to prevent loss of product due to evaporation after the next step. The cells were lysed in the solution at 96° C for 10 minutes. After this ten minutes, a solution containing Taq DNA polymerase, dNTPs, and MgCl2 was added under the mineral oil, and the PCR protocol used to isolate the ITS insert from the genomic DNA was used to test the colonies for the presence of the

ITS insert. The PCR products were run out on a 2% agarose gel along with a DNA size standard.

Positive colonies showed a band in the 600-700 bp size range. These positive colonies were used in the following steps. 56

The plasmid was isolated from the positive colonies using a trial version of the ZymoPure

Midi/Maxiprep™ kit from Zymo Research Corporation, or a plasmid mini kit from Qiagen. The clones which were positive for the ITS insert were grown in liquid selective media overnight.

The cells were then lysed using an alkaline buffer. The buffers in the plasmid isolation kits break down nuclear DNA and proteins but allow the plasmid to remain intact due to its circular shape.

The solution was then neutralized which causes the nuclear DNA and plasmid DNA to both form again. Plasmid DNA re-aligns correctly but nuclear DNA will re-align randomly and form a precipitate. The precipitate was removed, and the plasmid was isolated from the solution using an alcohol solution. The plasmid was then purified and sent to be sequenced.

The purified plasmid was sent to be sequenced at SeqWright genomic services in

Houston, Texas. The company used Sanger sequencing methods and universal sequencing primers M13F and M13R to sequence the insert. The priming sites of the universal primers flank the multiple cloning site that was found in the plasmid vector. The isolated pure plasmid was combined in a reaction with the sequencing primers, DNA polymerase, normal nucleotide bases

(dNTPs) and nucleotide bases that have been modified (ddNTPs) in a way that when they are incorporated into the newly synthesized DNA strand, elongation will be terminated. The reason that elongation is terminated upon incorporation of a ddNTP is that this nucleotide lacks a 3’ OH group, so it cannot form a phosphodiester bond with its neighboring nucleotide. Each type of ddNTP is labeled with a different color fluorescence. For every sample that is to be sequenced there are four different reactions needed. All four of the standard nucleotides are present in each reaction, but only one of the four ddNTPs is present. The resulting reaction products are denatured and separated using electrophoresis. The sequence of the sample can be read directly from the electrophoresis gel. This is possible because the fragments will separate in order of size,

and for each size of fragment the color of the fluorescence will be different allowing for base detection. Base detection is performed using software that gives a chromatogram as an output.

The chromatogram shows a peak of fluorescence for each base position of the sequence. Once the sequences were received they were edited manually using the chromatograms. The software that is used to determine the sequences declares a nucleotide “N” if it does not have strong confidence that it can make the correct base determination. For every “N” nucleotide, the corresponding peak on the chromatogram was located and the correct base was identified. In some cases the peaks were too inconspicuous to tell which base was the correct one at that position. In this situation the base was left as “N.”

Once the ITS sequences were edited, they were run through the Basic Local Alignment

Search Tool (BLAST) available from the National Center for Biotechnology Information

(NCBI). The BLAST tool compares nucleotide sequences to find areas of local similarity. Areas of local similarity are small regions within the whole sequence that match, as opposed to global similarity which involves whole sequence similarity or much larger areas. The program compares the input sequence to a database of billions of known sequences and calculates the statistical significance that two sequences have the detected areas of similarity by chance. If this value is very small that means that the similarities detected are not likely due to chance, and that these sequences are closely related. The most similar sequences to the input sequence according to the BLAST tool were ITS regions that had already been sequenced. The most similar of the sequences were Mirabilis ITS regions, suggesting that the correct sequence was isolated.

Sequences were automatically aligned using the software program MUSCLE (Edgar

2004). Aligning the sequences allows for areas of high similarity to be identified. These areas could reflect evolutionary relationships between sequences. A maximum likelihood tree was 58

constructed based on the sequence alignment. The Maximum Likelihood method gives the tree that is most likely statistically based on the DNA substitution model (General Time Reversible

(GTR)+G) and the input sequence alignment. Bootstrap values were calculated to assess node support. These values reflect the number of trees out of 100 random possible trees that contain the branch it pertains to. The values were estimated using 100 replicates of full searches using

100 random deletion sequences for each replication. Bootstrap values greater than 70 are interpreted as having a high amount of support (Douglas 2007). The program PhyML (Guindon et al. 2010) was used to construct the phylogenetic tree.

Inter Simple Sequence Repeat Analysis 12 primers from the University of British Columbia Biotechnology Laboratory primer set

9 were screened in order to find one which produced banding patterns in Mirabilis individuals.

Four DNA samples from four different populations were used in the screening process. Di- nucleotide repeats have been found to be much more common in plant genomes than tri- nucleotide repeats, therefore primers with di-nucleotide repeat motifs were chosen to screen

(Kantety 1995). Multiple annealing temperatures were tested for each primer that showed amplification in the four trial groups. The primer and temperature combination with the clearest bands was chosen to be used in the study. The best primer was UBC primer 842 (see Table 1 for sequence), and the optimal temperature for this specific primer was 48° C.

The PCR recipe used in the amplification reactions was made up of 1μL DNA template, 1

μL 15 pM ISSR primer, 0.25μL Taq DNA polymerase, 5 μL 10X PCR buffer, 5 μL 50 mM

MgCl2, 1 μL of a solution containing 10 mM of each dNTP, and 36.75 μL of molecular grade water. The PCR protocol consisted of an initial denaturation step at 95° C for 3 minutes, followed by 40 cycles of 94° C for 1 minute, 48° C for 1 minute, and 72° C for 1 minute 30 59

seconds. After the forty cycles elongation was continued at 72° C for 7 minutes. The PCR products were separated by electrophoresis on a 2% agarose gel stained with ethidium bromide.

The gels were imaged using a Bio-Rad Gel Doc EZ system equipped with a UV tray.

Bands that traveled the same distance on the gel were considered to be from a homologous locus. In order to score the bands, the DNA size standard of each gel was measured using Image J software to determine how far bands of known sizes traveled. Using these measurements, a linear equation was constructed using Microsoft Excel. Once the equation was obtained the distances of the bands present for each profile were measured using Image J, and plugged in to the equation to obtain a size estimate for each band. All bands present were recorded in a binary data matrix. For any individual that had a specific band present it was recorded as present, or 1, and if the band was not present in an individual it was scored as absent, or 0. A conserved data matrix was also constructed for which bands were lumped into groups of

25 base pairs. 25 base pairs was determined to be the minimum amount of base pairs that could be accurately distinguished. The conserved matrix prevents an overestimation of genetic diversity by scoring non homologous loci as homologous.

The software program PAUP 4.0β10 (Swofford 2002) was used to create phylogenetic trees based on the data matrices. A neighbor joining clustering method (Saitou 1987) was used for all trees. For each matrix two trees were created, a distance tree and a maximum parsimony tree. The distance method groups the tree based on how similar or different (distant) the ISSR profiles of individuals are. The scale bar at the bottom of distance trees reflects the rate of substitution of a band for a particular allele. The maximum parsimony method creates the tree that assumes the least amount of evolutionary events given the input ISSR profiles. The scale bar

on parsimony trees reflects the evolutionary steps needed to go from one ISSR profile to the other. For both trees bootstrap values were calculated.

Morphological Comparison Morphological data was gathered for each individual in the form of leaf area, and leaf hair density. One to two representative leaves from each individual were used to make the measurements. Image J software was used to measure the area of each leaf. Photos that included a known size marker were taken of each leaf. An example of the pictures used to make the measurements is shown in Figure 12. These photos were uploaded to Image J, and the size marker was used to calibrate the ruler. The height of each leaf was measured from the base to the tip, down the middle. The width of each leaf was measured at the widest point. The length and width were then used to calculate the area of each leaf.

Figure 4: An example of the pictures used to make leaf measurements. Individual B4 is shown.

In order to determine the leaf hair density, a random number generator was used to generate three sets of random coordinates for each individual. Each leaf was then placed on a grid, and the three random points were marked. The leaf was then transferred to a dissecting microscope. A small frame that had an area of 4 mm2 was placed in the center of each point, and the number of hairs was counted. The number counted was divided by 4 to obtain a measurement in the units of hairs per mm2. The three measurements were averaged in order to obtain an estimate of hair density. Averages were calculated for each measurement for each individual, and grand averages were calculated for each group.

Results Internal Transcribed Spacer Analysis A Maximum Likelihood phylogenetic tree and a Maximum Likelihood phenogram were constructed using a sequence alignment of 14 Mirabilis ITS sequences, and one outgroup ITS sequence (Acleisanthes anisophy). Three of the sequences (M. rotundifolia, M. albida (B1), and

M. albida (B7)) were isolated and sequenced from collected individuals. All other sequences were obtained from the NCBI website. Bootstrap values were calculated for each node using 100 full search replicates. Nodes with bootstrap values over 50 have the value displayed. The phylogenetic tree is shown in Figure 13. At the top of the tree there is a highly supported clade

(bootstrap 96) that contains all of the newly isolated ITS sequences and the previously published

M. albida ITS sequence. This clade also contains a Mirabilis species that is native to the U.S.

Southwest and Mexico, M. coccinea. The two M. albida sequences (B1 and B7) obtained for this study grouped sister to each other in a clade within the larger highly supported clade previously described.Sister to this M. albida group is the already published M. albida sequence obtained from NCBI. M. rotundifolia grouped closer to M. coccinea and the previously published

sequence for M. albida than it did to the new M. albida sequences, although they are all in the same general highly supported clade. M. rotundifolia groups in a branch on its own and it appears that the M. albida clade branches off from the M. rotundifolia clade. The phenogram is shown in Figure 14. The phenogram shows the same relationships as the phylogenetic tree because they were both constructed using the same data set and a Maximum Likelihood method.

The difference with the phenogram is that the lengths of the branches reflect the evolutionary distances between individuals. The scale bar at the bottom of the phenogram means that specific length reflects 0.1 substitutions per base position. The branch lengths in the first clade containing most of the sequences of interest are very short in comparison to the rest of the branches in the tree. Table 3 shows a breakdown of the alignment statistics for all ITS sequences aligned. All sequences were queried against the M. rotundifolia ITS sequence. The table shows how many base pairs were aligned for each query, and how many of those were exact matches (identities), as well as how many substitutions occurred. The table also shows the number of gaps for each query. Gaps are areas that did not match well, and therefore were left out of the alignment. The

“expect” values on the table tell how many matches you would expect to see by chance in a database of a given size, the lower the expect value, the less likely the match was obtained by random chance. The smallest number of substitutions occurred between M. rotundifolia and M. coccinea, and all individuals of M. albida.

Figure 5: MaximumSequence Likelihood similarity phylogenetic tree of Mirabilis species with Acleisanthes anisopholy as an outgroup constructed from ITS sequence alignment. Highly supported nodes have bootstrap values shown. Sequences of interest are highlighted in red.

Figure 6: Maximum Likelihood phenogram of Mirabilis species with Acleisanthes anisopholy as an outgroup constructed using ITS sequence data. The sequences of interest are highlighted in red.

Table 4: The alignment statistics from the ITS sequence alignment for Mirabilis species.

Subject Query % Total bases Gaps Identities Substitutions Expect identity aligned Value

M.rotundifolia M.coccinea 99.142 466 3 462 4 0

M.rotundifolia M.albida 98.718 468 3 462 6 0

M.rotundifolia M.longiflora 96.129 465 1 447 18 0

M.rotundifolia M.jalapa 96.137 466 3 448 18 0

M.rotundifolia M.multiflora 95.914 465 1 446 19 0

M.rotundifolia M.expansa 95.708 466 3 446 20 0

M.rotundifolia M.himalaica 95.494 466 2 445 21 0

M.rotundifolia M.triflora 96.137 466 2 448 18 0

M.rotundifolia M.tenuiloba 95.914 465 1 446 19 0

M.rotundifolia M.greenei 95.699 465 1 445 20 0

M.rotundifolia M.alipes 95.699 465 1 445 20 0

M.rotundifolia M.rotundifolia 100 465 0 465 0 0

M.rotundifolia M. albida (B1) 99.14 465 1 461 4 0

M.rotundifolia M. albida (B7) 98.925 465 1 460 5 0

M.rotundifolia A.anisophylla 90.129 466 14 420 46 1.75E- 173

Inter Simple Sequence Repeat Analysis The primer that produced the best amplification patterns was primer 842 (see Table 1 for sequence). This primer amplified 204 total bands that ranged in size from 90 to 1,808 base pairs.

The conserved data matrix, which grouped bands into bins of 25 base pairs, had a total of 47 bands, and the bin sizes ranged from 75 to 1800 base pairs. Out of all the plant samples collected, ISSR profiles were obtained from 55 total individuals. There is at least one individual to represent each of the 13 groups. Table 4 shows all individuals for which ISSR profiles were obtained and analyzed. Figure 15 shows the distance phylogenetic tree made using the full data matrix. In all of the ISSR trees the individuals are color coded by group designations, which are 66

listed in Table 2. Bootstraps that showed high support are shown on their corresponding branches for all trees. The populations overall grouped in a more or less random fashion. There is a group of M. albida individuals from El Paso County (Group B) that grouped closely together near the top of the tree, and a group of M. linearis (Group C) near the bottom of the tree that also grouped closely together. The two groups of M. albida (Groups B and D) fall into clades with M. rotundifolia on many different branches. There are seven general areas in the tree that show M. albida being in the same clade as M. rotundifolia. Out of the seven three of them show close relationships between large M. rotundifolia individuals and M. albida individuals. These large individuals came from two groups (L and K), which do not show an obvious grouping pattern together. Groups E and F, which are smaller individuals of M. rotundifolia from Lake Pueblo do group together in a few spots. The M. rotundifolia from Fremont County is in a clade with one

M. albida from El Paso County, and two M. rotundifolia individuals of different sizes from

Juniper Breaks. M. multiflora fell into clades with itself and with M. rotundifolia that was found at Lake Pueblo State Park at the Juniper Breaks Campground. Figure 16 shows the parsimony tree made with the full data matrix. This tree shows the same topology as the distance tree, however branch lengths differ due to a different tree constructing method being used. On both trees made from the full data matrix, only two branches had bootstrap values over 50. The values differ for the distance and parsimony tree but the two branches are the same, the one that includes individuals A6 and L1, which are both M. rotundifolia, and the branch that includes C11 and E2. C11 is M. linearis and E2 is M. rotundifolia.

Table 5: All individuals for which ISSR profiles were obtained, separated by the groups shown in Table 2 Individuals by population A1 A2 A3 A4 A5 A6 B1 B2 B3 B4 B5 B6 B7 C4 C5 C10 C11 C12 C13 C14 D5 D6 D10 D11 D12 D13 E1 E2 E3 E4 E5 F1 F2 F3 F4 F5 G1 H1 I1 J1 K1 K2 K3 K4 K5 K6 L1 L2 L3 L4 M1 M2 M4 M5

Figure 7: Phylogenetic tree constructed from the full data matrix using the distance method. Individuals are color coded by group designation. The shaded boxes show an area of M. albida individuals in the same clade, a typical area of mixed individuals, and a grouping of M. linearis.

Figure 17 shows the phylogenetic tree constructed from the conserved data matrix using Figure 8: Phylogenetic tree constructed from the full data matrix using the parsimony method. Individuals are color coded by group designation. The shaded boxes represent areas with high bootstrap support. the distance method. As with the trees made from the full matrix, the conserved trees are both

color coded by the group designations found in Table 2. The clades of M. albida (Group B) that were closely grouped on the tree made with the full matrix are not quite as obvious in the conserved trees, although M. linearis (Group C) is still closely grouped. Many individuals from the same populations group very close to each other, however the majority of clades contain individuals from different populations and different species. There are multiple clades that contain mainly M. rotundifolia and one individual of either M. albida or M. multiflora. Three of the seven areas where M. albida is found in a clade with or nearby a M. rotundifolia individual show the relationship being with a large M. rotundifolia individual. As in the trees made from the full matrix, groups E and F are frequently in clades together, and they are both smaller individuals from around Lake Pueblo. These trees show individuals from the Juniper Breaks

Campground grouping more frequently with plants found near them physically rather than by plants around the same size. The M. rotundifolia sample from Fremont County fell into a clade with four M. rotundifolia individuals from all around Lake Pueblo, and one M. albida from

North Cheyenne Canyon. Five branches showed high bootstrap support. These branches were; the branch connecting A1 (M. rotundifolia) and D11 (M. albida), the branch connecting C5 to

C13 (both M. linearis), the branch connecting C12 (M. linearis) to F1 (M. rotundifolia), the branch connecting D6 to D12 (both M. albida), and the highest supported branch was the one connecting K4 (M. rotundifolia) to M2 (M. multiflora). Figure 18 shows the tree constructed from the conserved data matrix using the parsimony method. Once again, the topology is the same as the parsimony tree, which suggests the relationships are highly supported. The D6 to

D12 branch is the only one that shows high support on the conserved matrix parsimony tree.

Figure 9: Phylogenetic tree constructed from the conserved data matrix using the distance method. Individuals are color coded by group designation. The shaded boxes show a grouping of M. linearis and M. rotundifolia.

Morphological Comparison Figure 10: Phylogenetic tree constructed from the conserved matrix using the parsimony method. Individuals are color coded by group designation. The shaded box shows a highly supported relationship between two individuals from the same population.

Morphological Comparison

The morphological data collected for all individuals can be seen in Table 5. There was no morphological data available for Group I. Grand averages for each group are also shown in the table. Surprisingly, Group B, which is made up of M. albida, had the highest average hair density at 6.657 hairs/mm2. Groups A, D, H, and K were on the higher end of the hair density spectrum.

With the exception of Group D, these are all populations of M. rotundifolia. Group J had the lowest hair density at 0 hairs/mm2. Group M also had a very low density at 0.042 hairs/mm2.

Groups C, E, F, G, and L were all in the middle range of hair density. Group M, which is M. multiflora had the largest area at 56.4 cm2, followed by Group L (large M. rotundifolia, 28.7 cm2), Group B (M. albida, 25.6 cm2), Group K (large M. rotundifolia, 20.2 cm2), and Group D

(M. albida 19.3 cm2). The smallest groups were G (M. rotundifolia, 3.0 cm2), and C (M. linearis,

3.2 cm2). A, E, F, and H (all M. rotundifolia) were in the middle range of all the leaf areas.

Group averages for leaf area and hair density are also represented graphically in Figures 19 and

20. Group B by far had the highest hair density, and it was left out of Figure 20 to make differences between other groups more obvious.

Table 6: All morphological data collected for each individual in the study. Areas and densities refer to leaves. Individual Species Average Height Average Average Average Hair (cm) Width Area (cm2) Density (cm) (hairs/mm2) A1 rotundifolia 1.911 1.807 3.453 4.667

A2 rotundifolia 1.675 1.282 2.147 0.083

A3 rotundifolia 3.186 2.772 8.829 0.167

A4 rotundifolia 2.476 2.519 6.236 0.333

A5 rotundifolia 2.091 1.832 3.830 0.333

A6 rotundifolia 1.361 1.735 2.361 0.083 Group A 2.117 1.991 4.214 0.945 B1 albida 7.611 3.196 24.325 7.750

B2 albida 7.140 3.732 26.646 3.167

B3 albida 6.473 3.469 22.455 1.417

B4 albida 6.153 2.342 14.410 8.000

B5 albida 6.868 2.256 15.494 7.750

B6 albida 5.527 2.947 16.288 1.500

B7 albida 6.282 2.016 12.665 5.167

B8 albida 4.487 2.780 12.474 8.000

B9 albida 2.596 1.578 4.096 7.167

B10 albida 5.429 2.344 12.726 2.833

B11 albida 11.851 5.062 59.981 5.583

B12 albida 11.027 3.520 38.810 7.083

B13 albida 9.097 4.273 38.869 11.417

B14 albida 11.071 3.116 34.490 5.500

B15 albida 9.761 4.396 42.907 7.917

B16 albida 9.368 2.938 27.523 3.667

B17 albida 11.365 3.596 40.867 6.167

Individual Species Average Height Average Average Average Hair (cm) Width Area (cm2) Density (cm) (hairs/mm2)

B18 albida 10.486 2.177 22.828 0.000

B19 albida 9.746 2.756 26.854 7.250

B20 albida 10.352 3.335 34.524 0.000

B21 albida 8.011 2.957 23.685 14.500

B22 albida 11.088 4.115 45.620 14.250

B23 albida 8.378 2.935 24.588 12.417

B24 albida 5.612 2.715 15.237 12.667 B25 albida 8.330 3.773 31.427 5.250 Group B 8.164 3.133 25.577 6.657 C1 linearis 9.582 0.635 6.079 0.167

C2 linearis 8.568 0.467 4.001 0.250

C3 linearis 9.043 0.509 4.603 0.417

C4 linearis 8.540 0.551 4.706 0.083

C5 linearis 5.920 0.369 2.184 0.000

C6 linearis 8.909 0.393 3.497 0.167

C7 linearis 6.345 0.296 1.875 0.417

C8 linearis 8.314 0.331 2.752 0.000

C9 linearis 7.974 0.374 2.982 0.333

C10 linearis 8.596 0.568 4.882 0.333

C11 linearis 8.238 0.154 1.269 0.000

C12 linearis 10.930 0.290 3.164 0.000

C13 linearis 9.884 0.252 2.486 0.000

C14 linearis 10.916 0.270 2.947 0.250

C15 linearis 8.824 0.271 2.387 0.083

C16 linearis 6.490 0.249 1.613 1.750

Individual Species Average Height Average Average Average Hair (cm) Width Area (cm2) Density (cm) (hairs/mm2) Group C 8.567 0.373 3.199 0.266 D1 albida 13.058 4.387 57.277 0.250

D2 albida 6.611 2.112 13.958 0.167

D3 albida 7.590 2.621 19.893 0.083

D4 albida 9.405 4.465 41.991 3.417

D5 albida 8.677 2.569 22.287 1.000

D6 albida 6.442 2.159 13.905 1.667

D7 albida 5.395 1.895 10.220 2.250

D8 albida 7.994 2.917 23.313 0.083

D9 albida 8.060 3.572 28.790 1.667

D10 albida 4.813 2.122 10.213 0.000

D11 albida 5.446 1.981 10.786 0.000

D12 albida 6.389 1.998 12.764 0.417

D13 albida 4.509 1.733 7.814 1.417 Group D 7.260 2.656 19.284 0.955 E1 rotundifolia 5.998 4.426 26.545 0.417

E2 rotundifolia 2.559 2.226 5.696 0.000

E3 rotundifolia 4.046 3.327 13.459 0.000

E4 rotundifolia 2.121 1.829 3.879 0.250

E5 rotundifolia 4.297 4.210 18.086 0.000 Group E 3.804 3.203 12.186 0.133

F1 rotundifolia 3.721 3.186 11.855 0.917

F2 rotundifolia 3.285 2.957 9.711 0.167

F3 rotundifolia 2.895 2.639 7.638 0.083

F4 rotundifolia 2.983 3.245 9.678 0.083

Individual Species Average Height Average Average Average Hair (cm) Width Area (cm2) Density (cm) (hairs/mm2) F5 rotundifolia 6.174 4.911 30.318 0.000 Group F 3.811 3.387 12.910 0.250 G1 rotundifolia 1.680 1.789 3.006 0.417 Group G 1.680 1.789 3.006 0.417 H1 rotundifolia 2.699 1.830 4.939 2.083 Group H 2.699 1.830 4.939 2.083 J1 rotundifolia 2.637 2.011 5.302 0.000 Group J 2.637 2.011 5.302 0.000

K1 rotundifolia 3.340 3.091 10.321 1.000

K2 rotundifolia 5.431 5.189 28.176 0.667

K3 rotundifolia 3.791 3.063 11.610 1.000

K4 rotundifolia 5.231 4.500 23.537 0.917

K5 rotundifolia 5.908 4.512 26.652 0.333

K6 rotundifolia 5.960 5.036 30.015 1.050 Group K 4.943 4.232 20.917 0.828

L1 rotundifolia 5.609 3.967 22.246 0.500

L2 rotundifolia 6.314 5.591 35.298 0.833

L3 rotundifolia 5.270 4.656 24.532 0.000

L4 rotundifolia 6.350 5.294 33.611 0.583 Group L 5.885 4.877 28.700 0.479 M1 multiflora 7.192 8.011 57.612 0.000

M2 multiflora 7.158 7.975 57.081 0.000

M3 multiflora 8.108 7.726 62.638 0.250

M4 multiflora 10.121 8.915 90.224 0.000

M5 multiflora 5.573 5.505 30.677 0.000

Individual Species Average Height Average Average Average Hair (cm) Width Area (cm2) Density (cm) (hairs/mm2) M6 multiflora 7.029 6.918 48.623 0.000 Group M 7.530 7.508 56.535 0.042

Figure 11: Average leaf areas for all groups in the study. Standard error of the mean is represented by error bars.

Figure 12: Average hair density of leaves for all groups in the study. Standard error of the mean is represented by error bars. Group B had an average leaf hair density of 6.67 hairs/mm2, therefore its bar is out of the axis range of the chart. This axis format was chosen to display the measurements of the other groups more clearly. Figure 21 shows the distance tree constructed from the full data matrix color coded based on leaf hair density. For all trees coded by hair density (Figures 21-24) individuals that had hair densities between 0 and 0.9 hairs/mm2 are in green, those with hair densities between 1 and 6.9 hairs/mm2 are blue, and those with hair densities between 7 and 15 hairs/mm2 are red. Most individuals fell into the category with the smallest range of values, the low hair density category

(green). All individuals from population B (M. albida) had either medium or high hair density, and many of them group somewhat near each other at the top of the tree, and individuals B3, B5, and B7 are all right next to each other in the same clade. Individuals H1 and B1 had high to medium densities and are found in the same clade. B6 which had medium hair density is in a clade sister to the one that includes H1 and B1. A1 and B2 are also in the same clade near the bottom of the tree and they both had medium level hair densities. Figure 22 shows the parsimony tree constructed from the full data matrix. Since it has the same topology as the distance tree, the groupings based on hair density are the same as stated for Figure 21. Figure 23 shows the

distance tree constructed using the conserved matrix color coded based on hair density. B1 and

B5, which both had high hair densities, fall in a clade together at the very top. B2, which had medium hair density, is also in this clade, which is sister to a clade that has two other individuals with medium hair density, B6 and B7. The fourth individual with medium hair density to fall into this large group is B3, which is in a clade sister to the one containing B6 and B7. A1 and H1 both had medium hair densities and they are in a clade together near the bottom of the tree. B4 falls in a clade with low hair density individuals. Figure 24 shows the parsimony tree constructed from the conserved data matrix. Since it has the same topology as the distance tree, the relationships with respect to hair density are the same as stated for Figure 23.

Figure 13: Distance tree made with full data matrix color coded by hair density level in hairs/mm2. The shaded boxes show two areas where high density individuals group together.

Figure 14: Parsimony tree constructed using the full data matrix color coded by hair density level in hairs/mm2. The shaded box shows two medium density individuals, a M. rotundifolia and a M. albida. 83

Figure 15: Distance tree constructed from the conserved data matrix color coded by hair density level in hairs/mm2. The shaded box shows a broad area where individuals with high and medium densities are found.

Figure 16: Parsimony tree constructed from the conserved data matrix color coded by hair density level in hairs/mm2. The shaded boxes show two areas where medium and high density individuals are interspersed with low individuals.

Figures 25 and 26 show the distance and parsimony trees (respectively) that were constructed from the full data matrix, color coded by average leaf area. Individuals in green have average leaf areas in the range of 0-10.9 cm2, those in blue have average leaf areas between 11 and 30.9 cm2, and those in red have average leaf areas in the range of 31-90 cm2. These colors correspond to all trees that are color coded by average leaf area (Figures 25-28). On the two trees made from the full data matrix (Figures 25 and 26), there are some general patterns to be seen with respect to average leaf area. There are five total individuals that fell into the largest leaf area category, out of these five, four of them group into sister clades. M4 and M2 are sister to each other in a clade that is two clades away from another clade that contains L2 and L4, which are also in the largest leaf area category. The fifth large area individual groups near the top, away from the other four. The middle and low area categories fall into clades together in most cases, however there are some broad general trends to note. There is a highly supported clade near the middle of Figures 25 and 26 that contains all low area individuals, and it is sister to another clade that is also made up of only low area individuals. Near the top and the bottom of Figures 25 and

26 there are some broad groups of blue individuals which are in the medium area category. On the conserved matrix trees (Figures 27 and 28) L2, L4 and M1 group together (high area individuals), however M4 is now 2 clades away from these other individuals, and M2 is even further down the tree in a clade with a medium area individual. The general grouping of medium and low level individuals is not as obvious as it was in the full matrix trees, almost every clade has individuals from more than one area category. There is one clade that contains only low area individuals (A2, A5, and K1) near the middle of Figures 27 and 28, and a clade near the top has six medium area individuals and just one low area individual (A6). Generally there are some broad groupings of medium and low area individuals that can be seen in Figures 27 and 28.

Figure 17: Distance tree constructed from the full data matrix color coded by average leaf area in cm2. The shaded boxes point out the placement of the high area individuals relative to each other.

Figure 18: Parsimony tree constructed from the full data matrix color coded by average leaf area in cm2. The shaded boxes show groupings of individuals of the same species and same area category.

Figure 19: Distance tree constructed from the conserved data matrix color coded by leaf area in cm2. The shaded box points out an area of higher area individuals.

Figure 20: Parsimony tree constructed from the conserved data matrix color coded by leaf area in cm2. The shaded boxes show clades made exclusively of one area category.

Figures 29-32 show the ISSR phylogenetic trees color coded by the general geographic area the individuals were collected from. Individuals found at the Juniper Breaks Campground at

Lake Pueblo State Park (the majority of samples) are green, individuals found in Southwestern

El Paso County are blue, individuals found at North Cheyenne Canyon Park are red, the individual collected from the Northwestern edge of Lake Pueblo State Park is black, the individual found in Eastern Fremont County is orange, the individual grown in the CSU-Pueblo greenhouse is yellow, and the individual grown at the Colorado College outdoor garden is pink.

Figures 29 and 30 are the distance and parsimony trees (respectively) constructed from the full data matrix. There are many clades that are comprised of mainly individuals found at the Juniper

Breaks Campground (M. rotundifolia, M. multiflora), and the same trend is also evident for individuals found in Southwestern El Paso County (M. albida, M. linearis). The individuals of

M. albida from North Cheyenne Canyon are found spread throughout the tree, the only two that fall in the same clade are D11 and D6. The individual grown at the CSU-P greenhouse (M. rotundifolia) falls right in between these two individuals. The M. rotundifolia sample from

Fremont County falls in a clade with all M. rotundifolia individuals with the exception of B1, which is M. albida from El Paso County. The M. rotundifolia individual from Northwestern

Lake Pueblo is in a clade sister to the individual grown at the CC garden. All other individuals close to these two are M. rotundifolia from Juniper Breaks. Figures 31 and 32 are the trees constructed from the conserved data matrix. K4 which is M. rotundifolia from Juniper Breaks and M2 which is M. multiflora from the same area fall sister to each other, and in the distance tree (Figure 31) this is a very highly supported relationship. The individuals of M. albida from

Cheyenne Canyon are still spread throughout the conserved trees, however D6 and D12 are the individuals that group together with high support. Near the top of the tree there is a general

pattern of individuals from SW El Paso County being close together, and near the lower middle of the trees there is a decently sized area with only individuals from Juniper Breaks. The individual from the CSU-P greenhouse is found in a clade with all M. albida individuals, either from SW El Paso County or Cheyenne Canyon. The individual from NW Lake Pueblo is alone in a clade sister to an M. albida and M. rotundifolia from Juniper Breaks. The individual from

Fremont County fell very close to a Juniper Breaks M. rotunidifolia, and is sister to an M. albida from Cheyenne Canyon.

Figure 21: Distance tree constructed from the full data matrix and color coded by geographical area. The shaded boxes show two M. albida from N. Cheyenne Canyon and a grouping of M. rotundifolia from many locations. 93

Figure 22: Parsimony tree constructed from the full data matrix color coded by geographical area. The shaded box shows a grouping of M. rotundifolia from many different locations.

Figure 23: Distance tree constructed from the conserved data matrix color coded by geographical area. The shaded box shows a highly supported relationship of individuals from the same geographic area.

Figure 24: Parsimony tree constructed from the conserved data matrix color coded by geographical area. The shaded box shows and area of individuals of different species from the same area.

Discussion Internal Transcribed Spacer Analysis

Figure 13 shows the Maximum Likelihood phylogenetic tree constructed using a sequence alignment of Mirabilis ITS sequences, and Figure 14 shows the Maximum Likelihood phenogram constructed using the same sequence alignment. The tree (Figure 13) and the phenogram (Figure 14) have the same topology, which lends high support to the relationships shown. The lengths of the branches of the phenogram reflect the evolutionary distances between individuals, the scale bar is 0.1 substitutions per base position, and with the exception of the outgroup, no branches are as long as the scale bar. This suggests that although differences were found in the sequences, overall the ITS sequences of Mirabilis individuals are very similar. Also, the branch lengths in the clade containing the individuals of interest to this study are much shorter than they are in the second large clade, which means that the individuals in the clade containing M. albida and M. rotundifolia have very similar ITS sequences. There are generally two big clades in the tree and phenogram. The most interesting result shown is that all newly isolated ITS sequences from M. rotundifolia and M. albida fall together in a large clade that is very highly supported (bootstrap value of 96). The fact that these individuals group in a highly supported clade shows that M. rotundifolia and M. albida are at least more closely related to each other than they are to other species in the genus Mirabilis. In addition to M. albida and M. rotundifolia individuals, this clade also contains M. coccinea, which is a species native to the

Southwestern U.S. and Northern Mexico. In The Flora of North America, it states that M. coccinea is morphologically very similar to M. linearis. Reading the treatment further, there are many physical characteristics that are reminiscent of M. rotundifolia as well. It is likely that M. coccinea is a species that genetically is intermediate to M. linearis and M. rotundifolia, since M. 97

coccinea grouped closer to M. rotundifolia than it did to any M. albida individual. The two newly isolated M. albida sequences grouped sister to each other in a clade with relatively high bootstrap support (58), and sister to these two individuals is the previously published M. albida sequence. The fact that all of these M. albida individuals grouped together shows high support that M. albida is a well-defined species, genetically and morphologically, since physical characteristics were used to initially identify the species. When the large highly supported clade is broken down into smaller clades, M. rotundifolia actually falls into a small clade by itself, sister to M. coccinea and the previously published M. albida sequence. The clade containing the

M. albida sequences branches off of the clade that only contains M. rotunidifolia, which suggests some genetic separation between the two groups. In 2000, a study done by Levin analyzed chloroplast and nuclear genomes of Mirabilis species and found that M. greenei and M. multiflora are sister to each other in the same clade. The clade including these three species was weakly supported according to a bootstrap analysis, however the three do share some unique morphological characteristics. In the ITS tree created in this study, M. multiflora is not sister to

M. greenei, which shows the importance of analyzing more than one molecular marker to get a better idea of species relationships.

Table 3 shows the ITS alignment statistics, comparing each sequence to the newly isolated M. rotundifolia sequence. None of the sequences were identical (except when M. rotundifolia was queried against itself obviously), which shows that these species are not clonal.

This is particularly relevant to the two newly isolated M. albida sequences, since they were actually growing in close proximity to each other. Although the sequences of all individuals in the first clade are very similar, they are not identical, which suggests there is some level of detectable genetic variation. Between all individuals in the highly supported clade, there was an 98

average of 4.75 substitutions in the entire ITS sequence. This is much less than when the M. rotundifolia sequence was queried against individuals from the second large clade, which gives even more support to the contention that all individuals in the M. rotundifolia clade are more closely related to each other than they are to the rest of the genus analyzed. In general, the ITS trees show that M. albida and M. rotundifolia are very closely related relative to the rest of the genus. The tree also shows evidence that this genus is in the early stages of evolution, which is probably why genetic studies of Mirabilis are so cumbersome. The ITS region in Mirabilis species has not evolved fast enough thus far to draw any solid conclusions about the designation between M. rotundifolia and M. albida, although there is valuable information to be taken from the trees. The evolution of the ITS region, however does seem to have gone further when M. rotundifolia is compared to species other than M. albida, which lends more support to the fact that these species are likely in the process of diverging from each other evolutionarily.

Inter Simple Sequence Repeat Analysis

Figures 15 and 16 show the trees constructed from the full ISSR data matrix. The trees show the same topology, which once again shows high support for the relationships represented, since two statistical methods used resulted in the same relationships. On the distance tree and the parsimony tree the same two branches were the only two to show high bootstrap support. One of these branches leads to a clade containing individuals A6 and L1, which are both M. rotundifolia individuals found at Lake Pueblo State Park at the Juniper Breaks Campground. This is an expected result since the geographical area and the presumed species designation were the same for these two individuals. It was not expected that the branch leading to the clade containing C11 and E2 would also have high support. C11 is M. linearis from El Paso County, and E1 is M.

rotundifolia from Juniper Breaks. This is not the only unexpected result seen in the ISSR full matrix trees, overall the trees show that the populations group more or less randomly. There are some general trends to make note of. Near the top of the tree many of the M. albida individuals from population B (El Paso County) group near each other, although one individual (B2) is found very far away near the bottom of the tree. There is also a very highly supported clade near the middle of the trees that contains mainly M. linearis individuals (population C) together in a highly supported clade. Right below this there are many individuals from population A (M. rotundifolia) that group very closely together. There are seven general areas of the full matrix trees where an M. albida individual falls in a clade with a M. rotundifolia individual. M. rotundifolia individuals from Juniper Breaks were separated based on size, to determine if larger individuals were more genetically similar to M. albida than were the more typical smaller individuals. Out of the seven areas where M. albida groups with M. rotundifolia, three of them show close relationships between large M. rotundifolia individuals and M. rotundifolia. The groups of larger M. rotundifolia individuals were groups L and K, and the smaller individuals were found in groups E and F. L and K do not show any grouping patterns together, but E and F do group together in a few places. Overall, the size of the M. rotunidfolia individual does not seem to affect how genetically similar it is to any M. albida individual, or to any other M. rotundifolia of a certain size. The fact that the M. rotundifolia individual found in Fremont

County grouped with M. rotundifolia from Juniper Breaks and also with an M. albida from El

Paso County shows that even with a large geographical separation, individuals of both species are still very similar with respect to their ISSR profiles. It was expected that M. multiflora individuals from Juniper Breaks would group together, and they did in some areas, but in others

M. multiflora grouped with M. rotundifolia from Juniper Breaks. This is interesting because the

100

ITS trees showed M. rotundifolia and M. multiflora being relatively distant relatives with respect to the ITS sequences. This is evidence that the ISSR markers are more quickly evolving areas than the ITS region is. Unlike the ITS analysis, where not enough variation was detected, the

ISSR regions vary almost too much to make any kind of concrete species designation. This also shows that even between distantly related Mirabilis species, there is a high amount of hybridization happening when they are found growing in close proximity to each other. High amounts of hybridization promotes genetic homogeneity, which is a likely explanation for the seemingly random grouping of the individuals of different presumed species.

Figures 17 and 18 are the distance and parsimony trees constructed using the conserved data matrix. These trees reduce the chance that scoring error and non-homologous bands are affecting the topology of the trees by combining similar sized bands into the same bins. Some of the general patterns seen in the full matrix trees (particularly the Group B cluster near the top of

Figures 15 and 16) is more spread out in the conserved trees. The grouping of individuals from

Group C is still evident in the conserved trees, however one individual (C12) is no longer in this group in Figures 17 and 18. The clades of Group A individuals is also lost in the conserved trees.

These results show that when bands are combined, some variation is lost, however there is still such a vast amount of variation between individuals that no extremely obvious patterns arise.

The tree is mostly grouped randomly with respect to which groups individuals came from, which lends more support to the fact that ISSR markers are very quickly evolving in this genus, and show so much variation that solid conclusions are difficult to draw. As in the full matrix trees, only three of the seven clades where M. rotundifolia groups with M. albida show close relationships between larger M. rotundifolia individuals (Groups L and K) and M. albida individuals. This suggests that the size of M. rotundifolia does not reflect how closely related it is

101

to M. albida, genetically speaking. Based on the grouping patterns of individuals from the same physical area, but of drastically different size, it appears that individuals closer to each other group together more often than individuals of similar size. This result shows the importance of hybridization in this genus. Plants that are closer to each other share more genes, and are therefore more related than plants that look more similar. As expected, more branches on the distance conserved tree had high bootstrap support than on the full matrix trees. What was not expected is which branches had high support. Two out of five of the highly supported branches connected individuals from the same group (one from group C and one from group D). The other three branches all connected M. rotundifolia individuals to individuals of other presumed species. One was a branch that led to a clade of M. rotundifolia and M. linearis, the other connected an M. rotundifolia to an M. albida from North Cheyenne Canyon, and the most highly supported branch connected an M. rotundifolia to an M. multiflora (both from Juniper Breaks).

Once again the data lend support to the fact that hybridization is the factor most effecting the genetic makeup of Mirabilis individuals with respect to ISSR molecular markers. The parsimony conserved tree (Figure 18) only had one highly supported branch and it led to a clade containing two individuals from Group D, which is an expected result.

Considering all ISSR trees, the data basically shows that ISSR markers are too quickly evolving to use them to make an accurate species designation between M. rotundifolia and M. albida. No two ISSR profiles were identical, and too much variation was detected to be able to group individuals into specific species. Although the variation detected was too much to cluster individuals based on their group designation, there are some valuable findings to be taken from the ISSR trees. The fact that M. rotundifolia and M. multiflora group together in all the trees, and with high bootstrap support, shows that, without a doubt, the rate of hybridization is very high

102

between individuals in this genus regardless of which species they are. The M. multiflora individuals were all collected from areas that had an M. rotundifolia individual very nearby, whereas when collecting M. rotundifolia, even from the same population, individuals right next to each other were avoided to try and get the most representative sample possible. Based on

ISSR markers M. rotundifolia and M. albida appear to be very closely related species, with the potential to hybridize which creates very similar ISSR profiles.

Comparison of ISSR Data with Morphological and Physical Data Hair density and leaf area were calculated for all collected individuals, and ISSR trees were color coded based on leaf hair density, leaf area, and general geographic location. Based on prior research and observation, it was expected that M. rotundifolia individuals would have the highest leaf hair density and the lowest leaf area, and that M. albida would have moderate leaf hair density and the highest leaf area. It was unexpected that Group B, which is M. albida, would have the highest average leaf hair density of all the groups. The other M. albida group, Group D, was also one of the groups with the highest leaf hair density, along with three M. rotundifolia groups, Groups A, H, and K. It was also unexpected that the group with the lowest leaf hair density would be a group of M. rotunidifolia (Group J). It was expected, however, that Group M

(M. multiflora) had the highest leaf area, since M. multiflora is typically a much larger plant than any of the other species in this study. Groups K and L, the large M. rotundifolia individuals found at the Juniper Breaks Campground, had higher average leaf areas than did the M. albida

Group D, and Group L actually had the second highest average leaf area. It was expected that a definite morphological pattern would be seen, dividing groups of species by measuring their average leaf hair density and average leaf area. It turns out that when populations are averaged and compared, there is a large amount of morphological variation that exists within and between

103

the currently accepted species boundaries. Based on the data with respect to the aim of this study, it does not appear that the chosen morphological characteristics are good predictors of species identity.

Figure 21 shows the ISSR full matrix distance tree color coded by average leaf hair density. Even though the category represented in green (lowest leaf hair density) by far had the smallest range of values (0-0.9 hairs/mm2), the majority of all individuals on the ISSR tree fell into this category. This shows that overall the leaf hair density of Mirabilis individuals of many species in Southern Colorado was very low during the times of collection. Because most all individuals fell into the low density category, they group together in many spots on both full matrix trees (Figures 21 and 22). What is more interesting to look at is where the few individuals in the blue and red categories (medium and high leaf hair densities respectively) fall on the trees.

There are some obvious groupings of medium and high hair density individuals on the full matrix trees, particularly the cluster of Group B individuals near the top and middle of the trees, and the clade at the bottom of the trees showing A1 and B2 (both medium hair densities) being sister to each other. The full matrix trees show that individuals with high and medium leaf hair densities do cluster together in many spots when ISSR profiles are used to construct a phylogeny.

The conserved matrix ISSR trees were also color coded based on average leaf hair density of individuals (Figures 23 and 24). In the two conserved trees many individuals from

Group B with either high or medium densities fall either in the same clade or into sister clades.

This does not hold true for B4 which groups far from the other Group B individuals amongst low hair density individuals. The only other two individuals with medium level leaf hair density are

A1 and H1, and they are in sister clades near the bottom of the trees. Overall, as in the full data matrix trees color coded based on leaf hair density, individuals with high and medium hair 104

density group near each other frequently. This pattern implies that to an extent leaf hair density is somewhat associated with ISSR patterns, or vice versa. Although there are subtle patterns to be seen in the leaf hair density trees, the patterns are not as concrete as was expected. Most of the clades contain individuals from more than one of the three hair density groupings. According to

ISSR marker patterns, hair density likely has some linkage to genetics, but it is not strong enough to use this characteristic to make accurate species designations.

The ISSR trees were also color coded based on the average leaf area of the individuals.

The leaf area categories were created with the goal of making patterns in the tree visible. Figures

25 and 26 are the full data matrix trees color coded by average leaf area. Four out of five of the individuals with high leaf areas (red) fall either in the same clade as another high area individual, or in a clade sister to another clade that contains a high area individual. M1 fell into the high leaf area category, and unexpectedly it fell into a clade away from all the other high area individuals near the top of the tree. The fact that four of these high area individuals group together lends confidence to the fact that ISSR markers are associated with leaf area, however this conclusion is strained by M1 being so far away from the others. Near the middle of the tree there is a relatively highly supported clade (bootstrap 51) that contains only low leaf area individuals, and it is sister to a clade that also is made exclusively of low area individuals. There is also a clade near the top of Figures 25 and 26 that contains only medium level individuals. Many of the medium level individuals are concentrated near the top of these trees. In all other clades low leaf area individuals are in clades with individuals in the medium level category. These data indicate that individuals with low leaf areas had ISSR profiles that were just as similar to medium area individuals as they were to other low area individuals. High leaf area individuals have similar

ISSR profiles according to the full matrix trees.

105

Figures 27 and 28 are the ISSR trees constructed from the conserved data matrix, color coded based on average leaf area. On the conserved trees, all five high leaf area individuals are now together near the bottom of the tree. All five individuals are either in the same clade as another high area individual, or in a clade sister to another high area individual. This is more evidence that high area individuals have similar ISSR profiles. The evidence for this conclusion is stronger in the conserved trees, where all five high area individuals are near each other. As far as the grouping of medium and low area individuals, the conserved trees show them mixed together in almost all clades. There is one clade that has a highly supported branch (bootstrap 50) near the top of the tree that has mostly medium area individuals. Based on all the trees color coded by average leaf area it seems that the higher the average leaf area, the more correlation that there is to be seen with respect to ISSR profile similarity. High leaf area individuals group together more strongly, and low area individuals never group together exclusively, with medium level individuals falling in between the two extremes.

Figures 29-32 are the ISSR trees color coded by geographic area. These trees were created to determine if general geographic position has any influence on the similarity of ISSR profiles. Most individuals in the study were collected from the Juniper Breaks Campground at

Lake Pueblo State Park. Four of the geographic areas only had one representative individual for which an ISSR profile was obtained. Figures 29 and 30 are the trees constructed from the full data matrix. The most obvious trends in these trees are that many individuals from Juniper

Breaks (green) group together in clades all over the full matrix trees. These groupings could be due to highly similar ISSR profiles, but they also could be due to the fact that most individuals are from this area, so naturally there will be many places that they group together. There are also many areas where individuals from Southwestern El Paso County (blue) group together. Near the

106

middle of the tree one of these groupings is highly supported (bootstrap 51) and is made of mostly M. linearis from SW El Paso County. Besides one clade, individuals from North

Cheyenne Canyon are spread throughout the tree and hardly group together. Individuals from areas with only one sample (all are M. rotundifolia) for the most part group with individuals from Juniper Breaks (mostly M. rotundifolia). This could be because they have similar ISSR profiles but it can’t be ruled out that these groupings are due to the fact that so many individuals are from Juniper Breaks.

Figures 31 and 32 are the conserved matrix trees color coded by geographic area. In these trees D6 and D12, which are from North Cheyenne Canyon, are sister to each other, and in both the distance and parsimony trees the relationship is highly supported (bootstrap 58 and 50).

Besides this relationship the North Cheyenne Canyon individuals are spread throughout the tree with no grouping patterns. At the very top of the tree and near the middle of the tree there are close groupings of individuals from SW El Paso County. The one near the top is mostly Group B and the one near the middle is mostly Group C, however the clades are not exclusively made of either group. As mentioned for the full matrix trees, there are clades that contain mainly Juniper

Breaks individuals, however these groupings could be due to the high number of samples from

Juniper Breaks, and not due to ISSR profile similarity. In the full matrix trees, many of the M. rotundifolia individuals from areas with only one sample fell into clades with other M. rotundifolia individuals. When the conserved matrix was used these individuals group with M. albida individuals more than they actually group with other M. rotundifolia individuals.

Considering that the conserved matrix reduces the chances of incorrectly scoring bands, these relationships have more confidence attached to them. The fact that in the conserved trees M.

107

albida groups with M. rotundifolia from all over Southern Colorado is in support of the statement by Dr. Spellenberg that, genetically, they could be the same species.

Conclusions Relationship between M. albida and M. rotundifolia Based on ITS data The Internal Transcribed Spacer tree and phenogram (Figures 13 and 14) have the exact same topology, which makes the relationships shown very highly supported. Based on the branch lengths of the ITS phenogram (which reflects rate of base substitution), it can be concluded that in the genus Mirabilis the ITS sequences are very similar between species. The branch lengths in the clade that contains M. albida and M. rotundifolia are particularly short, which means that the individuals in this clade have extremely similar ITS sequences. Although the sequences are very similar, none are identical (see Table 3) which indicates that there is sequence variation present in these individuals. The fact that no ITS sequences are identical also indicates that these populations are not behaving in a clonal manner, but are instead reproducing sexually. The clade that contains all M. albida and M. rotundifolia ITS sequences is a very highly supported clade

(bootstrap 96), so the confidence in these relationships is very high. It can be concluded with high confidence that M. rotundifolia and M. albida are more closely related to each other than they are to other species in the genus. This conclusion is supported by the alignment statistics in

Table 3. The average amount of substitutions in the highly supported clade was 4.75, which is much less than when the M. rotundifolia sequence was queried against the Mirabilis individuals in the second large clade. It was a surprise that M. coccinea fell into this clade of otherwise expected relationships. Based on morphological treatments and the data from this study, M. coccinea could be a genetic intermediate between M. rotundifolia and M. linearis. Unfortunately, an ITS sequence for M. linearis was not available, which would have shed more light on this

108

relationship. Another conclusion that can be drawn from the ITS analysis is that M. albida is a very well defined species. The three M. albida individuals are all right next to each other, and the two newly isolated M. albida sequences are sister to each other with very high bootstrap support.

This implies that M. albida is a very well established species genetically, and also morphologically because phenotypic characteristics were used to make the initial species designations. The ITS trees suggest that there is some genetic separation between M. albida and

M. rotundifolia when the large clade is broken down into smaller clades. When this is done M. rotundifolia is in its own clade, and the M. albida clade branches off of the M. rotundifolia clade.

This separation of clades indicates that these two species are either genetically separate, or that they are in the process of becoming genetically separate. Based on all of the data present in the

ITS trees, the main conclusion that can be drawn is that the ITS region in individuals of the genus Mirabilis is either very slowly evolving, or is still in the process of evolving. In general all of the ITS sequences of Mirabilis species are very similar, however the sequences of M. rotundifolia and M. albida are especially similar. Currently the ITS regions do not suggest that there is an indisputable amount of genetic variation that would warrant these two species to be considered separate. It is very possible, however, that the ITS region, and the genomes of the species in general, are in the process of speciation, and one day plenty of genetic variation could very well exist to say without a doubt that M. albida is not the same species as M. rotundifolia.

Relationship between M. albida and M. rotundifolia Based on ISSR data Figures 15 through 18 show the distance and parsimony phylogenetic trees constructed from both the full and the conserved data matrix (respectively). Both tree constructing methods showed the same topology when the same data matrix was input. This fact lends confidence to the relationships shown in the trees. It was expected that individuals in the same group would

109

have similar ISSR profiles, and therefore would fall near each other on the trees. In most cases this trend was not found on the ISSR trees. There are some areas where individuals from the same group fall into clades with each other, but in most cases the groups are spread throughout the tree. The majority of the clades also contain members of different presumed species. There were two branches on the full matrix ISSR trees with notable bootstrap values, one was leading to a branch containing two M. rotundifolia individuals, but the other leads to a branch containing an M. rotundifolia and an M. linearis. It was unexpected that a high bootstrap value would be associated with such a relationship. The most obvious relationships that can be seen in the ISSR trees are groupings of population B (M. albida) and C (M. linearis). There are multiple branches on the trees that show an M. albida individual being sister to an M. rotundifolia individual. The seemingly random grouping and unexpected trends of the ISSR trees do not lend support to the hypothesis that M. albida and M. rotundifolia are separate species. They also don’t separate any of the species nicely, so overall the results are inconclusive.

There were groups of M. rotundifolia that were broken up by size to determine if larger individuals were more similar to M. albida than the smaller individuals were. The trees show no evidence that larger M. rotundifolia individuals are more similar (with regards to ISSR profiles) to M. albida individuals or to each other. It was expected that M. multiflora individuals would group all together, but the trees showed many branches where M. multiflora grouped with M. rotundifolia found in the same area. This is evidence that there is a good deal of hybridization is occurring between even distantly related Mirabilis species. The main conclusion that can be drawn from the ISSR trees is that the ISSR markers are too rapidly evolving in this genus to be of much use taxonomically. There is so much variation present in even the conserved ISSR data matrix that it is difficult to make any concrete conclusions regarding species designation. Based

110

on these data it does not appear that M. rotundifolia and M. albida can be differentiated from

ISSR markers. None of the ISSR profiles were identical. However no patterns were able to be detected which would support the hypothesis that M. albida and M. rotundifolia are separate species.

Physical factors that reflect genetic patterns All ISSR trees were color coded based on average leaf area, average leaf hair density, and general geographic area. It was expected that trends would arise showing that individuals who shared one or more of these character states also shared clades on the ISSR trees. At the beginning of the study, it was hypothesized based on field sightings and current treatments that

M. rotundifolia would have smaller leaf area and have a higher leaf hair density that M. albida did. Based on only the averages for all groups of the measurements of these characteristics, it was found that a great deal of variation exists in this genus. When the measurements are averaged, there is a lot of overlap between species. Average leaf area and hair density do not appear to be efficient predictors of species identity.

The color coded ISSR trees showed more trends for average leaf hair density than for average leaf area. Although more trends were visible for hair density, there were still not as many trends or as strong of trends as was expected. Also, the fact that most of the individuals on the hair density ISSR trees belonged in one category could be the reason that more individuals of the same category grouped together on this tree than on the leaf area ISSR tree. It can be concluded that these morphological characteristics, particularly hair density, likely have genetic connections, however there are more factors coming into play. It seems that as far as these parameters are concerned this genus shows a low heritability of phenotypic traits (Cabrita 2001).

111

The ISSR trees were also color coded by general geographic area to try and determine how physical proximity related to ISSR profile similarity. There were clades that showed individuals from The Juniper Breaks Campground being closely related to each other and individuals from Southwest El Paso County being closely related to each other. The fact that most individuals in the study were from Juniper Breaks could have an effect on how often these individuals fall into clades together, however there are still many sister clades containing El Paso

County individuals. Other groups such as group D were spread all throughout the tree. Although there are many clades that show unexpected relationships, the highest number of trends out of all of the color coded ISSR trees are seen on the geographic area trees. This evidence leads to the conclusion that hybridization and gene sharing are more of a factor on the similarity of ISSR profiles than leaf area or leaf hair density are.

Future directions There are many future studies that could shed more light on the question of whether M. rotundifolia and M. albida are genetically separate species. One of the simplest things that would be useful in answering this question would be to isolate and sequence the ITS region of a local

M. linearis individual. This would be useful because M. coccinea is morphologically similar to

M. linearis, and finding out where they would fall in relation to each other on a phylogenetic tree could shed more light on this question. It would also be useful to see where M. linearis falls on the tree in relation to M. albida and M. rotundifolia. The genus Mirabilis is notoriously difficult to arrange taxonomically based on morphological or genetic characteristics, and the ITS part of this study lent more evidence to that fact. A more in depth sequence analysis could help to clear up species identities. Sequencing the entire chloroplast genomes of individuals from both species

112

would be an appropriate further direction. It would also be wise to sequence genomes from multiple individuals and compare consensus sequences rather than individual sequences.

A different type of genetic marker could also be analyzed to try to determine if these two species are the same or different. The main goal of finding a new molecular marker to use would be to find one with the appropriate level of variation. Too little or too much variability between markers makes species designations hard to make. ISSR markers were too variable to make any concrete conclusions, but perhaps microsatellite markers could be more useful. Sequence information would be needed to create primers. This information could be obtained either through sequencing many parts of the genome or by probing the microsatellite sequences and determining their flanking sequences. These markers may help to either separate or unite these species genetically.

A different type of study that could be done in the future is a transplant study. Planting

M. albida in a shale soil typical of the Arkansas River Valley, and M. rotundifolia in a more normal and general soil could provide valuable information. The effect of different soil compositions on the phenotype of the two species would be very interesting information to include in this study. The change in the phenotype, if any, of both species could be recorded and this could say a lot about the relatedness of these plants. If M. albida grown in shale soil turned out to be more hairy and smaller, then perhaps they are the same species, just adapted to different habitats. On the other hand, if the species looked physically the same no matter which soil they were grown in, this would lend evidence to the hypothesis that they are separate species. Many transplant studies have been done to explore the effect of habitat on plastic phenotypic traits. The main question trying to be answered with this type of study is whether or not the observed plasticity of traits is associated with certain environments. These studies aim to determine 113

whether those plastic traits are adaptive to a certain environment. In 2011, Haggerty and

Galloway from Virginia published a transplant study with a similar goal. This study took

Campanulastrum americanum from two different elevations, to determine how a lengthened growing season (the lower elevation) effects plastic phenotypic traits (Haggerty 2011). Many other studies similar to this one have been done for years, and it would be very interesting to incorporate a transplant study to address this issue.

The take home message from this study is really a three part one. The ITS data overall shows that M. rotundifolia and M. albida could definitely be separate species. The ISSR data overall is inconclusive. It can be said of this genus based on the ISSR data that there is a high amount of hybridization between species. The morphological analysis showed that phenotypic traits are highly variable for Mirabilis species, and they are poor predictors of genotypic characteristics. Generally more needs to be done to answer the question whether or not M. rotundifolia is a genetically unique species.

114

Bibliography

Anderson, J.L. 1996. Floristic Patterns on Late Tertiary Lacustrine Deposits in the Arizona Sonoran Desert. Madrono. 43. 255-272.

Center for Plant Conservation (CPC). National Collection Plant Profile: Mirabilis rotundifolia. Missouri Botanical Garden. Updated 5/20/2011. Retrieved from www.centerforplantconservation.org

Colorado Natural Heritage Program- Colorado State University, Fort Collins. 1999. Conservation Status Handbook. 3(2).

Cruden, R.W. 1973. Reproductive Biology of Weedy and Cultivated Mirabilis (Nyctaginaceae). American Journal of Botany 680:09.

Baldwin, Bruce G., et al. 1995. The ITS Region of Nuclear Ribosomal DNA: a Valuable Source of Evidence on Angiosperm Phylogeny. Annals of the Missouri Botanical Garden. 247- 277.

Bittrich V., and U. Kuhn. 1993. Nyctaginaceae. The Families and Genera of Flowering Plants. 473–486.

Bogle, A. L. 1974. The Genera of Nyctaginaceae in the Southeastern United States. Journal of the Arnold Arboretum. 55. 1–37.

Cockrell, T. D. and F. Garcia. 1898. Preliminary Note on the Growth of Plants in Gypsum. Science. 8. 119–121.

Douglas, Norman A. and Paul S. Manos. 2007. Molecular Phylogeny of Nyctaginaceae: Taxonomy, Biogeography, and Characters Associated With a Radiation of Xerophytic Genera in North America. American Journal of Botany. 94:5. 856-872.

Doyen, John T. and C. N. Slobodchikoff. 1974. An Operational Approach to Species Classification. Systematic Biology. 23.2. 239-247.

Edgar, Robert C. 2004. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Research. 32(5). 1792-97.

115

Escudero, A., R. C. Somolinos, J. M. Olano, and A. Rubio. 1999. Factors Controlling the Establishment of Helianthemum squamatum, an Endemic Gypsophile of Semi Arid Spain. Journal of Ecology. 87. 290–302.

Ft. Carson Public Affairs Office. September 6, 2011. Fort Carson finalizes Conservation Easement. U.S. Army official homepage. Retrieved October 8, 2014.

Guindon S., Dufayard J.F., Lefort V., Anisimova M., Hordijk W., Gascuel O. 2010. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Systematic Biology. 59(3). 307-21.

Gupta M., Chyi Y-S, Romero-Severson J, Owen JL. 1994. Amplification of DNA Markers from Evolutionarily Diverse Genomes Using Single Primers of Simple-Sequence Repeats. Theoretical and Applied Genetics. 89. 998-1006.

Gupta, A., et al. 2011. Isolation of Genomic DNA Suitable for Community Analysis from Mature Trees Adapted to Arid Environment. Gene. 487(2). 156-159.

Haggerty, B.P., and Galloway L.F. 2011. Response of Individual Components of Reproductive Phenology to Growing Season Length in a Monocarpic Herb. Journal of Ecology. 99. 242-253. Doi: 10.1111/j.1365-2745.2010.01744.x

Halward T., Stalker T., LaRue E., Kochert G. 1992. Use of Single Primer DNA Amplifications in Genetic Studies of Peanut (Arachis hypogaea L.). Plant Molecular Biology 18. 315- 325.

Hayward, Jeremy, and Nicole A. Hynson. 2014. New Evidence of Ectomycorrhizal Fungi in the Hawaiian Islands Associated with the Endemic Host Pisonia sandwicensis (Nyctaginaceae). Fungal Ecology 12. 62-69.

Heimerl, A. 1889. Nyctaginaceae. Die Natu¨rlichen Pflanzenfamilien. 14–32. Engelmann, Leipzig, Germany.

Heimerl, A. 1934. Nyctaginaceae. Die Natu¨rlichen Pflanzenfamilien. 86–134. Engelmann, Leipzig, Germany.

Integrated Taxonomic Information System on-line database, http://www.itis.gov. Mirabilis coccinea.

116

Johnston, I. M. 1941. Gypsophily Among Mexican Desert Plants. Journal of the Arnold Arboretum. 22. 145–170.

Kantety, Ramesh V., et al. 1995. Assessment of Genetic Diversity in Dent and Popcorn (Zea mays L.) Inbred Lines Using Inter-Simple Sequence Repeat (ISSR) Amplification. Molecular breeding. 1.4. 365-373.

Kelso, S., K. Heckman, J. Lawton, and G. Maez. 1995. Endemic Calciphiles of the Middle Arkansas Valley, Colorado. Proceedings of the 2nd Southwestern Rare Plant Conference. Flagstaff, AZ. 270-280 in J. Maschinski et al., editors, USDA Forest Service, General Technical Report RM-GTR-283.

Kelso, S. Bower, NW. Heckmann, KE. Beardsley, PM. Greve, D G. 2003. Geobotany of the Niobrara chalk barrens in Colorado: A study of edaphic endemism. Western North American naturalist. 63:3. 299.

Kruckenberg, A.R. 1969. Soil Diversity and the Distribution of Plants, with Examples from Western North America. Madroiio. 20. 129-154.

Kruckenberg, A. R. 1986. The Stimulus of Unusual Geologies for Plant Speciation—an Essay. Systematic Botany. 11. 455–463.

Levin, Rachel A. 2000. Phylogenetic Relationships Within Nyctaginaceae tribe Nyctagineae: Evidence from Nuclear and Chloroplast Genomes. Systematic Botany. 25.4 738-750.

Loomis, W. E. 1944. Effect of Heavy Applications of Gypsum on Plant Growth. Plant Physiology. 19. 706–708.

Mason, H.L. 1946. The Edaphic Factor in Narrow Endemism. I. The nature of Environmental Influences. Madrono. 8. 177-208.

Mayo, Ellen, and Anderson, David. 2004. Management Guidelines for Species at Risk on Department of Defense Installations. DoD Legacy Project #03-154. Provided by NatureServe to the U.S. Fish and Wildlife Service.

McGlaughlin, Mitchell, Keith Karoly, and Thomas Kaye. 2002. Genetic Variation and its Relationship to Population Size in Reintroduced Populations of Pink Sand Verbena, Abronia umbellata subsp. breviflora (Nyctaginaceae). Conservation Genetics 3.4. 411- 420.

Meyer, S. E. 1986. The Ecology of Gypsophile Endemism in the Eastern Mojave Desert. Ecology. 67. 1303–1313.

117

Ming-qian, Wu, et al. 2014. An Analysis of the Genetic Diversity and Genetic Structure of Eucommia ulmoides Using Inter-Simple Sequence Repeat (ISSR) Markers. African Journal of Biotechnology. 10.84. 19505-19513.

Muralidharan K, Wakeland EK. 1993. Concentration of Primer and Template Qualitatively Effects Products in Random Amplified Polymorphic DNA PCR. Biotechniques. 14. 362- 364.

Naumann. T. 1990. Status report for Oxybaphus rotundifolius. Colorado Natural Areas Program, Department of Natural Resources. Denver, CO.

Neid, Stephanie and Jill Handwerk. December 21, 2007. Rare Plant Surveys on Fort Carson 2006-2007. Colorado Natural Heritage Program Colorado State University. Prepared for: U.S. Fish and Wildlife Service.

Parsons, R. F. 1976. Gypsophily in Plants—a Review. American Midland Naturalist. 96. 1–20.

Pharmawati, Made, Guijun Yan, and Patrick M. Finnegan. 2005. Molecular Variation and Fingerprinting of Leucadendron Cultivars (Proteaceae) by ISSR Markers. Annals of botany. 95.7. 1163-1170.

Posada, D., and K. A. Crandall. 1998. Modeltest: Testing the Model of DNA Substitution. Bioinformatics. 14. 817–818.

Radford, Albert E., William C. Dickison, and Jimmy R. Massey. 1974. R. Bell. Vascular Plant Systematics. 221.

Ranjitkar, Sailesh, et al. 2014. Ensemble Forecast of Climate Suitability for the Trans-Himalayan Nyctaginaceae Species. Ecological Modelling. 282. 18-24.

Reddy, M. Pradeep, N. Sarla, and E. A. Siddiq. 2002. Inter Simple Sequence Repeat (ISSR) Polymorphism and its Application in Plant Breeding. Euphytica 128.1. 9-17.

Rogers, H.J., H.C. Parkes. 1999. Direct PCR Amplification from Leaf Discs. Plant Science. 143:2. 31. 183-186.

Romao, R. L., and A. Escudero. 2005. Gypsum physical soil crusts and the existence of gypsophytes in semi-arid central Spain. Plant Ecology 181: 127–137.

Roy, B. A., M. L. Stanton, and S. M. Eppley. 1999. Effects of Environmental Stress on Leaf Hair Density and Consequences for Selection. Journal of Evolutionary Biology. 12.6. 1089- 1103.

Saitou N, Nei M. 1987. The Neighbor-Joining Method: a New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution. 4:4. 406-425. 118

Saunders, N. Elizabeth, and Sedonia D. Sipes. 1987. Reproductive Biology and Pollination Ecology of the Rare Yellowstone Park Endemic Abronia ammophila (Nyctaginaceae). Plant Species Biology 21.2. 75-84.

Spellenberg, R.W. 2004. Mirabilis albida. Flora of North America. 4. 42, 48, 51, 5. Retrieved from www.efloras.org

Spellenberg, R.W. 2004. Mirabilis coccinea. Flora of North America. 4. 41, 48, 49, 5. Retrieved from www.efloras.org

Spellenberg, R.W. 2004. Mirabilis. Flora of North America. 4. 14, 15, 16, 25, 40, 46, 47, 50, 52. Retrieved from www.efloras.org

Spellenberg, R.W. 2004. Mirabilis rotundifolia. Flora of North America. 4. 41, 52, 54. Retrieved from www.efloras.org

Spellenberg, R.W. 2004. Nyctaginaceae. Flora of North America. 4. 14, 15, 68, 5. Retrieved from www.efloras.org

Spellenberg, Richard, and Sergio R. Rodríguez Tijerina. Geographic variation and taxonomy of North American species of Mirabilis, section Oxybaphoides (Nyctaginaceae). SIDA, Contributions to Botany. 2001. 539-570.

Standley, P. C. 1931. Studies of American plants: Nyctaginaceae. Field Museum Botanical Series. 8. 304–311.

Swofford, D. L. 2002. PAUP*, Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates. Sunderland, Massachusetts.

Turner, B. L. 1993. Texas species of Mirabilis (Nyctaginaceae). Phytologia. 75.6. 432-451.

Stanford, A. M., R. Harden, and C. R. Parks. 2000. Phylogeny and Biogeography of Juglans (Juglandaceae) based on matK and ITS Sequence Data. American Journal of Botany 87. 872–882.

Stebbins, G. L. 1974. Flowering plants, Evolution above the species level. Belknap Press of Harvard University Press. Cambridge, Massachusetts, USA.

Stuessy, Tod F. 1990. Plant Taxonomy: The Systematic Evaluation of Comparative Data. Columbia University Press. New York, NY.

Turner, B. L. 1991. A New Gypsophilic Species of Mirabilis (Nyctaginaceae) from Nuevo Leon, Mexico. Phytologia 70. 44–46.

119

Whipple, Jennifer J. 2002. Yellowstone Sand Verbena (Abronia ammophila): A Yellowstone Lake Endemic. Yellowstone Lake: Hotbed of Chaos or Reservoir of Resilience. 256.

Winston, Judith E. 1999. Describing Species. Columbia University Press. New York.

Yates, Eugene. 2007. MacFarlane’s Four-O’Clock in Hells Canyon of the Snake River. Kalmiopsis. 14.

Zhang, Li-Bing, Hans Peter Comes, and Joachim W. Kadereit. 2001.Phylogeny and quaternary History of the European montane/alpine endemic Soldanella (Primulaceae) based on ITS and AFLP variation. American Journal of Botany 88.12. 2331-2345.

Zietkiewicz, Ewa, Antoni Rafalski, and Damian Labuda. 1994. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics. 20.2. 176-183. .

120

Appendix A: ITS Sequence Alignment

121

Appendix B: Sample ISSR gel

122

Appendix C: ISSR data matrix A1 A2 A3 A4 A5 A6 B1 B2 B3 B4 B5 B6 B7 C4 C5 C10 C11 C12 C13 C14 D5 D6 D10 D11 D12 D13 E1 E2 E3 E4 E5 F1 F2 F3 F4 F5 G1 H1 I1 J1 K1 K2 K3 K4 K5 K6 L1 L2 L3 L4 M1 M2 M4 M5 1808 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1784 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1664 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1425 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1311 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1105 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1087 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 123

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1085 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1066 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1034 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1021 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 976 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 974 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 952 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

124

943 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 940 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 926 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 917 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 912 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 888 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 884 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 880 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

125

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 866 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 851 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 848 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 845 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 830 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 837 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 829 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

126

810 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 790 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 785 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 783 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 775 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 763 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 752 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 744 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0

127

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 742 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 739 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 737 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 725 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 719 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 715 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 708 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

128

692 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 689 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 683 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 681 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 672 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 670 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 666 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 663 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0

129

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 657 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 651 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 641 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 638 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 632 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 624 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 622 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

130

617 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 614 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 612 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 609 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 607 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 602 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 597 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 588 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

131

1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 580 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 568 0 0 0 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 565 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 562 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 560 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 554 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 549 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

132

544 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 540 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 538 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 535 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 531 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 524 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 522 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 515 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

133

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 512 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 509 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 503 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 501 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 492 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 490 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 487 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

134

485 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 482 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 479 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 468 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 460 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 449 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 451 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 444 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

135

0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 442 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 439 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 437 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 425 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 420 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 417 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 415 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

136

413 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 409 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 402 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 399 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 397 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 395 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 391 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 383 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

137

0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 380 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 378 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 376 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 374 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 371 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 368 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 366 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

138

364 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 359 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 354 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 351 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 348 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 345 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 341 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 339 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0

139

0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 337 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 334 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 331 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 328 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 323 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 320 0 0 0 0 0 0 0 1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 317 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0

140

314 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 310 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 308 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 306 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 304 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 301 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 297 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 295 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

141

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 293 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 291 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 289 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 286 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 284 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 281 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 279 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1

142

277 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 275 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 273 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 270 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 268 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 265 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 263 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 259 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0

143

0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 256 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 253 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 251 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 249 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 246 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 244 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 239 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0

144

235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 0 0 232 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 229 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 226 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 222 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 1 0 1 0 1 0 0 0 0 216 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 0 214 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 210 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0

145

0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 208 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 205 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 202 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 197 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 195 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 193 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0

146

191 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 187 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 185 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 183 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 181 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 178 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 176 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 173 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

147

0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 170 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 168 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 162 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 157 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 141 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 137 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0

148

135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 116 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 114 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 105 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

149

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

150

Appendix D: ISSR Conserved Matrix A1 A2 A3 A4 A5 A6 B1 B2 B3 B4 B5 B6 B7 C4 C5 C10 C11 C12 C13 C14 D5 D6 D10 D11 D12 D13 E1 E2 E3 E4 E5 F1 F2 F3 F4 F5 G1 H1 I1 J1 K1 K2 K3 K4 K5 K6 L1 L2 L3 L4 M1 M2 M4 M5 1800 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1775 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1650 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1425 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1300 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1100 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1075 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 151

0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1050 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1025 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 975 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 950 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 925 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 900 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

152

875 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 850 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 825 0 0 0 0 0 1 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 800 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 775 1 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 750 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 725 0 0 0 1 0 0 0 0 0 1 1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 700 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

153

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 675 1 0 0 0 0 0 0 1 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 650 0 0 1 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 625 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 600 0 0 0 1 0 0 1 0 0 0 1 1 0 1 0 1 0 0 0 0 0 1 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 575 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 550 0 0 0 0 0 1 0 0 0 1 1 0 1 1 0 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 525 1 0 1 0 0 0 1 1 1 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

154

500 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 1 0 0 0 0 0 1 0 0 1 0 0 0 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 475 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 450 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 425 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 1 0 0 0 0 0 0 1 1 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 400 1 0 0 1 0 0 1 1 0 0 1 0 0 1 0 1 0 0 0 1 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 375 0 1 1 1 0 1 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 1 0 0 0 350 1 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 325 0 0 0 1 0 0 1 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 1 1 0 0 1 1 1 0

155

0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 1 0 1 300 1 0 1 0 0 1 1 1 1 0 1 1 1 1 0 1 0 1 0 0 0 0 1 1 0 0 1 0 0 1 1 1 0 0 1 0 1 0 1 1 0 0 1 0 0 0 0 0 1 1 0 0 1 1 275 1 1 0 1 0 1 1 0 1 1 0 0 1 0 0 0 0 1 0 1 0 0 1 1 0 1 1 0 1 1 1 1 1 0 1 0 1 1 0 0 1 0 1 1 0 0 1 0 0 1 0 1 1 1 250 1 1 0 1 1 1 0 1 0 0 0 0 1 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 0 1 0 1 1 0 0 1 0 1 0 1 1 0 0 225 1 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 1 1 0 1 1 1 1 1 0 0 0 1 1 1 1 1 1 1 200 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 0 1 1 0 1 1 1 1 1 1 1 0 175 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 1 0 1 0 0 1 0 0 1 1 1 150 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0 1 0 0 0

156

125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 100 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

157

Slide 1

Molecular Insight into Mirabilis rotundifolia (Greene) Standley to Improve Management Decisions

SHERIE CAFFEY COLORADO STATE UNIVERSITY-PUEBLO, DEPARTMENT OF BIOLOGY DECEMBER 9, 2015

Slide 2 Mirabilis rotundifolia (Greene) Standley

• Four o’clock family (Nyctaginaceae)

• Endemic species with narrow range

• Imperiled and at risk of becoming endangered M. rotundifolia populations M. rotundifolia on Ft. Carson

Slide 3 Management Efforts

• 45% of known populations on Ft. Carson

• Pressure from conservation groups

• $40 million spent on land easements

Ft. Carson entrance in El Paso county CO

158

Slide 4 Mirabilis rotundifolia Might Not Be Genetically Unique

“Mirabilis rotundifolia is clearly closely related to Mirabilis albida and may only be a variant” -Dr. Richard Spellenberg

M. albida at N. Cheyenne Canyon, CO M. rotundifolia at Lake Pueblo, CO

Slide 5 Distribution Differences Are Key to Management Decisions

Distribution of M. albida from the USDA Distribution of M. rotundifolia from the USDA

Slide 6 Phenotypic Variation Between M. albida (Walter) Heimerl and M. rotundifolia M. albida: Large range of leaf shape and hair patterns on leaves and stems

M. albida from N. Linear Ovate Deltate Cheyenne Canyon, lanceolate lanceolate CO M. rotundifolia: Consistent hair patterns on leaves

and stem, smaller range of leaf M. rotundifolia from Hwy. Broad ovate Ovate triangular Round shape 115 in Fremont county, CO

159

Slide 7 Complicated Taxonomy

M. linearis

• Mirabilis has a complicated taxonomy

M. albida M. • M. albida phenotype varies rotundifolia

• Many species could be lumped

M. hirsuta

Slide 8 Hypothesis

We hypothesize that M. rotundifolia is a genetically unique species, and not a variant of M. albida.

M. rotundifolia at Lake Pueblo, CO

M. albida from N. Cheyenne Canyon, CO

Slide 9 Specific Aim 1: Comparison of Internal Transcribed Spacer Sequences

We aim to show whether or not there is significant sequence variation in the Internal Transcribed Spacer region of nrDNA of Mirabilis species.

160

Slide 10 Internal Transcribed Spacer Region

• Non transcribed nrDNA region

• Highly conserved priming sites, variable spacers

• Concerted evolution

• Used for species level Diagram of the ITS region comparisons

Slide 11 Specific Aim 1: Comparison of ITS Sequences

Methods: • Obtained sequence of ITS region from M. rotundifolia and M. albida • Compared to published sequences on GenBank (NCBI) • Used sequence alignment to construct phylogenetic trees (MUSCLE, PHYML) • Evolutionary look at inter-genus relationships

Construct Isolate ITS Clone into Isolate plasmid phylogenetic region bacteria and sequence trees

Slide 12 Specific Aim 2: Genetic Marker Analysis

We aim to show whether or not significant variation in genetic markers exists between M. rotundifolia and M. albida.

161

Slide 13 Inter Simple Sequence Repeat Analysis

• DNA profiling technique

• Detects length polymorphisms in specific DNA segments

• Phylogenetic trees show which individuals have similar ISSR profiles Example of ISSR gel

Slide 14 Specific Aim 2: Genetic Marker Analysis Method: • ISSRs determine variation between M. rotundifolia and M. albida • Construct phylogenetic trees using ISSR data matrices (PAUP) • Determine which individuals are closely related

Band DNA Primer Electrophoresis scoring/Data preparation screening/ PCR matrices

Simple schematic of the ISSR technique

Slide 15 Specific Aim 3: ISSR Data Compared to Phenotype and Geography

We aim to show whether or not the ISSR data correlate with phenotypic characteristics and/or geographic location

162

Slide 16 Specific Aim 3: ISSR Data Compared to Phenotype and Geography

Method: • ISSR data from distinct geographical populations • Compare to phenotypic characteristics • Determine if ISSR trees group by phenotype or geography

Measurements Separate into Color code Determine of leaves and geographical ISSR trees trends hair densities populations

Slide 17 Populations Sampled Information on the populations sampled for this study Group Location Habitat Species Number of Samples Lake Pueblo State Park Juniper Breaks A population 1 Shale Outcrop M. rotundifolia 6 B Southwest Colorado Springs Grassland M. albida 25 C Southwest Colorado Springs Grassland M. linearis 16 D North Cheyenne Canyon Park Montane Shrubland M. albida 13 Lake Pueblo State Park Juniper Breaks E population 2 Shale Outcrop M. rotundifolia 5 Lake Pueblo State Park Juniper Breaks F population 3 Shale Outcrop M. rotundifolia 5 G Northwest Lake Pueblo State Park Shale Outcrop M. rotundifolia 1 H Eastern Fremont County Shale Outcrop M. rotundifolia 1 I Colorado State University-Pueblo Greenhouse Indoor Garden M. rotundifolia 1 J Colorado College Garden Outdoor Garden M. rotundifolia 1 Lake Pueblo State Park Juniper Breaks K population 1 Shale Outcrop M. rotundifolia (large) 6 Lake Pueblo State Park Juniper Breaks L population 2 Shale Outcrop M. rotundifolia (large) 4 M Lake Pueblo State Park Juniper Breaks Shale Outcrop M. multiflora 6

Slide 18 ITS Sequence Comparison Results

• Maximum parsimony tree: least amount of evolutionary events

• M. rotundifolia takes a basal position

• Bootstrap support for relatedness but not for directionality

Maximum parsimony tree created from ITS sequence alignment

163

Slide 19 ITS Comparison Results

• Maximum likelihood tree: most likely using DNA substitution model

• Branch lengths reflect amount of change in sequence

• Not much evolution between the sequences of interest

Maximum likelihood tree constructed using ITS sequence alignment

Slide 20 ITS Sequence Comparison Results ITS sequence alignment statistics Subject Query % identity Total bases aligned Gaps Identities Substitutions Expect Value

M.rotundifolia M.coccinea 99.142 466 3 462 4 0

M.rotundifolia M.albida 98.718 468 3 462 6 0

M.rotundifolia M.longiflora 96.129 465 1 447 18 0

M.rotundifolia M.jalapa 96.137 466 3 448 18 0

M.rotundifolia M.multiflora 95.914 465 1 446 19 0

M.rotundifolia M.expansa 95.708 466 3 446 20 0

M.rotundifolia M.himalaica 95.494 466 2 445 21 0

M.rotundifolia M.triflora 96.137 466 2 448 18 0

M.rotundifolia M.tenuiloba 95.914 465 1 446 19 0

M.rotundifolia M.greenei 95.699 465 1 445 20 0

M.rotundifolia M.alipes 95.699 465 1 445 20 0

M.rotundifolia M.rotundifolia 100 465 0 465 0 0

M.rotundifolia M. albida (B1) 99.14 465 1 461 4 0

M.rotundifolia M. albida (B7) 98.925 465 1 460 5 0

M.rotundifolia A.anisophylla 90.129 466 14 420 46 1.75E-173

Slide 21

ISSR Analysis Results

• More or less random grouping • M. rotundifolia and M. albida in multiple clades together Parsimony tree created using full data matrix

164

Slide 22 ISSR Analysis Results

• Conserved scoring method still shows random grouping • All clades contain more than one species

Parsimony phylogenetic tree constructed from the conserved data matrix

Slide 23 Phenotype/Geography Comparison Results

Average leaf area calculated for all groups in cm^2

Slide 24 Phenotype/Geography Comparison Results

Average leaf hair density calculated for all groups in hairs/mm^2, Group B is excluded for clarity

165

Slide 25 Phenotype/Geography Comparison Results

• Most all individuals are in the category with the smallest range of values

• ISSR variation does not correlate with leaf hair density Full data matrix parsimony tree color coded by leaf hair density

Slide 26 Phenotype/Geography Comparison Results

Conserved data matrix ISSR tree does not correlate with leaf hair density either

Conserved data matrix parsimony tree color coded by leaf hair density

Slide 27 Phenotype/Geography Comparison Results

• High and medium area plants show some grouping but spread through whole tree

• ISSR variation does not explain leaf area Full data matrix parsimony tree color coded by leaf area

166

Slide 28 Phenotype/Geography Comparison Results

Broad patterns more broken up on conserved tree

Conserved matrix parsimony tree color coded by leaf area

Slide 29 Phenotype/Geography Comparison Results • Most samples from Juniper Breaks and SW El Paso County

• These two groups are together in many places throughout tree Full matrix parsimony tree color coded by geographic area

Slide 30 Phenotype/Geography Comparison Results

• ISSR variation not influenced by geographic proximity • Most clades contain more than one geographic area Conserved matrix parsimony tree color coded by geographic area

167

Slide 31 Conclusions from ITS Sequence Comparison

• Sequences are not identical

• Not enough variation or bootstrap support to make conclusions about relationships

• M. rotundifolia and M. albida are closely related (Spellenberg) M. rotundifolia from Juniper Breaks

Slide 32 Conclusions from ISSR Analysis

• ISSR variation is too abundant to separate distinguishable groups

• Not an appropriate marker for this application, too quickly evolving

• Bands from non homologous chromosomes scored as homologous? Large M. rotundifolia from Juniper Breaks

Slide 33 Conclusions from Phenotype/Geography Comparison

• ISSR variation does not strongly correlate with phenotype characteristics or geography

• Species look different but are genetically similar

Small M. rotundifolia from Fremont County

168

Slide 34 Implications of Results

• M. coccinea is an accepted species, so M. rotundifolia should be too according to ITS data

• ISSR data shows that Mirabilis is one big gene pool

• Whether M. rotundifolia is a unique species or not, at this time it’s best to protect populations

Slide 35 Possible Future Research

• Wider sampling to possibly detect more variation

• Different molecular marker, AFLP

• Chloroplast genome sequencing

Slide 36 Acknowledgements Dr. Brian Vanden Heuvel

Thesis Committee Dr. Lee Anne Martinez Dr. Helen Caprioglio

Others around Campus Dr. Dan Caprioglio Stacy Righini Theresa Jiminez

All of my family and friends!

169

Slide 37

Thank you for your time…

Questions or comments?

170