Characterization of the carbonic anhydrase gene family and other key osmoregulatory genes in Australian freshwater crayfish (genus Cherax)

Muhammad Yousuf Ali

BSc (Fisheries), MSc (Animal Breeding & Genetics)

Principal Supervisor: Dr. Peter J Prentis (EEBS, QUT)

Associate Supervisors: Dr. Ana Pavasovic (School of Biomedical Sciences, QUT

Professor Peter B Mather (EEBS, QUT)

School of Earth, Environmental and Biological Sciences Science and Engineering Faculty Queensland University of Technology Brisbane, Australia

A thesis submitted in fulfilment of requirements for the degree of

Doctor of Philosophy

2016 Key Words

Acid-base, carbonic anhydrase (CA), cytoplasmic carbonic anhydrase (CAC), membrane- associated glycosyl-phosphatidylinositol-linked carbonic anhydrase (CAg), Cherax, Cherax quadricarinatus (Cq); Cherax destructor (Cd), Cherax cainii (Cc); crayfish, expression, genomics, gills, glycosyl-phosphatidylinositol-linked (GPI-linked), H+-ATPase (HAT); marron, Na+/K+-ATPase (NKA); osmoregulation, osmoregulatory genes, pH balance, physiology, quantitative real-time polymerase chain reaction (qRT-PCR), redclaw, transcriptome, V-type H+-ATPase, V-type: vacuolar-type, yabby

Page ii

Abstract

(Each chapter contains its own abstract. It is a general abstract of the study.)

Cherax quadricarinatus (Redclaw), C. destructor (Yabby) and C. cainii (Marron) are an

abundant group of economically important freshwater crayfish and have been developed

for aquaculture production in many countries of the world including Australia, Mexico,

Ecuador, Uruguay, Argentina and China. They are endemic to Australia, and possess distinct natural distributions that span a diverse range of aquatic environments. Redclaw crayfish occurs naturally in rivers across northern Australia with an abrupt environmental pH gradient of 6.2-8.2; Yabby across southern and central Australia with a natural pH range 6-9; and Marron in south-west Western Australia with a natural pH range 7-8.25. These species have the capacity to acclimate to wide fluctuations in environmental parameters including pH and salinity. The unique physiological characteristics and their economic significance have made these three species an important group for physiological research on freshwater crustaceans. Despite this, genetic information for these crayfish is still largely limited to basic population genetic data on natural variation in wild stocks. To date, so far as we know, no studies have attempted to identify or characterise specific candidate genes that have a role in systemic acid-base balance or salinity regulation in freshwater crayfish. Thus, genomic and molecular studies aimed at characterising the major genes (or variants of the genes) involved in maintaining systemic pH and salinity balance are essential because it will provide a first step toward improving our understanding of their response to environmental changes.

Page iii

As crayfish are farmed in a wide range of culture conditions, optimisation of water quality

parameters, particularly pH and salinity, are crucial for their maximum growth performance.

Previous reports have shown that fluctuations in pH and salinity in culture environments can have a negative impact on growth and physiology of crayfish. It is also evident that physiological processes involved in osmoregulation and systemic acid-base balance are undertaken by a range of enzymes encoded by transport-related genes. Having considered this, we have sequenced, identified and characterised most major candidate genes involved in systemic pH balance and osmoregulation including: Carbonic anhydrase, Na+/K+-ATPase

(NKA), V-type-H+-ATPase (HAT) and Na+/K+/2Cl- cotransporter (NKCC). We also shed light on the expression and evolution of some major genes that have roles in pH balance or salinity

regulation.

In our first study (Chapter 2), we deeply sequenced the whole gill transcriptome from C.

quadricarinatus and generated 36,128 assembled contigs with an average length of 800bp.

Approximately 40% of contigs received significant BLAST hits and 22% were assigned gene

ontology terms. Full length sequences were identified and fully annotated for three CA

isoforms (cytoplasmic, membrane-associated and β-CA), Na+/K+-ATPase, V-type H+-ATPase, sarcoplasmic Ca+-ATPase, Arginine kinase and Calreticulin. In order to understand potential

roles of the candidate genes in response to environmental pH variation, gene expression

analysis for CA, V-type H+-ATPase and Arginine kinase were undertaken at 24 h after exposure to different pH conditions (pH 6, 7 and 8). The expression results from one sampling point suggested that cytoplasmic carbonic anhydrase might be involved in pH balance, as the gene was differentially expressed across the three pH treatments, while the other genes were not.

Page iv

To confirm the results of study 1 and further investigate the role of the genes in systemic pH

balance, further in-depth study was carried out that assessed the effects of pH on

expression for carbonic anhydrase (cytoplasmic form CAc and membrane-associated form

CAg), Na+/K+-ATPase α subunit (NKA-α) and V-type H+-ATPase subunit a (HAT-A) in gills of

Redclaw crayfish. Individuals were challenged to pH 6.2, 7.2 (control) and 8.2; and sampling

was done at 0h, 3h, 6h, 12h and 24h post-exposure. All genes showed significant differences

in expression levels, either across pH treatments or over time. Expression levels for CAc

significantly increased at low pH and decreased at high pH conditions 24 h post-transfer.

Though expression levels for CAg increased at both low and high pH conditions at 6 h post

exposure, but expression remained elevated only at low pH (6.2) at the end of the

experiment. Expression of HAT and NKA also showed a significant increase at low pH

conditions, 6 h post transfer, and their expression remained significantly elevated

throughout the experiment. Overall, these results suggest that CAc, CAg, NKA and HAT may

play a role in response to pH change in freshwater crayfish.

In the third study (Chapter 4), we undertook deep sequencing of gill transcriptomes from

two other important freshwater crayfish, C. cainii and C. destructor, and generated full

length sequences of the candidate genes. The sequences from this study and those obtained

from our previous study (study 1) were compared to examine patterns of molecular

sequence variation; and if the genes were evolving with patterns of nucleotide variation

consistent with the action of natural selection. Over 83 and 100 million high quality reads (Q

≥ 30) were assembled into 147,101 and 136,622 contigs for C. cainii and C. destructor,

respectively. A total of 24630 and 23623 contigs received significant BLASTx hits and

allowed the identification of multiple gill expressed candidate genes associated with pH

balance and osmoregulation. The comparative molecular analysis of the candidate genes

Page v

showed a high level of sequence conservation across the three Cherax sp. All candidate

genes showed patterns of molecular variation consistent with neutral evolution. Overall

these results demonstrate a high degree of conservation in these candidate genes, despite

the ecological and evolutionary divergence of the species studied.

In fourth study (included in Chapter 4), we carried out a tissue-specific expression

(occurrences) analysis of 80 candidate genes that have potential role in pH balance and ionic/osmotic regulation across different organs (gills, hepatopancreas, heart, kidney, liver, nerve and testes). Approximately 50% of the candidate genes were expressed in all tissue types examined. The largest number of genes was observed in nerve tissue (84%) and gills

(78%). The study also revealed that most of the candidate genes that have a role in systemic acid-base balance and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types. This indicates the potential for an important physiological role for these genes outside of osmoregulation in other tissue types.

Overall, we generated, for the first time, full length sequences for major systemic acid-base

balance and osmoregulatory genes in freshwater crayfish. We also provided the first report

on the distribution of the genes across multiple tissue types. Moreover, we present the first

in-depth expression study for major transport-related genes in freshwater crayfish. The study provides valuable genomic information for future genomic studies in decapod

crustaceans, particularly in crayfish. Taken together this information provides much needed

information to help improve crayfish aquaculture in the future.

Page vi

Table of Contents

Table of Contents

Key Words ...... ii

Abstract ...... iii

Table of Contents...... vii

List of Figures ...... x

List of Tables ...... xii

List of Abbreviations ...... xiii

Note on thesis preparation ...... xiv

Statement of Original Authorship ...... xv

Works published or submitted for publication by the author incorporated into the thesis ...... xvi

Acknowledgements ...... xviii

Chapter 1. General Introduction ...... 1 1.1 Economic and eco-physiological importance of Crayfish (as a model organism) ...... 1 1.2 Genes involved in pH balance and osmotic/ionic-regulation...... 6 1.2.1 Carbonic anhydrase and its role in pH balance and osmoregulation ...... 9 1.2.2 Na+/K+-ATPase and its role in pH balance and osmoregulation ...... 12 1.2.3 V-type-H+-ATPase and its role in pH balance and osmoregulation ...... 18 1.2.4 Arginine kinase and its role in pH balance and osmoregulation ...... 21 1.2.5 Ca+2-ATPase and its role in pH balance and osmoregulation ...... 21 1.2.6 Ion channels involved in pH balance and osmoregulation ...... 22 1.2.7 Functions of transporters and exchangers in maintaining pH balance and for osmoregulation .... 23 1.3 Knowledge GAP and Research Questions ...... 25 1.4 Aims and objectives ...... 27

Chapter 2. Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus ...... 29 2.1 Abstract ...... 31 2.2 Introduction ...... 32 2.3 Material and Methods ...... 35 2.3.1 Sample Preparation ...... 35 2.3.2 RNA extraction, cDNA library construction and sequencing ...... 36 2.3.3 De novo assembly and functional annotation ...... 36 2.3.4 Identification of CA and other osmoregulatory genes ...... 37

Page vii

2.3.5 CA expression patterns under different pH treatments ...... 38 2.4 Results ...... 39 2.4.1 Sequencing and assembly ...... 39 2.4.2 Mapping and functional annotation ...... 40 2.4.3 Identification and characterization of carbonic anhydrase (CA) genes ...... 41 2.4.4 Phylogenetic analysis of carbonic anhydrase ...... 48 2.4.5 Identification of additional osmoregulatory genes ...... 50 2.4.6 CA expression patterns under different pH treatments ...... 51 2.5 Discussion ...... 52 2.5.1 Carbonic anhydrase genes in Cherax quadricarinatus ...... 53 2.5.2 Other candidate osmoregulatory genes in Cherax quadricarinatus ...... 56 2.5.3 Vacuolar-type H+-ATPase ...... 57 2.5.4 Arginine kinase ...... 58 2.6 Conclusions ...... 59 2.7 Acknowledgements ...... 59 2.8 Data Archive ...... 59

Chapter 3. Expression patterns of two alpha Carbonic anhydrase genes, Na+/K+-ATPase and V-type H+- ATPase in the freshwater crayfish, Cherax quadricarinatus, under different pH conditions ...... 60 3.1 Abstract ...... 62 3.2 Introduction ...... 64 3.3 Materials and Methods ...... 67 3.3.1 Sample Preparation ...... 67 3.3.2 RNA extraction and cDNA synthesis ...... 68 3.3.3 Quantification of mRNA by quantitative Real-Time-PCR (qRT-PCR) ...... 68 3.3.4 Data analysis ...... 69 3.4 Results ...... 69 3.4.1 Carbonic anhydrase (CA) ...... 69 3.4.2 Na+/K+-ATPase (NKA) ...... 72 3.4.3 V-type H+-ATPase (HAT) ...... 73 3.5 Discussion ...... 74 3.5.1 Carbonic anhydrase (CA) ...... 74 3.5.2 Na+/K+-ATPase (NKA) ...... 76 3.5.3 Vacuolar-type H+-ATPase ...... 78 3.6 Conclusions ...... 79

Chapter 4. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii ...... 80 4.1 Abstract ...... 82 4.2 Introduction ...... 83 4.3 Material and Methods ...... 84 4.3.1 Sample collection and preparation...... 85 4.3.2 RNA extraction, cDNA synthesis and sequencing ...... 85 4.3.3 Assembly, functional annotation and gene identification ...... 86

Page viii

4.3.4 Molecular analyses ...... 86 4.3.5 Tissue-specific expression ...... 88 4.4 Results ...... 88 4.4.1 Transcriptome assembly, annotation and gene identification ...... 88 4.4.2 Sequences alignment, domain analysis and phylogenetic relationships ...... 93 4.4.3 Comparative molecular evolutionary analyses ...... 103 4.4.4 Tissue-specific expression analyses ...... 107 4.5 Discussion ...... 108 4.5.1 Comparative molecular analyses ...... 109 4.5.2 Tissue-specific expression analyses ...... 112 4.6 Conclusions ...... 114 4.7 Nucleotide sequence accession number ...... 114 4.8 Supplementary data ...... 114

Chapter 5. General Discussion and Conclusion ...... 115

Chapter 6. References ...... 125

Chapter 7. Appendices ...... 140 7.1 Appendix 1: Data distribution of the assembled contigs for C. quadricarinatus ...... 140 7.2 Appendix 2: Top-hit Species distribution of the assembled contigs for Redclaw...... 141 7.3 Appendix 3: Gene Ontology distribution of the gill transcripts from Redclaw ...... 142 7.4 Appendix 4: Multiple alignment of partial C. quadricarinatus CA...... 143 7.5 Appendix 5 : Full length nucleotide sequences of C. quadricarinatus CAg ...... 144 7.6 Appendix 6: Statistics for contigs from C. cainii (Marron) and C. destructor (Yabby) ...... 145 7.7 Appendix 7: Gene Ontology classification in C. cainii and C. destructor...... 146 7.8 Appendix 8: List of all possible contigs with their sequence description, length and roles in pH and/or salinity balance ...... 147 7.9 Appendix 9: Identity matrix across species based on amino acid compositions (7.9.1-7.9.11) ...... 151 7.10 Appendix 10: Tissue-specific expression of major pH- and osmoregulatory genes in Redclaw crayfish Cherax quadricarinatus ...... 157

Page ix

List of Figures

Figure 1.1 Natural distributions of Cherax quadricarinatus, C. destructor and C. cainii across Australia ...... 4 Figure 1.2 Generalized ion-transport model in crustacean gills ...... 7 Figure 1.3 Mechanism of Na+/K+ transport by Na+/K+ -ATPase (NKA) ...... 14 Figure 1.4 Schematic diagram of V-ATPase (HAT) showing the arrangement of the different subunits ...... 20 Figure 2.1 Full length nucleotide sequences of cytoplasmic carbonic anhydrase (ChqCAc) .. 43 Figure 2.2 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus cytoplasmic carbonic anhydrase isoform (ChqCAc) ...... 44 Figure 2.3 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus membrane-associated isoform (ChqCAg) ...... 45 Figure 2.4 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus β-CA isoform (ChqCA-beta) ...... 47 Figure 2.5 Bootstrapped neighbor-joining tree of deduced amino acid sequences showing relationships between the genes identified from our study...... 49 Figure 2.6 Relative mRNA expression levels of Cytoplasmic carbonic anhydrase, GPI-linked carbonic anhydrase, V-type H-ATPase and Arginine kinase...... 52 Figure 3.1 Relative expression of cytoplasmic carbonic anhydrase ...... 71 Figure 3.2 Relative expression of membrane-associated carbonic anhydrase ...... 71 Figure 3.3 Relative expression of Na+/K+-ATPase ...... 73 Figure 3.4 Relative expression of V-type-H+-ATPase ...... 74 Figure 4.1 Multiple alignments of amino acid sequences from three Cherax Carbonic anhydrase (CA) with other species...... 96 Figure 4.2 Phylogenetic relationships between the three Cherax crayfish with other organisms ...... 97 Figure 4.3 Multiple alignment of three Cherax Na+/K+-ATPase α-subunit amino acid sequences with other crustaceans ...... 99 Figure 4.4 Multiple alignment of three Cherax V-type-H+-ATPase subunit-a amino acid sequences with other species...... 102 Figure 4.5 Tissue-specific expression/occurrences of important genes associated with pH balance or ion-regulation in Redclaw crayfish (Cherax quadricarinatus) ...... 108 S Figure 2.1 Data distribution of the assembled contigs after blasting, mapping and annotation...... 140 S Figure 2.2 Major top-hit species distribution on the basis of BALST search using the assembled contigs from Redclaw (C. quadricarinatus) ...... 141 S Figure 2.3 Gene Ontology distribution of the gill transcripts from Cherax quadricarinatus based on Biological processes, Molecular functions and Cellular components...... 142

Page x

S Figure 2.4 Multiple alignment of translated amino acid sequences of two partial C. quadricarinatus CA ...... 143 S Figure 4.5 The proportion and number of contigs assigned to Gene Ontology groups in C. cainii and C. destructor ...... 146

Page xi

List of Tables

Table 1.1 Environmental tolerances of Redclaw (C. quadricarinatus), Yabby (C. destructor) and Marron (C. cainii) ...... 5 Table 1.2 List of some important genes responsible for acid-base balance and osmotic/ionic- regulation in crustaceans ...... 8 Table 1.3 Published studies that have identified genes associated with pH balance and osmotic/ionic-regulation in decapod crustacean taxa ...... 15 Table 2.1 Details of primers used in this study for amplification of the target genes at RT-PCR ...... 39 Table 2.2 Summary statistics for assembled contigs generated from C. quadricarinatus gill transcriptomes...... 41 Table 4.1 Summary statistics for assembled contigs from different organs of Cherax quadricarinatus, C. destructor and C. cainii ...... 91 Table 4.2 Full length coding sequences of the candidate genes involved in pH balance and osmotic/ionic regulation amplified from the gill transcriptomes of C. quadricarinatus, C. destructor and C. cainii ...... 92 Table 4.3 Molecular evolutionary analyses between three Cherax crayfish (C. quadricarinatus, C. destructor and C. cainii) at amino acid/codon level ...... 104 Table 4.4 Molecular evolutionary analyses across crustacean species at Amino acid level 106 S Table 4.1 Summary statistics for assembled contigs greater than 200 bp generated from C. cainii (Marron) and C. destructor (Yabby) gill transcriptomes using Trinity de novo assembler and cd-HIT clustering tool...... 145

Page xii

List of Abbreviations

aa= amino acid AK= arginine kinase bp= base pair CA= carbonic anhydrase CAb= beta (β) carbonic anhydrase CAc= cytoplasmic carbonic anhydrase CAg= membrane-associated glycosyl-phosphatidylinositol-linked carbonic anhydrase Cc= Cherax cainii (Marron) CD=expressed codons Cd=Cherax destructor (Yabby) Cq= Cherax quadricarinatus (Redclaw) CRT= calreticulin GPI= glycosyl-phosphatidylinositol HAT= H+-ATPase or V-type H+-ATPase HAT-116k=Vacuolar type H+-ATPase 116 kda + - NBC=Na /HCO3 cotransporter NCX1 = Na+/Ca+2 exchanger 1 NHE3 = Na+/H+ exchanger 3 NKA= Na+/K+-ATPase NKCC = Na+/K+/2Cl- cotransporter ORF= open reading frame qRT-PCR = quantitative real-time polymerase chain reaction SERCA= sarco/endoplasmic reticulum Ca+2-ATPase UTR: untranslated region V-type= vacuolar-type

Page xiii

Note on thesis preparation

Each chapter contains its own introduction, methodology, results, discussion and conclusion sections.

Chapter 2 to 4 of this thesis represent individual, independent studies that each have a discrete set of specific objectives and introduction and discussion sections particular to each study. As such, there is some necessary repetition of information in the General

Introduction (Chapter 1) and General Discussion and Conclusions sections (Chapter 5) when compared with the introductions and discussions sections of chapter 2 to 4.

Page xiv

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

QUT Verified Signature

Signature: Muhammad Yousuf Ali

Date: April, 2016

Page xv

Works published or submitted for publication by the author incorporated into the thesis

Statement of contribution to jointly authored works in the thesis

1. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015. Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus. Gene (Elsevier) 564, 176-187

This manuscript is incorporated as Chapter 2 of this thesis. The first author was responsible for conducting the research, analysis and interpretation of data, and writing this manuscript. The co‐authors were involved in refining the experimental design and provided conceptual, logistical and editorial support.

2. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015. Transcriptome analysis and characterisation of gill-expressed carbonic anhydrase and other key osmoregulatory genes in freshwater crayfish Cherax quadricarinatus. Data in Brief (Elsevier) 5, 187- 193.

This manuscript is incorporated in Chapter 2 of this thesis. The first author was responsible for conducting the research, analysis and interpretation of data, and writing this manuscript. The co‐authors were involved in refining the experimental design and provided conceptual, logistical and editorial support.

3. Ali, M. Y., Pavasovic, A., Mather, P. B., & Prentis, P. J. (2015). Expression patterns of two alpha Carbonic anhydrase genes, Na+/K+-ATPase and V-type H+-ATPase in the freshwater crayfish, Cherax quadricarinatus, under different pH conditions. (manuscript in preparation)

This manuscript is incorporated as Chapter 3 of this thesis. The first author was responsible for conducting the research, analysis and interpretation of data, and writing this manuscript. The co‐authors were involved in refining the experimental design and provided conceptual, logistical and editorial support.

Page xvi

4. Ali, M.Y., Pavasovic, A., Amin, S., Mather, P.B. and Prentis, P.J., 2015. Comparative analysis of gill transcriptomes of two freshwater crayfish, Cherax cainii and C. destructor. Marine Genomics (Elsevier) 22, 11-13.

This manuscript is incorporated in Chapter 4 of this thesis. The first author was responsible for conducting the research, analysis and interpretation of data, and writing this manuscript. The co‐authors were involved in refining the experimental design and provided conceptual, logistical and editorial support. In addition, the third co‐author was involved in data analysis.

5. Ali, M. Y., Pavasovic, A., Acharige, L. D., Mather, P. B., & Prentis, P. J. (2015). Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii. (manuscript in preparation)

This manuscript is incorporated in Chapter 4 of this thesis. The first author was responsible for conducting the research, analysis and interpretation of data, and writing this manuscript. The co‐authors were involved in refining the experimental design and provided conceptual, logistical and editorial support. In addition, the third co‐author was involved in sample collection, preparation and library preparation for sequencing.

Page xvii

Acknowledgements

At first I would like to express my heartiest gratitude to all of my PhD supervisors; Dr. Peter J

Prentis (School of Earth, Environmental and Biological Sciences, Science and Engineering

Faculty, Queensland University of Technology), Dr. Ana Pavasovic (School of Biomedical

Sciences, Faculty of Health, Queensland University of Technology) and Professor Peter B

Mather (School of Earth, Environmental and Biological Sciences, Science and Engineering

Faculty, Queensland University of Technology) for their excellent supervision, advice, guidance and constructive comments throughout the project and writing this thesis.

I would like to thank Australian government for awarding me IPRS and APA scholarships; and special thanks for the authority of QUT for proving me Vice Chancellor’s Top Up scholarship and providing me necessary facilities to conduct my PhD project. I also like to acknowledge the funds provided by QUT (Queensland University of Technology) Higher

Degree Research Support and a QUT ECARD grant awarded to Peter Prentis that facilitated this research.

Thanks to all in QUT Molecular Genetic Resource Facility (MGRF) and technical staff at

Banyo Pilot Plant Precinct for their cordial help during my project period. Especially, Vincent

Chand who arranged and organised everything nicely for rearing live crayfish at Banyo Pilot

Plant Precinct and arranged all types of facilities at QUT Molecular Genetics Lab. I would also thank to Ms. Kylie Agnew‐Francis and Hamish Kelly for sequencing my samples and to

Shane Russell for providing me some equipment for Banyo Aqualab. I also thank to administration, technical, academic and research staff within the School of Earth,

Environmental and Biological Sciences for making a friendly environment with a feeling of belonging to a community of people.

Page xviii

I greatly acknowledge the support and cooperation given by freshwater crayfish suppliers

(Redclaw: Peter and Ethel Moore – Cherax park, Theebine, Gympie, QLD; Marron: Peter

McGinty – Aquatic Resources Management Pty Ltd., Manjimup west, WA; Yabby: Peter and

Margaret Burns – B and B yabby farm, Mudgee, NSW) by supplying us good quality animals.

Finally, I would like to acknowledge all the members of Physiology Genomics Lab (PGL) where our lab group met regularly and discussed issues related to our project works, shared our experiences and learnt new knowledge. Special thanks to Shorash Amin, Joachim Surm and Jonathon Muller for helping me in RNA extraction and data analysis. I particularly acknowledge Dr. Lalith Dammannagoda Acharige who helped me in many ways in sample collection and lab work. I would also like to thank Lifat Rahi (PhD student, EEBS, QUT) for assisting me in RNA extraction and library preparation for NGS-sequencing.

Page xix

Chapter 1. General Introduction

1.1 Economic and eco-physiological importance of Crayfish (as a model organism)

Crustacean aquaculture, a multi-billion dollar industry around the world, has been expanding more rapidly than finfish and mollusc aquaculture over the last three decades

(FAO, 2011; FAO, 2012; Saoud et al., 2012; Saoud et al., 2013). Commercial crustacean aquaculture now contributes approximately 9.6% to global aquaculture production (FAO,

2012) and is dominated by penaeid species. Freshwater species now also make a significant contribution to crustacean production (29.4%). Of the farmed freshwater crustacean species, crayfish contribute the highest production, followed by Chinese mitten crab and freshwater prawns (FAO, 2012).

As demand for freshwater crustaceans continues to grow, there is pressure to expand production levels for this class of organisms, by exploiting desirable traits and optimising production practices. Selection of desirable traits has traditionally been associated with traits or genes related to growth performance and/or disease resistance, with less focus on selection for ecological traits, that would allow species to respond in positive ways where there are fluctuations in culture conditions, such as tolerance to changes in water pH and salinity levels.

Abrupt fluctuations in abiotic parameters including pH and salinity, within a production setting can often have significant impacts on ion transport, endocrine function, physiological traits and growth rate in many cultured crustaceans (Boron, 1986; Minh Sang and Fotedar,

2004; Pan et al., 2007; Ye et al., 2009). Pan et al., (2007) reported significantly lower growth

Page 1

rate in the marine shrimp, Litopenaeus vannamei cultured at 25 and 22 % salinity compared with at 31 % salinity (a salinity that approximately equals to natural environment). They also observed significantly lower weight gain at pH 7.1 and 9.1 as compared with that at pH 8.1

(optimal pH). In another study, the euryhaline shrimp (Penaeus latisulcatus) was exposed to

hyper-saline condition (46 ppt), where it showed both reduced hepatosomatic index and tail muscle index (Minh Sang and Fotedar, 2004). Reduced growth performance in this species was suggested to result from higher energy requirements diverted from growth to allow individuals to maintain internal ionic concentration. Ye et al. (2009) also observed poorer growth performance and lower feed conversion ratios in tiger shrimp (Penaeus monodon) exposed to both higher and lower salinities outside their optimal salinity level (25 ppt).

Increased energy expenditure on osmoregulation can produce many problems in cultured organisms including increased moisture content in muscle tissue, increased oxygen consumption and higher ammonia-N excretion (Silvia et al., 2004). Therefore, a better understanding of the genes that control osmoregulation and their function is required to optimise the productivity of commercially cultured crustaceans under variable water quality

parameters.

Cherax quadricarinatus (Redclaw), C. destructor (Yabby) and Cherax cainii (Marron) are the

most abundant and economically important freshwater crayfish species in the genus Cherax.

These species have been developed for aquaculture production in Australia and elsewhere

around the world, most notably in Mexico, Ecuador, Uruguay, Argentina and China

(Macaranas, 1995; FAO, 2010; Saoud et al., 2012; Saoud et al., 2013). All three commercially

important Cherax species are endemic to Australia, and possess different natural

distributions that span a diverse range of aquatic environments (Fig. 1.1 and Table 1.1).

Page 2

Redclaw crayfish, C. quadricarinatus occurs naturally in rivers across northern Australia, from the Kimberley region of north-western Western Australia across the Gulf of

Carpentaria to the tip of Cape York (Fig. 1.1). This species also occurs in the southern half of

Papua New Guinea (PNG). Wild populations of redclaw crayfish from northern Australia occur naturally in waters with an abrupt environmental (pH) gradient; at low pH conditions

(pH 6.2-6.5 in northern Queensland, Australia) or at higher pH conditions (pH 8-8.2 in

Northern Territory, Australia) (Merrick and Lambert, 1991; Macaranas, 1995; Baker et al.,

2008) (Fig. 1.1). Yabby (C. destructor) is distributed across southern and central Australia, notably in New South Wales, South Australia (SA) and Victoria with a natural pH range 6-9; while Marron (C. cainii) occurs in south-west Western Australia with a natural pH range 7-

8.25 (Merrick and Lambert, 1991; YGA, 1992; Lawrence and Morrissy, 2000; Lawrence et al.,

2002) (Fig.1.1 and Table 1.1). However, all the three Cherax species have been translocated to various places across Australia for commercial culture (Wingfield, 2008).

In general, all three species have the capacity to adapt to, and tolerate, fluctuations in environmental parameters including pH, salinity, temperature and dissolved oxygen (see references in Table 1.1). These physiological characteristics, as well as their economic significance, has made them an important model for physiological research in crustaceans.

Despite this, genetic information for these crayfish species is still largely limited to population genetic data describing genetic polymorphisms in natural populations (Miller et al., 2004; Austin et al., 2014; Gan et al., 2014). Thus, genomic and molecular studies directed at characterising the major genes involved in systematic acid-base balance and osmoregulation are novel and important because they will allow a better understanding of

Page 3 their response to environmental variables including changes in physico-chemical water properties.

Figure 1.1 Natural distributions of Cherax quadricarinatus, C. destructor and C. cainii across Australia

Page 4

Table 1.1 Environmental tolerances of Redclaw (C. quadricarinatus), Yabby (C. destructor) and Marron (C. cainii)

pH Salinity Temperature Dissolved Oxygen Source (ppm) (oC) (ppm) Reference

d Min Low Max Max High Stress Death growth Min for Growth impaire Distress Optimal Optimal

18000 20-34 (Jones, 1990) 6.5 8 (Merrick and Lambert, 1991) Redclaw 23-31 10 36 (Jones, 1998) 12000 18000 23-28 10 35 >5 1 (Mosig, 1998) 17000 28 34 (DPI, 2005) 6.5 8 12000 18000 22-31 10 35.5 34 >5 1 ← Mean >5000 16000 28 15 34 (Mills, 1983) 6000- 14000- 22000 15 (Morrissy et al., 1990) 8000 15000 Yabby 7.5 8.5 >6000 25-28 ≥4 (Merrick and Lambert, 1991) 7 7.5 5-7 2 (YGA, 1992) 6 9 20-26 1 35 (Mosig, 1998) 7.5 10.5 17000 25000 22-28 1 36 15 >4 (DPI, 2005) 7 8.9 6000 15750 21000 22-27.5 1 35.5 15 34 5 2 ← Mean

24 6.5 2.0 (Shipway, 1951)

8 30 12-13 (Morrissy et al., 1990) 7 8 17000 17-25 ≥6 (Merrick and Lambert, 1991)) Marron 7 8.5 >6000- 15000 24 30 12.5 6 3 (Lawrence, 1998) 8000 18-24 >6 (Mosig, 1998) 17000 25 31 >6 (DPI, 2006) 18-24 4 26 12 (Sampey, 2007) 7 8.25 7000 16333 17.5- >4 28.6 12.3 >6 2.5 ← Mean 24.5

Page 5

1.2 Genes involved in pH balance and osmotic/ionic-regulation

Many enzymes and transporters contribute to ion transport in crustacean taxa including;

Na+/K+-ATPase (NKA), V-type-H+-ATPase (HAT), carbonic anhydrase (CA), Na+/K+/2Cl-

+ − − + + cotransporter (NKCC), (Na )Cl /HCO3 (NCB) and Na /H exchangers (NHE) (Zhang et al., 2000a; Weihrauch et al., 2001a; Gao and Wheatly, 2004a; Serrano et al., 2007; Tsai and Lin, 2007; Freire et al., 2008; Pongsomboon et al., 2009; McNamara and Faria,

2012a; Havird et al., 2013; Tongsaikling, 2013; Havird et al., 2014). Table 1.2 summarises some of the major genes that have already been identified and shown to be involved in maintenance of systemic acid-base balance and ion-regulation/osmoregulation in decapod crustaceans. The inferred transport model and hypothetical schematic pathways for how these genes act are shown in Fig. 1.2 Briefly, CA produces H+ and

- + - + HCO3 ions through a reversible reaction, CO2+H2O ←→H +HCO3 , thereafter the H and

- + + + - HCO3 serve as anti-porters for Na /H (NH4 ) exchangers and Cl-/HCO3 cotransporter

(see comprehensive reviews by: Freire et al., 2008; Henry et al., 2012; Romano and

Zeng, 2012). NKA pumps Na+ ions out of the cell and draws K+ ions in, and thus

establishes an electrochemical gradient that acts as a driving force for transport of Na+

and K+ ions by other transporters including NKCC (Lucu and Towle, 2003; Jayasundara et

al., 2007; Leone et al., 2015; Li et al., 2015). Basolateral NKCC absorb Na+, K+ and Cl-

ions at low salinities, and apical NKCC extrude Na+, K+ and Cl- ions at high salinities to the

external environment, through the gradient driven by NKA (Onken and Riestenpatt,

1998; Weihrauch et al., 2004a). HAT (H+-ATPase) pumps protons (H+) and acidifies

intracellular organelles that help to maintain pH balance in crustacean taxa (Faleiros et

Page 6 al., 2010; Lee et al., 2011; Towle et al., 2011; Boudour-Boucheker et al., 2014; Lucena et al., 2015).

Figure 1.2 Generalized ion-transport model in crustacean gills

Generalized ion-transport model in crustacean gills (after Onken and Riestenpatt, 1998; Weihrauch et al., 2002; Weihrauch et al., 2004a; Weihrauch et al., 2004b). (1) Carbonic anhydrase (CA); (2) Cl−/ - + + + + + HCO3 exchanger; (3) Na /K -ATPase (NKA); (4) V-type-H -ATPase (HAT); (5) Na /H exchanger (NHE); (6) + + − + − + Na /K /2Cl co-transporter (NKCC); (7) K channel; (8) Cl channels; (9) paracellular diffusion of NH4 via + + vesicles acidified by V-ATPase that protonate NH3. Note: At high salinities, apical NKCC extrude Na , K and Cl- ions to the external environment, through a gradient driven by NKA, while at low salinities, basolateral + + - + - NKCC absorb these Na , K and Cl ions. CA catalyzes the reversible reaction: H +HCO3 ←→CO2+H2O, + - where H and HCO3 serve as anti-porters for (2) and (5). Thus, CA plays a vital role in pH balance, ion transport and gas exchange.

Page 7

Table 1.2 List of some important genes responsible for acid-base balance and osmotic/ionic-regulation in crustaceans

Gene Enzymes Functions Reference CAc Cytoplasmic carbonic anhydrase (CAc) pH balance and osmoregulation (Serrano et al., 2007; Pongsomboon et al., 2009; Liu et al., 2015) CAg GPI-linked carbonic anhydrase (CAg) pH balance and osmoregulation (Serrano et al., 2007; Serrano and Henry, 2008; Liu et al., 2015) NKA Na+/ K+-ATPase alpha subunit pH balance and osmoregulation (Chaudhari et al., 2015; Han et al., 2015; Leone et al., 2015) HAT V-type-H+-ATPase catalytic subunit a pH balance and osmoregulation (Pan et al., 2007; Wang et al., 2012; Havird et al., 2014) NKCC Na+/K+/2Cl- cotransporter pH balance and osmoregulation (Towle et al., 2001; Havird et al., 2013; Havird et al., 2014) + - NBC Na /HCO3 cotransporter pH balance and osmoregulation (Pan et al., 2007) + − – NCBE Na -driven Cl /HCO3 exchanger pH balance and osmoregulation (Freire et al., 2008) NHE Na+/H+ Exchanger pH balance and osmoregulation (Towle and Weihrauch, 2001; Weihrauch et al., 2004a; Ren et al., 2015)

NCX Na+/Ca+2 Exchanger Osmoregulation (Freire et al., 2008) AK arginine kinase pH balance and osmoregulation (Serrano et al., 2007; Havird et al., 2014) ALP alkaline phosphatase pH balance (Tongsaikling, 2013) CRT calreticulin Osmoregulation (Luana et al., 2007; Visudtiphole et al., 2010; Watthanasurorot et al., 2013; Duan et al., 2014; Lv et al., 2015; Xu et al., 2015) SERCA sarcoplasmic endoplasmic reticulum Ion regulation (Zhang et al., 2000b; Wheatly et al., 2002; Ahearn et al., 2004; Mandal et al., calcium-transporting ATPase 2009) K+ Channel K+ Channel Osmoregulation (Ren et al., 2015) Aquaporin integral membrane protein Aquaporins Osmotic signal transduction (Chung et al., 2012) Cell volume regulation MAPK P38 mitogen-activated protein kinases Osmotic signal transduction (Sun et al., 2015) response to osmotic shock

ITG Integrin Response to salinity stress and (Huang et al., 2015) controls homeostasis

Page 8

1.2.1 Carbonic anhydrase and its role in pH balance and osmoregulation

Carbonic anhydrase (CA) is a Zn-metalloenzyme that catalyses the inter-conversion of CO2

− − + + - and HCO3 through the reversible reaction: CO2 + H2O ↔ HCO3 + H ; where H and HCO3

− − + + serve as anti-porters for Cl / HCO3 exchanger and Na /H exchanger. Consequently, members of this gene family have been shown to play an important and large role in pH balance, ion transport, shell formation, bone deposition and gas exchange in eumetazoans

(Freire et al., 2008; Henry et al., 2012; Romano and Zeng, 2012). CA exists in three distinct forms in arthropods; cytoplasmic CA, membrane-associated CA (GPI-linked) and beta CA (β-

CA) (Serrano et al., 2007; Serrano and Henry, 2008; Zimin et al., 2008; Syrjanen et al., 2010;

Werren et al., 2010; Colbourne et al., 2011; Jillette et al., 2011; Nygaard et al., 2011). While cytoplasmic CA and GPI-linked CA are both members of the alpha carbonic anhydrase gene family they have an independent origin to β-CA, which is a member of the beta carbonic anhydrase gene family.

Carbonic anhydrases are widely distributed ion transport-related enzymes and members of the alpha CA family that have been well-studied in crustaceans (for examples; (Serrano et al., 2007; Serrano and Henry, 2008; Pongsomboon et al., 2009; Liu et al., 2015) and also see the reviews by: (Freire et al., 2008; Henry et al., 2012; Romano and Zeng, 2012). A substantial number of studies have been undertaken on its distribution among decapod species, biochemical- and molecular characterisation of its function, expression levels and its physiological role(s) in decapod crustaceans (Henry and Cameron, 1982; Henry and

Kormanik, 1985; Wheatly and Henry, 1987; Böttcher et al., 1990; Böttcher et al., 1991;

Onken and Riestenpatt, 1998; Henry et al., 2002; Henry et al., 2003; Henry and Campoverde,

Page 9

2006; Roy et al., 2007; Serrano et al., 2007; Serrano and Henry, 2008). Alpha CA genes,

cytoplasmic CA and GPI-linked CA, play a vital role in ion-regulation/osmoregulation

+ − because they provide H and HCO3 ions which are used as counterions for exchange of cations and anions, in particular Na+ and Cl- (Henry and Cameron, 1983; Henry, 2001; Freire et al., 2008; Henry et al., 2012; Havird et al., 2013). Its role in systematic acid-base balance

has also been established in a wide range of marine crustacean taxa including; prawns (Gao

and Wheatly, 2004a; Pongsomboon et al., 2009; Liu et al., 2010; Pan et al., 2011; Hu et al.,

2013); and crabs (Serrano et al., 2007; Serrano and Henry, 2008; Liu et al., 2012), but

information for freshwater species is limited.

The main CA enzyme that has been shown to respond to pH changes and plays a significant

role in systematic acid-balance in decapod crustaceans is cytoplasmic CA. The expression of

cytoplasmic CA has been demonstrated to be strongly induced in crustaceans by changes in

water salinity (Serrano and Henry, 2008), where the induction of CAc expression was more

pronounced when individuals were exposed to low salinity conditions (Henry et al., 2012). In

fact, previous studies have reported a 10-fold increase in CAc expression in the posterior

gills of two marine crab species C. sapidus and C. maenas after 6 h exposure to low salinity

levels, and the CAc expression levels increased to approximately 100-fold 24 h post-transfer

(Serrano et al., 2007; Serrano and Henry, 2008). It has been suggested that the change in

+ − expression levels occurs because cytoplasmic CA provides counter ions (H and HCO3 ) to

+ + − − the Na /H and Cl /HCO3 exchanger that drive ion uptake in crab gills when they are

exposed to low salinity levels or low pH environments (Henry and Cameron, 1983; Henry,

1988; Henry, 2001).

Page 10

The role and activity of membrane-associated CA (CAg) and β-CA (CAb) are not clearly resolved in systematic acid-balance and osmoregulation in decapod crustaceans (Havird et

al., 2013). For example, some studies have not found clear evidence that these two genes

are differentially expressed in response to changes in water pH and/or salinity (Henry, 1988;

Serrano et al., 2007). In fact, in studies that do find changes in the expression of the membrane bound CA form, this transcript shows much lower induction than the cytoplasmic form when exposed to low pH and low salinity conditions (Serrano et al., 2007; Serrano and

Henry, 2008; Liu et al., 2015). CAg is mainly located on the outer membrane of cells and is

− believed to facilitate mobilization of hemolymph HCO3 to molecular CO2 and assists with

CO2 excretion via the gills (Henry, 1987). Thus, this gene (CAg) may play a less significant

role in maintenance of acid-base balance in freshwater crayfish than cytoplasmic CA.

It remains unknown if CA-β is expressed in the gills of decapod crustaceans or if this enzyme

plays a role in either systematic acid-balance and osmoregulation. Recent studies have

shown that the homologous β CA protein in Drosophila is a highly active mitochondrial

enzyme (Syrjanen et al., 2010). This mitochondrial CA may have a functional role in the

− CO2/HCO3 interaction by providing counterions for the uptake of energy-linked

mitochondrial Ca2+ (Dodgson et al., 1980). However, CA-β was not identified in any of the

complete mitochondrial genomes of Cherax quadricarinatus (Gan et al., 2014), C. destructor

(Miller et al., 2004) and C. cainii (Austin et al., 2014) in Cherax crayfish. Thus, the role and

activity of CA-β in crayfish remains unclear.

Given that some CA enzymes play an important role in acid-base balance and

osmoregulation (particularly cytoplasmic CA), CA in general has received only limited

attention in crayfish. In this regard, freshwater crayfish may provide an interesting model

Page 11

for identification and characterisation of the various CA forms because these taxa experience in nature hypo-osmotic environments that can vary widely in pH (Baker et al.,

2008).

1.2.2 Na+/K+-ATPase and its role in pH balance and osmoregulation

Na+/K+-ATPase (NKA), often referred to as the Na+/K+ pump or sodium pump, is an

electrogenic transmembrane enzyme located in the plasma membrane of cells that pumps

sodium ions out of cells and potassium ions into the cell. Ion uptake in many crustaceans is

largely controlled by the activity of this enzyme (Havird et al., 2013; Chaudhari et al., 2015;

Han et al., 2015; Leone et al., 2015; Li et al., 2015). The NKA protein is normally located in

the gill basolateral membrane and provides the major driving force for transport of Na+ and

K+ ions by establishing an electrochemical gradient between the inside and outside of a cell

(Towle and Kays, 1986). In addition to active transport of Na+ and K+, NKA also helps to; maintain resting potential, regulate cell volume and affects transport of other ions as well.

Moreover, NKA functions as a signal transducer to regulate the ERK/MAPK pathway

(extracellular signal-regulated kinases or mitogen-activated protein kinases) and intracellular calcium. In most animal cells, NKA is responsible for the major component of energy expenditure (Skou and Esmann, 1992; Scheiner-Bobis, 2002). Of several major ion-

+ + + - regulating enzymes in crustaceans (Na /K -ATPase, V-H -ATPase, HCO3 -ATPase and

Carbonic anhydrase), NKA accounts for about 60-70% of the total ATPase activity (Skou and

Esmann, 1992; Morris, 2001). For example, in the freshwater shrimp, Macrobrachium olfersii, NKA function contributed approximately 70% of total ATPase activity; with the remaining 30% largely attributed to V-type and F0F1-ATPase activity (Furriel et al., 2000). In

Page 12

post larvae Litopenaeus vannamei, exposed to different salinity levels, Pan et al. (2007)

reported that NKA accounted for appriximately 62–78% of the total ATP activity; which

varied across different pH levels.

NKA consists of three different subunits; α, β and γ (Skou and Esmann, 1992; Pressley,

1995; Blanco and Mercer, 1998). The alpha subunit, the largest one (molecular mass ≈ 112-

115 kda), contains binding sites for cations and ATP, and thus responsible for the catalytic

function and ion regulation. The β-subunit, the second largest unit (molecular mass ≈ 40-60

kda), is usually involved in protein maturation and assists in anchoring the enzyme complex

in membranes (Blanco and Mercer, 1998). This process includes several steps (Fig. 1.3 illustrates the process) and after a single cycle, it pumps 3 Na+ ions out of the cell and draws

2 K+ ions into the cell (Skou, 1988; Glynn, 1993; Scheiner-Bobis, 2002) .

NKA-α subunit has been shown to be important for osmoregulation/ion-regulation but results vary across euryhaline organisms when they are challenged with changes in salinity

and pH levels in water (Towle et al., 2001; Parrie and Towle, 2002; Pan et al., 2007). Relative activity levels and gene expression of α-NKA are highly induced under salinity-stressed conditions in some species (Henry et al., 2002; Luquet et al., 2005; Jayasundara et al., 2007;

Li et al., 2015). In contrast, other studies have reported the down-regulation of NKA-α

expression following salinity challenges in the swimming crab Portunus trituberculatus (Xu

and Liu, 2011) and in the shore crab Carcinus maenas (Jillette et al., 2011). For example, Han

et al. (2015) reported a significant decrease in NKA-α expression in the first 6 h after

individuals were transferred from 35‰ (ppt) salinity to 15, 13, 11, and 9‰ salinity in P.

trituberculatus. The diverse activities of NKA-α under changes in water salinity are also

Page 13 demonstrated as some other studies have not observed any significant changes in expression levels in decapod crustaceans (Havird et al., 2014).

Tissue-specific gene expression patterns and enzyme activity studies have demonstrated that gill is the tissue with highest levels of NKA expression in decapod crustaceans: A. anguilla (Cutler et al., 1995), C .sapidus (Towle et al., 2001) F. heteroclitus (Semple et al.,

2002), S. sarba (Deane and Woo, 2005), P. marmoratus (Jayasundara et al., 2007), A. schlegeli (Choi and An, 2008) and P. trituberculatus (Han et al., 2015). For instance, Han et al. (2015) observed approximately 40 fold increase in NKA mRNA expression in the gills of swimming crab P. trituberculatus as compared to that in hemocytes, and almost double when compared with Hepatopancreas.

Figure 1.3 Mechanism of Na+/K+ transport by Na+/K+ -ATPase (NKA) Complete reaction cycle of NKA. Step1: NKA binds 3 Na+ and ATP in the E1 conformational state. Step 2: NKA is phosphorylated at an aspartate residue. This leads to the occlusion of three Na+ ions. Step 3: Na+ are released to the extracellular side. Step 4: New conformational state (E2-P) binds K+ Step 5: Binding of K+ leads to dephosphorylation of the enzyme and to the occlusion of two K+ cations. Step 6: K+ is then released to the cytosol after ATP binds to the enzyme with low affinity. (based on (Skou, 1988; Glynn, 1993; Scheiner-Bobis, 2002)).

Page 14

Table 1.3 Published studies that have identified genes associated with pH balance and osmotic/ionic-regulation in decapod crustacean taxa

Species Organ Stressor Level of Genes Expression Reference

Stress Duration Callinectes sapidus Gills salinity * 35→5 ‰ NKA No significant differences in expression (Towle et al., 2001) (blue crab) Penaeus chinensis Gills pH 6←7.5→8.5 14d NKA Down-regulated significantly below and after pH 7.5 (Wang et al., 2002) Carcinus maenas GIlls salinity 32→10‰ CAc CAc: Upregulated (5 fold at 24 h post-transfer) (Henry et al., 2003) AK AK: did not change Chasmagnathus granulatus Gills salinity 2←30→45‰ NKA- α NKA- α: upregulated (35 to 55 fold by 24 h at 2‰; 28 fold after 96h at (Luquet et al., 2005) ( euryhaline crab) HAT-B 45‰) NKCC HAT-B: slightly upregulated (5-8 fold by 24h at 2‰; 10 fold after 96 h at AK (Ct) 45‰) NKCC: upregulated (10-22 fold by 24 h at 2‰; 60 fold after 96h at 45‰) AK: slightly upregulated ( 3-4-fold by 24 h; 2-3 fold after 96 h at 45‰) Carcinus maenas Gills salinity 32→10‰ 7d CA 32→10‰: upregulated (10 fold at 24 h when transferred 32→10‰) (Henry et al., 2006) 32→25→20 32→25→20→15→10‰: upregulated (after 7 d, 10 fold at 15‰; 2-2.5 →15→10‰ fold at 20/25‰; 5 fold at 10‰) (CA activity also increased in similar pattern) Litopenaeus vannamei Gills pH 7.1←8.1→9.1 4d NKA pH: NKA upregulated below and above pH 8.1 at 24h (overall, NS) (Pan et al., 2007) - ( white shrimp) salinity 22‰←31‰ HAT HAT and HCO3 ATPase showed negative correlation with pH (S) - HCO3 -ATPase Salinity: NKA showed negative correlation with salinity - HAT and HCO3 ATPase not significantly changed

Callinectus sapidus Gills salinity 35→15‰ 28d CAc CAc: highly up-regulated (100 fold) (Serrano et al., (blue crab) CAg CAg: non-significantly up-regulated (3 fold) 2007) NKA-a NKA: significantly up-regulated (3-4 fold) AK AK: not significantly changed Carcinus maenas Gills salinity 32→15‰ 14d CAc CAc: upregulated (100 fold by 24 h) (Serrano and Henry, (crab) CAg CAg: significantly up-regulated (2 fold at 24h and 3 fold at 7 days) 2008) [CA activity 16 fold increase at 14 days] NKA NKA: upregulated (10-fold at 96 h and 20 fold after 14 days) AK AK: increased 1.5 fold at 7 d, but unchanged over 14 days (housekeeping

Page 15

gene) Pachygrapsus marmoratus Gills salinity 10←36→45 NKA Up-regulated at lower salinity (10‰) (Jayasundara et al., (euryhaline shore crab) ‰ No change at higher salinity (45‰) 2007) Penaeus monodon Gills salinity 25→3‰ 14d CA Gills: Significantly up-regulated after 24h (Pongsomboon et (shrimp) Epipodites Epipodites and antennal gland: down-regulated al., 2009) Antennal gland Litopenaeus vannamei Gills pH 5.6←7.4→9.3 24h NKA-b pH 5.6: NKA and HAT up-regulated (17 and 50 fold respectively) after 6h (Wang et al., 2012) (Pacific shrimp) Hepatopancre salinity 5←10←20‰ HAT-a pH 9.3: NKA and HAT up-regulated (4 and 10 fold respectively) after 3h as NKA and HAT upregulated (17 and 45 fold respectively) after 12h at salinity 5‰

Euryhaline sps Gills salinity meta-analysis NKA NKA, CA, HAT and NKCC up-regulated (Havird et al., 2013) (plus others) of 59 CA CFTR unchanged published HAT qPCR works NKCC CFTR Halocaridina rubra Gills salinity 2,15←32→45 7d NKA Overall, all unchanged after 7 days (Havird et al., 2014) ( anchialine shrimp) ‰ CAc NKA down-regulated after 24 h at 15‰ and 45‰ (by 26% and 35% CAg respectively) HAT-B HAT down-regulated in all transfers between 3-48 h (50-fold lower at NKCC 45‰ after 24 h) AK NKCC up-regulated slightly after 24 h at 2‰ (2.6-fold) CAs down-regulated after 48 h at 15‰ (by 76%)

Callinectes sapidus and Gills salinity 32→25→22.5 7d CA Upregulated ( 90-fold in C. sapidus and 2-fold in C. maenas within 6 h) (Mitchell and Carcinus maenas ‰ (300% and 100% increased CA activity at 4 days respectively) Henry, 2014)

Macrobrachium Gills pH 6.5→7→7.5 sa HAT Increased when pH increased from 6.5 t0 7.5, but decreased when pH (Lucena et al., 2015) amazonicum (adult and →8→8.5 me (activity) increased up to 8.5 (river shrimp) juvenile) day Same pattern in adult and juvenile. Exopalaemon carinicauda Gills salinity 4←32→39‰ 24h NKA-α Up-regulated both in low and high salinities in gills (12 fold in 4‰ at 32h (Li et al., 2015) (ridgetail white prawn) Hepatopancreas and 19.5 fold in 39‰ at 24 h) Hemocytes Highest expression in gill Muscle Callinectes ornatus Gills salinity 33→21‰ 10d NKA Expression up-regulated within 1-2-h ( ≈ 8-fold after 24-h) (Leone et al., 2015) (ornate blue crab) Activity increased (≈ 2.5-fold after 10d). Penaeus monodon Gills salinity 5←25→35‰ 20d NKA Expression up-regulated (1.5 fold at 5‰) (Chaudhari et al., Activity increased at 5‰ (3 folds) 2015) Activity decreased at 35‰.(0.48 folds)

Page 16

Portunus trituberculatus Gills salinity 9,11,13,15← 72h NKA Down-regulated in all transfers after 6 h (Han et al., 2015) (swimming crab) Hepatopancre 35‰ Up-regulated significantly in all transfers after 24 h as Hemocytes Muscle Litopenaeus vannamei Gill pH 7.4←8.2→9 72h CAc pH: CAc up-regulated within 12h (5 & 4.5 fold after 48h at pH7.4 and 9 Liu et al., 2015 (the pacific shrimp) salinity 20←30←35 CAg respectively) ‰ CAg up-regulated within 12h (2.5 & 3 fold after 12h at pH7.4 and 9 respectively ) Salinity: CAc up-regulated within 24h (5.5 & 3.5 fold after 24h at salinity 20 and 35‰ respectively) CAg up-regulated within 24h (2.5 & 1.5 fold after 24h at salinity 20 and 35‰ respectively )

Note: NKA=Na+/K+-ATPase, CAc=Cytoplasmic carbonic anhydrase, CAg=GPI-linked carbonic anhydrase, HAT-A=Vacuolar type H+-ATPase, NKCC = Na+/K+/2Cl- cotransporter, AK=Arginine kinase, SERCA=Sarco/endoplasmic reticulum Ca+2-ATPase, CALR=Calreticulin, * The root of the arrow indicates the control and the head of the arrow points towards the treatment where the samples were transferred to

Page 17

1.2.3 V-type-H+-ATPase and its role in pH balance and osmoregulation

Vacuolar-type H+-ATPase (HAT) or V-ATPase are a group of highly conserved membrane- associated enzymes that acidify a wide range of intracellular organelles and pump protons across the plasma membranes in multiple tissue-types. HAT are ATP-dependent proton pumps that couple the energy for ATP hydrolysis to actively transport protons into different compartments of the cell or outside of the cell via the plasma membrane (Forgac, 2007).

HATs are organized into two major multi-subunit functional domains, V0 and V1 that are interconnected to each other. The integral membrane associated V0 domain has six different

subunits (a, d, c, c', c", and e) and the peripherally associated V1 domain consists of eight different subunits (A–H) arranged in different ways to undertake the entire function of this

protein (Kitagawa et al., 2008; Muench et al., 2011; Marshansky et al., 2014; Rawson et al.,

2015) (Fig. 1.4). The A and B subunits of V1 domain possess the main catalytic sites that are

involved in ATP hydrolysis (Saroussi and Nelson, 2009; Nakanishi-Matsui et al., 2010; Toei et

al., 2010). ATP hydrolysis in the V1 domain drives the central rotary mechanism that HATs use to perform their main function, the unidirectional transport of H+ across the cell membrane (Imamura et al., 2003). The major responsibility of the Vo domain is to

translocate protons, where two protons are translocated every time ATP is hydrolysed

(Johnson et al., 1982). The majority of HAT subunits are expressed as multiple isoforms that

have been shown to have tissue-specific expression patterns (Toei et al., 2010). Factors

affecting the regulation of HAT activity include; dissociation of the V1 and V0 domains,

selective targeting of specific HAT units and the strength of coupling between proton

transport and ATP hydrolysis (Kane, 2006; Toei et al., 2010).

Page 18

HAT has been shown to be one of the master enzymes that regulate acid-base balance and

osmoregulation in many organisms (Forgac, 1998; Saliba and Kirk, 1999; Beyenbach, 2001;

Kirschner, 2004; Covi and Hand, 2005). Its involvement in osmoregulation in freshwater taxa

has also been demonstrated by a number of gene expression experiments and protein

activity studies (Faleiros et al., 2010; Lee et al., 2011; Towle et al., 2011). This enzyme

+ −/ − pumps protons to acidify intracellular organelles, thus influencing Na uptake and Cl HCO3

exchange (Weihrauch et al., 2004a; Martin Tresguerres et al., 2006). It also plays a pivotal

role in branchial NH3 excretion (Weihrauch et al., 2002; Weihrauch et al., 2009; Martin et

al., 2011; Weihrauch et al., 2012). Although, expression and activity levels of V(H+)-ATPase

may be regulated by extracellular pH, studies on the effects of pH on this enzyme in

crustaceans to date are rare (Pan et al., 2007; Lucena et al., 2015). In contrast, much more

work has been directed to attempting to understand the effects of salinity on V(H+)-ATPase

activity (Table 1.2).

HAT expression has been found to be commonly up-regulated when individuals are exposed

to low pH or low salinities (Pan et al. , 2007,(Havird et al., 2013). Pan et al. (2007) reported

a negative correlation between expression of HAT and pH level, where this enzyme is highly expressed under low pH conditions but lowly expressed at higher pH. Expression of HCO3-

ATPase was also modified in a pattern similar to HAT, showing peak changes up to 24 h in all treatment groups (pH 7.1, 7.6, 8.6, 9.1 as compared with a control group (pH 8.1). A few studies have also detected the down-regulation of HAT following transfer of individuals between different salinity environments (Havird et al., 2014). Havird et al. (2014) showed

significant decreases in the expression level of HAT when individuals were transferred from

32‰ to 2, 15 and 45‰ between 3 and 48 h post transfer. The lowest decline 24 h post-

Page 19

transfer was at 45‰, where the expression level was 50-fold lower than in control salinity condition. The study, however, did not find any significant changes in HAT expression after

48 h to 7 days (Havird et al., 2014). Lucena et al. (2015) reported significant down-regulation of gill V(H+)-ATPase activity at pH conditions both below and above neutral conditions (pH of

7.5), where they reported a 4-fold decrease at pH 6.5 and 2.5 fold decrease at pH 8.5. This

pattern was observed in both juvenile and adult individuals of the river shrimp, M.

amazonicum. Overall, there is a general pattern that HAT expression is upregulated at low

pH or low salinities and down-regulated at high pH or high salinity levels, but with some

variation among species. It remains to be tested whether HAT expression in freshwater

crayfish responds in similar way.

Figure 1.4 Schematic diagram of V-ATPase (HAT) showing the arrangement of the different subunits

(Beyenbach and Wieczorek, 2006)

Page 20

1.2.4 Arginine kinase and its role in pH balance and osmoregulation

Arginine kinase is an enzyme that plays an important role in maintaining ATP levels in the

cells of invertebrates (Song et al., 2012) and has been suggested to play a role in

osmoregulation and acid-base balance in some crustaceans. In fact, this enzyme has been shown to be differentially expressed in certain crustacean species, when transferred to different ionic conditions (Kinsey and Lee, 2003; Pan et al., 2004; Yao et al., 2005; Liu et al.,

2006; Silvestre et al., 2006; Abe et al., 2007; Song et al., 2012). This pattern does not hold for all decapod crustaceans, as some species show no significant difference in arginine kinase expression when transferred among different ionic conditions. For example, the relative abundance of AK mRNA was not different in the crab species, C. maenus, when individuals were transferred to low salinity conditions (Kotlyar et al., 2000; Towle and

Weihrauch, 2001). While the gene was not differentially expressed, arginine kinase protein levels did increase in low pH treatments where V-type H+-ATPase and cytoplasmic CA

protein abundance also increased. Weihrauch et al. (2001b) studied osmoregulation in

crustaceans, and suggested that AK levels increased in some species, to maintain ATP levels,

that are required for active ion transport and other cellular processes that require ATP. This

hypothesis would explain the increased levels of AK in lower pH treatments when active

transport enzymes are also upregulated. Whether this pattern of increased AK gene

expression at low pH occurs in freshwater crayfish species remains untested.

1.2.5 Ca+2-ATPase and its role in pH balance and osmoregulation

Ca+2-ATPase or the calcium pump is an important enzyme that is required for transbranchial

Ca2+ absorption and secretion (Wheatly et al., 2002; Ahearn et al., 2004). Ca2+-ATPase has

Page 21

been identified from branchial tissues in crustaceans including crayfish and shrimp (Chen et

al., 2002; Gao and Wheatly, 2004b; Gao and Wheatly, 2007; Wang et al., 2013b). It is

commonly located in the basolateral membrane of epithelial cells.

Sarcoplasmic/endoplasmic reticulum Ca2+-ATPase has been identified and characterised in a number of crustaceans (Zhang et al., 2000b; Mandal et al., 2009). This enzyme has also been implicated in the moulting process as it plays an active role in Ca2+ absorption during post-

moult period in crustacea. Molecular data on, and mRNA expression profiles for this

enzyme, however, are still very limited, even though the kinetic characteristics of the Ca2+

pump have been widely studied. The role of Ca2+-ATPase in systematic pH balance need to

be further explored in freshwater crustaceans.

1.2.6 Ion channels involved in pH balance and osmoregulation

A number of ion channels; including the Na+ ion channel, K+ ion channel, Cl- ion channel and

Ca+2 ion channel are involved in direct transport of some key osmoregulatory ions both into

and out of cells in crustaceans. The function of these ion channels can be seen in hyperosmoregulating crustacean taxa, where active NaCl absorption via the epithelium membrane compensates for passive loss of NaCl as a result of an external dilute medium

(Kirschner, 2004). Basolaterally located membrane transporters, including the Na+, K+ and Cl-

channels are ubiquitous in all NaCl absorbing epithelia (Onken et al., 1991; Zeiske et al.,

1992; Onken and Riestenpatt, 1998; Onken et al., 2003).

Epithelial Na+ channels have been identified in gills of the Chinese mitten crab (E. sinensis)

where the majority of osmoregulation and pH balance take place (Riestenpatt et al., 1994).

Basolateral, as well as an apical K+ channel have been identified across split gill lamellae in a

Page 22

number of weak hyperosmoregulators, including C. maenas and C. granulata, using Ba2+ or

Cs+ and short-circuit current analysis (Onken and Graszynski, 1989; Onken et al., 1991;

Riestenpatt et al., 1996; Onken and Riestenpatt, 1998). Onken et al. (1991) also presented additional evidence for a K+ channels when they examined the effects of hemolymph-side

Ba2+ or high K+ on the membrane voltage. Basolateral Cl− channels have also been identified

via transbranchial voltage and short-circuit current analysis in isolated gills of crustacean

taxa (Gilles and Pequeux, 1986; Siebers et al., 1990; Onken et al., 1991; Riestenpatt et al.,

1996). While these ion channels have been identified in the gills of various decapod crustaceans, little is known about whether these genes are expressed in the gills of freshwater crayfish.

1.2.7 Functions of transporters and exchangers in maintaining pH balance and for

osmoregulation

Transporters and exchangers have been identified in crustaceans that play fundamental roles in maintenance of pH balance and osmotic/ionic-regulation. They are associated with active or secondary ion transport in and out of cells. Of these, some of the most important

+ + - + - − – include; the Na /K /2Cl cotransporter, Na /HCO3 cotransporter, Cl /HCO3 exchanger,

+ + + +2 + + Na /H Exchanger, Na /Ca exchanger and the Na /NH4 exchanger (Table 1.2 and 1.3).

1.2.7.1 Na+/K+/2Cl- cotransporter (NKCC)

The Na+/K+/2Cl- cotransporter (NKCC) is a membrane transport protein that assists in active

transport of Na+, K+ and Cl- across cell membranes (Haas, 1994). As NKCC moves each solute in the same direction, sometimes it is termed as a symporter. NKCC that has a 1Na+:1K+:2Cl-

Page 23

stoichiometry, maintains electroneutrality via transport of two positively charged ions

(Na+and K+) in parallel with two negatively charged ions (2Cl-).

Two forms of this protein have been identified, NKCC1 and NKCC2, and are encoded by two different genes referred to as SLC12A2 and SLC12A1, respectively. NKCC1 is usually distributed throughout the body and plays a vital role in exocrine glands (organs that secrete fluids); while NKCC2 is limited to the kidney in invertebrates where it plays an active role in reabsorption of Na+, K+ and Cl- ions into hemolymph (Haas and Forbush III, 2000).

NKCC1 is commonly located in the basolateral membrane of cells. This location in the basolateral membrane, the closest part of the cell from the hemolymph vessels, facilitates

NKCC1 to transport Na+, K+ and Cl- from the hemolymph into the cell (Delpire et al., 1999).

The energy required to move the Na+ ion (along with K+ and Cl- ) across the cell membrane is

supplied by the electrochemical gradient of Na+, and this sodium gradient is established by

the ATP-dependent enzyme Na+/K+-ATPase (NKA).

NKCC has been identified in the crabs, C. maenas and C. sapidus, where strong expression

was found in the posterior gills of C. sapidus (Towle et al., 2001). NKCC has been suggested

to play a vital role in apical NaCl absorption in weak hyper-osmoregulators (see review: Haas

and Forbush III, 2000). Gene expression and relative activities of NKCC have been

investigated in a number of decapod crustaceans (Havird et al., 2013; see details in Table

1.3). In fact, a meta-analysis of 59 published qPCR studies showed that expression and/or

activity levels of NKCC were up-regulated after salinity transfer (Havird et al., 2013). Havird

et al. (2014), however, did not observe any change in NKCC expression levels in an

anchialine shrimp, Halocaridina rubra, after being transferred to 15, or 45‰ salinity from

32‰.; but NKCC was up-regulated slightly after 24 h at 2‰ (2.6 fold).

Page 24

- 1.2.7.2 Bicarbonate (HCO3 ) transporters

- Bicarbonate transporters are a group of proteins, involved in the transport of HCO3 ions,

- + - that drive HCO3 out of the cell while drawing in other important ions (Na and Cl ). This

enzyme is usually located in the apical region of an epithelial cell. The most important

+ - - - bicarbonate transporters in crustaceans are Na /HCO3 and Cl /HCO3 . Bicarbonate transport

is one the principal pH regulators and has been well studied euryhaline crustacean species

(Henry et al., 2003; Weihrauch et al., 2004a; Tsai and Lin, 2007; Freire et al., 2008; Henry et

al., 2012; Romano and Zeng, 2012). This process also plays an important role in movement

of acids and bases in many parts of the body, notably in gills, kidney, hepatopancreas and

- intestine. The presence of Cl /HCO3 exchangers in crustacean gills has been proposed based

- on the equimolar exchange of Cl for HCO3 or because of experiments that have used different anion transport inhibitors to infer their function (Ehrenfeld, 1974; Gilles and

Péqueux, 1985; Gilles and Pequeux, 1986; Péqueux and Gilles, 1988; Lucu, 1989; Onken and

Graszynski, 1989; Onken et al., 1991). Molecular identification and characterization of such exchangers in crustacean gill tissue, however, is still lacking. Like Na+/H+ exchangers, apical

+ - - - Na /HCO3 and Cl /HCO3 may be involved in transbranchial NaCl absorption and in

hemolymph acid–base regulation, but information on this is still lacking. They may also

regulate cell pH and volume when located in the basolateral gill cell membrane. This

enzyme has been well studied in vertebrate animals, but has received much less attention in

crustaceans (Pan et al., 2007).

1.3 Knowledge GAP and Research Questions

Page 25

The genus Cherax, an important group of freshwater crayfish in the family Parastacidae, is

the largest and most widespread group of freshwater crayfish in the southern hemisphere.

It represents an important ecological and evolutionary component of biodiversity in fresh

waters in this region (Riek, 1969; Crandall et al., 1999). Cherax spp. are confined largely to

lakes, rivers and freshwater streams in most regions in Australia and New Guinea

(Munasinghe et al., 2004) with Australia possessing the highest diversity (Riek, 1969;

Crandall et al., 1999). A number of species of Cherax crayfish have natural distributions that

are limited by strict pH ranges and consequently adaptation to these environmental pH may

have occurred in this group. Consequently, the identification of genes involved in systemic

acid-base balance and osmoregulation may be good candidates to examine for evidence of

selection across Cherax species.

Crayfish of the genus Cherax span a diverse range of aquatic environments and can tolerate

fluctuations in a range of environmental parameters, such as pH and salinity (Bryant and

Papas, 2007; McCormack, 2014). Due to the unique physiological characteristics of these

animals and relative economic importance of certain species, they provide models for

physiological and genomic research in crustaceans. Genetic information about Cherax spp.,

however, remains largely limited to mitochondrial and population genetic data (Miller et al.,

2004; Baker et al., 2008; Austin et al., 2014). There is a lack of basic information available on

genes that contribute to pH balance and osmoregulation under different acidic and basic

water conditions, in Cherax, and in freshwater crayfish in general. To date, no studies we are

aware of have attempted to identify or characterise specific candidate genes that are

involved in systemic acid-base balance in freshwater crayfish. This is a large knowledge gap

Page 26

in this economically important group that this study aims to fill by studying these genes in

Cherax crayfish.

Recently a few studies have been conducted on genomics of Cherax species, and only two

stress-related genes, HSP70 (heat-shock protein) and hemocyanin have been characterised

in these species (Fang et al., 2012; Wang et al., 2013a). No studies, to the best of our

knowledge, have focused on either CA gene family or other key osmoregulatory genes such

as Na+/K+-ATPase and H+-ATPase in this group of freshwater crayfish. The focus here,

therefore, will be on the characterization of functional genes and identifying the functional

mutations in carbonic anhydrase genes in addition to other osmoregulation genes or genes

involved in acid-base balance using selected Australian freshwater crayfish species in the genus Cherax. Thus, this project will try to address the following specific questions:

• Which genes are the major genes responsible for pH balance and osmoregulation in

Cherax crayfish?

• Are there any functional mutations at the nucleotide and protein levels between the

same genes (particularly CA gene family, Na+/K+-ATPase and H+-ATPase) in

congeneric Cherax species across Australia?

• Do the expression patterns of these genes vary under natural pH range conditions or

between different tissue types?

1.4 Aims and objectives

The overall aim of the project was to use a functional and comparative genomics approach

to identify a number of potentially important putative or candidate genes and specific

functional mutations in crayfish that affect adaptation to natural environmental pH and

Page 27 salinity ranges where species occur in natural ecosystems. The specific objectives of the project include;

• To sequence and annotate the gill transcriptomes from three economically and

ecologically important Australian endemic freshwater crayfish species; Cherax

quadricarinatus (Redclaw), C. destructor (Yabby) and C. cainii (Marron) and to

identify candidate genes that have potential roles in maintaining pH balance and in

osmoregulation (particularly CA, NKA, and HAT) .

• To document the expression patterns of key genes across a range of sub-lethal pH

treatments in order to determine their roles in maintaining pH balance.

• To generate full-length sequences for specific candidate genes and to compare

patterns of nucleotide and functional variation in the same genes in congeneric

Cherax species that are exposed to a wide diversity of different natural pH

environments.

Page 28

Chapter 2. Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus

Published as:

1. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015. Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus. Gene (Elsevier) 564, 176-187

(http://dx.doi.org/10.1016/j.gene.2015.03.074)

2. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015. Transcriptome analysis and characterisation of gill-expressed carbonic anhydrase and other key osmoregulatory genes in freshwater crayfish Cherax quadricarinatus. Data in Brief (Elsevier) 5, 187- 193.

(http://dx.doi.org/10.1016/j.dib.2015.08.018)

Page 29

Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus

Muhammad Yousuf Ali1, Ana Pavasovic2, Peter B Mather1 and Peter J Prentis1*

1School of Earth, Environmental and Biological Sciences, Queensland University of Technology, Brisbane, QLD

4001, Australia

2School of Biomedical Sciences, Queensland University of Technology, Brisbane, QLD 4001, Australia

* Corresponding author: Peter J Prentis, [email protected]

Email addresses: MYA: [email protected] AP: [email protected] PBM: [email protected] PJP: [email protected]

Page 30

2.1 Abstract

Changes in water quality parameters such as pH and salinity can have a significant effect on

productivity of aquaculture species. Similarly, relative osmotic pressure influences various

physiological processes and regulates expression of a number of osmoregulatory genes.

Among those, carbonic anhydrase (CA) plays a key role in systemic acid–base balance and

ion regulation. Redclaw crayfish (Cherax quadricarinatus) are unique in their ability to thrive

in environments with naturally varied pH levels, suggesting unique adaptation to pH stress.

To date, however, no studies have focused on identification and characterization of CA or

other osmoregulatory genes in C. quadricarinatus. Here, we analysed the redclaw gill

transcriptome and characterized CA genes along with a number of other key

osmoregulatory genes that were identified in the transcriptome. We also examined patterns

of gene expression of these CA genes when exposed to three pH treatments.

In total, 72,382,710 paired end Illumina reads were assembled into 36,128 contigs with an

average length of 800bp. Approximately 37% of contigs received significant BLAST hits and

22% were assigned gene ontology terms. Three full length CA isoforms; cytoplasmic CA

(ChqCAc), glycosyl-phosphatidylinositol-linked CA (ChqCAg), and β-CA (ChqCA-beta) as well

as two partial CA gene sequences were identified. Both partial CA genes showed high

similarity to ChqCAg and appeared to be duplicated from the ChqCAg. Full length coding

sequences of Na+/K+-ATPase, V-type H+-ATPase, sarcoplasmic Ca+-ATPase, Arginine kinase,

calreticulin and Cl- channel protein 2 were also identified. Only the ChqCAc gene showed significant differences in expression across the three pH treatments.

Page 31

These data provide valuable information on the gill expressed CA genes and their expression

patterns in freshwater crayfish. Overall our data suggest an important role for the ChqCAc

gene in response to changes in pH and in systemic acid–base balance in freshwater crayfish.

Key words: Redclaw, Cherax quadricarinatus, gills, osmoregulatory genes, carbonic anhydrase

2.2 Introduction

Crustacean aquaculture is a multi-billion dollar industry, which contributes approximately

9.6% to the global aquaculture production (FAO, 2012). Among the variety of species

commercially cultured, culture of crustacean species has grown more rapidly than finfish

and molluscan production over the last three decades (FAO, 2011). Currently, crustacean

production is dominated by penaeid species, while a significant contribution now comes

from production of freshwater species (29.4%). Of the freshwater crustacean species,

crayfish contributes the highest production, followed by Chinese mitten crab and freshwater

prawns (FAO, 2012). Redclaw crayfish (Cherax quadricarinatus von Martens 1968) are

among the most important commercial species developed for aquaculture production in

Australia and elsewhere around the world, most notably Mexico, Ecuador, Uruguay,

Argentina and China (Macaranas, 1995; FAO, 2010).

As demand for freshwater crustaceans continues to grow, there is pressure to further

develop production for this class of organisms, by exploiting desirable traits and optimising

production practices. Selection of desirable traits has traditionally been associated with

traits or genes relating to growth performance and disease resistance, with less focus on

Page 32

selection of traits, which would deem the culture species ‘hardy’ in light of significant

fluctuations in culture conditions, such as tolerance of changes in pH and salinity.

Fluctuations in abiotic parameters, such as water chemistry, within a production setting

frequently have significant impact on the physiology and growth performance of many

cultured crustaceans. For example, after the euryhaline shrimp (Penaeus latisulcatus) was

exposed to a high salinity (46 ppt), it showed a reduced hepatosomatic index and tail muscle

index (Minh Sang and Fotedar, 2004). Reduced growth performance in this species was

suggested to result from higher energy requirements used to maintain internal ionic

concentration. (Ye et al., 2009) also observed reduced growth performance and poor feed

conversion ratios in tiger shrimp (Penaeus monodon) exposed to either low or high salinities

outside the optimal salinity level of 25 ppt. This resulted from increased energetic

expenditure on molting and excretion in this species. Increased energy expenditure on

osmoregulation can produce many problems in culture including increased moisture content in muscle tissue, increased oxygen consumption and ammonia-N excretion (Silvia et al., 2004). Therefore, a better understanding of the genes that control osmoregulation and their function is required to optimise the production of commercially cultured crustaceans under different water quality parameters.

Ion-regulatory genes have been reported in a number of decapod crustaceans (e.g. Na+/K+-

ATPase (Tsai and Lin, 2007); V-type H+-ATPase (Weihrauch et al., 2001b); Carbonic

anhydrase (CA) and Alkaline Phosphate (Tongsaikling, 2013); Ca2+ATPase (Zhang et al.,

2000a; Gao and Wheatly, 2004a; Tongsaikling, 2013). Among these, CA is one of the master genes that has been reported to be involved in acid-base regulation in a wide variety of

marine crustacean taxa: e.g. shrimp (Gao and Wheatly, 2004a; Pongsomboon et al., 2009;

Page 33

Liu et al., 2010; Pan et al., 2011; Hu et al., 2013); crab (Serrano et al., 2007; Serrano and

Henry, 2008; Liu et al., 2012). Carbonic anhydrases also plays vital role in osmoregulation

+ - because they provide H and HCO3 ions which are used as counterions for exchanging cations and anions, especially Na+ and Cl- (Henry and Cameron, 1983; Henry, 2001; Freire et al., 2008; Henry et al., 2012). Despite its role in acid-balance and osmoregulation, CA has received limited attention in freshwater crustacean taxa (but see (Colbourne et al., 2011)).

In this regard, freshwater crayfish may provide an interesting model for identification and characterising the functions of CA isoforms because these taxa experience hypo-osmotic environments that can vary widely in pH (Baker et al., 2008). The redclaw crayfish, Cherax quadricarinatus, is an excellent candidate to examine CA and other osmoregulatory genes in freshwater crustaceans. This species has a natural range that spans an abrupt environmental (pH) gradient, with populations occurring in waters with low pH (6) (northern

Queensland, Australia) and higher pH (8) (Northern Territory, Australia). Previous research

(Macaranas, 1995) on this species reported a fixed allozyme difference at a carbonic anhydrase (CA) allozyme locus between C. quadricarinatus populations collected from either side of this pH gradient. This locus was the only fixed difference observed across this gradient and the authors of the paper suggest that this CA isoform may play an important role in maintaining systemic acid–base balance and ion regulation under different water chemistries. Consequently, identifying and functionally characterising allelic variants of CA genes in this species will help improve our understanding of how this important freshwater species copes with fluctuations in water quality, in particular pH stress.

To better understand osmoregulation in C. quadricarinatus we sequenced the gill transcriptome of this species to identify endogenous CA genes expressed in gill tissues from

Page 34

individuals exposed to different pH conditions. Gill tissue was chosen for sequencing as it is

the key organ for ion-exchange and acid-base regulation in freshwater crayfish. This

transcriptome sequence was also used to identify other major osmoregulatory genes

including Na+/K+-ATPase, V-type H+-ATPase, sarcoplasmic Ca+-ATPase, arginine kinase,

calreticulin, Cl- channel protein, Na+/K+/2Cl− co-transporters, Na+/H+ exchanger and alkaline

phosphatase. Gene expression patterns of the identified CA genes as well as some of the

osmoregulatory genes were examined when exposed to three pH treatments.

2.3 Material and Methods

2.3.1 Sample Preparation

Live redclaw crayfish (Cherax quadricarinatus) were obtained from Cherax Park Aquaculture,

Theebine, Queensland, Australia. Animals were housed in rectangular glass tanks (capacity

27 L each) and acclimated at 270C, pH 8 and conductivity 500 (μS/cm) for 2 weeks before

the start of the experiment. During the acclimation period all animals were fed regularly

with formulated feed pellets. Water quality was maintained at temperature 27-280C, pH 7.5 and conductivity 450-550 μS/cm with a computer-controlled filtration system (Technoplant).

Feeding was stopped 24 h before the treatment. Animals were distributed into three separate glass tanks (25×18×15 cm) with water temperature set at 25.5±0.90C and

conductivity 521.8±29 (μS/cm). A total of nine individuals (average length 131.9±6 mm and

body weight 56.3±6 g) were used for the experiment. These animals were placed in three

different pH levels (6, 7 and 8), a treatment within the tolerance range of this species

(Macaranas, 1995). Gill tissue was extracted at 3, 6 and 12 h. Continuous aeration was

provided to tanks using aquarium air pumps.

Page 35

2.3.2 RNA extraction, cDNA library construction and sequencing

Prior to tissue extraction, animals were euthanized in crushed ice for 5-10 minutes. Gill tissue were dissected out and immediately stored in RNAlater® solution. Tissues preserved in RNAlater® were stored at -800C prior to RNA extraction.

Total RNA was extracted from the pooled gill tissues, which contained equal amounts of sample from each of the animals from all treatments using a TRIZOL/Chloroform extraction

(Chomczynski and Mackey, 1995) and then purified further using a RNeasy Midi Kit (cat #

75144, QIAGEN). RNA yield and quality were checked using agarose gel electrophoresis, spectrophotometer absorbance and a bioanalyzer using a 2100 RNA nanochip. RNA was sequenced at the Beijing genomics institute and prepared using the same protocol as

(Prentis and Pavasovic, 2014).

2.3.3 De novo assembly and functional annotation

Illumina paired end sequences were assembled into contigs using CLC Genomics Workbench

6.0.2 with multiple kmers of 15, 20, 25, 30, 35, 40 and 45bp. It was found that a kmer of

25bp provided an assembly with the best quality metrics with the fewest chimeric sequences based on CEGMA and CD-Hit (Knudsen T and Knudsen B, 2013). The assembled data were blasted, mapped and annotated using Blast2Go Pro software (Camacho et al.,

2009), while contigs longer than 8000bp were manually blasted. Sequence annotation information was retrieved for sequences that had BLASTx queries that exceeded a stringency of e-value<10-5. For contigs that received significant BLAST hits with protein function information, Gene Ontology (GO) terms were assigned. Gene ontologies from identified ESTs were categorized into GO categories from Biological Process, Molecular

Function and Cellular Component using web-based batch analyzer software ‘CateGOrizer’

Page 36

(Hu et al., 2008). The distribution of the GO categories was mapped using WEGO (Ye et al.,

2006). To predict the metabolic pathways for each contig Enzyme Commission numbers were assigned and the relevant maps from the Kyoto Encyclopedia of Genes and Genomes were downloaded (Kanehisa and Goto, 2000).

2.3.4 Identification of CA and other osmoregulatory genes

The transcriptome data set was examined to identify transcripts that matched CA genes and other major osmoregulatory genes. The identified gene sequences were aligned with the non-redundant protein database at NCBI (National Centre for Biotechnology Information) in order to compare the similarity to previously identified and annotated genes. Following this validation step, three prime and five prime untranslated regions (UTR) as well as open reading frames were determined using ORF Finder. Open reading frames were translated into proteins. The potential cleavage site of the signal peptide was predicted using PrediSi

(PrediSI, 2014) and N-linked glycosylation sites were predicted with N-GlycoSite (Zhang et al., 2004) using NXS/T model (where N=Aspargine, S=Serine, T=Theronine and X=any amino acid). The translated amino acids sequencs were used as BLASTp queries against the NCBI database. Up to 20 top BLAST hits were downloaded for each gene and aligned with the C. quadricarinatus candidate gene in BioEdit (version 7.2.5; Hall, 1999) using a ClustalW alignment platform (Larkin et al., 2007). For the full-length CA genes Neighbour Joining trees were generated in Geneious (version 8.0.4) ) using the Jukes Cantor method with 1000 bootstraps (Kearse et al., 2012). The putative protein domains of the open reading frames was analysed using SMART (Simple Modular Architecture Research Tool) database (Schultz et al., 1998).

Page 37

2.3.5 CA expression patterns under different pH treatments

Live C. quadricarinatus individuals were obtained from Cherax Park Aquaculture, and

acclimated to lab conditions for two weeks under the same conditions as animals used for

RNA sequencing. Following acclimation, animals were transferred to water containing three

pH treatments, pH 6, 7 and 8, which are in a similar range as the two pH environments in

natural habitats. Animals were harvested after 24 hours and gills were extracted

immediately after animals were euthanized in crushed ice for 5-10 minutes. Three replicates animals were used in all experiments. Specific quantitative real-time PCR primers were designed for transcripts that identified as the three CA genes, V-type H+-ATPase, Arginine kinase and 18s rRNA based on the transcripts obtained in our study (Table 2.1). Realtime

PCR conditions included a pre-incubation of 950C for 5 minutes, followed by a total 45 cycles

of three-step amplification of 950C for 10 seconds; 600C for 10 seconds and 720C for 10 seconds using a LightCycler 96 RT-PCR machine and reagents (Roche, Version 04, Cat.

No.06924204001). Ribosomal 18S was used as an internal control gene to normalize sample-

to-sample variations. The relative expression of the target genes were measured as a ratio

(Ratio=concentration of target gene/concentration of 18S gene) using Relative Quant

analysis tool described in the Light Cycler 96 system operator’s guide, version 2.0. An one-

way ANOVA was used to determine if any of the genes showed significant expression

differences across the three pH treatments.

Page 38

Table 2.1 Details of primers used in this study for amplification of the target genes at RT-PCR

’ ’ 0 Target genes Primers Primer Sequence (5 →3 ) Tm ( C) Product Size (bp) Cytoplasmic CA (ChqCAc) CAcF CTTGCTGTCCTGGGAATGTT 64.0 196

CAcR CATAGCATGGTGGAGTGGTG 64.1 GPI-linked CA (ChqCAg) CAgF GGCACTAGGCTCTGAACACA 57.0 149

CAgR CTGACACCTCCAGCATCACT 56.8 Beta CA (ChqCAb) CAbF CAGTTTGAGGTTGTGCGAGA 64.1 168

CAbR CTCCTCATGCCCACAAAGAT 64.0 Na+K+ATPase alpha NaKF TGGTGTTGAGGAGGGAAGAC 64.2 130

NaKR ACCCAATGGTAGAGGCACAG 63.9 V-typeH+ATPase alpha VHaF ATCGAGTATTGGCTGCTGCT 63.8 142

VHaR ACTGGGATCCAACATTCAGC 63.9 Calreticulin CalF TACCAGATCCTGATGCCACA 64.2 106

CalR GGCTTCCATTCACCCTTGTA 63.8 Ca+2 ATPase Ca+2ATPF TGGCTCTTCTTCCGCTACAT 63.8 107

Ca+2ATPR TAGCTCAAGTGAGGGCCAGT 63.9 Arginine kinase AKF GGAGGATCATCTCCGCATTA 63.9 103

AKR GGGAACACGCTTTTCAATGT 63.8 Chloride channel protein Cl-ChF CTCCGAAAAGCGACGTAAAG 63.6 196

Cl-ChR ACGGGAGAGTGAGCGACTAA 63.9

2.4 Results

2.4.1 Sequencing and assembly

Transcriptome sequencing of the C. quadricarinatus gill library resulted in over 72 million

(72,382,710) high quality paired end sequence reads after low quality reads were removed.

Over 36 thousand (36,128) contigs with a length greater than 300 bp were assembled. The average contig length was 800 bp, the N50 was 936 bp and the longest contig was 14,972 bp

(Table 2.2).

Page 39

2.4.2 Mapping and functional annotation

Almost 37% of contigs (13,355) received significant BLASTx hits (S Fig. 2.1 in Appendix 1).

Overall there was a negative relationship between BLAST success and contig length, with contigs shorter than 800 bp in length having low BLASTx success. Of contigs receiving significant BLASTx hits, the most common top hit species was Daphnia pulex, a distantly related microcrustacean species, but currently the only crustacean with a complete genome sequence. Arthropod species represented the majority of top BLAST hits (17% of the total

Top-BLAST Hits; and 76% of the top 30 Species) (S Fig. 2.2 in Appendix 2). Twenty two percent of contigs (7,975) were assigned Gene Ontology (GO) terms (S Fig. 2.1 in Appendix

1). In total 48,684 GO terms were assigned to contigs, based on GO classification.

Approximately 48.5%, 29.2% and 22.3% of the GO terms were assigned to Biological

Processes, Molecular Function and Cellular Component GO categories, respectively (S Fig.

2.3 in Appendix 3). Sequences that had valid enzymes codes were assigned to 118 different

KEGG pathways. Contigs were most commonly assigned to purine metabolism (201 sequences, 42 enzymes), oxidative phosphorylation (94 sequences, 8 enzymes) and nitrogen metabolism (85 sequences, 13 enzymes).

Page 40

Table 2.2 Summary statistics for assembled contigs generated from C. quadricarinatus gill transcriptomes.

Statistics bp/number Total number of contigs: 36 128 N50 936 bp N75 535 bp N25 1835 bp Mean contig length 800 bp Minimum contig length 283 bp Length of the longest contig 14 972 bp Number of contigs longer than 500 bp 20 554 Number of contigs longer than 1500 bp 3807 GC content 43%

2.4.3 Identification and characterization of carbonic anhydrase (CA) genes

From BLASTx searches we were able to identify five transcripts belonging to the CA gene family. The CA transcripts included three complete CA isoforms; a cytoplasmic CA (ChqCAc,

KM538165), a glycosyl-phosphatidylinositol-linked CA (ChqCAg, KM538166), and a β-CA

(ChqCA-beta, KM538167); as well as two partial CA cds, ChqCA-p1 (KM610228) and ChqCA- p2 (KM880150). The open reading frames of the three full length transcripts: ChqCAc,

ChqCAg and ChqCAb were validated using RT-PCR and matched the transcript sequences with 100% nucleotide identity.

The cytoplasmic CA transcript (ChqCAc, KM538165) was 1527 bp in length and contained a

78 bp 5′-UTR, 816 bp ORF (including the stop codon), and a 633 bp 3′-UTR (Fig. 2.1). The deduced protein encoded by ChqCAc contained 271 amino acids, no signal peptide and contained two putative N-glycosylation motifs: NKS (aa. position 122) and NGS (aa. position

187). A possible polyadenylation cleavage signal (ATTTA) was detected 75bp downstream from the stop codon. A eukaryotic-type carbonic anhydrase domain was detected within the deduced polypeptide (aa. residues: 4-265 and e-value 7.07×e-102). These characteristics suggest that ChqCAc is a cytoplasmic carbonic anhydrase gene.

Page 41

A BLASTp search determined that the ChqCAc was highly conserved in decapod crustaceans and had greatest similarity with cytoplasmic CA isoforms from P. monodon (76% identity),

Litopenaeus vannamei (76% identity), and Callinectes sapidus (73.8% identity). Multiple alignment of the ChqCAc with the homologous genes in arthropods, fish and humans showed that three histidine residues involved in the zinc binding network (Histidine-94,

Histidine-96 and Histidine-119 using CA-II of Homo sapiens as a reference) were conserved in all the aligned sequences (Fig. 2.2). Amino acid residues associated with the hydrogen bond around the active site were also conserved.

The transcript identified as the glycosyl-phosphatidylinositol (GPI)-linked CA isoform of C. quadricarinatus (ChqCAg, KM538166) contained a total 3352 bp of nucleotide sequence consisting of 83 bp 5′-UTR, 933 bp ORF (including the stop codon), and a 2336 bp 3′-UTR (S

Fig. 2.5 in Appendix 5). The open reading frame was translated into a protein sequence and the predicted protein was 310 amino acids and identified as a membrane-associated GPI- anchored protein with an N-terminal signal (Met1 to Gly22). A single N-glycosylation motif,

NIK, was identified at position 189. Five possible polyadenylylation cleavage signals (mRNA instability motif ATTTA) were predicted in the 3’ UTR region (S figure 2.5 in Appendix 5). A eukaryotic-type carbonic anhydrase domain was identified within the translated polypeptide (amino acid residues: 28-281 and e-value 6.9×e-119).

Page 42

1 gtg ctc ttc cga tct cct taa acg tgc aag tga agg tac gct ctt 45 46 tcc tcc gct cct cta ctc ttc tac caa ttt gaa ATG GTC GGC TGG 90 M V G W 91 GGA TAC GCA AAG GCA AAC GGA CCC GCC ACT TGG CCA AAC CTG TTT 135 5 G Y A K A N G P A T W P N L F 19 136 CCC ATC GCA GGT GGA AGG CGG CAG TCC CCT ATT GAT ATC AAG TGC 180 20 P I A G G R R Q S P I D I K C 34 181 GAG GCT TGC CAG AAA GAT TCC AGT CTT TCC AAG ATC CAG GCT GTG 225 35 E A C Q K D S S L S K I Q A V 49 226 TAC AGC GGC ATC AAG GTC TCA GAG TTG TCT AAC ACG GGA CAC GCC 270 50 Y S G I K V S E L S N T G H A 64 271 TGG AAG GCA CAA GTC TCC GGA GGC AGT TCA AGC CTG AAG GGC GGT 315 65 W K A Q V S G G S S S L K G G 79 316 CCA CTG GGC ACT GAC GAG TAC GTG CTA GAA CAG TTC CAC TGT CAC 360 80 P L G T D E Y V L E Q F H C H 94 361 TGG GGC AAG ACC AAC GAC AAA GGT TCA GAA CAC ACT GTC AAT GGC 405 95 W G K T N D K G S E H T V N G 109 406 AAG TGC TAC GCT GCT GAG CTA CAC TTG GTA CAC TGG AAT AAG AGC 450 110 K C Y A A E L H L V H W N K S 124 451 AAA TTC TCA AGC TTT GCT GAA GCA GCA TCC TCT GAC GGC GGT CTT 495 125 K F S S F A E A A S S D G G L 139 496 GCT GTC CTG GGA ATG TTT TTA GAG GTT GGC AGT GAA CAC GAG GAA 540 140 A V L G M F L E V G S E H E E 154 541 CTG AAC AAG GTG TGC AAG CTA CTA CCC TTC GTG CAA CAC AAG GGT 585 155 L N K V C K L L P F V Q H K G 169 586 CAG GCT ATT ACT GTC ACT GAA CCA ATC AGT CCA GCT GCG TTC ATC 630 170 Q A I T V T E P I S P A A F I 184 631 CCC AAA AAT GGC TCC TAC TGG ACA TAT GCT GGC TCC CTC ACC ACT 675 185 P K N G S Y W T Y A G S L T T 199 676 CCA CCA TGC TAT GAG TCT GTC ACC TGG ATC GTA TAC GAA CAT CCC 720 200 P P C Y E S V T W I V Y E H P 214 721 ATC CAG GTG TCT CAG ACA CAG ATG GAC GCT TTC AGG TCA ATG AAG 765 215 I Q V S Q T Q M D A F R S M K 229 766 TCT TAT CAT CCT TGC GAG ACT TGT CCT GAG GAT GAG CTA GCA GGA 810 230 S Y H P C E T C P E D E L A G 244 811 GCA CTG GTT GAA AAC TAT CGA CCC CCG TGT CCT CTC TGT GAC CGA 855 245 A L V E N Y R P P C P L C D R 259 856 GTT GTC AGA GTT TAC AAG GAT TCA GTA CAA GAG GAA TAA tca gtc 900 260 V V R V Y K D S V Q E E * 272 901 tac aga aat cgc tat act gga ctg cat ata caa aaa tag tgt ctg 945 946 aac atg ata aaa att ggc acg tat att tac att ctg att atg cag 990 991 aaa ctg aag tga cga ttg tat ttc agg gca ttg tat tat tgt gaa 1035 1036 tgg cac aag aaa cat tta aaa aga atg aag gtg tgt atc tca taa 1080 1081 atg aaa act gac ttg aag ctt tcg gag gct aaa att ata cag tac 1125 1126 cat atg cag aaa tca att tta aaa gca aga taa ata att gtt gaa 1170 1171 agg gac ttt att aag cag cag cga tag tta taa ata aaa cca ata 1215 1216 cag gac caa ata gca aga gga gca gga cat tgt cga gaa cca acg 1260 1261 aga gga aca cag tac taa gaa ccc agc aac agc acc tcg ata cca 1305 1306 aga acc aac aag agg atc aca gta cca aga acc aac aag agg agc 1350 1351 aca gtg cca aga acc aaa agg agg aac aca gta cca aga acc atc 1395 1396 aag aac agc aca gtg cca aga acc aaa aga agg aac aca gta cca 1440 1441 agt acc aac aag agc agc agg gta cca aaa tct aac aac aat aca 1485 1486 aac aat cat aac tca gtc ctg tat tgt gct ttg caa cac aca 1527

Figure 2.1 Full length nucleotide sequences of cytoplasmic carbonic anhydrase (ChqCAc)

Full length nucleotide sequences along with corresponding deduced amino acid sequences of a CAc (cytoplasmic carbonic anhydrase, ChqCAc: KM538165) cDNA amplified from the gills Redclaw crayfish, C. quadricarinatus. Sequences are numbered at both sides of each line. The start codon and stop codon are in bold. N-linked glycosylation sites (NXS/T) are shaded and in bold. One putative AU-rich mRNA instability motif (polyadenylylation cleavage signal) (ATTTA) is in bold and underlined. 3’ and 5’ untranslated regions (UTR) are in small letters and expressed codons (CDS) are in capital letters.

Page 43

Figure 2.2 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus cytoplasmic carbonic anhydrase isoform (ChqCAc)

Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus CAc isoform (cytoplasmic carbonic anhydrase, ChqCAc: KM538165) with some representative cytoplasmic CA protein sequences from crustaceans: tiger shrimp Penaeus monodon (PmCA: ABV65904), white shrimp Litopenaeus vannamei CAc (LvCAc: ADM16544), blue crab Callinectes sapidus (CasCAc: ABN51213) and horse crab Portunus trituberculatus (PtCAc: AFV46144); the insects: mosquito Aedes aegypti CA (AaCA: XP_001650043), Anopheles gambiae CA (AgCA: ABF66618) and fruit fly Drosophila melanogaster CA-I (DmCA: NP_523561); sea lamprey Petromyzon marinus CA (PmaCA: AAZ83742); winter flounder Pseudopleuronectes americanus CA (PaCA: AAV97962); and human Homo sapiens CA-I (HsCA-I: NP_001729), CA-II (HsCA-II: NP_000058), CA-III (HsCA-III: NP_005172). Colours indicate the similarity. The symbols under the sequences: + signs indicate all putative

Page 44 active site residues; z represents the predicted Zinc-binding histidine residues; black dots localize the active- sites involved in hydrogen bond network.

Figure 2.3 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus membrane-associated isoform (ChqCAg)

Page 45

Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus CAg isoform (Glycosyl-phosphatidylinositol-linked carbonic anhydrase, ChqCAg: KM538166) with some representative GPI- linked CA isoform sequences from the crustaceans such as the blue crab Callinectes sapidus (CasCAg: EF375491), the horse crab Portunus trituberculatus (PtCAg: AFV46145), white shrimp Litopenaeus vannamei (LvCAg: AGC70493) and the littoral crab Carcinus maenas (CmCAg: ABX71209); from the insect Anopheles gambiae (AngCA: ABF66618); from the vertebrates such as the batrachian Xenopus laevis (XelCA: AAH42287), the agnatha Petromyzon marinus (PmCA: AAZ83742), the teleostei Tribolodon hakonensis CA-II (TrhCA: BAB83090) and the mammal Homo sapiens (HsCA-I: NP_001729; HsCA-II: NP_000058; HsCA-III: NP_005172). Colours indicate the similarity. The symbols under the sequences: + signs indicate all putative active site residues; z represents the predicted Zinc-binding histidine residues; black dots localize the active-sites involved in hydrogen bond network.

The ChqCAg predicted protein shared strong similarity with GPI-linked CA isoforms

identified in other crustacean taxa (C. sapidus: ABN51214, 74% identity; L. vannamei :

AGC70493, 73% identity; P. trituberculatus: AFV46145, 73% identity). Multiple alignment of the ChqCAg with the homologous genes in arthropods and vertebrates revealed that three histidine residues involved in the zinc binding were conserved as well as amino acid residues involved in the hydrogen bond around the active site (Fig. 2.3).

The β-CA transcript (ChqCA-beta, KM538167) was 1021 bp in length and consisted of a 194 bp 5′-UTR, 768 bp ORF (including the stop codon), and a 59 bp 3′-UTR. The coding sequence produced a predicted protein of 255 amino acids with no signal peptide sequence and no N- glycosylation motifs. No polyadenylylation cleavage signal was identified in the 3’ UTR region. The predicted ChqCA-beta protein contained a conserved β-CA-super family domain

(residues: 27-229 and e-value 6.84×e-36).

BLASTp analysis of the ChqCA-beta protein determined that it had high similarity to other β-

CA proteins identified in arthropods including D. pulex (EFX79480, 63% identity);

Acyrthosiphon pisum (XP_001943693, 65% identit) and Nasonia vitripennis (XP_001606972,

64% identity). Multiple alignment of the ChqCA-beta protein with homologous proteins in arthropod species identified that four amino acid residues involved in zinc binding, C-39, D-

Page 46

41, H-102 and C-105, were conserved (Fig. 2.4) as were amino acid residues associated with the hydrogen bond around the active site.

Figure 2.4 Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus β-CA isoform (ChqCA- beta)

Multiple alignment of deduced amino acid sequences of a complete C. quadricarinatus β-CA isoform (Beta carbonic anhydrase, ChqCA-beta: KM538167) with some representative β-CA isoform sequences from the microcrustacean Daphnia pulex (DapCA-beta: EFX79480); from the small arthropods such as the insects, pea aphid Acyrthosiphon pisum (AcpCA-beta: XP_001943693), small fly Nasonia vitripennis (NavCA-beta: XP_001606972), the ant Camponotus floridanus (CafCA-beta: EFN64927), the jumping ant Harpegnathos saltator (HasCA-beta: EFN90033), the ant Acromyrmex echinatior (AceCA-beta: EGI68846), the red dwarf honey bee Apis florea (ApfCA-beta: XP_003692734), the alfalfa leafcutter bee Megachile rotundata (MerCA-

Page 47 beta: XP_003699501), the southern house mosquito Culex quinquefasciatus (CuqCA-beta: XP_001849341),the fruit fly Drosophila mojavensis (DrmCA-beta: XP_001999442) and the silkworm Bombyx mori (BomCA-beta: XP_004922999). Colours indicate the similarity. The symbols under the sequences: z represents the predicted active-site Zinc-binding residues.

The partial coding sequence of a different CA gene, which we named ChqCA-p1 (KM610228) was 390bp in length and consisted of 386 bp of coding sequence (128 amino acids) and a

4bp 5’ UTR region. One putative N-glycosylation motif: NRT (amino acid position 30) was identified in the ChqCA-p1 predicted protein sequence. Homology searches determined that the ChqCA-p1 protein showed some similarity with GPI-linked CA isoforms identified in other crustacean taxa including; L. vannamei (AGC70493, 40% identity), C. maenas

(ABX71209, 42% identity) and P. trituberculatus (AFV46145, 42% identity). A second partial transcript, which we named ChqCA-p2 (KM880150) was 495 bp in length and translated into a partial protein of 165 amino acids. No start codon; stop codon or N-glycosylation site could be identified in the partial transcript. ChqCA-p2 was similar with the ChqCAg transcript in both the nucleotide and protein sequence. BLASTp analysis determined that this sequence was similar to GPI-linked CA isoforms from other crustacean taxa including; P. trituberculatus (AFV46145, 52% identity), C. maenas (ABX71209, 52% identity) and C. sapidus (ABN51214, 51% identity).

2.4.4 Phylogenetic analysis of carbonic anhydrase

A Neighbour Joining tree of the translated CA transcripts identified in this study showed that the ChqCAc transcript clustered cytoplasmic CA forms from arthropods, fish and humans

(Fig. 2.5). The ChqCAg transcript was resolved in well supported clade that contained GPI- anchored CA from arthropods. The partial transcript, ChqCA-p2 was sister to the GPI-linked

CA clade indicating that it shared a close relationship with the GPI-linked CA proteins from

Page 48 arthropods. The ChqCA-beta transcript and one partial CD (ChqCA-p1) could not be aligned with other CA proteins and were excluded from this analysis.

Figure 2.5 Bootstrapped neighbor-joining tree of deduced amino acid sequences showing relationships between the genes identified from our study Bootstrapped neighbor-joining tree of deduced amino acid sequences showing relationships between the genes identified from our study Cherax cytoplasmic carbonic anhydrase (ChqCAc:KM538165), Cherax Glycosyl-phosphatidylinositol-linked carbonic anhydrase (ChqCAg:KM538166, Cherax carbonic anhydrase partial cds (ChqCAp2: KM880150) and other CA isoforms: horse crab Portunus trituberculatus CAc (AFV46144), Portunus trituberculatus CAg (AFV46145), tiger shrimp Penaeous monodon (ABV65904); the blue crab C. sapidus CAc (ABN51213); C. sapidus CAg (ABN51214); white leg shrimp Litopenaeus vannamei CAc (ADM16544), Litopenaeus vannamei CAg (AGC70493); littoral crab Carcinus maenas (ABX71209), mosquito Aedes aegypti (XP_001650043), Anopheles gambiae (ABF66618), fruit fly Drosophila melanogaster (NP_523561), honey bee Apis mellifera (XP_392359), silk worm Bombyx mori (NP_001040186), flour beetle Tribolium castaneum (XP_974322), lamprey Petromyzon marinus (AAZ83742) and winter flounder Pseudopleuronectes americanus (AAV97962), and Homo sapiens CA-I (NP_001729), CA-II (NP_000058), CA-III (NP_005172), CA-IV (NP_000708), CA-V (NP_001730), CA-VI (NP_001206), CA-VII (NP_005173) CA-RP-VIII (NP_004047), CA-IX (NP_001207), CA-RP-X (NP_001076002), CA-RP-XI (NP_001208), CA-XII (NP_001209), CA- XIII (NP_940986) and CA-XIV (NP_036245). In the figure c, g and p after CA indicate cytoplasmic, GPI-linked (Glycosyl-phosphatidylinositol-linked) and partial cds respectively.

Page 49

2.4.5 Identification of additional osmoregulatory genes

We identified over a hundred different transcripts from C. quadricarinatus gills that had

been previously reported to be associated with osmoregulation, acid-base balance and ion

transport in other (Appendix 8). Of these transcripts, major osmoregulatory genes

previously identified in crustaceans included Na+/K+-ATPase, V-type H+-ATPase, sarco/endoplasmic reticulum Ca+-ATPase (SERCA), alkaline phosphatase, arginine kinase,

+ + − + + + − calrecticulin, Na /K /2Cl cotransporter (NKCC), Na /H exchanger, Na /HCO3 cotransporter

and Cl- channel protein (Table 2.3). For example, we identified multiple subunits of V-type

H+-ATPase including the alpha, B, C, D and H subunits. A number of other solute carrier gene

families were also identified.

Table 2.3 List of top candidate genes involved in pH and/or salinity balance identified from the gill transcriptomes of C. quadricarinatus.

Function Gene name Contig Contig ORF ORF CD GenBank number length (aa) position type Accession (bp) # pH balance Cytoplasmic carbonic anhydrase 720 1527 271 79-894 Full KM538165

pH balance GPI-linked carbonic anhydrase 458 3352 310 84-1016 Full KM538166

pH balance β-Carbonic anhydrase 19805 1021 255 195-962 Full KM538167

pH balance Carbonic anhydrase alpha 2595 549 165 1-495 Partial KM880150

pH balance GPI-linked CA 2596 390 128 4-389 Partial KM610228

salinity Na+/K+-ATPase alpha subunit 246 2391 673 19-2040 Full KM538168 regulation pH/salinity V-type H ATPase alpha subunit 791 2959 820 129-2591 Full KM538169 regulation pH/salinity V-type H ATPase 116 kda subunit 15404 1898 593 86-1867 Full KM610229 regulation a isoform 1 pH/salinity V-type H ATPase Subunit B 395 2008 489 83-1522 Full KM880151 regulation pH/salinity v-type H ATPase Subunit C 2517 1348 386 101-1261 Full regulation KP063232 pH/salinity V-type-H-ATpase Subunit H 2008 2070 478 52-1488 Full regulation KP063233 salinity Sarco/endoplasmic reticulum 2145 4631 1020 375-3437 Full KM538171 regulation Ca2+-ATPase salinity Arginine kinase 30 1197 210 242-874 Full KM610226 regulation salinity Calreticulin 929 1722 402 124-1332 Full KM538170 regulation salinity Cl- channel protein 2 3994 2408 686 41-2101 Full KM610227 regulation salinity Alkaline phosphatase 13232 1115 361 28-1113 Partial KM610230 regulation

Page 50

+ - pH/salinity Na /HCO3 cotransporter 4984 2023 614 180-2022 Partial KM659402 regulation - salinity Cl /HCO3 exchanger 5045 1471 463 81-1470 Partial KM659403 regulation salinity K+/Cl- symporter 28739 445 128 28-444 Partial KM880152 regulation pH/salinity Na+/H+ exchanger 3 5168 2826 935 21-2825 Partial KM880153 regulation salinity Na+/Ca2+ exchanger 1-like 2402 2687 835 178-2685 Partial KM880154 regulation

2.4.6 CA expression patterns under different pH treatments

The only transcript to show significant changes in expression levels across the three pH

treatments was ChqCAc (F2 = 14.6064; P < 0.005). This transcript was most highly expressed

in the pH 6 treatment and had decreased expression at both the pH 7 and 8 treatments. The

mRNA expression of CAs showed about 2-fold increase in pH 6 after 24 h, as compared to

that of pH 7 and it was approximately 6-fold when compared to pH 8 (Fig. 2.6). The V-type

H+-ATPase subunit A transcript showed a trend in its expression pattern similar to that of

ChqCAc, but did not show differential expression (F2 = 5.0104; P = 0.053). The ChqCA-beta

transcript was very lowly expressed and we could not determine reliable expression results

for this transcript. All other transcripts were not differentially expressed across the pH

treatments.

Page 51

Figure 2.6 Relative mRNA expression levels of Cytoplasmic carbonic anhydrase, GPI-linked carbonic anhydrase, V-type H- ATPase and Arginine kinase.

Relative mRNA expression levels of Cytoplasmic carbonic anhydrase (ChqCAc), GPI-linked carbonic anhydrase (ChqCAg), V-type H-ATPase and Arginine kinase observed after 24hrs. Relative expression levels were calculated as a ratio (conc. of target gene/conc. of 18S gene), using 18S as a reference gene.

2.5 Discussion

The data generated in this study contributes to our understanding of the genes involved in

acid-base balance in freshwater crayfish, while also providing genomic resources for a non-

model crayfish for which limited transcriptome data currently exists (Yudkovski et al., 2007;

Glazer et al., 2013). We identified 21 different genes, which have been shown to play an important role in osmoregulation or acid-base balance in other crustacean species. In

addition, this study demonstrated that the expression of cytoplasmic carbonic anhydrase is

significantly affected by changes in water pH, but not the GPI-linked or beta carbonic

anhydrase genes.

Page 52

2.5.1 Carbonic anhydrase genes in Cherax quadricarinatus

Carbonic anhydrase is a universal and well-studied transport-related enzyme in crustaceans.

A substantial number of studies have been undertaken on its occurrence, biochemical- and molecular characteristics, expression levels and physiological role in decapod crustaceans

(Henry and Cameron, 1982; Henry and Kormanik, 1985; Wheatly and Henry, 1987; Böttcher et al., 1990; Böttcher et al., 1991; Onken and Riestenpatt, 1998; Henry et al., 2002; Henry et al., 2003; Henry and Campoverde, 2006; Roy et al., 2007; Serrano et al., 2007; Serrano and

Henry, 2008). In this study we present the full coding sequence of three distinct gill- expressed CA isoforms (cytoplasmic, GPI-linked and β-class CA) in redclaw crayfish as well as information on their expression patterns in response to changes in water pH. The existence of multiple alpha CA genes in the gills of freshwater crayfish supports previous biochemical and physiological research which demonstrated the existence of two different CA types in crustacean gills; a cytoplasmic and a membrane-associated CA (Serrano et al., 2007; Serrano and Henry, 2008; Jillette et al., 2011). More recently we have also identified these CA isoforms in Cherax cainii and C. destructor, which are similar in length and sequence identity

(Ali et al., 2015a).

The cytoplasmic CA (ChqCAc) identified here was similar both in length and amino acid composition to cytoplasmic CA from other crustaceans (Serrano et al., 2007; Pongsomboon et al., 2009; Liu et al., 2012; Hu et al., 2013). This cytoplasmic CA was the only gene differentially expressed among pH treatments indicating that it may play an important role in acid-base balance in this species. Previous research has shown that the expression of cytoplasmic CA is strongly induced in crustaceans by changes in water salinity (Serrano and

Henry, 2008). The expression of CAc is more pronounced when exposed to low salinity,

Page 53

rather than in high salinity (Henry et al., 2012). In our study, we observed about 2-fold and

6-fold increase in mRNA expression of CAc after 24 h exposure to low pH (pH 6), as compared to that of pH 7 and pH8 respectively (Fig. 2.6). Some previous studies have reported approximately 10-fold increase of CAc expression in the posterior gills of both C. sapidus and C. maenas after 6 h of low salinity transfer, and the expression level increased to approximately 100-fold on 24 h post-transfer and remained static onwards (Serrano et al., 2007; Serrano and Henry, 2008). It is suggested that this change in expression occurs

+ − + + because cytoplasmic CA provides the counter ions H and HCO3 ions to the Na /H and

− − Cl /HCO3 exchanger to drive ion uptake in the gills of crustaceans when exposed to low

salinity or pH environments (Henry and Cameron, 1983; Henry, 1988; Henry, 2001).

Consequently, we hypothesise that the C. quadricarinatus cytoplasmic CA isoform may play

an important role in maintaining internal pH conditions in high and low pH streams across

northern Australia.

The membrane-associated GPI-linked CA from redclaw (ChqCAg) was similar to homologous proteins from other decapod crustaceans. We found no evidence that this enzyme was differentially expressed in response to changes in pH. This result is similar to previous studies on osmoregulation in crustaceans (Henry, 1988; Serrano et al., 2007), which have found that the change in expression of membrane bound isoform was much less than for the cytoplasmic form when exposed to low salinity conditions. The difference in expression levels of ChqCAc and ChqCAc can be attributed to isoform-specific physiological functions.

The presence of CAg is mainly on the outer membrane of the cells that is believed to

- facilitate the mobilization of hemolymph HCO3 to molecular CO2 and assist in CO2 excretion

Page 54 through the gills (Henry, 1987). Thus, we hypothesise that this gene may play a less important role in acid-base balance in freshwater crayfish than cytoplasmic CA.

Here we identified and characterized a novel β-CA gene (ChqCA-beta) which represents the first full sequence of a beta CA gene from a crayfish (C. quadricarinatus). β-CAs have been observed and well documented in archaea, bacteria, algae and fungi; in most plants; and in some invertebrates (Hewett-Emmett, 2000; Zimmerman and Ferry, 2008), but their activity are still not clear in the animal kingdom. Previously the presence of β-CAs in the animal kingdom was controversial and sometimes ignored as they seemed to be uncommon or result from poor quality sequences (Zimmerman and Ferry, 2008). However, β-CA genes have recently been reported in the microcrustacean D. pulex (Colbourne et al., 2011) and also in other arthropods (Zimin et al., 2008; Syrjanen et al., 2010; Werren et al., 2010;

Nygaard et al., 2011). More recently, we have also characterized β-CA in other freshwater crayfish Including C. destructor and C. cainii .These results suggest that β-CA is widespread in arthropods. The β isoform of CA has not previously been identified in the genomes of vertebrate species and the loss of β-CA gene in the chordate lineage might have occurred either in the last common ancestor of all chordates (Syrjanen et al., 2010). Our rt-PCR results show that CA-β gene was expressed in the gills of C. quadricarinatus at very low expression levels compared the other CA genes. This indicates that the β isoform of CA identified here does not play an important role in acid-base balance in freshwater crayfish.

In fact, recent studies have shown that the homologous β CA protein from Drosophila is a highly active mitochondrial enzyme (Syrjanen et al., 2010). Previous papers show that

− mitochondrial CAs have a functional role in the CO2/HCO3 interaction by providing counterions for the uptake of energy-linked mitochondrial Ca2+ (Dodgson et al., 1980).

Page 55

Although β-CAs catalyse a similar reaction as other CA isoforms there are some important structural differences between these classes. In α-, γ- and δ-CAs the active Zn-binding site is

coordinated by three histidines (Fig. 2.2 and 2.3), whereas in β-CAs it is linked with one

histidine and two cysteine residues (Cox et al., 2000). In spite of this structural difference, β-

+ CAs basically follow the same molecular mechanism for reversible hydration of CO2 into H

and HCO3- like α-CAs (Strop et al., 2001). Our limited gene expression data suggest no major

function of β-CAs in pH balance in freshwater crayfish. However, to confirm the activities of

β-CAs in crayfish and other decapod crustaceans, more detailed physiological and

biochemical investigations are needed.

The two partial CA transcripts identified, ChqCA-p1 and ChqCA-p2 showed greatest protein similarity with the GPI-linked CA isoform (S Fig. 2.4 in Appendix 4; Ali et al., 2015c). As these genes show greatest similarity with the GPI-linked CA isoform we hypothesise that these transcripts may represent duplicated copies of ChqCAg. GPI-linked carbonic anhydrase genes show evidence of duplication in a range of species including fish and other vertebrates (Tolvanen et al., 2013). In fact, it has been hypothesised that the extensive duplication of GPI-linked carbonic anhydrase genes in fish has resulted in different isoforms undertaking slightly different roles in breathing and acid excretion (Tolvanen, 2013). As crayfish also inhabit an aquatic environment the duplication of GPI-linked carbonic anhydrase genes in C. quadricarinatus may also have different functions in similar physiological processes in these species.

2.5.2 Other candidate osmoregulatory genes in Cherax quadricarinatus

We have found a number of candidate genes that have previously been identified as playing

a role in osmoregulation and pH balance in crustaceans. Many of these genes have been

Page 56

shown to be important for adaptation in response to salinity gradients and also in stress response to abrupt changes in pH or water chemistry (Henry et al., 2002; Serrano and

Henry, 2008; Liu et al., 2010; Havird et al., 2013). One group of candidate genes of particular

interest are those involved in ion transport and systemic acid–base balance. These genes

included sodium-potassium ATPase, sarco/endoplasmic reticulum Ca2+-ATPase, arginine

+ + + − kinase, calreticulin, Na /H exchanger, Na /HCO3 cotransporter, alkaline phosphatase, multiple subunits of vacuolar proton pump and a number of different genes from the solute carrier gene family. In this section, we will discuss two of these genes for which we had gene expression data, V-type H+-ATPase and arginine kinase, and whether they may play an important role in acid-base balance in freshwater crayfish.

2.5.3 Vacuolar-type H+-ATPase

The V-type H+-ATPase is a key enzyme that regulates osmoregulation and pH balance in many organisms (Forgac, 1998; Saliba and Kirk, 1999; Beyenbach, 2001; Kirschner, 2004;

Covi and Hand, 2005). Its involvement in freshwater osmoregulation has also been shown by a number of studies of gene expression and protein activity (Faleiros et al., 2010; Lee et al.,

2011; Towle et al., 2011). This protein pumps protons to acidify intracellular organelles and

− − + in this process influence HCO3 and Cl exchange and Na uptake (Weihrauch et al., 2004a;

Martin Tresguerres et al., 2006) and also plays a vital role in branchial NH3 excretion

(Weihrauch et al., 2002; Weihrauch et al., 2009; Martin et al., 2011; Weihrauch et al., 2012).

The large number of V-type H+-ATPase subunits expressed in the gills of C. quadricarinatus suggests that it may play an important role in this tissue. The gene expression data for V- type H+-ATPase subunit A was close to significant; so it may play a role in acid-base balance

in crustaceans. Further gene expression studies on this gene with greater replication than

Page 57 used in the current study may elucidate whether V-type H+-ATPase subunit A is involved in acid-base balance in C. quadricarinatus. Examining the expression of other V-type H+-ATPase subunits may also shed further light on other members of this gene family in acid-base balance in freshwater crayfish.

2.5.4 Arginine kinase

Arginine kinase is a kinase enzyme that plays an important role in maintaining ATP levels in invertebrates (Song et al., 2012)and has been suggested to play a role in osmoregulation and acid-base balance in crustaceans. In fact, this enzyme was shown to be differentially expressed in some crustacean species, but not in others, when transferred to different ionic conditions (Kinsey and Lee, 2003; Pan et al., 2004; Yao et al., 2005; Liu et al., 2006; Silvestre et al., 2006; Abe et al., 2007; Song et al., 2012). In our study we found no evidence for arginine kinase playing a role in acid-base balance in C. quadricarinatus as this gene was not differentially expressed across pH treatments. The enzyme activity and mRNA abundance of arginine kinase also did not change when C. maenus was transferred to low salinity (Kotlyar et al., 2000; Towle and Weihrauch, 2001). While the gene was not differentially expressed arginine kinase levels did increase in low pH treatments where V-type H+-ATPase and cytoplasmic CA were also increased. Weihrauch (Weihrauch et al., 2001b) in a study on osmoregulation in crustaceans suggested that while arginine kinase levels are increased in some species it is to maintain ATP levels, which are required for active ion transport and other cellular processes that require ATP. This hypothesis would explain the increased levels of arginine kinase in the lower pH treatment when active transport enzymes are also upregulated.

Page 58

2.6 Conclusions

From the gene expression data obtained from this study, we suggest that cytoplasmic

carbonic may play an important role in systemic acid-base balance in freshwater crayfish

while other CA genes probably play only a limited role in this process. This data is important

because we still know remarkably little about which genes are important for acid-base balance in freshwater crayfish.

2.7 Acknowledgements

This work was funded by the QUT (Queensland University of Technology) Higher Degree

Research Support and a QUT ECARD grant awarded to PP. We are grateful to the valuable

guidance and support of all the group members of Physiological Genomics Lab at QUT.

2.8 Data Archive

Raw sequence data was deposited in the SRA (Short Read Archive) repository of NCBI under

the accession number PRJNA275170. Data can be downloaded through the link:

http://www.ncbi.nlm.nih.gov/sra/?term=PRJNA275170

Page 59

Chapter 3. Expression patterns of two alpha Carbonic anhydrase genes, Na+/K+-ATPase and V-type H+-ATPase in the freshwater crayfish, Cherax quadricarinatus, under different pH conditions

(Manuscript is ready to be submitted very soon.)

Page 60

Expression patterns of two alpha Carbonic anhydrase genes, Na+/K+-ATPase and V-type H+-ATPase in the freshwater crayfish, Cherax quadricarinatus, under different pH conditions

Muhammad Yousuf Ali1, Ana Pavasovic2, Peter B Mather1 and Peter J Prentis1*

1School of Earth, Environmental and Biological Sciences, Queensland University of Technology, Brisbane, QLD

4001, Australia

2School of Biomedical Sciences, Queensland University of Technology, Brisbane, QLD 4001, Australia

* Corresponding author: Peter J Prentis ([email protected])

Email addresses: MYA: [email protected] AP: [email protected] PBM: [email protected] PJP: [email protected]

Page 61

3.1 Abstract

Osmoregulation and systemic acid-base balance in decapod crustaceans are largely

controlled by a set of transport-related enzymes including carbonic anhydrase (CA), Na+/K+-

ATPase (NKA) and V-type-H+-ATPase (HAT). Variable pH levels and changes in osmotic

pressure can have a significant impact on the physiology and behaviour of crustaceans.

Therefore, it is crucial to understand the mechanisms via which an animal can maintain its

internal pH balance and regulate the movement of ions into and out of its cells. Here, we examined expression patterns of the cytoplasmic (CAc) and membrane-associated form

(CAg) of CA, NKA α subunit and HAT subunit a in gills of the freshwater crayfish Cherax quadricarinatus. Expression levels of the genes were measured at three pH levels, pH 6.2,

7.2 (control) and 8.2 over a 24 hour period. All genes showed significant differences in expression levels, either among pH treatments or over time. Expression levels of CAc were significantly increased at low pH and decreased at high pH conditions 24 h after transfer to these treatments. Expression increased in low pH after 12 h, and reached their maximum level by 24 h. The membrane-associated form CAg showed changes in expression levels more quickly than CAc. Expression increased for CAg at 6 h post transfer at both low and high pH conditions, but expression remained elevated only at low pH (6.2) at the end of the experiment. Expression of CqNKA significantly increased at 6 h after transfer to pH 6.2 and remained elevated up to 24 h. Expression for HAT and NKA showed similar patterns, where expression significantly increased 6 h post transfer to the low pH conditions and remained significantly elevated throughout the experiment. The only difference in expression between the two genes was that HAT expression decreased significantly 24 h post transfer to high pH conditions. Overall, our data suggest that CAc, CAg, NKA and HAT gene

Page 62 expression is induced at low pH conditions in freshwater crayfish. Further research should examine the physiological underpinnings of these changes in expression to better understand systemic acid/base balance in freshwater crayfish.

Key words: osmoregulation, acid-base, pH balance, gills, expression, crayfish, Redclaw

Page 63

3.2 Introduction

Of all currently available farmed freshwater crayfish, Redclaw (Cherax quadricarinatus) is the most important commercial species developed for aquaculture production in Australia.

It is also an important commercial species in other areas of the world, most notably Mexico,

Ecuador, Uruguay, Argentina and China (FAO, 2010; Saoud et al., 2012). Redclaw occurs naturally across Northern Australia as well as Southern Papua New Guinea. Wild Australian population of Redclaw are distributed over a distinct pH gradient; one area has low pH

(≈6.2) in north Queensland and the other area higher pH (≈8.2) on the western side of

Northern Territory (Macaranas, 1995; Bryant and Papas, 2007; Baker et al., 2008). Previous research on this species reported a fixed allozyme difference at a carbonic anhydrase (CA) allozyme locus between C. quadricarinatus populations collected from either side of this pH gradient (Macaranas, 1995). The authors suggested that this CA isoform may play an important role in maintaining systemic acid–base balance and ion regulation under different water chemistry (Macaranas, 1995). This indicates that CA genes and potentially other genes involved in systemic acid-base balance or ion transport probably play an important role in the response to changes in water chemistry.

In the areas Cherax species occur and are cultured, pH Levels fluctuate not only among natural water bodies, but vary widely within water-bodies over time (Boyd, 1990). For example, many aquaculture ponds are built in areas with acid sulphate soils or areas with acid precipitation which can lead to decreased pH levels within water-bodies (Haines,

1981). Regardless of the causes, fluctuations in pH have been demonstrated to have a great impact on the distribution, growth, behaviour and physiology in many crustaceans including

Cherax crayfish (Chen and Chen, 2003; Pavasovic et al., 2004; Pan et al., 2007; Yue et al.,

Page 64

2009; Haddaway et al., 2013; Kawamura et al., 2015; Kim et al., 2015). It is also evident that

environmental pH has a great impact on acid-base balance and electrolyte concentrations in the haemolymph of freshwater crayfish (Morgan and McMahon, 1982; Wood and Rogano,

1986; Zanotto and Wheatly, 1993; Wheatly et al., 1996). For example, water with a low pH level has been shown to cause acid–base imbalance (decreased pH in haemolymph) and disturbed ion regulation (decreased Na+ and Cl- concentrations and increased K+) in

freshwater crayfish (Morgan and McMahon, 1982; Wood and Rogano, 1986; Wheatly et al.,

1996). Therefore, a better understanding of the effect of external pH on gene expression in

pH induced and ion transport-related genes in gills of freshwater crayfish is needed to

elucidate what role these important genes are playing in response to changes in water pH.

Systemic acid-base balance and ion-regulation in crustaceans are largely controlled by a set of transport-related enzymes including, carbonic anhydrase (CA), Na+/K+-ATPase (NKA) and

V-type-H+-ATPase (HAT); and gills are the main organs where these functions take place

+ - (Freire et al., 2008). CA produce H and HCO3 ions through a reversible reaction, CO2+H2O

+ - + - + + + ←→H +HCO3 , thereafter the H and HCO3 serve as anti-porters for Na /H (NH4 )

- exchangers and Cl-/HCO3 cotransporter (Freire et al., 2008; Henry et al., 2012; Romano and Zeng, 2012). NKA pumps Na+ ions out of the cell and draws K+ ions in, and thus

establishes an electrochemical gradient that acts as a driving force for transport of Na+ and

K+ ions by other transporters including Na+/K+/2Cl- cotransporter (Lucu and Towle, 2003;

Jayasundara et al., 2007; Leone et al., 2015; Li et al., 2015). H+-ATPase pumps protons (H+)

and acidifies intracellular organelles that help to maintain pH balance in crustacean taxa

(Faleiros et al., 2010; Lee et al., 2011; Towle et al., 2011; Boudour-Boucheker et al., 2014;

Lucena et al., 2015).

Page 65

Recently, two distinct forms of CA as well as key systemic acid-base balance genes Na+/K+-

ATPase (NKA) and V-type-H+-ATPase (HAT) were identified through transcriptome sequencing in multiple species of the genus Cherax; Cherax quadricarinatus, C. destructor and C. cainii (Ali et al., 2015a; Ali et al., 2015b). More recently, comparative molecular analysis between these species showed that there were very few non-synonymous mutations in CA or other key osmoregulatory genes that are likely to lead to large differences in protein function within and between these species (Our unpublished results).

Therefore, we hypothesize that differential expression of CA genes and other important ion transport and systemic acid-base balance genes may enable Redclaw crayfish to survive in both acidic and alkaline water conditions. However, this hypothesis has to be thoroughly investigated through a gene expression study at varied pH conditions.

Despite the fact that expression and activity levels of the ion-transport enzymes are probably regulated by extracellular pH, studies on the effects of pH on the expression of these genes in crustaceans is limited (Pan et al., 2007; Wang et al., 2012; Liu et al., 2015;

Lucena et al., 2015). Most of the previous work has investigated the effect of salinity on expression of ion-transport genes in decapod crustaceans (for example; CA (Serrano et al.,

2007; Serrano and Henry, 2008; Pongsomboon et al., 2009); NKA (Mitchell and Henry, 2014;

Chaudhari et al., 2015; Han et al., 2015; Leone et al., 2015; Li et al., 2015); HAT (Luquet et al., 2005; Havird et al., 2014). However, to the best of our knowledge, all the studies have been undertaken in euryhaline species, and none have investigated freshwater crayfish.

Recently, we have reported gene expression of CA and HAT in C. quadricarinatus, but the study was limited to one sampling point and mainly comprised the description of a transcriptome dataset (Ali et al., 2015b). Thus, in this study we have undertaken a time

Page 66 course of expression patterns for the key genes involved in pH-balance and osmoregulation under varied pH conditions in C. quadricarinatus. The study reports the expression patterns of two forms of alpha carbonic anhydrase (a cytoplasmic form, referred to as CqCAc and a membrane-associated form, referred to as CqCAg); sodium-potassium pump Na+/K+-ATPase

α subunit (CqNKA); and proton (H+) pump V-type-H+-ATPase subunit a (CqHAT) at three different pH levels, pH 6.2, 7.2 (control) and 8.2, in the gills of C. quadricarinatus over a time course of 24 hours.

3.3 Materials and Methods

3.3.1 Sample Preparation

Live inter-moult C. quadricarinatus were obtained from Theebine, Queensland, Australia.

Animals were housed in rectangular glass tanks (size: 25×18×15 cm, capacity: 27 L each) at

QUT (Queensland University of Technology) Aquaculture facility and acclimated at pH 7.2 ±

0.14 for three weeks before the experiment. Other water quality parameters were as follows: temperature 20.9±0.90C, conductivity 405±42 μS/cm. Water quality was maintained with a computer-controlled filtration system (Technoplant). During the acclimation period all animals were fed regularly with formulated feed pellets.

Feeding was stopped 24 h before the pH treatments were undertaken. A total of 45 animals

(weight 41±4 g and length 11.8±0.6) were distributed into separate tanks. The animals were stressed by two pH treatments, pH 6.2 and pH 8.2, a treatment within the tolerance range of this species (Macaranas, 1995; Bryant and Papas, 2007); and pH 7.2 was used as a no change control. Gills were extracted from three individuals as biological replicates at 0 h, 3 h, 6 h, 12 h and 24 h post-exposure for each treatment.

Page 67

3.3.2 RNA extraction and cDNA synthesis

Prior to tissue extraction, animals were euthanized in crushed ice for 5-10 minutes. Gill tissue were dissected and immediately frozen in liquid nitrogen. Total RNA was extracted from individual gill tissue, from 0.1 g of tissue from each animal, using a TRIZOL/Chloroform extraction (Chomczynski and Mackey, 1995) and then purified using a RNeasy Midi Kit (cat #

75144, QIAGEN) using an existing protocol (Prentis and Pavasovic, 2014). Genomic DNA was digested with Turbo DNA-free kit (REF-AM1907, Ambion RNA, Life Technologies, USA) and

RNA quality and concentration were checked using a Bioanalyzer 2100 RNA nanochip

(Agilent Technologies).

Complementary DNA (cDNA) was synthesized by reverse transcription from 1 μg of total

RNA using SensiFAST cDNA synthesis protocol (Bioline, Australia, Cat # BIO-65054). The reaction was made in a final volume of 20 μl with 1 μg RNA template, 1x TransAmp Buffer, 1

μl Reverse Transcriptase and of DNase/RNase free water as required. The resulting cDNA samples were stored at −20°C until used as templates for real-time quantitative PCR.

3.3.3 Quantification of mRNA by quantitative Real-Time-PCR (qRT-PCR)

The relative abundance of mRNA levels was measured using the quantitative real-time PCR machine LightCycler 96 (Roche, Version 04) using FastStart Essential DNA Green Master

(Roche, Germany, Cat. No.06924204001). Three replicate animals were used for all sampling points in all experimental treatments and all qRT-PCR amplifications were carried out in triplicate. Gene-specific quantitative real-time PCR primers were designed in primer3 using the settings from Amin et al. (2014) for transcripts that were identified as: two forms from the alpha CA gene family (CqCAc and CqCAg), CqNKA, CqHAT and 18s rRNA (Cq18s) (Ali et al., 2015b). The RT-PCR reaction contained 1 μl cDNA template, 1 μl Green Master, 2 μl

Page 68 primers (1 μl forward and 1 μl reverse, concentration 10 μmole) and DNase free water required to make the final volume up to 20 μl. Real-time PCR conditions included a pre- incubation of 950C for 5 minutes, followed by a total 45 cycles of three-step amplification of

950C for 10 seconds; 600C for 10 seconds and 720C for 10 seconds. Ribosomal 18S was used as an internal control gene (whose expression levels did not change under different treatments) to normalize sample-to-sample variation. Negative controls (without cDNA template) were also used. The relative expression of the target genes were measured as a ratio (concentration of target gene/concentration of 18S gene) according to Pfaffl (2001).

3.3.4 Data analysis

The relative expression values for the genes were obtained using the Relative Quant analysis tool described in the Light Cycler 96 system operator’s guide, version 2.0. Statistical analyses were performed using Minitab software (version 17). A one-way ANOVA was undertaken with a Fisher’s tests to determine if any of the genes showed significant expression differences across the three pH treatments or time points at p<0.05.

3.4 Results

3.4.1 Carbonic anhydrase (CA)

We analysed expression patterns of two forms of carbonic anhydrase, CqCAc and CqCAg.

The results showed that CqCAc was only differentially expressed at 24 hour time point, across all three treatments, low pH (6.2), high pH (8.2) and the control pH treatment (7.2)

(Fig. 3.1). At 24 h, the expression levels of CqCAc were significantly upregulated with an approximately 3 fold increase at pH 6.2 (p=0.007, F-value 22.14) whereas, at pH 8.2, the expression levels were significantly down-regulated (p=0.023, F-value 18.60). CqCAc

Page 69 expression levels were consistent in control group (pH 7.2) over the experiment. For pH 6.2 treatment, CqCAc showed consistent expression up to 6 h mark; after this expression of

CqCAc started increasing dramatically with the initial increase of ≈2 fold at 12 h, and 3 fold at 24 h (p=0.007, F-value 22.14). At pH 8.2, CqCAc expression did not change significantly up to the 12 h mark, but there was a significant decrease in expression 24 h post transfer

(p=0.023, F-value 18.60).

The pattern of CqCAg expression was similar to CqCAc, but CqCAg was induced more quickly than CqCAc (Fig. 3.2). The expression of CqCAg initially increased at 6 h post transfer at both pH 6.2 and pH 8.2; although these increases were not statistically significant (p>0.05, F value

1.79). The expression levels remained elevated at pH 6.2, but non-significantly, for any time points post-transfer. Expression levels of CqCAg in the pH 8.2 treatment gradually increased until 6 h but started to decrease 12 h post transfer and expression decreased significantly by

≈2.5 fold at 24 h as compared to the initial expression level (p=0.01, F-value 33.82).

Page 70

Figure 3.1 Relative expression of cytoplasmic carbonic anhydrase

Relative mRNA expression of CqCAc (cytoplasmic carbonic anhydrase) in the gills of Redclaw crayfish (Cherax quadricarinatus) acclimated to pH 7.2 (control) and after being transferred to pH 6.2 and pH 8.2 at various times for up to 24 hours. Vertical bars represent the mean±s.e.m (n=3). Different letters above the bars denote significant differences from the control group in the same time of sampling at the 0.05 level ( one- way ANOVA, Tukey’s and Fisher post-hoc tests). Asterisk (*) indicate the significant differences (at 0.05 level) in expression levels over the course of exposure time compared with the initial level (0 h) of mRNA-expression within the same treatment group. Expression levels were normalized with respect to reference gene 18S (internal control gene) for the same sample, and calculated as a ratio (conc. of target gene/conc. of 18S gene) according to Pfaffl (2001).

Figure 3.2 Relative expression of membrane-associated carbonic anhydrase

Relative mRNA expression of CqCAg (membrane-associated carbonic anhydrase) in the gills of Redclaw crayfish (C. quadricarinatus) acclimated to pH 7.2 (control) and after being transferred to pH 6.2 and pH 8.2 at various times for up to 24 hours. Vertical bars represent the mean±s.e.m (n=3). Different letters above the

Page 71

bars denote significant differences from the control group in the same time of sampling at the 0.05 level ( one- way ANOVA, Tukey’s and Fisher post-hoc tests). Asterisk (*) indicate the significant differences (at 0.05 level) in expression levels over the course of exposure time compared with the initial level (0 h) of mRNA-expression within the same treatment group.

3.4.2 Na+/K+-ATPase (NKA)

Expression of CqNKA was significantly different between treatments (p= 0.021, F-value 9.19)

from 6 h onwards. At pH 6.2 expression of CqNKA increased ≈4.5 fold at 6 h and remained

differentially expressed up to 24 h post transfer (≈3 fold expression increase compared to

time 0)(Fig. 3.3, p= 0.016 and F-value 16.37). In contrast, the magnitude of increase in expression of CqNKA at pH 8.2 was less than that at pH 6.2. At pH 8.2, the highest level of expression was reached at 12 h post-transfer with an increase of ≈2.5 fold, but the change was not statistically significant (p=0.36, F-value 1.02). At 24 h post-exposure to high pH (pH

8.2) the expression levels sharply decreased almost to its initial level of expression (0 h) (Fig.

3.3).

Page 72

Figure 3.3 Relative expression of Na+/K+-ATPase

Relative mRNA expression of CqNKA (Na+/K+-ATPase) in the gills of Redclaw crayfish (C. quadricarinatus) acclimated to pH 7.2 (control) and after being transferred to pH 6.2 and pH 8.2 at various times for up to 24 hours. Vertical bars represent the mean±s.e.m (n=3). Different letters above the bars denote significant differences from the control group in the same time of sampling at the 0.05 level ( one-way ANOVA, Tukey’s and Fisher post-hoc tests). Asterisk (*) indicate the significant differences (at 0.05 level) in expression levels over the course of exposure time compared with the initial level (0 h) of mRNA-expression within the same treatment group.

3.4.3 V-type H+-ATPase (HAT)

The expression of CqHAT was similar to that of CqNKA, and demonstrated significantly higher levels of expression 6 h after transfer to pH 6.2 (p=0.023 and F-value 18.74 at 6h; p=0.005 and F-value 53.30 at 24 h ). This pattern of increased expression remained fairly constant approximately 2-3 fold higher than initial expression until the experiment ceased

(Fig. 3.4). For pH 8.2 the expression of CqHAT was not significantly different from that of the control group until 24 h post-transfer. At 24 h post-exposure the expression level dropped sharply to less than the initial level of expression (≈35% of the control level, p=0.012, F-value

29.62).

Page 73

Figure 3.4 Relative expression of V-type-H+-ATPase

Relative mRNA expression of CqHAT (V-type-H+-ATPase) in the gills of Redclaw crayfish (C. quadricarinatus) acclimated to pH 7.2 (control) and after being transferred to pH 6.2 and pH 8.2 at various times for up to 24 hours. Vertical bars represent the mean±s.e.m (n=3). Different letters above the bars denote significant differences from the control group in the same time of sampling at the 0.05 level ( one-way ANOVA, Tukey’s and Fisher post-hoc tests). Asterisk (*) indicate the significant differences (at 0.05 level) in expression levels over the course of exposure time compared with the initial level (0 h) of mRNA-expression within the same treatment group.

3.5 Discussion

The expression of all candidate genes was induced by transfer to low pH. The timing of induction varied between the candidate genes as did the fold increase of expression. The role that these candidate genes may play in systemic acid-base balance is discussed in the following subsections.

3.5.1 Carbonic anhydrase (CA)

In our study, expression levels of CqCAc increased upon exposure to low pH conditions (≈3 fold at 24 hour post-exposure) (Fig. 3.1). Other studies have reported increased levels of CA expression in crustaceans after being exposed to low pH conditions (Liu et al., 2015) or low

Page 74

salinity levels (Jayasundara et al., 2007; Serrano et al., 2007; Serrano and Henry, 2008;

Pongsomboon et al., 2009; Mitchell and Henry, 2014). For instance, Liu et al. (2015) reported a 5 fold increase in expression of CAc in the euryhaline shore crab Pachygrapsus marmoratus 12h after transfer to a pH 7.4 treatment (control pH 8.2). A large induction of

CAc was also reported by Serrano et al. (Serrano et al., 2007) (100 fold increase in blue crab

Callinectus sapidus), Serrano and Henry (Serrano and Henry, 2008) (100 fold increase in green crab Carcinus maenas), Mitchell and Henry (Mitchell and Henry, 2014) (90 fold increase in C. sapidus), and Henry et al. (2006) (10 fold increase in C. maenas) following transfer to low salinity water. The pattern of CAc expression we found in our study was similar to that seen in other studies where CAc expression was more pronounced at low salinity or low pH conditions (Jayasundara et al., 2007; Serrano et al., 2007; Serrano and

Henry, 2008). It is suggested that this change in expression occurs due to the fact that

+ − + + − − cytoplasmic CA provides the counter ions H and HCO3 ions to the Na /H and Cl /HCO3

exchanger to drive ion uptake in the gills of crustaceans when exposed to low pH or low

salinity environments (Henry and Cameron, 1983; Henry, 1988; Henry, 2001).

Previous studies have shown decreased level of Cl- concentrations in freshwater crayfish

including Procambarus clarkii, Orconectes propinguus and Orconectes rusticus after

exposure to low pH conditions (Wood and Rogano, 1986; Zanotto and Wheatly, 1993).

Therefore, it is possible that in C. quadricarinatus, also a freshwater crayfish species, that internal Cl- concentrations may decrease in haemolymph under low pH conditions;

− − - increasing the activity of Cl /HCO3 exchanger to compensate for the loss of Cl . The activity

− of CAc should increase under low-pH stress because HCO3 are supplied by CAc through

hydration of CO2. From these findings, we can infer that the cytoplasmic CA form from C.

Page 75

quadricarinatus may play an important role in maintaining internal pH conditions in low

streams across northern Australia where they occur naturally.

Our study showed that the timing for initial induction of CqCAg was faster than that of

CqCAc in both pH conditions. For CqCAc, the initial increase in expression was observed only

after 12 h post-exposure, and only at the lower pH (pH 6.2); while for CqCAg, the initial

increase started at 6 h post-transfer, in both low pH and high pH conditions (Fig. 3.2). This finding suggests that CqCAg is more sensitive to pH changes, and responds quicker. Liu et al.

(2015) also reported similar pattern of expression for the same two forms of CA in

Litopenaeus vannamei, where CAg was induced more quickly than the CAc. This indicates that CAg might be more sensitive to changes in pH than CAc at both low and high pH levels.

We also observed that the cytoplasmic CA (CqCAc) was induced more at low pH than high pH (Fig. 3.1); and had a greater magnitude of ‘inductive scope’ (degree of differences in

expression between the maximal level of expression and baseline expression). In contrast,

CAg showed increased induction at higher pH levels. Liu et al. (2015) also observed similar

patterns of CA gene expression, where they found that CAc was induced more under low pH

conditions, and that CqCAc was induced at a higher level compared to CAg. Very

interestingly, the patterns of sensitivity and induction at different pH conditions are very

similar to expression patterns of Cag and CAc under different salinity conditions in other

decapod crustaceans (Serrano et al., 2007; Serrano and Henry, 2008).

3.5.2 Na+/K+-ATPase (NKA)

In our study, expression of CqNKA was significantly upregulated at low pH conditions but

non-significantly increased at high pH (pH 8.2) (Fig. 3.3). Previous studies have reported

similar patterns of NKA expression, where they found increased levels of either NKA

Page 76 transcription or NKA enzyme activity under both low and/or high pH conditions (Pan et al.,

2007; Wang et al., 2012). In an experiment with L. vannamei, Pan et al. (2007) reported 3-4 fold increases in NKA activity 24 h after exposure to low pH (pH 7.1) and high pH conditions

(pH 9.1). In the present study, we report a maximum increase of 4.5 fold in expression at low pH conditions and 2.5 fold increase at high pH conditions. This indicates that Na+/K+-

ATPase from C. quadricarinatus is induced more strongly to low pH, rather than the high-pH conditions. Similarly, Wang et al. (Wang et al., 2012) in L. vannamei documented a 17 fold and 4 fold increase in NKA expression after exposure to low pH (at 6 h post-exposure to pH

5.6) and high pH conditions (at 3h post-exposure to pH 9.3). The main reason for the differences reported in the level of NKA expression among our study and the two L. vannamei studies is probably related to differences in the pH treatments (transfer from pH

7.4 to pH 5.6 and 9.3).

In crustacean species, a large number of previous studies have examined the effect of salinity on expression of transport-related genes, but few studies have focused on the effects of external pH (Wang et al., 2002; Pan et al., 2007; Wang et al., 2012; Li et al., 2015).

Changes in expression patterns of CqNKA induced by pH in our study are quite similar with that induced by salinity in other crustacean species, i.e. higher induction levels at low salinity exposure (Luquet et al., 2005; Jayasundara et al., 2007; Pan et al., 2007; Serrano et al., 2007; Wang et al., 2012; Havird et al., 2013; Han et al., 2015; Leone et al., 2015; Li et al.,

2015). As published reports show that Na+ concentration decreases and Na+ concentration increases in the haemolymph of the freshwater crayfish Procambarus clarkia and

Orconectes rusticus upon exposure to low-pH conditions (Morgan and McMahon, 1982;

Wood and Rogano, 1986; Wheatly et al., 1996), it is logical that the NKA expression level

Page 77 should also increase in C. quadricarinatus under similar conditions. The main reason of increased expression levels for CqNKA in C. quadricarinatus may be attributed to increased level of NKA activity in the gills. Because, Na+/K+-ATPase is a key enzyme that pumps Na+ into haemolymph and draws K+ in the cell, it establishes electrochemical gradients that act as a driving force for trans-epithelial movement of many monovalent ions including Na+, K+,

H+, Cl- across the gills in crustacean taxa (Havird et al., 2013; Chaudhari et al., 2015; Han et al., 2015; Leone et al., 2015; Li et al., 2015). Overall, these findings suggest that NKA plays a role in maintaining systemic acid-base balance in Cherax crayfish.

3.5.3 Vacuolar-type H+-ATPase

In the present study, expression of Vacuolar-type H+-ATPase in C. quadricarinatus was upregulated at low-pH and down-regulated at high-pH conditions (Fig. 3.4). Previous studies in crustacean species have also reported that expression levels of Vacuolar-type H+-ATPase are changed under low and high pH conditions in a similar pattern, but this pattern can vary among species (Pan et al., 2007; Wang et al., 2012; Havird et al., 2013). For example, in a study of HAT enzyme activity in L. vannamei, Pan et al. (2007) reported a negative correlation between activity of HAT and pH levels. HAT expression is probably affected by changes in external pH, because it is one of the key enzymes that acidifies intracellular organelles which in turn influence the activity of other ion-transport enzymes including

+ + + −/ − Na /H (NH4 ) and Cl HCO3 exchanger (Weihrauch et al., 2002; Weihrauch et al., 2004a;

Luquet et al., 2005; Martin Tresguerres et al., 2006; Pan et al., 2007; Weihrauch et al., 2009;

Faleiros et al., 2010; Martin et al., 2011; Wang et al., 2012; Weihrauch et al., 2012; Havird et al., 2013).

Page 78

In the present study, we report a maximum increase of 2-3 fold in mRNA expression of

CqHAT between 6-12 h after exposure to low pH (6.2) and a 3 fold decrease at high pH (pH

8.2) conditions (Fig. 3.4). Our results are similar to a recent study that reported a significant down-regulation of 2.5 fold in gill V(H+)-ATPase activity of river shrimp M. amazonicum at

pH 8.5, as compared to that at pH 7.5 (Lucena et al., 2015). Wang et al. (2012), however,

reported increased levels of HAT expression in L. vannamei at both low- and high-pH

conditions, but expression levels were higher at low pH. This variation in the expression of

HAT transcripts or HAT activity are probably attributed to species-specific physiological

differences in species with distinct osmoregulatory capabilities (Anger and Hayd, 2010;

Faleiros et al., 2010; Charmantier and Anger, 2011; Lucena et al., 2015). These findings

suggest that V(H+)-ATPase likely plays an important role in systemic acid-base balance in

freshwater crayfish.

3.6 Conclusions

From the gene expression data, we suggest that cytoplasmic carbonic anhydrase, Na+/K+-

ATPase and V-type-H+-ATPase may play important role in the maintenance of pH balance in

freshwater crayfish, while the membrane-associated CA probably plays a more limited or

indirect role in this process. We can also infer that cytoplasmic CA, Na+/K+-ATPase and V-

type-H+-ATPase are induced more strongly at low pH conditions compared with high pH

conditions. These data can help to provide a better understanding of which genes are

involved in systemic pH balance in freshwater crayfish.

Page 79

Chapter 4. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

Part of this chapter published as:

Ali, M.Y., Pavasovic, A., Amin, S., Mather, P.B. and Prentis, P.J., 2015. Comparative analysis of gill transcriptomes of two freshwater crayfish, Cherax cainii and C. destructor. Marine Genomics (Elsevier) 22, 11-13.

(http://dx.doi.org/10.1016/j.margen.2015.03.004)

Page 80

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

Muhammad Yousuf Ali1, Ana Pavasovic2, Lalith Dammannagoda Acharige1, Peter B Mather1 and Peter J Prentis1*

1School of Earth, Environmental and Biological Sciences, Queensland University of Technology, Brisbane, QLD

4001, Australia

2School of Biomedical Sciences, Queensland University of Technology, Brisbane, QLD 4001, Australia

* Corresponding author: Peter J Prentis ([email protected])

Email addresses: MYA: [email protected] AP: [email protected] LDA: [email protected] PBM: [email protected] PJP: [email protected]

Page 81

4.1 Abstract

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part

maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-

+ + + − + - - ATPase (NKA), H -ATPase (HAT), Na /K /2Cl cotransporter (NKCC), Na /Cl /HCO3

cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-

ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of

these genes in three commercially important yet eco-physiologically distinct freshwater

crayfish, C. quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in

these genes and determine if observed patterns of mutations were consistent with the

action of natural selection. We also conducted a tissue-specific expression analysis of these

genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver,

nerve and testes using NGS transcriptome data. A total of 87290, 136622 and 147101

assembled contigs were obtained from more than 72 million, 83 million and 100 million high

quality reads from the gills of C. quadricarinatus, C. cainii and C. destructor, with a BLAST

success rate of 25.3%, 17% and 18% respectively. The molecular analysis of the candidate

genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that half of the genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression

analysis also revealed that most of the master genes regulating pH and osmoregulation (CA,

NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important

Page 82

physiological role for these genes outside of osmoregulation in other tissue types. The high

level of sequence conservation observed in the candidate genes may be explained by the

important role of these genes as well as potentially having a number of other basic

physiological functions in different tissue types.

Key words: Redclaw, Yabby, Marron, osmoregulatory genes, carbonic anhydrase, Na+/K+- ATPase, V-type H+-ATPase

4.2 Introduction

In decapod crustaceans, systematic acid-base balance and ion-regulation are processes that are largely controlled by a set of transport-related enzymes including carbonic anhydrase

(CA), Na+/K+-ATPase (NKA), Vacuolar-type H+-ATPase (HAT), Na+/K+/2Cl− cotransporter

+ - (NKCC), Na /HCO3 cotransporter (NBC), Arginine kinase (AK), Calreticulin (CRT),

Sarco/endoplasmic reticulum Ca2+ATPase (SERCA), Na+/H+ exchanger (NHE) and Na+/Ca+2

exchanger (NCX) (Pan et al., 2007; Serrano et al., 2007; Freire et al., 2008; Henry et al., 2012;

McNamara and Faria, 2012a; Romano and Zeng, 2012; Havird et al., 2013). The distribution,

expression patterns and activities of these genes have been reported in a number of

decapod crustaceans (for example; CA (Serrano et al., 2007; Pongsomboon et al., 2009; Ali

et al., 2015b; Liu et al., 2015); NKA (Chaudhari et al., 2015; Han et al., 2015; Leone et al.,

2015); HAT (Pan et al., 2007; Wang et al., 2012; Havird et al., 2014; Ali et al., 2015b); NKCC

(Towle et al., 1997; Havird et al., 2013; Havird et al., 2014); NHE (Towle and Weihrauch,

2001; Weihrauch et al., 2004a; Ren et al., 2015); NCX (Flik et al., 1994; Lucu and Flik, 1999;

Flik and Haond, 2000); AK (Serrano et al., 2007; Havird et al., 2014; Ali et al., 2015b); CRT

(Luana et al., 2007; Visudtiphole et al., 2010; Watthanasurorot et al., 2013; Duan et al.,

Page 83

2014). Despite this, we know little about the molecular evolution of these key gene classes

or their tissue specific expression in decapod crustaceans.

Cherax quadricarinatus (Redclaw), Cherax destructor (Yabby) and Cherax cainii (Marron) are

the most abundant and commercially important freshwater crayfish, endemic to Australia.

These species occur in a diverse range of aquatic environments and can tolerate wide

fluctuations in a range of water parameters such as pH, salinity, dissolved oxygen and

temperature (Bryant and Papas, 2007; McCormack, 2014). This indicates that these crayfish

species have a great capacity to cope with highly variable aquatic environments.

Consequently, because of the physiological robustness of these animals and their economic

significance, it has led to their use in physiological genomic research in crustaceans.

In previous studies we have identified a number of the above mentioned ion-transport

related genes in C. quadricarinatus, C. destructor and C. cainii (Ali et al., 2015a; Ali et al.,

2015b). In the present study, we undertook an in-depth molecular analysis of candidate systemic acid-base and ion-transport related genes across these three freshwater crayfish species. In addition, we have performed comparative and evolutionary genomic analysis of these genes across other related arthropod species. The main focus of this study was to identify synonymous and non-synonymous mutations in these genes and to determine if the observed patterns of mutations were consistent with the action of natural selection or neutral evolution. This study will also investigate the tissue-specific expression of the pH and ion/osmoregulatory genes in the gills, hepatopancreas, heart, kidney, liver, nervous system and testes using publically available transcriptome metadata.

4.3 Material and Methods

Page 84

4.3.1 Sample collection and preparation

Live redclaw crayfish (C. quadricarinatus) were obtained from Theebine, in Queensland,

Australia; yabby (C. destructor) were sourced from New South Wales, Australia; and Marron

(C. cainii) from Mudgee, Western Australia, Australia. Culture conditions for C.

quadricarinatus has already been described in (Ali et al., 2015b). Cherax destructor and C. cainii were housed at QUT aquaculture facility under standard culture conditions. Animals were acclimated to lab conditions for three weeks (210C, pH 7 and conductivity 1700

μS/cm). Before tissue collection, three C. cainii (body length 11 ± 0.9 cm and wet body

weight 57 ± 5g) and three C. destructor (9 ± 0.7 cm and 45 ± 3g) were exposed to pH 6, 7 and

8; a natural pH tolerance range of Cherax species (Macaranas, 1995; Bryant and Papas,

2007).

4.3.2 RNA extraction, cDNA synthesis and sequencing

Gills were excised from the samples, immediately following euthanisation in ice for 5-10

minutes. Tissues were extracted after six hours at each treatment, following euthanisation

in ice-water. Tissue samples were pooled for each species and crushed in liquid nitrogen

before total RNA was extracted using an existing protocol (Prentis and Pavasovic, 2014).

Genomic DNA was digested with Turbo DNA-free kit (Life Technologies) and RNA quality and concentration was determined using a Bioanalyzer 2100 (Agilent Technologies). RNASeq library preparation and paired-end sequencing were undertaken on an Illumina Next Seq

500 (NextSeq 150 bp pair-ends) according to the manufacturer's protocol for stranded library preparation.

Six individual hepatopancreas samples were dissected and homogenised in liquid N2 before

total RNA was extracted using the protocol of Prentis and Pavasovic (2014). Genomic DNA

Page 85

was digested with Turbo DNA-free kit (REF-AM1907, Ambion RNA, Life Technologies, USA)

and RNA quality and concentration were checked using the Bioanalyzer 2100 (Agilent

Technologies). RNASeq library preparation and sequencing were undertaken according to

the Ion Proton 200 bp library preparation and sequencing protocol (Thermo Fisher, see

Amin et al., 2014). Raw Illumina sequence data for heart, kidney, liver, nerve and testes

were downloaded from NCBI SRA database as FastQ files (Bio-project No. PRJEB5112).

4.3.3 Assembly, functional annotation and gene identification

Reads which did not meet our quality criteria (Q>30, N bases <1%) were removed before assembly using Trimmomatic (Version 0.32; Bolger et al., 2014). These filtered reads were assembled with the Trinity short read de novo assembler using the stranded option for

Illumina data (Version 2014-04-13p1; Haas et al., 2013) and the unstranded option for Ion

Torrent data. Contigs with > 95% sequence similarity were clustered into gene families using

CD-HIT (Version 4.6.1; Huang et al., 2010). Coding sequences representing open reading

frames (ORFs) from the transcripts were determined using Transdecoder (Version

r20140704; Haas et al., 2013).

Assembled data were used as BLASTx queries against the NCBI NR protein database using

BLAST+ (Version 2.2.29; Camacho et al., 2009) with a stringency of 10 x e-5. Gene ontology

(GO) terms were assigned to annotated transcripts using Blast2Go Pro (Version 3.0; Conesa

et al., 2005). Candidate genes were identified based on literature searches, PFAM domains,

and GO terms (Henry et al., 2012; Eissa and Wang, 2014; Ali et al., 2015b).

4.3.4 Molecular analyses

Comparative molecular analyses were carried out on the candidate genes previously

reported to have important role in pH balance and/or ion-/osmo-regulation. The translated

Page 86

amino acids sequences from translated ORFs were used as BLASTp queries against the NCBI

NR database. The top BLAST hits were downloaded for each gene and aligned in BioEdit

(version 7.2.5; Hall, 1999) using a ClustalW alignment (Larkin et al., 2007). Neighbour Joining

trees based on amino acid data were generated in Geneious (version 8.0.4)) using the Jukes

Cantor method with 10000 bootstraps (Kearse et al., 2012). Important functional residues and PFAM domains in the predicted amino acid sequences for each candidate gene were determined using SMART (Schultz et al., 1998), PROSITE (Sigrist et al., 2013) and NCBI’s

Conserved Domain Database (Marchler-Bauer et al., 2015). Putative signal peptides, functional motifs and potential cleavage sites of signal peptides were predicted using PrediSi

(PrediSI, 2014) and SignalP 4.0 (Petersen et al., 2011). N-linked glycosylation sites were

predicted with N-GlycoSite (Zhang et al., 2004) using the NXS/T model (where N=Aspargine,

S=Serine, T=Theronine and X=any amino acid).

Molecular evolutionary analyses for each of the gene sequences were generated using

MEGA (version 6; Tamura et al., 2013). Estimates of natural selection for each codon

(codon-by-codon) were determined using HyPHy analysis (hypothesis testing using

phylogenies) according to (Sergei and Muse, 2005). In this analysis, estimates of the

numbers of synonymous (s) and nonsynonymous (n) substitutions for each codon, and their

respective potential numbers of synonymous (S) and nonsyonymous (N) sites were also

determined. These estimates were calculated using joint Maximum Likelihood

reconstructions of ancestral states under a Muse-Gaut model (Muse and Gaut, 1994) of

codon substitution and a General Time Reversible model (Nei and Kumar, 2000). The

differences between the nonsynonymous substitutions rate (per site) (dN = n/N) and

synonymous substitutions rate (dS= s/S) were used for detecting the codons that had

Page 87 undergone positive selection. The null hypothesis of neutral evolution was rejected at p<0.05 (Suzuki and Gojobori, 1999; Kosakovsky and Frost, 2005). All positions in the aligned sequences containing gaps and missing data were eliminated from the final analysis.

Estimates of evolutionary divergence between the sequences were conducted in MEGA6 using the Poisson correction model (Zuckerkandl and Pauling, 1965). The equality of evolutionary rate between two sequences from two different species was conducted according to Tajima's relative rate test using amino acid substitutions model (Tajima, 1993).

4.3.5 Tissue-specific expression

Transcriptomes were assembled separately for seven different C. quadricarinatus organs including gills, hepatopancreas, heart, kidney, liver, nerve and testes. This analysis examined the presence or absence of 80 important genes that are directly or indirectly involved in either acid-base balance or osmotic/ionic regulation across the seven different tissues. Two data sets (from gills and hepatopancreas) were generated in our lab and the remaining five were sourced from publicly available NGS-sequenced data archived in NCBI SRA data bank

(Small Reads Archive).

4.4 Results

4.4.1 Transcriptome assembly, annotation and gene identification

4.4.1.1 Transcriptomes of gills from Yabby and Marron

RNA libraries yielded more than 83 million (83,984,583) and 100 million (100,712,892) high quality (Q ≥ 30) 150 bp paired-end reads for C. cainii and C. destructor, respectively.

Assemblies resulted in 147,101 contigs (C. cainii) and 136,622 contigs (C. destructor) ≥ 200

Page 88

bp. Contigs with >70% protein sequence similarity were clustered into 18,325 and 18,113

gene families in C. cainii and C. destructor (Table 4.1). Coding sequences (CDS) representing

open reading frames using Transdecoder are given in supplementary data 1 and 2. Average

contig length (747 and 740) and the N50 statistic (1380 and 1326), which is a weighted

median statistic where half of the entire assembly length is contained in contigs equal to or

larger than this value, were similar in both assemblies. Average contig lengths from our

assemblies were longer than that from other assemblies in crustaceans: e.g. 323 bp in

Macrobrachium rosenbergii (Mohd-Shamsudin et al., 2013) and 492 bp in Euphausia

superba (Clark et al., 2011).

Assembled data were used as BLASTx queries against the NR NCBI protein database using

BLAST+ (Version 2.2.29). More than 23,000 contigs for each species received significant

BLASTx hits against the NR database with a stringency of e-5. The percentage BLAST success

attained for the two transcriptomes (17-18 %) were lower compared to other freshwater

crayfish; Procambarus clarkii (36 %; Shen et al., 2014) and C. quadricarinatus (37 %; Ali et al.,

2015b).

4.4.1.2 Transcriptomes of different organs from Redclaw (C. quadricarinatus)

The seven transcriptome libraries, when combined, constituted a data set of 608 million high quality (Q ≥ 30) reads. RNA libraries for gills yielded more than 72 million (72,382,710),

83 million (83,984,583) and 100 million (100,712,892) high quality reads for C. quadricarinatus, C. cainii and C. destructor, respectively. The hepatopancreas transcriptome from Redclaw yielded ≈65 million reads and 67401 transcripts (Table 4.1). The detailed statistics of raw reads, assembled contigs and BLAST success are presented in Table 4.1. Our genes of interest were identified and characterised for the three species and full length

Page 89 cDNA of these genes were submitted to NCBI gene-bank database with the accession numbers (Table 4.2). Most transcripts of interest from the three Cherax species were highly conserved at the nucleotide level and had predicted proteins of similar size (Table 4.2).

Page 90

Table 4.1 Summary statistics for assembled contigs from different organs of Cherax quadricarinatus, C. destructor and C. cainii

Summary statistics for assembled contigs greater than 200 bp generated from different organs of Cherax quadricarinatus (Redclaw), C. destructor (Yabby) and C. cainii (Marron) using Trinity de novo assembler and cd- HIT clustering tool.

Summary statistics Redclaw Yabby Marron

Gills Hepato- Heart Kidney Liver Nerve Teste Gills Gills pancreas s Total reads (million) 72.3 65 47 63 51 64 62 100 83.9

Number of total contigs 87290 67401 38938 66308 47166 66564 63924 136 622 147 101

N50 725 398 720 1033 705 1190 995 1326 1380

Mean contig length 563 386 554 663 548 716 653 740 747

Length of the longest contig 15028 9532 16343 15021 17690 20121 16889 17725 22 324

Number of contigs longer 27973 12055 10129 22622 13665 23290 19642 49678 52 459 than 500 bp Number of contigs longer 5274 0 2048 6264 2867 6670 5050 16 178 17 486 than 1500 bp Number of clusters 24123 21732 23127 19816 22963 22837 22989 18 113 18 325

Blast Success rate (%) 25.3 35 31.2 25.9 27.7 27.1 27.4 17 18

Page 91

Table 4.2 Full length coding sequences of the candidate genes involved in pH balance and osmotic/ionic regulation amplified from the gill transcriptomes of C. quadricarinatus, C. destructor and C. cainii

Redclaw Yabby Marron

Genes Enzymes GeneID Contig Protein Accession GeneID Protein Accession # GeneID Contig Protein Accession # length length # length length length Bp (aa) (aa) Bp (aa) Bp Contig length

CAc Carbonic anhydrase alpha CqCAc 1527 271 KM538165 CdCAc 1589 271 KP299962 CcCAc 2795 271 KP221715

CAg Carbonic anhydrase GPI-linked CqCAg 3352 310 KM538166 CdCAg 2465 289 KP299963 CcCAg 4774 310 KP221716

CAb Beta carbonic anhydrase CqCAb 927 257 - CdCAb 2459 257 KP299965 CcCAb 4163 257 KP221717

NKA-α Sodium/potassium ATPase alpha CqNKA-α 4351 1038 - CdNKA-α 5500 1038 KP299966 CcNKA-α 3888 1038 KP221718 subunit NKA-β Sodium/potassium ATPase beta CqNKA-β 1662 316 - CdNKA-β 1601 316 KP299967 CcNKA-β 1551 316 KP221719 subunit HAT-c V-type H+-ATPase Catalytic CqHATc 2626 622 - CdHATc 2760 622 KP299968 CcHATc 2678 622 KP221720 subunit A HAT V-type H+-ATPase 116 kda subunit CqHAT 3184 831 - CdHAT 2810 838 KP299969 CcHAT 2908 838 KP221721 A AK Arginine kinase CqAK 1432 357 - CdAK 1477 357 KP299970 CcAK 1421 357 KP221722

CRT Calreticulin CqCRT 1722 402 KM538170 CdCRT 1708 403 KP299971 CcCRT 1739 402 KP221723 SERCA Sarco/endoplasmic reticulum Ca+2 CqSERCA 4631 1020 KM538171 CdSERCA 4344 1002 KP299972 CcSERCA 6255 1020 KP221724 ATPase SEPHS Selenophosphate synthetase CqSEPHS 2142 326 - CdSEPHS 2160 326 KP299975 CcSEPHS 2186 326 KP221726

NKCC Sodium/chloride cotransporter CqNKCC 4643 1061 - CdNKCC 4524 909 KP299986 CcNKCC 4728 1074 KP221733

NHE3 Sodium/hydrogen exchanger 3 CqNHE3 3578 943 CdNHE3 3308 943 KP299982 CcNHE3 4271 986 KP221730

NBC Sodium/bicarbonate CqNBCi4 5217 1133 - CdNBCi4 5023 1134 KP299979 CcNBCi4 4986 1133 KP299993 cotransporter isoform 4 NBC Sodium/bicarbonate CqNBCi5 4855 1114 - CdNBCi5 5188 1115 KP299980 CcNBCi5 4915 1114 KP299994 cotransporter isoform 5 NCX1 Sodium/calcium exchanger 1 CqNCX1 4895 846 - CdNCX1 4148 849 KP299983 CcNCX1 4289 848 KP221731

Page 92

4.4.2 Sequences alignment, domain analysis and phylogenetic relationships

Multiple protein alignments were performed for CA, NKA and HAT, as these genes are

considered the most important genes responsible for pH balance and osmoregulation in

crustaceans.

4.4.2.1 Carbonic anhydrase

Cytoplasmic CA from C. quadricarinatus, C. destructor and C. cainii (CqCAc, CdCAc and

CcCAc) encoded a predicted protein of 271 aa (Table 6.2). None of the sequences contained

a signal peptide; while all predicted proteins had two putative N-glycosylation motifs: (NKS

at 122 aa. and NGS at 187 aa. position). BLASTp analysis (homologous protein analysis)

showed that the cytoplasmic CAs from C. quadricarinatus, C. destructor and C. cainii were

highly conserved to other decapod crustaceans and had greatest similarity with cytoplasmic

CA forms from Penaeus monodon (75-76% identity, EF672697), Litopenaeus vannamei (74-

76% identity, HM991703), and Callinectes sapidus (72-74% identity, EF375490). Protein analysis revealed that cytoplasmic CAs obtained from C. quadricarinatus, C. destructor and

C. cainii had greatest similarity to one another and shared 97-98% identity at the amino acid level (Appendix 9).

Glycosyl-phosphatidylinositol (GPI)-linked CA forms; CqCAg and CcCAg contained a predicted protein with 310 aa (CdCAg had a partial CD of 289 aa). The sequence analysis showed that all the CAg (CqCAg, CdCAg and CcCAg) contained a N-terminal signal peptide of

22 amino acids (Met1 to Gly22). The membrane-associated CA (CAg) obtained from all Cherax

species shared strong similarity with the CAg forms identified in other crustacean species

(for example: 73-74% identity with C. sapidus, EF375491; 71-73% identity with L. vannamei,

Page 93

JX975725; 72-73% identity with P. trituberculatus, JX524150); and the similarity among the three Cherax species ranged between 97-99% protein identity ( Appendix 9).

The β-CA had moderate to high sequence similarity to β-CA proteins obtained from other arthropod species (for example; 64-65% identity with Acyrthosiphon pisum, XP_001943693;

61-63% identity with D. pulex, EFX79480 (Colbourne et al., 2011) and 62-64% identity with

Nasonia vitripennis, XP_001606972). Cherax quadricarinatus, C. destructor and C. cainii shared between 98-99% amino acid sequence identity with each other (Appendix 9).

Multiple alignment of all three forms of CAs with the homologous proteins in arthropods revealed that all active sites, including the zinc binding sites and the hydrogen bonding sites around the active sites are conserved in all CA proteins (Fig. 4.1). A Neighbour Joining phylogenetic tree showed that the β-CA proteins formed a separate and well resolved clade from the alpha CA proteins (CAc and CAg). The three Cherax species formed a separate group in the β-CA clade that was sister to the same protein from insects. Within the large alpha CA clade, both the CAg and CAc proteins formed distinct well resolved clades. For the

CAg clade, the three Cherax species formed a monophyletic group that was sister to a group comprised of crabs Carcinus maenas (ABX71209, Serrano and Henry, 2008), Callinectes sapidus (ABN51214, Serrano et al., 2007) and Portunus trituberculatus (AFV46145, Xu and

Liu, 2011); with shrimps being more distantly related Litopenaeus vannamei (AGC70493, Liu et al., 2015) and Halocaridina rubra (AIM43573, Havird et al., 2014). The CAc clade clustered according to taxonomic affinity where vertebrate species formed a separate group from the arthropod species. Within the arthropod clade, insects species Drosophila melanogaster

(NP_523561, Hoskins et al., 2007), Apis florea (XM_003696244) and Bombus terrestris

(XP_003395501)) formed a separate and well supported group from decapod crustacean

Page 94

species including Callinectes sapidus, (ABN51213, Serrano et al., 2007) and Portunus

trituberculatus (AFV46144, Xu and Liu, 2011), and shrimp species Halocaridina rubra

(AIM43574, Havird et al., 2014), Litopenaeus vannamei (ADM16544, Liu et al., 2015) ,

Penaeus monodon (ABV65904, Pongsomboon et al., 2009) (Fig 4.2). The three Cherax species clustered together in a discrete group which was sister to the other decapod species.

Page 95

A. CAc

B. CAg

C. β-CA

Figure 4.1 Multiple alignments of amino acid sequences from three Cherax Carbonic anhydrase (CA) with other species.

Page 96

Multiple alignments of amino acid sequences from three Cherax Carbonic anhydrase (CA) with other species. Colours indicate the similarity. The black-boxed indicate the predicted active-sites, Zinc-binding residues. A. Multiple alignment of cytoplasmic CA B. Multiple alignment of membrane associated CA, and C. Multiple alignment of β-CA

A. CA B. NKA

Cherax quadricarinatus CAc (AIW68600) Cherax quadricarinatus (KM538168) Cherax cainii CAc (AJO70180) Crayfish Cherax destructor CAc (AJO69996) Cherax cainii (KP221718) Crayfish Halocaridina rubra CAc (KF650062) Callinectes sapidus CAc (EF375490) Cherax destructor (KP299966) Crabs Portunus trituberculatus CAc (JX524149) Homarus americanus (AAN17736) Lobster Litopenaeus vannamei CAc(HM991703) Shrimps Penaeus monodon CAc (EF672697) Pachygrapsus marmoratus (ABA02166) Drosophila melanogaster CAc (NM 078837) Callinectes sapidus (AAG47843) Crabs Apis florea CAc (XM 003696244) Insecta CAc Bombus terrestris CAc (XM 003395453) Portunus trituberculatus (JX173959) Danio rerio CAc (NP 571185) Halocaridina rubra (KF650059) Cyprinus carpio CAc (AAZ83743) Fish Oncorhynchus mykiss CAc (NP 001117693) Exopalaemon carinicaudagi (JQ360623) Salmo salar CAc (NP 001133769) Litopenaeus stylirostris (JN561324) Shrimps Homo sapiens CAc (NP 001729) Pan troglodytes CAc (NP 001182062) Penaeus monodon (ABD59803) Mammals Rattus norvegicus CAc (NP 001101130) Fenneropenaeus indicus (ADN83843) Mus musculus CAc (NP 033929) Litopenaeus vannamei CAg (JX975725) Shrimps Bactrocera dorsalis (XM 011214827) Halocaridina rubra CAg (KF650061) P. humanuscorporis (XP 002427714) Cherax quadricarinatus CAg (AIW68601) Insects Cherax cainii CAg (AJO70181) Crayfish CAg Locusta migratoria (KF813097) Cherax destructor CAg (AJO69997) Carcinus maenas CAg (EU273944) Leptocoris trivittatus (JQ771499) Callinectes sapidus CAg (EF375491) Crabs I. scapularis (XP 002404061) Arachnida Portunus trituberculatus CAg (JX524150) H. sapiens (NP 001243143) Cherax quadricarinatus CAb (AIW68602) Mammals Cherax cainii CAb (AJO70182) Crayfish B. taurus (XP 002695120) Cherax destructor CAb (AJO69999) Drosophila melanogaster CAb (NM 141592) S. salar (ACN10460) CA-beta Bombyx mori CAb (XM 004922942) O. mykiss (NP 001117930) Fish Apis dorsata CAb (XM 006612942) Insecta Megachile rotundata CAb (XM 012283184) F. heteroclitus (AAL18003) Bombus terrestris CAb (XM 003402502)

C. HAT-A Wasmannia auropunctata (XM 011701129) Pogonomyrmex barbatus (XM 011643683) Camponotus floridanus (XM 011263300) Cerapachys biroi (XM 011350646) Insecta Megachile rotundata (XM 012284907) Bombus terrestris (XM 003397650) Arthropoda Bombus impatiens (XM 003486192) Nasonia vitripennis (XM 001607768) Cherax quadricarinatus Cherax destructor (KP299969) Crayfish Cherax cainii (KP221721) Litopenaeus vannamei (HM163157) Shrimp Esox lucius (XP 010899534) Takifugu rubripes (XP 003978025) Fish (Osteichthyes Danio rerio (XP 005163855) Homo sapiens (NP 001123492) Bos taurus (NP 777179) Mammals Mus musculus (NP 058616) Rattus norvegicus(NP 113792)

Figure 4.2 Phylogenetic relationships between the three Cherax crayfish with other organisms Bootstrapped Neighbour-joining tree showing the phylogenetic relationships between the three Cherax crayfish with other organisms on the basis of the amino acid sequences. Accession numbers are placed in brackets. A. Phylogenetic tree of Carbonic Anhydrase proteins (CA) B. Phylogenetic tree of Na+/K+-ATPase α-subunit (NKA) C. Phylogenetic tree of V-type-H+-ATPase 116 kDa subunit a (HAT-A)

Page 97

4.4.2.2 Na+/K+-ATPase (NKA)

Full-length nucleotide sequences and predicted aa sequences of the Na+/K+-ATPase alpha subunit from C. quadricarinatus, C. destructor and C. cainii (CqNKA, CdNKA and CcNKA) were functionally characterised (Table 4.2). The CqNKA, CdNKA and CcNKA ORFs all produced a predicted protein of 1038 aa in length. No signal-peptide was present, but eight transmembrane domains were detected through hydrophobicity analysis of the sequences

(Fig. 4.3).

Page 98

Figure 4.3 Multiple alignment of three Cherax Na+/K+-ATPase α-subunit amino acid sequences with other crustaceans Multiple alignment of three Cherax Na+/K+-ATPase α-subunit amino acid sequences with other crustaceans; Cherax quadricarinatus (), C. destructor (), C. cainii (), Homarus americanus (AAN17736), Callinectes sapidus (AAG47843), Paeneus monodon (ABD59803) and Portunus trituberculatus (AGF90965). Putative transmembrane domains are marked by black-boxed; likely ATP-binding site, by red-boxed ; and phosphorylation site, by dashed-black boxed

Page 99

The NKA proteins from Cherax species were highly conserved (97-99% aa identity) and

showed greatest similarity to NKA from other decapod crustacean species (for example;

96% with Homarus americanus (AY140650); 95% with Eriocheir sinensis (KC691291); 95%

with C. sapidus (AF327439) and 93% with P. monodon (DQ399797)). Genetic similarity

among all pairs of sequences is presented in Appendix 9.

Multiple alignment of NKA with the homologous proteins of other crustaceans revealed that all active sites are highly conserved (Fig. 4.3). The phylogenetic tree based on the α-subunit of NKA showed the existence of three distinct groups; arthropods, mammals, and osteichthyes (Fig 4.2). The arthropods further clustered into three clades; crustaceans, insects and arachnids. All the NKA α-subunit sequence obtained from C. quadricarinatus, C. destructor and C. cainii formed a distinct monophyletic group that was sister to a Homarus americanus sequence (AAN17736). Crayfish sequences were more closely related to those of the crab species Callinectes sapidus (AAG47843), Portunus trituberculatus (JX173959) and

Pachygrapsus marmoratus (ABA02166) than to shrimp species Penaeus monodon

(ABD59803), Fenneropenaeus indicus (ADN83843), Halocaridina rubra (KF650059),

Litopenaeus stylirostris (JN561324) and Exopalaemon carinicaudagi (JQ360623) (Fig. 4.2).

4.4.2.3 V-type H+ATPase (HAT)

In the Cherax datasets, multiple H+-ATPase (HAT) subunits were identified (Table 4.2),

however, only HAT 116kDa subunit A was used for phylogenetic analyses. Subunit A was

chosen as it is the main catalytic subunit in proton translocation. Translation of ORFS

revealed that the predicted proteins from HAT 116kda subunit A transcripts were similar in

length across the three Cherax species (831 aa, Table 4.2).

Page 100

Conserved domains were identified in HAT subunit A including V_ATPase_I domain between

26–818 aa (protein family: pfam01496). Another predicted feature of the HAT-A predicted

protein was seven putative transmembrane regions at positions: 398–420, 441–461, 532–

550, 567–587, 640–660, 733–751 and 765–785aa.

The HAT-A predicted protein was highly conserved in C. quadricarinatus, C. destructor and C. cainii (97-98% aa identity), as well as across arthropods in general (Fig 4.4). The HAT-A from

Cherax species had the greatest similarity with the HAT-116kDA from other arthropods (for examples; 63-64% with L. vannamei (AEE25939); 71-72% with B. terrestris (XP_003397698);

70-71% with M. rotundata (XP_012140297); and 70-71% with C. floridanus

(XP_011261602)).

The phylogenetic tree based on the translated amino acid sequences revealed that V-type-

H+-ATPase subunit-A formed three distinct groups; arthropods, fish and mammals.

Arthropods further clustered into two clades; decapod crustaceans and insects. All crayfish

species, C. quadricarinatus, C. destructor and C. cainii formed a monophyletic group that

was sister to a group comprised of insects; and were distantly related to the shrimp L. vannamei, (AEE25939, Wang et al., 2012)). The arthropod clade was distinct from a second well resolved clade of vertebrates (Fig 4.2c).

Page 101

Figure 4.4 Multiple alignment of three Cherax V-type-H+-ATPase subunit-a amino acid sequences with other species. Multiple alignment of three Cherax V-type-H+-ATPase 116kDa subunit-a amino acid sequences with other closely related species. Putative transmembrane domains are marked by black-boxed

Page 102

4.4.2.4 Other genes

Comparative sequence analyses showed that all genes including Na+/K+/2Cl− cotransporter

+ - - + + + +2 (NKCC), Na /Cl /HCO3 cotransporter (NBC), Na /H exchanger 3 (NHE3), Na /Ca exchanger

1 (NCX1), Arginine kinase (AK), Sarcoplasmic Ca+2-ATase (SERCA) and Calreticulin (CRT) had

the putative proteins (the deduced amino acid composition) similar in length and weight

across the three species (Table 4.2). All predicted proteins shared about 97-99% amino acid

identity with the corresponding genes across the Cherax species (Appendix 9) and all the functional sites were conserved in the predicted proteins (Table 4.2 and Appendix 9).

4.4.3 Comparative molecular evolutionary analyses

4.4.3.1 Evolutionary analyses of ion transport genes in Cherax sp.

The molecular evolutionary analyses at amino acid/codon level between C. quadricarinatus,

C. destructor and C. cainii showed that all candidate genes had a number of synonymous substitutions (Table 4.3). In terms of protein changing mutations, CAc, CAg and β-CA

contained 9, 4 and 5 nonsynonymous sites, respectively (Table 4.3). The other candidate

genes examined in detail, NKA, HAT-A, NKCC, NBC, NHE3, NCX1, AK, SERCA, CRT had 3, 12,

37, 24, 91, 15, 10, 23 and 7 nonsynonymous sites respectively (Table 4.3). Relative

evolutionary analysis showed that C. quadricarinatus, C. destructor and C. cainii have had an

equal evolutionary rate for all of the candidate genes (the null hypothesis of unequal

evolutionary rate were rejected at p<0.05, (Table 4.3)).

Page 103

Table 4.3 Molecular evolutionary analyses between three Cherax crayfish (C. quadricarinatus, C. destructor and C. cainii) at amino acid/codon level

CAc CAg CAb NKA HAT-116k NKCC NBC NHE3 NCX1 AK SERCA CRT Total sites/positions in analysis 271 277 257 1038 831 848 1145 921 846 357 1002 402 Identical sites in all three species 262 273 252 1035 819 811 1121 830 831 347 979 395 Nonsynonymous sites 9 4 5 3 12 37 24 91 15 10 23 7 Synonymous substitutions at codon 54 57 18 71 85 506 107 143 91 26 55 39 Divergent sites in all three species 0 0 0 0 0 1 1 9 1 1 1 0 Unique differences in Redclaw 3 0 0 1 6 11 7 29 7 1 6 1 Unique differences in Yabby 3 2 3 2 1 14 7 20 2 3 9 3 Unique differences in Marron 3 2 2 0 5 11 9 33 5 5 7 3 Equal evolutionary rate between Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Redclaw & Yabby? (1.00)* (0.16) (0.08) (0.56) (0.06) (0.55) (0.8) (0.20) (0.10) (0.32) (0.44) (0.32) Equal evolutionary rate between Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Redclaw &Marron? (1.0) (0.16) (0.16) (0.32) (0.76) (1) (0.8) (0.61) (0.56) (0.10) (0.78) (0.32) Equal evolutionary rate between Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yabby & Marron? (1.0) (1.00) (0.65) (0.16) (0.10) (0.55) (0.6) (0.07) (0.26) (0.48) (0.62) (1.0) Average Evolutionary Divergence 0.022 0.010 0.013 0.002 0.010 0.03 0.05 0.072 0.012 0.02 0.016 0.012

Note: CAc=Cytoplasmic carbonic anhydrase, CAg=GPI-linked carbonic anhydrase, CAb=Beta carbonic anhydrase, NKA=Na+/K+-ATPase alpha subunit, HAT-116k=Vacuolar type H+-ATPase 116 kda, NKCC = Na+/K+/2Cl- + - + + +2 +2 cotransporter, NBC=Na /HCO3 cotransporter, NHE3 =Na /H exchanger 3, NCX1 =Na+/Ca exchanger 1 , AK=Arginine kinase, SERCA=Sarco/endoplasmic reticulum Ca -ATPase, CRT=Calreticulin, * Values in brackets are p-values used to reject the null hypothesis of equal evolutionary rate

Page 104

4.4.3.2 Evolutionary analyses across crustacean species

Comparative analyses across arthropods, which included mostly crustaceans (around 15 species including three Cherax sp.), revealed a large number of non-synonymous mutations in all the sequences (173 in CAc, 128 in CAg, 143 in CAb, 243 in NKA, 355 in HAT-116k, 586 in

NKCC, 506 in NBC, 504 in NHE3, 529 in NCX1, 78 in AK, 276 in SERCA and 193 in CRT) (see

Table 4.4). Despite a large number of nonsynonymous mutations, HyPHy analysis (codon-by- codon natural selection estimations for each codon) detected that no candidate genes showed patterns of nucleotide variation consistent with the action of natural selection

(p<0.05).

Page 105

Table 4.4 Molecular evolutionary analyses across crustacean species at Amino acid level

Enzymes Gene No. of species/ Total Total Total Rate of Nucleotide In-Del Sequences in sites in segregating Identical segregation/site diversity analysis analysis sites sites Cytoplasmic carbonic anhydrase CAc 15 265 173 92 0.65283 0.38225 0 GPI-linked carbonic anhydrase CAg 8 287 128 159 0.445993 0.24029 0 Beta carbonic anhydrase CAb 16 254 143 111 0.562992 0.2691 0 Na+/K+-ATPase alpha subunit NKA 16 1001 243 758 0.242757 0.08577 0 Vacuolar type H+-ATPase 116 kda HAT-116k 15 803 355 448 0.442092 0.19255 0 Na+/K+/2Cl- cotransporter NKCC 16 838 586 252 0.699284 0.39172 0

+ - Na /HCO3 cotransporter NBC 16 1033 506 527 0.489835 0.23662 0 Na+/H+ exchanger 3 NHE3 15 843 504 339 0.597865 0.25904 0 Na+/Ca+2 exchanger 1 NCX1 15 793 529 264 0.667087 0.28318 0 Arginine kinase AK 15 355 78 277 0.219718 0.07329 0 Sarco/endoplasmic reticulum Ca+2-ATPase SERCA 15 989 276 713 0.27907 0.12366 0 Calreticulin CRT 15 396 193 203 0.487374 0.212 0

Page 106

4.4.4 Tissue-specific expression analyses

A total of 80 important genes that are directly or indirectly associated with either acid-base balance or osmotic/ionic regulation expression was investigated in seven different tissue types (gills, hepatopancreas, heart, kidney, liver, nerve and testes) in C. quadricarinatus

(Appendix 10). The results showed that 46% of the genes (37) were expressed in all types of

tissues; 11% (9 genes) in 6 tissue types, 5% (4 genes) in 5 tissue types, 8% (6 genes) in 4

tissue types; 6% (5 genes) in 3 tissue types; 14% (11 genes) in 2 tissue types (Fig 4.5 ). About

10% of the genes (8) were expressed in only one tissue type, i.e. they were unique in that

particular type of tissue. The highest number of genes were observed in the nerve (84%, 67

genes) followed by the gills (78%, 62 genes). The percentage of genes expressed in other

tissues are 70% for heart (56 genes), 70% for kidney (56 genes), 69% for liver (55 genes),

67.5% for hepatopancreas (54 genes), and 66% for testes (53 genes) (Fig 4.5).

Page 107

Figure 4.5 Tissue-specific expression/occurrences of important genes associated with pH balance or ion- regulation in Redclaw crayfish (Cherax quadricarinatus) A. Tissue-specific percentage of genes expressed B. Maximum types of organs with % of genes expressed therein

4.5 Discussion

Overall this study has demonstrated that most of the candidate genes involved in systemic acid-base balance and/or ion transport examined in this study are highly conserved in the genus Cherax and in crustaceans in general. While these genes showed little variation across the three target species, we found no evidence of purifying selection shaping nucleotide variation in any of the genes. The majority of these genes were expressed across multiple tissue types indicating they play an important and potentially multiple roles in a number of different tissues.

Page 108

4.5.1 Comparative molecular analyses

4.5.1.1 Carbonic anhydrase

Comparative analysis across the three Cherax species showed that both cytoplasmic and membrane linked CA were highly conserved, which may be explained by the conserved function of CA. Carbonic anhydrase is a Zn-metalloenzyme that plays a pivotal role in pH

balance, ion transport and gas exchange in all metazoan species (Freire et al., 2008; Henry et

al., 2012; Romano and Zeng, 2012). The molecular structure of CA comprises four primary

components: the Zn binding sites, the substrate association pocket, the threonine-199 loop

and the proton shuttling mechanism (Christianson and Alexander, 1989; Merz, 1990; Krebs

et al., 1993). In our study, we did not find any mutations in these important functional sites

at the amino acid level in both cytoplasmic and membrane-associated isoforms of CA across

the Cherax species. We did, however, find amino acid replacements outside of these

functional sites and these may be important for adaptation to different pH environments in

Cherax species.

Previous research has shown that many Cherax species, including C. quadricarinatus, C.

destructor and C. cainii, naturally occur in locations with water of different pH levels

(Macaranas, 1995; Bryant and Papas, 2007; Baker et al., 2008). Therefore, amino acid

replacements in cytoplasmic and membrane linked CA may be associated with the

differences in water chemistry experienced by different species. Adaptation to acidic water

chemistries has been demonstrated in the freshwater fish, Tribolodon hakonensis, which

contain high concentrations of CA in the chloride cells of its gill (Hirata et al., 2003). In fact,

Hirata et al. (2003) used functional and physiological studies to show that CA protein levels

were increased under low pH conditions in this species and contributed to its ability to

Page 109

survive in this environment. While we lack functional data, the changes in amino acids we

observed in the Cherax species may alter gene expression in the different species and play

an important role in coping with different pH environments. Conversely, these amino acid

replacements may be beneficial to protein function under different water pH environments

or they may also have no effect on protein function and be effectively neutral. Before any of

these hypotheses can be supported more genomic, functional and physiological

experiments will need to be undertaken to validate our findings here.

4.5.1.2 Na+/K+-ATPase

All the expected features of NKA were highly conserved in the three Cherax species,

including eight transmembrane domains (Mitsunaga-Nakatsubo et al., 1996), the putative

ATP-binding site (Horisberger et al., 1991) and a phosphorylation site. In fact, only two

conservative amino acid replacements were observed among the three Cherax species, an

alanine to glycine replacement in C. destructor and an alanine to threonine replacement in

C. quadricarinatus. Given that these Cherax species are naturally distributed in

environments with diverse salinity and pH ranges (Bryant and Papas, 2007), you might

expect to find more adaptive amino acid replacements in this gene. The lack of variation at

the amino acid level may indicate other mechanisms are more important than amino acid

differences for the response to salinity and pH changes in Cherax species. Changes in the

level of expression of NKA associated with salinity or pH changes may be a plausible

hypothesis for this lack of amino acid variation among Cherax species. A number of studies

have demonstrated that NKA expression is strongly induced by changes in salinity and/or pH in the gills of decapod crustaceans lending support to this hypothesis (Luquet et al., 2005;

Page 110

Serrano and Henry, 2008; Wang et al., 2012; Han et al., 2015; Leone et al., 2015; Li et al.,

2015). This hypothesis needs to be further tested, however, before it can be supported.

4.5.1.3 H+-ATPase

Inter-species evolutionary analyses between the three Cherax crayfish and other arthropod

species showed that V-H+-ATPase subunit A (HAT-A) was largely conserved at the protein

sequence level, but had patterns of nucleotide variation consistent with neutral evolution.

The small amount of amino acid variation found at this enzyme in Cherax species is probably because of its conserved function, as it is one of key enzymes via which many crustaceans maintain their internal acid-base balance (Kitagawa et al., 2008; Faleiros et al., 2010; Lee et al., 2011; Muench et al., 2011; Towle et al., 2011; Wang et al., 2012; Boudour-Boucheker et al., 2014; Marshansky et al., 2014; Lucena et al., 2015; Rawson et al., 2015). As the maintenance of acid-base balance is very important in aquatic crustaceans, amino acid replacements in important functional domains might have a deleterious effect on the function and activity of this enzyme. Alternatively, amino acid replacements in V-H+-ATPase

subunit A that increase its activity under different pH conditions may be beneficial to the

different Cherax species. A pattern of adaptive amino acid replacement has been observed

in fish gills under low pH conditions in a Japanese lake (Hirata et al., 2003).

4.5.1.4 Other genes

The comparative molecular analyses showed that most other genes including Na+/K+/2Cl-

+ - - + + cotransporter (NKCC), Na /Cl /HCO3 cotransporter (NBC), Na /H exchanger 3 (NHE3),

Na+/Ca+2 exchanger 1 (NCX1), Arginine kinase (AK), Sarcoplasmic Ca+2-ATase (SERCA) and

Calreticulin (CRT) were conserved across the three Cherax crayfish (Table 4.3 and 4.4). The

underlying reason may be that the these genes encode a set of enzymes that are actively or

Page 111

passively associated with the fundamental and common physiological processes of ion-

regulation in crustaceans (Lucu, 1989; Onken et al., 1991; Onken et al., 2003; Ahearn et al.,

2004; Serrano et al., 2007; Mandal et al., 2009; Lv et al., 2015; Ren et al., 2015; Xu et al.,

2015). The high level of amino acid conservation in these predicted proteins may be attributed to the fact that they are found in important biochemical pathways that influence systemic acid-base balance and/or ion transport (Uda et al., 2006; Hwang et al., 2011; Hiroi and McCormick, 2012; McNamara and Faria, 2012b). These genes have previously been demonstrated as important enzymes involved in osmoregulatory organs such as gills and epipodites in a number of crustaceans (Towle and Weihrauch, 2001; Weihrauch et al.,

2004a; Freire et al., 2008; Mandal et al., 2009). In fact, gene expression data for Na+/K+/2Cl-

cotransporter (Luquet et al., 2005; Havird et al., 2013) and Calreticulin (Luana et al., 2007; Lv

et al., 2015; Xu et al., 2015) show that they are induced under different ionic conditions and

arginine kinase has also been shown to be induced under different pH and salinity

conditions (Serrano et al., 2007; Xie et al., 2014; Ali et al., 2015b).

4.5.2 Tissue-specific expression analyses

Tissue-specific expression of the candidate genes involved in systemic acid-base balance

revealed that most of the major genes involved in this process including carbonic anhydrase

(CA), Na+/K+-ATPase (NKA), Vacuolar type H+-ATPase (HAT), Na+/H+ exchanger (NHE),

+ + - + - - Na /K /2Cl cotransporter (NKCC), Na /Cl /HCO3 cotransporter, Arginine kinase (AK) and

Sarco/endoplasmic reticulum Ca+2-ATPase (SERCA) were expressed in most tissue types. The

two tissue types with highest number of candidate genes expressed were the gills and

nervous system. A large number of genes involved in acid-base balance and osmic-/ionic-

regulation expressed in the gills was expected based on previous studies in decapod

Page 112

crustaceans (Freire et al., 2008; Romano and Zeng, 2012). The largest number of transport

related genes were expressed in nervous tissue and studies on the expression of these

genes in crustacean nervous system is still lacking. Data from vertebrate species, however,

has shown that many ion transport related genes are highly expressed in nervous tissue as

they play an important role in generating action potential (Fry and Jabr, 2010; Benarroch,

2011; Deval and Lingueglia, 2015; Hertz et al., 2015; Shrivastava et al., 2015; Wu et al., 2015;

Zhang et al., 2015). It is evident that dynamic voltage changes like action potential (nerve

impulses) are mainly caused by changes in membrane permeability for Na+, K+, Ca+2, and Cl-

ions, which in turn result from changes in functional activity of various ion transporters, ion

channels and ion exchangers (Barnett and Larkman, 2007; Fry and Jabr, 2010). For example,

Na+/K+-ATPase maintains the Na+ and K+ potential inside and outside the cell membrane

that are of fundamental importance for the maintenance of neural excitability and

conduction of action potential and secondary transport mechanisms involved in synaptic

uptake of neurotransmitters and regulation of cell volume, pH and Ca+2 concentration

(Benarroch, 2011). Action potentials in nervous tissues are triggered by specific voltage-

gated ion channels fitted in plasma membrane of a cell. When an action potential travels

towards the axon of a neuron, it results in changes in polarity across the membrane. Na+

and K+ gated ion channels open and close accordingly, in response to a signal from another

neuron. At the beginning of the process, the Na+ channels open and Na+ ions move down

the axon, causing depolarization. Afterwards, K+ channels open causing repolarization and K+

ions move out of the axon. Thus, Na+/K+-ATPase, Na+ and K+ channels plus other transport enzymes play vital role in nervous system; and the corresponding genes encoding theses enzymes are highly expressed in mammalian nerve cells. Similar patterns of gene expression

Page 113 in the nervous tissue of crustaceans are highly likely, but require further study and functional validation to support this idea.

4.6 Conclusions

We analysed the molecular differences and similarities at amino acid and nucleotide levels in most of the major genes involved in acid-base balance and osmotic/ionic regulation in three freshwater Cherax crayfish. The majority of these genes were expressed across most tissue types and were highly conserved at the amino-acid level. These findings indicate that these genes are important and probably have diverse functions related to ion exchange and pH balance across different tissues in freshwater crayfish.

4.7 Nucleotide sequence accession number

All raw sequence data was deposited in the Sequence Read Archive under the Bio-project numbers PRJNA275170, PRJNA275038 and PRJNA275165.

4.8 Supplementary data

Supplementary data 1 (Available online: http://dx.doi.org/10.1016/j.margen.2015.03.004)

Supplementary data 2 (Available online: http://dx.doi.org/10.1016/j.margen.2015.03.004)

Page 114

Chapter 5. General Discussion and Conclusion

In the study we used Cherax crayfish as a model organism for genetic research considering

their physiological and economic importance. These species make representative species for

other freshwater crayfish as well as other freshwater crustaceans. Crustacean aquaculture

has been growing rapidly because of its high demand, availability of commercially viable

species and the wide range of culture environments they can be produced under (Saoud et

al., 2013). Significantly, over the last three decades, crustacean culture has expanded at a

faster rate than either finfish or mollusc aquaculture (FAO, 2011; FAO, 2012; Saoud et al.,

2012; Saoud et al., 2013). Amongst the presently available farmed freshwater crustacean

species, crayfish are the most highly produced (FAO, 2012). Cherax quadricarinatus

(Redclaw), Cherax destructor (Yabby) and Cherax cainii (Marron) are economically important freshwater crayfish, and the culture of these species have been developed in many countries of the world (Macaranas, 1995; FAO, 2010; Saoud et al., 2012; Saoud et al., 2013).

Thus the selection of the Cherax species as a model organism for freshwater crustaceans is well justified and needed. The findings from our study, will potentially contribute to better growth and production of crayfish, especially by addressing the stress-related genes and their expression under different pH and salinity conditions. In addition, it contributes valuable information in the larger scientific community who can undertake genomic research in these species as a result of the genetic resources now developed specifically for the genus Cherax.

In Chapter one, we have critically reviewed all relevant research that have been undertaken in the field of ion transport physiology in crustaceans; and identified the research gaps

Page 115

relevant to our study. It can also be used as ready information to assist in finding out suitable research objectives for further physiological genomics study in freshwater crayfish.

In study one (Chapter 2), we have identified and characterised most of the major pH- balance and osmoregulatory genes, and shed light on the potential role of select genes in response to pH changes. The outcomes of these experiments have potential implications in enhancing crayfish production. Because, in the areas where Cherax species naturally occur and are commercially cultured, pH and salinity levels fluctuate for many reasons including; the condition of surrounding soils, duration of daylight, seasonal weather changes, heavy or low rainfall, flooding, acid precipitation, as well as long term climate change (Haines, 1981;

Boyd, 1990). As crayfish are farmed in a wide range of culture conditions, optimisation of water quality parameters, particularly pH and salinity, are crucial for their maximum growth and survival. In fact, fluctuations in pH and salinity have been demonstrated to have a great impact on the distribution, growth, behaviour and physiology in many crustaceans including

Cherax crayfish (Chen and Chen, 2003; Pavasovic et al., 2004; Pan et al., 2007; Yue et al.,

2009; Haddaway et al., 2013; Kawamura et al., 2015; Kim et al., 2015). For example, significantly reduced growth performance was observed at sub-lethal pH and salinity ranges in euryhaline and marine shrimp including Penaeus monodon (Ye et al., 2009), Litopenaeus

vannamei (Pan et al., 2007) and Penaeus latisulcatus (Minh Sang and Fotedar, 2004); and in

the freshwater species Macrobrachium rosenbergii (Chand et al., 2015; Kawamura et al.,

2015) and Austropotamobius pallipes (Haddaway et al., 2013). Reduced growth

performance in these species was suggested to result from higher energy requirements

diverted from growth to allow individuals to maintain pH balance and internal ionic

concentration. Increased energy expenditure on osmoregulation can produce many

Page 116

problems in cultured organisms including increased moisture content in muscle tissue, increased oxygen consumption and higher ammonia-N excretion (Silvia et al., 2004). It is also evident that environmental pH has a great impact on acid-base balance and electrolyte concentrations in the haemolymph of freshwater crayfish (Morgan and McMahon, 1982;

Wood and Rogano, 1986; Zanotto and Wheatly, 1993; Wheatly et al., 1996). For example, water with a low pH level has been shown to cause acid–base imbalance (decreased pH in haemolymph) and disturbed ion regulation (decreased Na+ and Cl- concentrations and

increased K+) in freshwater crayfish (Morgan and McMahon, 1982; Wood and Rogano, 1986;

Wheatly et al., 1996). Previous research also showed that physiological response of

crustaceans to varied water quality parameters are mainly controled by a conserved set of

physiological processes including osmoregulation and systemic acid-base balance. These

important physiological processes are undertaken by a range of proteins encoded by ion

transport-related genes of which carbonic anhydrase (CA), Na+/K+-ATPase (NKA), V-type-H+-

+ + - ATPase (HAT) and Na /K /2Cl cotransporter (NKCC) are among the best studied (Serrano et

al., 2007; Tsai and Lin, 2007; Freire et al., 2008; Pongsomboon et al., 2009; McNamara and

Faria, 2012a; Havird et al., 2013; Tongsaikling, 2013; Havird et al., 2014). In the study, we have not only sequenced, identified and characterised all of these genes, but also shed light on the expression and molecular evolution of these and other candidate genes that have potential roles in pH balance, salinity regulation, or stress-response. To the best of our knowledge, the molecular characterization and expression studies on these candidate genes are the first undertaken in freshwater crayfish from the genus Cherax. All the previously published data are largely limited to either patterns of enzyme activity or population genetics in wild populations of Cherax species (Miller et al., 2004; Austin et al., 2014; Gan et

Page 117 al., 2014). Thus, the data generated here will serve as a foundation for future molecular and genomic research in freshwater crustaceans, and in particular freshwater crayfish.

In second study (Chapter 3), we have assessed spatial effects of pH changes on expression patterns of some master genes involved in systemic pH balance and salinity regulation. As with the first study (Chapter 1) suggested potential role of the genes in pH balance, study at different time points over a period of time further elucidated their roles in response to pH challenges. The findings of the study showed that two forms of carbonic anhydrase (CA),

Na+/K+-ATPase (NKA) and V-type-H+-ATPase (HAT) were induced after transfer to different pH conditions (at pH 6.2 and 8.2 from control pH 7.2) . The cytoplasmic form of carbonic anhydrase (CqCAc) showed a significant increase in expression levels at low pH (6.2) and decreased expression levels at high pH condition (8.2). Expression of CAc increased in low pH after 12 h, and reached their maximum level by 24 h. The GPI-linked membrane- associated form of carbonic anhydrase (CqCAg) showed changes in expression levels more quickly than CAc, and the expression remained elevated at low pH (6.2) until the end of the experiment. The beta form of CA (CA-beta) was very low at all pH levels, so it was excluded from the analysis. Expression levels of Na+/K+-ATPase (CqNKA) and V-type-H+-ATPase

(CqHAT) showed similar patterns, where expression significantly increased 6 h post transfer at low pH conditions and remained significantly elevated throughout the experiment (over

24 hrs) (Fig. 3.3 and 3.4). Overall, observed expression patterns of all the genes reported in our study were similar to those documented for other crustacean species under different pH or salinity treatments (Pan et al., 2007; Serrano et al., 2007; Tsai and Lin, 2007; Serrano and

Henry, 2008; Pongsomboon et al., 2009; Havird et al., 2013; Han et al., 2015; Leone et al.,

2015; Liu et al., 2015). This indicates that these genes play a very similar role and are

Page 118 expressed in a similar way across gills of decapod crustacean species in response to pH change. The findings of our gene expression study suggest that CAc, CAg, NKA and HAT gene expression are induced at low pH conditions and are likely to have an important role for systemic pH balance in freshwater crayfish. These outcomes may have a great practical application in crayfish farming, in a way that it helps to address stress-related issues due to environmental pH fluctuations.

Two factors, however, that may have affected our gene expression study are small sample size and the inter-moult cycle of crustacean species. In this study, we used inter-moult crayfish in the gene expression study, but could not determine the exact stage of moulting of the experimental animals. The stage of inter-moult could have affected patterns of gene expression we observed, as the moulting cycle is known to influence gene expression in decapod crustaceans. Although we could not control for this, to minimise the potential influence the inter-moult cycle may have has on gene expression patterns, we applied our best judgment to pick animals of equal size and age. Given that the results of our study were consistent with most other studies (Pan et al., 2007; Serrano et al., 2007; Leone et al., 2015;

Liu et al., 2015) on decapod crustaceans, it would seem that the inter-moult cycle has had a limited impact on our gene expression results. In our study, we also used three individuals at each sampling point over a period of 24 hours. Small sample size may have obscured some patterns of gene expression, as we observed some variance in gene expression between technical replicates. In addition, it seemed from our results that a longer term experiment may have been beneficial, as gene expression patterns were yet to stabilize at the end of the of the experiment. Therefore, future experiments evaluating gene expression on the chosen candidate genes should be undertaken with larger sample size (> eight individuals)

Page 119

at each sampling points and expose animals to stress conditions for longer time periods (at

least three days to a few weeks) to determine the duration of expression effects (Pan et al.,

2007; Serrano et al., 2007; Chaudhari et al., 2015; Liu et al., 2015). Similarly, analysing the

expression of these genes across other tissue types may have an effect on how they are

expressed in the gills, while also providing a more comprehensive analysis of the distribution

of expression of these important osmoregulatory and systemic acid-base balance genes in

response to pH change.

In the third study (Chapter 4), we generated gill transcriptomes from two other important

freshwater crayfish, Yabby (C. destructor) and Marron (C. cainii); and identified and annotated candidate genes associated with pH balance and osmotic-/ionic regulation. In addition, we made a comprehensive comparative molecular analysis between three Cherax species, which were sourced from three distinct and geographically isolated areas (see Fig

1.1). The study has generated large scale genomic resources for the three most commercially important Cherax species. The gill transcriptomes (from Redclaw, Yabby and

Marron) sequenced in this study are much larger than the genomic resources previously available for C. quadricarinatus, which are largely limited to a few studies, one that was sequenced using the Ion Torrent platform (Dammannagoda et al., 2015) and another using

Roche 454 (Glazer et al., 2013). Recently, however, a large scale Illumina Miseq dataset (206 million reads with an average read length of 80 bp) has been generated and published for C. quadricarinatus (Tan et al., 2015). This dataset is comprised of multiple tissue types including heart, nerve, muscle, testes and brain (Tan et al., 2015), but each individual dataset is smaller than our current dataset and they did not sequence gill tissue. Our

Illumina sequenced datasets each comprised between 72–100 million paired-end reads and

Page 120

assembled into >100 000 contigs for each species. These assembled gill transcriptomes from

the three Cherax species, provided an excellent resource to identify candidate genes related

to systemic pH balance and osmoregulation as they were largely complete based on the

presence of 248 ultra conserved eukaryote genes. Overall, in all three Cherax species, we identified most of the major genes associated with pH balance or osmoregulation including: three forms of Carbonic anhydrase (CAc, CAg and CAb), Na+/K+-ATPase (NKA), V-type-H+-

+ + - + − − + + ATPase (HAT), Na /K /2Cl cotransporter (NKCC), (Na )Cl /HCO3 (NCB), Na /H exchangers

(NHE), Arginine kinase (AK), Sarcoplasmic/endoplasmic reticulum calcium-ATPase (SERCA)

and Calreticulin (CRT). These candidate genes were used in follow up studies to examine

their tissue specific expression and molecular evolution in order to better understand their

function in pH balance in freshwater crayfish species.

The structure-function analysis and comparative molecular study showed that all the

candidate genes were highly conserved in Cherax crayfish and other related decapods. The

genes are highly conserved not only in decapod crustaceans but also in other crustaceans

and insects (Hoskins et al., 2007; Serrano et al., 2007; Serrano and Henry, 2008;

Pongsomboon et al., 2009; Xu and Liu, 2011; Havird et al., 2014; Han et al., 2015; Xu et al.,

2015). It is interesting that all three Cherax species, although naturally distributed in three

distinct environmental conditions and geographically disconnected areas (see natural

distribution in Fig 1.1 and environmental tolerances in Table 1.1), showed a high degree of conservation in terms of sequence variation and functional structures. This high level of conservation is probably associated with the conserved function of the genes in ion transport as well as having multiple other basic physiological functions including cell volume control, maintaining a concentration gradient, signal transduction and integration in

Page 121

different tissue types. Many genes that influence to multiple phenotypic traits (pleiotropic

genes) are highly conserved. This is because a non-synonymous mutation in a pleiotropic gene can often affect multiple traits simultaneously (Mackay et al., 2009). As a result a non- synonymous mutation that improves the function of one process may be deleterious to another process and is often selected against. Therefore, in many pleiotropic genes (genes that affects multiple traits) we often see only a limited number of mutations and those that we do are often dominated by synonymous mutations. While we observed that the candidate genes examined in this study were highly conserved, we found no evidence of purifying selection acting on these genes. This is contrast to other studies which have found evidence of purifying selection in other animals (Hughes et al., 2003; Ward and Kellis,

2012).

Tissue specific expression of the candidate genes involved in systemic acid-base balance and ionic/osmotic-regulation revealed that most of the genes involved in these processes including carbonic anhydrase (CA), Na+/K+-ATPase (NKA), Vacuolar type H+-ATPase (HAT),

+ + + + - + - - Na /H exchanger (NHE), Na /K /2Cl cotransporter (NKCC), Na /Cl /HCO3 cotransporter,

Arginine kinase (AK) and Sarco/endoplasmic reticulum Ca+2-ATPase (SERCA) were expressed

in all tissue types. This indicates that the majority of ion transport genes are expressed in

most tissue types in freshwater crayfish and is something that needs to be taken into

account in future gene expression studies of these genes in specific tissues such as gills. As

all the major genes were expressed in tissues other than gills, it implies an important

physiological role for these genes outside of osmoregulation. For example Na+/K+-ATPase,

an important osmoregulatory gene, has another important function as a signal

transducer/integrator that regulates the mitogen activated stress kinase pathway,

Page 122 intracellular calcium concentrations and reactive oxygen species (Xie and Askari, 2002; Yuan et al., 2005; Bhavsar et al., 2014). Multifunctional proteins such as Na+/K+-ATPase are required to perform functions in multiple cell and tissue types; therefore the expression of similar ion transport and systemic pH balance genes is expected in multiple tissue types.

In our analysis, the two tissue types with highest number of candidate genes expressed were the gills and nervous system. A large number of the genes (78%, 62 genes ) expressed in the gills was expected based on previous research in decapod crustaceans (Freire et al.,

2008; Romano and Zeng, 2012) as this is one of the principal tissues where osmoregulation and systemic acid-base balance occur. Interestingly, we observed the highest number of genes expressed in nervous tissue (84%, 67 genes). However, expression studies of these genes in the nervous system of crayfish are still scant (Kingston and Cronin, 2015), hence data from crayfish are still lacking to support our finding. Despite this, studies on the expression profile of vertebrate orthologs of these candidate genes, has shown that many are highly expressed in nerve tissue (Fry and Jabr, 2010; Benarroch, 2011; Deval and

Lingueglia, 2015; Hertz et al., 2015; Shrivastava et al., 2015; Wu et al., 2015; Zhang et al.,

2015). In fact, a number of ion transport related genes play a large role in generating and maintaining the concentration gradient and action potential in nerve cells (Barnett and

Larkman, 2007; Fry and Jabr, 2010; Benarroch, 2011; Hertz et al., 2015), which has been discussed in details at tissue-specific expression section in Chapter 4. Many of these genes examined in this study are also involved in muscle tissue (e. g. Sarco/endoplasmic reticulum

Ca+2-ATPase) and/or play key roles in other important cellular processes. The findings of this study opens up a new avenue to multi-tissue expression study for the genes involved in

Page 123

maintenance of systemic pH balance and osmoregulation in freshwater crustaceans and particularly in freshwater caryfish.

Despite a few limitations in our study, we are confident that the findings from our study will contribute to the wider community of scientific research and in particular crustacean aquaculture. Overall, we have successfully identified and characterised a suite of key osmoregulatory and systemic acid-base balance genes, across three freshwater crayfish species, of commercial and ecological importance, both in Australia and globally. Our results demonstrate a high degree of conservation in these candidate genes, despite the ecological and evolutionary divergence between the species studied. Importantly, we provide the first report on the distribution of expression of these key genes across multiple tissue types in freshwater crayfish, suggesting they potentially play important and multiple roles across these tissue types. Ultimately, data generated in our study will produce a valuable resource of genomic information for future use in studies on freshwater crayfish as well as wider comparative genomic studies in decapod crustaceans.

To conclude, outcomes of our study will serve as a basic foundation for future molecular and genomic studies of transport- and stress-related enzymes in freshwater crayfish. It will also assist to determine the optimal water quality parameters, particularly pH and salinity, to avoid any stress related to un-favourable pH and salinity conditions, and thus helping in achieving better productivity of commercially cultured crayfish under variable environmental conditions.

Page 124

Chapter 6. References

Abe, H., Hirai, S. and Okada, S., 2007. Metabolic responses and arginine kinase expression under hypoxic stress of the kuruma prawn Marsupenaeus japonicus. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 146, 40-46. Ahearn, G.A., Mandal, P.K. and Mandal, A., 2004. Calcium regulation in crustaceans during the molt cycle: a review and update. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 137, 247-257. Ali, M.Y., Pavasovic, A., Amin, S., Mather, P.B. and Prentis, P.J., 2015a. Comparative analysis of gill transcriptomes of two freshwater crayfish, Cherax cainii and C. destructor. Marine Genomics 22, 11-13. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015b. Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus. Gene 564, 176-187. Ali, M.Y., Pavasovic, A., Mather, P.B. and Prentis, P.J., 2015c. Transcriptome analysis and characterisation of gill-expressed carbonic anhydrase and other key osmoregulatory genes in freshwater crayfish Cherax quadricarinatus. Data in Brief 5, 187-193. Amin, S., Prentis, P.J., Gilding, E.K. and Pavasovic, A., 2014. Assembly and annotation of a non-model gastropod (Nerita melanotragus) transcriptome: a comparison of De novo assemblers. BMC research notes 7, 488. Anger, K. and Hayd, L., 2010. Feeding and growth in early larval shrimp Macrobrachium amazonicum from the Pantanal, southwestern Brazil. Aquatic Biology 9, 251-261. Austin, C.M., Tan, M.H., Croft, L.J. and Gan, H.M., 2014. The complete mitogenome of the freshwater crayfish Cherax cainii (Crustacea: Decapoda: Parastacidae). Mitochondrial DNA 0, 1-2. Baker, N., De Bruyn, M. and Mather, P.B., 2008. Patterns of molecular diversity in wild stocks of the redclaw crayfish (Cherax quadricarinatus) from northern Australia and Papua New Guinea: impacts of Plio-Pleistocene landscape evolution. Freshwater Biology 53, 1592-1605. Barnett, M.W. and Larkman, P.M., 2007. The action potential. Practical Neurology 7, 192-197. Benarroch, E.E., 2011. Na+, K+-ATPase Functions in the nervous system and involvement in neurologic disease. Neurology 76, 287-293. Beyenbach, K.W., 2001. Energizing Epithelial Transport with the Vacuolar H+-ATPase. Beyenbach, K.W. and Wieczorek, H., 2006. The V-type H+ ATPase: molecular structure and function, physiological roles and regulation. Journal of Experimental Biology 209, 577-589. Bhavsar, S.K., Hosseinzadeh, Z., Brenner, D., Honisch, S., Jilani, K., Liu, G., Szteyn, K., Sopjani, M., Mak, T.W. and Shumilina, E., 2014. Energy-sensitive regulation of Na+/K+-ATPase by Janus kinase 2. American Journal of Physiology-Cell Physiology 306, C374-C384. Blanco, G. and Mercer, R.W., 1998. Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. American Journal of Physiology-Renal Physiology 275, F633-F650. Bolger, A.M., Lohse, M. and Usadel, B., 2014. Trimmomatic: A flexible trimmer for Illumina Sequence Data. Bioinformatics. Boron, W.F., 1986. Intracellular pH Regulation in Epithelial Cells. Annual Review of Physiology 48, 377-388. Böttcher, K., Siebers, D. and Becker, W., 1990. Carbonic anhydrase in branchial tissues of osmoregulating shore crabs, Carcinus maenas. Journal of Experimental Zoology 255, 251- 261. Böttcher, K., Siebers, D., Becker, W. and Petrausch, G., 1991. Physiological role of branchial carbonic anhydrase in the shore crabCarcinus maenas. Marine Biology 110, 337-342. Boudour-Boucheker, N., Boulo, V., Charmantier-Daures, M., Grousset, E., Anger, K., Charmantier, G. and Lorin-Nebel, C., 2014. Differential distribution of V-type H+-ATPase and Na+/K+-ATPase Page 125

in the branchial chamber of the palaemonid shrimp Macrobrachium amazonicum. Cell and Tissue Research 357, 195-206. Boyd, C.E., 1990. Water quality in ponds for aquaculture. Birmingham Publishing, Birmingham, AL, USA 482. Bryant, D. and Papas, P., 2007. Marron Cherax Cainii (Austin) in Victoria: A Literature Review, Arthur Rylah Institute for Environmental Research, Department of Sustainability and Environment. Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K. and Madden, T., 2009. BLAST+: architecture and applications. BMC Bioinformatics 10, 421. Chand, B., Trivedi, R., Dubey, S., Rout, S., Beg, M. and Das, U., 2015. Effect of salinity on survival and growth of giant freshwater prawn Macrobrachium rosenbergii (de Man). Aquaculture Reports 2, 26-33. Charmantier, G. and Anger, K., 2011. Ontogeny of osmoregulatory patterns in the South American shrimp Macrobrachium amazonicum: loss of hypo-regulation in a land-locked population indicates phylogenetic separation from estuarine ancestors. Journal of Experimental Marine Biology and Ecology 396, 89-98. Chaudhari, A., Gireesh-Babu, P., Tripathi, G., Sabnis, S., Dhamotharan, K., Vardarajan, R., Kumari, K., Dasgupta, S. and Rajendran, K., 2015. Expression studies on NA+/K+-ATPase in gills of Penaeus monodon (Fabricius) acclimated to different salinities. Indian Journal of Experimental Biology 53, 273-280. Chen, D., Zhang, Z., Wheatly, M.G. and Gao, Y., 2002. Cloning and characterization of the heart muscle isoform of sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) from crayfish. Journal of experimental biology 205, 2677-2686. Chen, S.-M. and Chen, J.-C., 2003. Effects of pH on survival, growth, molting and feeding of giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 218, 613-623. Choi, C.Y. and An, K.W., 2008. Cloning and expression of Na+/K+-ATPase and osmotic stress transcription factor 1 mRNA in black porgy, Acanthopagrus schlegeli during osmotic stress. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 149, 91-100. Chomczynski, P. and Mackey, K., 1995. Short technical reports. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques 19, 942-945. Christianson, D.W. and Alexander, R.S., 1989. Carboxylate-histidine-zinc interactions in protein structure and function. Journal of the American Chemical Society 111, 6412-6419. Chung, J.S., Maurer, L., Bratcher, M., Pitula, J.S. and Ogburn, M.B., 2012. Cloning of aquaporin-1 of the blue crab, Callinectes sapidus: its expression during the larval development in hyposalinity. Aquatic biosystems 8, 1-10. Clark, M.S., Thorne, M.A.S., Toullec, J.-Y., Meng, Y., Guan, L.L., Peck, L.S. and Moore, S., 2011. Antarctic Krill 454 Pyrosequencing Reveals Chaperone and Stress Transcriptome. PLoS ONE 6, e15919. Colbourne, J.K., Pfrender, M.E., Gilbert, D., Thomas, W.K., Tucker, A., Oakley, T.H., Tokishita, S., Aerts, A., Arnold, G.J., Basu, M.K., Bauer, D.J., Cáceres, C.E., Carmel, L., Casola, C., Choi, J.-H., Detter, J.C., Dong, Q., Dusheyko, S., Eads, B.D., Fröhlich, T., Geiler-Samerotte, K.A., Gerlach, D., Hatcher, P., Jogdeo, S., Krijgsveld, J., Kriventseva, E.V., Kültz, D., Laforsch, C., Lindquist, E., Lopez, J., Manak, J.R., Muller, J., Pangilinan, J., Patwardhan, R.P., Pitluck, S., Pritham, E.J., Rechtsteiner, A., Rho, M., Rogozin, I.B., Sakarya, O., Salamov, A., Schaack, S., Shapiro, H., Shiga, Y., Skalitzky, C., Smith, Z., Souvorov, A., Sung, W., Tang, Z., Tsuchiya, D., Tu, H., Vos, H., Wang, M., Wolf, Y.I., Yamagata, H., Yamada, T., Ye, Y., Shaw, J.R., Andrews, J., Crease, T.J., Tang, H., Lucas, S.M., Robertson, H.M., Bork, P., Koonin, E.V., Zdobnov, E.M., Grigoriev, I.V., Lynch, M. and Boore, J.L., 2011. The Ecoresponsive Genome of Daphnia pulex. Science 331, 555-561.

Page 126

Conesa, A., Götz, S., García-Gómez, J.M., Terol, J., Talón, M. and Robles, M., 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674-3676. Covi, J.A. and Hand, S.C., 2005. V-ATPase expression during development of Artemia franciscana embryos: potential role for proton gradients in anoxia signaling. Journal of Experimental Biology 208, 2783-2798. Cox, E., McLendon, G., Morel, F., Lane, T., Prince, R., Pickering, I. and George, G., 2000. The active site structure of Thalassiosira weissflogii carbonic anhydrase 1. Biochemistry 39, 12128 - 12130. Crandall, K.A., Fetzner Jr, J.W., Lawler, S.H., Kinnersley, M. and Austin, C.M., 1999. Phylogenetic relationships among the Australian and New Zealand genera of freshwater crayfishes (Decapoda: Parastacidae). Australian Journal of Zoology 47, 199-214. Cutler, C.P., Sanders, I.L., Hazon, N. and Cramb, G., 1995. Primary sequence, tissue specificity and expression of the Na+,K+-ATPase α 1 subunit in the European eel (Anguilla anguilla). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 111, 567-573. Dammannagoda, L.K., Pavasovic, A., Prentis, P.J., Hurwood, D.A. and Mather, P.B., 2015. Expression and characterization of digestive enzyme genes from hepatopancreatic transcripts from redclaw crayfish (Cherax quadricarinatus). Aquaculture Nutrition, n/a-n/a. Deane, E.E. and Woo, N.Y.S., 2005. Cloning and characterization of sea bream Na+-K+-ATPase α and β subunit genes: In vitro effects of hormones on transcriptional and translational expression. Biochemical and Biophysical Research Communications 331, 1229-1238. Delpire, E., Lu, J., England, R., Dull, C. and Thorne, T., 1999. Deafness and imbalance associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet 22, 192-195. Deval, E. and Lingueglia, E., 2015. Acid-sensing ion channels and nociception in the peripheral and central nervous systems. Neuropharmacology. Dodgson, S.J., Forster, R.E., Storey, B.T. and Mela, L., 1980. Mitochondrial Carbonic Anhydrase. Proceedings of the National Academy of Sciences of the United States of America 77, 5562- 5566. DPI, 2005. Aquaculture Prospects for Freshwater Crayfish. Department of Primary Industries, New South Wales DPI, 2006. Aquaculture Prospects for Freshwater Crayfish. Department of Primary Industries, New South Wales Duan, Y., Liu, P., Li, J., Wang, Y., Li, J. and Chen, P., 2014. Molecular responses of calreticulin gene to Vibrio anguillarum and WSSV challenge in the ridgetail white prawn Exopalaemon carinicauda. Fish & Shellfish Immunology 36, 164-171. Ehrenfeld, J., 1974. Aspects of ionic transport mechanisms in crayfish Astacus leptodactylus. Journal of Experimental Biology 61, 57-70. Eissa, N. and Wang, H.-P., 2014. Transcriptional stress responses to environmental and husbandry stressors in aquaculture species. Reviews in Aquaculture 6, 1-28. Faleiros, R.O., Goldman, M.H.S., Furriel, R.P.M. and McNamara, J.C., 2010. Differential adjustment in gill Na+/K+- and V-ATPase activities and transporter mRNA expression during osmoregulatory acclimation in the cinnamon shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae). The Journal of Experimental Biology 213, 3894-3905. Fang, D.-A., Wang, Q., He, L., Wang, J. and Wang, Y., 2012. Characterization of heat shock protein 70 in the red claw crayfish (Cherax quadricarinatus): Evidence for its role in regulating spermatogenesis. Gene 492, 138-147. FAO, 2010. FAO yearbook. Fishery and Aquaculture Statistics. 2008. . FAO Fisheries and Aquaculture Information and Statistics Service, Rome, FAO, 1-72.

Page 127

FAO, 2011. Global Capture Production Statistics Dataset 1950–2009 and Global Aquaculture Production Statistics dataset (Quantity and Value) 1950–2009. FAO Fisheries and Aquaculture Department, Rome. FAO, 2012. The State of World Fisheries and Aquaculture 2012. FAO Fisheries and Aquaculture Department, Rome, 36-39. Flik, G. and Haond, C., 2000. Na, K-ATPase, Ca-ATPase and Na/Ca-exchange activities in gills, epipodites and branchiostegite of European lobster, Homarus gammarus: effects of exposure to dilute seawater. J. Exp. Biol 203, 213-220. Flik, G., Verbost, P.M., Atsma, W. and Lucu, C., 1994. Calcium transport in gill plasma membranes of the crab Carcinus maenas: evidence for carriers driven by ATP and a Na+ gradient. The Journal of experimental biology 195, 109-122. Forgac, M., 1998. Structure, function and regulation of the vacuolar (H+)-ATPases. FEBS Letters 440, 258-263. Forgac, M., 2007. Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nat Rev Mol Cell Biol 8, 917-929. Freire, C.A., Onken, H. and McNamara, J.C., 2008. A structure-function analysis of ion transport in crustacean gills and excretory organs. Comp Biochem Physiol A Mol Integr Physiol 151, 272- 304. Fry, C.H. and Jabr, R.I., 2010. The action potential and nervous conduction. Surgery (Oxford) 28, 49- 54. Furriel, R.P.M., McNamara, J.C. and Leone, F.A., 2000. Characterization of (Na+, K+)-ATPase in gill microsomes of the freshwater shrimp Macrobrachium olfersii. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 126, 303-315. Gan, H.M., Tan, M.H. and Austin, C.M., 2014. The complete mitogenome of the red claw crayfish Cherax quadricarinatus (Von Martens, 1868) (Crustacea: Decapoda: Parastacidae). Mitochondrial DNA 0, 1-2. Gao, Y. and Wheatly, M.G., 2004a. Characterization and expression of plasma membrane Ca2+- ATPase (PMCA3) in the crayfish Procambarus clarkii antennal gland during molting. Journal of Experimental Biology 207, 2991-3002. Gao, Y. and Wheatly, M.G., 2004b. Characterization and expression of plasma membrane Ca2+ ATPase (PMCA3) in the crayfish Procambarus clarkii antennal gland during molting. Journal of experimental biology 207, 2991-3002. Gao, Y. and Wheatly, M.G., 2007. Molecular characterization of an epithelial Ca2+ channel-like gene from crayfish Procambarus clarkii. Journal of Experimental Biology 210, 1813-1824. Gilles, R. and Pequeux, A., 1986. Physiological and ultrastructural studies of NaCl transport in crustaceans gills. Bolletino di zoologia 53, 173-182. Gilles, R. and Péqueux, A.J.R., 1985. Ion Transport in Crustacean Gills: Physiological and Ultrastructural Approaches, in: Gilles, R. and Gilles-Baillien, M. (Eds.), Transport Processes, Iono- and Osmoregulation. Springer Berlin Heidelberg, pp. 136-158. Glazer, L., Tom, M., Weil, S., Roth, Z., Khalaila, I., Mittelman, B. and Sagi, A., 2013. Hemocyanin with phenoloxidase activity in the chitin matrix of the crayfish gastrolith. The Journal of Experimental Biology 216, 1898-1904. Glynn, I.M., 1993. Annual review prize lecture. 'All hands to the sodium pump'. The Journal of Physiology 462, 1-30. Haas, B.J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P.D., Bowden, J., Couger, M.B., Eccles, D., Li, B., Lieber, M., MacManes, M.D., Ott, M., Orvis, J., Pochet, N., Strozzi, F., Weeks, N., Westerman, R., William, T., Dewey, C.N., Henschel, R., LeDuc, R.D., Friedman, N. and Regev, A., 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protocols 8, 1494-1512. Haas, M., 1994. The Na-K-Cl cotransporters.

Page 128

Haas, M. and Forbush III, B., 2000. The Na-K-Cl Cotransporter of Secretory Epithelia. Annual Review of Physiology 62, 515-534. Haddaway, N.R., Mortimer, R.J., Christmas, M. and Dunn, A.M., 2013. Effect of pH on Growth and Survival in the Freshwater Crayfish Austropotamobius pallipes. Freshwater Crayfish 19, 53- 62. Haines, T.A., 1981. Acidic Precipitation and Its Consequences for Aquatic Ecosystems: A Review. Transactions of the American Fisheries Society 110, 669-707. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic acids symposium series. pp. 95-98. Han, X., Liu, P., Gao, B., Wang, H., Duan, Y., Xu, W. and Chen, P., 2015. Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress. Chinese Journal of Oceanology and Limnology, 1-10. Havird, J.C., Henry, R.P. and Wilson, A.E., 2013. Altered expression of Na+/K+-ATPase and other osmoregulatory genes in the gills of euryhaline animals in response to salinity transfer: A meta-analysis of 59 quantitative PCR studies over 10years. Comp Biochem Physiol Part D Genomics Proteomics 8, 131-40. Havird, J.C., Santos, S.R. and Henry, R.P., 2014. Osmoregulation in the Hawaiian anchialine shrimp Halocaridina rubra (Crustacea: Atyidae): expression of ion transporters, mitochondria-rich cell proliferation and hemolymph osmolality during salinity transfers. The Journal of Experimental Biology 217, 2309-2320. Henry, R.P., 1987. Membrane-associated carbonic anhydrase in gills of the blue crab, Callinectes sapidus. American Journal of Physiology - Regulatory, Integrative and Comparative Physiology 252, R966-R971. Henry, R.P., 1988. Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus. Journal of Experimental Zoology 245, 1-8. Henry, R.P., 2001. Environmentally mediated carbonic anhydrase induction in the gills of euryhaline crustaceans. Journal of Experimental Biology 204, 991-1002. Henry, R.P. and Cameron, J.N., 1982. The distribution and partial characterization of carbonic anhydrase in selected aquatic and terrestrial decapod crustaceans. Journal of Experimental Zoology 221, 309-321. Henry, R.P. and Cameron, J.N., 1983. The Role of Carbonic Anhydrase in Respiration, Ion Regulation and Acid-Base Balance in the Aquatic Crab Calunectes Sapidus and the Terrestrial Crab Gecarcinus Lateraus. Journal of Experimental Biology 103, 205-223. Henry, R.P. and Campoverde, M., 2006. Neuroendocrine regulation of carbonic anhydrase expression in the gills of the euryhaline green crab, Carcinus maenas. Journal of Experimental Zoology Part A: Comparative Experimental Biology 305A, 663-668. Henry, R.P., Garrelts, E.E., McCarty, M.M. and Towle, D.W., 2002. Differential induction of branchial carbonic anhydrase and Na+/K+-ATPase activity in the euryhaline crab, Carcinus maenas, in response to low salinity exposure. Journal of Experimental Zoology 292, 595-603. Henry, R.P., Gehnrich, S., Weihrauch, D. and Towle, D.W., 2003. Salinity-mediated carbonic anhydrase induction in the gills of the euryhaline green crab, Carcinus maenas. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 136, 243-258. Henry, R.P. and Kormanik, G.A., 1985. Carbonic Anhydrase Activity and Calcium Deposition during the Molt Cycle of the Blue Crab Callinectes sapidus. Journal of Crustacean Biology 5, 234- 241. Henry, R.P., Lucu, C., Onken, H. and Weihrauch, D., 2012. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals. Front Physiol 3, 431. Henry, R.P., Thomason, K.L. and Towle, D.W., 2006. Quantitative changes in branchial carbonic anhydrase activity and expression in the euryhaline green crab, Carcinus maenas, in

Page 129

response to low salinity exposure. Journal of Experimental Zoology Part A: Comparative Experimental Biology 305A, 842-850. Hertz, L., Song, D., Xu, J., Peng, L. and Gibbs, M.E., 2015. Role of the Astrocytic Na+, K+-ATPase in K+ Homeostasis in Brain: K+ Uptake, Signaling Pathways and Substrate Utilization. Neurochemical research, 1-12. Hewett-Emmett, D., 2000. Evolution and distribution of the carbonic anhydrase gene families. EXS 90, 29 - 76. Hirata, T., Kaneko, T., Ono, T., Nakazato, T., Furukawa, N., Hasegawa, S., Wakabayashi, S., Shigekawa, M., Chang, M.-H. and Romero, M.F., 2003. Mechanism of acid adaptation of a fish living in a pH 3.5 lake. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 284, R1199-R1212. Hiroi, J. and McCormick, S.D., 2012. New insights into gill ionocyte and ion transporter function in euryhaline and diadromous fish. Respiratory physiology & neurobiology 184, 257-268. Horisberger, J., Lemas, V., Kraehenbuhl, J. and Rossier, B., 1991. Structure-function relationship of Na, K-ATPase. Annual review of physiology 53, 565-584. Hoskins, R.A., Carlson, J.W., Kennedy, C., Acevedo, D., Evans-Holm, M., Frise, E., Wan, K.H., Park, S., Mendez-Lago, M., Rossi, F., Villasante, A., Dimitri, P., Karpen, G.H. and Celniker, S.E., 2007. Sequence Finishing and Mapping of Drosophila melanogaster Heterochromatin. Science 316, 1625-1628. Hu, Y.Y., Pan, L.Q. and Liu, M.Q., 2013. Litopenaeus vannamei glycosyl-phosphatidylinositol-linked carbonic anhydrase (CAg). Direct Submission, Gene Bank:JX975725, College of Fisheries, Ocean University of China, Qingdao, China. Hu, Z.-L., Bao, J. and Reecy, J.M., 2008. CateGOrizer: A Web-Based Program to Batch Analyze Gene Ontology Classification Categories. Online Journal of Bioinformatics 9 108-112. Huang, Y., Niu, B., Gao, Y., Fu, L. and Li, W., 2010. CD-HIT Suite: a web server for clustering and comparing biological sequences. Bioinformatics 26, 680-682. Huang, Y., Zhao, L.-L., Feng, J.-L., Zhu, H.-X., Huang, X., Ren, Q. and Wang, W., 2015. A novel integrin function in innate immunity from chinese mitten crab (eriocheir sinensis). Developmental & Comparative Immunology. Hughes, A.L., Packer, B., Welch, R., Bergen, A.W., Chanock, S.J. and Yeager, M., 2003. Widespread purifying selection at polymorphic sites in human protein-coding loci. Proceedings of the National Academy of Sciences 100, 15754-15757. Hwang, P.-P., Lee, T.-H. and Lin, L.-Y., 2011. Ion regulation in fish gills: recent progress in the cellular and molecular mechanisms. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 301, R28-R47. Imamura, H., Nakano, M., Noji, H., Muneyuki, E., Ohkuma, S., Yoshida, M. and Yokoyama, K., 2003. Evidence for rotation of V1-ATPase. Proceedings of the National Academy of Sciences 100, 2312-2315. Jayasundara, N., Towle, D.W., Weihrauch, D. and Spanings-Pierrot, C., 2007. Gill-specific transcriptional regulation of Na+/K+-ATPase α-subunit in the euryhaline shore crab Pachygrapsus marmoratus: sequence variants and promoter structure. Journal of Experimental Biology 210, 2070-2081. Jillette, N., Cammack, L., Lowenstein, M. and Henry, R.P., 2011. Down-regulation of activity and expression of three transport-related proteins in the gills of the euryhaline green crab, Carcinus maenas, in response to high salinity acclimation. Comp Biochem Physiol A Mol Integr Physiol 158, 189-93. Johnson, R.G., Beers, M.F. and Scarpa, A., 1982. H+ ATPase of chromaffin granules. Kinetics, regulation, and stoichiometry. Journal of Biological Chemistry 257, 10701-10707. Jones, C.M., 1990. The biology and aquaculture potential of the tropical freshwater crayfish Cherax quadricarinatus. Information Series vol. Q190028. (Queensland Department of Primary Industries: Brisbane ).

Page 130

Jones, C.M., 1998. The New Rural industries, a handbook for Farmers and Investors. pp 127-133. (Rural Industries and Research Development Corporation: Barton). Kane, P.M., 2006. The Where, When, and How of Organelle Acidification by the Yeast Vacuolar H+- ATPase. Microbiology and Molecular Biology Reviews 70, 177-191. Kanehisa, M. and Goto, S., 2000. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Research 28, 27-30. Kawamura, G., Bagarinao, T., Yong, A., Chen, C., Noor, S. and Lim, L., 2015. Low pH affects survival, growth, size distribution, and carapace quality of the postlarvae and early juveniles of the freshwater prawn Macrobrachium rosenbergii de Man. Ocean Science Journal 50, 371-379. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P. and Drummond, A., 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647-1649. Kim, Y., Mo, H.-h., Son, J., Lee, Y.-S., Lee, S.-E. and Cho, K., 2015. Interactive effects of water pH and hardness levels on the growth and reproduction of Heterocypris incongruens (Crustacea: Ostracoda). Hydrobiologia 753, 97-109. Kingston, A.C. and Cronin, T.W., 2015. Short-and long-wavelength-sensitive opsins are involved in photoreception both in the retina and throughout the central nervous system of crayfish. Journal of Comparative Physiology A 201, 1137-1145. Kinsey, S.T. and Lee, B.C., 2003. The effects of rapid salinity change on in vivo arginine kinase flux in the juvenile blue crab, Callinectes sapidus. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 135, 521-531. Kirschner, L.B., 2004. The mechanism of sodium chloride uptake in hyperregulating aquatic animals. Journal of Experimental Biology 207, 1439-1452. Kitagawa, N., Mazon, H., Heck, A.J.R. and Wilkens, S., 2008. Stoichiometry of the Peripheral Stalk Subunits E and G of Yeast V1-ATPase Determined by Mass Spectrometry. Journal of Biological Chemistry 283, 3329-3337. Knudsen T and Knudsen B, 2013. CLC Genomics Benchwork 6. Available: http://www.clcbio.com. . Kosakovsky, P.S.L. and Frost, S.D.W., 2005. Not so different after all: a comparison of methods for detecting amino acid sites under selection. Molecular biology and evolution 22, 1208-1222. Kotlyar, S., Weihrauch, D., Paulsen, R.S. and Towle, D.W., 2000. Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus. Journal of Experimental Biology 203, 2395-2404. Krebs, J.F., Rana, F., Dluhy, R.A. and Fierke, C.A., 1993. Kinetic and spectroscopic studies of hydrophilic amino acid substitutions in the hydrophobic pocket of human carbonic anhydrase II. Biochemistry 32, 4496-4505. Larkin, M., Blackshields, G., Brown, N., Chenna, R., McGettigan, P., McWilliam, H., Valentin, F., Wallace, I., Wilm, A., Lopez, R., Thompson, J., Gibson, T. and Higgins, D., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947 - 2948. Lawrence, C., 1998. Marron. in ‘The New Rural industries, a handbook for Farmers and Investors’. pp 114-119. (Rural Industries and Research Development Corporation: Barton). Lawrence, C., Jones, C. and Holdich, D., 2002. Cherax. Biology of freshwater crayfish, 635-669. Lawrence, C.S. and Morrissy, N.M., 2000. Genetic improvement of marron Cherax tenuimanus Smith and yabbies Cherax spp. in Western Australia. Aquaculture Research 31, 69-82. Lee, C.E., Kiergaard, M., Gelembiuk, G.W., Eads, B.D. and Posavi, M., 2011. Pumping ions: Rapid parallel evolution of ionic regulation following habitat invasions. Evolution 65, 2229-2244. Leone, F.A., Garçon, D.P., Lucena, M.N., Faleiros, R.O., Azevedo, S.V., Pinto, M.R. and McNamara, J.C., 2015. Gill-specific (Na+, K+)-ATPase activity and α-subunit mRNA expression during low- salinity acclimation of the ornate blue crab Callinectes ornatus (Decapoda, Brachyura). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology "In press".

Page 131

Li, J., Ma, P., Liu, P., Chen, P. and Li, J., 2015. The roles of Na+/K+-ATPase α-subunit gene from the ridgetail white prawn Exopalaemon carinicauda in response to salinity stresses. Fish & Shellfish Immunology 42, 264-271. Liu, H.Y., Tan, B.P., Chi, S.Y., Dong, X.H. and Yang, Q.H., 2010. Molecular cloning and expression of gill Na+/K+-ATPase and carbonic anhydrase in the Pacific white shrimp (Litopenaeus vannamei) induced by acute hypo-osmotic stress. Direct submission, GenBank: HM626273.1, Aquaculture, Guangdong Ocean University, Guangdong 524025, PR China. Liu, M., Liu, S., Hu, Y. and Pan, L., 2015. Cloning and expression analysis of two carbonic anhydrase genes in white shrimp Litopenaeus vannamei, induced by pH and salinity stresses. Aquaculture 448, 391-400. Liu, M.Q., Pan, L.Q. and Hu, Y.Y., 2012. Cytoplasmic carbonic anydrase [Portunus trituberculatus]. Direct submission, GenBank: AFV46144, College of Fisheries, Ocean University of China, Qingdao, China. Liu, W.-Q., Rao, X.-M. and Yu, Z.-H., 2006. Alkaline unfolding and salt-induced folding of arginine kinase from shrimp Feneropenaeus chinensis under high pH conditions. International Journal of Biological Macromolecules 38, 211-215. Luana, W., Li, F., Wang, B., Zhang, X., Liu, Y. and Xiang, J., 2007. Molecular characteristics and expression analysis of calreticulin in Chinese shrimp Fenneropenaeus chinensis. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 147, 482-491. Lucena, M.N., Pinto, M.R., Garçon, D.P., McNamara, J.C. and Leone, F.A., 2015. A kinetic characterization of the gill V(H+)-ATPase in juvenile and adult Macrobrachium amazonicum, a diadromous palaemonid shrimp. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 181, 15-25. Lucu, Č., 1989. Evidence for Cl− exchangers in perfused Carcinus gills. Comparative Biochemistry and Physiology Part A: Physiology 92, 415-420. Lucu, Č. and Flik, G., 1999. Na+-K+-ATPase and Na+/Ca2+ exchange activities in gills of hyperregulating Carcinus maenas. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 276, R490-R499. Lucu, Č. and Towle, D.W., 2003. Na++K+-ATPase in gills of aquatic crustacea. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 135, 195-214. Luquet, C.M., Weihrauch, D., Senek, M. and Towle, D.W., 2005. Induction of branchial ion transporter mRNA expression during acclimation to salinity change in the euryhaline crab Chasmagnathus granulatus. Journal of Experimental Biology 208, 3627-3636. Lv, J., Wang, Y., Zhang, D., Gao, B., Liu, P. and Li, J., 2015. Cloning and characterization of calreticulin and its association with salinity stress in P. trituberculatus. Cell Stress and Chaperones, 1-10. Macaranas, J., Mather, PB, Hoeben, P and Capra, MF 1995. Assessment of genetic variation in wild populations of the redclaw crayfish (Cherax quadricarinatus, von Martens 1868) by means of allozyme and RAPD-PCR markers. Marine and Freshwater Research 46, 1217–1228. Mackay, T.F., Stone, E.A. and Ayroles, J.F., 2009. The genetics of quantitative traits: challenges and prospects. Nature Reviews Genetics 10, 565-577. Mandal, A., Arunachalam, S.C., Meleshkevitch, E.A., Mandal, P.K., Boudko, D.Y. and Ahearn, G.A., 2009. Cloning of sarco-endoplasmic reticulum Ca2+-ATPase (SERCA) from Caribbean spiny lobster Panulirus argus. Journal of Comparative Physiology B 179, 205-214. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C. and Bryant, S.H., 2015. CDD: NCBI's conserved domain database. Nucleic Acids Research 43, D222-D226. Marshansky, V., Rubinstein, J.L. and Grüber, G., 2014. Eukaryotic V-ATPase: Novel structural findings and functional insights. Biochimica et Biophysica Acta - Bioenergetics 1837, 857-879. Martin, M., Fehsenfeld, S., Sourial, M.M. and Weihrauch, D., 2011. Effects of high environmental ammonia on branchial ammonia excretion rates and tissue Rh-protein mRNA expression

Page 132

levels in seawater acclimated Dungeness crab Metacarcinus magister. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 160, 267-277. Martin Tresguerres, Fumi Katoh, Elizabeth Orr, Scott K. Parks and Greg G. Goss, 2006. Chloride Uptake and Base Secretion in Freshwater Fish: A Transepithelial Ion‐Transport Metabolon? Physiological and Biochemical Zoology 79, 981-996. McCormack, R.B., 2014. New records and review of the translocation of the yabby Cherax destructor into eastern drainages of New South Wales, Australia. Australian Zoologist 37, 85-94. McNamara, J.C. and Faria, S.C., 2012a. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: a review. J Comp Physiol B 182, 997-1014. McNamara, J.C. and Faria, S.C., 2012b. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: a review. Journal of Comparative Physiology B 182, 997-1014. Merrick, J.R. and Lambert, C.N., 1991. The Yabby, Marron and Red Claw: Production and Marketing. (J.R. Merrick Publications: Artarmon). Merz, K.M., 1990. Insights into the function of the zinc hydroxide-Thr199-Glu106 hydrogen bonding network in carbonic anhydrases. Journal of molecular biology 214, 799-802. Miller, A.D., Nguyen, T.T.T., Burridge, C.P. and Austin, C.M., 2004. Complete mitochondrial DNA sequence of the Australian freshwater crayfish, Cherax destructor (Crustacea: Decapoda: Parastacidae): a novel gene order revealed. Gene 331, 65-72. Mills, B.J., 1983. A Review of Diseases of Freshwater Crayfish, with Particular Reference to the Yabbie, Cherax destructor. Department of Fisheries, South Australia. Minh Sang, H. and Fotedar, R., 2004. Growth, survival, haemolymph osmolality and organosomatic indices of the western king prawn (Penaeus latisulcatus Kishinouye, 1896) reared at different salinities. Aquaculture 234, 601-614. Mitchell, R.T. and Henry, R.P., 2014. Carbonic anhydrase induction in euryhaline crustaceans is rate- limited at the post-transcriptional level. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 169, 15-23. Mitsunaga-Nakatsubo, K., Yamazaki, K., Hatoh-Okazaki, M., Kawashita, H., Okamura, C., Akasaka, K., Shimada, H. and Yasumasu, I., 1996. cDNA cloning of Na+, K+-ATPase α-subunit from embryos of the sea urchin, Hemicentrotus pulcherrimus. Zoological science 13, 833-841. Mohd-Shamsudin, M.I., Kang, Y., Lili, Z., Tan, T.T., Kwong, Q.B., Liu, H., Zhang, G., Othman, R.Y. and Bhassu, S., 2013. In-Depth Tanscriptomic Analysis on Giant Freshwater Prawns. PLoS ONE 8, e60839. Morgan, D.O. and McMahon, B.R., 1982. Acid Tolerance and Effects of Sublethal Acid Exposure on Iono-Regulation and Acid-Base Status in Two Crayfish Procambarus Clarki and Orconectes Rusticus. Journal of Experimental Biology 97, 241-252. Morris, S., 2001. Neuroendocrine regulation of osmoregulation and the evolution of air-breathing in decapod crustaceans. Journal of Experimental Biology 204, 979-989. Morrissy, N.M., Evans, L. and Huner, J.V., 1990. Australian freshwater crayfish: aquaculture species. World Aquaculture 21, 113-120. Mosig, J., 1998. Australian Yabby Farmer. CSIRO Publishing: Collingwood. Muench, S.P., Trinick, J. and Harrison, M.A., 2011. Structural divergence of the rotary ATPases. Quarterly Reviews of Biophysics 44, 311-356. Munasinghe, D., Burridge, C. and Austin, C., 2004. The systematics of freshwater crayfish of the genus Cherax Erichson (Decapoda: Parastacidae) in eastern Australia re-examined using nucleotide sequences from 12S rRNA and 16S rRNA genes. Invertebrate systematics 18, 215- 225. Muse, S.V. and Gaut, B.S., 1994. A likelihood approach for comparing synonymous and nonsynonymous nucleotide substitution rates, with application to the chloroplast genome. Molecular Biology and Evolution 11, 715-724.

Page 133

Nakanishi-Matsui, M., Sekiya, M., Nakamoto, R.K. and Futai, M., 2010. The mechanism of rotating proton pumping ATPases. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1797, 1343- 1352. Nei, M. and Kumar, S., 2000. Molecular evolution and phylogenetics, Oxford University Press. Nygaard, S., Zhang, G., Schiøtt, M., Li, C., Wurm, Y., Hu, H., Zhou, J., Ji, L., Qiu, F., Rasmussen, M., Pan, H., Hauser, F., Krogh, A., Grimmelikhuijzen, C.J.P., Wang, J. and Boomsma, J.J., 2011. The genome of the leaf-cutting ant Acromyrmex echinatior suggests key adaptations to advanced social life and fungus farming. Genome Research 21, 1339-1348. Onken, H. and Graszynski, K., 1989. Active Cl− absorption by the Chinese crab (Eriocheir sinensis) gill epithelium measured by transepithelial potential difference. Journal of Comparative Physiology B 159, 21-28. Onken, H., Graszynski, K. and Zeiske, W., 1991. Na+-independent, electrogenic Cl-uptake across the posterior gills of the Chinese crab (Eriocheir sinensis): Voltage-clamp and microelectrode studies. Journal of Comparative Physiology B 161, 293-301. Onken, H. and Riestenpatt, S., 1998. NaCl absorption across split gill lamellae of hyperregulating crabs: Transport mechanisms and their regulation. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 119, 883-893. Onken, H., Tresguerres, M. and Luquet, C.M., 2003. Active NaCl absorption across posterior gills of hyperosmoregulating Chasmagnathus granulatus. Journal of experimental biology 206, 1017-1023. Pan, J.-C., Yu, Z.-H., Hui, E.-F. and Zhou, H.-M., 2004. Conformational change and inactivation of arginine kinase from shrimp Feneropenaeus chinensis in oxidized dithiothreitol solutions. Biochemistry and Cell Biology 82, 361-367. Pan, L.-Q., Zhang, L.-J. and Liu, H.-Y., 2007. Effects of salinity and pH on ion-transport enzyme activities, survival and growth of Litopenaeus vannamei postlarvae. Aquaculture 273, 711- 720. Pan, L.Q., Hu, Y.Y. and Li, L., 2011. Litopenaeus vannamei carbonic anhydrase I mRNA, complete cds. GenBank: ADM16544.2, Direct submission, Fisheries College, Ocean University of China, Shandong 266003, China. Parrie, L. and Towle, D.W., 2002. Induction of Na++K+-ATPase alpha subunit mRNA in branchial tissues of the American lobster Homarus americanus. J Integr Comp Biol 42, 1291. Pavasovic, M., Richardson, N.A., Anderson, A.J., Mann, D. and Mather, P.B., 2004. Effect of pH, temperature and diet on digestive enzyme profiles in the mud crab, Scylla serrata. Aquaculture 242, 641-654. Péqueux, A. and Gilles, R., 1988. The transepithelial potential difference of isolated perfused gills of the Chinese crab Eriocheir sinensis acclimated to fresh water. Comparative Biochemistry and Physiology Part A: Physiology 89, 163-172. Petersen, T.N., Brunak, S., von Heijne, G. and Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Meth 8, 785-786. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research 29, e45. Pongsomboon, S., Udomlertpreecha, S., Amparyup, P., Wuthisuthimethavee, S. and Tassanakajon, A., 2009. Gene expression and activity of carbonic anhydrase in salinity stressed Penaeus monodon. Comparative Biochemistry and Physiology a-Molecular & Integrative Physiology 152, 225-233. PrediSI, 2014. Prediction of Signal Peptides, http//www.predisi.de

Prentis, P.J. and Pavasovic, A., 2014. The Anadara trapezia transcriptome: A resource for molluscan physiological genomics. Marine Genomics 18, Part B, 113-115. Pressley, T., 1995. Structure and function of the Na, K pump: ten years of molecular biology. Mineral and electrolyte metabolism 22, 264-271.

Page 134

Rawson, S., Phillips, C., Huss, M., Tiburcy, F., Wieczorek, H., Trinick, J., Harrison, Michael A. and Muench, Stephen P., 2015. Structure of the Vacuolar H+-ATPase Rotary Motor Reveals New Mechanistic Insights. Structure 23, 461-471. Ren, Q., Pan, L., Zhao, Q. and Si, L., 2015. Ammonia and urea excretion in the swimming crab Portunus trituberculatus exposed to elevated ambient ammonia-N. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 187, 48-54. Riek, E., 1969. The Australian freshwater crayfish (Crustacea: Decapoda: Parastacidae), with descriptions of a new species. Australian Journal of Zoology 17, 855-918. Riestenpatt, S., Onken, H. and Siebers, D., 1996. Active absorption of Na+ and Cl-across the gill epithelium of the shore crab Carcinus maenas: voltage-clamp and ion-flux studies. The Journal of experimental biology 199, 1545-1554. Riestenpatt, S., Zeiske, W. and Onken, H., 1994. Cyclic AMP stimulation of electrogenic uptake of Na+ and Cl-across the gill epithelium of the Chinese crab Eriocheir sinensis. The Journal of experimental biology 188, 159-174. Romano, N. and Zeng, C., 2012. Osmoregulation in decapod crustaceans: implications to aquaculture productivity, methods for potential improvement and interactions with elevated ammonia exposure. Aquaculture 334-337, 12-23. Roy, L.A., Davis, D.A., Saoud, I.P. and Henry, R.P., 2007. Branchial carbonic anhydrase activity and ninhydrin positive substances in the Pacific white shrimp, Litopenaeus vannamei, acclimated to low and high salinities. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 147, 404-411. Saliba, K.J. and Kirk, K., 1999. pH Regulation in the Intracellular Malaria Parasite, Plasmodium falciparum : H+ Extrusion via a V-Type H+-ATPase. Journal of Biological Chemistry 274, 33213-33219. Sampey, D., 2007. Marron Growers Association, Western Australia (pers.comm, 2007). Saoud, I.P., Garza De Yta, A. and Ghanawi, J., 2012. A review of nutritional biology and dietary requirements of redclaw crayfish Cherax quadricarinatus (von Martens 1868). Aquaculture Nutrition 18, 349-368. Saoud, I.P., Ghanawi, J., Thompson, K.R. and Webster, C.D., 2013. A Review of the Culture and Diseases of Redclaw Crayfish Cherax quadricarinatus (Von Martens 1868). Journal of the World Aquaculture Society 44, 1-29. Saroussi, S. and Nelson, N., 2009. The little we know on the structure and machinery of V-ATPase. Journal of Experimental Biology 212, 1604-1610. Scheiner-Bobis, G., 2002. The sodium pump. Its molecular properties and mechanics of ion transport. Eur J Biochem 269, 2424-33. Schultz, J., Milpetz, F., Bork, P. and Ponting, C.P., 1998. SMART, a simple modular architecture research tool: Identification of signaling domains. Proceedings of the National Academy of Sciences 95, 5857-5864. Semple, J., Green, H. and Schulte, P., 2002. Molecular Cloning and Characterization of Two Na/K- ATPase Isoforms in Fundulus heteroclitus. Marine Biotechnology 4, 512-519. Sergei, L.K.P. and Muse, S.V., 2005. HyPhy: hypothesis testing using phylogenies, Statistical methods in molecular evolution. Springer, pp. 125-181. Serrano, L., Halanych, K.M. and Henry, R.P., 2007. Salinity-stimulated changes in expression and activity of two carbonic anhydrase isoforms in the blue crab Callinectes sapidus. J Exp Biol 210, 2320-32. Serrano, L. and Henry, R.P., 2008. Differential expression and induction of two carbonic anhydrase isoforms in the gills of the euryhaline green crab, Carcinus maenas, in response to low salinity. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 3, 186- 193.

Page 135

Shen, H., Hu, Y., Ma, Y., Zhou, X., Xu, Z., Shui, Y., Li, C., Xu, P. and Sun, X., 2014. In-Depth Transcriptome Analysis of the Red Swamp Crayfish Procambarus clarkii. PLoS ONE 9, e110548. Shipway, B., 1951. The natural history of the marron and other freshwater crayfishes of south Western Australia. Western Australian Naturalist 3, 7-12; 27-34

Shrivastava, A.N., Redeker, V., Fritz, N., Pieri, L., Almeida, L.G., Spolidoro, M., Liebmann, T., Bousset, L., Renner, M. and Léna, C., 2015. α‐synuclein assemblies sequester neuronal α3‐ Na+/K+‐ATPase and impair Na+ gradient. The EMBO journal, e201591397. Siebers, D., Petrausch, G. and Hamann, A., 1990. Effects of some chloride channel blockers on potential differences and ion fluxes in isolated perfused gills of shore crabs Carcinus maenas. Comparative Biochemistry and Physiology Part A: Physiology 97, 9-15. Sigrist, C.J.A., de Castro, E., Cerutti, L., Cuche, B.A., Hulo, N., Bridge, A., Bougueleret, L. and Xenarios, I., 2013. New and continuing developments at PROSITE. Nucleic Acids Research 41, D344- D347. Silvestre, F., Dierick, J.-F., Dumont, V., Dieu, M., Raes, M. and Devos, P., 2006. Differential protein expression profiles in anterior gills of Eriocheir sinensis during acclimation to cadmium. Aquatic Toxicology 76, 46-58. Silvia, G.-J., Abel Antonio, U.-R., Francisco, V.-O. and Georgina, H.-W., 2004. Ammonia efflux rates and free amino acid levels in Litopenaeus vannamei postlarvae during sudden salinity changes. Aquaculture 233, 573-581. Skou, J. and Esmann, M., 1992. The Na,K-ATPase. Journal of Bioenergetics and Biomembranes 24, 249-261. Skou, J.C., 1988. [1] Overview: The Na,K-pump, in: Sidney Fleischer, B.F. (Ed.), Methods in Enzymology. Academic Press, pp. 1-25. Song, C., Cui, Z., Liu, Y., Li, Q. and Wang, S., 2012. Cloning and expression of arginine kinase from a swimming crab, Portunus trituberculatus. Molecular Biology Reports 39, 4879-4888. Strop, P., Smith, K., Iverson, T., Ferry, J. and Rees, D., 2001. Crystal structure of the "cab"-type beta class carbonic anhydrase from the archaeon Methanobacterium thermoautotrophicum. J Biol Chem 276, 10299 - 10305. Sun, W.-J., Zhu, M., Wang, Y.-L., Li, Q., Yang, H.-D., Duan, Z.-L., He, L. and Wang, Q., 2015. ERK Is Involved in the Process of Acrosome Reaction In Vitro of the Chinese Mitten Crab, Eriocheir sinensis. Marine Biotechnology 17, 305-316. Suzuki, Y. and Gojobori, T., 1999. A method for detecting positive selection at single amino acid sites. Molecular biology and evolution 16, 1315-1328. Syrjanen, L., Tolvanen, M., Hilvo, M., Olatubosun, A., Innocenti, A., Scozzafava, A., Leppiniemi, J., Niederhauser, B., Hytonen, V., Gorr, T., Parkkila, S. and Supuran, C., 2010. Characterization of the first beta-class carbonic anhydrase from an arthropod (Drosophila melanogaster) and phylogenetic analysis of beta-class carbonic anhydrases in invertebrates. BMC Biochemistry 11, 28. Tajima, F., 1993. Simple methods for testing the molecular evolutionary clock hypothesis. Genetics 135, 599-607. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30, 2725-2729. Tan, M.H., Gan, H.M., Gan, H.Y., Lee, Y.P., Croft, L.J., Schultz, M.B., Miller, A.D. and Austin, C.M., 2015. First comprehensive multi-tissue transcriptome of Cherax quadricarinatus (Decapoda: Parastacidae) reveals unexpected diversity of endogenous cellulase. Organisms Diversity & Evolution, 1-16. Toei, M., Saum, R. and Forgac, M., 2010. Regulation and Isoform Function of the V-ATPases. Biochemistry 49, 4715-4723.

Page 136

Tolvanen, M., 2013. Pseudogenes and Gene Duplications Tell a Story of Evolutionary Fates of Animal Alpha Carbonic Anhydrases. PhD Thesis, University of Tampere, Institute of Biomedical Technology; . Tolvanen, M.E.E., Ortutay, C., Barker, H.R., Aspatwar, A., Patrikainen, M. and Parkkila, S., 2013. Analysis of evolution of carbonic anhydrases IV and XV reveals a rich history of gene duplications and a new group of isozymes. Bioorganic & Medicinal Chemistry 21, 1503-1510. Tongsaikling, T., Salaenoi J and Mingmuang M. 2013, 2013. Ca2+-ATPase, Carbonic Anhydrase and Alkaline Phosphatase Activities in Red Sternum Mud Crabs (Scylla serrata). Kasetsart J. (Nat. Sci) 47, 252-260. Towle, D., Weihrauch, D., Fooks, A. and Cohen, Z., 1997. Molecular identification and cDNA sequencing of a Na+/K+/2Cl–cotransporter in gills of the euryhaline blue crab Callinectes sapidus. Am. Zool 37, 87A. Towle, D.W., Henry, R.P. and Terwilliger, N.B., 2011. Microarray-detected changes in gene expression in gills of green crabs (Carcinus maenas) upon dilution of environmental salinity. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 6, 115-125. Towle, D.W. and Kays, W.T., 1986. Basolateral localization of Na+ + K+-ATPase in gill epithelium of two osmoregulating crabs, Callinectes sapidus and Carcinus maenas. Journal of Experimental Zoology 239, 311-318. Towle, D.W., Paulsen, R.S., Weihrauch, D., Kordylewski, M., Salvador, C., Lignot, J.-H. and Spanings- Pierrot, C., 2001. Na++K+-ATPase in gills of the blue crab Callinectes sapidus: cDNA sequencing and salinity-related expression of α-subunit mRNA and protein. Journal of Experimental Biology 204, 4005-4012. Towle, D.W. and Weihrauch, D., 2001. Osmoregulation by Gills of Euryhaline Crabs: Molecular Analysis of Transporters. American Zoologist 41, 770-780. Tsai, J.-R. and Lin, H.-C., 2007. V-type H+-ATPase and Na+,K+-ATPase in the gills of 13 euryhaline crabs during salinity acclimation. Journal of Experimental Biology 210, 620-627. Uda, K., Fujimoto, N., Akiyama, Y., Mizuta, K., Tanaka, K., Ellington, W.R. and Suzuki, T., 2006. Evolution of the arginine kinase gene family. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 1, 209-218. Visudtiphole, V., Watthanasurorot, A., Klinbunga, S., Menasveta, P. and Kirtikara, K., 2010. Molecular characterization of Calreticulin: A biomarker for temperature stress responses of the giant tiger shrimp Penaeus monodon. Aquaculture 308, Supplement 1, S100-S108. Wang, D.-L., Sun, T., Zuo, D., Wang, L.-M., Wang, Q. and Zhao, Y.-L., 2013a. Cloning and tissue expression of hemocyanin gene in Cherax quadricarinatus during white spot syndrome virus infection. Aquaculture 410–411, 216-224. Wang, L., Wang, W.-N., Liu, Y., Cai, D.-X., Li, J.-Z. and Wang, A.-L., 2012. Two types of ATPases from the Pacific white shrimp, Litopenaeus vannamei in response to environmental stress. Molecular Biology Reports 39, 6427-6438. Wang, W.-N., Wang, A.-L., Chen, L., Liu, Y. and Sun, R.-Y., 2002. Effects of pH on survival, phosphorus concentration, adenylate energy charge and Na+–K+ ATPase activities of Penaeus chinensis Osbeck juveniles. Aquatic Toxicology 60, 75-83. Wang, Y., Luo, P., Zhang, L., Hu, C., Ren, C. and Xia, J., 2013b. Cloning of sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) gene from white shrimp, Litopenaeus vannamei and its expression level analysis under salinity stress. Molecular biology reports 40, 6213-6221. Ward, L.D. and Kellis, M., 2012. Evidence of abundant purifying selection in humans for recently acquired regulatory functions. Science 337, 1675-1678. Watthanasurorot, A., Jiravanichpaisal, P., Söderhäll, K. and Söderhäll, I., 2013. A calreticulin/gC1qR complex prevents cells from dying: a conserved mechanism from arthropods to humans. Journal of Molecular Cell Biology 5, 120-131.

Page 137

Weihrauch, D., Chan, A.C., Meyer, H., Döring, C., Sourial, M. and O'Donnell, M.J., 2012. Ammonia excretion in the freshwater planarian Schmidtea mediterranea. The Journal of Experimental Biology 215, 3242-3253. Weihrauch, D., McNamara, J.C., Towle, D.W. and Onken, H., 2004a. Ion-motive ATPases and active, transbranchial NaCl uptake in the red freshwater crab, Dilocarcinus pagei (Decapoda, Trichodactylidae). Journal of Experimental Biology 207, 4623-4631. Weihrauch, D., Morris, S. and Towle, D.W., 2004b. Ammonia excretion in aquatic and terrestrial crabs. Journal of Experimental Biology 207, 4491-4504. Weihrauch, D., Wilkie, M.P. and Walsh, P.J., 2009. Ammonia and urea transporters in gills of fish and aquatic crustaceans. Journal of Experimental Biology 212, 1716-1730. Weihrauch, D., Ziegler, A., Siebers, D. and Towle, D.W., 2001a. Molecular characterization of V-type H(+)-ATPase (B-subunit) in gills of euryhaline crabs and its physiological role in osmoregulatory ion uptake. Journal of Experimental Biology 204, 25-37. Weihrauch, D., Ziegler, A., Siebers, D. and Towle, D.W., 2001b. Molecular characterization of V-type H+-ATPase (B-subunit) in gills of euryhaline crabs and its physiological role in osmoregulatory ion uptake. Journal of Experimental Biology 204, 25-37. Weihrauch, D., Ziegler, A., Siebers, D. and Towle, D.W., 2002. Active ammonia excretion across the gills of the green shore crab Carcinus maenas: participation of Na+/K+-ATPase, V-type H+- ATPase and functional microtubules. Journal of Experimental Biology 205, 2765-2775. Werren, J.H., Richards, S., Desjardins, C.A., Niehuis, O., Gadau, J., Colbourne, J.K. and Group, T.N.G.W., 2010. Functional and Evolutionary Insights from the Genomes of Three Parasitoid Nasonia Species. Science 327, 343-348. Wheatly, M., Zanotto, F. and Hubbard, M., 2002. Calcium homeostasis in crustaceans: subcellular Ca dynamics. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 132, 163-178. Wheatly, M.G. and Henry, R.P., 1987. Branchial and Antennal Gland Na+/K+- Dependent ATPase and Carbonic Anhydrase Activity During Salinity Acclimation of the Euryhaline Crayfish Pacifastacus Leniusculus. Journal of Experimental Biology 133, 73-86. Wheatly, M.G., Souza, S.C.R.d. and Hart, M.K., 1996. Related Changes in Hemolymph Acid-Base Status, Electrolytes, and Ecdysone in Intermolt Crayfish (Procambarus clarkii) at 23°C during Extracellular Acidosis Induced by Exposure to Air, Hyperoxia, or Acid. Journal of Crustacean Biology 16, 267-277. Wingfield, M., 2008. An updated overview of the Australian freshwater caryfish farming industry. Freshwater Crayfish 16, 15-17. Wood, C.M. and Rogano, M.S., 1986. Physiological responses to acid stress in crayfish (Orconectes): haemolymph ions, acid-base status, and exchanges with the environment. Canadian Journal of Fisheries and Aquatic Sciences 43, 1017-1026. Wu, H., Che, X., Tang, J., Ma, F., Pan, K., Zhao, M., Shao, A., Wu, Q., Zhang, J. and Hong, Y., 2015. The K+–Cl− Cotransporter KCC2 and Chloride Homeostasis: Potential Therapeutic Target in Acute Central Nervous System Injury. Molecular neurobiology, 1-11. Xie, Y., Gong, J., Ye, H., Huang, H. and Yang, Y.n., 2014. Molecular Characteristic and Responsive Expression of Arginine Kinase in the Mud Crab, Scylla paramamosain. Journal of the World Aquaculture Society 45, 127-137. Xie, Z. and Askari, A., 2002. Na+/K+‐ATPase as a signal transducer. European Journal of Biochemistry 269, 2434-2439. Xu, B., Long, C., Dong, W., Shao, Q. and Shu, M., 2015. Molecular characterization of calreticulin gene in mud crab Scylla paramamosain (Estampador): implications for the regulation of calcium homeostasis during moult cycle. Aquaculture Research, n/a-n/a. Xu, Q. and Liu, Y., 2011. Gene expression profiles of the swimming crab Portunus trituberculatus exposed to salinity stress. Marine Biology 158, 2161-2172.

Page 138

Yao, C.-L., Wu, C.-G., Xiang, J.-H. and Dong, B., 2005. Molecular cloning and response to laminarin stimulation of arginine kinase in haemolymph in Chinese shrimp, Fenneropenaeus chinensis. Fish & Shellfish Immunology 19, 317-329. Ye, J., Fang, L., Zheng, H., Zhang, Y., Chen, J., Zhang, Z., Wang, J., Li, S., Li, R., Bolund, L. and Wang, J., 2006. WEGO: a web tool for plotting GO annotations. Nucleic Acids Research 34, W293- W297. Ye, L., Jiang, S., Zhu, X., Yang, Q., Wen, W. and Wu, K., 2009. Effects of salinity on growth and energy budget of juvenile Penaeus monodon. Aquaculture 290, 140-144. YGA, 1992. An Introduction to Yabbie Farming. Yabbie Growers Association Inc., Australia. Yuan, Z., Cai, T., Tian, J., Ivanov, A.V., Giovannucci, D.R. and Xie, Z., 2005. Na/K-ATPase tethers phospholipase C and IP3 receptor into a calcium-regulatory complex. Molecular biology of the cell 16, 4034-4045. Yudkovski, Y., Shechter, A., Chalifa-Caspi, V., Auslander, M., Ophir, R., Dauphin-Villemant, C., Waterman, M., Sagi, A. and Tom, M., 2007. Hepatopancreatic multi-transcript expression patterns in the crayfish Cherax quadricarinatus during the moult cycle. Insect Molecular Biology 16, 661-674. Yue, C.F., Wang, T.T., Wang, Y.F. and Peng, Y., 2009. Effect of combined photoperiod, water calcium concentration and pH on survival, growth, and moulting of juvenile crayfish (Procambarus clarkii) cultured under laboratory conditions. Aquaculture Research 40, 1243-1250. Zanotto, F.P. and Wheatly, M.G., 1993. The effect of ambient pH on electrolyte regulation during the postmoult period in freshwater crayfish Procambarus clarkii. Journal of experimental biology 178, 1-19. Zeiske, W., Onken, H., Schwarz, H.-J. and Graszynski, K., 1992. Invertebrate epithelial Na+ channels: amiloride-induced current-noise in crab gill. Biochimica et Biophysica Acta (BBA)- Biomembranes 1105, 245-252. Zhang, M., Gaschen, B., Blay, W., Foley, B., Haigwood, N., Kuiken, C. and Korber, B., 2004. Tracking global patterns of N-linked glycosylation site variation in highly variable viral glycoproteins: HIV, SIV, and HCV envelopes and influenza hemagglutinin. Glycobiology 14, 1229-1246. Zhang, X., Li, Y., Zhang, X., Duan, Z. and Zhu, J., 2015. Regulation of Transepithelial Ion Transport in the Rat Late Distal Colon by the Sympathetic Nervous System. Physiological research/Academia Scientiarum Bohemoslovaca 64, 103-110. Zhang, Z., Chen, D. and Wheatly, M.G., 2000a. Cloning and characterization of sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) from crayfish axial muscle. Sarco/Endoplasmic Reticulum Ca2+-ATPase. Journal of Experimental Biology 203, 3411-3423. Zhang, Z., Chen, D. and Wheatly, M.G., 2000b. Cloning and characterization of sarco/endoplasmic reticulum Ca(2+)-ATPase (SERCA) from crayfish axial muscle. Sarco/Endoplasmic Reticulum Ca(2+)-ATPase. Journal of Experimental Biology 203, 3411-3423. Zimin, A.V., Smith, D.R., Sutton, G. and Yorke, J.A., 2008. Assembly reconciliation. Bioinformatics 24, 42-45. Zimmerman, S.A. and Ferry, J.G., 2008. The beta and gamma classes of Carbonic Anhydrase. Current Pharmaceutical Design 14, 716-721. Zuckerkandl, E. and Pauling, L., 1965. Evolutionary divergence and convergence in proteins, pp. 97- 166 in Evolving Genes and Proteins, edited by V. Bryson and H.J. Vogel. Academic Press, New York.

Page 139

Chapter 7. Appendices

7.1 Appendix 1: Data distribution of the assembled contigs for C. quadricarinatus

S Figure 2.1 Data distribution of the assembled contigs after blasting, mapping and annotation.

Page 140

7.2 Appendix 2: Top-hit Species distribution of the assembled contigs for Redclaw.

Others Daphnia pulex Tribolium castaneum Pediculus humanus Branchiostoma floridae Ixodes scapularis Crassostrea gigas Nasonia vitripennis Strongylocentrotus purpuratus Capitella teleta Megachile rotundata Saccoglossus kowalevskii Camponotus floridanus

Harpegnathos saltator Acyrthosiphon pisum Danaus plexippus

Species Acromyrmex echinatior Aedes aegypti Bombus terrestris Nematostella vectensis Apis florea Solenopsis invicta Danio rerio Apis mellifera Bombus impatiens Culex quinquefasciatus Dendroctonus ponderosae Hydra magnipapillata Penaeus monodon Cherax quadricarinatus 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 # Seq

S Figure 2.2 Major top-hit species distribution on the basis of BALST search using the assembled contigs from Redclaw (C. quadricarinatus)

Page 141

7.3 Appendix 3: Gene Ontology distribution of the gill transcripts from Redclaw

S Figure 2.3 Gene Ontology distribution of the gill transcripts from Cherax quadricarinatus based on Biological processes, Molecular functions and Cellular components.

Page 142

7.4 Appendix 4: Multiple alignment of partial C. quadricarinatus CA

S Figure 2.4 Multiple alignment of translated amino acid sequences of two partial C. quadricarinatus CA

Multiple alignment of translated amino acid sequences of two partial C. quadricarinatus CA (ChqCAp1: KM610228 and ChqCAp2: KM880150) with CA isoforms from some representative crustaceans such as the pacific white shrimp Litopenaeus vannamei (LvCAg: AGC70493), the littoral crab Carcinus maenas (CmCAg: ABX71209), the horse crab Portunus trituberculatus (PtCAg: AFV46145) and the blue crab Callinectes sapidus (CasCAg: ABN51214). The letter g after CA indicates the Glycosyl-phosphatidylinositol-linked carbonic anhydrase.

Page 143

7.5 Appendix 5 : Full length nucleotide sequences of C. quadricarinatus CAg

S Figure 2.5: Full length nucleotide sequences of C. quadricarinatus CAg (ChqCAg)

Full length nucleotide sequences along with corresponding deduced amino acid sequences of a CAg (Glycosyl-phosphatidylinositol-linked carbonic anhydrase, ChqCAg: KM538166) cDNA amplified from the gills Redclaw crayfish, C. quadricarinatus. Sequences are numbered at both sides of each line. The start codon and stop codon are in bold. N-linked glycosylation sites (NXS/T) are shaded and in bold. One putative AU-rich mRNA instability motif (polyadenylylation cleavage signal) (ATTTA) is in bold and underlined. 3’ and 5’ untranslated regions (UTR) are in small letters and expressed codons (CDS) are in capital letters.

Page 144

7.6 Appendix 6: Statistics for contigs from C. cainii (Marron) and C. destructor (Yabby)

S Table 4.1 Summary statistics for assembled contigs greater than 200 bp generated from C. cainii (Marron) and C. destructor (Yabby) gill transcriptomes using Trinity de novo assembler and cd-HIT clustering tool.

Summary statistics bp/number

Marron Yabby

Number of total contigs 147 101 136 622

N50 1380 1326

Mean contig length 747 740

Length of the longest contig 22 324 17725

Number of contigs longer than 500 bp 52 459 49678

Number of contigs longer than 1500 bp 17 486 16 178

Number of clusters 18 325 18 113

Number of singletons 128 776 118 509

Page 145

7.7 Appendix 7: Gene Ontology classification in C. cainii and C. destructor

S Figure 4.5 The proportion and number of contigs assigned to Gene Ontology groups in C. cainii and C. destructor

The proportion and number of contigs assigned to Gene Ontology terms from biological process, cellular component and molecular function in C. cainii (Marron) and C. destructor (Yabby).

Page 146

7.8 Appendix 8: List of all possible contigs with their sequence description, length and roles in pH and/or salinity balance

(It is a short list. Full list with GO functions, enzyme codes and InterProScan are available online: http://dx.doi.org/10.1016/j.gene.2015.03.074)

mean Seq. Name Seq. Description Seq. Length #Hits min. eValue Similarity #GOs contig_13232 alkaline phosphatase 1115 20 1.44E-106 61.80% 1 contig_458 alpha-carbonic anhydrase 3318 20 2.48E-152 63.25% 3 contig_2595 alpha-carbonic anhydrase 549 20 2.04E-49 61.85% 5 contig_30 arginine kinase 1197 20 0 97.15% 3 contig_7797 ca-activated cl channel protein 1735 20 5.23E-42 42.30% 4 contig_9096 calcium channel flower-like isoform 1 724 20 2.28E-42 67.25% 4 calcium homeostasis endoplasmic reticulum contig_2587 protein 2893 20 8.01E-43 61.20% 1 contig_33447 calcium uniporter mitochondrial 894 20 6.04E-96 74.70% 8 contig_22653 calcium uptake protein 1 mitochondrial-like 707 20 6.66E-36 72.95% 5 calcium-activated chloride channel regulator contig_31373 1 754 20 1.95E-18 52.05% 2 calcium-activated chloride channel regulator contig_10821 1-like 547 20 3.91E-12 55.25% 0 calcium-activated chloride channel regulator contig_21528 4 986 20 4.05E-45 47.80% 4 contig_109 calcium-dependent chloride channel-1 6381 20 1.01E-143 49.95% 8 calcium-transporting atpase sarcoplasmic contig_2145 endoplasmic reticulum type-like 4631 20 0 91.15% 14 calcium-transporting atpase sarcoplasmic contig_28533 endoplasmic reticulum type-like 508 20 2.81E-92 86.80% 6 calcium-transporting atpase type 2c member contig_7731 1-like 3166 20 0 73.45% 12 contig_3781 calmodulin-like isoform 1 863 20 5.18E-73 79.50% 2 contig_6375 calmodulin-like protein 4-like 858 20 3.02E-76 83.15% 3 contig_929 calreticulin 1722 20 0 88.55% 5 contig_30278 calreticulin 1052 20 1.18E-156 95.45% 59 contig_19805 carbonic anhydrase 1021 20 6.15E-119 78.40% 4 contig_720 carbonic anhydrase 2-like 1527 20 1.14E-133 73.65% 3 contig_8131 chloride channel accessory 2-like 1149 20 1.20E-76 51.15% 0 contig_16307 chloride channel calcium activated 2-like 1710 20 1.44E-81 49.55% 8 contig_5606 chloride channel clic-like protein 1-like 488 20 8.65E-16 49.55% 2 contig_24700 chloride channel- isoform a 465 20 1.37E-53 71.20% 4 contig_3994 chloride channel protein 2 2408 20 2.07E-80 72.65% 3 contig_5834 chloride channel protein 2 1543 20 6.11E-115 82.30% 4 contig_1950 chloride channel protein 2-like 1089 20 5.43E-70 69.30% 3 contig_27916 chloride channel protein 2-like 393 9 2.33E-04 58.78% 8 contig_32462 chloride channel protein 2-like 382 20 1.31E-63 85.35% 5 contig_35968 chloride channel protein 2-like 426 20 3.21E-75 92.70% 4 contig_36091 chloride channel protein 3 499 20 1.40E-26 78.60% 4 contig_8662 chloride intracellular channel 5 502 20 1.78E-33 51.45% 4 contig_595 chloride intracellular channel exc-4-like 2565 20 5.11E-150 88.00% 5 contig_8488 epithelial chloride channel 3166 20 6.39E-78 43.15% 4 contig_9234 epithelial chloride channel 1440 20 4.39E-54 45.30% 0 contig_16799 epithelial chloride channel 652 20 5.45E-36 61.00% 0 contig_25768 epithelial chloride channel protein 498 20 7.18E-18 58.50% 8 Page 147

mean Seq. Name Seq. Description Seq. Length #Hits min. eValue Similarity #GOs contig_5434 glutamate-gated chloride channel 1657 20 3.87E-65 56.80% 2 contig_33490 glutamate-gated chloride channel 322 20 1.28E-08 56.10% 7 glutamate-gated chloride channel alpha3a contig_21149 subunit 864 20 2.17E-23 82.50% 10 glycosyl-phosphatidylinositol-linked carbonic contig_2596 anhydrase 390 20 2.95E-13 52.40% 5 contig_21880 h+ transporting atp synthase beta subunit 700 20 6.61E-50 82.70% 8 contig_1935 h+ transporting atp synthase subunit d 816 20 5.03E-50 67.90% 5 contig_33631 k+-dependent na+ ca+ exchanger 709 9 1.05E-13 42.56% 8 mitochondrial sodium hydrogen exchanger contig_1327 nha2 3143 20 6.04E-104 60.75% 1 mitochondrial sodium hydrogen exchanger contig_1328 nha2 1562 20 3.77E-105 63.95% 1 mitochondrial sodium hydrogen exchanger contig_1329 nha2 2035 20 1.81E-100 63.55% 2 mitochondrial sodium hydrogen exchanger contig_11596 nha2 1936 20 1.72E-97 60.05% 1 na(+) h(+) exchange regulatory cofactor nhe- contig_11896 rf2-like 771 12 6.96E-21 62.92% 0 contig_34002 na+ + atpase alpha-subunit 1 537 15 2.17E-11 71.07% 14 contig_246 na+ k+-atpase alpha subunit 2391 20 0 95.30% 22 contig_22854 potassium channel 397 20 4.04E-51 86.30% 5 potassium channel subfamily k member 16- contig_28074 like 327 20 9.93E-19 59.30% 1 contig_21007 potassium chloride symporter 417 20 5.73E-45 63.75% 4 contig_28739 potassium chloride symporter 445 20 4.51E-76 88.75% 6 potassium voltage-gated channel subfamily h contig_27320 member 7 366 19 2.80E-09 68.26% 4 potassium voltage-gated subfamily h (eag- contig_19257 related) member 2 797 20 1.36E-60 83.25% 10 probable sodium potassium calcium contig_22664 exchanger cg1090-like 687 20 1.23E-55 54.10% 3 probable sodium potassium calcium contig_35624 exchanger cg1090-like 515 20 9.57E-09 77.95% 2 contig_4984 sodium bicarbonate cotransporter 2023 20 0 70.70% 8 contig_2402 sodium calcium exchanger 1-like 2727 20 0 66.85% 3 contig_20861 sodium channel modifier 1 713 20 1.69E-28 68.90% 1 contig_11941 sodium channel modifier 1-like 408 5 6.62E-05 56.40% 0 contig_25916 sodium chloride dependent transporter 368 17 5.54E-09 63.24% 8 contig_30914 sodium chloride dependent transporter 446 19 2.35E-13 55.42% 8 contig_5168 sodium hydrogen exchanger 3 2826 20 0 68.10% 5 contig_18243 sodium hydrogen exchanger 7-like 914 20 5.89E-67 70.55% 4 contig_16014 sodium hydrogen exchanger 8 2151 20 0 78.45% 5 contig_25242 sodium leak channel non-selective 403 20 3.42E-59 84.45% 7 sodium potassium-dependent atpase beta-2 contig_322 subunit 649 20 3.35E-121 68.45% 5 sodium potassium-transporting atpase contig_10309 subunit beta-1-interacting 791 17 3.80E-11 58.29% 3 sodium potassium-transporting atpase contig_1144 subunit beta-2-like 1690 20 8.01E-153 62.30% 5 contig_11187 sodium-bile acid cotransporter 1799 20 2.82E-99 62.85% 3 sodium-driven chloride bicarbonate contig_5045 exchanger 1471 20 0 77.40% 3 contig_21006 solute carrier family 12 member 6 428 20 2.48E-73 89.70% 4 contig_31783 solute carrier family 12 member 6 441 20 5.48E-75 90.80% 4 contig_6530 solute carrier family 12 member 9-like 2834 20 0 66.90% 3 contig_24613 solute carrier family 13 member 2 764 20 4.96E-64 72.55% 8 contig_33754 solute carrier family 13 member 3 806 20 4.04E-72 62.55% 4

Page 148

mean Seq. Name Seq. Description Seq. Length #Hits min. eValue Similarity #GOs contig_5410 solute carrier family 15 member 4 454 20 1.67E-21 72.40% 4 contig_5637 solute carrier family 15 member 4-like 382 20 1.74E-25 57.30% 2 contig_7707 solute carrier family 2 680 20 1.37E-34 60.90% 3 contig_17227 solute carrier family 22 member 15-like 917 20 1.03E-70 60.25% 6 contig_33919 solute carrier family 22 member 15-like 357 20 3.92E-16 50.00% 1 contig_8702 solute carrier family 22 member 2 1323 20 3.95E-27 56.80% 1 contig_3312 solute carrier family 22 member 5 2723 20 2.17E-08 44.00% 7 contig_30613 solute carrier family 22 member 7 645 20 3.11E-27 50.80% 7 contig_17820 solute carrier family 23 member 1 348 20 1.86E-44 82.95% 16 contig_21235 solute carrier family 23 member 1 771 20 2.00E-82 72.95% 16 solute carrier family 25 (mitochondrial carrier contig_442 phosphate carrier) member 3 1545 20 1.58E-171 82.20% 6 contig_13773 solute carrier family 25 member 35 386 20 5.08E-21 77.05% 2 contig_711 solute carrier family 25 member 38 2716 20 1.82E-115 74.55% 2 contig_19758 solute carrier family 25 member 40 1082 20 2.14E-97 65.50% 1 contig_16434 solute carrier family 25 member 42 1424 20 7.69E-119 74.65% 11 contig_14925 solute carrier family 25 member 46 1890 20 3.63E-107 67.00% 1 solute carrier family 26 (sulfate transporter) contig_30576 member isoform cra_a 441 20 1.33E-18 63.70% 4 contig_18874 solute carrier family 35 member b1 1287 20 2.66E-133 72.50% 1 contig_29226 solute carrier family 35 member c2 482 20 2.67E-51 73.70% 1 contig_16598 solute carrier family 35 member d3-like 372 20 1.70E-30 60.10% 2 contig_19192 solute carrier family 35 member e1 homolog 1363 20 2.41E-121 76.25% 2 solute carrier family 40 (iron-regulated contig_24210 transporter) member 1 498 20 1.11E-26 60.15% 10 contig_13469 solute carrier family 40 member 1 893 20 5.46E-33 54.95% 6 contig_10680 solute carrier family 41 member 1-like 1977 20 8.78E-158 76.75% 2 contig_23324 solute carrier family 43 member 3-like 483 20 7.48E-09 56.85% 2 contig_25283 solute carrier family 43 member 3-like 668 4 3.06E-05 62.75% 2 contig_11457 solute carrier family 45 member 3 1135 20 3.58E-46 59.60% 2 contig_16093 t family of potassium channels protein 18 580 20 1.07E-35 74.30% 3 contig_25373 t family of potassium channels protein 18 386 20 6.59E-18 77.50% 7 contig_18958 two pore calcium channel protein 1 isoform 1 1438 20 4.33E-123 67.90% 5 contig_4067 two pore calcium channel protein 1-like 1093 20 4.54E-49 66.35% 4 contig_20456 two pore channel 3 475 20 5.29E-50 78.30% 4 contig_395 vacuolar h 2008 20 0 95.90% 12 contig_791 vacuolar h alpha subunit 2978 20 0 75.15% 7 contig_1152 vacuolar h 1127 20 0 91.10% 6 contig_2008 vacuolar h 2070 20 0 80.30% 7 contig_2517 vacuolar h Subunit C 1348 20 0 83.25% 5 contig_24856 vacuolar h 511 20 2.02E-87 94.20% 9 vacuolar h(+)-atpase proteolipid subunit contig_1931 homolog 500 20 5.14E-25 86.20% 5 voltage-dependent calcium channel subunit contig_17208 alpha-2 delta-1 477 20 5.11E-40 57.35% 3 voltage-dependent calcium channel subunit contig_17836 alpha-2 delta-1 1064 20 1.72E-13 46.10% 1 voltage-dependent calcium channel subunit contig_31332 alpha-2 delta-2-like 607 20 1.17E-18 49.95% 3 contig_19298 voltage-gated ion channel 801 20 2.43E-117 80.30% 10 contig_24738 voltage-gated ion channel 1015 20 5.15E-118 76.45% 6 contig_26733 voltage-gated ion channel 576 20 5.82E-87 81.85% 14 v-type proton atpase 116 kda subunit a contig_15404 isoform 1-like isoform 1 1898 20 0 78.40% 3

Page 149

mean Seq. Name Seq. Description Seq. Length #Hits min. eValue Similarity #GOs v-type proton atpase 21 kda proteolipid contig_1525 subunit-like 796 20 1.74E-64 81.25% 5 contig_598 v-type proton atpase catalytic subunit a-like 2354 20 0 91.10% 6 contig_9658 v-type proton atpase subunit d 1-like 412 20 1.94E-26 71.75% 2 contig_397 v-type proton atpase subunit s1-like 1472 20 7.83E-42 45.00% 2

Page 150

7.9 Appendix 9: Identity matrix across species based on amino acid compositions (7.9.1-7.9.11)

7.9.1 Amino acid identity across crustacean species based on cytoplasmic CA (CAc)

P. C. quadricarinatus C. cainii C. destructor L. vannamei P. monodon C. sapidus trituberculatus Cherax quadricarinatus CAc (KM538165) 97.786 97.786 76.015 76.015 73.801 73.063 Cherax cainii CAc (KP221715) 97.786 97.786 76.015 76.015 73.801 73.063 Cherax destructor (KP299962) 97.786 97.786 75.646 75.277 73.801 72.694 Litopenaeus vannamei (HM991703) 76.015 76.015 75.646 97.778 73.432 73.063 Penaeus monodon (EF672697) 76.015 76.015 75.277 97.778 73.432 72.694 Callinectes sapidus (EF375490) 73.801 73.801 73.801 73.432 73.432 94.465 Portunus trituberculatus (JX524149) 73.063 73.063 72.694 73.063 72.694 94.465

7.9.2 Amino acid identity across crustacean species based on membrane-associated CA (CAg)

C. C. quadricarinatus C. cainii destructor L. vannamei H. rubra C. sapidus P. trituberculatus C. maenas Cherax quadricarinatus (KM538166) 99.355 92.929 71.104 72.903 73.701 73.377 70.13 Cherax cainii (KP221716) 99.355 92.256 71.429 73.226 73.701 73.377 70.455 Cherax destructor (KP299963) 92.929 92.256 66.78 68.35 68.475 68.136 67.119 Litopenaeus vannamei (JX975725) 71.104 71.429 66.78 75.806 70.779 69.481 69.481 Halocaridina rubra (KF650061) 72.903 73.226 68.35 75.806 71.935 71.613 70.645 Callinectes sapidus (EF375491) 73.701 73.701 68.475 70.779 71.935 95.13 88.636 Portunus trituberculatus (JX524150) 73.377 73.377 68.136 69.481 71.613 95.13 87.338 Carcinus maenas (EU273944) 70.13 70.455 67.119 69.481 70.645 88.636 87.338

Page 151

7.9.3 Amino acid identity across crustacean species based on beta CA (CA-beta)

C. C. B. Apis N. Athalia quadricarinatus C. cainii destructor terrestris dorsata vitripennis rosae Cherax quadricarinatus (KM538167) 99.222 98.833 62.745 60.392 63.529 63.137 Cherax cainii (KP221717) 99.222 98.054 63.137 60.784 63.922 63.529 Cherax destructor (KP299965) 98.833 98.054 63.137 61.176 64.314 63.922 Bombus terrestris (XM_003402502) 62.745 63.137 63.137 82.745 84.706 86.275 Apis dorsata (XM_006612942) 60.392 60.784 61.176 82.745 81.569 83.529 Nasonia vitripennis (XM_001606922) 63.529 63.922 64.314 84.706 81.569 94.902 Athalia rosae (XM 012404250) 63.137 63.529 63.922 86.275 83.529 94.902

7.9.4 Amino acid identity across crustacean species based on Na+/K+-ATPase alpha subunit (NKA)

C. Cherax quadricarnatus cainii C. P. F. L. C. P. P. E. NKA (KP221718) destructor monodon indicus stylirostris sapidus trituberculatus marmoratus sinensis Cherax quadricarnatus NKA 99.904 99.711 93.545 94.027 91.908 95 95 95.568 95.665 Cherax cainii (KP221718) 99.904 99.807 93.545 94.027 92.004 95.096 95.096 95.665 95.761 Cherax destructor (KP299966) 99.711 99.807 93.449 93.931 91.908 95 95 95.568 95.665 Penaeus monodon (|DQ399797) 93.545 93.545 93.449 98.844 95.472 92.212 92.404 92.1 92.004 Fenneropenaeus indicus (HM012803) 94.027 94.027 93.931 98.844 96.243 92.596 92.788 92.775 92.293 Litopenaeus stylirostris (JN561324) 91.908 92.004 91.908 95.472 96.243 90.577 90.865 90.655 90.366 Callinectes sapidus (AF327439) 95 95.096 95 92.212 92.596 90.577 99.326 97.69 97.209 Portunus trituberculatus (JX173959) 95 95.096 95 92.404 92.788 90.865 99.326 97.594 97.113 Pachygrapsus marmoratus (DQ173924) 95.568 95.665 95.568 92.1 92.775 90.655 97.69 97.594 98.457 Eriocheir sinensis (KC691291) 95.665 95.761 95.665 92.004 92.293 90.366 97.209 97.113 98.457

Page 152

7.9.5 Amino acid identity across crustacean species based on V- type H+-ATPase (HAT-A)

C. W. P. quadricarinatus C. destructor C. cainii auropunctata barbatus C. floridanus B. terrestris Cherax quadricarinatus 99.158 98.676 71.059 70.824 71.025 71.226 Cherax.destructor (KP299969) 99.158 99.278 70.824 70.588 70.907 70.991 Cherax.cainii (KP221721) 98.676 99.278 70.824 70.588 70.907 70.991 Wasmannia auropunctata (XM 011701129) 71.059 70.824 70.824 96.908 95.838 88.889 Pogonomyrmex barbatus (XM 011643683) 70.824 70.588 70.588 96.908 95.244 88.416 Camponotus floridanus (XM 011263300) 71.025 70.907 70.907 95.838 95.244 89.125 Bombus terrestris (XM 003397650) 71.226 70.991 70.991 88.889 88.416 89.125

7.9.6 Amino acid identity across crustacean species based on Na+/K+/2Cl- cotransporter (NKCC)

C. C. M. B. D. B. C. quadricarinatus C. destructor cainii sapidus H. rubra domestica cucurbitae melanogaster terrestris Cherax quadricarinatus 96.934 97.288 49.25 49.024 49.664 49.943 50 47.119 Cherax destructor (KP299986) 96.934 97.03 50.431 49.893 51.207 51.386 51.86 48.837 Cherax cainii (KP221733) 97.288 97.03 48.448 47.711 48.802 49.101 49.282 47.25 Callinectes sapidus (AF190129) 49.25 50.431 48.448 76.245 49.359 49.118 49.722 47.903 Halocaridinarubra (KF650065) 49.024 49.893 47.711 76.245 48.168 48.37 48.597 47.23 Musca domestica (XM_011298324) 49.664 51.207 48.802 49.359 48.168 84.898 81.795 57.713 Bactrocera cucurbitae (XM 011181369) 49.943 51.386 49.101 49.118 48.37 84.898 81.803 58.079 Drosophila melanogaster (NM_140315) 50 51.86 49.282 49.722 48.597 81.795 81.803 58.318 Bombus terrestris (XM 003399442) 47.119 48.837 47.25 47.903 47.23 57.713 58.079 58.318

Page 153

+ - 7.9.7 Amino acid identity across crustacean species based on Na /HCO3 cotransporter (NBC)

W. C. destructor C. destructor C. cainii C. cainii C. quadricarinatus auropunctata P. barbatus Cherax destructor (KP299976) 99.914 98.497 98.361 97.412 60.371 59.354 Cherax destructor (KP299977) 99.914 98.361 98.447 97.498 60.371 59.354 Cherax cainii (KP221727) 98.497 98.361 99.914 97.323 60.455 59.437 Cherax cainii (KP221728) 98.361 98.447 99.914 97.409 60.455 59.437 Cherax quadricarinatus (KP221728) 97.412 97.498 97.323 97.409 60.796 59.933 Wasmannia auropunctata (XM 011705063) 60.371 60.371 60.455 60.455 60.796 94.187 Pogonomyrmex barbatus (XM 011642543) 59.354 59.354 59.437 59.437 59.933 94.187

7.9.8 Amino acid identity across crustacean species based on Na+/H+ exchanger (NHE)

C. C. A. A. V. P. B. quadricarinatus destructor C. cainii echinatior echinatior emeryi barbatus impatiens Cherax quadricarinatus (KM880153) 92.628 91.161 40.833 40.535 40.457 40.99 40.04 Cherax destructor (KP299982) 92.628 92.259 41.071 40.774 40.597 41.089 40.681 Cherax cainii (KP221730) 91.161 92.259 39.603 39.319 39.242 39.754 38.725 Acromyrmex echinatior (XM_011069477) 40.833 41.071 39.603 96.753 91.516 92.769 78.524 Acromyrmex echinatior (XM_011069496) 40.535 40.774 39.319 96.753 88.37 89.534 76.42 Vollenhovia emeryi (XM 012027471) 40.457 40.597 39.242 91.516 88.37 90.095 78.178 Pogonomyrmex barbatus (XM_011649419) 40.99 41.089 39.754 92.769 89.534 90.095 79.037 Bombus impatiens (XM 003491441) 40.04 40.681 38.725 78.524 76.42 78.178 79.037

Page 154

7.9.9 Amino acid identity across crustacean species based on Na+/Ca+2 exchanger (NCX)

C. C. P. A. W. destructor C. cainii quadricarinatus barbatus cephalotes auropunctata C. floridanus A. dorsata Cherax destructor (KP299983) 98.94 98.469 38.317 37.721 38 37.751 37.458 Cherax cainii (KP221731) 98.94 98.231 38.206 37.611 37.889 37.639 37.347 Cherax quadricarinatus 98.469 98.231 38.206 37.611 37.889 37.639 37.458 Pogonomyrmex barbatus (XM 011636160) 38.317 38.206 38.206 95.293 93.8 91.734 87.011 Atta cephalotes (XM 012203310) 37.721 37.611 37.611 95.293 95.293 93.456 87.371 Wasmannia auropunctata (XM 011701097) 38 37.889 37.889 93.8 95.293 93.318 87.112 Camponotus floridanus (XM_011255402) 37.751 37.639 37.639 91.734 93.456 93.318 87.112 Apis dorsata (XM 006616508) 37.458 37.347 37.458 87.011 87.371 87.112 87.112

7.9.10 Amino acid identity across crustacean species based on Arginine kinase

C. C. C. C. S. L. P. quadricarinatus destructor cainii P. clarkii H. vulgaris maenas serrata C. sapidus vannamei monodon Cherax.quadricarinatus 98.599 98.039 96.639 94.944 92.717 92.135 92.997 90.169 90.73 Cherax destructor (KP299970) 98.599 97.479 96.359 94.663 92.437 92.135 92.717 89.607 89.607 Cherax cainii (KP221722) 98.039 97.479 96.078 94.101 92.157 91.573 91.877 89.045 89.607 Procambarus clarkii (JN828651) 96.639 96.359 96.078 95.225 93.838 94.382 94.678 91.292 91.011 Homarus vulgaris (X68703) 94.944 94.663 94.101 95.225 92.697 92.697 93.82 91.011 91.011 Carcinus maenas (AF167313) 92.717 92.437 92.157 93.838 92.697 97.191 97.199 91.292 92.135 Scylla serrata (GQ851626) 92.135 92.135 91.573 94.382 92.697 97.191 98.034 93.258 94.101 Callinectes sapidus (AF233355) 92.997 92.717 91.877 94.678 93.82 97.199 98.034 92.978 92.978 Litopenaeus vannamei (DQ975203) 90.169 89.607 89.045 91.292 91.011 91.292 93.258 92.978 96.067 Penaeus monodon (KF177337) 90.73 89.607 89.607 91.011 91.011 92.135 94.101 92.978 96.067

Page 155

7.9.11 Amino acid identity across crustacean species based on Calreticulin

C. C. F. P. E. P. S. quadricarinatus destructor C. cainii chinensis monodon L. vannamei carinicauda leniusculus paramamosain Cherax quadricarinatus (KM538170) 98.759 99.005 86.946 87.192 86.453 85.714 91.832 86.207 Cherax destructor (KP299971) 98.759 98.263 86.7 86.946 86.207 85.961 91.111 85.714 Cherax cainii (KP221723) 99.005 98.263 87.192 87.192 86.453 85.961 91.337 86.207 Fenneropenaeus chinensis (DQ323054) 86.946 86.7 87.192 98.768 96.798 88.424 86.7 85.222 Penaeus monodon (GU140040) 87.192 86.946 87.192 98.768 98.03 88.67 86.946 83.99 Litopenaeus vannamei (JQ682618.) 86.453 86.207 86.453 96.798 98.03 88.177 86.207 83.99 Exopalaemon carinicauda (JX508647) 85.714 85.961 85.961 88.424 88.67 88.177 85.222 83.99 Pacifastacus leniusculus (HQ596362) 91.832 91.111 91.337 86.7 86.946 86.207 85.222 84.975 Scylla paramamosain (HQ260918) 86.207 85.714 86.207 85.222 83.99 83.99 83.99 84.975

Page 156

7.10 Appendix 10: Tissue-specific expression of major pH- and osmoregulatory genes in Redclaw crayfish Cherax quadricarinatus

# Gene Name Gill Hepatopancreas Heart Kidney Liver Nerve Testes 1 cytoplasmic carbonic anhydrase (CAc) p p p p p p p 2 GPI-linked carbonic anhydrase (CAg) p p p p p p p 3 Beta carbonic anhydrase (CAb) p a p p p p a 4 carbonic anhydrase-related protein 10 p a a a a p a 5 na+ k+-atpase alpha subunit p p p p p p p sodium potassium-transporting atpase subunit 6 beta p p p p p p p 7 v-type proton atpase catalytic subunit a p p p p p p p 8 v-type proton atpase 116 kda subunit a p p p a p p p 9 v-type proton atpase subunit B p p p a a a a 10 v-type proton atpase subunit C p p p a p a a 11 v-type proton atpase subunit D p p p p p p p 12 v-type proton atpase subunit E p p p p p p p 13 v-type proton atpase subunit H p p a a a a a 14 v-type proton atpase subunit S p p p p p p a 15 v-type proton atpase 21 kda proteolipid subunit p p p p p p p 16 arginine kinase p p p p p p p 17 alkaline phosphatase p p p p p p p 18 calreticulin p p p p p p p 19 selenophosphate synthetase p p p p p p p calcium-transporting atpase sarcoplasmic 20 endoplasmic reticulum type p p p p p p p 21 calcium-transporting atpase type 2C p p p p p p p plasma membrane calcium-transporting atpase 22 3 p p p p p p p 23 sodium hydrogen exchanger 2 a a a a a a p 24 sodium hydrogen exchanger 3 p a a p a p a 25 sodium hydrogen exchanger 7 p p p p p p p 26 sodium hydrogen exchanger 8 p p p p p p p 27 sodium hydrogen exchanger 9 p a a a a p a 28 sodium calcium exchanger 1 p a p p p p p 29 sodium calcium exchanger 3 a a p p p p a 30 sodium bicarbonate cotransporter (Na+/HCO3) p a p p p p p sodium-driven chloride bicarbonate exchanger 31 (Cl (Na+)/HCO3) p p p a p a a 32 sodium chloride cotransporter (Na/Cl) p p p p p p p 33 potassium chloride symporter (K/Cl) p p p p a p a 34 sodium channel protein (Na) a a p a a p a 35 sodium channel protein 60e a a a a a p p 36 potassium channels protein 7 (t family ) a a a a p p a 37 potassium channels protein 18 (t family ) p a a a p p p 38 potassium channel 1 (k family) a p a a p p a 39 potassium channel 3 (k family) a a a a a p a 40 potassium channel 9 (k family) a a a a a p p 41 potassium channel 10 (k family) a a a a a p a

Page 157

# Gene Name Gill Hepatopancreas Heart Kidney Liver Nerve Testes 42 potassium channel 16 (k family) p a p a p a a 43 potassium channel 18 (k family) a a a a a a p 44 calcium-activated potassium channel a a p p a p p 45 two pore potassium channel protein sup-9 a a a P p p p 46 chloride channel p p p p a p p 47 chloride channel protein 2 p p p p p p p 48 chloride channel protein 3 p a a p p p p 49 chloride channel protein 7 a a a p a a a 50 epithelial chloride channel p p p p p p p 51 glutamate-gated chloride channel p p a a a p a 52 histamine-gated chloride channel a a p a p a a 53 ph-sensitive chloride channel a a a p p a a 54 ca-activated cl channel protein p p p p p p p 55 two pore calcium channel protein 1 p p p p a p p calcium release-activated calcium channel 56 protein p p p p p p p 57 Calmodulin p p p p p p p 58 h+ transporting atp synthase beta subunit p p a p a p p 59 h+ transporting atp synthase subunit o p p p p p p p 60 h+ transporting atp synthase subunit d p p p p p p p 61 Integrin alpha p p p p p p p 62 Integrin beta p p p p p p p 63 ATP-binding cassette transporters A p p p p p p p 64 ATP-binding cassette transporters B p p p p p p p 65 ATP-binding cassette transporters C p p p p p p a 66 ATP-binding cassette transporters D p p p p p p p 67 ATP-binding cassette transporters E p p p p p p p 68 ATP-binding cassette transporters F p p p p p p p 69 ATP-binding cassette transporters G p p p p a p p 70 Calmodulin p p p p p p p 71 p38 mitogen-activated protein kinase p p p p p p p 72 Aquaporin transporter p p p p p p p 73 Aquaporin-1 a a p a a a a 74 Aquaporin-3 a P a p a p a 75 Aquaporin 9 p a a a a p a 76 Aquaporin 10 p a a a a a a 77 Aquaporin 12a a P a a a a a 78 magnesium transporter protein 1 p p p p p p p 79 magnesium transporter nipa p p a p p p p 80 membrane magnesium transporter p p p p p p p

Page 158