Ppix) in Lung Carcinoma

Home , Porphobilinogen

Author Manuscript Published OnlineFirst on February 2, 2016; DOI: 10.1158/0008-5472.CAN-15-1484 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Phytoestrogen suppresses efflux of the diagnostic marker protoporphyrin IX

(PpIX) in lung carcinoma

Running title: Genistein promotes ALA-mediated PpIX accumulation

HIROFUMI FUJITAa,#,*, KEISUKE NAGAKAWAa,#, HIROTSUGU

KOBUCHIb, TETSUYA OGINOc, YOICHI KONDOa, KEIJI INOUEd, TARO

SHUINd, TOSHIHIKO UTSUMIe, KOZO UTSUMIa†, JUNZO SASAKIa,

HIDEYO OHUCHIa

Departments of aCytology and Histology, bCell Chemistry, Okayama

University Graduate School of Medicine, Dentistry and Pharmaceutical

Sciences, Okayama 700-8558, Japan,

cDepartment of Nursing Science, Faculty of Health and Welfare Science,

Okayama Prefectural University, Soja, Japan,

dDepartment of Urology, Kochi University Medical School, Nankoku, Kochi

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 2, 2016; DOI: 10.1158/0008-5472.CAN-15-1484 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

783-8505, Japan,

eDepartment of Biological Chemistry, Faculty of Agriculture, Yamaguchi

University, Yamaguchi 753-8515, Japan

# Authors made an equal contribution.

*Corresponding author. E-mail: [email protected]

The authors disclose no potential conflicts of interest.

ABSTRACT

One promising method to visualize cancer cells is based on detection of the

fluorescent photosensitizer protoporphyrin IX (PpIX) synthesized from

5-aminolevulinic acid (ALA), but this method can not be used in cancers

which exhibit poor PpIX accumulation. PpIX appears to pumped out of

cancer cells by the ABC transporter G2 (ABCG2), which is associated with

multidrug resistance. Genistein is a phytoestrogen that appears to

competitively inhibit ABCG2 activity. Therefore, we investigated whether

genistein can promote PpIX accumulation in human lung carcinoma cells.

Here we report that treatment of A549 lung carcinoma cells with genistein or

a specific ABCG2 inhibitor promoted ALA-mediated accumulation of PpIX by

~2-fold. ABCG2 depletion and overexpression studies further revealed that

genistein promoted PpIX accumulation via functional repression of ABCG2.

After an extended period of genistein treatment, a significant increase in

PpIX accumulation was observed in A549 cells (3.7-fold) and in other cell

lines. Systemic preconditioning with genistein in a mouse xenograft model of

lung carcinoma resulted in a 1.8-fold increase in accumulated PpIX.

Long-term genistein treatment stimulated the expression of genes encoding

enzymes involved in PpIX synthesis, such as porphobilinogen deaminase,

uroporphyrinogen decarboxylase, and protoporphyrinogen oxidase.

Accordingly, the rate of PpIX synthesis was also accelerated by genistein

pre-treatment. Thus, our results suggest that genistein treatment effectively

enhances ALA-induced PpIX accumulation by preventing the

ABCG2-mediated efflux of PpIX from lung cancer cells, and may represent a

promising strategy to improve ALA-based diagnostic approaches in a

broader set of malignancies.

INTRODUCTION

Protoporphyrin IX (PpIX) functions as a fluorescent photosensitizer, which is

synthesized from 5-aminolevulinic acid (ALA). Since PpIX preferentially

accumulates in malignant tissues (1), the exogenous administration of ALA

enables us to detect tumors exhibiting enhanced PpIX fluorescence. This

technology, referred to as photodynamic diagnosis, has been widely used

clinically, especially during surgery for bladder cancer (2), prostate cancer (3),

and brain tumors (4), in order to identify precise tumor margins and prevent

overlooking small lesions that are otherwise invisible. However, ALA-based

photodynamic diagnosis remains unsatisfactory in diagnosing some tumors

that accumulate insufficient amounts of PpIX (5-9).

Successful ALA-induced PpIX accumulation may rely on the activity

of enzymes that synthesize and metabolize PpIX and on the proteins that

transport PpIX (10, 11). Exogenously added ALA is taken up by target cells

and metabolized to coproporphyrinogen III in the cytosol by several enzymes,

which include porphobilinogen deaminase (PBGD), uroporphyrinogen III

synthase (UROS), which is the rate-limiting enzyme of porphyrin

metabolism (12), and uroporphyrinogen decarboxylase (UROD).

Coproporphyrinogen III is then translocated into mitochondria through

ATP-binding cassette (ABC) transporter B6 and metabolized to PpIX by

coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase

(PPOX) (5, 7). PpIX is metabolized further to heme by ferrochelatase

(FECH). Furthermore, accumulating evidence indicates that the

elimination of PpIX from cells is carried out by ABC transporter G2 (ABCG2),

which is a multi-drug resistance-associated protein (11). Thus, heme

synthesis enzymes and ABCG2 play important roles in regulating the

cellular accumulation of PpIX in cancer. Our current research goal is to

develop new combination regimens with compounds that enhance the

accumulation of PpIX in order to improve ALA-induced PpIX accumulation.

A recent study reported that the systemic administration of vitamin D3 for

preconditioning significantly increased the accumulation of PpIX in

squamous tumor cell lines both in vitro and in vivo (13). The underlying

mechanism involves increases in the expression of CPOX and decreases in

that of FECH. We previously reported that the iron chelator deferoxamine

(DFX) promoted the accumulation of PpIX in urothelial carcinoma in vitro

and in vivo as well as in prostate cancer, oral squamous cell carcinoma, and

histiocytic lymphoma in vitro (14-17). Furthermore, the inhibition of

ABCG2 by specific inhibitors or knockdown using RNAi facilitated the

ALA-mediated accumulation of PpIX (8, 18, 19). Therefore, the use of

compounds that stimulate the synthesis of PpIX or block the efflux of PpIX

may become a good strategy to improve ALA-induced PpIX accumulation.

Estrogens are known to induce porphyria cutanea tarda, which is

characterized clinically by cutaneous photosensitivity and the excessive

excretion of porphyrins (20). This effect of estrogen is supported by the

findings of another study using cancer-bearing female rats in which estrogen

depletion by ovariectomy caused a significant reduction in ALA-induced

PpIX levels and PBGD activity in tumors (21). On the other hand, a

phytoestrogen genistein known as a tyrosine kinase inhibitor was found to

exhibit estrogen-like activity by interacting with estrogen receptors in

mammals (22-24). Furthermore, a previous study reported that genistein

reversed ABCG2-mediated multidrug resistance and genistein was likely to

competitively inhibit the efflux of anticancer agents such as SN-38 and

mitoxantrone by ABCG2 (25).

These findings prompted us to hypothesize that genistein promotes

the accumulation of PpIX by increasing the synthesis of PpIX and/or

reducing the efflux of PpIX. However, the effects of genistein on the

accumulation of PpIX have not yet been elucidated.

Therefore, we herein determined whether genistein increased the

accumulation of PpIX in vitro and in a xenograft model using the human

lung carcinoma A549 cell line, which expresses high levels of the endogenous

ABCG2 protein.

MATERIALS AND METHODS

Chemicals

ALA was purchased from COSMO OIL (Tokyo, Japan). The iron chelator

DFX, genistein, Ko143, fetal bovine serum (FBS), and G418 were obtained

from Sigma-Aldrich (St. Louis, MO, USA). RPMI medium 1640 was

obtained from Wako (Osaka, Japan).

(Z)-1-[N-(2-Aminoethyl)-N-(2-ammonioethyl)-amino]diazen-1-ium-1,2-

diolate (NOC18) was obtained from Dojindo (Kumamoto, Japan). The

monoclonal antibody to ABCG2 was obtained from Cell Signaling Technology

(Danver, MA). The monoclonal anti-actin antibody (clone C4) was from

Millipore (Temecula, CA). The anti-FECH antibody was a gift from Dr. S.

Taketani (Kyoto Institute of Technology, Kyoto, Japan). MitoTracker Green

was obtained from Invitrogen (Carlsbad, CA). The BCA protein assay kit

was from Thermo Scientific (Waltham, MA, USA). All other chemicals were

of analytical grade and obtained from Nacalai Tesque (Kyoto, Japan). DFX

was dissolved in saline as a stock solution. Genistein, Ko143, and

MitoTracker Green were dissolved in dimethyl sulfoxide (DMSO) and stored

in aliquots at -20 ºC until use. ALA was diluted in ultrapure water to make

a stock solution of 0.5 M.

Cell lines and culture conditions

The following cell lines were purchased from the Japanese Collection of

Research Bioresources (JCRB, Osaka, Japan): A549, HEK293T, T98G, T24,

MDA-MB-231, MeWo, DLD-1, and H1299. U937 and HL-60 cell lines were

obtained from the RIKEN Cell Bank (Ibaraki, Japan). These cell lines were

authenticated using short tandem repeat analysis with the GenePrint 10

System (Promega, Madison, WI, USA) and Cell Line Authentication

Database of JCRB and American Type Culture Collection (ATCC) in 2015.

ST-HEK cells were prepared by the stable transfection of ABCG2 and cells

expressing high levels of the functional ABCG2 protein (18). These cells

were maintained in complete medium: RPMI1640 supplemented with 10%

heat-inactivated FBS, 100 U/ml penicillin, and 100 g/ml streptomycin in a

humidified atmosphere with 5% CO2/air at 37ºC. Typically, 1×105 cells

were seeded in 1.5 ml of complete medium on 3.5-cm dishes and cultured for

24 h before each experiment. Unless otherwise indicated, chemicals were

added at the following final concentrations: 0.5 mM of ALA, 550 M of

genistein, 1 M of Ko143, and 300 M of Noc18.

Flow cytometry of cellular PpIX

After being incubated, cells were rinsed three times with PBS and harvested

by trypsinization. After centrifugation at 800 ×g for 5 min, the cells were

resuspended in 0.4 ml of PBS. Cellular PpIX contents were measured using

the flow cytometer FACScan (BD Biosciences, San Diego, CA) and quantified

with CellQuest software (BD Biosciences). A total of 10,000 cells were

analyzed in each sample (excitation 488 nm, emission 650 nm).

Fluorescence microscopy

After being treated with ALA, cells were stained with 1 M MitoTracker

Green for 20 min at 37ºC and then observed by fluorescence microscopy

(Axiovert 200, Carl Zeiss Inc., Oberkochen, Germany). MitoTracker Green is

a fluorescent dye compound that is used for the detection of mitochondria.

Fluorescence images were taken using a highly light-sensitive

thermo-electrically cooled charge-coupled device camera (Axio-Cam CCD

camera, Zeiss). The filter combinations were a 450-nm excitation filter,

510-nm beam splitter, and 515–565-nm emission filter for MitoTracker

green; a 400-nm excitation filter, 580-nm beam splitter, and 590-nm long

pass emission filter for PpIX.

Western blotting analysis

Cells were solubilized in ice-cold lysis buffer (20 mM Tris-HCl, pH 7.4, 0.15

M NaCl, 1% NP-40, 0.1% SDS, 0.1% sodium deoxycholate, 5 mM EDTA, 5

mM EGTA, 1 mM phenylmethyl-sulfonyl fluoride, and 1 mg/ml each of

leupeptin and pepstatin A). After centrifugation of the homogenate at

15,000 × g for 15 min to remove cell nuclei, the supernatant was collected

and the protein content was determined using a BCA protein assay kit.

Samples were prepared by mixing with 2 × SDS sample buffer and boiling for

5 min, and were then stored at -80ºC until use. Protein content was

determined using a BCA protein assay kit. The samples were subjected to

SDS-polyacrylamide gel electrophoresis and proteins in the gel were

transferred electrophoretically onto an Immobilon membrane (Millipore,

Waltham, MA). The membrane was blocked by 5% skim milk in TBST (0.15

M NaCl, 0.05% Tween 20, 10 mM Tris-HCl, pH 7.4) and then incubated

overnight with primary antibodies (1:1000 for the mouse anti-human actin

antibody, 1:300 for the rabbit anti-human ABCG2 antibody, and 1:1000 for

the rabbit anti-bovine FECH antibody) diluted in TBST containing 5% skim

milk at 4ºC. After washing three times with TBST, the membrane was

incubated for 1.5 h with the HRP-conjugated secondary antibody diluted at

1:5000 in TBST containing 5% skim milk at room temperature.

Immunoreactive bands ware visualized with Immunostar LD (Wako, Osaka,

Japan) and exposed to Polaroid films.

Quantitative RT-PCR

Total RNA was isolated from A549 cells treated with or without 50 M

genistein for 28 h using RNeasy mini kit (Qiagen, Hilden, Germany)

following the manufacturer’s instructions. The RNA was treated with a

TURBO DNA-free kit (ThermoFisher Scientific) to remove genomic DNA.

cDNA was prepared from 0.5 g of total RNA using Revertra Ace qPCR RT

master Mix (TOYOBO, Osaka, Japan). One-twentieth of each of the

obtained cDNA specimens was used for each PCR. Quantitative real-time

PCR was performed in LightCycler 8-Tube Strips using the LightCycler

Nano Instrument and FastStart Essential DNA Green Master (Roche). The

primers used to amplify heme synthesis genes and an internal standard

-actin were: human ALAD forward primer CCTCGGTTCCAACCAACTGAT,

ALAD reverse primer: GATAGGVTGTATGTCATCAGGAACA; human PBGD

forward primer CAAGGACCAGGACATCTTGGAT, PBGD reverse primer:

CCAGACTCCTCCAGTCAGGTACA; human UROS forward primer

TCAGCACTGCCTCTTCTATTTCC, UROS reverse primer:

CTGGGTGTGCAACTGTCTGATAC; human UROD forward primer

CGGGAGTGTGTGGGAA, UROD reverse primer:

AAGCAGACGTGAGTGTTTATGCA; human CPOX forward primer

GGCGGAGATGTTGCCTAAGAC, CPOX reverse primer:

AATGCTCACCCCAGCCTTTT; human -actin forward primer

TGGCACCCAGCACAATGAA, -actin reverse primer:

CTAAGTCATAGTCCGCCTAGAAGCA; The PCR protocol was 95°C for 10

min followed by 40 cycles of denaturation at 95°C for 15 sec and

annealing/extension at 60°C for 1 min.

Generation of an in vivo tumor xenograft model

All animal procedures were approved by the Okayama University

Institutional Animal Care and Use Committee (approval number:

OKU-2012634 and OKU-2015443). Male athymic nude mice (BALB/c

nu/nu) were obtained from Charles River Japan, Inc. (Yokohama, Japan) and

they received intradermal injections of 2 × 106 A549 cells in each flank.

After 2 weeks, visible nodules approximately 5 mm in diameter had formed.

Mice (n = 5 per group) received vehicle (50% ethanol in PBS) or genistein (10

mg/kg/day, i.p. daily for 3 days) as a preconditioning treatment. Zero, 1, 4,

12 and 24 h after the administration of ALA (75 mg/kg, intramuscularly) to

both groups, the mice were euthanized and the tumors and neighboring

normal-appearing tissues were harvested, embedded in OCT compound

(Sakura Finetek, Tokyo Japan), and frozen in liquid nitrogen. Sections

were cut (15-m thickness) and five consecutive sections were mounted on

separate Superfrost Plus glass slides (Thermo Fisher Scientific). PpIX was

detected without fixation with a 400 nm excitation filter, a 565 nm beam

splitter, and a 605/70 nm bandpass emission filter on a fluorescence

microscope (BZ-X700, KEYENCE, Osaka, Japan). Sections containing

tumor tissue and neighboring normal-appearing tissue were identified and

analyzed with BZ-X Analyzer software (KEYENCE). Detection of

E-cadherin was used to distinguish the tumor tissues and non-tumor tissues,

as described below. PpIX fluorescence was measured as reported previously

(13) with the following modifications. The PpIX signal intensity per unit

area was measured separately in the tumor and non-tumor tissues by

calculating the mean intensity of the red fluorescence in each pixel of each

digital image. The ratio of tumor PpIX signal per unit area and non-tumor

PpIX signal per unit area were compared.

E-cadherin immunohistochemistry

Frozen sections adjacent to the sections used for PpIX detection were fixed in

4% paraformaldehyde for 10 min and then were incubated with blocking

solution (5% goat serum and 0.25% Triton X-100 in PBS) for 30 min at room

temperature. The sections were incubated with the anti-E-cadherin

antibody diluted 1:200 in IMMUNO SHOT (Cosmobio, Tokyo, Japan) for 16 h

at 4ºC. After washing, Alexa488-labeled secondary antibodies were diluted

1:750 for 1.5 h at room temperature. Cell nuclei were stained with

4'-6-diamidino-2-phenylindole (DAPI). The slides were mounted with the

anti-fade mountant, SlowFade Gold (Life technologies, MD). The sections

were analyzed by confocal microscopy (ZEISS Confocal Laser Scanning

Microscope Model LSM780) or BZ-X700.

Statistical analysis

Statistical analyses were performed using the Student’s t-test. The mean of

three distributions was considered significantly different if p<0.05.

RESULTS

Effects of genistein on ALA-mediated accumulation of PpIX in A549 cells

In order to determine whether genistein promoted the ALA-mediated

accumulation of PpIX by inhibiting ABCG2, we examined the relationship

between the abundance of ABCG2 and effects of genistein on the

accumulation of PpIX. A western blot analysis confirmed that A549 cells

had a high content of ABCG2, whereas human histiocytic lymphoma U937

cells had a low content of ABCG2 (Figure 1A) (18). The ALA-mediated

accumulation of PpIX was significantly lower in A549 cells than in U937

cells (Figure 1B). Genistein increased the ALA-mediated accumulation of

PpIX in A549 cells in dose- and time-dependent manners, which was similar

to the effects of the specific ABCG2 inhibitor Ko143 (Figure 1C and D). In

contrast, neither Ko143 nor genistein promoted the ALA-mediated

accumulation of PpIX in U937 cells (Figure 1E). When heme synthesis was

inhibited by the FEHC inhibitor Noc18 (NO donor), cellular PpIX levels

increased significantly in U937 cells and A549 cells (Figure 1E and F).

Fluorescence microscopy revealed that accumulated PpIX mainly localized in

mitochondria (Figure 2). These results indicated that the ALA-mediated

accumulation of PpIX was facilitated by genistein in A549 cells in vitro.

Genistein stimulated PpIX accumulation by the functional repression of

ABCG2

Since genistein stimulated the ALA-mediated accumulation of PpIX in a

similar manner to that of the ABCG2 inhibitor, we expected genistein to

suppress the efflux of PpIX through ABCG2. Thus, we examined the effects

of genistein on the accumulation of PpIX in ABCG2-knockdown cells.

Figure 3A shows that the siRNA designed to silence the ABCG2 gene

obliterated the protein expression of ABCG2 in A549 cells. After the

accumulation of PpIX was induced with ALA, washing the control cells with

ALA-free medium significantly decreased the accumulated levels of PpIX in

3 h. On the other hand, large amounts of PpIX still remained in ABCG2

knockdown cells after washing (Figure 3B). When control cells were

washed in the presence of Ko143 or genistein, larger amounts of PpIX were

retained in the cells. The accumulation of PpIX in ALA-treated ABCG2

knockdown cells was greater with Noc18, which inhibits ferrochelatase

through the generation of NO, but not with Ko143 or genistein than that in

control cells. These results suggested that the efflux of PpIX by ABCG2 and

heme synthesis were major factors regulating the intracellular accumulation

of PpIX in A549 cells and also that genistein suppressed the efflux of

intracellular PpIX by ABCG2.

We then investigated the effects of genistein on the ALA-mediated

accumulation of PpIX in ABCG2-overexpressing HEK cells (ST-HEK cells,

Figure 3C). The ALA treatment failed to increase the accumulation of PpIX

in ST-HEK cells, which was in contrast to that in parental HEK cells.

However, these two cells showed the higher or similar accumulation of PpIX

when cells were treated with Ko143 or genistein, respectively (Figure 3D).

These results suggested that genistein suppressed the PpIX efflux function

of ABCG2 in HEK cells.

A longer genistein treatment markedly stimulated ALA-mediated

accumulation of PpIX

We also examined the effects of a longer genistein treatment for up to 48 h on

the ALA-mediated accumulation of PpIX in A549 cells. The accumulation of

PpIX was markedly higher by ALA + genistein than by ALA alone or ALA +

Ko143 (Figure 4A). The ABCG2 inhibitory activity of Ko143 was not

affected by the incubation in culture medium for 48 h (data not shown).

Fluorescence microscopy revealed that the ALA + genistein treatment for 48

h increased PpIX fluorescence in A549 cells and that PpIX was localized in

the cytosol and mitochondria, which was similar to that with ALA alone

(Figure 4B). Furthermore, the pretreatment with genistein significantly

increased the ALA-mediated accumulation of PpIX in a manner that

depended on the dose of genistein and time of the pretreatment (Figures 5A

and 5B). In addition, genistein enhanced ALA-mediated PpIX

accumulation in another lung carcinoma cell line, H1299, and also in various

tumor cell lines that express ABCG2, including glioblastoma T98G cells,

breast cancer MDA-MB-231 cells, melanoma MeWo cells, and colorectal

adenocarcinoma DLD-1 cells (Supplementary Figure 1A and B).

Importantly, genistein pretreatment also enhanced the cell death induced by

ALA-mediated photodynamic treatment in A549 cells (Supplementary

Figure 1C). Since estrogen and estrogenic compounds often stimulate the

proliferation of cancer cells (26-28), the effect of genistein on the cell growth

of A549 cells was examined. As shown in Figure 5C, 25 and 50 M

genistein inhibited the cell growth of A549 cells for 48 h.

Systemic preconditioning with genistein enhanced the accumulation of PpIX

in a tumor model established in vivo

To determine whether genistein can enhance the accumulation of PpIX in

tumor cells in vivo, nude mice were implanted with A549 adenocarcinoma

cells. After two weeks, the tumors were visible and the animals received

systemic preconditioning with vehicle or genistein over a 3-day period. On

the third day, ALA was injected intramuscularly and both tumor-bearing and

non-tumor tissues were harvested 0, 1, 4, 12, and 24 h later and were

analyzed for PpIX fluorescence. In the vehicle control, ALA was found to

induce a transient accumulation of PpIX in the xenografted tumor cells

(Supplementary Figure 2A), which was confirmed with the detection of

E-cadherin immunoreactivity in the tumor tissues. PpIX accumulation

peaked 4 h after the administration of ALA (Supplementary Figure 2A),

although, the fluorescence intensity ratio for PpIX between the tumor and

non-tumor tissues was relatively low at the same time point (1.49 ± 0.31).

The greatest contrast in PpIX fluorescence was observed 1 h after ALA

administration, and at the same time point the genistein pretreatment

significantly increased PpIX accumulation in the xenografted tumor (Figure

6A-C). Moreover, this increase in PpIX accumulation did not affect the

tumor:non-tumor PpIX fluorescence ratio (Figure 6C). Treatment with

genistein also increased the accumulation of PpIX in the normal epidermis

and hair follicles (Supplementary Figure 2, B and C), suggesting that

genistein promotes PpIX accumulation in proliferating tissues such as skin.

We also attempted to elucidate the mechanism by which the

long-term treatment with genistein increased the accumulation of PpIX in

vitro. We examined whether genistein affected the expression of ABCG2 in

A549 cells. Figure 6D showed that genistein did not suppress, but rather

increased the protein expression of ABCG2. We investigated the effects of

genistein on the gene expression of heme synthesis enzymes. The gene

expression of ALAD, PBGD, UROS, UROD, CPOX and PPOX was

stimulated by the genistein treatment (Figure 6E). Accordingly, the rate of

PpIX synthesis was also accelerated by the genistein pretreatment for 48 h

when the efflux of PpIX by ABCG2 and its consumption by FECH were

inhibited by Ko143 and Noc18 (Figure 6F). These results suggested that

the long-term treatment with genistein increased the accumulation of PpIX

by up-regulating gene expression involved in the synthesis of PpIX.

DISCUSSION

The enhanced accumulation of PpIX in tumor cells represents a critical issue

for successful ALA-mediated photodynamic diagnosis. In the present study,

we showed that genistein stimulated the accumulation of PpIX in A549

human lung adenocarcinoma cell line both in vitro and in vivo by preventing

ABCG2-mediated PpIX efflux and up-regulating the gene expression of heme

synthesis enzymes (Figure 7). Furthermore, the enhancement of PpIX

accumulation by genistein was not limited to the A549, lung adenocarcinoma

cell line, and similar accumulation patterns were observed in other tumor

cell lines. Thus, genistein appears to effectively improved ALA-induced

PpIX accumulation in ABCG2 expressing tumors in vitro and in vivo and

these findings suggest that the phytoestrogen, genistein, may represent a

potentiating agent for ALA-mediated photodynamic diagnosis in humans.

Various approaches have been attempted to promote the

accumulation of PpIX in tumors by regulating key factors in the synthesis

and metabolism of PpIX. The inhibition of heme synthesis by deferoxamine

has been shown to improve the ALA-induced accumulation of PpIX in

urothelial carcinoma, leukemia, and gastric cancer (15-17, 29-31). However,

the anemic conditions commonly observed in patients with cancer may limit

the use of such an iron chelator to locally. A treatment with an ABCG2

inhibitor alone or in combination with ferrochelatase inhibitors was shown to

significantly increase the ALA-mediated accumulation of PpIX in human

urothelial and oral squamous cell carcinoma in vitro (8, 19). Vitamin D3 has

also been reported to promote the ALA-mediated accumulation of PpIX by

increasing the protein expression of the heme synthesis enzyme CPOX (13).

In this context, our results demonstrated for the first time that genistein

promoted the accumulation of PpIX by regulating multiple key factors in the

accumulation of PpIX such as ABCG2, ALAD, PBGD, UROS, UROD, and

PPOX in A549. Furthermore, the combination of these approaches such as

the genistein treatment with vitamin D3 may improve ALA-induced PpIX

accumulation more efficiently, which is the next subject to be explored.

Genistein has a structural similarity to 17-estradiol, which

explains its estrogenic activity (32). Genistein binds to estrogen receptors

alpha and beta (ER), and its affinity to ER is similar to that of

17-estradiol (22). Although the stimulation of ER by its selective agonist

2,3-bis (4-hydroxyphenyl) propionitrile was previously shown to promote the

activation of ERK1/2 and cell growth in 201T human non-small cell lung

cancer cells (33), genistein did not stimulate the proliferation of A549 cells

expressing ER (Figure 1 and 5C) (34-36). Furthermore, estrogen depletion

by ovariectomy in rats reduced ALA-induced PpIX levels in the tumors of

these animals (21). These findings suggest that estrogen and the

phytoestrogen genistein may accelerate the accumulation of PpIX by

stimulating ER signaling.

Porphyria cutanea tarda is a metabolic disease of the heme

synthesis pathway and is characterized by vesicles, bullae, and the fragility

of skin and sclerodermoid changes that occur predominantly in sun-exposed

areas (37, 38). This disorder is biochemically characterized by the

accumulation of uroporphyrin and hepta-carboxyl porphyrin in the liver (39).

Uroporphyrin and hepta-carboxyl porphyrin circulate in the plasma and

mediate cutaneous photosensitivity. It is widely accepted that estrogen is

one of the environmental factors of porphyria cutanea tarda and the use of

estrogen also plays a role its clinical expression (37, 39). In this context, it

is important to note that genistein pretreatment increased ALA-induced

PpIX accumulation in the mouse normal epidermis and hair follicles as well

as in xenografted tumor in the present study. Thus, estrogens may be good

candidates of potentiating agents for ALA-mediated photodynamic diagnosis

in humans.

Genistein is known to enhance apoptosis induced by the anticancer

drug trichostatin A in A549 cells, but not in normal human lung fibroblasts

by increasing the expression of ER-mediated TNF receptor-1 (40, 41).

Therefore, genistein may be beneficial not only for improving the quality of

ALA-mediated photodynamic diagnosis, but also for better outcomes of

subsequent chemotherapy in patients with lung cancer.

In the present study, ALA-induced PpIX accumulation increased

3.7-fold in vitro and 1.8-fold in vivo following pretreatment with genistein

(Figures 5B and 6B). This discrepancy between the in vitro and in vivo

results may be multifactorial. One possible explanation is that genistein

can be metabolized to 3’-OH-genistein by cytochrome P450 1A2 (CYP1A2), a

major enzyme in the phase I hydroxylation process in mouse liver (42, 43).

Another consideration is that passive targeting systems [e.g., tumor

targeting nanoparticles (44)] may improve the effects of genistein in vivo by

achieving a better distribution of genistein among cancer cells.

When ALA-induced PpIX is activated by visible light in tumor cells,

cytotoxic singlet oxygens are generated and these can kill the tumor cells.

In the present study, cell death due to ALA-based photodynamic treatment

increased 1.8-fold and PpIX accumulation increased 3.7-fold following 50 M

genistein pretreatment. The mild increase in cytotoxicity despite a marked

PpIX increase suggests that genistein partially acts as an antioxidant (45).

In addition, genistein has been shown to up-regulate the expression of

antioxidant genes via estrogen receptors and ERK1/2 activation (46). Thus,

it is possible that some of the cytotoxic effects that are mediated by

ALA-based photodynamic treatment in the presence of genistein may be

cancelled by genistein itself.

In the present study, the 48-h genistein treatment was associated

with an increase, rather than a decrease in ABCG2 protein expression,

despite the treatment markedly promoting the ALA-mediated accumulation

of PpIX in A549 cells. While the reason for this apparent discrepancy

currently remains unknown, it may reflect the multi-faceted functions of

genistein. Namely, the synthesis of PpIX by genistein-induced heme

synthesis enzymes may override the efflux of PpIX by genistein-induced

ABCG2 in A549 cells and/or genistein may suppress pre-existing and

genistein-induced ABCG2 protein levels.

REFERENCES

1. Peng Q, Warloe T, Berg K, Moan J, Kongshaug M, Giercksky KE, et

al. 5-Aminolevulinic acid-based photodynamic therapy. Clinical research and

future challenges. Cancer. 1997;79:2282-308.

2. Inoue K, Fukuhara H, Shimamoto T, Kamada M, Iiyama T,

Miyamura M, et al. Comparison between intravesical and oral

administration of 5-aminolevulinic acid in the clinical benefit of

photodynamic diagnosis for nonmuscle invasive bladder cancer. Cancer.

2012;118:1062-74.

3. Fukuhara H, Inoue K, Satake H, Tamura K, Karashima T,

Yamasaki I, et al. Photodynamic diagnosis of positive margin during radical

prostatectomy: preliminary experience with 5-aminolevulinic acid.

International journal of urology : official journal of the Japanese Urological

Association. 2011;18:585-91.

4. Friesen SA, Hjortland GO, Madsen SJ, Hirschberg H, Engebraten O,

Nesland JM, et al. 5-Aminolevulinic acid-based photodynamic detection and

therapy of brain tumors (review). International journal of oncology.

2002;21:577-82.

5. Messmann H, Mlkvy P, Buonaccorsi G, Davies CL, MacRobert AJ,

Bown SG. Enhancement of photodynamic therapy with 5-aminolaevulinic

acid-induced porphyrin photosensitisation in normal rat colon by threshold

and light fractionation studies. British journal of cancer. 1995;72:589-94.

6. Teng L, Nakada M, Zhao SG, Endo Y, Furuyama N, Nambu E, et al.

Silencing of ferrochelatase enhances 5-aminolevulinic acid-based

fluorescence and photodynamic therapy efficacy. British journal of cancer.

2011;104:798-807.

7. Togsverd-Bo K, Lerche CM, Philipsen PA, Poulsen T, Wulf HC,

Haedersdal M. Porphyrin biodistribution in UV-exposed murine skin after

methyl- and hexyl-aminolevulinate incubation. Experimental dermatology.

2012;21:260-4.

8. Yamamoto M, Fujita H, Katase N, Inoue K, Nagatsuka H, Utsumi K,

et al. Improvement of the efficacy of 5-aminolevulinic acid-mediated

photodynamic treatment in human oral squamous cell carcinoma HSC-4.

Acta medica Okayama. 2013;67:153-64.

9. Zhao SG, Chen XF, Wang LG, Yang G, Han DY, Teng L, et al.

Increased expression of ABCB6 enhances protoporphyrin IX accumulation

and photodynamic effect in human glioma. Annals of surgical oncology.

2013;20:4379-88.

10. Ishizuka M, Abe F, Sano Y, Takahashi K, Inoue K, Nakajima M, et

al. Novel development of 5-aminolevurinic acid (ALA) in cancer diagnoses

and therapy. International immunopharmacology. 2011;11:358-65.

11. Kuo MT. Redox regulation of multidrug resistance in cancer

chemotherapy: molecular mechanisms and therapeutic opportunities.

Antioxidants & redox signaling. 2009;11:99-133.

12. Doss M, Sixel-Dietrich F, Verspohl F. "Glucose effect" and rate

limiting function of uroporphyrinogen synthase on porphyrin metabolism in

hepatocyte culture: relationship with human acute hepatic porphyrias.

Journal of clinical chemistry and clinical biochemistry Zeitschrift fur

klinische Chemie und klinische Biochemie. 1985;23:505-13.

13. Anand S, Wilson C, Hasan T, Maytin EV. Vitamin D3 enhances the

apoptotic response of epithelial tumors to aminolevulinate-based

photodynamic therapy. Cancer research. 2011;71:6040-50.

14. Amo T, Kawanishi N, Uchida M, Fujita H, Oyanagi E, Utsumi T, et

al. Mechanism of cell death by 5-aminolevulinic acid-based photodynamic

action and its enhancement by ferrochelatase inhibitors in human histiocytic

lymphoma cell line U937. Cell biochemistry and function. 2009;27:503-15.

15. Fukuhara H, Inoue K, Kurabayashi A, Furihata M, Fujita H,

Utsumi K, et al. The inhibition of ferrochelatase enhances 5-aminolevulinic

acid-based photodynamic action for prostate cancer. Photodiagnosis and

photodynamic therapy. 2013;10:399-409.

16. Inoue K, Fukuhara H, Kurabayashi A, Furihata M, Tsuda M,

Nagakawa K, et al. Photodynamic therapy involves an antiangiogenic

mechanism and is enhanced by ferrochelatase inhibitor in urothelial

carcinoma. Cancer science. 2013;104:765-72.

17. Inoue K, Karashima T, Kamada M, Shuin T, Kurabayashi A,

Furihata M, et al. Regulation of 5-aminolevulinic acid-mediated

protoporphyrin IX accumulation in human urothelial carcinomas.

Pathobiology : journal of immunopathology, molecular and cellular biology.

2009;76:303-14.

18. Kobuchi H, Moriya K, Ogino T, Fujita H, Inoue K, Shuin T, et al.

Mitochondrial localization of ABC transporter ABCG2 and its function in

5-aminolevulinic acid-mediated protoporphyrin IX accumulation. PloS one.

2012;7:e50082.

19. Ogino T, Kobuchi H, Munetomo K, Fujita H, Yamamoto M, Utsumi T,

et al. Serum-dependent export of protoporphyrin IX by ATP-binding cassette

transporter G2 in T24 cells. Molecular and cellular biochemistry.

2011;358:297-307.

20. Vail JT, Jr. Porphyria cutanea tarda and estrogens. Jama.

1967;201:671-4.

21. Gibson SL, Anderson LT, Havens JJ, Hilf R. Effect of estrogenic

perturbations on delta-aminolevulinic acid-induced porphobilinogen

deaminase and protoporphyrin IX levels in rat Harderian glands, liver, and

R3230AC tumors. Biochemical pharmacology. 1999;58:1821-9.

22. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der

Saag PT, et al. Interaction of estrogenic chemicals and phytoestrogens with

estrogen receptor beta. Endocrinology. 1998;139:4252-63.

23. Ming LG, Chen KM, Xian CJ. Functions and action mechanisms of

flavonoids genistein and icariin in regulating bone remodeling. Journal of

cellular physiology. 2013;228:513-21.

24. Prossnitz ER, Barton M. The G-protein-coupled estrogen receptor

GPER in health and disease. Nature reviews Endocrinology. 2011;7:715-26.

25. Imai Y, Tsukahara S, Asada S, Sugimoto Y.

Phytoestrogens/flavonoids reverse breast cancer resistance

protein/ABCG2-mediated multidrug resistance. Cancer research.

2004;64:4346-52.

26. Beral V. Breast cancer and hormone-replacement therapy in the

Million Women Study. Lancet. 2003;362:419-27.

27. Beral V, Bull D, Green J, Reeves G. Ovarian cancer and hormone

replacement therapy in the Million Women Study. Lancet. 2007;369:1703-10.

28. Lucki NC, Sewer MB. Genistein stimulates MCF-7 breast cancer

cell growth by inducing acid ceramidase (ASAH1) gene expression. The

Journal of biological chemistry. 2011;286:19399-409.

29. Berg K, Anholt H, Bech O, Moan J. The influence of iron chelators

on the accumulation of protoporphyrin IX in 5-aminolaevulinic acid-treated

cells. British journal of cancer. 1996;74:688-97.

30. Lin F, Geiger PG, Korytowski W, Girotti AW. Protoporphyrin

IX-sensitized photoinactivation of 5-aminolevulinate-treated leukemia cells:

effects of exogenous iron. Photochemistry and photobiology. 1999;69:375-81.

31. Tan WC, Krasner N, O'Toole P, Lombard M. Enhancement of

photodynamic therapy in gastric cancer cells by removal of iron. Gut.

1997;41:14-8.

32. Mahmoud AM, Yang W, Bosland MC. Soy isoflavones and prostate

cancer: a review of molecular mechanisms. The Journal of steroid

biochemistry and molecular biology. 2014;140:116-32.

33. Hershberger PA, Stabile LP, Kanterewicz B, Rothstein ME, Gubish

CT, Land S, et al. Estrogen receptor beta (ERbeta) subtype-specific ligands

increase transcription, p44/p42 mitogen activated protein kinase (MAPK)

activation and growth in human non-small cell lung cancer cells. The

Journal of steroid biochemistry and molecular biology. 2009;116:102-9.

34. Verma MK, Miki Y, Abe K, Niikawa H, Sasano H. Cytoplasmic

estrogen receptor beta as a potential marker in human non-small cell lung

carcinoma. Expert opinion on therapeutic targets. 2012;16 Suppl 1:S91-102.

35. Shen L, Li Z, Shen S, Niu X, Yu Y, Li Z, et al. The synergistic effect

of EGFR tyrosine kinase inhibitor gefitinib in combination with aromatase

inhibitor anastrozole in non-small cell lung cancer cell lines. Lung Cancer.

2012;78:193-200.

36. Tang H, Liao Y, Chen G, Xu L, Zhang C, Ju S, et al. Estrogen

upregulates the IGF-1 signaling pathway in lung cancer through estrogen

receptor-beta. Med Oncol. 2012;29:2640-8.

37. Elder GH. Porphyria cutanea tarda. Seminars in liver disease.

1998;18:67-75.

38. Urbanek RW, Cohen DJ. Porphyria cutanea tarda: pregnancy versus

estrogen effect. Journal of the American Academy of Dermatology.

1994;31:390-2.

39. Phillips JD, Jackson LK, Bunting M, Franklin MR, Thomas KR,

Levy JE, et al. A mouse model of familial porphyria cutanea tarda.

Proceedings of the National Academy of Sciences of the United States of

America. 2001;98:259-64.

40. Shiau RJ, Chen KY, Wen YD, Chuang CH, Yeh SL. Genistein and

beta-carotene enhance the growth-inhibitory effect of trichostatin A in A549

cells. European journal of nutrition. 2010;49:19-25.

41. Wu TC, Yang YC, Huang PR, Wen YD, Yeh SL. Genistein enhances

the effect of trichostatin A on inhibition of A549 cell growth by increasing

expression of TNF receptor-1. Toxicology and applied pharmacology.

2012;262:247-54.

42. Hu M, Krausz K, Chen J, Ge X, Li J, Gelboin HL et al. Identification

of CYP1A2 as the main isoform for the phase I hydroxylated metabolism of

genistein and a prodrug converting enzyme of methylated isoflavones. Drug

Metabolism and Disposition. 2003;31:924-31.

43. Kulling SE, Honig DM, Metzler M. Oxidative metabolism of the soy

isoflavones daidzein and genistein in humans in vitro and in vivo. Journal of

Agricultural and Food Chemistry. 2001;49:3024-33.

44. Cho K, Wang X, Nie S, Chen ZG, Shin DM. Therapeutic nanoparticles for

drug delivery in cancer. Clinical Cancer Research. 2008;14:1310-6.

45. Wei H, Wei L, Frenkel K, Bowen R, Barnes S. Inhibition of tumor

promoter-induced hydrogen peroxide formation in vitro and in vivo by

genistein. Nutrition and Cancer. 1993;20:1-12.

46. Borrás C, Gambini J, Gómez-Cabrera MC, Sastre J, Pallardó FV,

Mann GE et al. Genistein, a soy isoflavone, up-regulates expression of

antioxidant genes: involvement of estrogen receptors, ERK1/2, and

NFkappaB. The FASEB Journal. 2006;20:2136-8.

FIGURE LEGENDS

Figure 1. Effects of genistein on ALA-mediated accumulation of PpIX in

ABCG2-expressing cells. (A) Protein expression of ABCG2 and

ferrochelatase (FECH) in U937 and A549 cells. Cell lysates were analyzed

by western blotting using antibodies against ABCG2, FECH, and actin. (B)

The ALA-mediated accumulation of PpIX in U937 and A549 cells. Cells

were treated with the indicated concentration of ALA for 3 h. PpIX

fluorescence was measured by a flow cytometer and expressed as a

percentage of the control (0 mM ALA). (C) Genistein (left graph) and Ko143

(an ABCG2 inhibitor, right graph) treatments stimulated ALA-mediated

accumulation of PpIX in A549 cells in a dose-dependent manner. (D)

Genistein and Ko143 stimulated ALA-mediated accumulation of PpIX in

A549 cells in a time-dependent manner. Data in (C) are % increases

relative to the PpIX fluorescence intensity induced by 0.5 mM ALA only. (E,

F) Effects of genistein, Ko143, and Noc18 (FECH inhibitor) on the

ALA-induced accumulation of PpIX in U937 (E) and A549 (F) cells. Cells

were incubated with 0.5 mM ALA for 3 h in the presence or absence of 1 M

Ko143, 25 M genistein, or 300 M Noc18 and intracellular PpIX

fluorescence was measured. The mean ± SD for three independent

experiments. Asterisks indicate a significant difference from ALA only.

Figure 2. Effects of genistein and Ko143 on the amount and distribution of

PpIX in ALA-treated A549 cells in vitro. Cells were incubated with 0.5 mM

ALA for 3 h in the presence or absence of 1 M Ko143 or 25 M genistein and

then stained with MitoTracker Green, a mitochondrial-selective probe.

Images were taken using fluorescent microscopy. Magnification × 200.

Figure 3. Genistein stimulated PpIX accumulation by functionally

repressing ABCG2. (A, B) ABCG2 protein expression in A549 cells was

knocked down by RNAi, and the effects of genistein on PpIX

excretion/consumption were determined by removing the substrate. Cells

were transfected with ABCG2-specific siRNA for 5 days, treated with ALA

for 1.5 h, rinsed with ALA-free medium, and then incubated in the medium

for 3 h in the presence of 1 M Ko143, 25 M genistein, or 300 M Noc18.

(A) Western blot for the ABCG2 protein from ABCG2-knockdown A549 cells.

(B) PpIX levels were measured by flow cytometry. Asterisks indicate a

significant difference from the corresponding “control cells”. # indicates a

significant difference from the corresponding “Wash” samples. (C) ABCG2

protein expression in parental HEK cells and ST-HEK cells, in which an

ABCG2 expression vector was stably transfected. (D) Effects of genistein on

the accumulation of PpIX in HEK cells and ST-HEK cells. HEK cells and

ST-HEK cells were incubated with 0.5 mM ALA for 3 h in the presence of 1

M Ko143 or 25 M genistein. The mean ± SD for three independent

experiments. Asterisks indicate a significant difference from the

corresponding “ALA” samples.

Figure 4. A longer genistein treatment markedly stimulated ALA-mediated

accumulation of PpIX. (A) Cells were treated with 0.5 mM ALA for 48 h in

the presence of 1 M Ko143 or 50 M genistein and PpIX fluorescence was

analyzed by flow cytometry. (B) The amount and distribution of PpIX at 48 h

were analyzed by fluorescence microscopy. Magnification × 200.

MitoTracker Green is a mitochondrial-sensitive probe.

Figure 5. The genistein pretreatment stimulated ALA-mediated

accumulation of PpIX. (A) A549 cells were treated with the indicated

concentration of genistein for 48 h and then with 0.5 mM ALA + genistein for

3 h. PpIX fluorescence was analyzed by flow cytometry. (B) Pre-incubation

time-dependent accumulation of ALA-mediated PpIX by genistein. (C)

Effects of genistein on A549 cell growth at 48 h. Cell growth was analyzed

with a hemocytometer and the Trypan blue exclusion test. The asterisks

indicate that genistein significantly increased the accumulation of PpIX.

Data are the mean ± SD derived from three independent experiments.

Figure 6. Preconditioning with genistein stimulated the accumulation of

PpIX in a xenograft tumor model and promoted the gene expression of heme

metabolism enzymes in A549 cells. (A) Histological detection of PpIX levels

in A549 tumor cells established in nude mice as a xenograft model (see

Methods). These mice received genistein (10 mg/kg, daily, i.p.) for 3 days

and ALA (75 mg/kg, i.m.) for 1 h to stimulate the synthesis of PpIX before the

tumors were analyzed. Wide-field and confocal fluorescence

photomicrographs of frozen sections showed PpIX fluorescence and

E-cadherin immunoreactivity, respectively. The asterisk indicates calcified

tissue. Scale bar: 300 m. (B) Digital quantification of PpIX fluorescence

in A549 tumors subjected to genistein as shown in (A). PpIX signal per unit

area in the E-cadherin positive region was calculated and expressed as a

percentage of vehicle PpIX fluorescence. Data are the mean ± SD calculated

from five samples. The asterisks indicate a significant difference from the

vehicle control. (C) The ratio of PpIX fluorescence in the tumor to that in

adjacent non-tumor tissue is shown. (D) Western blot analysis of protein

levels. A549 cells were treated with 50 M genistein for the indicated times

in vitro. Proteins were analyzed by western blotting. (E) Changes in the

mRNA expression of heme metabolism enzymes in A549 cells treated with

genistein in vitro. These mRNAs were analyzed by quantitative real time

RT-PCR. Asterisks indicate a significant difference from the 0-h control of

each gene of interest. FECH, ALAD, PBGD, UROS, UROD, CPOX, and

PPOX are ferrochelatase, 5-aminolevulinic acid dehydrogenase,

porphobilinogen deaminase, uroporphyrinogen III synthase,

uroporphyrinogen decarboxylase, coproporphyrinogen oxidase, and

protoporphyrinogen oxidase, respectively. (F) The rate of PpIX synthesis in

genistein-treated A549 cells. A549 cells were treated with or without 50 M

genistein for 48 h and then treated with 0.5 mM ALA for 1 and 2 h in the

presence of Noc18 and Ko143.

Figure 7. Schematic representation of potential mechanisms by which

phytoestrogen genistein stimulates ALA-mediated accumulation of PpIX in

malignant cells. FECH, ALAD, PBGD, UROS, UROD, CPOX, PPOX, and

PEPT are ferrochelatase, 5-aminolevulinic acid dehydrogenase,

porphobilinogen deaminase, uroporphyrinogen III synthase,

uroporphyrinogen decarboxylase, coproporphyrinogen oxidase,

protoporphyrinogen oxidase, and oligopeptide transporter, respectively.

Phytoestrogen suppresses efflux of the diagnostic marker protoporphyrin IX (PpIX) in lung carcinoma

Hirofumi Fujita, Keisuke Nagakawa, Hirotsugu Kobuchi, et al.

Cancer Res Published OnlineFirst February 2, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-15-1484

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/03/04/0008-5472.CAN-15-1484.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2016/02/02/0008-5472.CAN-15-1484. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.