Purification of Porphobilinogen Deaminase and the Sequencing and Expression of Thehemc Gene of Rhodobacter Capsulatus

Home , Bilane, Carbonic anhydrase, Coproporphyrinogen III, Ferrochelatase, Hydroxymethylbilane, Porphobilinogen

Louisiana State University LSU Digital Commons

LSU Historical Dissertations and Theses Graduate School

1998 Purification of Porphobilinogen Deaminase and the Sequencing and Expression of thehemC Gene of Rhodobacter Capsulatus. Keith A. Canada Louisiana State University and Agricultural & Mechanical College

Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses

Recommended Citation Canada, Keith A., "Purification of Porphobilinogen Deaminase and the Sequencing and Expression of thehemC Gene of Rhodobacter Capsulatus." (1998). LSU Historical Dissertations and Theses. 6813. https://digitalcommons.lsu.edu/gradschool_disstheses/6813

This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type o f computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back o f the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/521-0600

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. PURIFICATION OF PORPHOBILINOGEN DEAMINASE AND THE SEQUENCING AND EXPRESSION OF THE hemC GENE OF Rhodobacter capsulatus

A Dissertation

Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy

The Department of Biological Sciences

by Keith A. Canada B.S., Purdue University, 1992 December 1998

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: 9922062

This microform edition is protected against unauthorized copying under Title 17, United States Code.

UMI 300 North Zeeb Road Ann Arbor, MI 48103

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DEDICATION

To my loving wife Darla who’s strength and encouragement have helped me to achieve my dreams

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ACKNOWLEDGMENTS

I would first like to thank my parents and family for their support

(financial & emotional) throughout my life. Without their encouragement and

love I would have never made it to where I am now.

To my wife, Darla, I am forever in debt. She has helped at every stage

of my graduate career, from designing experiments, to running experiments, to

proofreading this dissertation. I am very fortunate to have a wife that can

understand me as I talk about the ups and downs of the tetrapyrrole pathway.

Her faith and encouragement have helped me become a better scientist.

I would like to thank my major professor, Alan J. Biel, for taking me

under his wings and teaching me his knowledge of microbiology. I deeply

appreciate all the time and effort he has invested. His patience and

encouragement have made my graduate career a successful one.

I would like to express my sincere appreciation to the members of my

graduate committee: Dr. Donal Day, Dr. Randall Gayda, Dr. Gregg Pettis, Dr.

Ding Shih and Dr. James Krahenbuhl for their support and helpful advice

throughout my graduate career.

To all of my laboratory colleagues past and present, Karl Indest,

Georgia Ineichen, Katya Kanazireva, David Huang, Alok Khanna and Karen

Sullivan, I would like to express my deepest gratitude for being so helpful and

being such good friends.

Special thanks to Cindy Henk and Ron Bouchard for their help in

photography and slide preparation.

iii

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TABLE OF CONTENTS

DEDICATION...... ii

ACKNOWLEDGMENTS...... iii

LIST OF TABLES...... vi

LIST OF FIGURES...... vii

ABSTRACT...... viii

INTRODUCTION...... 1 Tetrapyrrole Pathway of R. capsulatus...... 3 Aminolevulinate Synthase ...... 3 Porphobilinogen Synthase ...... 7 Porphobilinogen Deaminase...... 9 Uroporphyrinogen III Synthase ...... 12 Uroporphyrinogen III Decarboxylase ...... 13 Coproporphyrinogen III Oxidase ...... 15 Protoporphyrinogen IX Oxidase ...... 17 Tetrapyrrole Biosynthesis Regulation ...... 20

MATERIALS AND METHODS...... 30 Strains and Plasmids ...... 30 Media ...... 30 Growth Conditions ...... 30 Protein Determination ...... 34 Porphobilinogen Deaminase Assay ...... 34 Isolation and Purification of Porphobilinogen Deaminase ...... 37 (NH4)2S04 Fractionation and Heat Treatment ...... 37 Anion-Exchange Chromatography ...... 38 Hydroxylapatite Chromatography ...... 38 Gel-Filfration Chromatography ...... 39 Molecular Weight Determination by Electrophoresis ...... 39 Denaturing Conditions ...... 39 Nondenaturing Conditions...... 40 Isoelectric Focusing ...... 42 Two-Dimensional Gel Electrophoresis ...... 43 Protein Blotting ...... 43 Plasmid DNA Isolation ...... 44 Restriction Enzyme Digestion ...... 45 DNA Ligation...... 45 Agarose Gel Electrophoresis...... 46 DNA Recovery from Agarose G els...... 46

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Electroporation ...... 46 Triparental Matings ...... 47 DNA Sequencing ...... 48 Chloramphenicol Acetyltransferase Assay ...... 48

RESULTS...... 50 Purification of Porphobilinogen Deaminase ...... 50 Molecular Weight Determination of Porphobilinogen Deaminase 50 Nondenaturing Gel Electrophoresis ...... 50 SDS-PAGE...... 53 Determination of Optimum pH and Isoelectric Point ...... 57 Kinetic Analysis of Porphobilinogen Deaminase ...... 57 Stoichiometry...... 57 Inhibitors ...... 60 Effects of Oxygen on Porphobilinogen Deaminase Activity ...... 60 N-terminal Sequence Analysis ...... 62 Cloning of the R. capsulatus hemC Gene ...... 62 Sequencing of the hemC G ene ...... 64 Overexpression of the hemC G ene...... 68 Construction of a hemC-cat Transcriptional Fusion Plasmid ...... 71 Effects of Oxygen on Transcription of the hemC-cat Fusion Plasmid .. 75

DISCUSSION...... 78

REFERENCES...... 87

VITA...... 118

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF TABLES

1. Strains used in this study ...... 31

2. Plasmids used in this study ...... 32

3. Purification of porphobilinogen deaminase ...... 51

4. Effects of additives on the R. capsulatus porphobilinogen deaminase ...... 61

5. Overexpression of hemC in E. c o li...... 72

6. Overexpression ofhemC in R. capsulatus...... 73

7. Effects of oxygen on chloramphenicol acetyltransferase activity ...... 76

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. LIST OF FIGURES

1. Tetrapyrrole biosynthetic pathway of R. capsulatus...... 4

2. Analysis of the R. capsulatus porphobilinogen deaminase by nondenaturing polyacrylamide gel electrophoresis ...... 52

3. Mobility of proteins in nondenaturing gels ...... 54

4. Molecular weight determination of the nondenatured R. capsulatus porphobilinogen deaminase ...... 55

5. Analysis of the R. capsulatus porphobilinogen deaminase bySDS-PAGE...... 56

6. Effects of pH on the R. capsulatus porphobilinogen deaminase activity . . . 58

7. Kinetic analysis of the R. capsulatus porphobilinogen deaminase ...... 59

8. Two-dimensional gel electrophoresis of the purified R. capsulatus porphobilinogen deaminase ...... 63

9. Plasmid pCAP154 containing the R. capsulatus hemC and hemE genes ... 65

10. Restriction map of R. capsulatus hemC derivatives ...... 66

11. Nucleotide sequence of the R. capsulatus hemC gene ...... 67

12. Alignment of conserved cofactor binding sites ...... 69

13. Palindromic sequences upstream of R. capsulatus genes ...... 70

14. The hemC-cat fusion plasmid constructed to study transcriptional regulation by oxygen ...... 74

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ABSTRACT

Rhodobacter capsulatus uses the common tetrapyrrole pathway to

synthesize heme, bacteriochlorophyll, siroheme and vitamin B-12. As part of

our studies on the regulation of this pathway, the product of the hemC gene,

porphobilinogen deaminase was purified approximately 200-fold. The

molecular weight, isoelectric point, pH optimum and K„ of the enzyme were all

similar to other porphobilinogen deaminases. The stoichiometry of the enzyme

was found not to be the expected four porphobilinogens used per one

uroporphyrin formed. Rather a 9:1 ratio was typically seen. Further study of

this atypical ratio uncovered evidence of possible in vivo regulation of

porphobilinogen deaminase dependant on the cellular redox state. The protein

was isolated from a two-dimensional gel and the sequence of the first twenty

amino acids from the N-terminus was determined. This protein sequence

matched a putative amino acid sequence 110 bp upstream of the R. capsulatus

hemE gene. The putative hemC locus was subcloned from the plasmid

pCAP154 which contains the R. capsulatus hemE gene with 1.2 Kb of

upstream DNA. The sequence of the upstream DNA was determined by

dideoxy sequencing of both strands. A single open reading frame of 951 bp

was found which could code for a 317 amino acid protein of 34,082 Da. The

putative protein has 49% identity with the E. coli porphobilinogen deaminase

and 44% identity with the B. subtilis enzyme. When a plasmid carrying the R.

capsulatus hemC was inserted into E. coli and R. capsulatus, a four-fold and

ten-fold increase in porphobilinogen deaminase activity was seen respectively.

viii

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The DNA sequence revealed that the hemC and hemE genes are divergently

transcribed. A palindrome was identified between the two start sites, 47 bp

upstream of hemE and 42 bp upstream of hemC. This palindrome, found

upstream of many R. capsulatus genes, has been proposed to be a

transcriptional regulatory site. The effects of oxygen on the transcription of

hemC were studied using a hemC-cat fusion vector. Under the conditions

tested, oxygen had no effect on the transcription of the R. capsulatus hemC

gene.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. INTRODUCTION

Rhodobacter capsulatus is a purple nonsulfur bacteria, in the

alpha-subgroup of proteobacteria, that is capable of anoxygenic

photosynthesis. Unlike the photosynthesis in cyanobacteria or eukaryotic

algae, R. capsulatus uses only one photosystem. Like all anoxygenic

phototrophic bacteria, R. capsulatus is unable to photolyse water and no

oxygen is produced. Reducing power must be provided for C02 fixation by

reduced compounds from the environment that have lower redox potential than

water. Most commonly, hydrogen or organic compounds such as aliphatic

acids or alcohols are used as photosynthetic electron donors. To harness the

energy from light, the photosynthetic pigments and the photosynthetic

apparatus are located in an extended system of intracytoplasmic membranes

that originate and are continuous with the cytoplasmic membrane. The major

photosynthetic pigments are bacteriochlorophyll a or b and various carotenoids

of the spheroidene series. These photopigments are responsible for the

distinct coloration of R. capsulatus cultures.

R. capsulatus is an extremely metabolically versatile bacteria often

described as the most versatile of the prokaryotes (186). The preferred growth

mode for R. capsulatus is photoheterotrophically under anaerobic conditions in

the light using a variety of organic compounds as electron donors and carbon

sources (57). This mode of growth depends on the absence of oxygen,

because photopigments are not synthesized in the presence of oxygen. Under

these phototrophic conditions respiration is inhibited, yet R. capsulatus still

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. exhibits a considerable respiratory capacity. This allows R. capsulatus to

switch immediately from phototrophic to respiratory metabolism when

environmental conditions change. R. capsulatus is capable of

photoautotrophic growth under anaerobic conditions in the light with C02 as

the sole carbon source and H2 as the electron donor (197). R. capsulatus can

also grow under anaerobic conditions in the dark, as a chemoautotroph (186),

using hydrogen as the energy source (312). Since R. capsulatus is quite

tolerant of oxygen, it can grow well as a chemoheterotroph under aerobic

conditions in the dark using a variety of organic compounds for carbon and

energy, and 0 2 as the final electron acceptor. R. capsulatus can also perform

a respiratory metabolism anaerobically in the dark using various sugars for

carbon and either nitrate, nitrous oxide, dimethyl sulfoxide (DMSO), or

trimethylamine-N-oxide (TMAO) as electron acceptors (184,185,197). Along

with these specialized metabolic processes, R. capsulatus can fix nitrogen in

both light and dark conditions (13). This makes it possible to grow R.

capsulatus in the simplest of medium, containing C02 for carbon, light for

energy, and ammonium for nitrogen, or in the most complex of medium such as

Peptone-Yeast Extract (PYE).

Tetrapyrroles are essential molecules in energy metabolism and are

found in almost all organisms in nature. Humans are able to produce the

tetrapyrrole heme, while plants, algae, and cyanobacteria are able to

synthesize the tetrapyrroles heme and chlorophyll. R. capsulatus is uniquely

versatile in that it has the ability to form four tetrapyrrole end products:

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. bacteriochlorophyil, heme, siroheme, and vitamin B12. Bacteriochlorophyll is

used as the major light harvesting pigment. Heme is used as the prosthetic

group for cytochromes, catalase, and peroxidase and is required for all growth

modes. Siroheme is the prosthetic group for sulfite and nitrite reductase (206,

207). Vitamin B12 is used as the cofactor for homocysteine methyltransferase,

an enzyme involved in methionine biosynthesis (50).

Tetrapyrrole Pathway of R. capsulatus

The four tetrapyrrole end products made by R. capsulatus are the

products of a common pathway (Figure 1) that branches after the formation of

protoporphyrin IX to form bacteriochlorophyll and heme (130,167). Except for

a few cases, all organisms synthesize tetrapyrroles by some form of this

common pathway. Those organisms that have incomplete pathways require

exogenous sources of heme or a tetrapyrrole precursor molecule (99). In

humans, defects in this common pathway lead to a group of disorders called

porphyrias (205). These disorders, most commonly inherited as autosomal

dominant traits, are characterized by excess production of porphyrin

precursors.

Aminolevulinate Synthase

The first intermediate molecule common to all tetrapyrroles is the five

carbon aminoketone, 5-aminolevulinate (ALA). Depending on the organism,

two pathways leading to the formation of 5-aminolevulinate are known. One

production pathway called the Cs-pathway involves the conversion of glutamate

into ALA via a three step process (23). This pathway is widely distributed

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. SUCCiNYL-CoA + GLYCINE

Aminolevulinate Synthase (hemA)

■ AMINOLEVULINATE

^Porphobilinogen Synthase (hemB)

PORPHOBILINOGEN

^ Porphobilinogen Deaminase (hemC)

HYDROXYMETHYLBILANE

Uroporphyrinogen ill Synthase (hemD) I' UROPORPHYRINOGEN III

Uroporphyrinogen III Decarboxylase (hemE)

COPROPORPHYRINOGEN III SIROHEME Coproporphyrinogen III JOxidase (hemF) PROTOPORPHYRINOGEN IX VITAMIN B-12 Protoporphyrinogen IX IOxidase (hemGi PROTOPORPHYRIN IX 1Ferrochelatase (hemH) 10 Steps HEME BACTERIOCHLOROPHYLL

Figure 1. Tetrapyrrole biosynthetic pathway of R. capsulatus.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. among the phototrophic bacterial groups and is probably the more primitive and

evolutionarily earlier pathway (12). First, the enzyme glutamyl-tRNA

synthetase links a tRNAGIU to the alpha-carboxyl group of glutamate through an

ATP and Mg2+ dependant ligation (221). Second, a NADPH-dependant

glutamyl-tRNA dehydrogenase reduces the tRNA bound glutamate to

glutamate-1-semialdehyde (11). Third, glutamate-1-semialdehyde

aminotransferase interchanges the positions of the nitrogen and oxygen atoms

on the glutamate-1 -semialdehyde through a pyridoxal phosphate dependant

transamination reaction to form 6-aminolevulinate. The C5 pathway for ALA

biosynthesis is utilized by the green sulfur bacteria Chlorobium vibrioforme

(242), the green nonsulfur bacteria Chloroflexus aurantiacus (224), the purple

sulfur bacteria Chromatium vinosum (225), the unicellular red algae Cyanidium

caldarium (303), cyanobacteria (75, 221, 241) and higher plants (24, 233). The

Cs pathway is also used by the non-chlorophyll containing organisms Bacillus

subtilis (220, 228), Clostridium thermoaceticum (226), Escherichia coli( 11,174,

220), Salmonella typhimurium (79), and the archaebacterium

Methanobacterium thermoautotrophicum (89).

The second ALA production pathway, called the C4 or the Shemin

pathway (153, 267), involves a one step reaction using the product of the

hemA gene, aminolevulinate synthase (EC 2.3.1.37). Glycine is first bound as

a Schiff-base to the pyridoxal phosphate cofactor of ALA synthase, to which a

succinate from succinyl-CoA is transferred. Subsequently C 02 is split off and

ALA is released from the enzyme. The C4 pathway first found in Rhodobacter

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sphaeroides (96, 153) is also utilized by humans (41), yeast (23), Rhizobium

(170), and other photosynthetic bacteria (12,231).

The protein ALA synthase has been highly purified and characterized

from R. sphaeroides. Initial studies found the enzyme to be a soluble protein

with a molecular mass of 57 to 61 kDa (299, 323), however the native enzyme

was later proven to be a homodimer with a molecular mass of 80 to 100 kDa

(82, 213). The Rhodopseudomonas palustris ALA synthase was found to be a

monomer with a native molecular mass of 61 to 65 kDa (295). The ALA

synthases purified from yeast (298) and rat liver (261) were found to have

similar characteristics to the R. sphaeroides enzyme. Inhibition studies done

on the R. sphaeroides ALA synthase have shown the enzyme is inhibited by

hemin and sulfhydryl reagents (46, 82, 299, 323). ATP was found to be a

strong inhibitor of the R. sphaeroides enzyme with 60 to 88 percent inhibition at

1 mM concentration (81). The existence of two distinct ALA synthases was

demonstrated in R. sphaeroides (82). It was reported that one form of ALA

synthase is cytoplasmic and is functionally associated with dark metabolism.

The other form of ALA synthase found in the chromatophores, could be

specifically induced by light and is functionally associated with

photometabolism. The two forms of the ALA synthase protein may be encoded

by different genes as mentioned below.

The hemA gene encoding ALA synthase has been cloned and

sequenced from many organisms. The hemA gene of R. capsulatus was

cloned using a cosmid that complemented a hemA:Tn5 mutant (33). The R.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. capsulatus hemA gene was later cloned and sequenced by probing a R.

capsulatus cosmid bank with the hemA gene from R. sphaeroides (113). The

R. capsulatus sequence predicts a 401 amino acid protein with a molecular

mass of 44.1 kDa. There have been two ALA synthase encoding genes

reported in R. sphaeroides with the second encoded by hemT (280). The two

genes hemA and hemT, which respectively are located on the large and small

chromosomes, express isozymes with 53% amino acid identity (216). Under

photosynthetic conditions, the R. sphaeroides hemA transcript levels are three

fold higher than under aerobic conditions, suggesting the hemA isozyme may

encode the ALA synthase associated with photometabolism (216). Currently

the hemT gene does not seem to be expressed under any physiological

conditions so far tested. The R. sphaeroides hemA sequence was 76%

identical to the R. capsulatus sequence, while only 50 to 76% identical to other

hemA genes sequenced. Other organisms utilizing the C4 pathway from which

the hemA gene has been sequenced include human (22), chicken (187),

mouse (260), yeast (291), Agrobacterium radiobacter (73), Rh'rzobium meliloti

(170), and Bradyrhizobium japonicum (196).

Porphobilinogen Synthase

The first monopyrrole in the common tetrapyrrole pathway,

porphobilinogen (PBG), is formed by the condensation of two ALA molecules

with the subsequent loss of two water molecules. This reaction is catalyzed by

the enzyme PBG synthase (ALA dehydratase) (EC 4.2.1.24), the product of the

hemB gene. PBG synthase from all sources examined has a native molecular

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mass of 250 to 320 kDa. PBG synthase was first purified from R. sphaeroides

(209, 211,212) and found to be a hexamer of 240 to 250 kDa that requires

thiols and K+ (110). Various metallic cations stimulated enzymatic activity and

16 pM protoheme inhibited 96% of the PBG synthase activity. The PBG

synthase from R. capsulatus was also found to be a hexamer of 260 kDa (209),

however, it was active without the addition of metallic cations and thiols.

Protoheme was not inhibitory (only 9% inhibition at 50 pM) to the R. capsulatus

enzyme. The PBG synthase has been purified from many plant sources

including spinach (177), maize (190), and radish (259), all of which have a

strict requirement for either Mg2+ or Mn2*. Many of the eukaryotic PBG

synthases have also been purified, such as cow liver (15), human erythrocytes

(5), mouse liver (56), and yeast (40). The eukaryotic enzymes all have a strict

requirement for Zn2+. The purified E. coli PBG synthase was found to be a

octamer with a native molecular mass of 290 kDa, with 36.5 kDa subunits, that

was dependant on thiols and Zn2+ (276). Suprizingly, the E. coli enzyme was

also found to be stimulated by Mg2+ (200). PBG synthase was

also purified from Mycobacterium phlei (316) and B. japonicum (229), both of

which required Mg2+.

The hemB gene coding for PBG synthase has been cloned and

sequenced from many organisms including animals, plants, yeast, and

bacteria. All sequences code for a putative protein of 35 to 45 kDa. The R.

capsulatus hemB gene sequenced by Indest and Biel was found to have a Mg2+

binding site but no Zn2+ site (120). The nucleotide sequence of the

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. R. sphaeroides hemB gene was determined and expressed in E. coli making a

39 kDa product (68). The sequence has also been determined for B. subtilis

(104), C. vibrioforme (240), Clostridium josui (94), cyanobacterium (128), E. coli

(74,175, 176), human (304, 305), the pea Pisium satvium (36), Pseudomonas

aeruginosa (88), spinach (258), Staphylococcus aureus (146), rat liver (35),

and yeast (208). All hemB sequences examined have 36 to 40% identity to

each other (176).

Porphobilinogen Deaminase

The first tetrapyrrole, uroporphyrinogen III, is formed by the sequential

action of two enzymes. Porphobilinogen deaminase (E.C. 4.1.3.8), the product

of the hemC gene, joins four PBG molecules together to form the linear

tetrapyrrole hydroxymethylbilane (preuroporphyrinogen) (16, 47, 80). The

released hydroxymethylbilane is cyclized to form uroporphyrinogen III by the

product of the hemD gene uroporphyrinogen III (co-)synthase (18). In the

absence of uroporphyrinogen ill synthase, hydroxymethylbilane spontaneously

cyclizes into the non-physiological isomer uroporphyrinogen I.

Some groups believe the enzymes PBG deaminase and

uroporphyrinogen III synthase exist as a complex called porphobilinogenase

(111). The two enzymes have been copurifed and the resultant mixture

characterized from avian erythrocytes (179), Euglena gracilis (248, 249), R.

palustris (144), soybean callus tissue (180), and yeast (6, 7). Jordan maintains

that these enzymes do not form a complex, but rather function independently

and sequentially (134).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The PBG deaminase, also called hydroxymethylbilane synthase or

uroporphyrinogen I synthase, has been extensively studied because of the

complexity of the enzyme conversion mechanism. The PBG deaminase

enzyme has been purified and characterized from E. coli (105,138), R.

sphaeroides (66, 137, 247) and R. palustris (157,158). The eukaryotic PBG

deaminases isolated include cow liver (252), human erythrocytes (4, 90, 201),

rat liver and spleen (195, 307), unicellular algae (143, 270, 308), and yeast

(60). Many plant PBG deaminases have also been purified, such as from A.

thaliana (131), P. satvium (275), spinach leaves (111), and wheat germ (91,

111, 250). The characterized PBG deaminases from most sources is a

monomer with a molecular mass of approximately 35 kDa. The only exception

is the R. palustris PBG deaminase, which had a native molecular mass of 74

kDa and may be a dimer (158). No characterized PBG deaminase requires

metal ions or other cofactors for activity.

PBG deaminase has been found to contain a dipyrromethane cofactor

essential for activity that is not turned over (139). The dipyrromethane cofactor

was subsequently found to be attached to the protein, via the sulfur of a

conserved cysteine residue in the active site (108, 109, 141,198). This same

dipyrromethane cofactor was found to be the site of attachment for the four

molecules of PBG during the catalytic cycle (262, 301). Being that the

dipyrromethane cofactor has the structure of two pyrrole units it was postulated

that the cofactor was synthesized from two PBG units. However, it has

recently been found that PBG deaminase can synthesize its own

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dipyrromethane cofactor from hydroxymethylbilane much faster than from PBG

(14, 272). PBG deaminase has been found to undergo large conformational

changes during the assembly of the four PBG subunits (300). The assembly of

the four PBG units occurs in a sequential order starting with ring A, followed by

rings B, C, and D (17, 263). Sequentially formed intermediate enzyme-

substrate complexes have been identified (26, 60, 133) and purified (4).

Many sites in the PBG deaminase enzyme have been found to be vital

for activity. Pyridoxal phosphate has been found to inhibit the enzyme by

modifying lysines (100, 107,199). Conserved arginine residues have been

found to be involved in binding the carboxylate side chains of the

dipyrromethane cofactor and the growing oligopyrrole chain (162). Site

directed mutagenesis of the arginine residues affected dipyrromethane cofactor

assembly and tetrapyrrole chain initiation and elongation (142). An aspartate

near the active site was found to play a key role in catalysis. When substituted

with a glutamate, the was reduced by two orders of magnitude (309).

The X-ray crystal structure has been determined for the E. coli PBG

deaminase under oxidized conditions (140, 181) and again under reduced

conditions (101). The enzyme has three flexible domains with a single active

site in between. The dipyrromethane cofactor is covalently attached to domain

3 and it sticks into the cleft between domains 1 and 2 (181). Comparison of the

structure and ligand showed that the E. coli PBG deaminase is very similar to

transferrin, maltose-binding protein, and the sulfate and phosphate binding

proteins (227). Comparison of the crystal structures has shown the cofactor

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. moves in position depending upon the redox conditions of the crystals. Under

reduced conditions the cofactor occupies a position near the rear of the active

site, while under oxidized conditions the cofactor is found in the active site

occupying a position postulated to be a substrate binding site (161).

The hemC gene encoding PBG deaminase has been cloned and

sequenced from many sources including A. thaliana (178), B. subtilis (104), C.

josui (94), C. vibrioforme (189, 202), E. gracilis (265), E. coli (2, 285), human

erythrocytes (239), mouse (25), P. aeruginosa (204), rat cDNA (279), S. aureus

(145), and yeast (152). All hemC sequences code for a putative protein of 33

to 37 kDa.

Uroporphyrinogen III Synthase

The linear tetrapyrrole hydroxymethylbilane released from PBG

deaminase is cyclized by the enzyme uroporphyrinogen III (co-)synthase (EC

4.2.1.75) to form the first intermediate with a tetrapyrrole macrocycle,

uroporphyrinogen III. During the cyclization, hydroxymethylbilane goes through

a spiro-intermediate to invert ring D (62, 169). Without uroporphyrinogen III

synthase present, the hydroxymethylbilane spontaneously cyclizes into the

non-physiological isomer uroporphyrinogen I. The presence of the

uroporphyrin III synthase enzyme has been found to facilitate the release of

tetrapyrrole product from the PBG deaminase (247).

The purification of uroporphyrinogen ill synthase has proved difficult

because of the extreme heat sensitivity of the enzyme. The synthase is

incapable of forming uroporphyrinogen III from PBG or uroporphyrinogen I (37).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. It was shown that Chlorella extracts heated to 55°C prior to incubation with

PBG would only form the uroporphyrinogen I isomer (39). The

uroporphyrinogen III synthase has been characterized from many sources

including B. subtilis (277), cow liver (252), E. coli (3, 62), E. gracilis (107),

human erythrocytes (290), mouse spleen (172, 173), and rat liver (274). All of

the uroporphyrinogen III synthase enzymes have a molecular mass of 28 to 32

kDa. The enzyme has no metal or cofactor requirements, yet is sensitive to

both lysine and arginine modifying agents.

The gene coding for uroporphyrinogen III synthase, hemD, has been

sequenced from many organisms. The E. coli hemD and hemC exist in an

operon (2,135, 136, 256). HemD is expressed from the same promoter as

hemC, with hemC being transcribed first. It is proposed this coordinate

expression oihem C and hemD exists to avoid accumulation of porphyrins.

The hemD gene has also been sequenced from S. subtilis (104), C. josui (94),

C. vibrioforme (202), cyanobacterium (128), human (289), P. aeruginosa (204),

and S. aureus (145). All of the genes coded for a putative protein of 27 to 29

kDa.

Uroporphyrinogen III Decarboxylase

The intermediate uroporphyrinogen III is located at a branch point in the

common tetrapyrrole pathway. A small quantity of uroporphyrinogen III is

methylated, committing it to siroheme and vitamin B12 biosynthesis. The

majority of uroporphyrinogen III is decarboxylated into the product

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. coproporphyrinogen ill, which eventually is converted into heme or

bacterioch lorophyl I.

Uroporphyrinogen III decarboxylase (EC 4.1.1.37) catalyzes the removal

of four molecules of C02 from the acetic acid side chains of uroporphyrinogen

III to form coproporphyrinogen III (76). Intermediates containing 5, 6, and 7

carboxylic acid groups have been isolated, indicating that the decarboxylation

of uroporphyrinogen III occurs in a sequential manner (112,194). At

physiological substrate concentrations the decarboxylations start on ring D of

uroporphyrinogen III and continue in a clockwise fashion (182). The

decarboxylation becomes random when higher substrate levels are present

(182).

Uroporphyrinogen III decarboxylase has been purified from R.

sphaeroides (132) and R. palustris (156). The protein has also been purified

from many eukaryotes including avian erythrocytes (150), bovine liver (278),

human erythrocytes (77, 293), tobacco leaves (52), and yeast (83). All

uroporphyrinogen decarboxylases examined are monomers of 38 to 46 kDa,

except the bovine (57 kDa) and avian (79 kDa) decarboxylases. Unlike most

decarboxylases, the uroporphyrinogen decarboxylase has no metal or

coenzyme requirements. The recently determined crystal structure of the

human erythrocyte uroporphyrinogen decarboxylase shows a 40.8 kDa protein

with a single domain that exists as a dimer in solution (306).

The hemE gene that encodes uroporphyrinogen III decarboxylase has

been cloned and sequenced from R. capsulatus by Ineichen and Biel (122).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The sequence is also available from B. subtilis (103), E. coli (217), human (243,

246), mouse (311), rat (244, 245), yeast (69, 95), tobacco and barley (203). All

of the hemE sequences code for a putative peptide of 40 to 44 kDa in size.

Coproporphyrinogen III Oxidase

The enzyme coproporphyrinogen III oxidase (EC 1.3.3.3) oxidatively

decarboxylates coproporphyrinogen III to form protoporphyrinogen IX. The

enzyme converts the two propionic sidechains on rings A and B of

coproporphyrinogen III into vinyls, releasing two molecules of COz and two H+

atoms, producing protoporphyrinogen IX. Intermediates with one vinyl group

and three carboxylic acid groups have been identified (232, 254). The side

chains are converted in a sequential manner with the 2-propionic acid side

chain of coproporphyrinogen III being converted to the vinyl group before the

4-propionic acid group is modified (51).

Coproporphyrinogen oxidases from aerobic organisms, prokaryotic and

eukaryotic, have a strict requirement for oxygen. Extracts from aerobically or

anaerobically grown R. sphaeroides have a coproporphyrinogen oxidase

activity (282). The aerobic activity was localized to the supernatant, while the

anaerobic activity was found to need both the pellet and supernatant fractions.

The aerobic activity, which used 0 2 as an electron acceptor, was purified and

found to have a molecular mass of 44 kDa (281). The anaerobic activity, which

used NAD or NADP as the electron acceptor, required

5-andenosyl-L-methionine (SAM) or L-methionine, ATP and Mg2+, suggesting

that SAM is a cofactor (281). The anaerobic extracts of yeast (236) and B.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. japonicum (151), have similar requirements as the R. sphaeroides enzyme.

The R. sphaeroides aerobic and anaerobic coproporphyrinogen oxidase

mechanisms were studied using stereospecifically-labeled porphobilinogen

(264). Both the aerobic and anaerobic activities were able to oxidize

coproporphyrinogen III into protoporphyrinogen IX. This led to the postulation

of a branch in the common pathway separating heme and bacteriochlorophyll

synthesis at the level of coproporphyrinogen III oxidase (58). Purification of

coproporphyrinogen III oxidase from yeast (48) and bovine liver (155, 318)

found the enzyme to be a 70 to 75 kDa homodimer.

The first gene cloned and sequenced that encoded coproporphyrinogen

III oxidase was HEM13 obtained from yeast (324). In R. sphaeroides, a gene

was cloned and sequenced that when overexpressed in E. coli causes

increased coproporphyrinogen oxidase activity (58). The gene product was a

protein of 34,185 Da with 44.7% similarity to the yeast protein. If the gene was

disrupted, R. sphaeroides cells were unable to form bacteriochlorophyll under

anaerobic conditions. It was proposed that the gene product is an anaerobic

coproporphyrinogen oxidase dedicated to bacteriochlorophyll synthesis. In E.

coli and S. typhimurium two gene sequences encoding a coproporphyrinogen

III oxidase, hemF and hemN, have been identified. Anaerobic heme synthesis

required hemN function, while either hemN or hemF was sufficient for aerobic

heme synthesis (287, 313). The S. typhimurium hemF sequence codes for a

putative protein of 34.4 kDa and is 44% identical to the yeast sequence (315).

The hemN gene of S. typhimurium codes for a putative protein of 52.8 kDa,

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. which is 38% identical to the R. sphaeroides enzyme (314). The E. coli hemF

sequence codes for a putative protein of 34.3 kDa, with 43% identity to the

yeast enzyme and 90% identical to the S. typhimurium hemF sequence (288).

The E. coli hemN sequence codes for a putative protein of 52.8 kDa that is

92% identical to the S. typhimurium hemN and 35% identical to the R.

sphaeroides sequence (287). Using the amino acid sequence of the bovine

liver coproporphyrinogen III oxidase as a probe, a mouse cDNA library was

probed and the sequence of the mouse hemF determined (155). The mouse

hemF sequence is 52% identical to the yeast HEM13 sequence. The human

placental hemF sequence coding for a protein of 36.8 kDa is 86% identical to

the mouse sequence (283). The hemF sequence has also been determined

from the plant sources tobacco and barley, each coding for proteins of

approximately 39 kDa (160). No hemN sequence has been found in any of the

eukaryotic sources which only grow aerobically.

Protoporphyrinogen IX Oxidase

The ultimate reaction of the common tetrapyrrole pathway is catalyzed

by the membrane bound protoporphyrinogen IX oxidase (EC 1.3.3.4), which

removes six hydrogens from the protoporphyrinogen IX ring to form

protoporphyrin IX. The first characterized protoporphyrinogen IX oxidase, from

yeast mitochondria, required 0 2 as an electron acceptor, had a molecular mass

of 180 kDa and was sensitive to hemin (50% at 20 pM) (237). The E. coli

protoporphyrinogen IX oxidase was the first that demonstrated the ability to

carry out an anaerobic oxidation process using fumarate instead of oxygen as

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the physiological electron acceptor (125). Nitrate was also found to work for

anaerobic oxidation, but not as effectively as fumarate (126). They reported

the protoporphyrinogen IX oxidase in anaerobic E. coli extracts to be 90%

inhibited by 2-heptyl-4-hydroxyquinoline-N-oxide, a quinine inhibitor,

suggesting the enzyme may be linked to quinone in the anaerobic electron

transport chain.

The protoporphyrinogen IX oxidase of R. sphaeroides was found in the

membrane fractions of aerobically and photosynthetically grown cells (127).

Interestingly, this enzyme was not able to use Oz directly as an oxidant. The

protoporphyrinogen oxidation was found to be strongly inhibited by cyanide

and azide, suggesting the R. sphaeroides enzyme is coupled to the electron

transport system. When the quinones were extracted, 80% of the

protoporphyrinogen oxidase activity was inhibited, yet only minor inhibition was

seen with 2-heptyl-4-hydroxyquinoline-N-oxide. These results are much

different from those seen in R. capsulatus where protoporphyrinogen IX

oxidation was not inhibited by cyanide or azide, but strongly inhibited by

2-heptyl-4-hydroxyquinoline-N-oxide (R. Cardin and A. Biel, unpublished

results).

The membrane bound protoporphyrinogen IX oxidase of the anaerobic

bacterium Desulfovibrio gigas was purified and found to have a native

molecular mass of 148 kDa (154). When solubilized with detergent, three

nonidentical subunits with molecular masses of 12,18.5, and 57 kDa were

revealed, which could be linked by sulfhydryl bonds to form a hexamer. The D.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. gigas enzyme was found to have no aerobic activity and could donate electrons

to 2,6-dichlorophenol-indophenol but not to NAD, NADP, FAD, or FMN. The

natural electron acceptor was not identified. The protoporphyrinogen IX

oxidase has also been purified from the eukaryotic sources of mammalian

mitochondria (235), mouse liver mitochondria (63, 84), and bovine liver (273).

All of these eukaryotic proteins were found to be monomers of 57 to 65 kDa.

The bovine enzyme was unique in that it was found to be associated with FAD

or FMN. The protoporphyrinogen IX oxidase has been purified from plants

(123) such as barley, where it is a chloroplast associated enzyme with a

molecular mass of 210 kDa, composed of 36 kDa subunits (124). In contrast

to other protoporphyrinogen IX oxidases, the B. subtilis enzyme was found to

be a soluble enzyme of 52 kDa (64).

The hemG gene encoding the enzyme protoporphyrinogen IX oxidase

has been sequenced from A. thaliana (214), B. subtilis (64,102,103), E. coli

(255), human (218), and tobacco (171). All of the hemG sequences code for a

protein with predicted molecular mass of 50 to 57 kDa except for the E. coli

sequence which codes for a protein of only 21,202 Da.

The tetrapyrrole protoporphyrin IX resides at the second branch point of

the common tetrapyrrole pathway. Insertion of a magnesium ion (Mg2+) into the

protoporphyrin IX ring, a reaction catalyzed by a magnesium chelatase,

commits the product to bacteriochlorophyll synthesis. If a ferrous iron (Fe2+) is

incorporated into the protoporphyrin IX ring, the product is committed to heme

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. biosynthesis. The enzyme ferrochelatase (EC 4.99.1.1) catalyzes the insertion

of Fe2+ into protoporphyrin IX to form protoheme.

Tetrapyrrole Biosynthesis Regulation

R. capsulatus, like other phototrophic organisms, is able to regulate the

content and composition of its tetrapyrroles. The four tetrapyrrole end products

formed by R. capsulatus serve very different functions. For this reason, the

common tetrapyrrole pathway can be expected to have many complex

regulatory mechanisms. In the last three decades serious efforts have been

made to determine how various environmental factors influence tetrapyrrole

biosynthesis. To date three environmental factors have been shown to

influence the levels of the tetrapyrrole end products: light, heme, and oxygen.

The environmental factors can cause many changes in the R. capsulatus

cell structure. While aerobically grown R. capsulatus has a membrane

structure that is morphologically and functionally like that of a Gram negative

cell, when oxygen tensions are lowered below 2.5% many changes start

occurring in the R. capsulatus cell. An extensive series of invaginations of the

cytoplasmic membrane develops as well as induction of the photosynthetic

apparatus, bacteriochlorophyll and carotenoids. Each photosynthetic

apparatus is composed of three distinct protein complexes that convert light to

chemical energy. Two light-harvesting complexes LH-I (B870) and LH-II

(B800-B850) absorb visible and near-infrared radiation and transfer the energy

to the reaction center complex. The reaction center is where photochemical

charge separation occurs transferring electrons through the electron transport

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. system, which produces a transmembrane potential that drives ATP synthesis.

Each component of the photochemical apparatus has bacteriochlorophyll and

carotenoids attached. Most of the R. capsulatus bacteriochlorophyll genes

(bch), which encode enzymes responsible for converting Mg-protoporphyrin

into bacteriochlorophyll, were identified by complementation of bch mutants

with R’-plasmids carrying various bacteriochlorophyll genes (191). Eventually

a physical map was created localizing the bacteriochlorophyll and carotenoid

genes (284). The R. capsulatus bch and the carotenoid biosynthetic genes

(erf) were found to be clustered in a 46 kb region of the genome referred to as

the photosynthetic gene cluster (322, 326). Within this region two operons

were identified, the puh operon encoding the polypeptides of the light-

harvesting complex I and the puf operon encoding the reaction center

polypeptides (319). The genes of the puc operon, encoding the light-

harvesting complex II polypeptides, were not localized within the

photosynthetic cluster (321). The entire R. capsulatus photosynthetic gene

cluster has been sequenced (1, 320). The many complex regulatory circuits

controlling photosynthetic gene expression have recently been reviewed by

Bauer (19).

The influences of light on pigment synthesis were initially studied by

Cohen-Bazire (55) in R. sphaeroides. Highly illuminated photosynthetically

grown cultures of R. sphaeroides were found to contain low levels of

bacteriochlorophyll and carotenoids, while dimly lit cultures contained cells

packed with membranes and large amounts of photopigment per cell mass. No

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. matter what the initial pigment concentration, the same steady state of

bacteriochlorophyll synthesis was eventually established at any given light

intensity (55). Influences of light on enzymes of the common pathway was

demonstrated on ALA synthase and PBG synthase, which were both found to

be four to five fold more active in cultures grown anaerobically in the light than

aerobically in the dark (164). In R. palustris the enzymatic levels of ALA

synthase were also higher in anaerobic light grown cells compared to cells

grown aerobically in the dark (294). In contrast to these results, Oelze and

Arnheim (223) using chemostat cultures of R. sphaeroides, found light had no

significant effect on ALA synthase, although it clearly regulated

bacteriochlorophyll levels. Oelze (222) later found bacteriochlorophyll, LH-I

and LH-II complex levels reduced 50% by high light intensity. The assumption

was that light somehow regulates bacteriochlorophyll synthesis. Evidence that

this assumption was incorrect was provided by Biel (28) who found that light

regulates the degradation of bacteriochlorophyll. Light was found to have no

effect on the transcription of many oxygen-regulated bacteriochlorophyll genes

of R. capsulatus (31). The R. capsulatus genes for light-harvesting antenna I

proteins LH-I and LH-II; the reaction center proteins L, M, and H; and

bacteriochlorophyll and carotenoid biosynthesis were shown by dot-blot

analysis to be repressed by high light (325). Recently, the trans-acting

regulator gene, hvrA, was discovered in R. capsulatus that activates LH-I and

reaction center gene expression (not LH-II or bacteriochlorophyll expression) in

response to reductions in light intensity (45).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. The c-type cytochromes have historically been implicated to influence

carbon flow down the common tetrapyrrole pathway. This was based on the

fact that c-type cytochrome mutants accumulate photopigments (65,159). The

Tn5 insertion mutant AJB530, isolated by Biel and Biel (32), was found to have

a disruption in the gene encoding cytochrome c synthetase which completely

stopped c-type cytochrome biosynthesis. This mutant made only 19% of the

normal amount of bacteriochlorophyll, but accumulated 18-fold more

coproporphyrin and nine-fold more protoporphyrin. When the total porphyrin

levels (bacteriochlorophyll, coproporphyrin, and protoporphyrin) were

examined, they were found to be the same in wild-type PAS100 and the mutant

AJB530, indicating c-type cytochromes have no influence on carbon flow over

the pathway (116).

Heme has been shown to inhibit many enzymes of the common

tetrapyrrole pathway. The R. sphaeroides ALA synthase was found to be

inhibited in vitro by hemin (iron-protoporphyrin) and a possible negative

feedback mechanism was proposed (46). This in vitro inhibition of the R.

sphaeroides ALA synthase by hemin was confirmed in many other studies: 1)

57% inhibition by 5 pM hemin (299), 2) 50% by 0.4 pM hemin and 50%

inhibition with 2.2 pM Mg-protoporphyrin and 30 pM protoporphyrinogen (323),

and 3) complete inhibition by 0.1 mM hemin (82). The PBG synthase of R.

sphaeroides was also found to be inhibited by hemin, with 50% inhibition

occurring at 40 pM (46, 209). Interestingly, the R. capsulatus PBG synthase

was found to be insensitive to hemin (210). The R. sphaeroides enzyme,

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. uroporphyrinogen III decarboxylase, has been shown to be slightly inhibited by

hemin, with 20% inhibition occurring at 8 pM (132). Unfortunately, higher

concentrations of hemin were not tested. The R. sphaeroides ferrochelatase

was also found sensitive to hemin with 50% inhibition occurring at 10 pM (129).

To elucidate the manner in which heme regulates tetrapyrrole

biosynthesis, cells were fed various levels of heme and the production of

various tetrapyrroles monitored. Lascelles (166) found that the addition of

ferric citrate to R. sphaeroides cultures reduced porphyrin formation 100-fold,

while increasing the bacteriochlorophyll formation eight to ten fold. R.

capsulatus cell suspensions grown photosynthetically in iron-deficient media

accumulated large amounts of coproporphyrin and Mg-protoporphyrin

monomethyl ester, while synthesizing less than half the normal amount of

bacteriochlorophyll (59). Using a more specific method for producing heme

deficient cells, R. capsulatus and R. sphaeroides cell suspensions were

incubated in media supplemented with iron and the ferrochelatase inhibitor,

N-methylprotoporphyrin. In both species the production of Mg-protoporphyrin

monomethyl ester was increased, while bacteriochlorophyll levels were not

changed (115, A. Biel, unpublished results). Overall the heme deficient cell

seems to have a higher level of carbon flow over the tetrapyrrole pathway.

This has been attributed to the lack of feedback inhibition by heme on ALA

synthase. This regulation was simulated in vivo by overexpressing a low copy

number vector containing the hemH gene of R. capsulatus. This

overexpression of ferrochelatase, by the hemH gene, caused increased heme

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. formation which inhibited the ALA synthase activity subsequently reducing the

synthesis of porphyrins (147). In R. capsulatus the regulation of tetrapyrrole

biosynthesis by heme was found to be separate from that exerted by oxygen

(149).

Oxygen shows the greatest influences over the common tetrapyrrole

pathway of R. capsulatus. Initial studies by Cohen-Bazire showed the

synthesis of carotenoids and bacteriochlorophyll was rapidly inhibited by

molecular oxygen (55). They proposed the regulation by oxygen comes from

the redox conditions of some carrier of the electron transport system, which

could influence bacteriochlorophyll synthesis. When the influences of oxygen

on the hemoprotein content of cells was examined it was found to be two to

three times higher in cells grown anaerobically in the light rather than that of

aerobically grown organisms (234). Examination of bacteriochlorophyll

mutants revealed that tetrapyrroles only accumulated when cells were grown

anaerobically (163). When the levels of the tetrapyrroles were quantified in R.

sphaeroides, anaerobically grown cells made 25 nmoles of bacteriochlorophyll

per mg of dry weight, 0.3 nmoles heme per mg dry weight, and 0.07 nmoles of

vitamin B12 per mg of dry weight, while aerobically grown cells produced no

bacteriochlorophyll yet the same amounts of heme and vitamin B12 (165). This

regulation over bacteriochlorophyll levels by oxygen was found to work

independently from the light regulation (10). Biel and Marrs (31) analyzed the

transcription of several R. capsulatus bacteriochlorophyll genes using lacZ

fusions. They found transcription to increase two to three fold with a drop of

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. oxygen tension from 23% to 2%. Analysis of R. capsulatus and R. sphaeroides

mRNA transcript levels of the bch genes also revealed transcription increases

two to three fold upon anaerobisis (53,118). The regulation of carotenoids by

oxygen is different than that influenced on bacteriochlorophyll. Biel and Marrs

found oxygen doesn't directly regulate the production of certain carotenoids

(30). Yet examination of the transcription of the crt genes, by lacZ fusions and

by looking at mRNA transcript levels, found all synthesis to increase 2 to 12

fold upon anaerobisis (9).

A novel regulatory factor, synthesized as the product of the pufQ gene

located at the 5' end of the puf operon, was found to influence

bacteriochlorophyll synthesis. Using a pufQ-lacZ fusion, pufQ synthesis was

found to be 30-fold regulated by oxygen and to be essential for

bacteriochlorophyll synthesis (21). A linear relationship exists between pufQ

and bacteriochlorophyll synthesis, which has led to speculation that the PufQ

protein may function as a carrier for intermediates in bacteriochlorophyll

synthesis (20). PufQ purified from R. capsulatus was found to be a integral

membrane protein (86, 87). The PufQ protein has been found to effect the

early steps in the common tetrapyrrole pathway synthesis somewhere in the

conversion of porphobilinogen to coproporphyrinogen III. It was found that

PBG deaminase activity was two-fold higher when pufQ was present (85).

Lascelles and Hatch (168) proposed a model for the mechanism of the

regulation of bacteriochlorophyll synthesis by oxygen. They proposed the

magnesium and iron branches of the biosynthetic pathway compete for

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protoporphyrinogen IX. They suggested oxygen inhibits magnesium chelation

into the protoporphyrin IX ring. This would lead to a larger protoporphyrin IX

pool, which ferrochelatase makes into heme. The heme then feedback inhibits

ALA synthase thus slowing carbon flow over the pathway. Biel and Marrs (31)

verified that oxygen regulates the synthesis of protoporphyrin IX using a R.

capsulatus bchH mutant, which cannot insert magnesium into protoporphyrin

IX. The accumulation of protoporphyrin IX by the mutant was measured under

high and low oxygen tensions. In the bchH mutant there was a dramatic

increase in protoporphyrin IX levels under low oxygen tension compared to

high oxygen tensions.

Oxygen has been found to exert influences at many steps of the

common pathway. In R. sphaeroides the ALA synthase activity increased four

to five fold upon a shift from high to low oxygen (164, 223) and it was later

found that oxygen regulates the transcription of hemA (165). Northern analysis

of the hemA and hemT transcripts in R. sphaeroides showed both transcripts

are expressed three times higher under anaerobic rather than aerobic

conditions (215). In R. capsulatus there is no evidence of ALA synthase

activity regulation by oxygen (A. Biel, unpublished results). Examination of

hemA transcription in R. capsulatus by use of a hemA-lacZ fusion showed

promoter activity increased of two to three fold after reducing oxygen tension

(114, 310). These small changes are not enough to explain the dramatic

increase in tetrapyrrole synthesis during photosynthetic growth.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Evidence that the major step regulated by oxygen is after ALA synthesis,

came when the addition of exogenous ALA given to a R. capsulatus bchH

mutant did not alter the accumulation of protoporphyrin IX under anaerobic

conditions (29). Therefore, a R. capsulatus bchH mutant was grown with

exogenous PBG under high and low oxygen tensions. This resulted in the

accumulation of protoporphyrin IX under all oxygen conditions, suggesting that

PBG disrupted oxygen-mediated control of the common tetrapyrrole pathway.

It was concluded that oxygen regulates PBG levels and that perhaps ALA is not

the committed precursor to tetrapyrroles (29).

In R. capsulatus there exists considerable evidence that indicates ALA is

not committed to tetrapyrrole synthesis. Feeding [14C]-aminolevulinate to R.

capsulatus cells led to 85% of the radioactivity being distributed to other

compounds than tetrapyrroles (A. Biel, unpublished results). In a similar study

[14C]-aminolevulinate was fed to Rhodospirillum rubrum and the radioactivity

was found in tetrapyrroles as well as in aminohydroxyvalerate,

hydroxyglutamate, and glutamate (269). Recently in R. capsulatus an ALA

dehydrogenase activity, which converts ALA to aminohydroxyvalerate in the

presence of NADPH, was detected (A. Khanna and A. Biel, unpublished

results). All of these facts provide substantial evidence for ALA not being a

committed precursor to tetrapyrrole biosynthesis.

Realizing ALA is not the major control point by oxygen, the influence of

oxygen over porphobilinogen synthesis was examined. R. sphaeroides

cultures were shown to have a lower PBG synthase activity in anaerobic

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. cultures (268). Using a ftemB-chloramphenicol acetyltransferase fusion vector

and northern analysis of the R. capsulatus hemB gene, no transcriptional

regulation was seen by oxygen (119). Overexpression of the R. capsulatus

hemB gene in the bchH mutant showed similar results to those seen when

exogenous PBG was added (119).

The goal of the present study was to further investigate how

porphobilinogen is involved in the oxygen regulatory scheme of tetrapyrrole

biosynthesis. To achieve this goal, the enzyme porphobilinogen deaminase

was purified from R. capsulatus and characterized. The N-terminal sequence

of the protein was used to clone the R. capsulatus hemC gene. Sequencing of

the hemC gene revealed the R. capsulatus hemC and hemE are divergently

transcribed. The hemC gene was overexpressed in E. coli and R. capsulatus.

The transcription of the hemC gene was measured by monitoring the

chloramphenicol acetyltransferase activity of a hemC-cat fusion vector.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. MATERIALS AND METHODS

Strains and Plasmids

Bacterial strains and plasmids used in this study are listed in Tables 1

and 2.

Media

E. coli was grown in L-Broth (27) modified by decreasing the sodium

chloride concentration to 0.5% and omitting glucose. R. capsulatus was

routinely grown in either RCV, a malate minimal salts medium (302), or in 0.3%

Bacto Peptone-0.3% Yeast Extract (PYE) (Difco Laboratories, Detroit, Ml).

Solid media contained 1.5% agar (Difco). Antibiotics and other supplements,

when necessary, were added to the following concentrations (pg/ml):

ampicillin, 250; chloramphenicol, 25; kanamycin, 10; streptomycin, 75;

tetracycline, 10 (E. coli) and 0.4 (R. capsulatus); IPTG (isopropyl-p-D-

thiogalactopyranoside), 5; X-gal (5-bromo-4-chloro-3-indolyl-p-D-

galactopyranoside), 40. Strains of both E. coli and R. capsulatus were stored

in 10% glycerol at -85°C.

Growth Conditions

E. coli and R. capsulatus strains were routinely grown aerobically in the

dark with shaking at 37°C. R. capsulatus was also grown anaerobically, in the

light, in completely filled Vacutainer tubes incubated in front of 100W light

bulbs at 30°C, and anaerobically, in the dark, in completely filled Vacutainer

tubes in RCV-media supplemented with 0.25% glucose and 20 mM dimethyl

sulfoxide. When growth of R. capsulatus under defined oxygen tension was

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 1. Strains used in this study.

Designation Genotype Reference E. coli

NM522 A/Jsd5(rk'mk+) supE thi-1 a (lac- Gough and Murray (98) proAB) F’tproAB /aclqZAM15] HB101 ara 14 galK2 /jsdS20(rBmB+) Boyer and Roulland- /acY1 leuB6 mtl-1 proA2 recA13 Dussoix (42) rpsl_20 supE44 f/?/-1 xyl-5 A(mcrC-mrr) F' MC1061 araD139 ga/KgalU /7sdR2(rk'mk+) Cassadaban and Cohen rpsLthi-'\ A(ara-/etv)7696 (49) A/acX74 R. capsulatus PAS100 /?sd-1 sfr-2 Taylor et al. (284) SB1003 nf-10 Yen and Marrs (317)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 2. Plasmids used in this study.

Plasmid Relevant Reference or Description Characteristics PBR322Q ApR, TcR, SmR, SpcR Omega cartridge cloned from pHP45Q (238) into EcoRI site of pBR322. pCM4 ApR, TcR, cat* Close and Rodriguez (54) PRK2013 mob', tra\ KnR Ditta et al. (71) PRK404 mob*, Plac, TcR Ditta et al. (70) pUC18 P,ac.ApR Vieria and Messing (296) pUC19 P,ac.ApR Vieria and Messing (296) PCAP145 TcR, SmR, SpcR Omega cartridge cloned from pBR322Q into the Hindlll site of pRK404 (This study) pCAP153 TcR, CmR, c a t cat gene cloned into pRK404 (121) PCAP154 ApR 4 kb R. capsulatus genomic BamHI fragment in pUC18 (This study) PCAP155 ApR 2 kb R. capsulatus genomic EcoRI fragment in pUC18 (121) PCAP167 ApR 2.1 kb EcoRI fragment removed from pCAP154 (This study) PCAP168 ApR 0.5 kb Hincll-EcoRI fragment of pCAP155 in pUC18 (This study) PCAP169 ApR 3 kb Hindi fragment removed from pCAP154 (This study) PCAP171 mob*, TcR 1 kb Hindlll-BamH! fragment of pCAP169 cloned into pRK404 (This study) (Table 2 continued)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. pCAP172 mob*, TcR 1.3 kb Pstl-BamHI fragment of pCAP154 cloned into pRK404 (This study) a. < PCAP175 Q. 1.3 kb Pstl-BamHI fragment of pCAP154 cloned into pUC19 (This study) pCAP176 ApR, CmR, hemCrcat* Chloramphenicol gene from pCM4 cloned into Beil site of pCAP175 (This study) pCAP178 ApR 1 kb Hindlll-BamHI fragment of pCAP169 cloned into pUC19 (This study) pCAP182 mob*, TcR, SmR, 2.3 kb Pstl-BamHI fragment of hemCr.cat* pCAP176 containing hemCrcat* cloned into pCAP145(This study)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. required, a 10 ml overnight culture was subcultured into 100 ml of media in a

100 ml graduated cylinder at an initial Klett (red filter) value of approximately

ten and incubated in a 37°C water bath for four generations under high or low

oxygen tension. Low oxygen tension was obtained by sparging the culture with

a mixture of 3% oxygen, 5% carbon dioxide, and 92% nitrogen. High oxygen

tension was obtained by sparging the culture with compressed air

supplemented with 3% oxygen, resulting in an initial oxygen tension of 23%.

Protein Determination

The protein concentrations in cell extracts used for various enzyme

assays were determined using the BioRad Protein assay (BioRad Laboratories,

Hercules, CA) which is based on the method of Bradford (43). Purified bovine

serum albumin (BSA) was used to create a protein standard curve with

concentrations between 10 and 50 pg per 100 pi total volume. The cell extract

to be tested for protein concentration was also diluted in a 100 pi total reaction

volume in a separate tube. Five milliliters of a one-fifth dilution of BioRad Dye

Concentrate was added to each tube and the mixture was vortexed. After five

minutes incubation at room temperature the absorbance at 595 nm was

recorded. The protein concentration of the cell extract was determined by

comparison to the BSA standard curve.

Porphobilinogen Deaminase Assay

R. capsulatus was grown in 200 ml of PYE until late log phase then

harvested by centrifugation in a Sorvall RC-5B Refrigerated Superspeed

Centrifuge (Sorvall, Inc., Newton, CT) at 5,900 x g in the Sorvall GSA rotor for

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ten minutes. The cell pellet was resuspended in 4 ml of 0.1 M Tris-CI, pH 8.0

and sonicated four to six times for 20 seconds with at least 30 seconds cooling

between bursts using the Sonicator Ultrasonic Processor, Model W-200 fitted

with the Sonicator Ultrasonic Convertor, Model C-2 (Heat Systems-Ultrasonics,

Inc., Farmingdale, NY). The sonicated cells were then centrifuged in the

Sorvall SS34 rotor at 27,000 x g for 20 minutes. The cleared cell extract was

stored at 4°C for two hours before assaying and could be stored at -20°C for

extended periods of time. Porphobilinogen deaminase was assayed either by

following the disappearance of the substrate porphobilinogen (PBG) or by

measuring the formation of uroporphyrinogen I (Uro-I). The assay mixture

contained 50 mM Tris-CI, pH 8.0, 0.2 mM porphobilinogen (Porphyrin Products,

Logan, UT) and enzyme, in a total volume of 1 ml. The reaction was incubated

at 37°C. At intervals aliquots were removed for monitoring PBG usage and

Uro-I formation. To assay the disappearance of PBG, aliquots of 100 pi were

transferred into 1.4 ml of 10% trichloroacetic acid. One and a half milliliters of

Modified Ehrlichs' reagent (193) was added and the absorbance measured at

554 nm in a Perkin-Elmer Lambda 3B UVA/IS spectrophotometer (Perkin-Elmer

Corp., Norwalk, CT) after incubation at room temperature for ten minutes. To

assay the Uro-I formed, aliquots of 200 pi were pipetted into 2 ml of 1N HCI

containing 0.01% l2. After 20 minutes incubation in the dark to oxidize the

uroporphyrinogen I to uroporphyrin I, the iodine was reduced by adding 1.8 ml

of 0.1% Na2S2Os. The fluorescence was then measured using an excitation

wavelength of 403 nm and an emission wavelength of 596 nm in a Perkin-

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Elmer LS-3 Fluorescence Spectrophotometer (Perkin-Elmer Corp., Norwalk,

CT). The fluorescence value was used to determine the uroporphyrin I

concentration by comparison to a standard curve prepared using uroporphyrin I

standards (Porphyrin Products, Logan, UT). This assay procedure is based

upon the procedure used by Jordan and Shemin (137).

When the porphobilinogen deaminase was assayed under the same

conditions as the cells were grown, a different procedure was used to make the

extracts. The R. capsulatus cultures were grown aerobically under the defined

high oxygen tension. The R. capsulatus cultures were grown anaerobically by

photosynthesis or anaerobic respiration as mentioned above. The cells were

pelleted by centrifugation in a bench-top centrifuge for one hour. The

supernatant of the aerobic cultures was decanted. The supernatant of the

anaerobic cultures was sucked from the anaerobic Vacutainer tubes with a

syringe, while adding argon gas. The cell pellets were resuspended in 1 ml of

degassed 0.1 M Tris-CI, pH 8.0, added using a syringe. To break open the

cells, 20 pi of a 10 mg per ml lysozyme solution was added using a Hamilton

syringe and the suspension was swirled gently for 15 minutes at room

temperature. These aerobic and anaerobic extracts were then assayed as

described earlier. The anaerobic porphobilinogen deaminase assays were

done in 3 ml Vacutainer tubes. The anaerobic assay mixture was degassed

before the enzyme was added. The anaerobic enzyme solution was added

using a Hamilton syringe.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Isolation and Purification of Porphobilinogen Deaminase

All purification procedures were carried out at 4°C and all buffers used

contained 1 mM dithiotreitol (DTT). To purify the enzyme porphobilinogen

deaminase from R. capsulatus, eight liters of PAS100 were grown in PYE

medium. The cells were harvested at late-log phase by centrifuging the cell

suspensions at 5,900 x g in the Sorvall GSA rotor for ten minutes. The cells

were resuspended in cold 0.1 M Tris-CI, pH 7.5 using 10 ml per liter of cell

culture. The cellular suspension was sonicated 20 times (until the solution

cleared) for 20 seconds with 30 second cooling periods using the Sonicator

Ultrasonic Processor, Model W-200 (Heat Systems-Ultrasonics, Inc.,

Farmingdale, NY). The sonicated suspension was spun at 27,000 x g for 20

minutes in the Sorvall SS34 rotor and the supernatant collected. This crude R.

capsulatus extract was frozen overnight at -20°C.

(NH4)2S04 Fractionation and Heat Treatment

The crude extract was thawed and a saturated (NH4)2S04 solution was

slowly added to 45% overall saturation (818 ml of saturated (NH4)2S04 per liter

of extract). The extract was stirred slowly for 30 minutes then centrifuged for

20 minutes at 27,000 x g in the Sorvall SS34 rotor. The supernatant,

containing the porphobilinogen deaminase, was carefully decanted and a

further quantity of the saturated (NH4)2S04 solution was added to a saturation

of 60% (375 ml of saturated (NH4)2S04 per liter of extract). The extract was

again stirred slowly for 30 minutes and then centrifuged, as before. The

resulting pellet was resuspended in 10 ml of 20 mM Tris-CI, pH 8.0,1 mM DTT,

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and 1 mM EDTA. The resulting suspension was then dialyzed for eight hours,

against two changes of two liters of the same buffer to remove all traces of

ammonium sulfate. The dialyzed suspension was then heated with gentle

stirring at 60°C in a water bath for ten minutes. After heating, the extract was

cooled in ice and centrifuged at 27,000 x g in the Sorvall SS34 rotor for one

hour to remove all denatured proteins.

Anion-Exchange Chromatography

Using the BioRad Econo Chromatography Control System (Hercules,

CA), the enzyme solution was loaded onto a 244 cm3 (46 cm x 2.6 cm) DEAE-

Cellulose chromatography column equilibrated in the dialysis buffer at a flow

rate of 1 ml per minute. The column was washed with 100 ml of the same

buffer and the protein was eluted using a linear gradient up to 1 M KCI. The

two milliliter fractions, collected during the entire column run, were assayed for

porphobilinogen deaminase activity. The enzyme was eluted at 0.15 M KCI

and the active fractions were pooled. The resulting solution was dialyzed

overnight in two changes of two liters of 10 mM KP04, pH 7.2 buffer to remove

all of the salt.

Hydroxylapatite Chromatography

The dialyzed DEAE-cellulose activity was applied onto a small 21 cm3

(12 cm x 1.5 cm) hydroxylapatite column equilibrated in 10 mM KP04, pH 6.8.

At a flow rate of 0.5 ml per minute, the column was washed with 50 ml of the

same buffer and eluted with a linear gradient up to 0.5 M KP04, pH 6.8. One

milliliter fractions were collected and assayed for activity. The fractions

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. collected during the column wash contained all the deaminase activity. These

fractions were pooled and dialyzed against two liters of 20 mM Tris-CI, pH 8.0

buffer overnight. The dialyzed hydroxylapatite solution was concentrated to 10

ml by covering the dialysis sack with Aquacide II (Calbiochem, LaJolla, CA) for

four hours.

Gel-Filtration Chromatography

The concentrated enzyme was loaded onto a 493 cm3 (93 cm x 1.3 cm)

column of Sephadex G-75, previously equilibrated with 20 mM Tris-CI, pH 8.0,

1 mM DTT, and 1 mM EDTA, at a flow rate of 0.6 ml per minute. Fractions (3

ml) were collected and assayed for porphobilinogen deaminase activity. The

active fractions were pooled together and concentrated by placing the resulting

solution into a dialysis sack and covering it with Aquacide II for five hours. The

resulting enzyme solution was stabilized by the addition of glycerol to a final

concentration of 20% (v/v).

Molecular Weight Determination by Electrophoresis

Denaturing Conditions

Proteins were routinely analyzed and their molecular weights

determined using polyacrylamide gel electrophoresis with sodium dodecyl

sulfate (SDS-PAGE). The procedure used was a discontinuous SDS-PAGE

system containing tricine that optimally separated proteins in the range from 1

to 100 kDa as described by Schagger (257). The composition of the gels is

defined by the total concentration (%) of both monomers (acrylamide and

bisacrylamide), denoted T, and the percent concentration of the crosslinker

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. relative to the total concentration, denoted C. A 10% T, 3% C gel was used for

the separating gel, while overlaid by a 2 cm thick 4% T, 3% C stacking gel.

The SDS molecular weight markers (Sigma, St. Louis, MO) of a-lactalbumin

(14.2 kDa), trypsinogen (24 kDa), carbonic anhydrase (29 kDa),

glyceraldehyde-3-phosphate dehydrogenase (36 kDa), egg albumin (45 kDa),

bovine albumin (66 kDa), and phosphorylase B (97.4 kDa) were loaded on

every gel. All protein samples, ~2 pg per protein band, were incubated for one

minute at 100°C in 4% SDS, 12% glycerol (w/v), 50 mM Tris-CI, pH 6.8, 2% p-

mercaptoethanol (v/v), and 0.01% bromophenol blue before loading onto the

gel. Gels were run at 110 V (constant voltage) until the marker dye

bromophenol blue reached the bottom of the gel. Gels were stained in a

solution containing 50% methanol, 10% acetic acid and 0.25% Coomassie

Brilliant Blue R for 30 to 60 minutes. A complete background destaining of the

gels was achieved by shaking the gels in several changes of 50% methanol

and 10% acetic acid.

Nondenaturing Conditions

To examine the proteins under conditions where characteristics of the

native protein were retained, proteins were examined by electrophoresis in

nondenaturing systems. The procedure which involved modification of the

methods of Bryan (44) and Davis (67) allowed determination of several

characteristics, most notably molecular weight determination of homogenous

proteins. For non-homogenous proteins, charge-isomers or molecular weight

isomers could be examined. To examine the molecular weight of a given

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. protein it was first separated by electrophoresis on a series of continuous gels

equilibrated to pH 8.0 with Tris-Citrate containing from five to nine percent

polyacrylamide concentrations. In each gel a mixture of nondenaturing

molecular weight markers was also loaded. The markers used were a-

lactalbumin (14.2 kDa), carbonic anhydrase (29 kDa- characterized by three

closely spaced bands (charge isomers)), chicken egg albumin (45 kDa-

characterized by two closely spaced bands (charge isomers)), and bovine

serum albumin that exhibits a monomer (66 kDa) and a dimer (132 kDa) band.

Before the gel was loaded, all protein samples (~0.02 mg per ml) were mixed

with an equal volume of 2X Tris-Citrate Sample buffer (40 mM Tris-Citrate, pH

8.0, 20% Glycerol, 0.004% Bromophenol Blue). Each gel was run at 110 V

(constant voltage) at room temperature until the marker dye (Bromophenol

Blue) reached 1 cm from the anodic end of the gel. To visualize the protein

bands, the gel was stained by shaking it in a solution of 40% methanol, 7%

acetic acid, and 0.25% Coomassie Brilliant Blue R for 30 minutes. This gel

was subsequently decolorized using several changes of a 40% methanol and

7% acetic acid solution. To localize porphobilinogen deaminase activity within

the gel, the lane containing PBG deaminase was incubated with 10 ml of 0.1

mg/ml PBG for 30 minutes at 37°C with shaking. The hydroxymethylbilane

formed was cyclized into Uro-I by adding 10 ml of 1N HCI with 0.01% Iodine.

After 20 minutes incubation in the dark, to oxidize the uroporphyrinogen to

uroporphyrin, 0.1% Na2S205 was added until the yellow iodine color

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. disappeared. The resulting fluorescent bands were viewed using a short wave

UV light box (Fotodyne, Inc., New Berlin, Wl).

Isoelectric Focusing

Proteins were separated by isoelectric focusing, on narrow range pH

gradients, in tube gels. The tube gels contained an acrylamide solution of

7.5% T and 0.8% C with a mixture of 3/10 and 3/5 ampholytes yielding optimal

separation between pH 3 and pH 5. Using riboflavin as the catalyst,

polymerization was stimulated by placing the tubes in front of a light bank. The

gels were run in a tube gel electrophoresis unit with 20 mM NaOH as the

cathode solution and 10 mM phosphoric acid as the anode solution. Protein

samples and isoelectric focusing standards were loaded under a layer of 5%

glycerol in separate tube gels. The isoelectric focusing standard mixture

(Sigma Chemical Co., St. Louis, MO) contained amyloglucosidase (3.6),

glucose oxidase (4.2), trypsin inhibitor (4.6), |3-lactoglobulin (5.1), carbonic

anhydrase (5.4, 5.9 and 6.6), and the anionic dye methyl red. The tube gel

electrophoresis unit was run at 4°C at 200 V (constant voltage) for 18 to 20

hours, until the marker dye methyl red quit moving. Gels were removed from

the tubes by rimming the top and bottom of each gel with a stream of water.

Those gels containing porphobilinogen deaminase could be assayed for

uroporphyrin I formation as done on nondenaturing gels. To visualize the

protein bands the gels were fixed in 20 ml of 10% trichloracetic acid for four

hours. The gels were then stained for protein with isoelectric focusing stain

containing 30% isopropanol, 10% acetic acid, 0.04% Coomassie Blue R-250,

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and 0.5% CuS04. The gels were then destained with a solution of 30%

isopropanol, 10% acetic acid, and 0.5% CuS04.

Two-Dimensional Gel Electrophoresis

Proteins were separated using the two-dimensional gel electrophoresis

system developed by O'Farrell (219). The first dimension was run in a tube gel

as described in the isoelectric focusing section. After electrophoresis the

isoelectric focusing tube gel was incubated in two changes of SDS transfer

buffer (0.0625 M Tris-CI, pH 6.8, 2% SDS, 10% Glycerol, and 5%

P-mercaptoethanol) for 30 minutes. A SDS-PAGE gel prepared as described

earlier was prerun at 90 mA (constant amperage) with the upper buffer

containing 0.1 mM thioglycolic acid. The tube gel was then adhered to the top

of the SDS-PAGE gel using 1% agarose containing 0.1% SDS. A sample of

the SDS molecular weight markers described earlier were loaded into a well

made in the agarose. The proteins were then separated in the second

dimension at 90 mA (constant amperage) until the marker dye bromophenol

blue migrated to the end of the gel.

Protein Blotting

Proteins separated by gel electrophoresis were electroblotted to

lmmobilon-PSQ (Millipore, Bedford, MA), a microporous polyvinylidene fluoride

(PVDF) membrane enhanced for protein sequencing, using the procedure

described by Matsudaira (192). The lmmobilon-PSQ membrane was first wet in

100% methanol for a few seconds then transferred into electrotransfer buffer

(25 mM Tris, 192 mM glycine, pH 8.3) for 10 to 15 minutes. After

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. electrophoresis, the separating gel was soaked in electrotransfer buffer for ten

minutes. The Immobilon-P50 membrane was placed next to the gel taking care

to remove all air bubbles between the gel and membrane. The gel with

membrane was then placed between blotter paper and sponges soaked in

electrotransfer buffer in the blotting cassette. The loaded blotting cassette was

placed into the TE50X Transfer Electrophoresis Unit (Hoefer Scientific

Instruments, San Francisco, CA) filled with six liters of electrotransfer buffer.

Transfer was done at 0.88 mA (constant amperage) for four hours. When

finished the membrane was stained by shaking in 1% acid Coomassie stain

(50% methanol, 1% acetic acid, 0.125% Coomassie Blue R-250) for exactly

one minute. The membrane was destained in several changes of 12%

isopropanol. To remove all salts and other contaminants that may inhibit

sequencing, the membrane was rinsed in several changes of deionized water.

Plasmid DNA Isolation

Plasmid DNA was isolated from 1 to 5 ml of an overnight culture using

the QIAprep Spin Plasmid Kit (Quiagen Inc., Chatsworth, CA). The plasmid

extraction procedure is based on the modified alkaline lysis method of Birnboim

and Doly (34) and on the adsorption of DNA onto silica in the presence of high

salt (297). The procedure consisted of: 1) Preparing a clear lysate, 2)

Adsorbing the DNA to a silica-gel membrane in the presence of high salt, 3)

Washing away the s a lt, and 4) Elution of plasmid DNA with 50 to 100 pi of

sterile HzO. The concentration of DNA in each sample was ascertained by

measuring the absorbance at 260 nm using a Lambda 3B UV/VIS

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. spectrophotometer (Perkin-Elmer Corp., Norwalk, CT). At the wavelength of

260 nm, one optical density (O.D.) unit equals 50 pg DNA per ml. All plasmid

DNA solutions were stored at -20°C.

Restriction Enzyme Digestion

Restriction digestion of DNA was routinely performed by mixing 1 pg of

DNA in a 10 pi reaction containing 1 pi (5 -10 units) of enzyme and 1 pi of the

appropriate 10X reaction buffer from New England Biolabs (Beverly, MA). The

mixture was incubated one to two hours in a dry-bath incubator at the optimal

enzyme incubation temperature.

DNA Ligation

The DNA was cleaned by precipitation with one-tenth volume of 3 M

sodium acetate, pH 4.8 and three volumes of cold 95% ethanol. After

incubation at -80°C for twenty minutes the sample was centrifuged at maximum

speed for four minutes in a microcentrifuge (Eppendorf, Madison, Wl). The

supernatant was removed and the pellet was washed with cold 70% ethanol.

After incubation at -80°C for twenty minutes, the sample was centrifuged for

four minutes. The pellet was dried in a vacuum desiccator and suspended in

sterile deionized HzO. Routine DNA ligations consisted of 1 to 5 pg of DNA

fragments containing compatible ends in a 10 pi reaction along with 1 pi of 10X

T4 DNA ligase buffer and 1 pi (400U) of T4 DNA ligase (New England Biolabs,

Beverly, MA). The reactions were incubated overnight at 16°C.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Agarose Gel Electrophoresis

DNA was routinely separated through 0.7% agarose gels containing 0.5

Mg/ml ethidium bromide using either the BRL Horizontal System, Model H5 or

the Hoefer Gel Unit, Model HE-33. A 50X stock solution of TAE (1X TAE =

0.04 M Tris-acetate, pH 8.0, 2 mM EDTA, pH 8.0) was diluted to 1X to serve as

a solvent for gel preparation and as electrophoresis buffer. DNA samples were

prepared by adding a one-tenth volume of 10X loading buffer (0.25%

bromothymol blue, 40% sucrose). Electrophoresis of the gels was carried out

at 80 volts for up to two hours. Upon completion of electrophoresis, the DNA

was visualized using a short wave UV light box (Fotodyne, Inc., New Berlin,

Wl). When necessary gels were photographed with a Polaroid camera. The

size of the DNA fragments was estimated by comparison to lambda DNA

digested with Hindlll, which served as a molecular length marker.

DNA Recovery from Agarose Gels

DNA was routinely recovered from agarose gels using the GENECLEAN

II Kit (BIO 101, Inc., La Jolla, CA). Many of the principles of the GENECLEAN

procedure are based on the data of Vogelstein and Gillespie (296).

Electroporation

E. coli cells were grown in L-broth until mid-log phase (O.D.eeo = 0.5-1.0)

then centrifuged at 5,900 x g in a Sorvall SS34 rotor for eight minutes. The cell

pellet was washed twice with 10 ml of cold sterile water. In a microcentrifuge

tube the pellet was washed five consecutive times with 1 ml cold sterile 10%

glycerol. The cell pellet was resuspended in a final volume of 200 pi of cold

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sterile 10% glycerol. Forty microliters of the freshly prepared cells and up to 2

pg of DNA were transferred to a sterile 0.2 cm electroporation cuvette and

mixed. The suspension was pulsed using the BioRad Gene Pulser (BioRad

Laboratories, Hercules, CA) set at 2.5 kV, 25 pF, and 200 ohms. Two milliliters

of L-broth was immediately added to the cuvette and the suspension was

transferred to a sterile test tube. The cell suspension was incubated for one

hour at 37°C in a roller drum and 0.1 ml was plated onto the appropriate

selective medium.

Triparental matings

E. coli strain MC1061, containing the donor plasmid and the E. coli strain

HB101, containing the helper plasmid pRK2013, were grown overnight in 10 ml

of L-broth supplemented with the appropriate antibiotics at 37°C with slow

shaking. R. capsulatus recipient strains were grown overnight in 10 ml of PYE

at 37°C without shaking. One milliliter of the R. capsulatus recipient culture

and 0.2 ml of each E. coli culture were added to a microcentrifuge tube and

centrifuged. After removal of the supernatant, the cells were gently

resuspended in the remaining liquid and transferred to a nitrocellulose disc

placed on the surface of a PYE plate. The plate was incubated at room

temperature for four hours to overnight after which the nitrocellulose disc was

transferred to a PYE plate supplemented with the appropriate antibiotics. The

cells were spread with 0.1 ml of PYE and the plate was incubated at 37°C for

two to four days.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DNA Sequencing

The DNA sequencing was performed using the New England Biolabs

Circumvent™ Thermal Cycle Dideoxy DNA Sequencing Kit (New England

Biolabs, Beverly, MA) which is based on the dideoxynucleotide chain

termination method of Sanger et al. (253). The dideoxy terminated chains were

labeled by the incorporation of [a35S] dATP. Sequencing reactions were

subjected to 25 cycles of incubation in a Hybaid Thermal Reactor (National

Labnet Laboratories, Woodbridge, NJ). Following the initial denaturation step

at 95°C for five minutes, each cycle was composed of denaturation at 95°C for

one minute, annealing at 55°C for one minute, and chain extension at 72°C for

one minute. The double stranded plasmid templates were extended using the

thermostable VentR® (exo ) DNA polymerase from Thermococcus litoralis. The

DNA fragments generated were denatured at 80°C for five minutes and

separated by electrophoresis through a 6.0% poiyacrylamide-urea gel at 59°C

using the Polar Bear Isothermal Electrophoresis system (Owl Scientific,

Woburn, NJ). Following electrophoresis, the gel was fixed in 20% ethanol-10%

acetic acid then adhered to 3M Whatman paper and dried for three to four

hours at 80°C in a BioRad Gel Drier, Model 483 (BioRad Laboratories,

Hercules, CA). The dried gel was exposed to Kodak BioMax X-ray film

(Eastman Kodak Co., Rochester, NY) for two to three days.

Chloramphenicol Acetyltransferase Assay

The levels of chloramphenicol acetyltransferase were determined using

the procedure described by Shaw (266). R. capsulatus was grown in 100 ml

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. PYE containing the appropriate antibiotics until the density reached 75 to 100

Kletts. The cells were harvested then resuspended in 2 ml of 50 mM Tris-CI,

pH 7.8. The cell suspension was then sonicated five times for 20 seconds with

30 second cooling periods using the Sonicator Ultrasonic Processor, Model

W-200 (Heat Systems-Ultrasonics, Inc., Farmingdale, NY). After 20 minutes of

centrifugation at 27,000 x g in the Sorvall SS-34 rotor all the cell debris was

removed. Two hundred and fifty microliters of crude extract were mixed with

250 pi of 4 mg/ml 5,5'-dithiobis-2-nitrobenzoic acid (DTNB) in 1 M Tris-CI, pH

7.8, 50 pi 5mM acetyl-CoA, and 1.95 ml water. One milliliter of the reaction

mixture was added to two water-jacketed cuvettes. The cuvettes were placed

in the Lambda 3B UV/VIS spectrophotometer (Perkin-Elmer Corp., Norwalk,

CT) and blanked. After the cuvettes containing the enzyme and the reaction

mixture had been allowed to equilibrate at 37°C, the reaction was started by

adding 20 pi of 5 mM chloramphenicol to the sample cuvette. The change in

absorbance at 412 nm was monitored using a chart recorder.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. RESULTS

Purification of Porphobilinogen Deaminase

Table 3 summarizes the results of a typical purification of

porphobilinogen deaminase from eight liters of R. capsulatus cell culture. At

each purification step there was only one peak that could consume

porphobilinogen. PBG usage co-purified with Uro-I forming activity, verifying

that we were purifying porphobilinogen deaminase. The PBG usage activity

was purified approximately 140-fold with 25% overall yield, while the Uro-I

forming activity was purified approximately 200-fold with a 36% overall yield.

Molecular Weight Determination of Porphobilinogen Deaminase

Nondenaturing Gel Electrophoresis

The porphobilinogen deaminase and nondenaturing molecular weight

standards were separated by electrophoresis on a series of nondenaturing gels

containing from five to nine percent polyacrylamide. All protein bands

containing PBG deaminase activity were localized in each gel (Figure 2) using

the assay protocol described in the Materials and Methods. To determine the

molecular weight of the R. capsulatus PBG deaminase, the relative mobility (R,)

of the nondenaturing molecular weight standards and the PBG deaminase was

determined for each gel. The R, was determined by dividing the protein

migration distance by the migration distance of the marker dye. For each

polyacrylamide concentration, the 100 [log (R, x 100)] value was determined for

the nondenaturing molecular weight standards and the PBG deaminase. The

resulting series of 100 [log (Rf x 100)] values were plotted against the percent

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 8.63 Ratio0 Activity Specific 12.2 7.27 3.20 9.11 Uro-I Factor Purification 675 40.9 7.63 201 52.2 3.16 9.54 16.5 1.00 11.7 53.0 3280 199 Uro-I Specific Activity5 (%) 100 69.7 Uro-I Yield Formed 1.00 2.41 98.7 PBG Factor Purification 193 PBG Specific Activity8 (%) 25.2 26700 138 36.4 PBG Used Yield 1.93 13.8 32.0 4730 24.5 53.6 (mg) 1050 100 Protein ml Total 102 12.5 5.00 25.0 60.0 43.3 1470 7.63 20.0 276 55.3 428 2.22 83.2 21.5 323 73.5 465 Peak Peak DEAE- DEAE- Sample 45-60% (NH4)2S04 Crude Crude Extract Cellulose Peak Hydroxylapatite Sephadex G-75 G-75 Sephadex 45-60% Heated b Uro-I formed specific activity is expressed as nanomoles of uroporphyrin I formed per hour per mg of protein. ofprotein. per mg formed per hour ofuroporphyrin I as nanomoles activityspecific expressed formed is Uro-I b specific activity. formed tothe specific activity Thethe activity Uro-I used specific the PBG ofratio ratio is c 8 PBG used specific activity is expressed as nanomoles of porphobilinogen used per hour per mg of protein. ofprotein. ofporphobilinogen per mg per hour used as nanomoles activity specific expressed is used PBG 8 Table 3. Purification ofporphobilinogen deaminase.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure 2. Analysis of the R. capsulatus porphobilinogen deaminase by nondenaturing polyacrylamide gel electrophoresis. Lane 1 was stained for protein with Coomassie Brilliant Blue. Lane 2 was incubated with porphobilinogen. The resulting uroporphyrinogen band was oxidized by the addition of 0.01% l2 in 1N HCI. The uroporphyrin I band formed was viewed using a short wave UV light box.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. gel concentration (Figure 3). The absolute value of the slopes obtained from

this graph were plotted against the known molecular weights of the

nondenaturing molecular weight standards on two cycle log-log paper (Figure

4). The molecular weight of the nondenatured R. capsulatus porphobilinogen

deaminase was determined from this graph to be 36,000 ± 2,000.

SDS-PAGE

With each purification step the fractions containing porphobilinogen

deaminase activity were identified and pooled. The pooled fractions were

analyzed by SDS-PAGE. After staining with Coomassie Brilliant Blue, the G-75

purified sample revealed a major protein band (Figure 5) with a mobility similar

to that of glyceraldehyde-3-phosphate dehydrogenase (Mr 36 kDa). A

logarithmic plot of the molecular weights of the marker proteins against mobility

yielded a straight line (results not shown). From this plot the molecular weight

of the major protein band of the G-75 sample was calculated to be 35,000 ±

1,000. This result is very similar to the value obtained for the nondenatured R.

capsulatus PBG deaminase. This indicates that the major protein band on

SDS-PAGE is PBG deaminase. The data obtained from the SDS-PAGE and

the nondenaturing gel analysis indicates that the R. capsulatus PBG

deaminase is a monomeric protein. This is consistent with observations on

other purified PBG deaminases, which are also reported to be monomers with

molecular weights ranging from 34,000 to 44,000 (271).

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 180

170

•*- 150

o> 140 o 130

10 4 5 6 7 8 9 10 Aery lam ide Concentration (%)

Figure 3. Mobility of proteins in nondenaturing gels. The nondenaturing molecular weight standards were Bovine Serum Aibumin(dimer, ▲, and monomer, T), Chicken Egg Albumin (■), Carbonic Anhydrase (♦), and a- lactaibumin ( • ) . The PBG deaminase is represented by the symbol O.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ® a. 0 1

0.9 0.8 0.7 0.6 0.5 10 20 30 40 50 60 80 100 200 Molecular Weight x 1000

Figure 4. Molecular weight determination of the nondenatured R. capsulatus porphobilinogen deaminase. The solid black line is the regression line and the dashed lines display the 95% confidence interval. The square represents the porphobilinogen deaminase.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 2 3 4 5

66 KDa -

45 KDa -

36 KDa -

29 KDa -

24 KDa -

r& .y Z frrr-

14.2 KDa -

Figure 5. Analysis of the R. capsulatus porphobilinogen deaminase by SDS-PAGE. Lane 1: Monomeric molecular weight standards. Lane 2: Crude Extract. Lane 3: DEAE-Cellulose column peak. Lane 4: Hydroxylapatite column peak. Lane 5: Sephadex G-75 column peak. The arrow indicates porphobilinogen deaminase.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Determination of Optimum pH and Isoelectric Point

The R. capsulatus porphobilinogen deaminase exhibited a pH optimum

at pH 8.0 (Figure 6) in 50 mM Tris buffer. A similar curve was obtained with

phosphate buffer except the optimal activity was at pH 7.6. All purified

porphobilinogen deaminases have optimal activities between pH 7.4 and pH

8.2 (4, 61, 131, 270). Isoelectric focusing of the partially purified deaminase

from the Sephadex G-75 step revealed the presence of five bands. The band

determined to contain porphobilinogen deaminase activity was found at pi 4.5.

This value is similar to those reported for the R. sphaeroides enzyme (pi 4.46)

(66) and the E. coli enzyme (pi 4.5) (138).

Kinetic Analysis of Porphobilinogen Deaminase

Using substrate concentrations up to 250 pM, the Km value for the

substrate porphobilinogen was 94 pM as measured by its consumption and the

Vmax was approximately 7.6 nmoles porphobilinogen consumed per minute.

The Km value when measuring uroporphyrin formation was 81 pM and the Vmax

was 1.0 nmole of uroporphyrin I formed per minute (Figure 7). Our Km value for

uroporphyrin formation is similar to those reported for the deaminases from

C. regularis (85 pM) (270), E. gracilis (70 pM) (308), Scenedesmus obliquus

(79 pM) (143), and wheat germ (70 pM) (91).

Stoichiometry

The stoichiometry of the reaction was estimated by measuring the ratio

of porphobilinogen consumption and the uroporphyrin I formation. Crude

extracts of R. capsulatus not containing added reducing agents displayed

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. without prohibited reproduction Further owner. copyright the of permission with Reproduced activity. Figure 6. Effects of pH on the the on pH of Effects 6. Figure

Specific Activity 1 3 f 1300 .f 1400 | £ <0 2 c | o> a &■

1100 1200 1000 1500 800 900

7.0 7.5 R. capsulatusR. 58 8.0 pH porphobilinogen deaminase porphobilinogen 8.5 9.0

4 ® E

3 w ® o E e

0 2 1 0 1 2 3 4 5 6 1 / PBG] (1/OiM x 100))

Figure 7. Kinetic analysis of the R. capsulatus porphobilinogen deaminase. The solid black line is the regression line and the dashed lines display the 95% confidence interval.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ratios of approximately 20 porphobilinogen molecules used to form one

uroporphyrin. During the purification of porphobilinogen deaminase, the mild

reducing agent DTT was added, which had the effect of lowering the

stoichiometric ratio to approximately nine porphobilinogens used to form one

uroporphyrin (Table 3). The theoretical stoichiometry, one mole of

uroporphyrin from four moles porphobilinogen, was only achieved when the

strong reducing agent sodium borohydride (5 mM) was added to enzymatic

assays (Table 4). Reducing agents stimulated both of the activities of the

purified enzyme, but the most dramatic changes were seen in uroporphyrin I

formation,

inhibitors

The effects of various compounds on enzymatic activity are shown in

Table 4. Metal-chelating agents had no effect on the enzymatic activity.

Sulfhydryl reactive reagents such as mercuric chloride and N-ethylmaleimide

showed strong inhibition. N-ethylmaleimide inhibited only Uro-I formation,

while mercuric chloride showed strong inhibition of both PBG used and Uro-I

formation. Addition of ammonia or a derivative such as hydroxylamine,

reduced the Uro-I production but had little effect on PBG usage.

Effects of Oxygen on Porphobilinogen Deaminase Activity

Two R. capsulatus wild-type strains, PAS100 and SB1003, were grown

under aerobic conditions, photosynthetic conditions, and by anaerobic

respiration. In both strains grown and assayed aerobically, the ratio of

porphobilinogen used to uroporphyrin I formed was 23.5 ± 5.4:1. The

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 4. Effects of additives on the R. capsulatus porphobilinogen deaminase.

Inhibitor Cone. PBG Used Uro-I Formed Ratio* (mM) (% of control) (% of Control)

Control — 100 100 9:1 Sodium 5 120±12 660±47 4:1 Borohydride EDTA 25 107±4 107±4 9:1 Mercuric Chloride 0.05 22±4 20±4 9:1 /tf-Ethylmaleimide 10 133±5 30±3 23:1 Ammonium 100 113±3 84±5 11:1 Acetate Hydroxylamine 100 115±16 11 ±2 80:1

a The ratio of PBG used specific activity to the Uro-I formed specific activity.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. photosynthetically-grown and the anaerobic respiration-grown cultures of both

wild-types were assayed under strict anaerobic conditions. These anaerobic

porphobilinogen deaminases displayed a ratio of 13.2 ± 2.5 porphobilinogen

used to one uroporphyrin I formed. This is a 2-fold difference between aerobic

and anaerobic cultures.

N-Terminal Sequence Analysis

The R. capsulatus porphobilinogen deaminase was separated using

two-dimensional electrophoresis (Figure 8). The resulting gel was blotted to an

lmmobilon-PSQ membrane. The protein spot of the deaminase was cut out of

the membrane and the first twenty amino acids were determined by the Baylor

Core Sequencing Facility. The first twenty amino acids of the R. capsulatus

porphobilinogen deaminase are MEQMPSPNAPLKIGTRGSPL.

Cloning of the R. capsulatus hemC Gene

The porphobilinogen deaminase N-terminal sequence was used to clone

the hemC gene of R. capsulatus. The N-terminal sequence was analyzed

using the BLAST WWW Server available from the National Center for

Biotechnology Information that locally aligns the query protein sequence with

over 200,000 known protein sequences in the database. The R. capsulatus

porphobilinogen deaminase N-terminal sequence was found to have 75%

identity and 91% similarity to regions in the P. sativum and A. thaliana

porphobilinogen deaminase sequences. Another analysis was done using the

TFASTA search algorithm that back translates the protein sequence into ail six

possible nucleotide sequences then compares these to all nucleotide

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 6.0 pi 3.0

66 KDa-

45 KDa- 36 KDa- 29 KDa- 24 KDa-

14.2 KDa-

Figure 8. Two-dimensional gel electrophoresis of the purified R. capsulatus porphobilinogen deaminase. The protein spot of porphobilinogen deaminase is circled.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. sequences in Genbank. The R. capsulatus porphobilinogen deaminase N-

terminal sequence was found to have 100% homology with a gene sequence

located upstream of the R. capsulatus hemE gene, a sequence previously

submitted by our lab (122). By localization of the N-terminal sequence onto the

R. capsulatus hemE sequence, it appears the hemC gene is transcribed in the

opposite direction of hemE. Clones obtained in the studies on the R.

capsulatus hemE were available for study. The largest clone, containing 4 kb

of R. capsulatus DNA, was pCAP154 (Figure 9) which contains the hemE gene

with 1.2 kb of upstream DNA. The clone pCAP154 was mapped by restriction

enzymes and various fragments from pCAP154 were subcloned into pUC18

(Figure 10).

Sequencing of the hemC Gene

The subclones pCAP155, pCAP167, pCAP168 and pCAP169 each

containing small fragments of the region upstream of the R. capsulatus hemE

gene (Figure 10) were used for sequencing the entire 1.2 kb of DNA upstream

of hemE gene in both directions. Analysis of this nucleotide region (Figure 11)

indicates there is a single open reading frame 951 bp long. The ATG codon

beginning at position 137 is the most likely candidate for the start codon, based

on the homology to the R. capsulatus porphobilinogen deaminase N-terminal

sequence. The open reading frame encodes a 317 amino acid protein with a

theoretical molecular mass of 34,082 Da and pi of 5.2. These values match

very well to values reported in this study for the R. capsulatus porphobilinogen

deaminase. The derived amino acid sequence of the R. capsulatus enzyme

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. HemC

pCAP154 HemE 6800 bpi

E co R I

Figure 9. Plasmid pCAP154 containing the R. capsulatus hemC and hemE genes.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

1 1 ----- 1 ----- I ------LJ ------I 1 ------1 H E ------1 ------! ------1 derivatives. Restriction enzyme cleavage sites are BamHI hem E ----- 1 ---- 1—I ------CXPSMVN 1—| 1—I R. capsulatus hemC capsulatus R. ------1 E E C H 1 hemC ------| B B E H C C B B E E H P C B Figure 10. Restriction map of (B), EcoRI (E), Hindi (C), Hindlll (H), Mscl (M), expressed Ncol (N), in kilobases.Pstl (P), Pvull (V), Sphl (S), and Xmnl (X). Distances are pCAP169 | pCAP168 | pCAP167 pCAP167 pCAP155 pCAP155 1 pCAP154 CD O)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 1 GCGCGCAGGATCGTCTTGTCGGTCATTTGGAGGGCCTCCTTCTTGCCCCTTAACAGCGTCCCCTGCGGCT ♦-hemE hemC-> 71 GAAEHS&AGCACTGTE^^CTTGTAAAGCTTGCGCGGGCAATCTGACGCGGTTATGCCAAGCGCATGG M

141 AACAGATGCCCTCGCCCAACGCCCCGCTGAAGATCGGCACCCGCGGCAGCCCTCTGGCGCTCGCGCAAGC EQMPSPNAPLKIGTRGSPLALAQA

211 CTTTGAGACCCGCTCGCGGCTCATGGCCGCGTTCGATCTGCCCGAAGAGGCCTTCGAGATCSTCGTGATC FETRSRLMAAFDLPEEAFEIVVI

281 AAGACCTCGGGCGACAATGCGGCGCTGATCGCCGCCGACAAGCCTTTGAAAGAGGTGGGGGGCAAGGGCC KTSGDNAALXAADKPLKEVGGKG

3 5 1 TTTTCACCAAGGAAATCGAAGAGGCGATGCTGGCGGGCTCGATCGACATCGCCGTGCATTCGATGAAGGA LFTKEIEEAMLAGSIDIAVH3MKD

421 CATGCCGACGCTTCAGCCCGAGGGGCTGATCCTCGATTGCTACCTGCCGCGCGAAGACACCCGCGACGCC mptlqpeglildcylpredtrda

4 91 TTCGTTTCGATGAAATACAATTCGCTCGCCGAGCTGCCCGAGGGCGCGGTGGTGGGCACCTCCAGCTTGC FVSMKYNSLAELPEGAVVGT3SL

561 GCCGTCGCGCCCAGCTTGCCGCGCGTCGCCCCGATCTGAAGATGGTCGAATTCCGCGGCAACGTGCAGAC RRRAQLAARRPDLKMVE FRGMVQT

6 3 1 GCGGATGAAGAAACTGGGCGAAGGCGTGGCCGATGCCACCTTCCTTGCGCTGGCCGGTCTGAACCGTCTG RMKKLGE GVADATFLALAGLNRL

701 GGCATGTCCGAAGTGGCGAAATCCGCGATCGAGCCCGAGGACATGCTGCCCGCCGTGGCGCAGGGCTGCA GMSEVAKSAIEPEDMLPAVAQGC

771 TCGGGATCGAACGCCGCGAGGCCGACACCCGGGCCAAGATGCTGCTCGATGCGATCCATCACGCGCCTTC IGIERREADTRAKMLLDAIHHAPS

841 GGGCCTGCGGCTGGCCTGCGAACGCAGCTTCCTGCTGACGCTCGACGGCTCCTGCGAGACCCCGATCGGC G L R L A C E R 3 FLLTLDG3CETPIG

911 GGTCTTTCGGTGCTGGAAGGCGATCAGATCTGGCTGCGCGGCGAGATCCTGCGTCCCGATGGCTCCGAGA GLSVLEGDQXWLRGEILRPDGSE

981 CGATCACCGGCGAGATCCGCGGCCCGGCCGCCGATGGCGTGGCGCTGGGGGCGGAGCTGGCGAAACAATT TITGEIRGPAADGVALGAELAKQL

1051 GCTGGCCAAGGCGCCCGCGGATTTCTTCTGCTGGCGGTAAGCCTGCCGCGCCCGCGCGAAGGGCGTATTT LAKAPADFFCWR*

1121 GGGCCAAGAAGAAACCAATGCCGTTTCTTCTTGGTGCAAATACGCGAAAGCGCGGCCTGAGCCGGGGGAT

1 1 9 1 CC

Figure 11. Nucleotide sequence of the R. capsulatus hemC gene. The upstream palindrome region is underlined with a double line and the conserved cofactor binding site sequence is underlined with a single line.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. shows 49% identity with that of E. coli, 44% identity with that of B. subtilis, and

42% identity with that of E. gracilis. The consensus porphobilinogen

deaminase cofactor binding site sequence E-R-x-[LIVMF]-x(3)-[LIVMF]-x-G-

[GSA]-C-x-[IVT>P-[LIVMF]-[GSA] (198), with C being the cofactor attachment

site, was confirmed in the R. capsulatus hemC sequence (Figure 12). The

hemC and hemE genes are divergently transcribed. Between the two start

sites, 45 bp upstream of hemC and 47 bp upstream of hemE, a palindrome was

discovered. This palindrome (Figure 13) is structurally similar to palindromes

found in the control regions of many R. capsulatus genes that are reported to

be regulated by oxygen tension (8, 183).

Overexpression of the hemC Gene

To verify the sequence could express a functional enzyme, the hemC

gene was overexpressed in E. coli and R. capsulatus. The 1.3 kb Pstl-BamHI

DNA fragment containing the hemC gene was subcloned into pUC19 to

generate pCAP175. The shorter 1.1 kb Hindlll-BamHI DNA fragment

containing the hemC gene without the upstream palindrome was subcloned

into pUC19 to generate pCAP178. The orientation of the hemC gene in both

constructs is in the same direction as transcription extending from the P!ac on

the plasmid. These clones were electroporated into the E. coli host NM522 in

order to determine if the hemC gene could express active enzyme.

NM522(pCAP175), NM522(pCAP178), and the control NM522(pUC19) were all

grown with IPTG induction to stimulate P!ac and the porphobilinogen deaminase

activities were determined as described in the Materials and Methods. The

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. R. aa.psixla.tu8 ERSFLLTLDGSC ETPIG A.thaliana ERAFLETLDGSC RTPIA P.satvium ERAFLTTLDGSc RTPIA P .aeruginosa ERALNKRLNGGc Q VPIA E.coli ERAMNTRLEGAc Q VPIG B .subtilis ERAFLNAMEGGc Q VPIA S .cerevisae ERALMRTLEGGc SVPIG Human ERAFLRHLEGGc SVPV Mouse ERAFLRHLEGGc SVPV

Consensus ERXLXXXLXGGc XIPLG I I S VIS £> V VAT M M U F F a

Figure 12. Alignment of conserved cofactor binding sites.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. TGTAA N8 TGACA 63 bp bchB TGTCA N8 TTACA 22 bp bchE TGTAA N8 TTACA 20 bp crtA TGTAA N8 TTACA 69 bp crtD TGTAA N8 TTACA 51 bp crtE TGTAA N8 ATACA 51 bp bchCXYZ TGTAA N8 TTACA 143 bp puc TGTCA N8 TGACA 47 bp hemE TGTCA N8 TGACA 42 bp hemC

TGTAA N8 TTACA R. capsulatus Consensus

Figure 13. Palindromic sequences upstream of R. capsulatus genes.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. results summarized in Table 5 show the hemC gene sequence was able to

express porphobilinogen deaminase. NM522(pCAP175) has a two-fold higher

porphobilinogen deaminase activity than the wild-type strain, while

NM522(pCAP178) has nearly a five-fold higher activity.

The expression was then verified in R. capsulatus. The 1.3 kb Pstl-

BamHI DNA fragment containing the hemC gene was subcloned into

mobilizable plasmid pRK404, generating pCAP171. The shorter 1.1 kb Hindlll-

BamHI DNA fragment containing the hemC gene without the upstream

palindrome was subcloned into pRK404 to generate pCAP172. The orientation

of the hemC gene in both constructs in the same direction as transcription

extending from the P ^ on the plasmid. Both constructs were mated into the R.

capsulatus wild-type strain PAS100. PAS100(pCAP171), PAS100(pCAP172),

and the control PAS100(pRK404) were all grown aerobically in the dark, then

assayed for porphobilinogen deaminase activity. As seen in Table 6, the

expression from the hemC gene was greater than that seen in E. coli.

PAS100(pCAP171) has six-fold higher PBG usage and nine-fold higher

uroporphyrin formed than the control. PAS100(pCAP172) has nine-fold higher

PBG usage and 16-fold higher Uro-I formation. These results show the Uro-I

forming activity was stimulated by adding extra copies of the hemC gene more

than the PBG using activity.

Construction of a hemC-cat Transcriptional Fusion Plasmid

In order to test transcriptional regulation of the R. capsulatus hemC by

oxygen, a hemC-cat fusion vector, pCAP182 (Figure 14), was constructed as

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 5. Overexpression ofhemC in E. coli.

Strain PBG Used Uro-I Formed Specific Activity* Specific Activity1* NM522(pUC19) 10 0.50 NM522(pCAP175) 19 0.90 NM522(pCAP178) 49 2.3

a PBG used specific activity is expressed as nanomoles of porphobilinogen used per hour per mg of protein. Results are representative of at least three trials.

b Uro-I formed specific activity is expressed as nanomoles of uroporphyrin I formed per hour per mg protein. Results are representative of at least three trials.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 6. Overexpression ofhemC in R. capsulatus.

Strain PBG Used Uro-1 Formed Specific Activity8 Specific Activity6 PAS100(pRK404) 220 8.5 PAS100(pCAP171) 1200 75 PAS100(pCAP172) 2000 140

a PBG used specific activity is expressed as nanomoles of porphobilinogen used per hour per mg of protein. Results are representative of at least two trials.

b Uro-I formed specific activity is expressed as nanomoles of uroporphyrin I formed per hour per mg protein. Results are representative of at least two trials.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. P lac

,P s tI

O m ega Sail.. ..P a tl

S m a l. T e t H em E H em C

CAT

pCAP182 H em C ' 14700 bps

B a m H l

E c o R l

Figure 14. The hemC-cat fusion plasmid constructed to study transcriptional regulation by oxygen.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. follows. The promoterless chloramphenicol acetyltransferase ( cat) gene from

pCM4 was cloned into the unique Bell site, contained within the coding region

of the R. capsulatus hemC gene, of pCAP175, forming pCAP176. The cat

gene was inserted so that its transcription would be in the same direction as

that of the hemC gene. The Q cartridge, which contains many strong

transcriptional and translational terminator sequences, was cloned from

pBR322Q into the Hindlll site of the mobilizable vector pRK404, making

pCAP145. The Pstl-BamHI fragment from pCAP176, containing the hemC-cat

fusion, was cloned into pCAP145 downstream of the Q cartridge, forming

pCAP182. The Q cartridge prevents readthrough transcription of cat by the P!ac

promoter of pCAP145. The hemC-cat fusion vector, pCAP182 was mated from

its E. coli host strain into R. capsulatus PAS100 as described in the Materials

and Methods.

Effects of Oxygen on Transcription of the hemC-cat Fusion Plasmid

The control strain PAS100(pCAP153) was created to account for

differences in cat expression due to changes in plasmid structure or copy

number, that may accompany changes in oxygen tension. The control strain

was grown in RCV media under conditions of high and low oxygen, harvested,

then assayed for chloramphenicol acetyltransferase activity. The control

cultures grown under low oxygen tension exhibited 1.4-fold more

chloramphenicol acetyltransferase activity than those cultures grown under

high oxygen tension (Table 7). PAS100(pCAP182) was also grown in RCV

media under conditions of high and low oxygen then assayed for

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table 7. Effects of oxygen on chloramphenicol acetyltransferase activity.

Strains Specific Activity* Specific Activity* 23% Oxygen 3% Oxygen PAS100(pCAP153) 33 46 PAS100(pCAP182) 48 66

a Specific activity expressed as nanomoles of chloramphenicol acetylated per min per mg protein at 37°C. Results are representative of at least two trials.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. chloramphenicol acetyltransferase activity. PAS100(pCAP182) cultures grown

under low oxygen tension exhibited 1,4-fold more chloramphenicol

acetyltransferase activity than those cultures grown under high oxygen tension.

Since this difference is not greater than that seen in the control, the results

show that chloramphenicol acetyltransferase activity from pCAP182 is not

influenced by oxygen.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DISCUSSION

The goal in our laboratory has been the study of regulation of carbon

flow over the common tetrapyrrole pathway of R. capsulatus through cloning,

sequencing and characterization of the hem genes. Several of the R.

capsulatus hem genes have been cloned and sequenced including hemA (33),

hemB (120), hemE (122), and hemH (148). The R. capsulatus porphobilinogen

deaminase was purified allowing us to clone the R. capsulatus hemC. The

entire hemC gene was sequenced (Figure 11) revealing a 951 bp open reading

frame that codes for a putative protein of 34,082 Da with a pi of 5.2. These

values are very similar to those obtained for the purified deaminase, which had

a molecular mass of 35,000 Da and pi of 4.5. The putative amino acid

sequence of the R. capsulatus hemC shares from 40 to 50% identity with other

porphobilinogen deaminases. The sequence revealed that hemC and hemE

are divergently transcribed. The conserved cofactor binding site (Figure 12)

was found in the putative amino acid sequence, indicating the cysteine residue,

which binds the dipyrromethane cofactor through a sulfhydryi linkage, is

involved in the R. capsulatus enzyme.

The palindrome (Figure 13) identified between the hemE and hemC

genes was first identified upstream of three genes in the 11 kb R. capsulatus

crt gene cluster by Armstrong (8). A palindrome with the same motif was also

identified upstream of the puc operon. These four palindromes were found to

overlap putative E. co/Mike promoters (8). The palindromes are centered from

20 bp upstream of the gene as in crtA up to 143 bp upstream as seen in the

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. puc operon. The palindrome consensus was found to be similar to the

consensus sequence from the recognition sites of many positive and negative

prokaryotic regulators including NifA, AraC, CAP, Lad, GaIR, LexA, TrpR,

LysR, and te ll (97). Because of this consensus similarity, Armstrong proposed

the R. capsulatus palindrome was the binding site for a transcriptional

regulatory factor. Since several of the R. capsulatus genes that have this

palindrome located upstream are known to be regulated by oxygen, it was

suggested that the palindrome may be involved in oxygen-mediated

transcriptional regulation. Site-directed mutagenesis of either part or all of the

palindromes upstream of some bch genes led to only two-fold reduction in

anaerobic induction (183).

A R. capsulatus hemC-cat fusion plasmid was constructed to determine

if the R. capsulatus hemC gene is transcriptionally regulated by oxygen. The

constructed fusion plasmid was mated into R. capsulatus PAS100 and the cells

were grown under high and low oxygen conditions. Extracts from the cultures

grown under both high and low oxygen tensions had the same level of activity,

when assayed for chloramphenicol acetyltransferase. This indicates the R.

capsulatus hemC is not transcriptionally regulated by oxygen. Using a similar

fusion plasmid constructed with the R. capsulatus hemE gene (121), oxygen

was found not to transcriptionally regulate the R. capsulatus hemE gene.

Since these genes are not transcriptionally regulated by oxygen, these results

demonstrate that the palindrome located upstream of the R. capsulatus hemC

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. and hemE genes is not involved in oxygen-mediated transcriptional regulation.

The palindrome, may however, play a role in transcription of these genes.

Interestingly, during initial experiments with crude extracts of R.

capsulatus, more porphobilinogen was consumed than stoichiometrically

expected. In R. capsulatus only one enzyme, porphobilinogen deaminase, is

known to utilize PBG. Under stoichiometric conditions PBG deaminase utilizes

four molecules of PBG to form one molecule of Uro-I. Yet, the R. capsulatus

crude extracts used twenty molecules of PBG to form one molecule of Uro-I. It

was postulated that there may be another enzyme utilizing PBG in R.

capsulatus. A porphobilinogen oxygenase has been identified in plants and

animals that oxidizes PBG into 2-hydroxy-5-oxoporphobilinogen as the major

product and 5-oxoporphobilinogen as the minor product (92, 93, 286). Since

porphobilinogen is one of the key intermediates in porphyrin metabolism, its

oxidation to an oxypyrrolenine, which is not converted into a porphyrin, may be

considered a regulatory step in porphyrin biosynthesis.

This led us to determine whether R. capsulatus had other PBG utilizing

enzymes. Throughout our purification process, only one PBG utilizing activity

was found, corresponding to PBG deaminase. The purification of PBG

deaminase from R. capsulatus (Table 3) proved relatively straightforward.

While the heating of the enzyme solution did not lead to significant increases in

purity, it did ensure the inactivation of the heat labile uroporphyrinogen III

synthase. Each step of the purification was equally effective, with

approximately three to five fold purification occurring at each step. It is evident

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. from the SDS-PAGE gel (Figure 5) that the eluted fraction from the Sephadex

G-75 column still contained a mixture of proteins. However, only one of the

bands, as seen under nondenaturing gel electrophoresis (Figure 2), was

shown to have deaminase activity. By comparing the size of the band

containing PBG deaminase activity in the nondenaturing gels to the size of the

major band seen on SDS-PAGE, the porphobilinogen deaminase was found to

be a monomer with a molecular mass of approximately 35,000 Daltons. The

PBG deaminase optimum pH of 8.0 and pi of 4.5, indicates the protein is acidic

and that it works best at slightly alkaline pH levels. The low Km value obtained

for PBG deaminase suggests the physiological concentration of PBG in R.

capsulatus may be very small.

The effects of ammonium ions, the product of the deamination, or

derivatives of ammonia, such as hydroxylamine, on the PBG deaminase was

first described by Pluscec and Bogorad (230), who found they interfered

markedly and preferentially with the formation of porphyrin. Both ammonium

ions and hydroxylamine at millimolar concentrations inhibited the R. capsulatus

PBG deaminase Uro-I formation exclusively (Table 4). This is in agreement

with the results of Jordan and Warren (139) who found that hydroxylamine

releases bound substrate molecules, but not the dipyrromethane cofactor.

The involvement of sulfhydryl groups in the active site of PBG

deaminase has been historically demonstrated (251). It has also been

demonstrated that in E. coli a dipyrromethane cofactor, which is covalently

linked through cysteine-242 to the enzyme, is responsible for binding the first

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. PBG molecule (301). The thiol alkylating reagent N-ethylmaleimide was only

inhibitory to Uro-I formation (Table 4). In contrast, mercuric chloride inhibited

both Uro-I formation and PBG usage, probably due to the binding of the metal

to essential thiol groups. These results suggest the involvement of sulfhydryl

groups in the active site of the R. capsulatus enzyme.

The influences of various additives on the purified PBG deaminase,

provided evidence that the two activities of the enzyme may be uncoupled.

N-ethylmaleimide was only inhibitory to Uro-I formation, indicating the presence

of more sensitive sulfhydryl groups in the part of the enzyme responsible for

Uro-I formation. The addition of reducing agents like DTT or sodium

borohydride increased Uro-I formation, again supporting the idea of the

presence of sulfhydryl groups in the porphyrin forming part of the deaminase.

The results of ammonia or hydroxylamine addition point to the same

conclusion.

The R. capsulatus enzyme is interesting in that it has a stoichiometry

that is influenced by redox conditions. Abnormal stoichiometric ratios for the

purified deaminases have been seen only in a few cases (38, 66, 91). The

abnormal stoichiometry was probably rarely noticed, since most groups

assayed the deaminase under reducing conditions. During studies on the E.

coli PBG deaminase 3D-crystal structure, it was found that the dipyrromethane

cofactor shifts positions in the active site upon varied redox conditions (161).

Since the stoichiometric ratio and the cofactor positioning can be altered by

redox conditions, we postulated that there may be an in vivo regulatory

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. mechanism controlling the activity of porphobilinogen deaminase in response

to redox conditions. We found cultures grown and assayed under strict aerobic

conditions formed less than half the amount of Uro-I as those grown and

assayed under strict anaerobic conditions. While this observed difference is

not enough to explain the change in carbon flow over the common tetrapyrrole

pathway, we hypothesize that this is the major control point of the common

tetrapyrrole pathway. While we cannot mimic the true intracellular conditions,

the fact that the conversion of PBG into Uro-I is regulated by redox conditions

is our most promising lead to date.

Our laboratory has shown that regulation of carbon flow through the

common tetrapyrrole pathway is not the result of transcriptional regulation of

hem genes (119, 121, 310). We have also not found any oxygen-mediated

changes in the activities in either aminolevulinate synthase (A. Biel,

unpublished results) or porphobilinogen synthase (119). This suggests that

oxygen regulates carbon flow over this pathway by shuttling some intermediate

out of the pathway. Biel (29) showed that exogenous porphobilinogen

disrupted normal oxygen-mediated regulation. In the presence of exogenous

porphobilinogen, carbon flow over the pathway remained high even when the

organism was grown under high oxygen tension. These results were extended

by Indest (119), who showed that carbon flow over the common tetrapyrrole

pathway in a strain containing multiple copies of hemB, which would have

increased intracellular levels of porphobilinogen, was also constitutive. Biel

(29) also showed that exogenous aminolevulinate did not alter regulation of

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. carbon flow over the common tetrapyrrole pathway. Taken together, these

results suggest that some step in the conversion of aminolevulinate to

uroporphyrinogen III is regulated by oxygen.

Recently, an aminolevulinate dehydrogenase activity has been found in

R. capsulatus (A. Khanna and A. Biel, unpublished results). This means that

ALA is not the first committed precursor in this pathway, and suggests the

pathway could be regulated by converting ALA to aminohydroxyvalerate

preferentially under aerobic conditions. However, further experiments have

shown that the ALA dehydrogenase activity was higher in extracts from

photosynthetically grown cultures than in extracts of aerobically grown cultures.

Therefore, it is unlikely that ALA dehydrogenase plays any role in regulating

the common tetrapyrrole pathway.

The results presented in this study suggest a mechanism by which

oxygen might regulate the common tetrapyrrole pathway. Ideally, it takes four

molecules of PBG to produce one Uro-I. We obtained this ratio when sodium

borohydride was added to our PBG deaminase assay. The ratio was only

slightly higher (10:1) when anaerobically grown cells were kept anaerobic

during the assay. When cultures were grown aerobically and assayed

aerobically, the ratio increased to between 20:1 and 30:1. In other words,

when the culture was grown in the presence of oxygen, it took as many as 30

molecules of PBG to form one molecule of Uro-I. This suggests that as the

oxygen tension increases, more and more PBG is shunted out of the common

tetrapyrrole pathway. The most likely mechanism is that the PBG is made into

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. dipyrrole and tripyrrole intermediates, as seen during ammonia and

hydroxylamine inhibition (139). Instead of being converted into Uro-I, the

intermediates are released from the enzyme. This could be due to alterations

of the PBG deaminase conformation brought about by changes in redox

conditions in the cell. Studies on the E. coli PBG deaminase 3D-Crystal

structure have found the reduced conformation of the enzyme is the active form

of the molecule (161). Under reducing conditions the dipyrromethane cofactor

occupies a position in the rear of the active site. The internal volume of the

enzyme under reduced conditions corresponds to approximately 3.5 pyrrole

rings (116). This volume limitation explains why the polymerization does not

proceed beyond a tetrapyrrole product. Upon oxidation the dipyrromethane

cofactor shifts into a position in the front of the active site that is likely a

substrate-binding site (116). The internal volume of the enzyme under oxidized

conditions has not been reported, yet the oxidized position of the

dipyrromethane cofactor could very likely reduce the internal volume needed

for the polymerization of four PBG molecules. Instead of creating a

tetrapyrrole, intermediates would be released.

To summarize, the hemC gene of R. capsulatus was cloned by

alignment of the purified PBG deaminase N-terminal sequence with a

sequence upstream of the R. capsulatus hemE gene. The hemC gene was

overexpressed in E. coli and R. capsulatus making a functional PBG

deaminase, proving the entire hemC sequence was cloned. Sequencing of the

hemC gene revealed it is transcribed in the opposite direction as hemE.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Between the two start sites a palindrome was identified that has been

implicated in oxygen-mediated transcriptional regulation of other R. capsulatus

genes. Monitoring the chloramphenicol acetyltransferase activity of a hemC-

cat fusion plasmid indicated that hemC is not transcriptionally regulated by

oxygen. The purified porphobilinogen deaminase has a atypical stoichiometric

ratio that is sensitive to redox conditions. We believe that PBG deaminase is

the regulated point of the common tetrapyrrole pathway.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. REFERENCES

1. Alberty, M., and J. E. Hearst. 1991. Sequence of the 46 kb photosynthetic gene cluster of Rhodobacter capsulatus. Photochem. Photobiol. Suppl. 53:1225.

2. Alefounder, P. R., C. Abell, and A. R. Battersby. 1988. The sequence of hemC, hemD and two additional E. coli genes. Nucl. Acids Res. 16:9871.

3. Alwan, A. F., B. I. A. Mgbeje, and P. M. Jordan. 1989. Purification and properties of uroporphyrinogen III synthase (co-synthase) from an overproducing recombinant strain of Escherichia coli K-12. Biochem. J. 264:397-402.

4. Anderson, P. M., and R. J. Desnick. 1980. Purification and properties of uroporphyrinogen I synthase from human erythrocytes. J. Biol. Chem. 255:1993-1999.

5. Anderson, P. M., and R. J. Desnick. 1979. Purification and properties of delta-aminolevulinic acid dehydratase from human erythrocytes. J. Biol. Chem. 254:6924-6930.

6. Araujo, L. S., M. E. Lombardo, and A. M. d. C. Battle. 1994. Inhibition of porphobilinogenase by porphyrins in Saccharomyces cerevisiae. Int. J. Biochem. 26:1377-1381.

7. Araujo, L. S., M. E. Lombardo, M. V. Rossetti, and A. M. d. C. Batlle. 1989. Saccharomyces cerevisiae porphobilinogenase some physical and kinetic properties. Comp. Biochem. Physiol. 92B:297-301.

8. Armstrong, G. A., M. Alberti, F. Leach, and J. E. Hearst. 1989. Nucleotide sequence, organization, and nature of the protein products of the carotenoid biosynthesis gene cluster of Rhodobacter capsulatus. Mol. Gen. Genet. 216:254-268.

9. Armstrong, G. A., D. N. Cook, D. Ma, M. Alberti, D. H. Burke, and J. E. Hearst. 1993. Regulation of carotenoid and bacteriochlorophyll biosynthesis genes and identification of an evolutionarily conserved gene required for bacteriochlorophyll accumulation. J. Gen. Microbiol. 139:897-906.

10. Amheim, K., and J. Oelze. 1983. Differences in the control of bacteriochlorophyll formation by light and oxygen. Arch. Microbiol. 135:299-304.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 11. Avissar, Y. J., and S. I. Beale. 1989. Identification of the enzymatic basis for 5-aminolevulinic acid auxotrophy in a hemA mutant of Escherichia coli. J. Bacteriol. 171:2919-2924.

12. Avissar, Y. J., J. G. Ormerod, and S. I. Beale. 1989. Distribution of ^-aminolevulinic acid biosynthetic pathways among phototrophic bacterial groups. Arch. Microbiol. 151:513-519.

13. Avtges, P., R. G. Kranz, and R. Haselkom. 1985. Isolation and organization of genes for nitrogen fixation in Rhodopseudomonas capsu/ata. Mol. Gen. Genet. 201:363-369.

14. Awan, S. J., G. Siligardi, P. M. Shoolingin-Jordan, and M. J. Warren. 1997. Reconstitution of the holoenzyme form of Escherichia coli porphobilinogen deaminase from apoenzyme with porphobilinogen and preuroporphyrinogen: A study using circular dichroism spectroscopy. Biochemistry 36:9273-9282.

15. Battle, A. M. d. C., A. M. Ferramola, and M. Grinstein. 1970. <5-aminolevulinic acid dehydratase (Cow liver). Methods Enzymol. 16:216-220.

16. Battersby, A. R., C. J. R. Fookes, K. E. Gustafson-Potter, and G. W. J. Matcham. 1979. Proof by synthesis that unrearranged hydroxymethylbilane is the product from deaminase and the substrate for cosynthetase in the biosynthesis of uro'gen-lll. Journal of the Chemical Society. Chemical Communications. 1155-1158.

17. Battersby, A. R., C. J. R. Fookes, G. W. J. Matcham, and E. McDonald. 1979. Order of assembly of the four pyrrole rings during biosynthesis of the natural porphyrins. Journal of the Chemical Society. Chemical Communications. 539-541.

18. Battersby, A. R., C. J. R. Fookes, G. W. J. Matcham, E. McDonald, and K. E. Gustafson-Potter. 1979. Biosynthesis of the natural porphyrins: Experiments on the ring-closure steps and with the hydroxy-analog of porphobilinogen. Journal of the Chemical Society. Chemical Communications. 316-319.

19. Bauer, C. E., and T. H. Bird. 1996. Regulatory circuits controlling photosynthesis gene expression. Cell 85:5-8.

20. Bauer, C. E., and B. L. Marts. 1988. Rhodobacter capsulatus operonpuf encodes a regulatory protein (PufQ) for bacteriochlorophyll biosynthesis. Proceedings of the National Academy of Sciences. USA. 85:7074-7078.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 21. Bauer, C. E., D. A. Young, and B. L. Marrs. 1988. Analysis of the Rhodobacter capsulatus operon.puf J. Biol. Chem. 263:4820-4827.

22. Bawden, M. J., I. A. Borthwick, H. M. Healy, C. P. Morris, B. K. May, and E. H. Elliot. 1987.Sequence of human 5-aminolevulinate synthase cDNA. Nucl. Acids Res. 15:8563.

23. Beale, S. I. 1990. Biosynthesis of the tetrapyrrole pigment precursor, 5-aminolevulinic acid, from glutamate. Plant Physiol. 93:1273-1279.

24. Beale, S. I., and P. A. Castelfranco. 1974. The biosynthesis of 5-aminolevulinic acid in higher plants. I. Accumulation of 5-aminolevulinic acid in greening plant tissues. Plant Physiol. 53:291-296.

25. Beaumont, C., C. Porcher, C. Picat, Y. Nordmann, and B. Grandchamp. 1989. The mouse porphobilinogen deaminase gene. J. Biol. Chem. 264:14829-14834.

26. Berry, A., P. M. Jordan, and J. S. Seehra. 1981. The isolation and characterization of catalytically competent porphobilinogen deaminase-intermediate complexes. FEBS Lett. 129:220-224.

27. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300.

28. Biel, A. J. 1986. Control of bacteriochlorophyll accumulation by light in Rhodobacter capsulatus. J. Bacteriol. 168:655-659.

29. Biel, A. J. 1992.Oxygen-regulated steps in the Rhodobacter capsulatus tetrapyrrole biosynthetic pathway. J. Bacteriol. 174:5272-5274.

30. Biel, A. J., and B. L. Marrs. 1985. Oxygen does not directly regulate carotenoid biosynthesis in Rhodobacter capsuiata. J. Bacteriol. 162:1320-1321.

31. Biel, A. J., and B. L. Marrs. 1983. Transcriptional regulation of several genes for bacteriochlorophyll biosynthesis in Rhodopseudomonas capsuiata in response to oxygen. J. Bacteriol. 156:686-694.

32. Biel, S. W., and A. J. Biel. 1990. Isolation of a Rhodobacter capsulatus mutant that lacks c-type cytochromes and excretes porphyrins. J. Bacteriol. 172:1321-1326.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 33. Biel, S. W., M. S. Wright, and A. J. Biel. 1988. Cloning of the Rhodobacter capsulatus hemA gene. J. Bacteriol. 170:4382-4384.

34. Bimboim, H. C., and J. Doly. 1979. A rapid alkaline procedure for rapidly screening recombinant plasmid DNA. Nucl. Acids Res. 7:1513-1523.

35. Bishop, T. R., P. J. Cohen, S. H. Boyer, A. N. Noyes, and L. P. Frelin. 1986. Isolation of a rat liver 5-aminolevulinate dehydratase (ALAD) cDNA clone: Evidence for unequal ALAD gene dosage among inbred mouse strains. Proc. Natl. Acad. Sci. USA 83:5568-5572.

36. Boese, Q. F., A. J. Spano, J. Li, and M. P. Timko. 1991. Aminolevulinic acid dehydratase in pea (Pisium satvium L). J. Biol. Chem. 266:17060-17066.

37. Bogorad, L. 1958. The enzymatic synthesis of porphyrins from porphobilinogen. I. Uroporphyrin I. J. Biol. Chem. 233:501-509.

38. Bogorad, L. 1962. Porphyrin synthesis. I. Uroporphyrinogen I synthetase. Methods Enzymol. 5:885-891.

39. Bogorad, L., and S. Granick. 1953. The enzymatic synthesis of porphyrins from porphobilinogen. Proc. Natl. Acad. Sci. USA 39:1176-1188.

40. Borralho, L. M., C. H. D. Oritz, A. D. Panek, and J. R. Mattoon. 1990. Purification of 5-aminolevulinic acid dehydratase from genetically engineered yeast. Yeast 6:319-330.

41. Bottomly, S. S., and G. A. Smithee. 1968. Characterization and measurement of d-aminolevulinate synthase in bone marrow cell mitochondria. Biochim. Biophys. Acta 159:27-37.

42. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Molec. Biol. 41:459-472.

43. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.

44. Bryan, J. K. 1977. Molecular weights of protein multimers from polyacrylamide gel electrophoresis. Anal. Biochem. 78:513-519.

45. Buggy, J. J., M. W. Sganga, and C. E. Bauer. 1994. Characterization of a light-responding trans-activator responsible for differentially controlling

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. reaction center and light-harvesting-1 gene expression in Rhodobacter capsulatus. J. Bacteriol. 176:6936-6943.

46. Bumham, B. F., and J. Lascelles. 1963. Control of porphyrin biosynthesis through a negative-feedback mechanism. Biochem. J. 87:462-472.

47. Burton, G., P. E. Fagemess, S. Hosozawa, P. Jordan, and A. I. Scott. 1979.13C N.M.R. evidence for a new intermediate, pre-uroporphyrinogen, in the enzymic transformation of porphobilinogen into uroporphyrinogens I and III. Journal of the Chemical Society. Chemical Communications. 202-204.

48. Camadro, J.-M., H. Chambon, J. Jolles, and P. Labbe. 1986. Purification and properties of coproporphyrinogen oxidase from the yeast Saccharomyces cerevisiae. Eur. J. Biochem. 156:579-587.

49. Cassadaban, M., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Molec. Biol. 138:179-207.

50. Cauthen, S. E., J. R. Pattison, and J. Lascelles. 1967. Vitamin B12 in photosynthetic bacteria and methionine synthesis by Rhodopseudomonas sphaeroides. Biochem. J. 102:774-781.

51. Cavaleiro, J. A. S., G. W. Kenner, and K. M. Smith. 1974. Pyrroles and related compounds. XXXII. Biosynthesis of protoporphyrin IX from coproporphyrinogen III. J. Chem Soc. Perkin. Trans. 1:1188-1194.

52. Chen, T. C., and G. W. Miller. 1974. Purification and characterization of uroporphyrinogen decarboxylase from tobacco leaves. Plant Cell Physiology 15:993-1005.

53. Clark, W. G., E. Davidson, and B. L. Marrs. 1984. Variation of levels of mRNA coding for antenna and reaction center polypeptides in Rhodopseudomonas capsuiata in response to changes in oxygen concentration. J. Bacteriol. 157:945-948.

54. Close, T. J., and R. L. Rodriguez. 1982. Construction and characterization of the chloramphenicol-resistance gene cartridge: a new approach to the transcriptional mapping of extrachromosoma! elements. Gene 20:305- 316.

55. Cohen-Bazire, G., W. R. Sistrom, and R. Y. Stanier. 1957. Kinetic studies of pigment synthesis by non-sulfur purple bacteria. Journal of Cellular Comparative Physiology 49:25-68.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 56. Coleman, D. L. 1970. ^-Aminolevulinic acid dehydratase (Mouse liver). Methods Enzymol. 16:211-216.

57. Conrad, R., and H. G. Schlegel. 1977. Different degradation pathways for glucose and fructose in Rhodopseudomonas capsuiata. Arch. Microbiol. 112:39-48.

58. Coomber, S. A., R. M. Jones, P. M. Jordan, and C. N. Hunter. 1992.A putative anaerobic coproporphyrinogen III oxidase in Rhodobacter sphaeroides. I. Molecular cloning, transposon mutagenesis and sequence analysis of the gene. Molec. Microbiol. 6:3159-3169.

59. Cooper, R. 1963. The biosynthesis of coproporphyrinogen, magnesium protoporphyrin monomethyl ester and bacteriochlorophyll by Rhodopseudomonas capsuiata. Biochem. J. 89:100-108.

60. Correa Garcia, S., M. V. Rossetti, M. Bermudez Moretti, and A. M. Battle. 1994. Yeast porphobilinogen deaminase also forms enzyme-pyrrole intermediates. Enzyme Protein 48:275-281.

61. Correa Garcia, S. R., M. V. Rossetti, and A. m. d. C. Batile. 1991. Studies on porphobilinogen-deaminase from Saccharomyces cerevisiae. Z. Naturforsch. 46c:1017-1023.

62. Crockett, N., P. R. Alefounder, A. R. Battersby, and C. Abell. 1991. Uroporphyrinogen III synthase: Studies on its mechanism of action, molecular biology, and biochemistry. Tetrahedron 47:6003-6014.

63. Dailey, H. A., and S. W. Karr. 1987. Purification and characterization of murine protoporphyrinogen oxidase. Biochemistry 26:2697-2701.

64. Dailey, T. A., P. Meissner, and H. A. Dailey. 1994. Expression of a cloned protoporphyrinogen oxidase. J. Biol. Chem. 269:813-815.

65. Daldal, F., E. Davidson, and S. Cheng. 1987. Isolation of the structural genes for the Rieske Fe-S protein, cytochrome b and cytochrome cv All components of the ubiquinol: cytochrome c* oxidoreductase complex of Rhodopseudomonas capsuiata. J. Molec. Biol. 195:1-12.

66. Davies, R. C., and A. Neuberger. 1973. Polypyrroles formed from porphobilinogen and amines by uroporphyrinogen synthetase of Rhodopseudomonas sphaeroides. Biochem. J. 133:471-492.

67. Davis, B. J. 1964.Disc electrophoresis-ll: Method and application to human serum proteins. Ann. N.Y. Acad. Sci. 121:404-427.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 68. Delaunay, A.-M., C. Huault, and A. P. Balange. 1991. Molecular cloning of the 5-aminolevulinic acid dehydratase gene from Rhodobacter sphaeroides. J. Bacteriol. 173:2712-2715.

69. Diflumeri, C., R. Larocque, and T. Keng. 1993. Molecular analysis of HEM6(HEM12) in Saccharomyces cerevisiae, the gene for uroporphyrinogen decarboxylase. Yeast 9:613-623.

70. Ditta, G., T. Schmidhauser, E. Yakobson, P. Lu, X.-W. Liang, D. R. Finlay, D. Guiney, and D. R. Helinski. 1985. Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13:149-153.

71. Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351.

72. Droiet, M., L. Peloquin, Y. Echelard, L. Cousineau, and A. Sasarman. 1989. Isolation and nucleotide sequence of the hemA gene of Escherichia coli K12. Mol. Gen. Genet. 216:347-352.

73. Droiet, M., and A. Sasarman. 1991. Cloning and nucleotide sequence of the hemA gene of Agrobacterium radiobacter. Mol. Gen. Genet. 226:250-256.

74. Echelard, Y., J. Dymetryszyn, M. Droiet, and A. Sasarman. 1988. Nucleotide sequence of hemB gene of Escherichia coli K12. Mol. Gen. Genet. 214:503-508.

75. Einav, M., and Y. J. Avissar. 1984. The biosynthesis of 5-aminolevulinate from glutamate in the blue-green alga Spirulina platensis. Plant Science Letters 35:51-54.

76. Elder, G. H., and A. G. Roberts. 1995. Uroporphyrinogen decarboxylase. J. of Bioenergetics and Biomembranes 27:207-214.

77. Elder, G. H., J. A. Tovey, and D. M. Sheppard. 1983. Purification of uroporphyrinogen decarboxylase from human erythrocytes. Immunological evidence for a single protein with decarboxylase activity in human erythrocytes and liver. Biochem. J. 215:45-55.

78. Elliot, T. 1989. Cloning, genetic characterization, and nucleotide sequence of the hemA-prfA operon of Salmonella typhimurium. J. Bacteriol. 171:3948-3960.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 79. Elliot, T., and J. R. Roth. 1989.Heme-deficient mutants of Salmonella typhimurium: Two genes required for ALA synthesis. Mol. Gen. Genet. 216:303-314.

80. Evans, J. N. S., R. C. Davies, A. S. F. Boyd, I. Ichinose, N. E. Mackenzie, A. I. Scott, and R. L. Baxter. 1986. Biosynthesis of porphyrins and Corrins. 1 .1H and 13C NMR spectra of (Hydroxymethyl)bilane and uroporphyrinogens I and III. Biochemistry 25:896-904.

81. Fanica-Gaignier, M., and J. Clement-Metral. 1973. 5-Aminolevulinic-acid synthetase of Rhodopseudomonas sphaeroides Y. Kinetic mechanism and inhibition by ATP. Eur. J. Biochem. 40:19-24.

82. Fanica-Gaignier, M., and J. Clement-Metral. 1973. 5-Aminolevulinic-acid synthetase of Rhodopseudomonas sphaeroides Y. Purification and some properties. Eur. J. Biochem. 40:13-18.

83. Felix, F., and N. Brouillet. 1990. Purification and properties of uroporphyrinogen decarboxylase from Saccharomyces cerevisiae. Eur. J. Biochem. 188:393-403.

84. Ferreira, G. C., and H. A. Dailey. 1988. Mouse protoporphyrinogen oxidase. Biochem. J. 250:597-603.

85. Fidai, S., J. A. Dahl, and W. R. Richards. 1995. Effect of the PufQ protein on the early steps in the pathway of bacteriochlorophyll biosynthesis in Rhodobacter capsulatus. FEBS Lett. 372:264-268.

86. Fidai, S., S. B. Hinchigeri, T. J. Borgford, and W. R. Richards. 1994. Identification of the PufQ protein in membranes of Rhodobacter capsulatus. J. Bacteriol. 176:7244-7251.

87. Fidai, S., G. B. Kalmar, W. R. Richards, and T. J. Borgford. 1993. Recombinant expression of the pufQ gene of Rhodobacter capsulatus. J. Bacteriol. 175:4834-4842.

88. Frankenberg, N., T. Kittel, C. Hungerer, U. Ronlig, and D. Jahn. 1998. Cloning, mapping and functional characterization of the hemB gene of Pseudomonas aeruginosa, which encodes a magnesium-dependant 5-aminolevulinic acid dehydratase. Mol. Gen. Genet. 257:485-489.

89. Friedmann, H. C., R. K. Thauer, S. P. Gough, and C. G. Kannangara. 1987. 5-aminolevulinic acid formation in the archaebacterium Methanobacterium thermoautotrophicum requires tRNAau. Carlsberg Res. Comm. 52:363-371.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 90. Frydman, R. B., and G. Feinstein. 1974. Studies on porphobilinogen deaminase and uroporphyrinogen III cosynthase from human erythrocytes. Biochim. Biophys. Acta 350:358-373.

91. Frydman, R. B., and B. Frydman. 1970. Purification and properties of porphobilinogen deaminase from wheat germ. Arch. Biochem. Biophys. 136:193-202.

92. Frydman, R. B., M. L. Tomaro, and B. Frydman. 1979. Porphobilinogen oxygenase from human erythrocytes. Clinica Chimica Acta 97:269-278.

93. Frydman, R. B., M. L. Tomaro, A. Wanschelbaum, E. M. Anderson, J. Awruch, and B. Frydman. 1973. Porphobilinogen oxygenase from wheat germ: Isolation, properties, and products formed. Biochemistry 12:5253-5262.

94. Fujino, E., T. Fujino, S. Karita, K. Sakka, and K. Ohmiya. 1995. Cloning and sequencing of some genes responsible for porphyrin biosynthesis from the anaerobic bacterium Clostridium josui. J. Bacteriol. 177:5169-5175.

95. Garey, J. R., R. Labbe-Bois, A. Chelstowska, J. Rytka, L. Harrison, J. Kushner, and P. Labbe. 1992. Uroporphyrinogen decarboxylase in Saccharomyces cerevisiae. HEM12 gene sequence and evidence for two conserved glycines essential for enzymatic activity. Eur. J. Biochem. 205:1011-1016.

96. Gibson, K. D. 1958. Biosynthesis of 5-aminolevulinate acid by extracts of Rhodopseudomonas sphaeroides. Biochim. Biophys. Acta 28:451.

97. Gicquel-Sanzey, B., and P. Cossart. 1982. Homologies between different prokaryotic DNA-binding regulatory proteins and between their sites of action. EMBO J. 1:591-595.

98. Gough, J. A., and M. N.E. 1983. Sequence diversity among related genes for recognition of specific targets in DNA molecules. J. Molec. Biol. 166:1-19.

99. Granick, S., and S. i. Beale. 1978. Hemes, chlorophylls and related compounds: biosynthesis and metabolic regulation. Advan. Enzymology 40:33-203.

100. Hadener, A., P. R. Alefounder, G. J. Hart, C. Abell, and A. R. Battersby. 1990. Investigation of putative active-site lysine residues in hydroxymethylbilane synthase. Biochem. J. 271:487-491.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 101. Hadener, A., P. K. Matzinger, V. N. Malashkevich, G. V. Louie, S. P. Wood, P. Oliver, P. R. Alefounder, A. R. Pitt, C. Abell, and A. R. Battersby. 1993. Purification, characterization, crystallization and X-ray analysis of selenomethane-labeied hydroxymethylbilane synthase from Escherichia coli. Eur. J. Biochem. 211:615-624.

102. Hansson, M., and L. Hederdtedt. 1994. Bacillus subtilis HemY is a peripheral membrane protein essential for protoheme IX synthesis which can oxidize coproporphyrinogen III and protoporphyrinogen IX. J. Bacteriol. 176:5962-5970.

103. Hansson, M., and L. Hederstedt. 1992. Cloning and characterization of the Bacillus subtilis hemEHY gene cluster, which encodes protoheme IX biosynthetic enzymes. J. Bacteriol. 174:8081-8093.

104. Hansson, M., L. Rutberg, I. Schroder, and L. Hederstedt. 1991. The Bacillus subtilis hemAXCDBL gene cluster, which encodes enzymes of the biosynthetic pathway from glutamate to uroporphyrinogen III. J. Bacteriol. 173:2590-2599.

105. Hart, G. J., C. Abell, and A. R. Battersby. 1986. Purification, N-terminal amino acid sequence and properties of hydroxymethylbilane synthase (porphobilinogen deaminase) from Escherichia coli. Biochem. J. 240:273-276.

106. Hart, G. J., and A. R. Battersby. 1985. Purification and properties of uroporphyrinogen III synthase (co-synthetase) from Euglena gracilis. Biochem. J. 232:151-160.

107. Hart, G. J., F. J. Leeper, and A. R. Battersby. 1984. Modification of hydroxymethylbilane synthase (porphobilinogen deaminase) by pyridoxal 5'-phosphate. Biochem. J. 222:93-102.

108. Hart, G. J., A. D. Miller, and A. R. Battersby. 1988. Evidence that the pyrromethane cofactor of hydroxymethylbilane synthase (porphobilinogen deaminase) is bound through the sulphur atom of a cysteine residue. Biochem. J. 252:909-912.

109. Hart, G. J., A. D. Miller, U. Beifuss, F. J. Leeper, and A. R. Battersby. 1990. Biosynthesis of porphyrins and related macrocycles. Part 35. Discovery of a novel dipyrrolic cofactor essential for the catalytic action of hydroxymethylbilane synthase (porphobilinogen deaminase). Journal of the Chemical Society. Perkin Transactions. 1:1979-1993.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 110. Heyningen, S. v., and D. Shemin. 1971. Quaternary structure of 5-aminolevulinate dehydratase from Rhodopseudomonas sphaeroides. Biochemistry 10:4676-4682.

111. Higuchi, M., and L. Bogorad. 1975. The purification and properties of uroporphyrinogen I synthases and uroporphyrinogen III cosynthase. Interactions between the enzymes. Annals of the New York Academy of Sciences 244:401-418.

112. Hoare, D. S., and H. Heath. 1959. The biosynthesis of porphyrins from porphobilinogen by Rhodopseudomonas sphaeroides. The partial purification and some properties of porphobilinogen deaminase and uroporphyrinogen decarboxylase. Journal of Biochemistry 73:679-690.

113. Homberger, U., R. Liebetanz, H.-V. Tichy, and G. Drews. 1990. Cloning and sequencing of the hemA gene of Rhodobacter capsulatus and isolation of a 5-aminolevulinic acid-dependant mutant strain. Mol. Gen. Genet. 221:371-378.

114. Homberger, U., B. Wieseler, and G. Drews. 1991. Oxygen tension regulated expression of the hemA gene of Rhodobacter capsulatus. Arch. Microbiol. 156:129-134.

115. Houghton, J. D., C. L. Honeyboume, K. M. Smith, H. D. Tabba, and O. T. G. Jones. 1982.The use of N-methylprotoporphyrin dimethyl ester to inhibit fierrochelatase in Rhodopseudomonas sphaeroides and its effect in promoting biosynthesis of magnesium tetrapyrroles. Biochem. J. 208:479-486.

116. Huang, D. H. 1996. Porphyrin accumulation in the Rhodobacter capsulatus mutants AJB456 and AJB530. M.S. Thesis. Louisiana State University, Baton Rouge, Louisiana.

117. Hungerer, C., D. S. Weiss, R. K. Thauer, and D. Jahn. 1996. The hemA gene encoding glutamyl-tRNA reductase from the archeon Methanobacterium thermoautotrophicum strain Marburg. Bioorg. Med. Chem. 4:1089-1095.

118. Hunter, C. N., and S. A. Coomber. 1988. Cloning and oxygen-regulated expression of the bacteriochlorophyll biosynthesis genes bch E, B, A and C of Rhodobacter sphaeroides. J. Gen. Microbiol. 134:1491-1497.

119. Indest, K. 1995. Molecular cloning, sequencing, and regulation of the Rhodobacter capsulatus hemB gene. Ph.D. Louisiana State University, Baton Rouge, LA.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 120. Indest, K., and A. J. Biel. 1995. Nucleotide sequence of the Rhodobacter capsulatus hemB gene. Plant Physiol. 108:421.

121. Ineichen, G. 1996. Cloning, Sequencing and Regulation of the Rhodobacter capsulatus hemE gene. Ph.D. Louisiana State University, Baton Rouge, LA.

122. Ineichen, G., and A. J. Biel. 1995. Nucleotide sequence of the Rhodobacter capsulatus hemE gene. Plant Physiol. 108:423.

123. Jacobs, J. M., and N. J. Jacobs. 1984. Effect of unsaturated fatty acids on protoporphyrinogen oxidation, a step in heme and chlorophyll synthesis in plant organelles. Biochem. Biophys. Res. Comm. 123:1157- 1164.

124. Jacobs, J. M., and N. J. Jacobs. 1987. Oxidation of protoporphyrinogen to protoporphyrin, a step in chlorophyll and heam biosynthesis: Purification and partial characterization of the enzyme from barley organelles. Biochem. J. 244:219-224.

125. Jacobs, N. J., and J. M. Jacobs. 1975. Fumarate as alternative electron acceptor for the late steps in anaerobic heme synthesis in Escherichia coli. Biochem. Biophys. Res. Comm. 65:435-441.

126. Jacobs, N. J., and J. M. Jacobs. 1976. Nitrate, fumarate, and oxygen as electron acceptors for a late step in microbial heme synthesis. Biochem. Biophys. Res. Comm. 449:1-9.

127. Jacobs, N. J., and J. M. Jacobs. 1981. Protoporphyrinogen oxidation in Rhodopseudomonas sphaeroides, a step in heme and bacteriochlorophyll synthesis. Arch. Biochem. Biophys. 211:305-311.

128. Jones, M. C., J. M. Jenkins, A. G. Smith, and C. J. Howe. 1994. Cloning and characterization of genes for tetrapyrrole biosynthesis from the cyanobacterium Anacystis nidulans R2. Plant Mol. Bio. 24:435-448.

129. Jones, M. S., and O. T. G. Jones. 1970. Ferrochelatase of Rhodopseudomonas sphaeroides. Biochem. J. 119:453-462.

130. Jones, O. T. G. 1963. The production of magnesium protoporphyrin monomethyl ester by Rhodopseudomonas sphaeroides. Biochem. J. 86:429.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 131. Jones, R. M., and P. M. Jordan. 1994. Purification and properties of porphobilinogen deaminase from Arabidopsis thaliana. Biochem. J. 299:895-902.

132. Jones, R. M., and P. M. Jordan. 1993. Purification and properties of the uroporphyrinogen decarboxylase from Rhodobacter sphaeroides. Biochem. J. 293:703-712.

133. Jordan, P. M., and A. Berry. 1981. Mechanism of action of porphobilinogen deaminase. Biochem. J. 195:177-181.

134. Jordan, P. M., G. Burton, H. Nordlov, M. M. Schnieder, L. Pryde, and A. I. Scott. 1979. Pre-uroporphyrinogen: a substrate for uroporphyrinogen III cosynthetase. Journal of the Chemical Society. Chemical Communications. 204-205.

135. Jordan, P. M., B. I. A. Mgbeje, A. F. Alwan, and S. D. Thomas. 1987. Nucleotide sequence of hemD, the second gene in the hem operon of Escherichia coli K-12. Nucl. Acids Res. 15:10583.

136. Jordan, P. M., B. I. A. Mgbeje, S. D. Thomas, and A. F. Alwan. 1988. Nucleotide sequence for the hemD gene of Escherichia coli encoding uroporphyrinogen III synthase and initial evidence for a hem operon. Biochem. J. 249:613-616.

137. Jordan, P. M., and D. Shemin. 1973. Purification and properties of uroporphyrinogen I synthetase from Rhodopseudomonas sphaeroides. J. Biol. Chem. 248:1019-1024.

138. Jordan, P. M., S. D. Thomas, and M. J. Warren. 1988. Purification, crystallization and properties of porphobilinogen deaminase from a recombinant strain of Escherichia coli K12. Biochem. J. 254:427-435.

139. Jordan, P. M., and M. J. Warren. 1987. Evidence for a dipyrromethane cofactor at the catalytic site of E. coli porphobilinogen deaminase. FEBS Lett. 225:87-92.

140. Jordan, P. M., M. J. Warren, and B. I. A. Mgbeje. 1992. Crystallization and preliminary x-ray investigation of Escherichia coli porphobilinogen deaminase. J. Molec. Biol. 224:269-271.

141. Jordan, P. M., M. J. Warren, H. J. Williams, N. J. Stolowich, C. A. Roessner, S. K. Grant, and A. I. Scott. 1988. Identification of a cysteine residue as the binding site for the dipyrromethane cofactor at

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. the active site of Escherichia coli porphobilinogen deaminase. FEBS Lett. 235:189-193.

142. Jordan, P. M., and S. C. Woodcock. 1991. Mutagenesis of arginine residues in the catalytic cleft of Escherichia coli porphobilinogen deaminase that affects dipyrromethane cofactor assembly and tetrapyrrole chain initiation and elongation. Biochem. J. 280:445-449.

143. Juknat, A. A., D. Domemann, and H. Senger. 1994. Purification and kinetic studies on a porphobilinogen deaminase from the unicellular green alga Scenedesmus obliquous. Planta 193:123-130.

144. Juknat, A. A., M. L. Kotler, G. E. Koopman, and A. M. C. Battle. 1989. Porphobilinogenase from Rhodopseudomonas palustris. Comp. Biochem. Physiol. 92B:291-295.

145. Kafala, B., and A. Sasarman. 1997. Isolation of the Staphylococcus aureus hemCDBL gene cluster coding for the early steps in heme biosynthesis. Gene 199:231-239.

146. Kafala, B., et al. 1994. Cloning and sequence analysis of the hemB gene of Staphylococcus aureus. Can. J. Microbiol. 40:651-657.

147. Kanazireva, E., and A. J. Biel. 1995. Cloning and overexpression of the Rhodobacter capsulatus hemH gene. J. Bacteriol. 177:6693-6694.

148. Kanazireva, E., and A. J. Biel. 1996. Nucleotide sequence of the Rhodobacter capsulatus hemH gene. Gene 170:149-150.

149. Kanazireva, E. V. 1997. Cloning, sequencing, and regulation of the Rhodobacter capsulatus hemH gene. Ph.D. Louisiana State University, Baton Rouge, LA.

150. Kawanishi, S., Y. Seki, and S. Sano. 1983. Uroporphyrinogen decarboxylase. Purification, properties, and inhibition by polychlorinated bipheny isomers. J. Biol. Chem. 258:4285-4292.

151. Keithly, J. H., and K. D. Nadler. 1983. Protoporphyrin formation in Rhizobium japonicum. J. Bacteriol. 154:838-845.

152. Keng, T., C. Richard, and R. Laroque. 1992. Structure and regulation of yeast HEM3, the gene for porphobilinogen deaminase. Mol. Gen. Genet. 234:233-243.

100

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 153. Kikuchi, G., A. Kumor, P. Talmage, and D. Shemin. 1958. The enzymatic synthesis of 5-aminolevulinic acid. J. Biol. Chem. 233:1214-1219.

154. Klemm, D. J., and L. L.Barton. 1987. Purification and properties of protoporphyrinogen oxidase from an anaerobic bacterium, Desulfovibrio gigas. J. Bacteriol. 169:5209.

155. Kohno, H., T. Furukawa, T. Yoshinaga, R. Tokunaga, and S. Taketani. 1993. Coproporphyrinogen Oxidase. Purification, molecular cloning, and induction of mRNA during erythroid differentiation. J. Biol. Chem. 268:21359-21363.

156. Koopman, G. E., and A. M. C. Battle. 1987. Biosynthesis of porphyrins in Rhodopseudomonas palustris-Vl. The effect of metals, thiols and other reagents on the activity of uroporphyrinogen decarboxylase. Int. J. Biochem. 19:373-377.

157. Kotler, M. L., S. A. Fumagalli, A. A. Juknat, and A. M. C. Batlle. 1987. Porphyrin biosynthesis in Rhodopseudomonas palustris-IX. PBG-deaminase. Kinetic studies. Int. J. Biochem. 19:981-985.

158. Kotler, M. L., S. A. Fumagalli, A. A. Juknat, and A. M. C. Batlle. 1987. Porphyrin biosynthesis in Rhodopseudomonaspalustris-\/\\\. Purification and properties of deaminase. Comp. Biochem. Physiol. 87B:601-606.

159. Kranz, R. G. 1989. Isolation of mutants and genes involved in cytochromes c biosynthesis in Rhodobacter capsulatus. J. Bacteriol. 171:456-464.

160. Kruse, E., H. P. Mock, and B. Grimm. 1995. Coproporphyrinogen III oxidase from barley and tobacco. Sequence analysis and initial expression studies. Planta 196:796-803.

161. Lambert, R., P. D. Brownlie, S. C. Woodcock, G. V. Louie, J. C. Cooper, M. J. Warren, P. M. Jordan, T. L. Blundell, and S. P. Wood. 1994. Structural studies on porphobilinogen deaminase. Ciba Foundation Symposium 180:97-110.

162. Lander, M., A. R. Pitt, P. R. Alefounder, D. Bardy, C. Abell, and A. R. Battersby. 1991. Studies on the mechanism of hydroxymethylbilane synthase concerning the role of arginine residues in substrate binding. Biochem. J. 275:447-452.

101

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 163. Lascelles, J. 1966. The accumulation of bacteriochlorophyll precursors by mutant and wild-type strains of Rhodopseudomonas sphaeroides. Biochem. J. 100:175-183.

164. Lascelles, J. 1959. Adaptation to form bacteriochlorophyll in Rhodopseudomonas sphaeroides: Changes in activity of enzymes concerned in pyrrole synthesis. Biochemistry 72:508-518.

165. Lascelles, J. 1978.The regulation of pyrroles, p. 795.In R. K. Clayton and W. R. Sistrom (ed.), The photosynthetic bacteria. Plenum Press, New York.

166. Lascelles, J. 1956.The synthesis of porphyrins and bacteriochlorophyll by cell suspensions of Rhodopseudomonas sphaeroides. Biochem. J. 62:78-93.

167. Lascelles, J. 1964. Tetrapyrrole biosynthesis and its regulators. W.A. Benjamin, New York and Amsterdam.

168. Lascelles, J., and T. P. Hatch. 1969. Bacteriochlorophyll and heme synthesis in Rhodopseudomonas sphaeroides: Possible role of heme in regulation of the branched biosynthetic pathway. J. Bacteriol. 98:712-720.

169. Leeper, F. J. 1994. The evidence for a spirocyclic intermediate in the formation of uroporphyrinogen III by cosynthase. Ciba Foundation Symposium 180:111 -130.

170. Leong, S. A., G. S. Ditta, and D. R. Helinski. 1982. Heme biosynthesis in Rhizobium. Identification of a cloned gene coding for 5-aminolevulinic acid synthetase from Rhizobium meliloti. J. Biol. Chem. 257:8724-8730.

171. Lermontova, I., E. Kruse, H. P. Mock, and B. Grimm. 1997.Cloning and characterization of a plastidal and a mitochondrial isoform of tobacco protoporphyrinogen IX oxidase. Proc. Natl. Acad. Sci. USA 94:8895-8900.

172. Levin, E. Y. 1971. Enzymatic properties of uroporphyrinogen III cosynthetase. Biochemistry 10:4669-4675.

173. Levin, E. Y. 1968. Uroporphyrinogen III cosynthetase from mouse spleen. Biochemistry 7:3781-3788.

102

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 174. Li, J.-M., O. Brathwaite, S. D. Cosloy, and C. S. Russel. 1989. 5-Aminolevulinic acid synthesis in Escherichia coli. J. Bacteriol. 171:2547-2552.

175. Li, J.-M., H. Umanoff, R. Proenca, C. S. Russel, and S. D. Cosley. 1988. Cloning of the Escherichia coli K-12 hemB gene. J. Bacteriol. 170:1021-1025.

176. Li, J. M., C. S. Russel, and S. D. Cosloy. 1989. The structure of the Escherichia coli hemB gene. Gene 75:177-184.

177. Liedgens, W., C. Lutz, and H. A. W. Schnieder. 1983. Molecular properties of 5-aminolevulinic acid dehydratase from Sinacia olereia. Eur. J. Biochem. 135:75-79.

178. Lim, S. H., M. Witty, A. D. M. Wallace-Cook, L. I. Ilag, and A. G. Smith. 1994. Porphobilinogen deaminase is encoded by a single gene in Arabidopsis thaliana and is targeted to the chloroplasts. Plant Mol. Bio. 26:863-872.

179. Llambias, E. B. C., and A. M. C. Batlle. 1971. Porphyrin biosynthesis. VIII. Avian erythrocyte porphobilinogen deaminase-uroporphyrinogen III cosynthetase, its purification, properties and the separation of its components. Biochim. Biophys. Acta 227:180-191.

180. Llambias, E. B. C., and A. M. C. Batlle. 1971. Studies on the porphobilinogen deaminase-uroporphyrinogen cosynthetase system of cultured soya-bean cells. Biochem. J. 121:327-340.

181. Louie, G. V., P. D. Brownlie, R. Lambert, J. B. Cooper, T. L. Blundell, S. P. Wood, M. J. Warren, S. C. Woodcock, and P. M. Jordan. 1992. Structure of porphobilinogen deaminase reveals a flexible multidomain polymerase with a single catalytic site. Nature 359:33-39.

182. Luo, J., and C. K. Lim. 1993. Order of uroporphyrinogen III decarboxylation on incubation of porphobilinogen and uroporphyrinogen III with erythrocyte uroporphyrinogen decarboxylase. Biochem. J. 289:529-532.

183. Ma, D., D. N. Cook, D. A. O'Brien, and J. E. Hearst. 1993. Analysis of the promoter and regulatory sequences of an oxygen-regulated bch operon in Rhodobacter capsulatus by site-directed mutagenesis. J. Bacteriol. 175:2037-2045.

103

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 184. Madigan, M., J. C. Cox, and H. Gest. 1982. Photopigments in Rhodopseudomonas capsulatus cells grown anaerobically in darkness. J. Bacteriol. 150:1422-1429.

185. Madigan, M. T., and H. Gest. 1978. Growth of a photosynthetic bacterium anaerobically in darkness, supported by "Oxidant-Dependant" sugar fermentation. Arch. Microbiol. 117:119-122.

186. Madigan, M. T., and G. H. 1979. Growth of the photosynthetic bacterium Rhodopseudomonas capsuiata chemoautotrophically in darkness with hydrogen as the energy source. J. Bacteriol. 137:524-530.

187. Maguire, 0. J., A. R. Day, A. Borthwick, G. Srivastava, P. L. Wigley, B. K. May, and W. H. Elliot. 1986. Nucleotide sequence of the chicken 5-aminolevulinic acid synthase gene. Nucl. Acids Res. 14:1379-1391.

188. Majumdar, D., Y. J. Avissar, J. H. Wyche, and S. I. Beale. 1991. Structure and expression of the Chlorobium vibrioforme hemA gene. Arch. Microbiol. 156:281-289.

189. Majumdar, D., and J. H. Wyche. 1997. Molecular cloning and nucleotide sequence of the porphobilinogen deaminase gene, hemC, from Chlorobium vibrioforme. Curr. Microbiol. 34:258-263.

190. Maralihalli, G. B., S. R. Rao, and A. S. Bhagwat. 1985. Histidine residues at the active site of maize delta-aminolevulinic acid dehydratase. Phytochem. 24:2533-2536.

191. Marrs, B. 1981. Mobilization of the genes for photosynthesis from Rhodopseudomonas capsuiata by a promiscuous plasmid. J. Bacteriol. 146:1003-1012.

192. Matsudaira, P. 1987. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262:10035-10038.

193. Mauzerall, D., and S. Granick. 1956. The occurrence and determination of 5-aminolevulinic acid and porphobilinogen in urine. J. Biol. Chem. 219:435-446.

194. Mauzerall, D., and S. Granick. 1958. Porphyrin biosynthesis in erythrocytes. III. Uroporphyrinogen and its decarboxylase. J. Biol. Chem. 232:1141.

104

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 195. Mazzetti, M. B., and J. M. Tomio. 1988. Characterization of porphobilinogen deaminase from rat liver. Biochim. Biophys. Acta 957:97-104.

196. McClung, C. R., J. E. Somerville, M. L. Guerinot, and B. K. Chelm. 1987. Structure of the Bradyrhizobium japonicum gene hemA encoding 5-aminolevulinic acid synthase. Gene 54:133-139.

197. McEwan, A. G. 1994. Photosynthetic electron transport and anaerobic metabolism in purple non-sulfur phototrophic bacteria. Antonie van Leeuwenhoek 66:151-164.

198. Miller, A. D., G. J. Hart, L. C. Packman, and A. R. Battersby. 1988. Evidence that the pyrromethane cofactor of hydroxymethylbilane synthase (porphobilinogen deaminase) is bound to the protein through the sulphur atom of cysteine-242. Biochem. J. 254:915-918.

199. Miller, A. D., L. C. Packman, G. J. Hart, P. R. Alefounder, C. Abell, and A. R. Battersby. 1989. Evidence that pyridoxal phosphate modification of lysine residues (Lys-55 and Lys-59) causes inactivation of hydroxymethylbilane synthase (porphobilinogen deaminase). Biochem. J. 262:119-124.

200. Mitchell, L. W., and E. K. Jaffe. 1993. Porphobilinogen synthase from Escherichia coli is a Zn(ll) metalloenzyme stimulated by Mg(ll). Arch. Biochem. Biophys. 300:169-177.

201. Miyagi, K., M. Kaneshima, J. Kawakami, F. Nakada, Z. J. Petryka, and C. J. Watson. 1979. Uroporphyrin I synthase from human erythrocytes: Separation, purification, and properties of isoenzymes. Proc. Natl. Acad. Sci. USA 76:6172-6176.

202. Moberg, P. A., and Y. J. Avissar. 1994. A gene cluster in Chlorobium vibrioforme encoding the first enzymes of chlorophyll biosynthesis. Photosynth. Res. 41:253-260.

203. Mock, H.-P., L. Trainotti, E. Kruse, and B. Grimm. 1995. Isolation, sequencing and expression of cDNA sequences encoding uroporphyrinogen decarboxylase from tobacco and barley. Plant Mol. Bio. 28:245-256.

204. Mohr, C. D., S. K. Sonsteby, and V. Deretic. 1994. The Pseudomonas aeruginosa homologs ofhemC and hemD are linked to the gene encoding the regulator of mucoidy AlgR. Mol. Gen. Genet. 242:177-184.

105

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 205. Moore, M. R. 1993. Biochemistry of porphyria. Int. J. Biochem. 25:1353-1368.

206. Murphy, M. J., and L. M. Siegel. 1973. Siroheme and Sirohydrochlorin: The basis for a new type of porphyrin-related prosthetic group common to both assimilatory and dissimilatory sulfite reductases. J. Biol. Chem. 248:6911-6919.

207. Murphy, M. J., L. M. Siegel, S. R. Tove, and H. Kamin. 1974.Siroheme: A new prosthetic group participating in six-electron reduction reactions catalyzed by both sulfite and nitrite reductases. Proc. Natl. Acad. Sci. USA 71:612-616.

208. Myers, A. M., M. 0. Crivellonne, T. Koemer, and A. Tzagoloff. 1987. Characterization of the yeast HEM2 gene and transcriptional regulation of COX5 and COR1 by heme. J. Biol. Chem. 262:16822-16829.

209. Nandi, D. L., K. F. Baker-Cohen, and D. Shemin. 1968. (^-Aminolevulinic acid dehydratase of Rhodopseudomonas sphaeroides. I. Isolation and properties. J. Biol. Chem. 243:1224-1230.

210. Nandi, D. L., and D. Shemin. 1973. 5-aminolevulinic acid dehydratase of Rhodopseudomonas capsuiata. Arch. Biochem. Biophys. 158:305-311.

211. Nandi, D. L., and D. Shemin. 1968. ^-Aminolevulinic acid dehydratase of Rhodopseudomonas sphaeroides. II. Association to polymers and dissociation to subunits. J. Biol. Chem. 243:1231-1235.

212. Nandi, D. L., and D. Shemin. 1968. ^-Aminolevulinic acid dehydratase of Rhodopseudomonas sphaeroides. III. Mechanism of porphobilinogen synthesis. J. Biol. Chem. 243:1236-1242.

213. Nandi, D. L., and D. Shemin. 1977. Quaternary structure of 5-aminolevulinic acid synthase from Rhodopseudomonas sphaeroides. J. Biol. Chem. 252:2278-2280.

214. Narita, S., R. Tanaka, T. Ito, K. Okada, S. Taketani, and H. Inokuchi. 1996. Molecular cloning and characterization of a cDNA that encodes protoporphyrinogen oxidase of Arabidopsis thaliana. Gene 182:169-175.

215. Neidle, E. L., and S. Kaplan. 1993. 5-Aminolevulinic acid availability and control of spectral complex formation in hemA and hemT mutants of Rhodobacter sphaeroides. J. Bacteriol. 175:2304-2313.

106

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 216. Neidle, E. L., and S. Kaplan. 1993. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes. J. Bacteriol. 175:2292-2303.

217. Nishimura, K., T. Nakayashiki, and H. Inokucki. 1993. Cloning and sequencing of the hemE gene encoding uroporphyrinogen III decarboxylase (UPD) from Escherichia coli K-12. Gene 133:109-113.

218. Nishimura, K., S. Taketani, and H. Inokuchi. 1995. Cloning of a human cDNA for protoporphyrinogen oxidase by complementation in vivo of a hemG mutant of Escherichia coli. J. Biol. Chem. 270:8076-8080.

219. O'Farrell, P. H. 1975. High resolution two dimensional electrophoresis of proteins. J. Biol. Chem. 250:4007-4021.

220. O'Neill, G. P., M. W. Chen, and D. Soli. 1989. 5-aminolevulinic acid biosynthesis in Escherichia coli and Bacillus subtilis involves formation of glutamyl-tRNA. FEMS Lett. 60:255-260.

221. O'Neill, G. P., D. M. Peterson, A. Schon, M. Chen, and D. Soli. 1988. Formation of the chlorophyll precursor 5-aminolevulinic acid in cyanobacteria requires aminoacylation of a tRNAGLU species. J. Bacteriol. 170:3810-3816.

222. Oelze, J. 1988. Regulation of tetrapyrrole synthesis by light in chemostat cultures of Rhodobacter sphaeroides. J. Bacteriol. 170:4652-4657.

223. Oelze, J., and K. Amheim. 1983. Control of bacteriochlorophyll formation by oxygen and light in Rhodopseudomonas sphaeroides. FEMS Lett. 19:197-199.

224. Oh-hama, T., P. J. Santander, N. J. Stolowich, and A. I. Scott. 1991. Bacteriochlorophyll c formation via the C5 pathway of 5-aminolevulinic acid synthesis in Chloroflexus aurantiacus. FEBS Lett. 281:173-176.

225. Oh-hama, T., H. Seto, and S. Miyachi. 1986.13C-NMR evidence of bacteriochlorophyll a formation by the C5 pathway in Chromatium. Arch. Biochem. Biophys. 246:192-198.

226. Oh-hama, T., N. H. Stolowich, and A. I. Scott. 1988. 5-Aminolevulinic acid formation from glutamate via the C5 pathway in Clostridium thermoaceticum. FEBS Lett. 228:89-93.

107

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 227. Overington, J. P., Z.-Y. Zhu, A. Sali, M. S. Johnson, R. Sowdhamini, G. V. Louie, and T. L. Blundell. 1993. Molecular recognition in protein families: A database of aligned three-dimensional structures of related proteins. Biochem. Soc. Trans. 21:597-604.

228. Petricek, M., L. Rutberg, I. Schroder, and L. Hederstedt 1990. Cloning and characterization of the hemA region of the Bacillus subtilis chromosome. J. Bacteriol. 172:2250-2258.

229. Petrovich, R. M., S. Litwin, and E. K. Jaffa. 1996. Bradyrhizobium japonicum porphobilinogen synthase uses two Mg(ll) and monovalent cations. J. Biol. Chem. 271:8692-8699.

230. Pluscec, J., and L. Bogorad. 1970. A dipyrrylmethane intermediate in the enzymatic synthesis of uroporphyrinogen. Biochemistry 9:4736-4743.

231. Porra, R. J. 1986. Labelling of chlorophylls and precursors by [2-14C]glycine and 2-[1-14C]oxoglutarate in Rhodopseudomonas sphaeroides and Zea mays. Resolution of the Cs and Shemin pathways of 5-aminolaevulinate biosynthesis by thin layer radiochromatography. Eur. J. Biochem. 156:111-121.

232. Porra, R. J., and J. E. Falk. 1964. The enzymatic conversion of coproporphyrinogen III into protoporphyrin IX. Biochem. J. 90:69-75.

233. Porra, R. J., O. Klein, and P. E. W right 1983. The proof by 13C-NMR spectroscopy of the predominance of the C5 pathway over the Shemin pathway in chlorophyll biosynthesis in higher plants and of the formation of the methyl ester groups of chlorophyll from glycine. Eur. J. Biochem. 130:509-516.

234. Porra, R. J., and J. Lascelles. 1965. Haemoproteins and Haem synthesis in facultative photosynthetic and denitrifying bacteria. Biochem. J. 94:120-126.

235. Poulson, R. 1976. The enzymatic conversion of protoporphyrinogen IX to protoporphyrin IX in mammalian mitochondria. J. Biol. Chem. 251:3730- 3733.

236. Poulson, R., and W. J. Polglase. 1974. Aerobic and anaerobic coproporphyrinogenase activities in extracts from Saccharomyces cerevisiae. J. Biol. Chem. 249:6371-6387.

237. Poulson, R., and W. J. Polglase. 1975. The enzymatic conversion of protoporphyrinogen IX to protoporphyrin IX. I. Protoporphyrinogen

108

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. oxidase activity in mitochondrial extracts of Sacchammyces cerevisiae. J. Biol. Chem. 250:1269-1274.

238. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313.

239. Raich, N., P. H. Romeo, A. Dubart, D. Beaupain, M. Cohen-Solal, and M. Goossens. 1986. Molecular cloning and complete primary sequence of human erythrocyte porphobilinogen deaminase. Nucl. Acids Res. 14:5955-5968.

240. Rhie, G.-e., Y. J. Avissar, and S. I. Beale. 1996. Structure and expression of the Chlorobium vibrioforme hemB gene and characterization of its encoded enzyme, porphobilinogen synthase. J. Biol. Chem. 271:8176-8182.

241. Rieble, S., and S. I. Beale. 1988. Enzymatic transformation of glutamate to 5-aminolevulinic acid by soluble extracts of Synechocystis sp. 6803 and other oxygenic prokaryotes. J. Biol. Chem. 263:8864-8871.

242. Rieble, S., J. G. Omnerod, and S. I. Beale. 1989. Transformation of glutamate to 5-aminolevulinic acid by soluble extracts of Chlorobium vibrioforme. J. Bacteriol. 171:3782-3787.

243. Romana, M., A. Dubart, D. Beaupain, C. Chabret, M. Goossens, and P.-H. Romeo. 1987. Structure of the gene for human uroporphyrinogen decarboxylase. Nucl. Acids Res. 15:7343-7356.

244. Romana, M., P. Le Boulch, and P. Romeo. 1987. Rat uroporphyrinogen decarboxylase cDNA: nucleotide sequence and comparison to human uroporphyrinogen decarboxylase. Nucl. Acids Res. 15:7211.

245. Romeo, P.-H., A. Dubart, B. Grandchamp, H. d. Vemeuil, J. Rosa, Y. Nordmann, and M. Goossens. 1984. Isolation and identification of a cDNA clone coding for rat uroporphyrinogen decarboxylase. Proc. Natl. Acad. Sci. USA 81:3346-3350.

246. Romeo, P.-H., N. Raich, A. Dubart, D. Beaupain, M. Pryor, J. Kushner, M. Cohen-Solal, and M. Goossens. 1986. Molecular cloning and nucleotide sequence of a complete human uroporphyrinogen decarboxylase cDNA. J. Biol. Chem. 261:9825-9831.

247. Rose, S., R. B. Frydman, C. d. I. Santos, A. Sburlati, A. Valasinas, and B. Frydman. 1988. Spectroscopic evidence for a porphobilinogen

109

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. deaminase-tetrapyrrole complex that is an intermediate in the biosynthesis of uroporphyrinogen III. Biochemistry 27:4871-4879.

248. Rossetti, M. V., L. S. Araujo, M. E. Lombardo, S. C. Garcia, and A. M. C. Battle. 1987. Porphyrin biosynthesis in Euglena gracilis-MI. The effect of growth conditions on porphobilinogenase activity and further properties. Comp. Biochem. Physiol. 87B:593-600.

249. Rossetti, M. V., M. E. Lombardo, A. A. J. Geralnik, L. S. Araujo, and A. M. C. Batlle. 1986. Porphyrin biosynthesis in Euglena gracilis-V. Soluble and particulate PBG-ase. Comp. Biochem. Physiol. 85B:451-458.

250. Russell, C. S., and S. E. Pollack. 1978. Application of affinity chromatography to the purification of wheat germ porphobilinogen deaminase. Journal of Chromatography 166:632-636.

251. Russell, C. S., and P. Rockwell. 1980. The effects of sulfhydryl reagents on the activity of wheat germ uroporphyrinogen I synthase. FEBS Lett. 116:199-202.

252. Sancovich, H. A., A. M. C. Battle, and M. Grinstein. 1969. Porphyrin Biosynthesis. VI. Separation and purification of porphobilinogen deaminase and uroporphyrinogen isomerase from cow liver. Biochim. Biophys. Acta 191:130-143.

253. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.

254. Sano, S., and S. Granick. 1961. Mitochondrial coproporphyrinogen oxidase and protoporphyrin formation. J. Biol. Chem. 236:1173.

255. Sasarman, A., J. Letowski, G. Czaika, V. Ramierez, M. A. Nead, J. M. Jacobs, and R. Morais. 1993. Nucleotide sequence of the hemG gene involved in the protoporphyrinogen oxidase activity of Escherichia coli K12. Can. J. Microbiol. 39:1155-1161.

256. Sasarman, A., A. Nepveu, Y. Echelard, J. Dymetryszyn, M. Droiet, and C. Goyer. 1987. Molecular cloning and sequencing of the hemD gene of Escherichia coli K-12 and preliminary data on the Uro operon. J. Bacteriol. 169:4257-4262.

257. Schagger, H., and G. v. Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379.

110

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 258. Schaumberg, A., H. A. W. Schnieder-Poetsch, and C. Eckerskom. 1992. Characterization of plastid 5-aminolevulinate dehydratase (ALAD; EC 4.2.1.24) from spinach ( Spinacia oleracea L.) by sequencing and comparison with non-plant ALAD enzymes. Z. Naturforsch. 47c:77-84.

259. Schibata, H., and H. Ochiai. 1976. Purification and properties of 5-aminolevulinic acid dehydratase from radish cotyledons. Plant Cell Physiol. 18:421-429.

260. Schoenhaut, D. S., and P. J. Curtis. 1986. Nucleotide sequence of mouse 5-aminolevulinic acid synthase cDNA and expression of its gene in hepatic and erythroid tissues. Gene 48:55-63.

261. Scholnick, P. L., L. E. Hammaker, and M. H.S. 1972. Soluble 5-aminolevulinic acid synthase of rat liver. J. Biol. Chem. 247:4126-4131.

262. Scott, A. I., N. J. Stolowich, H. J. Williams, M. D. Gonzalez, C. A. Roessner, S. K. Grant, and C. Pichon. 1988. Concerning the catalytic site of porphobilinogen deaminase. Journal of the American Chemical Society 110:5898-5900.

263. Seehra, J. S., and P. M. Jordan. 1980. Mechanism of action of porphobilinogen deaminase: Ordered addition of the four porphobilinogen molecules in the formation of preuroporphyrinogen. Journal of the American Chemical Society 102:6841-6846.

264. Seehra, J. S., P. M. Jordan, and M. Akhtar. 1983. Anaerobic and aerobic coproporphyrinogen Hi oxidases of Rhodopseudomonas sphaeroides. Biochem. J. 209:709-718.

265. Sharif, A. L., A. G. Smith, and C. Abell. 1989. Isolation and characterization of a cDNA clone for a chlorophyll synthesis enzyme from Euglena gracilis. Eur. J. Biochem. 184:353-359.

266. Shaw, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 43:737-755.

267. Shemin, D. 1957.The biosynthesis of porphyrins. Ergeb. Physiol. 49:299.

268. Shemin, D. 1971. 5-aminolevulinic acid dehydratase, p. 323. In P. D. Boyer (ed.), The Enzymes. Academic Press, New York and London.

269. Shigesada, K. 1972. Possible occurrence of a succinate-glycine cycle in Rhodospirillum rubrum. J. Biochem. 71:961-972.

111

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 270. Shioi, Y., M. Nagamine, M. Kuroki, and T. Sasa. 1980. Purification by affinity chromatography and properties of uroporphyrinogen I synthetase from Chlorella regularis. Biochim. Biophys. Acta 616:300-309.

271. Shoolingin-Jordan, P. M. 1995. Porphobilinogen deaminase and uroporphyrinogen lii synthase: Structure, molecular biology, and mechanism. Journal of Bioenergetics and Biomembranes 27:181-195.

272. Shoolingin-Jordan, P. M., M. J. Warren, and S. J. Awan. 1996. Discovery that the assembly of the dipyrromethane cofactor of porphobilinogen deaminase holoenzyme proceeds initially by the reaction of preuroporphyrinogen with the apoenzyme. Biochem. J. 316:373-376.

273. Siepker, L. J., M. Ford, R. de Kock, and S. Kramer. 1987. Purification of bovine protoporphyrinogen oxidase: immunological cross-reactivity and structural relationship to ferrochelatase. Biochim. Biophys. Acta 9134:349-358.

274. Smythe, E., and D. C. Williams. 1988. Rat liver uroporphyrinogen III synthase has similar properties to the enzyme from Euglena gracilis, including absence of a requirement for a reversibly bound cofactor for activity. Biochem. J. 253:275-279.

275. Spano, A. J., and M. P. Timko. 1991. Isolation, characterization and partial amino acid sequence of a chloroplast-localized porphobilinogen deaminase from pea ( Pisum sativum L.). Biochim. Biophys. Acta 1076:29-36.

276. Spencer, P., and P. M. Jordan. 1993. Purification and characterization of 5-aminolaevulinic acid dehydratase from Escherichia coli and a study of the reactive thiols at the metal-binding domain. Biochem. J. 290:279-287.

277. Stamford, N. P. J., A. Capretta, and A. R. Battersby. 1995. Expression, purification, and characterization of the product from the Bacillus subtilis hemD gene, uroporphyrinogen III synthase. Eur. J. Biochem. 231:236-241.

278. Straka, J. G., and J. P. Kushner. 1983. Purification and characterization of bovine hepatic uroporphyrinogen decarboxylase. Biochemistry 22:4664-4672.

112

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 279. Stubnicer, A. C., C. Picat, and B. Grandchamp. 1988. Rat porphobilinogen deaminase cDNA: nucleotide sequence of the erythropoietic form. Nucl. Acids Res. 16:3102.

280. Tai, T., M. D. Moore, and S. Kaplan. 1988. Cloning and characterization of 5-aminolevulinate synthase gene(s) from Rhodobacter sphaeroides. Gene 70:139-151.

281. Tait, G. H. 1972. Coproporphyrinogenase activities in extracts of Rhodopseudomonas sphaeroides and Chromatium strain D. Biochem. J. 128:1159-1169.

282. Tait, G. H. 1969. Coproporphyrinogenase activity in extracts from Rhodopseudomonas sphaeroides. Biochem. Biophys. Res. Comm. 37:116-122.

283. Taketani, S., H. Kohno, T. Furukawa, T. Yoshinga, and R. Tokunaga. 1994. Molecular cloning, sequencing and expression of cDNA encoding human coproporphyrinogen oxidase. Biochim. Biophys. Acta 1183:547-549.

284. Taylor, D. P., S. N. Cohen, W. G. Clark, and B. L. Marrs. 1983. Alignment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsuiata chromosome by a conjugated-mediated marker rescue technique. J. Bacteriol. 154:580-590.

285. Thomas, S. D., and P. M. Jordan. 1986. Nucleotide sequence of the hemC locus encoding porphobilinogen deaminase of Escherichia coli K12. Nucl. Acids Res. 14:6215-6226.

286. Tomaro, M. L., R. B. Frydman, and B. Frydman. 1973. Porphobilinogen oxygenase from rat liver: Induction, isolation, and properties. Biochemistry 12:5263-5268.

287. Troup, B., C. Hungerer, and D. Jahn. 1995.Cloning and characterization of the Escherichia coli hemN gene encoding the oxygen-independent coproporphyrinogen III oxidase. J. Bacteriol. 177:3326-3331.

288. Troup, B., M. Jahn, C. Hungerer, and D. Jahn. 1994. Isolation of the hemF operon containing the gene for the Escherichia coli aerobic coproporphyrinogen III oxidase by in vivo complementation of a yeast HEM13 mutant. J. Bacteriol. 176:673-680.

113

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 289. Tsai, S.-F., D. F. Bishop, and R. J. Desnick. 1988. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA. Proc. Natl. Acad. Sci. USA 85:7049-7053.

290. Tsai, S. F., D. F. Bishop, and R. J. Desnick. 1987. Purification and properties of uroporphyrinogen III synthase from human erythrocytes. J. Bacteriol. 262:1268-1273.

291. Urban-Grimal, D. C., C. Volland, T. Dehoux, and R. Labbe-Bois. 1986. The nucleotide sequence of the HEM1 gene and evidence for a precursor form of the mitochondrial 5-aminolevulinate synthase in Sacchammyces cerevisiae. Eur. J. Biochem. 156:511-519.

292. Verkamp, E., and B. K. Chelm. 1989. Isolation, Nucleotide Sequence, and Preliminary Characterization of the Escherichia coli K-12 hemA gene. J. Bacteriol. 171:4728-4735.

293. Vemeuil, H. D., S. Sassa, and A. Kappas. 1983. Purification and properties of uroporphyrinogen decarboxylase from human erythrocytes. A single enzyme catalyzing the four sequential decarboxylations of uroporphyrinogens I and III. J. Biol. Chem. 258:2454-2460.

294. Viale, A. A., E. A. Wider, and A. M. C. Battle. 1987. Porphyrin biosynthesis in Rhodopseudomonas palustris-XW. 5-Aminolevulinate synthetase switch-off/on regulation. Int. J. Biochem. 19:379-383.

295. Viale, A. A., E. A. Wider, and A. M. C. Batlle. 1987. Porphyrin biosynthesis in Rhodopseudomonas palustris-X\. Extraction and characterization of 5-aminolevulinate synthetase. Comp. Biochem. Physiol. 87B:607-613.

296. Vieria, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertional mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268.

297. Vogelstein, B., and D. Gillespie. 1979. Preparative and analytical purification of DNAfrom agarose. Proc. Natl. Acad. Sci. USA 76:615-619.

298. Voland, C. a. F., F. 1984. Isolation and properties of 5-aminolevulinate synthase from yeast Saccharomyces cerevisiae. Eur. J. Biochem. 142:551-557.

114

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 299. Wamick, G. R., and B. F. Bumham. 1971. Regulation of porphyrin biosynthesis. Purification and characterization of 5-aminolevulinic acid synthetase. J. Biol. Chem. 246:6880-6885.

300. Wairen, M. J., S. Gul, R. T. Aplin, A. I. Scott, C. A. Roessner, P. O'Grady, and P. M. Shoolingen-Jordan. 1995. Evidence for conformational changes in Escherichia coli porphobilinogen deaminase during stepwise pyrrole chain elongation monitored by increased reactivity of cysteine-134 to alkylation by /V-ethylmaleimide. Biochemistry 34:11288-11295.

301. Warren, M. J., and P. M. Jordan. 1988. Investigation into the nature of substrate binding to the dipyrromethane cofactor of Escherichia coli porphobilinogen deaminase. Biochemistry 27:9020-9030.

302. Weaver, P. F., J. D. Wall, and H. G est 1975. Characterization of Rhodobacter capsulatus. Arch. Microbiol. 105:207-216.

303. Weinstein, J. D., and S. I. Beale. 1984. Biosynthesis of protoheme and heme a precursors solely from glutamate in the unicellular red alga Cyanidium caldarium. Plant Physiol. 74:146-151.

304. Wetmur, J. G., D. F. Bishop, C. Cantelmo, and R. J. Desnick. 1986. Human <5-aminolevulinate dehydratase: Nucleotide sequence of a full-length cDNA clone. Proc. Natl. Acad. Sci. USA 83:7703-7707.

305. Wetmur, J. G., D. F. Bishop, L. Ostasiewicz, and R. J. Desnick. 1986. Molecular cloning of a cDNA for human 5-aminolevulinate dehydratase. Gene 43:123-130.

306. Whitby, F. G., J. D. Phillips, J. P. Kushner, and C. P. Hill. 1998. Crystal structure of human uroporphyrinogen decarboxylase. EMBO J. 17:2463-2471.

307. Williams, D. C. 1984. Characterization of the multiple forms of hydroxymethylbilane synthase from rat spleen. Biochem. J. 217:675-683.

308. Williams, D. C., G. S. Morgan, E. McDonald, and A. R. Battersby. 1981. Purification of porphobilinogen deaminase from Euglena gracilis and studies of its kinetics. Biochem. J. 193:301-310.

309. Woodcock, S. C., and P. M. Jordan. 1994. Evidence for participation of aspartate-84 as a catalytic group at the active site of porphobilinogen

115

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. deaminase obtained by site-directed mutagenesis of the hemC gene from Escherichia coli. Biochemistry 33:2688-2695.

310. Wright, M. S., J. J. Eckert, S. W. Biel, and A. J. Biel. 1991. Use of a lacZ fusion to study transcriptional regulation of the Rhodobacter capsulatus hemA gene. FEMS Lett. 78:339-342.

311. Wu, C., W. Xu, C. A. Kozak, and R. J. Desnick. 1996. Mouse uroporphyrinogen decarboxylase: cDNA cloning, expression, and mapping. Mouse Genome 7:349-352.

312. Xu, H.-W., and J. D. Wall. 1991. Clustering of genes necessary for hydrogen oxidation in Rhodobacter capsulatus. J. Bacteriol. 173:2401-2405.

313. Xu, K., J. Delling, and T. E llio tt 1992. The genes required for heme synthesis in Salmonella typhimurium include those encoding alternative functions for aerobic and anaerobic coproporphyrinogen oxidation. J. Bacteriol. 174:3953-3963.

314. Xu, K., and T. Elliot. 1994. Cloning, DNA sequence, and complementation analysis of the Salmonella typhimurium hemN gene encoding a putative oxygen-independent coproporphyrinogen III oxidase. J. Bacteriol. 176:3196-3203.

315. Xu, K., and T. E llio t 1993. An oxygen-dependant coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium. J. Bacteriol. 175:4990-4999.

316. Yamasaki, H., and T. Moriyama. 1971. ^-Aminolevulinic acid dehydratase of Mycobacterium phlei. Biochim. Biophys. Acta 227:698-705.

317. Yen, H.-C., and B. Marrs. 1976. Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata. J. Bacteriol. 126:619-629.

318. Yoshinaga, T., and S. Sano. 1980. Coproporphyrinogen oxidase. J. Biol. Chem. 255:4722-4726.

319. Youvan, D. C., M. Alberti, H. Begusch, E. J. Bylina, and J. E. Hearst 1984. Reaction center and light-harvesting I genes from Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 81:189-192.

116

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. 320. Youvan, D. C., E. J. Bylina, M. Alberti, H. Begusch, and J. E. Hearst. 1984. Nucleotide and deduced polypeptide sequences of the photosynthetic reaction-center, B870 antenna, and flanking polypeptides from R. capsulata. Cell 37:949-957.

321. Youvan, D. C., and S. Ismail. 1985. Light-harvesting II (B800-B850 complex) structural genes from Rhodopseudomonas capsulata. Proceedings of the National Academy of Sciences. USA. 82:58-62.

322. Youvan, D. C., and B. L. Marrs. 1985. Photosynthesis apparatus genes from Rhodopseudomonas capsulata, p. 173-181. In (ed.), Molecular Biology of the Photosynthetic Apparatus. Cold spring harbor laboratory,

323. Yubisui, T., and Y. Yoneyama. 1972. 5-Aminolevulinic Acid Synthetase of Rhodopseudomonas sphaeroides: Purification and properties of the enzyme. Arch. Biochem. Biophys. 150:77-85.

324. Zagorec, M., J.-M. Buhler, I. Triech, T. Keng, L. Guarente, and R. Labbe-Bois. 1988. Isolation, Sequence, and Regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase. J. Biol. Chem. 263:9718-9724.

325. Zhu, Y. S., and J. E. Hearst. 1986. Regulation of expression of genes for light-harvesting antenna proteins LH-I and LH-II; reaction center polypeptides RC-L, RC-M, and RC-H; and enzymes of bacteriochlorophyll and carotenoid biosynthesis in Rhodobacter capsulatus by light and oxygen. Proc. Natl. Acad. Sci. USA 83:7613-7617.

326. Zsebo, K. M., and J. E. Hearst. 1984. Genetic-physical mapping of a photosynthetic gene cluster from R. capsulata. Cell 37:937-947.

117

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. VITA

Keith Allen Canada was born on November 7,1970, in Minot, North

Dakota. He graduated from Chippewa Valley High School, Mt Clemens,

Michigan, in June 1988. In May 1992, he was awarded the bachelor of science

degree in biology from Purdue University, West Lafayette, Indiana. Keith was

employed as a research associate from May 1992 until August 1993 at the

Purdue University School of Veterinary Medicine. In August 1993, Keith

entered the doctoral degree program in the Department of Microbiology at

Louisiana State University, Baton Rouge, under the direction of Alan J. Biel, his

graduate advisor. Keith is currently a doctoral candidate in the Department of

Biological Sciences at Louisiana State University, Baton Rouge.

118

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. DOCTORAL EXAMINATION AND DISSERTATION REPORT

Candidate: Keith A. Canada

Major Field: Microbiology

Title of Dissertation: Purification of Porphobilinogen Deaminase and the Sequencing and Expression of the hemC Gene of Hb.Qd.obacter capsulatus

Approved:

Major professor arid Chairman

Dean of the Graduate School

EXAMINING COMMITTEE:

■ J' i l " 1

Q r r r l A — 1 ^ -\^N

Date of Examination:

October 16, 1998

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. IMAGE EVALUATION TEST TARGET (QA-3) /

<£> S r . 'S

I.O £ 1 3 IIIIIM

III— 1“ ! t l i i u . l a l . l

i l l 1 - 8

1.25 1.4 1.6

150mm

IIV14GE . Inc 1653 East Main Street Rochester, NY 14609 USA Phone: 716/482-0300 Fax: 716/288-5989

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.