Supporting Information Ng et al. 10.1073/pnas.1000093107 SI Materials and Methods were able to manually map four, thus providing us with Ensembl Compilation of LRR-Containing Proteins. We compiled a list of protein IDs corresponding to 367 genes. Using these protein UniProt accessions for human proteins annotated as containing IDs, we identified orthologs for 319 of the 367 genes in version LRRs in InterPro (1) (release 18.0), the Swiss-Prot section of 3 (beta) of the OrthoMCL database (13). For each gene which UniProt (2) (release 14.6), and LRRML (3) (release 0.3). For had been mapped to multiple protein IDs, we used the protein InterPro, we selected all proteins with at least one domain an- ID associated with the greatest number of orthologues in the notated as a “True positive” for one of the signature IDs listed in database. We then constructed for each of the 319 LRR genes Dataset S2F. For Swiss-Prot, we extracted all proteins annotated a string of 0s and 1s such that each digit indicated the presence with an “LRR”“REPEAT” feature. We then mapped each (i.e., 1) or absence (i.e., 0) of an orthologue in the corresponding UniProt accession to an Entrez GeneID. For each of the resulting species. We used the resulting strings as vectors to hierarchically fi 375 genes, we selected as the representative protein either the cluster the LRR genes; speci cally, we used Cluster 3.0 (15) to corresponding Swiss-Prot entry or, if no such entry existed, the perform complete linkage clustering, with uncentered Pearson longest corresponding entry in Trembl. correlation as the distance measure. We then visualized the result of the clustering in a heat map, with each row representing a gene Identification of Potential Irregular LRRs. We then identified and and each column a nonhuman species with at least one human scored potential irregular LRRs according to the following criteria: LRR orthologue. We ordered the columns so the associated species would be partitioned into taxonomically related groups (i) Irregular LRRs can only occur in proteins with at least one (based on information from the National Center for Biotech- regular LRR. nology Information taxonomy database (16) and the species (ii) Irregular LRRs cannot overlap non-LRR domains. These within each group would be arranged from left to right in de- domains include TM regions and signal peptides [as pre- creasing order of orthologue count. We next repeated this pro- dicted by Phobius (4)] as well as PFam (5), SMART (6), cedure to generate comparable heat maps for human proteins and PRINTS (7) non-LRR domains which are annotated containing SH2 and PDZ domains. For the SH2 domain, we used fi in InterPro as “true positive.” the set of 110 human SH2-containing proteins pro led by Liu (iii) The length of an irregular LRR is the maximum number et al. (17), whereas for the PDZ domain, we used all human proteins annotated in release 23.0 of InterPro (1) as containing of residues such that the resulting LRR contains between the InterPro domain IPR001478 (PDZ/DHR/GLGF). To gen- 19 and 35 residues and does not overlap any other LRRs erate a heat map depicting the relative degrees of conservation or non-LRR domains. of the LRRs, we first used ClustalW2 (18) (version 2.09, default (iv) The score for a putative irregular LRR is the sum of options) to compute the distances (percent divergences) between a sequence component and a structure component. Using the LRR proteins and their orthologues in OrthoMCL. We then the scoring scheme described previously (8), the sequence constructed for each LRR gene a vector consisting of a similarity component of the score is the sum of the scores for the score for each nonhuman species. We then normalized the simi- residues in positions 1, 4, 6, and 9. larity scores by computing Student t statistic for each score with (v) Based on the approach described by Matsushima et al. (9), respect to the other scores for the corresponding species, and the structure component of the score factors in the number we used the resulting vectors to cluster the LRR genes as de- of residues in positions 3 through 5 for which the associ- scribed earlier. ated secondary structure is predicted to be a beta strand. Analysis of Gene Expression Across 79 Human Tissues. Microarray We used SSpro (10) (version 4.0) to predict the secondary data files were obtained from the Novartis GNF human expression structure of each LRR protein. atlas resource, version 2 (19), and expression values of 33,689 probe sets from the HG-U133A (Affymetrix) platform and the GNF1H custom chip were analyzed as described by Krishnan Identification of Enriched PANTHER Ontology Terms. Enrichment of ontology terms from the PANTHER classification system (11) was et al. (20). computed using one-sided Fisher exact test implemented in the Cell Culture. All cells were maintained at 37 °C and 5% CO2 in R programming language. P values were corrected for multiple- DMEM supplemented with 10% FCS, 100 U/mL penicillin G, hypothesis testing using the Benjamini and Hochberg method and 100 μg/mL streptomycin sulfate unless stated otherwise. (12). For the ontology analysis of the classified and unclassified LRR proteins, we defined the background gene set to be all LRR Human Macrophage Culture and Exposure to Bacteria. Macrophages genes annotated in PANTHER with terms other than “molecular were prepared and infected as detailed previously (21, 22), with S. function unclassified” (when determining the enrichment of terms aureus, M. tuberculosis, L. monocytogenes, S. enterica serovar ty- in the “molecular function” category) and “biological process phi, and EHEC. unclassified” (for terms in the “biological process” category). For the analysis of the LRR proteins strongly conserved in fungi, we Quantitative RT-PCR. RNA was isolated using the RNeasy kit further restricted the background gene set to only include those (Qiagen), and reverse transcription performed using the iScript with orthologues in OrthoMCL (13). cDNA synthesis kit (BioRad). Gene expression was quantified on an iQ5 RT-PCR detection system (Bio-Rad) using iQ SYBR Generation of Evolutionary Profile Heatmaps. We mapped the genes Green Supermix (Bio-Rad) according to the manufacturer’s pro- for the 375 LRR proteins to the equivalent Ensembl protein tocol. The data were normalized to GAPDH expression using the IDs using the BioMart function of Ensembl (14) (release 56). Of standard ΔΔCT method. The Student t test (two-tailed, unequal the 12 genes for which BioMart did not provide mappings, we variance) was used to assess statistical significance. Ng et al. www.pnas.org/cgi/content/short/1000093107 1of7 − siRNA Transfection and Exposure to TLR Ligands. RAW264.7 mac- exchanged for low-gentamycin DMEM (containing 20 μgmL 1 rophages were transfected with 25 nM siRNA oligos (ON- gentamycin sulfate). Cells were washed twice in PBS solution TARGETplus SMARTpool; Dharmacon) using HiPerFect Re- before being fixed in 4% formaldehyde solution, permeabilized agent (Qiagen) on two consecutive days and used at 72 h. Cells with 0.1% Triton X-100 in PBS solution for 2 min and stained were then stimulated with polyIC or LPS (Invivogen) for 6 h and with Hoechst 33342 and Alexa 633–conjugated phalloidin (In- supernatants assayed for IL-6 levels using ELISA. Cells were vitrogen) according to manufacturer’s instructions. Following fi harvested and RNA isolated for quantitative RT-PCR to con rm mounting, slides were viewed for counting under wide-field siRNA knockdown. fluorescence illumination with a ×100 lens (Axioplan; Carl Zeiss MicroImaging). The total number of bacteria per cell and the IL-6 ELISA. Assays were performed using the OptEIA Mouse IL-6 ’ number of GFP-LC3 positive bacteria were assessed in randomly ELISA Kit (BD Biosciences) according to the manufacturer s fi protocol. chosen elds with at least 50 cells counted for each condition. The numbers of GFP-LC3 positive bacteria were then calculated RNA Interference of LRSAM1. HeLa cells stably transduced with as a percentage of total bacteria. Bacteria were scored as within GFP-LC3 were plated in 12-well plates containing 18-mm glass autophagosomes only when a complete and closely conforming coverslips at a density of 1 × 105 cells per well. After 24 h, 20 pmol GFP-LC3 “capsule” was visible. Significance was assessed using of modified RNA oligo duplexes (Stealth RNAi; Invitrogen) were the two-tailed, unequal variance Student t test with Bonferroni transfected into each well using Lipofectamine 2000 (Invitrogen) correction for multiple comparisons. according to the manufacturer’s instructions. Autophagy assays were begun 48 h after transfection. Knockdown was confirmed by siRNA Duplex Sequences. siRNA duplex sequences were as follows: quantitative RT-PCR. LRSAM1 siRNA 1, 5′GCAGAUGACAUUCUCGACAUCUCUA; LRSAM1 siRNA 2, 5′CCGGCUCAUCCAGAUGGCCUACGAA; Infection Endocytosis Assays. S. typhimurium infections were per- LRSAM1 siRNA 3, 5′CCUUGUCCUUGAAGCUGCAAGAA- formed as previously described (23). Briefly, S. typhimurium GA; and FNBP1L siRNA 3, 5′CAAAGGUGACGGAUGGACA- SL1344 carrying a DsRed2 expression plasmid was grown over- AGAGCU, as used previously (23). − night in Luria-Bertani broth containing 10 μgmL 1 tetracycline sulfate at 37 °C with aeration and subcultured at a dilution of Mfhas1 siRNA Sequences. Mfhas1 siRNA (Dharmacon SMART- 1:33 for a further 3 h in Luria-Bertani broth plus tetracycline. pool) sequences were as follows: 5′CCAAAUAUAUGGACCG- This culture was further diluted in DMEM 10% serum without CAU, 5′GCUCUAUCUUAGUCGCAAU, 5′GAACAACGGC- antibiotics to yield a multiplicity of infection of 100, and added to CUCGAGGAU, and 5′CUGGAUUGUUCGCACGUUA. HeLa GFP-LC3 cells grown on coverslips in 12-well plates. In- fections were allowed to proceed for 20 min, cells were washed Cnot6L siRNA Sequences. Cnot6L siRNA (Dharmacon SMARTpool) − once in complete medium containing 100 μgmL 1 gentamycin sequenceswereasfollows:5′CAGCAUCAUUCACGGUUAU, 5′ sulfate, and then incubated in fresh high-gentamycin medium for UAAACAGAGUAAUGACGAA, 5′CUUAAGAGCGCCUAU- 1, 2, or 4 h.