DOCSLIB.ORG

Supporting Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Supporting Information Ng et al. 10.1073/pnas.1000093107 SI Materials and Methods were able to manually map four, thus providing us with Ensembl Compilation of LRR-Containing Proteins. We compiled a list of protein IDs corresponding to 367 genes. Using these protein UniProt accessions for human proteins annotated as containing IDs, we identified orthologs for 319 of the 367 genes in version LRRs in InterPro (1) (release 18.0), the Swiss-Prot section of 3 (beta) of the OrthoMCL database (13). For each gene which UniProt (2) (release 14.6), and LRRML (3) (release 0.3). For had been mapped to multiple protein IDs, we used the protein InterPro, we selected all proteins with at least one domain an- ID associated with the greatest number of orthologues in the notated as a “True positive” for one of the signature IDs listed in database. We then constructed for each of the 319 LRR genes Dataset S2F. For Swiss-Prot, we extracted all proteins annotated a string of 0s and 1s such that each digit indicated the presence with an “LRR”“REPEAT” feature. We then mapped each (i.e., 1) or absence (i.e., 0) of an orthologue in the corresponding UniProt accession to an Entrez GeneID. For each of the resulting species. We used the resulting strings as vectors to hierarchically fi 375 genes, we selected as the representative protein either the cluster the LRR genes; speci cally, we used Cluster 3.0 (15) to corresponding Swiss-Prot entry or, if no such entry existed, the perform complete linkage clustering, with uncentered Pearson longest corresponding entry in Trembl. correlation as the distance measure. We then visualized the result of the clustering in a heat map, with each row representing a gene Identification of Potential Irregular LRRs. We then identified and and each column a nonhuman species with at least one human scored potential irregular LRRs according to the following criteria: LRR orthologue. We ordered the columns so the associated species would be partitioned into taxonomically related groups (i) Irregular LRRs can only occur in proteins with at least one (based on information from the National Center for Biotech- regular LRR. nology Information taxonomy database (16) and the species (ii) Irregular LRRs cannot overlap non-LRR domains. These within each group would be arranged from left to right in de- domains include TM regions and signal peptides [as pre- creasing order of orthologue count. We next repeated this pro- dicted by Phobius (4)] as well as PFam (5), SMART (6), cedure to generate comparable heat maps for human proteins and PRINTS (7) non-LRR domains which are annotated containing SH2 and PDZ domains. For the SH2 domain, we used fi in InterPro as “true positive.” the set of 110 human SH2-containing proteins pro led by Liu (iii) The length of an irregular LRR is the maximum number et al. (17), whereas for the PDZ domain, we used all human proteins annotated in release 23.0 of InterPro (1) as containing of residues such that the resulting LRR contains between the InterPro domain IPR001478 (PDZ/DHR/GLGF). To gen- 19 and 35 residues and does not overlap any other LRRs erate a heat map depicting the relative degrees of conservation or non-LRR domains. of the LRRs, we first used ClustalW2 (18) (version 2.09, default (iv) The score for a putative irregular LRR is the sum of options) to compute the distances (percent divergences) between a sequence component and a structure component. Using the LRR proteins and their orthologues in OrthoMCL. We then the scoring scheme described previously (8), the sequence constructed for each LRR gene a vector consisting of a similarity component of the score is the sum of the scores for the score for each nonhuman species. We then normalized the simi- residues in positions 1, 4, 6, and 9. larity scores by computing Student t statistic for each score with (v) Based on the approach described by Matsushima et al. (9), respect to the other scores for the corresponding species, and the structure component of the score factors in the number we used the resulting vectors to cluster the LRR genes as de- of residues in positions 3 through 5 for which the associ- scribed earlier. ated secondary structure is predicted to be a beta strand. Analysis of Gene Expression Across 79 Human Tissues. Microarray We used SSpro (10) (version 4.0) to predict the secondary data files were obtained from the Novartis GNF human expression structure of each LRR protein. atlas resource, version 2 (19), and expression values of 33,689 probe sets from the HG-U133A (Affymetrix) platform and the GNF1H custom chip were analyzed as described by Krishnan Identification of Enriched PANTHER Ontology Terms. Enrichment of ontology terms from the PANTHER classification system (11) was et al. (20). computed using one-sided Fisher exact test implemented in the Cell Culture. All cells were maintained at 37 °C and 5% CO2 in R programming language. P values were corrected for multiple- DMEM supplemented with 10% FCS, 100 U/mL penicillin G, hypothesis testing using the Benjamini and Hochberg method and 100 μg/mL streptomycin sulfate unless stated otherwise. (12). For the ontology analysis of the classified and unclassified LRR proteins, we defined the background gene set to be all LRR Human Macrophage Culture and Exposure to Bacteria. Macrophages genes annotated in PANTHER with terms other than “molecular were prepared and infected as detailed previously (21, 22), with S. function unclassified” (when determining the enrichment of terms aureus, M. tuberculosis, L. monocytogenes, S. enterica serovar ty- in the “molecular function” category) and “biological process phi, and EHEC. unclassified” (for terms in the “biological process” category). For the analysis of the LRR proteins strongly conserved in fungi, we Quantitative RT-PCR. RNA was isolated using the RNeasy kit further restricted the background gene set to only include those (Qiagen), and reverse transcription performed using the iScript with orthologues in OrthoMCL (13). cDNA synthesis kit (BioRad). Gene expression was quantified on an iQ5 RT-PCR detection system (Bio-Rad) using iQ SYBR Generation of Evolutionary Profile Heatmaps. We mapped the genes Green Supermix (Bio-Rad) according to the manufacturer’s pro- for the 375 LRR proteins to the equivalent Ensembl protein tocol. The data were normalized to GAPDH expression using the IDs using the BioMart function of Ensembl (14) (release 56). Of standard ΔΔCT method. The Student t test (two-tailed, unequal the 12 genes for which BioMart did not provide mappings, we variance) was used to assess statistical significance. Ng et al. www.pnas.org/cgi/content/short/1000093107 1of7 − siRNA Transfection and Exposure to TLR Ligands. RAW264.7 mac- exchanged for low-gentamycin DMEM (containing 20 μgmL 1 rophages were transfected with 25 nM siRNA oligos (ON- gentamycin sulfate). Cells were washed twice in PBS solution TARGETplus SMARTpool; Dharmacon) using HiPerFect Re- before being fixed in 4% formaldehyde solution, permeabilized agent (Qiagen) on two consecutive days and used at 72 h. Cells with 0.1% Triton X-100 in PBS solution for 2 min and stained were then stimulated with polyIC or LPS (Invivogen) for 6 h and with Hoechst 33342 and Alexa 633–conjugated phalloidin (In- supernatants assayed for IL-6 levels using ELISA. Cells were vitrogen) according to manufacturer’s instructions. Following fi harvested and RNA isolated for quantitative RT-PCR to con rm mounting, slides were viewed for counting under wide-field siRNA knockdown. fluorescence illumination with a ×100 lens (Axioplan; Carl Zeiss MicroImaging). The total number of bacteria per cell and the IL-6 ELISA. Assays were performed using the OptEIA Mouse IL-6 ’ number of GFP-LC3 positive bacteria were assessed in randomly ELISA Kit (BD Biosciences) according to the manufacturer s fi protocol. chosen elds with at least 50 cells counted for each condition. The numbers of GFP-LC3 positive bacteria were then calculated RNA Interference of LRSAM1. HeLa cells stably transduced with as a percentage of total bacteria. Bacteria were scored as within GFP-LC3 were plated in 12-well plates containing 18-mm glass autophagosomes only when a complete and closely conforming coverslips at a density of 1 × 105 cells per well. After 24 h, 20 pmol GFP-LC3 “capsule” was visible. Significance was assessed using of modified RNA oligo duplexes (Stealth RNAi; Invitrogen) were the two-tailed, unequal variance Student t test with Bonferroni transfected into each well using Lipofectamine 2000 (Invitrogen) correction for multiple comparisons. according to the manufacturer’s instructions. Autophagy assays were begun 48 h after transfection. Knockdown was confirmed by siRNA Duplex Sequences. siRNA duplex sequences were as follows: quantitative RT-PCR. LRSAM1 siRNA 1, 5′GCAGAUGACAUUCUCGACAUCUCUA; LRSAM1 siRNA 2, 5′CCGGCUCAUCCAGAUGGCCUACGAA; Infection Endocytosis Assays. S. typhimurium infections were per- LRSAM1 siRNA 3, 5′CCUUGUCCUUGAAGCUGCAAGAA- formed as previously described (23). Briefly, S. typhimurium GA; and FNBP1L siRNA 3, 5′CAAAGGUGACGGAUGGACA- SL1344 carrying a DsRed2 expression plasmid was grown over- AGAGCU, as used previously (23). − night in Luria-Bertani broth containing 10 μgmL 1 tetracycline sulfate at 37 °C with aeration and subcultured at a dilution of Mfhas1 siRNA Sequences. Mfhas1 siRNA (Dharmacon SMART- 1:33 for a further 3 h in Luria-Bertani broth plus tetracycline. pool) sequences were as follows: 5′CCAAAUAUAUGGACCG- This culture was further diluted in DMEM 10% serum without CAU, 5′GCUCUAUCUUAGUCGCAAU, 5′GAACAACGGC- antibiotics to yield a multiplicity of infection of 100, and added to CUCGAGGAU, and 5′CUGGAUUGUUCGCACGUUA. HeLa GFP-LC3 cells grown on coverslips in 12-well plates. In- fections were allowed to proceed for 20 min, cells were washed Cnot6L siRNA Sequences. Cnot6L siRNA (Dharmacon SMARTpool) − once in complete medium containing 100 μgmL 1 gentamycin sequenceswereasfollows:5′CAGCAUCAUUCACGGUUAU, 5′ sulfate, and then incubated in fresh high-gentamycin medium for UAAACAGAGUAAUGACGAA, 5′CUUAAGAGCGCCUAU- 1, 2, or 4 h.
Load more

Recommended publications
  • ANP32A and ANP32B Are Key Factors in the Rev Dependent CRM1 Pathway
    bioRxiv preprint doi: https://doi.org/10.1101/559096; this version posted February 24, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 ANP32A and ANP32B are key factors in the Rev dependent CRM1 pathway 2 for nuclear export of HIV-1 unspliced mRNA 3 Yujie Wang1, Haili Zhang1, Lei Na 1, Cheng Du1, Zhenyu Zhang1, Yong-Hui Zheng1,2, Xiaojun Wang1* 4 1State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, the Chinese 5 Academy of Agricultural Sciences, Harbin 150069, China 6 2Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan, 7 USA. 8 * Address correspondence to Xiaojun Wang, [email protected]. 9 10 11 12 13 14 15 16 17 18 19 20 21 1 bioRxiv preprint doi: https://doi.org/10.1101/559096; this version posted February 24, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 22 Abstract 23 The nuclear export receptor CRM1 is an important regulator involved in the shuttling of various cellular 24 and viral RNAs between the nucleus and the cytoplasm. HIV-1 Rev interacts with CRM1 in the late phase of 25 HIV-1 replication to promote nuclear export of unspliced and single spliced HIV-1 transcripts. However, the 26 knowledge of cellular factors that are involved in the CRM1-dependent viral RNA nuclear export remains 27 inadequate. Here, we identified that ANP32A and ANP32B mediate the export of unspliced or partially spliced 28 viral mRNA via interacting with Rev and CRM1.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Discovery of the First Genome-Wide Significant Risk Loci for ADHD
    bioRxiv preprint doi: https://doi.org/10.1101/145581; this version posted June 3, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Discovery of the first genome-wide significant risk loci for ADHD Ditte Demontis,1,2,3† Raymond K. Walters,4,5† Joanna Martin,5,6,7 Manuel Mattheisen,1,2,3,8,9 Thomas D. Als,1,2,3 Esben Agerbo,1,10,11 Rich Belliveau,5 Jonas Bybjerg-Grauholm,1,12 Marie Bækvad-Hansen,1,12 Felecia Cerrato,5 Kimberly Chambert,5 Claire Churchhouse,4,5,13 Ashley Dumont,5 Nicholas Eriksson,14 Michael Gandal,15,16,17,18 Jacqueline Goldstein,4,5,13 Jakob Grove,1,2,3,19 Christine S. Hansen,1,12,20 Mads E. Hauberg,1,2,3 Mads V. Hollegaard,1,12 Daniel P. Howrigan,4,5 Hailiang Huang,4,5 Julian Maller,5,21 Alicia R. Martin,4,5,13 Jennifer Moran,5 Jonatan Pallesen,1,2,3 Duncan S. Palmer,4,5 Carsten B. Pedersen,1,10,11 Marianne G. Pedersen,1,10,11 Timothy Poterba,4,5,13 Jesper B. Poulsen,1,12 Stephan Ripke,4,5,13,22 Elise B. Robinson,4,23 Kyle F. Satterstrom,4,5,13 Christine Stevens,5 Patrick Turley,4,5 Hyejung Won,15,16 ADHD Working Group of the Psychiatric Genomics Consortium (PGC), Early Lifecourse & Genetic Epidemiology (EAGLE) Consortium, 23andMe Research Team, Ole A.
    [Show full text]
  • Identification of FBXL4 As a Metastasis Associated Gene in Prostate Cancer
    Identification of FBXL4 as a Metastasis Associated Gene in Prostate Cancer Elzbieta Stankiewicz1 , Xueying Mao1, D Chas Mangham2 , Lei Xu1, Marc Yeste- Velasco1, Gabrielle Fisher3, Bernard North3, Tracy Chaplin1, Bryan Young4, Yuqin Wang1, Jasmin Kaur Bansal1, Sakunthala Kudahetti1, Lucy Spencer1, Christopher S Foster5, Henrik Moller6, Peter Scardino7, R Tim Oliver1, Jonathan Shamash1, Jack Cuzick3, Colin S Cooper8, Daniel M Berney1,+, Yong-Jie Lu1,+,* 1 Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK 2 The Robert Jones and Agnes Hunt Orthopaedic Hospital, Department of Pathology, Oswestry, Shropshire SY10 7AG, UK 3 Cancer Research UK Centre for Epidemiology, Mathematics and Statistics, Wolfson Institute of Preventive Medicine, Queen Mary University of London, London EC1 6BQ, UK 4 Centre for Haemato-Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK 5 Division of Cellular and Molecular Pathology, University of Liverpool, Liverpool L69 3BX, UK 6 King's College London, Cancer Epidemiology and Population Health, London SE1 9RT, UK 7 Department of Urology, Memorial Sloan Kettering Cancer Center, New York, NY 10065, USA 1 8 School of Medicine, University of East Anglia, Norwich, NR4 7TJ, UK +These authors contributed equally as senior role *Corresponding author: Yong-Jie Lu, Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, Telephone number: 442078823563, Fax: 442078823884, e-mail address: [email protected] 2 Abstract Prostate cancer is the most common cancer among western men, with a significant mortality and morbidity reported for advanced metastatic disease. Current understanding of metastatic disease is limited due to difficulty of sampling as prostate cancer mainly metastasizes to bone.
    [Show full text]
  • Towards a Molecular Understanding of Microrna-Mediated Gene Silencing
    REVIEWS NON-CODING RNA Towards a molecular understanding of microRNA-mediated gene silencing Stefanie Jonas and Elisa Izaurralde Abstract | MicroRNAs (miRNAs)­ are a conserved class of small non-coding RNAs that assemble with Argonaute proteins into miRNA-induced silencing complexes (miRISCs) to direct post-transcriptional silencing of complementary mRNA targets. Silencing is accomplished through a combination of translational repression and mRNA destabilization, with the latter contributing to most of the steady-state repression in animal cell cultures. Degradation of the mRNA target is initiated by deadenylation, which is followed by decapping and 5ʹ‑to‑3ʹ exonucleolytic decay. Recent work has enhanced our understanding of the mechanisms of silencing, making it possible to describe in molecular terms a continuum of direct interactions from miRNA target recognition to mRNA deadenylation, decapping and 5ʹ‑to‑3ʹ degradation. Furthermore, an intricate interplay between translational repression and mRNA degradation is emerging. Deadenylation MicroRNAs (mi­RNAs) are conserved post-transcriptional recruit additional protein partners to mediate silenc- 5,6 Shortening of mRNA poly(A) regulators of gene expression that are integral to ing . Silencing occurs through a combination of tails. In eukaryotes, this almost all known biological processes, including translational repression, deadenylation, decapping and process is catalysed by the cell growth, proliferation and differentiation, as well 5ʹ‑to‑3ʹ mRNA degradation5,6 (FIG. 1). The GW182 pro- consecutive but partially as organismal metabolism and development1. The teins play a central part in this process and are among redundant action of two 5,6 cytoplasmic deadenylase number of mi­RNAs encoded within the genomes of the most extensively studied AGO partners .
    [Show full text]
  • Fine Mapping Studies of Quantitative Trait Loci for Baseline Platelet Count in Mice and Humans
    Fine mapping studies of quantitative trait loci for baseline platelet count in mice and humans A thesis submitted in fulfillment of the requirements for the degree of Doctor of Philosophy Melody C Caramins December 2010 University of New South Wales ORIGINALITY STATEMENT ‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’ Signed …………………………………………….............. Date …………………………………………….............. This thesis is dedicated to my father. Dad, thanks for the genes – and the environment! ACKNOWLEDGEMENTS “Nothing can come out of nothing, any more than a thing can go back to nothing.” - Marcus Aurelius Antoninus A PhD thesis is never the work of one person in isolation from the world at large. I would like to thank the following people, without whom this work would not have existed. Thank you firstly, to all my teachers, of which there have been many. Undoubtedly, the greatest debt is owed to my supervisor, Dr Michael Buckley.
    [Show full text]
  • Macropinocytosis Requires Gal-3 in a Subset of Patient-Derived Glioblastoma Stem Cells
    ARTICLE https://doi.org/10.1038/s42003-021-02258-z OPEN Macropinocytosis requires Gal-3 in a subset of patient-derived glioblastoma stem cells Laetitia Seguin1,8, Soline Odouard2,8, Francesca Corlazzoli 2,8, Sarah Al Haddad2, Laurine Moindrot2, Marta Calvo Tardón3, Mayra Yebra4, Alexey Koval5, Eliana Marinari2, Viviane Bes3, Alexandre Guérin 6, Mathilde Allard2, Sten Ilmjärv6, Vladimir L. Katanaev 5, Paul R. Walker3, Karl-Heinz Krause6, Valérie Dutoit2, ✉ Jann N. Sarkaria 7, Pierre-Yves Dietrich2 & Érika Cosset 2 Recently, we involved the carbohydrate-binding protein Galectin-3 (Gal-3) as a druggable target for KRAS-mutant-addicted lung and pancreatic cancers. Here, using glioblastoma patient-derived stem cells (GSCs), we identify and characterize a subset of Gal-3high glio- 1234567890():,; blastoma (GBM) tumors mainly within the mesenchymal subtype that are addicted to Gal-3- mediated macropinocytosis. Using both genetic and pharmacologic inhibition of Gal-3, we showed a significant decrease of GSC macropinocytosis activity, cell survival and invasion, in vitro and in vivo. Mechanistically, we demonstrate that Gal-3 binds to RAB10, a member of the RAS superfamily of small GTPases, and β1 integrin, which are both required for macro- pinocytosis activity and cell survival. Finally, by defining a Gal-3/macropinocytosis molecular signature, we could predict sensitivity to this dependency pathway and provide proof-of- principle for innovative therapeutic strategies to exploit this Achilles’ heel for a significant and unique subset of GBM patients. 1 University Côte d’Azur, CNRS UMR7284, INSERM U1081, Institute for Research on Cancer and Aging (IRCAN), Nice, France. 2 Laboratory of Tumor Immunology, Department of Oncology, Center for Translational Research in Onco-Hematology, Swiss Cancer Center Léman (SCCL), Geneva University Hospitals, University of Geneva, Geneva, Switzerland.
    [Show full text]
  • A. Cellular Senescence
    Generation of antisense RNAs at convergent gene loci in cells undergoing senescence Maharshi Krishna Deb To cite this version: Maharshi Krishna Deb. Generation of antisense RNAs at convergent gene loci in cells undergo- ing senescence. Human genetics. Université Paul Sabatier - Toulouse III, 2016. English. NNT : 2016TOU30274. tel-03209213 HAL Id: tel-03209213 https://tel.archives-ouvertes.fr/tel-03209213 Submitted on 27 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 5)µ4& &OWVFEFMPCUFOUJPOEV %0$503"5%&-6/*7&34*5²%&506-064& %ÏMJWSÏQBS Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) 1SÏTFOUÏFFUTPVUFOVFQBS DEB Maharshi Krishna -F mercredi 30 mars 2016 5Jtre : Generation of antisense RNAs at convergent gene loci in cells undergoing senescence École doctorale et discipline ou spécialité : ED BSB : Génétique moléculaire 6OJUÏEFSFDIFSDIF CNRS-UMR5088; LBCMCP %JSFDUFVS T EFʾÒTF Dr. TROUCHE Didier Co-Directeur/trice(s) de Thèse : Dr. NICOLAS Estelle 3BQQPSUFVST Prof. GILSON Eric, Dr. LIBRI Domenico, Dr. VERDEL Andre "VUSF T NFNCSF T EVKVSZ Prof. GLEIZES Pierre Emmanuel, President of Jury Dr. TROUCHE Didier, Thesis Supervisor This thesis is dedicated to any patients who may get cured with treatments manifesting from this work.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • USP48 Governs Cell Cycle Progression by Regulating the Protein Level of Aurora B
    International Journal of Molecular Sciences Article USP48 Governs Cell Cycle Progression by Regulating the Protein Level of Aurora B Ainsley Mike Antao 1,†, Kamini Kaushal 1,† , Soumyadip Das 1, Vijai Singh 2 , Bharathi Suresh 1, Kye-Seong Kim 1,3,* and Suresh Ramakrishna 1,3,* 1 Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul 04763, Korea; [email protected] (A.M.A.); [email protected] (K.K.); [email protected] (S.D.); [email protected] (B.S.) 2 Department of Biosciences, School of Science, Indrashil University, Rajpur, Ahmedabad 382740, Gujarat, India; [email protected] 3 College of Medicine, Hanyang University, Seoul 04763, Korea * Correspondence: [email protected] (K.-S.K.); [email protected] (S.R.) † These authors contributed equally. Abstract: Deubiquitinating enzymes play key roles in the precise modulation of Aurora B—an essential cell cycle regulator. The expression of Aurora B increases before the onset of mitosis and decreases during mitotic exit; an imbalance in these levels has a severe impact on the fate of the cell cycle. Dysregulation of Aurora B can lead to aberrant chromosomal segregation and accumulation of errors during mitosis, eventually resulting in cytokinesis failure. Thus, it is essential to identify the precise regulatory mechanisms that modulate Aurora B levels during the cell division cycle. Using a deubiquitinase knockout strategy, we identified USP48 as an important candidate that can regulate Aurora B protein levels during the normal cell cycle. Here, we report that USP48 interacts with and Citation: Antao, A.M.; Kaushal, K.; stabilizes the Aurora B protein.
    [Show full text]
  • GENOME EDITING in AFRICA’S AGRICULTURE 2021 an EARLY TAKE-OFF TABLE of CONTENTS Abbreviations and Acronyms 3
    GENOME EDITING IN AFRICA’S AGRICULTURE 2021 AN EARLY TAKE-OFF TABLE OF CONTENTS Abbreviations and Acronyms 3 1. Introduction 4 1.1 Milestones in Plant Breeding 5 1.2 How CRISPR genome editing works in agriculture 6 2 . Genome editing projects and experts in eastern Africa 7 2.1 Kenya 8 2.2 Ethiopia 14 2.3 Uganda 15 3 . Gene editing projects and experts in southern Africa 17 3.1 South Africa 18 4. Gene editing projects and experts in West Africa 19 4.1 Nigeria 20 5. Gene editing projects and experts in Central Africa 21 5.1 Cameroon 22 6. Gene editing projects and experts in North Africa 23 6.1 Egypt 24 7. Conclusion 25 8. CRISPR genome editing: inside a crop breeder’s toolkit 26 9. Regulatory Approaches for Genome Edited Products in Various Countries 27 10. Communicating about Genome Editing in Africa 28 2 ABBREVIATIONS AND ACRONYMS CRISPR Clustered Regularly Interspaced Short Palindromic Repeats DNA Deoxyribonucleic acid GM Genetically Modified GMO Genetically Modified Organism HDR Homology Directed Repair ISAAA International Service for the Acquisition of Agri-biotech Applications NHEJ Non Homologous End Joining PCR Polymerase Chain Reaction RNA Ribonucleic Acid LGS1 Low germination stimulant 1 3 1.0 INTRODUCTION Genome editing (also referred to as gene editing) comprises a arm is provided with the CRISPR-Cas9 cassette, homology-directed group of technologies that give scientists the ability to change an repair (HDR) will occur, otherwise the cell will employ non- organism’s DNA. These technologies allow addition, removal or homologous end joining (NHEJ) to create small indels at the cut site alteration of genetic material at particular locations in the genome.
    [Show full text]