Smith Et Al., Supplemental Materials 1 Folding and Lamination of The

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Smith et al., Supplemental Materials 1 1 Folding and lamination of the human neocortex depend on the sodium potassium pump 2 alpha 3 (ATP1A3) subunit 3 4 5 Richard S. Smith1, Marta Florio2,3, Shyam K. Akula1,4, Jennifer E. Neil1, Yidi Wang1, R. Sean 1 2,3 2,3 2,3 5 6 Hill , Melissa Goldman , Christopher D. Mullally , Nora Reed , Luis Bello-Espinosa , Laura 7 Flores-Sarnat6, Fabiola Paoli Monteiro7, Casella B. Erasmo8, Filippo Pinto e Vairo9,10, Eva 8 Morava10, A. James Barkovich11, Joseph Gonzalez-Heydrich12, Catherine A. Brownstein1, 9 Steven A. McCarroll2,3, Christopher A. Walsh1 10 11 1Division of Genetics and Genomics, Howard Hughes Medical Institute, Broad Institute of MIT and Harvard, 12 Manton Center for Orphan Disease Research, Boston Children’s Hospital, Harvard Medical School, Boston, MA 13 02115, USA 14 15 2Department of Genetics, Harvard Medical School, Boston, MA 02115, USA 16 17 3Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Cambridge, MA, 02142, USA 18 4Harvard-MIT MD/PhD Program; Program in Neuroscience; Harvard Medical School, Boston, MA, 02115, USA 19 20 5Arnold Palmer Hospital for Children, Orlando, Fl, 32806, USA 21 6University of Calgary and Alberta Children´s Hospital Research Institute (Owerko Centre), Dept of Paediatrics 22 and Clinical Neurosciences, Calgary, Alberta, Canada 23 24 7Mendelics Genomic Analysis, CEP 04013-000, São Paulo, SP, Brazil 25 26 8Children's Institute, Hospital das Clinicas, São Paulo, SP, Brazil 27 28 9Center for Individualized Medicine, Mayo Clinic, Rochester, MN, 55905, USA 29 30 10Department of Clinical Genomics, Mayo Clinic, Rochester, MN, 55905, USA 31 32 11Benioff Children's Hospital, Departments of Radiology, Pediatrics, Neurology, and Neurological Surgery, 33 University of California San Francisco, San Francisco, CA, 94117, USA 34 35 12Department of Psychiatry, Boston Children’s Hospital, Harvard Medical School, Boston, MA 02115, USA 36 37 38 *Correspondence should be addressed to: [email protected] and 39 [email protected] 40 41 42 43 44 45 46 Smith et al., Supplemental Materials 2 47 EXPERIMENTAL DETAILS 48 Human subjects and samples 49 Individuals presented herein were identified and evaluated in a clinical setting, and biological samples 50 collected after obtaining written informed clinical and/or research consent. Human subject research was 51 conducted according to protocols approved by the institutional review boards of Boston Children’s 52 Hospital, Beth Israel Deaconess Medical Center and the Mayo Clinic. Fetal brain tissue was received 53 after release from clinical pathology, with a maximum post-mortem interval of 4 h. Cases with known 54 anomalies were excluded. Tissue was transported in Hibernate-E medium (Thermo Fisher) on ice to 55 either the Walsh laboratory or McCarroll laboratory for downstream processing. The neonatal brain 56 sample was obtained from the University of Maryland Brain and Tissue Bank of the NIH 57 NeuroBioBank (sample number UMBN 5817) and stored at -80C until further processing. 58 59 Human genetics sequencing and analysis 60 For Case A and B, whole exome sequencing and data processing were performed by the Genomics 61 Platform at the Broad Institute of MIT and Harvard. Libraries from DNA samples (>250ng of DNA, at 62 >2 ng/ul) the Human Core Exome Kit from Twist Biosciences was used to capture target regions (~38 63 Mb target), and sequencing was performed on the Illumina NovaSeq 6000 (150 bp paired reads) to 64 cover >96% of targets at 20x and a mean target coverage of >100x. Sample identity quality assurance 65 checks were performed on each sample. The exome sequencing data was de-multiplexed and each 66 sample's sequence data were aggregated into a single Picard BAM file. Exome sequencing data was 67 processed through a pipeline based on Picard, using base quality score recalibration and local 68 realignment at known indels. The BWA aligner was used for mapping reads to the human genome build 69 38. Single nucleotide variants (SNVs) and insertions/deletions (indels) were jointly called across all 70 samples using Genome Analysis Toolkit (GATK) HaplotypeCaller package version 4. Default filters Smith et al., Supplemental Materials 3 71 were applied to SNV and indel calls using the GATK Variant Quality Score Recalibration (VQSR) 72 approach. Annotation was performed using Variant Effect Predictor (VEP). The variant call sets were 73 uploaded to seqr (https://seqr.broadinstitute.org/) for collaborative analysis between the Center for 74 Mendelian Genomics (CMG) and investigator. Identified variants were validated with Sanger 75 sequencing run in all available members of the family. For Case C, WES was performed in Mendelics 76 Genomic Analysis facilities using Illumina NovaSeq 6000. Sequencing library was built with Illumina 77 Nextera Flex and for capture of target regions Customized Exome Kit from Twist Biosciences was 78 used. Sequencing of sample resulted in a total of 27.173.797 paired 101 bp sequences mapped to 79 b37/hg19 human genome reference. 96.1 % of the Nextera exome reference was sampled at 10X or 80 more. Exome reads were mapped to b37/hg19 reference using BWA MEM software (http://bio- 81 bwa.sourceforge.net/). Resulting BAM files were genotyped using Broad Institute best practices with 82 GATK (https://software.broadinstitute.org/gatk/). Resulting VCF files were processed using Mendelics 83 in-house pipeline for annotation and filtering. “In silico” pathogenicity evaluation was performed using 84 VSA, a Mendelics proprietary machine-learning based software. Aligned BAM files were also 85 processed by ExomeDepth in order to identify CNVs. The heterozygous c.2771T>C; p.Leu24Pro 86 variant in ATP1A3 was validated in the proband by Sanger sequencing. The proband’s parents were 87 also investigated for the ATP1A3 variant using Sanger sequencing, which was found to be absent in 88 both, in peripheral blood samples. For Case D, WES was performed at GeneDx. Genomic DNA from 89 the submitted specimen was enriched for the complete coding regions and splice site junctions for most 90 genes of the human genome using a proprietary capture system developed by GeneDx for next- 91 generation sequencing with CNV calling (NGS-CNV). The enriched targets were simultaneously 92 sequenced with paired-end reads on an Illumina platform. Bi-directional sequence reads were 93 assembled and aligned to reference sequences based on NCBI RefSeq transcripts and human genome 94 build GRCh37/UCSC hg19. Using a custom-developed analysis tool (XomeAnalyzer), data were Smith et al., Supplemental Materials 4 95 filtered and analyzed to identify sequence variants and most deletions and duplications involving three 96 or more coding exons (Retterer et al., 2016). 97 98 Phenotypic assessment 99 All affected individuals and clinical data were examined by neurologists and/or geneticists, and 100 radiologists, and polymicrogyria was diagnosed using criteria described previously (Jansen et al., 2015; 101 Smith and Walsh, 2020). Supplemental text below summarizes their phenotypes and detailed clinical 102 and radiographic evaluations. 103 104 Human brain tissue preparation and mRNA in situ hybridization 105 Performed as previously described Smith et al3. Briefly, following fixation (4% PFA) and 106 cryoprotection (30% sucrose), brains were frozen using Isopentane on dry ice. Samples were sectioned 107 at 20 – 30 µm thickness (Leica Cryostat), mounted immediately onto warm charged SuperFrost Plus 108 slides (Fisher), and stored at –80°C. We followed manufacturer’s standard protocol for multiplex 109 fluorescent in situ hybridization (Multiplex Version 2 kit, Advanced Cell Diagnostics). In situ probe 110 ACD catalog numbers are as follows: ATP1A3: 503941, Vimentin: 479411, Eomes: 429691. Whole 111 tissue mRNA in situ imaging was performed on a Zeiss Axio Observer with automated image. (Figure 112 3B) Bright-field images were background corrected by Zen Blue Software for center intensity 113 illumination and stitched together (Figure 3B). 114 115 Bulk human cortex gene expression analysis 116 The Allen Human Brain Atlas (ABA) publishes a rich dataset of cortical genetic expression across 117 cortical brain regions, from age 8 weeks post conception to adult ages.(Jones et al., 2009) BrainSpan 118 data analysis of ATP1A1 (chr1:116,915,289-116,952,883, GRCh37/hg19), ATP1A2 (chr1:160,085,548- Smith et al., Supplemental Materials 5 119 160,113,381, GRCh37/hg19), and ATP1A3 (chr19:42,470,733-42,498,384, GRCh37/hg19) was 120 performed. ATP1A4 is not expressed in the CNS and was not included as the read counts were near 121 zero. RNA-seq expression measured in RPKM (reads per kilobase exon per million mapped reads) was 122 obtained from the BrainSpan project data and summarized to Gencode v10 exons for all annotated 123 neocortical tissues aged 12 weeks post conception to 36 years. To obtain a moving average across ages, 124 we fit a polynomial to the data using Igor pro software. Brain regions for Figure 3B include: 125 dorsolateral prefrontal cortex; ventrolateral prefrontal cortex; anterior (rostral) cingulate (medial 126 prefrontal) cortex; orbital frontal cortex; primary motor-sensory cortex; parietal neocortex; posterior 127 (caudal) superior temporal cortex (area 22c), inferolateral temporal cortex (area 20); occipital 128 neocortex, thalamic regions and hippocampus, among others. 129 130 Single-cell suspensions for Drop-Seq 131 The intact left brain hemisphere of a 21 wpc specimen was transported
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.
  • Comprehensive Analysis of the Expression of Sodium/Potassium-Atpase Α Subunits and Prognosis of Ovarian Serous Cystadenocarcinoma

    Comprehensive Analysis of the Expression of Sodium/Potassium-Atpase Α Subunits and Prognosis of Ovarian Serous Cystadenocarcinoma

    Comprehensive Analysis of the Expression of Sodium/Potassium-ATPase α Subunits and Prognosis of Ovarian Serous Cystadenocarcinoma Wei Huang Tumor Hospital of Harbin Medical University Yongjian Zhang Tumor Hospital of Harbin Medical University Ye Xu Tumor Hospital of Harbin Medical University Shaoyou Yang Tumor Hospital of Harbin Medical University Bing Li Tumor Hospital of Harbin Medical University Lan Huang Tumor Hospital of Harbin Medical University Ge Lou ( [email protected] ) Tumor Hospital of Harbin Medical University https://orcid.org/0000-0001-6617-4482 Primary research Keywords: Adenosine triphosphate, ovary, cystadenocarcinoma, gynecology, gene expression Posted Date: June 22nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-23702/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on July 14th, 2020. See the published version at https://doi.org/10.1186/s12935-020-01414-5. Page 1/21 Abstract Background: Ovarian serous cystadenocarcinoma (OSC) is the most common and lethal gynecological cancer in women worldwide; however, biomarkers to diagnose and predict prognosis of OSC remain limited. Therefore, the present study aimed to investigate whether sodium/potassium adenosine triphosphate (Na+/K+-ATP)ase α-subunits (ATP1As) are helpful diagnostic and prognostic markers of OSC. Methods: Gene expression data (RNA-Seq) of 376 patients with OSC were downloaded from The Cancer Genome Atlas (TCGA) program database. Additional databases used in our analysis included the Gene Expression Omnibus, International Cancer Genome Consortium, Genotype–Tissue Expression, the Human Protein Atlas, cBioPortal for Cancer Genomics, and Cancer Cell Line Encyclopedia.
  • A Recurrent De Novo Mutation in ATP1A3 Gene in a Mexican Patient with Alternating Hemiplegia of Childhood Detected by Massively Parallel Sequencing © Permanyer 2019

    A Recurrent De Novo Mutation in ATP1A3 Gene in a Mexican Patient with Alternating Hemiplegia of Childhood Detected by Massively Parallel Sequencing © Permanyer 2019

    BoletínMédicodel HospitalInfantildeMéxico CLINICALCASE A recurrentde novo mutationinATP1A3 geneinaMexican patient withalternatinghemiplegiaofchildhooddetectedby massivelyparallelsequencing © Permanyer 2019 Carolina I. Galaz-Montoya1, Sofia Alcaraz-Estrada2, Leopoldo A. García-Montaño3, . Juan C. Zenteno3,4 and Raul E. Piña-Aguilar5* 1Private practice, Hermosillo, Sonora, Mexico; 2Division of Medical Genomics, Centro Médico Nacional 20 de Noviembre, ISSSTE, Mexico City, Mexico; 3Research Unit in Genetics, Instituto de Oftalmología Conde de Valencia, Mexico City, Mexico; 4Department of Biochemistry, Facultad de Medicina, Universidad Nacional Autónoma de Mexico, Mexico City, Mexico; 5School of Medicine, Medical Sciences and Nutrition, University of Aberdeen, Aberdeen, United Kingdom of the publisher Abstract Background: Pediatric movement disorders represent a diagnostic challenge for pediatricians and pediatric neurologists due to their high clinical heterogeneity and shared common features. Therefore, specific diagnoses require different approaches including metabolic work-up and specific tests for frequent genetic conditions. Alternating hemiplegia of childhood (AHC) is an ultra-rare pediatric movement disorder, characterized by paroxysmal alternating hemiplegia, dystonia, and seizure-like epi- sodes that can be misleading during the evaluation of a child with a movement disorder. Case report: We present a Mexican patient with abnormal movements referred to the Genetics clinic because of hyperammonemia and a possible organic acide- mia. Our assessment did not find clinical features compatible with an inborn error of metabolism. A massively parallel sequen- cing approach with targeted panel sequencing was used to get a final diagnosis. A missense variant c.2839G>A (p.Gly947Arg) located at exon 21 of ATP1A3 gene was demonstrated. This variant (rs398122887) has been previously reported as de novo producing alternating hemiplegia of childhood (AHC).
  • Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer

    Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer

    Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/).
  • Supplementary Information Page

    Supplementary Information Page

    Supplementary information page Criteria for inclusion of patient variants in the analysis 1 Figure e-1 Alignment of the four human Na,K-ATPase alpha subunits 2-3 Figure e-2 Conformation differences when Na+ or K+ ions are bound 4 Figure e-3 Color-coded conservation scores for ATP1A1 generated by ConSurf 5 Figure e-4 Milder and more severe ATP1A3 pathogenic variants in the P domain are similar 6 Figure e-5 ATP1A2 and ATP1A3 variants in the S domain are also similar 7 Table e-1 Variants in ATP1A1 with references 8 Table e-2 Variants in ATP1A2 with references 9-13 Table e-3 Variants in ATP1A3 with references 14-19 Table e-4 Variants excluded from the analysis with references 20-21 Criteria for inclusion of patient variants in the analysis All included variants were missense, except that deletions of single amino acids were included without prejudice because several were recurrent in ATP1A2 and ATP1A3. The few more complicated genetic variants, splice site variants, and premature stops were not considered. Variants were considered pathogenic if: 1) identical variants arose independently in two or more unrelated patients/families with similar symptoms; 2) variants caused alternative amino acid changes in a single codon, with symptoms on the spectrum; 3) variants occurred at the equivalent position in more than one paralog, with symptoms typical of that paralog; or 4) there was laboratory evidence of impairment of Na,K-ATPase activity or biosynthesis. Single-family variants not meeting those criteria were considered probably pathogenic if 1) variants were proven to be de novo with DNA from both parents, or 2) pedigree data showed segregation with only affected members of the family, and 3) were considered possibly pathogenic when there was minimal or ambiguous pedigree data.
  • ATP1A3 Information Sheet 6-7-19

    ATP1A3 Information Sheet 6-7-19

    ATP1A3 Analysis for Alternating Hemiplegia of Childhood Clinical Features: Alternating hemiplegia of childhood (AHC) [OMIM #614820] is a rare neurodevelopmental syndrome characterized by recurrent episodes of hemiplegia on alternating sides of the body, beginning in infancy (1). Hemiplegia episodes often resolve during sleep in affected individuals (2). Some patients may have specific triggers for hemiplegia, which may include cold temperatures, emotional stress, fatigue, and bathing (2). Other features include developmental delay, dystonia, choreoathetosis and epilepsy (1). Behavioral and psychiatric disorders may also be observed, including attention deficit, impulsivity, and short-temperedness (2). Mutations in ATP1A3 can also be associated with rapid-onset dystonia-parkinsonism [OMIM#128235] (1). Molecular Genetics: Abnormalities of the ATP1A3 [OMIM #182350] gene, have been identified in patients with alternating hemiplegia of childhood. ATP1A3 has 23 coding exons and is located at 19q13.2. Heinzen et al. (2012) identified heterozygous ATP1A3 mutations in 82 out of 105 patients with AHC (78%), including missense, splice site and frameshift mutations. ATP1A3 encodes a subunit of the Na+/K+ ATPase pump, which is involved in maintaining electrochemical gradients across the plasma membranes of neurons. Functional studies of selected AHC-associated ATP1A3 mutations have shown that mutations lead to reduced ATPase activity in vitro (1). Inheritance: ATP1A3 mutations are inherited in an autosomal dominant pattern. The majority of cases are due to de novo mutations. Recurrence risk for unaffected parents of confirmed de novo cases is low. Test methods: Comprehensive sequence coverage of the coding regions and splice junctions of the ATP1A3 gene is performed. Targets of interests are enriched and prepared for sequencing using the Agilent SureSelect system.
  • *Revised Manuscript Click Here to View Linked References

    *Revised Manuscript Click Here to View Linked References

    *Revised Manuscript Click here to view linked References Regular Article A functional correlate of severity in alternating hemiplegia of childhood Melody Li, BSc(Hons)a, Dana Jazayeri, BSc(Hons)a, Ben Corry, PhDb, K. Melodi McSweeney, BScc, Erin L. Heinzen, PhDc, David B. Goldstein, PhDc, Steven Petrou, PhDa,d aIon Channels & Disease Group, Epilepsy Division, The Florey Institute of Neuroscience and Mental Health, Parkville, Victoria, Australia. bResearch School of Biology, Australian National University, Canberra, Australia, cCenter for Human Genome Variation, Duke University School of Medicine, Durham, North Carolina, USA. dCentre for Neural Engineering, Department of Electrical Engineering, The University of Melbourne, Victoria, Australia Corresponding author: Prof Steven Petrou Corresponding author’s address: Florey Institute of Neuroscience and Mental Health Kenneth Myer Building, 30 Royal Parade, Parkville Victoria, Australia, 3010 Corresponding author’s phone and fax: +613 9035 3628 Corresponding author’s e-mail address: [email protected] Number of words in abstract: 240 Number of words in main text: 2940 Number of figures: 5 Conflict of interest and submission declaration: The authors have nothing to disclose. The manuscript is not under consideration for publication in any other journals. Acknowledgement statement: We would like to acknowledge Prof. David C. Gadsby, Dr. Natascia Vedovato, Dr. Peter A. Paulsen and Hanne Poulsen for their helpful suggestions on experimental protocol. PAGE 2 ABSTRACT Objective: Mutations in ATP1A3, the gene that encodes the α3 subunit of the Na+/K+ ATPase, are the primary cause of alternating hemiplegia of childhood (AHC). Correlations between different mutations and AHC severity were recently reported, with E815K identified in severe and D801N and G947R in milder cases.
  • A Genome-Wide Rnai Screen Identifies Multiple RSK-Dependent Regulators of Cell Migration

    A Genome-Wide Rnai Screen Identifies Multiple RSK-Dependent Regulators of Cell Migration

    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press A genome-wide RNAi screen identifies multiple RSK-dependent regulators of cell migration Gromoslaw A. Smolen,1,5 Jianmin Zhang,1,5 Matthew J. Zubrowski,1 Elena J. Edelman,1 Biao Luo,2 Min Yu,1 Lydia W. Ng,1 Cally M. Scherber,3 Benjamin J. Schott,1 Sridhar Ramaswamy,1,2 Daniel Irimia,3 David E. Root,2 and Daniel A. Haber1,4,6 1Massachusetts General Hospital Cancer Center, Harvard Medical School, Charlestown, Masachusetts 02129, USA; 2Broad Institute, Cambridge, Massachusetts 02142, USA; 3BioMEMS Resource Center, Center for Engineering in Medicine and Surgical Services, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02114, USA; 4Howard Hughes Medical Institute, Harvard Medical School, Boston, Massachusetts 02114, USA To define the functional pathways regulating epithelial cell migration, we performed a genome-wide RNAi screen using 55,000 pooled lentiviral shRNAs targeting ~11,000 genes, selecting for transduced cells with increased motility. A stringent validation protocol generated a set of 31 genes representing diverse pathways whose knockdown dramatically enhances cellular migration. Some of these pathways share features of epithelial- to-mesenchymal transition (EMT), and together they implicate key regulators of transcription, cellular signaling, and metabolism, as well as novel modulators of cellular trafficking, such as DLG5. In delineating downstream pathways mediating these migration phenotypes, we observed universal activation of ERKs and a profound dependence on their RSK effectors. Pharmacological inhibition of RSK dramatically suppresses epithelial cell migration induced by knockdown of all 31 genes, suggesting that convergence of diverse migratory pathways on this kinase may provide a therapeutic opportunity in disorders of cell migration, including cancer metastasis.
  • Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias

    Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias

    International Journal of Molecular Sciences Review Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias Giacomo Garone 1,2 , Alessandro Capuano 2 , Lorena Travaglini 3,4 , Federica Graziola 2,5 , Fabrizia Stregapede 4,6, Ginevra Zanni 3,4, Federico Vigevano 7, Enrico Bertini 3,4 and Francesco Nicita 3,4,* 1 University Hospital Pediatric Department, IRCCS Bambino Gesù Children’s Hospital, University of Rome Tor Vergata, 00165 Rome, Italy; [email protected] 2 Movement Disorders Clinic, Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (A.C.); [email protected] (F.G.) 3 Unit of Neuromuscular and Neurodegenerative Diseases, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (L.T.); [email protected] (G.Z.); [email protected] (E.B.) 4 Laboratory of Molecular Medicine, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] 5 Department of Neuroscience, University of Rome Tor Vergata, 00133 Rome, Italy 6 Department of Sciences, University of Roma Tre, 00146 Rome, Italy 7 Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00165 Rome, Italy; [email protected] * Correspondence: [email protected]; Tel.: +0039-06-68592105 Received: 30 April 2020; Accepted: 13 May 2020; Published: 20 May 2020 Abstract: Paroxysmal movement disorders (PMDs) are rare neurological diseases typically manifesting with intermittent attacks of abnormal involuntary movements. Two main categories of PMDs are recognized based on the phenomenology: Paroxysmal dyskinesias (PxDs) are characterized by transient episodes hyperkinetic movement disorders, while attacks of cerebellar dysfunction are the hallmark of episodic ataxias (EAs).
  • Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures

    Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures

    CONTINUOUSLY ACTIVE TRANSCRIPTIONAL PROGRAMS ARE REQUIRED TO BUILD EXPANSIVE SEROTONERGIC AXON ARCHITECTURES By LAUREN JANINE DONOVAN Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY January 2020 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Lauren Janine Donovan candidate for the degree of Doctor of Philosophy*. Committee Chair Jerry Silver, Ph.D. Committee Member Evan Deneris, Ph.D. Committee Member Heather Broihier, Ph.D. Committee Member Ron Conlon, Ph.D. Committee Member Pola Philippidou, Ph.D. Date of Defense August 29th, 2019 *We also certify that written approval has been obtained for any proprietary material contained therein. ii TABLE OF CONTENTS List of Figures……………………………………………………………………….….vii Abstract………………………………………….………………………………..….…1 CHAPTER 1. INTRODUCTION………………………………………………...……..3 GENERAL INTRODUCTION TO SEROTONIN………………………………….….4 Serotonin: Discovery and function………………………….……………...4 Serotonin Biosynthesis…………………………..…………………………..6 Manipulation of the serotonin system in humans……………………….6 Human mutations in 5-HT related genes………………………………….9 SEROTONIN NEURON NEUROGENESIS……………..………………………….11 5-HT neuron specification……………..………………………………...…11 Development of 5-HT neurons……………..………………………………13 NEUROANATOMY……………..……………………………………………………..13 Cytoarchitecture ……………..………………………………………………13 Adult Ascending 5-HT axon projection system ………………………..14
  • The Biophysics of Na+,K+-Atpase in Neuronal Health and Disease

    The Biophysics of Na+,K+-Atpase in Neuronal Health and Disease

    kth royal institute of technology Doctoral Thesis in Biological Physics The Biophysics of Na+,K+-ATPase in neuronal health and disease EVGENY AKKURATOV Stockholm, Sweden 2020 The Biophysics of Na+,K+-ATPase in neuronal health and disease EVGENY AKKURATOV Academic Dissertation which, with due permission of the KTH Royal Institute of Technology, is submitted for public defence for the Degree of Doctor of Philosophy on Friday the 18h December 2020, at 1:00 p.m. in Fire, Science for Life Laboratory, Tomtebodavägen 23A, Solna. Doctoral Thesis in Biological Physics KTH Royal Institute of Technology Stockholm, Sweden 2020 © Evgeny Akkuratov ISBN 978-91-7873-738-3 TRITA-SCI-FOU 2020:47 Printed by: Universitetsservice US-AB, Sweden 2020 Abstract Na+,K+-ATPase is one of the most important proteins in the mammalian cell. It creates sodium and potassium gradients which are fundamental for the membrane potential and sodium-dependent secondary active transport. It has a second role in the cell as a receptor that by binding chemicals from the cardiotonic steroids family, the most knowledgeable of them is ouabain, triggers various signaling pathways in the cell which regulate gene activation, proliferation, apoptosis, etc. It has been shown that several severe neurological diseases are associated with mutations in the Na+,K+-ATPase encoding genes. Although Na+,K+-ATPase was discovered already in 1957 by the Danish scientist Jens Skou, the knowledge about the function of this enzyme is still not complete. In the studies included in the thesis, we have learned more about the function of Na+,K+-ATPase in different aspects of health and disease.