Accepted Manuscript
Histone methyltransferase G9a promotes liver cancer development by epige- netic silencing of tumor suppressor gene RARRES3
Lai Wei, David Kung-Chun Chiu, Felice Ho-Ching Tsang, Dicky Cheuk-Ting Law, Carol Lai-Hung Cheng, Sandy Leung-Kuen Au, Joyce Man-Fong Lee, Carmen Chak-Lui Wong, Irene Oi-Lin Ng, Chun-Ming Wong
PII: S0168-8278(17)32051-2 DOI: http://dx.doi.org/10.1016/j.jhep.2017.05.015 Reference: JHEPAT 6540
To appear in: Journal of Hepatology
Received Date: 25 August 2016 Revised Date: 29 April 2017 Accepted Date: 11 May 2017
Please cite this article as: Wei, L., Chiu, D.K-C., Tsang, F.H-C., Law, D.C-T., Cheng, C.L-H., Au, S.L-K., Lee, J.M-F., Wong, C.C-L., Ng, I.O-L., Wong, C-M., Histone methyltransferase G9a promotes liver cancer development by epigenetic silencing of tumor suppressor gene RARRES3, Journal of Hepatology (2017), doi: http://dx.doi.org/ 10.1016/j.jhep.2017.05.015
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Histone methyltransferase G9a promotes liver cancer development by epigenetic silencing of tumor suppressor gene RARRES3
Lai Wei 1,2,3, David Kung-Chun Chiu 1,2, Felice Ho-Ching Tsang 1,2,3, Dicky Cheuk-Ting Law 1,2,
Carol Lai- Hung Cheng 1, 2 , Sandy Leung-Kuen Au 1,2, Joyce Man-Fong Lee 1,2, Carmen Chak-
Lui Wong 1,2, Irene Oi-Lin Ng 1,2 *, and Chun-Ming Wong 1,2,3 *
1. State Key Laboratory for Liver Research, the University of Hong Kong, Hong Kong
2. Department of Pathology, Li Ka Shing Faculty of Medicine, University of Hong Kong, Hong
Kong.
3. The University of Hong Kong Shenzhen Institute of Research and Innovation, Shenzhen,
China
* Correspondence address
Correspondence to: Chun-Ming Wong or Irene Oi-Lin Ng, State Key Laboratory for Liver
Research and Department of Pathology, University Pathology Building, The University of Hong
Kong, Queen Mary Hospital, Pokfulam, Hong Kong. E-mail: Irene Oi-Lin Ng ([email protected]) or
Chun-Ming Wong ([email protected])
Keywords: Epigenetics; histone modifications, G9a; gene amplification, miR-1, RARRES3
Financial support: The study was supported by National Natural Science Foundation of China
General Program (81572446), and Hong Kong Research Grants Council Theme-based Research
Scheme (T12-704/16R) and General Research Funds (17115815 and HKU780612M). I.O.L. Ng is Loke Yew Professor in Pathology.
Acknowledgements: We thank the Core Facility and Center for Genomic sciences of LKS
Faculty of Medicine for their technical support. We also thank the Laboratory Animal Unit of the
University of Hong Kong for animal holding.
Author contribution: C.M.W. and L.W. designed the experiments. L.W., D.C., F.T., D.L., C.C.,
S.A., J. L., and C.C.W. performed the experiments. C.M.W., and L.W. analyzed the data,
C.M.W., L.W. and I.N. wrote the manuscript. C.M.W. and I.N. supervised the study.
Conflict of interest: The authors who have taken part in this study declared that they do not have anything to disclose regarding funding or conflict of interest with respect to this manuscript. 1 Abstract
2 Background and Aims: Hepatocellular carcinoma (HCC) is a major leading cause of cancer
3 mortality worldwide. Epigenetic deregulation is a common trait of human HCC. G9s is an
4 important epigenetics regulator. However, its roles in liver carcinogenesis remain to be
5 investigated.
6 Methods: Gene expressions were determined by RNA-Seq and qRT-PCR. G9a knockdown and
7 knockout cell lines were established by lentiviral-based shRNA and CRISPR/Cas9 gene editing
8 system. Tumor promoting functions of G9a was studied by both in HCC cell lines and nude mice
9 model. The down-stream targets of G9a were identified by RNA-Seq and confirmed by ChIP
10 assay. The therapeutic value of G9a inhibitors was evaluated both in vitro and in vivo.
11 Results: We identified G9a as a frequently up-regulated histone methyltransferase in human
12 HCCs. Up-regulation of G9a was significantly associated with HCC progression and aggressive
13 clinicopathological features. Functionally, we demonstrated that inactivation of G9a by RNAi
14 knockdown, CRISPR/Cas9 knockout, and pharmacological inhibition remarkably abolished
15 H3K9 di-methylation and suppressed HCC cell proliferation and metastasis in both in vitro and
16 in vivo models. Mechanistically, we showed that the frequent up-regulation of G9a in human
17 HCCs was attributed to gene copy number gain at chromosome 6p21. In addition, we identified
18 miR-1 as a negative regulator of G9a. Loss of miR-1 relieved the post-transcriptional repression
19 on G9a and contributed to its up-regulation in human HCC. Utilizing RNA-sequencing, we
20 identified the tumor suppressor RARRES3 as a critical target of G9a. Epigenetic silencing of
21 RARRES3 contributed to the tumor-promoting function of G9a. 22 Conclusion: Our findings discovered a frequent deregulation of miR-1/G9a/RARRES3 axis in
23 liver carcinogenesis. Our findings also highlighted the pathological significance of G9a and its
24 therapeutic potential in HCC treatment.
25
26 Word count: 274 words
27
28 29 Lay Summary: In this study, we identified G9a histone methylation was frequently up-regulated
30 in human HCC and contribute to epigenetic silencing of tumor suppressor genes RARRES3 in
31 liver cancer. Targeting G9a may be a novel approach for HCC treatment.
32
33 Graphical abstract
34
35 Graphical abstract: Deregulation of G9a in human HCC. G9a was frequently up-regulated in
36 human HCC and implicated in HCC tumorigenesis and metastasis. The frequent up-regulation of
37 G9a in human HCC was attributed to gene copy number gain at 6p21 and loss of miR-1. The
38 oncogenic function of G9a was at least partially attributed to the epigenetic silencing of tumor
39 suppressor RARRES3.
40 41 Introduction
42 Hepatocellular carcinoma (HCC) is the fifth most common malignancy worldwide [1]. In 2012,
43 there were 782,000 new HCC cases diagnosed, and 746,000 patients died of HCC. HCC
44 accounts for 9.1% of all cancer deaths, making it the second largest cause of cancer mortality
45 worldwide [1, 2]. The patient survival rate of HCC is extremely poor. This is mainly due to the
46 asymptomatic progression of HCC at the early stage and high metastasis potential at the late 47 stage. Conventional chemotherapies have no significant impact on the overall survival, and only
48 a small fraction of HCC patients are eligible for curative surgical resection [1, 2]). Currently,
49 Sorafenib is the only molecularly targeted drug approved by Food and Drug Administration
50 (FDA) for the treatment of advanced HCC. However, the survival advantage of Sorafenib
51 treatment is only modest [3]. Therefore, a better understanding of the molecular mechanisms
52 underlying liver carcinogenesis is crucial for the development of novel diagnostic methods as
53 well as identification of new therapeutic targets, which may help to improve the patients’
54 survival rates of this deadly disease.
55 Traditionally, cancer was considered as a disease driven by genetic abnormalities. Currently, it is
56 also commonly believed that deregulation of epigenetic components may play an equally
57 important role in human carcinogenesis [4]. The development of HCC follows a multistep
58 process that often initiates from chronic hepatitis B viral (HBV) or C (HCV) infection. The
59 chronic inflammatory microenvironment promotes liver cirrhosis, which may evolve into the
60 pre-malignant dysplastic nodule. These background liver diseases can consequently induce
61 malignant transformation of early HCC and eventually develops into a metastatic outgrowth of
62 advance HCC. This multistep process involves a gradual accumulation of genetic and epigenetic
63 alternations leading to hyperactivation of proto-oncogenes and inactivation of critical tumor 64 suppressor genes to fuel cancer progression [5]. Common epigenetic changes in human cancers
65 include aberrant DNA methylation, altered post-translational histone modifications, disordered
66 chromatin remodeling, and deregulated non-coding RNA expression. Unlike genetic alterations,
67 these epigenetic changes are often reversible, which makes epigenetic therapy an attractive
68 direction for anti-cancer drug development [6]. The profound involvement of aberrant DNA
69 methylation in liver carcinogenesis has already been firmly established in the literature, while the
70 implications of histone modifications in HCC are relatively less well characterized. Nevertheless,
71 histone modifications appear to play important roles in organizing the nuclear architecture, with
72 consequent effects on the regulation of gene transcription [7, 8]. Recently, deregulation of
73 histone modifications has emerged as an important mechanism in cancer development. For
74 instance, histone lysine methyltransferases, EZH2, SUV39H1, and SETDB1 are frequently
75 deregulated in human HCC and are essential for HCC initiation, progression and metastasis [9-
76 11]. In the present study, we showed that histone lysine methyltransferase G9a (also known as
77 euchromatic histone-lysine N-methyltransferase 2, EHMT2) was significantly up-regulated in
78 HCC, as revealed by whole transcriptome sequencing and qRT-PCR analyses. G9a is a SET
79 domain-containing protein and specifically catalyzes histone 3 lysine 9 di-methylation
80 (H3K9me2), which is a prominent epigenetic mark for transcriptional repression in euchromatin
81 region. G9a-mediated transcriptional repression is essential for cell differentiation and
82 embryogenesis [12-14]. G9a-deficient mice are embryonically lethal due to severe growth
83 retardation [14]. Aberrant installation of H3K9me2 was found to be involved in the pathogenesis
84 of different types of human cancers [15, 16]. However, little is known about the clinical and
85 pathological roles of G9a in human HCC. Given the importance of G9a in mediating histone
86 modification and the fact that it is highly up-regulated in human HCC, we hypothesize that 87 deregulation of G9a may contribute to aberrant epigenetic silencing in HCC. Whether G9a
88 functions as a tumor-promoting gene in HCC or not and the mechanisms by which G9a
89 deregulation promotes hepatocarcinogenesis remain to be clarified. Therefore, a comprehensive
90 investigation into the functional and pathological roles of G9a in human HCC is warranted.
91
92 Results
93 Frequent up-regulation of G9a in human HCCs
94 Our previous expression profiling analyses of human HCCs and their corresponding non-
95 tumorous (NT) livers with TaqMan low density array and whole transcriptome sequencing
96 (RNA-Seq) revealed that up-regulation of epigenetic regulators was a common event [9, 11]. We
97 found that G9a was consistently one of the most significantly up-regulated epigenetic regulators.
98 In the RNA-Seq discovery sample set, the mRNA expression of G9a was increased in HCCs by
99 4.5 folds as compared with their corresponding NT livers (Figure 1A). We validated this initial
100 observation in an expanded sample cohort consisting of 5 normal livers and 92 pairs of HCCs
101 and NT livers by qRT-PCR. As expected, G9a was found to be significantly up-regulated in
102 HCCs (P < 0.0001, Figure 1B). Overexpression of G9a (> 2 folds) was detected in 68% (63/92)
103 of HCCs. In contrast, only 4% (4/92) of HCC cases exhibited down-regulation (< 0.5 fold)
104 (Figure 1C). Since our HCCs are mainly (~80%) associated with HBV infection, to confirm
105 whether G9a up-regulation is a common event across different etiology groups, we analyzed the
106 G9a expression in TCGA (The Cancer Genome Atlas) RNA-Seq dataset, which has mixed
107 etiologies. Consistent with our findings, significant up-regulation of G9a was also detected in 50
108 paired HCCs, with both HCCs and corresponding NT livers available, in TCGA (P < 0.0001, 109 Figure 1D). 60% (30/50) of HCC cases showed at least 2-fold up-regulation, and yet no cases
110 showed down-regulation of G9a (Figure 1E). These findings suggested that up-regulation of G9a
111 was not limited to HBV-associated HCCs but was a general phenomenon in human HCCs. More
112 strikingly, G9a expression was also significantly up-regulated in multiple cancer types available
113 in TCGA, indicating that deregulation of G9a is indeed a common alteration in human cancers
114 (Supplementary figure 1).
115 Clinicopathological significance of G9a up-regulation in human HCCs
116 We investigated G9a expression in different stages of liver carcinogenesis and found that its
117 expression was increased in a step-wise manner. In our qRT-PCR analysis on the expanded HCC
118 cohort, the median G9a expression level increased from normal liver (NL) to chronic hepatitis
119 (CH) and cirrhotic liver (CL), then to early HCC and finally advanced HCC (P < 0.0001, Figure
120 1F). Next, we investigated the clinical implications of G9a up-regulation in human HCCs by
121 correlating G9a mRNA expression changes with the various clinicopathological features. We
122 found that G9a overexpression was significantly associated with the aggressiveness and
123 metastatic features of HCC, in terms of advanced pTNM stage (P = 0.0195), the presence of
124 venous invasion (P = 0.0042) and tumor microsatellite formation (P = 0.0080), and the absence
125 of tumor encapsulation (P = 0.0145) (Figure 1G). Taken together, these findings suggested that
126 up-regulation of G9a had significant pathological implications and might promote cancer
127 metastasis in human HCC.
128 G9a gene copy number gain contributed to G9a mRNA up-regulation in human HCCs
129 G9a was highly up-regulated in human HCCs, yet the underlying mechanisms remain elusive.
130 Based on the published comparative genomic hybridization (CGH) studies, chromosome 6p21,
131 where the G9a gene is located, was frequently amplified in human HCCs (Supplementary Figure 132 2). Therefore, we sought to investigate whether gene copy number gain directly contributed to
133 the frequent up-regulation of G9a in human HCCs. We performed a qPCR-based gene copy
134 number assay in 32 pairs of HCCs and their NT liver counterparts and found that gain of G9a (≥
135 3 copies) was detected in 60% of HCCs. In contrast, all of the NT livers had only 2 copies of
136 G9a gene (Figure 2A and B). Notably, the mRNA expression of G9a was also positively
137 correlated with G9a gene copy number gain in the HCC tumors (Figure 2C). Similar
138 observations were also made from analysis of the G9a gene copy number and mRNA expression
139 data available in TCGA (Figure 2D and 2E). Together, these findings demonstrated that G9a
140 gene copy gain was a common event in HCCs and has a direct impact on the up-regulation of
141 G9a mRNA expression.
142 Loss of miR-1 contributed to G9a up-regulation in human HCC
143 MicroRNA (miRNA) is an important class of post-transcriptional regulators mediating mRNA
144 expression by binding to the 3’ untranslated region (3’UTR) of its target genes. In order to
145 investigate whether miRNAs are involved in regulating G9a expression, we genetically deleted
146 the 3’UTR of G9a in BEL7402 cells by using CRISPR/Cas9 (clustered regularly interspaced
147 short palindromic repeats) genome editing technology (Figure 3A). Successful deletion of G9a-
148 3’UTR was confirmed by Sanger sequencing. Two of the clones, G9a-∆3’UTR#42 and #52,
149 were chosen for further analysis. Strikingly, the expression of G9a at both mRNA and protein
150 levels were significantly augmented upon deletion of G9a-3’UTR (Figure 3B). These
151 observations imply that miRNA may be involved in the post-transcriptional regulation of G9a
152 expression. To identify the potential miRNA binding sites in G9a-3’UTR, in silico analysis was
153 performed using TargetScan and miRANDA miRNA target prediction algorithms
154 (Supplementary figure 3). MiR-1 and miR-613 were suggested as potential miRNAs that could 155 regulate G9a expression. However, miR-613 was not expressed in human HCC nor NT livers
156 (data not shown); thus we focused on studying the impact of miR-1 on G9a expression. MiR-1
157 was predicted to form a thermokinetically stable duplex with G9a-3’UTR and the miR-1 binding
158 sequence was evolutionarily conserved across different species (Figure 3C). The expression of
159 miR-1 was also found to be frequently down-regulated in human HCCs (P = 0.0002, Wilcoxon
160 signed-rank test, Figure 3D). Importantly, miR-1 expression was negatively correlated with the
161 mRNA expression of G9a (R2 = 0.2581, P < 0.0001, Figure 3E). The direct interaction between
162 miR-1 and G9a-3’UTR was experimentally validated by dual-luciferase reporter assay. The wild
163 type (WT) and mutant (Mut) miR-1 binding sequences of G9a-3’UTR were inserted into the 3’
164 end of a firefly luciferase gene (Figure 3F). We found that overexpression of miR-1 precursor
165 significantly repressed luciferase activity associated with WT G9a-3’UTR but not Mut G9a-
166 3’UTR nor the empty vector control (P < 0.001, Figure 3G), which confirms that miR-1 could
167 target 3’UTR of G9a and negatively regulate its expression. Consistent with this finding, we also
168 found that transient overexpression of miR-1 significantly down-regulated endogenous G9a
169 protein expression in HCC cell lines (Figure 3H). Collectively, we demonstrated that miR-1 is a
170 post-transcriptional regulator of G9a. Loss of miR-1 relieved the post-transcriptional repression
171 imposed on G9a and contributed to its up-regulation in human HCC.
172 G9a is the major histone methyltransferase responsible for H3K9 di-methylation in HCC
173 Consistent with our findings in human HCCs, significant up-regulation of G9a was also found in
174 all HCC cell lines when compared with the immortalized normal liver cell line, THLE-3 (Figure
175 4A). To characterize the molecular functions of G9a in HCC, we established G9a stable
176 knockdown models in BEL7402 and SMMC-7721 cell lines by delivering short hairpin RNA
177 (shRNA) targeting the coding sequence of G9a through a lentiviral system. Two independent 178 shRNA sequences (shG9a#69 and #70) were included to avoid possible off-target effects.
179 Successful knockdown of G9a was verified at both protein and mRNA levels, and both shRNA
180 sequences achieved more than 70% of knockdown efficiency in BEL7402 and SMMC-7721 cell
181 lines (Figure 4B). In addition, we established the G9a genetically knockout HCC cell models in
182 BEL7402 and SMMC-7721 using CRISPR/Cas9 system to target the exon 7 of G9a and
183 eliminate all isoforms (Figure 4C). Two independent single guide RNA (sgRNA) sequences
184 (sg#3 and sg#4) were used to minimize the possible experimental artifacts. The complete
185 knockout of G9a was confirmed by Western blotting (Figure 4D). We found that the H3K9me2
186 level was substantially diminished upon G9a knockout whereas the levels of H3K9me3,
187 H3K4me3 and H3K27me3 were not affected, suggesting that G9a is the major histone
188 methyltransferase responsible for the transcriptional repressive H3K9me2 in HCC genome
189 (Figure 4E).
190 Knockdown and knockout of G9a suppressed the proliferation and migration of HCC cells
191 in vitro
192 Our RNA-Seq data indicated that the expression level of G9a was positively correlated with the
193 proliferation marker Ki67 in human HCC, suggesting that G9a may play a role in HCC cell
194 proliferation (R2 = 0.7192, P < 0.0001, Figure 5A). We then performed cell proliferation assay
195 and colony formation assay to test the effects of G9a on HCC cell growth. The results showed
196 that knockdown or knockout of G9a significantly inhibited the proliferation of both BEL7402
197 and SMMC-7721 cells (Figure 5B, C, D, and E). We also showed that knockout of G9a induced
198 cell apoptosis and autophagy (Supplementary figure 4), which may contribute to the reduced cell
199 proliferation upon G9a depletion in HCC cells. Besides the effect on cell proliferation, our
200 clinical correlation analysis revealed a positive association between G9a up-regulation and 201 aggressive metastatic features in human HCCs (Figure 1G). It is therefore reasonable to
202 speculate that up-regulation of G9a may also be implicated in HCC metastasis. In order to
203 examine the effect of G9a on HCC cell migration, transwell cell migration assay was performed.
204 Knockdown or knockout of G9a remarkably reduced HCC cell migration rate (Figure 5F and G),
205 which echoed with our observations in the clinicopathological analysis in HCC patients and
206 highlighted the important role of G9a on HCC cell motility and metastasis.
207 Knockdown and knockout of G9a inhibited HCC tumorigenicity and lung metastasis in
208 vivo
209 To consolidate the findings obtained from the above in vitro experiments, we sought to further
210 demonstrate the tumor-promoting role of G9a in HCC using in vivo models. Subcutaneous
211 xenograft model was employed to test the effect of G9a knockdown in HCC tumorigenicity. We
212 found that the size and weight of tumors derived from the shG9a group were significantly
213 decreased as compared with the NTC group (Figure 6A and B). The findings were consistent
214 with both BEL7402 (Figure 6A) and SMMC-7721 (Figure 6B) cell lines. To further verify the
215 tumor-promoting function of G9a, we performed orthotopic liver implantation experiment using
216 G9a knockout BEL7402 HCC cells. We found that knockout of G9a in BEL7402 cells
217 significantly decreased the size of HCC tumors formed in the liver microenvironment as
218 compared with the WT cells (Figure 6C). Importantly, knockout of G9a also attenuated the lung
219 metastasis of HCC cells (Figure 6D). The reduced lung metastasis of HCC cells upon G9a
220 knockout was also observed in tail-vein injection model (Supplementary figure 5). These
221 observations were in accordance with what we observed in the in vitro models. Taken together,
222 these further indicate that G9a functions as a tumor-promoting gene and is crucial for HCC cell
223 growth and metastasis. 224 G9a histone methyltransferase inhibitors suppressed HCC cell proliferation
225 Small molecular inhibitors of histone methyltransferases have recently attracted considerable
226 interests for the development of novel targeted cancer therapy. Our present study showed that
227 G9a as a major histone methyltransferase for H3K9me2 was essential for HCC proliferation and
228 metastasis. These findings prompted us to investigate the therapeutic potential of targeting G9a
229 as a novel approach for HCC treatment. UNC0638 [18] and BIX01294 [19] are specific G9a
230 inhibitors which selectively inhibit the histone methyltransferase activity of G9a, thus
231 modulating the global H3K9me2 level and local histone modification signature to regulate gene
232 expressions. In this study, we showed that the UNC0638 and BIX01294 effectively suppressed
233 HCC cell proliferation with GI50 (50% growth inhibition) at 7.325 µM and 5.225 µM,
234 respectively (Figure 6E and F). UNC0638 and BIX01294 treatment at 5µM substantially
235 inhibited colony formation and induced notable morphological change in HCC cells (Figure 6G).
236 The specificity of G9a inhibition was demonstrated by Western blotting which showed that
237 treatment of UNC0638 and BIX01294 at 5 µM significantly depleted H3K9me2 in HCC cells
238 without affecting H3K4me3 and H3K27me3 levels (Figure 6G and Supplementary figure 6).
239 Since UNC0638 and BIX01294 are not stable in vivo, we used another newly identified G9a
240 inhibitor UNC0642 which has good pharmacokinetic (PK) properties to test the effect of G9a on
241 tumor growth in vivo. We showed that UNC0642 could also specifically inhibited H3K9me2 and
242 significantly reduced tumor volume in vivo (Supplementary figure 7). Taken together, our
243 findings suggested that chemically inhibition of G9a histone methyltransferase activity by small
244 molecular inhibitors selectively reduced H3K9me2 level and consequently resulted in
245 suppression of HCC cell proliferation both in vitro and in vivo. Our findings supported the notion
246 that G9a may be a potential therapeutic target for HCC treatment. 247 Suppression of RARRES3 contributed to the tumor-promoting function of G9a
248 We hypothesize that G9a could exert its tumor-promoting function through epigenetically
249 silencing important tumor suppressor genes in human HCC. To identify possible downstream
250 targets of G9a, we performed RNA-Seq to investigate the transcriptomic changes in G9a stable
251 knockdown HCC cells. To this end, we identified 201 genes that were significantly up-regulated
252 (> 2 folds) upon G9a knockdown in BEL7402 and SMMC-7721 cells (Figure 7A). Among them,
253 16 genes were commonly up-regulated in both two cell lines. We identified RARRES3 (Retinoic
254 acid receptor responder protein 3) as one of the potential targets of G9a in human HCC (Figure
255 7A). The RNA-Seq analysis showed that RARRES3 mRNA expression was increased by 4.24
256 folds in SMMC-7721 cells and 2.93 folds in BEL7402 cells upon stable knockdown of G9a
257 (Figure 7B).
258 RARRES3 was first identified as a tumor suppressor in 1998 and shown to be involved in cell
259 growth and differentiation [20]. Reduced expression of RARRES3 has been observed in several
260 cancer types and re-expression of RARRES3 induced apoptosis and resulted in decreased cell
261 proliferation and migration [21-24]. However, the expression level, functional roles, and
262 regulatory mechanisms of RARRES3 in human HCC are unclear. To this end, we examined the
263 RARRES3 mRNA expression in human HCCs. Consistently, RARRES3 was found to be
264 significantly down-regulated in HCC as revealed by our RNA-Seq data (P < 0.0001, Figure 7C)
265 and TCGA RNA-Seq dataset (P = 0.0041, Supplementary figure 8A). 48% (24/50) of TCGA
266 HCC cases showed at least 2-fold down-regulation (Supplementary figure 8B). In addition, a
267 negative correlation between RARRES3 and G9a was also observed in our human HCC samples
268 (P = 0.0016, R2 = 0.2867, Figure 7C) as well as a panel of HCC cell lines (P = 0.042, R2 =
269 0.2807, Supplementary figure 8C). We then determined the RARRES3 mRNA expression 270 changes in our HCC cell models and found that both knockdown and knockout of G9a
271 significantly up-regulated RARRES3 expression (Figure 7D). Similarly, suppression of G9a
272 histone methyltransferase activity by small molecular inhibitors, UNC0638 and BIX01294,
273 resulted in a remarkable elevation of RARRES3 expression in HCC cell lines (Figure 7E). On
274 the contrary, overexpressing G9a significantly reduced RARRES3 level in HCC cells as
275 demonstrated by our G9a-3’UTR deleted HCC cell model (Supplementary figure 8D). The direct
276 regulation of G9a to RARRES3 was further validated by ChIP assay. We showed that knockout
277 of G9a significantly diminished the binding of G9a as well as the level of H3K9me2 in the
278 promoter region of RARRES3 (Figure 7F). Taken together, these results suggest that G9a
279 negatively regulates the expression of RARRES3 in human HCC.
280 Next, we queried whether suppression of RARRES3 contributed to the tumor-promoting
281 function of G9a in HCC. To this end, we found that knockdown of RARRES3 in PLC/PRF/5
282 HCC cell line, which has higher endogenous RARRES3 expression, substantially accelerated
283 cell proliferation (P < 0.0001, Figure 7G). Moreover, stable knockdown of RARRES3 in
284 MHCC-97L also significantly promoted HCC cell migration (Figure 7H). In line with the above
285 findings, BrdU incorporation assay demonstrated that knockdown of RARRES3 remarkably
286 rescued the cell proliferation defects resulted by G9a knockout (Figure 7I). These results
287 collectively suggest that RARRES3 is a downstream target of G9a and the suppression of
288 RARRES3 expression significantly contributes to the tumor-promoting function of G9a in
289 human HCC.
290
291 Discussion 292 Cancer cells experience intensive epigenetic re-programing. Deregulation of epigenetic
293 regulators that are involved in controlling DNA methylation, histone modifications, and
294 chromatin remodeling may have immense impacts on cellular transformation and evolution of
295 cancer cells. In our previous RNA-Seq profiling study of 591 epigenetic regulators in human
296 HCC, we found that deregulation of epigenetic regulators is a striking feature of HCC [11]. In
297 this study, we demonstrated that G9a, a histone methyltransferase, was frequently up-regulated
298 in human HCC. The frequent up-regulation of G9a is a common characteristic of human HCC
299 that can be readily validated in an expand sample cohort consisting of 92 HCC cases as well as in
300 TCGA HCC samples. G9a is a SET domain containing histone methyltransferase specific for
301 H3K9me2 which represents a specific epigenetic mark for transcriptional repression in
302 euchromatin domain. G9a probably is the major enzyme response for this modification, because,
303 as shown in our study, genetic ablation of G9a dramatically abolished H3K9me2 in HCC
304 genome. Emerging lines of evidence have suggested that G9a up-regulation may play a role in
305 human carcinogenesis [25-27]. For instance, over-expression of G9a in ovarian cancer was
306 closely associated with advanced tumor stage and poor survival of the patients. Knockdown of
307 G9a impaired ovarian cancer cell adhesion, migration, and invasion [27]. Consistent with these
308 findings, we found that G9a expression was gradually increased along the multistep liver
309 carcinogenesis, implying that G9a up-regulation might facilitate HCC progression.
310 Clinicopathological analysis showed that G9a overexpression was significantly associated with
311 aggressive features of HCC, which further highlighted the pathological implications of G9a in
312 liver carcinogenesis. Experimentally, we employed two approaches, using RNAi knockdown and
313 CRISPR/Cas9 knockout, resulting in different depletion levels and demonstrated that G9a was
314 indeed indispensable for HCC tumorigenicity and metastasis both in vitro and in vivo. With the 315 above findings, we believe that G9a functions as a tumor-promoting gene to facilitate human
316 HCC proliferation and metastasis. In addition, pharmacological inhibition of G9a elicited a
317 drastic growth suppression effect in HCC cell lines both in vitro and in vivo. Similar observations
318 have also been made in other cancer models including neuroblastoma [28], oral squamous cell
319 carcinoma [29], and head and neck squamous cell carcinoma[30], suggesting that G9a is a
320 promising novel target for cancer epigenetic therapy.
321 In this study, we also investigated the underlying molecular mechanisms that lead to deregulation
322 of G9a in human HCC. Chromosomal aberration is frequently observed in HCC. We previously
323 reported that frequent chromosome gain and amplification at 1q21 contributed to the up-
324 regulation of SETDB1, another histone methyltransferase that responsible for H3K9me3 [11]. In
325 addition to chromosome 1q, chromosome gain of 6p was also reported as one of the most
326 frequent abnormalities in HCC [31, 32]. A recent CGH meta-analysis showed that 22.3% of
327 HCC cases acquired 6p21 amplification in their tumor [33]. Furthermore, the amplification of
328 6p21 was significantly associated with tumor invasiveness [34] and advanced tumor stage [35],
329 supporting the possible oncogenic role of 6p21 amplification in HCC. Several tumor-promoting
330 genes have been identified in this region including cyclin D3 [36], dual-specificity tyrosine-(Y)-
331 phosphorylation-regulated kinase 2 (DYRK2), and protein tyrosine kinase 7 (PTK7) [37] which
332 were implicated in various cancer types. In line with these findings, we also found that the copy
333 number of G9a was frequently gained at chromosome 6p21 in more than 60% of our HCC
334 samples and 43% of TCGA HCC cohort. More importantly, the up-regulation of G9a mRNA
335 was positively correlated with the gene copy number gain. Therefore, our study identified G9a as
336 a tumor-promoting gene with frequent chromosome 6p21 gain and may be implicated in the
337 oncogenic role of 6p amplification in HCC. 338 In addition to chromosomal abnormality, we also investigated the post-transcriptional
339 mechanism that may contribute to the frequent up-regulation of G9a. As an essential post-
340 transcriptional regulator, miRNAs deregulation is associated with the development and
341 progression of various human cancers. For instance, we previously reported that loss of miR-139
342 and miR-125b contributed to over-expression of Rho kinase 2 (ROCK2) and SUV39H1 [10, 38].
343 Recently, we also found that under-expression of miR-29a contributed to frequent up-regulation
344 of SETDB1 in HCC [11]. In this study, we identified miR-1 as an important post-transcriptional
345 regulator that negatively regulates G9a expression in human HCC. Elimination of G9a-3’UTR,
346 which contains miR-1 binding site, led to up-regulation of G9a expression at both mRNA and
347 protein levels as demonstrated by our CRISRP/Cas9-mediated G9a-3’UTR deletion model.
348 Exogenously overexpression of miR-1 reduced the G9a-3’UTR tagged luciferase signal and the
349 endogenous protein level of G9a. The expression of miR-1 was also negatively correlated with
350 that of G9a in clinical HCC specimens. All these findings suggest that loss of miR-1 relieves the
351 post-transcriptionally repression on G9a and contributes to its up-regulation in human HCC,
352 which further underlies the important role of deregulation of miRNA in HCC development.
353 Previous studies have identified several tumor suppressors that were negatively regulated by
354 G9a-mediated epigenetic silencing. In human breast cancer, knockdown of G9a restored E-
355 cadherin expression which resulted in suppression of cell migration in vitro and in vivo [26]. G9a
356 also negatively regulates Ep-CAM to promote lung cancer progression [25]. G9a plays an
357 important role in transcriptional repression in hypoxia adaptation [39, 40]. More recently, G9a
358 has been shown to be a critical modulator of autophagy and metabolic reprogramming [41, 42].
359 Herein, through RNA-Seq analysis, we identified a tumor suppressor RARRES3 (also known as
360 TIG3 and RIG-1) as a novel downstream target of G9a in human HCC. RARRES3 is a 361 phospholipase involved in the production of arachidonic acid and other lipid signaling
362 messengers [43]. The expression of RARRES3 can be induced by retinoid acid to negatively
363 regulate cell proliferation and induce cell differentiation [20]. RARRES3 promoter contains a
364 p53 binding site and its expression can be transactivated by p53 protein [44]. The expression of
365 RARRES3 is reduced in multiple cancers. Loss of RARRES3 has been considered as a key
366 driver of lung metastasis in estrogen receptor negative (ER-) breast cancer by disabling cellular
367 differentiation and facilitating the cancer cells to adhere to lung parenchyma [24]. This could be
368 achieved through modulating the Wnt/β-catenin signaling pathway, thereby influencing the stem
369 cell properties and epithelial-mesenchymal transition of breast cancer cells [45]. However, the
370 mechanism underpinning the transcriptional silencing of RARRES3 in cancers has not been
371 reported. Our present study found that the expression of RARRES3 was frequently
372 downregulated in human HCCs in both our HCC cohort and TCGA sample sets. RARRES3
373 expression was negatively correlated with that of G9a in HCC samples as well as HCC cell lines.
374 Inactivation of G9a by RNAi knockdown, CRISPR/Cas9 knockout and pharmacological
375 inhibitors consistently relieved the transcriptional silencing of RARRES3 in human HCC cell
376 lines, demonstrating the causal relationship between G9a overexpression and RARRES3 down-
377 regulation. It has been previously reported that ectopic overexpression of RARRES3 resulted in
378 impaired cell proliferation and migration abilities [21, 22, 24, 46]. Consistently, we showed that
379 knockdown of RARRES3 effectively accelerated HCC cell growth and promoted cell migration.
380 Importantly, knockdown of RARRES3 substantially recused the cell proliferation defect of G9a
381 knockout BEL7402 cells. Taken together, our results suggest that G9a negatively regulates
382 RARRES3 and thus contributes to HCC proliferation and metastasis. 383 In summary, we delineated the tumor-promoting function of G9a in HCC. G9a was frequently
384 up-regulated in HCC, partly due to the gene copy number gain and loss of post-transcriptional
385 regulator miR-1. Inactivation of G9a halted HCC cell proliferation and migration in both in vitro
386 and in vivo models. G9a exerts is tumor promoting function at least partially through epigenetic
387 silencing of tumor suppressor RARRES3. Thus, targeting G9a may be a novel approach for HCC
388 treatment.
389
390 Methodology
391 Clinical specimens
392 The HCC patients involved in this study had surgical resection at Queen Mary Hospital in Hong
393 Kong between 1991 and 2007. The use of clinical specimens has been approval by the Institutional
394 Review Board of the University of Hong Kong and the Hong Kong Hospital Authority.
395 Establishment of G9a and RARRES3 stable knockdown cell lines
396 The G9a and RARRES3 stable knockdown cell lines were established by lentivral based stable
397 shRNA overexpression. Non-target control shRNA (shNTC) obtained from Sigma-Aldrich was
398 used as negative control.
399 Establishment of G9a knockout cell lines
400 The plasmid pSpCas9 (BB)-2A-Puro (PX459) (Addgene) was used to simultaneously express
401 wild-type Cas9 and single guide RNA. Two guide RNA sequences
402 GGGTCACTTCTCCTGAACGC (sg#3) and GGTCACTTCTCCTGAACGCC (sg#4) were used
403 in this experiment. These two sgRNAs both target exon 7 of G9a and generate frame-shift indel 404 to disrupt the translation of both G9a-S and G9a-L isoforms. The G9a knockout effect was
405 screened and validated by Western Blotting.
406 ChIP assay
407 The G9a antibody used in CHIP assay was purchased from Abcam (ab40542). The H3K9me2
408 antibody was purchased from Cell Signaling Technology (#9753). The primer sequence to detect
409 G9a and H3K9me2 enrichment in RARRES3 promoter region is RARRES3-ChIP-F:
410 GGGCATCCCCATGGAATGAA and RARRES3-ChIP-R: CATTCGGAGGCAGGGAGATG
411 Orthotopic tumor implantation model
412 For orthotopic tumor implantation model, 2 ×106 luciferase labelled t cells were mixed with 25 µl
413 DMEM-hg/Matrigel (1:1) and injected into the left liver lobule of nude mice. Mice were
414 sacrificed at 6 weeks, livers and lungs were collected. Formation of extra-hepatic metastasis was
415 detected by ex-vivo bioluminescent imaging.
416 Treatment of G9a inhibitors, UNC0638 and BIX01294
417 Small molecule inhibitors of G9a, UNC0638 and BIX01294, were purchased from Cayman
418 Chemical. GI50 of these inhibitors on cell growth was determined in BEL7402 cells upon 48
419 hours of UNC0638 and BIX01294 treatment, respectively.
420 Transcriptome sequencing
421 Transcriptome sequencing (RNA-Seq) was performed G9a stably knockdown (shG9a #69) and
422 non-target control of BEL7402 and SMMC-77721 cells. The sample preparation and data
423 analysis procedures were described previously [11].
424 Statistical analyses 425 Statistical analysis was performed using IBM SPSS version 20 and PRISM 5 software package. P <
426 0.05 was considered as statistically significant.
427 Detailed materials and methods can be found in Supplementary Methodology.
428
429 References
430 [1] Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer
431 incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012.
432 International journal of cancer Journal international du cancer 2015;136(5): E359-386.
433 [2] Bruix J, Gores GJ, Mazzaferro V. Hepatocellular carcinoma: clinical frontiers and
434 perspectives. Gut 2014;63(5): 844-855.
435 [3] Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, et al. Sorafenib in
436 advanced hepatocellular carcinoma. The New England journal of medicine 2008;359(4): 378-
437 390.
438 [4] Momparler RL. Cancer epigenetics. Oncogene 2003;22(42): 6479-6483.
439 [5] Wong CM, Ng IO. Molecular pathogenesis of hepatocellular carcinoma. Liver
440 international : official journal of the International Association for the Study of the Liver
441 2008;28(2): 160-174.
442 [6] Arrowsmith CH, Bountra C, Fish PV, Lee K, Schapira M. Epigenetic protein families: a
443 new frontier for drug discovery. Nature reviews Drug discovery 2012;11(5): 384-400. 444 [7] Esteller M. Cancer epigenomics: DNA methylomes and histone-modification maps.
445 Nature reviews Genetics 2007;8(4): 286-298.
446 [8] Jenuwein T, Allis CD. Translating the histone code. Science 2001;293(5532): 1074-1080.
447 [9] Au SL, Wong CC, Lee JM, Fan DN, Tsang FH, Ng IO, et al. Enhancer of zeste homolog
448 2 epigenetically silences multiple tumor suppressor microRNAs to promote liver cancer
449 metastasis. Hepatology 2012;56(2): 622-631.
450 [10] Fan DN, Tsang FH, Tam AH, Au SL, Wong CC, Wei L, et al. Histone lysine
451 methyltransferase, suppressor of variegation 3-9 homolog 1, promotes hepatocellular carcinoma
452 progression and is negatively regulated by microRNA-125b. Hepatology 2013;57(2): 637-647.
453 [11] Wong CM, Wei L, Law CT, Ho DW, Tsang FH, Au SL, et al. Up-regulation of histone
454 methyltransferase SETDB1 by multiple mechanisms in hepatocellular carcinoma promotes
455 cancer metastasis. Hepatology 2016;63(2): 474-487.
456 [12] Feldman N, Gerson A, Fang J, Li E, Zhang Y, Shinkai Y, et al. G9a-mediated irreversible
457 epigenetic inactivation of Oct-3/4 during early embryogenesis. Nature cell biology 2006;8(2):
458 188-194.
459 [13] Wen B, Wu H, Shinkai Y, Irizarry RA, Feinberg AP. Large histone H3 lysine 9
460 dimethylated chromatin blocks distinguish differentiated from embryonic stem cells. Nature
461 genetics 2009;41(2): 246-250.
462 [14] Tachibana M, Sugimoto K, Nozaki M, Ueda J, Ohta T, Ohki M, et al. G9a histone
463 methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is
464 essential for early embryogenesis. Genes & development 2002;16(14): 1779-1791. 465 [15] Seligson DB, Horvath S, McBrian MA, Mah V, Yu H, Tze S, et al. Global levels of
466 histone modifications predict prognosis in different cancers. The American journal of pathology
467 2009;174(5): 1619-1628.
468 [16] Ellinger J, Kahl P, von der Gathen J, Rogenhofer S, Heukamp LC, Gutgemann I, et al.
469 Global levels of histone modifications predict prostate cancer recurrence. The Prostate
470 2010;70(1): 61-69.
471 [17] Mshvildadze M, Neu J, Shuster J, Theriaque D, Li N, Mai V. Intestinal microbial ecology
472 in premature infants assessed with non-culture-based techniques. J Pediatr 2010;156.
473 [18] Vedadi M, Barsyte-Lovejoy D, Liu F, Rival-Gervier S, Allali-Hassani A, Labrie V, et al.
474 A chemical probe selectively inhibits G9a and GLP methyltransferase activity in cells. Nature
475 chemical biology 2011;7(8): 566-574.
476 [19] Kubicek S, O'Sullivan RJ, August EM, Hickey ER, Zhang Q, Teodoro ML, et al.
477 Reversal of H3K9me2 by a small-molecule inhibitor for the G9a histone methyltransferase.
478 Molecular cell 2007;25(3): 473-481.
479 [20] DiSepio D, Ghosn C, Eckert RL, Deucher A, Robinson N, Duvic M, et al. Identification
480 and characterization of a retinoid-induced class II tumor suppressor/growth regulatory gene.
481 Proceedings of the National Academy of Sciences of the United States of America 1998;95(25):
482 14811-14815.
483 [21] Tsai FM, Shyu RY, Jiang SY. RIG1 suppresses Ras activation and induces cellular
484 apoptosis at the Golgi apparatus. Cellular signalling 2007;19(5): 989-999. 485 [22] Higuchi E, Chandraratna RA, Hong WK, Lotan R. Induction of TIG3, a putative class II
486 tumor suppressor gene, by retinoic acid in head and neck and lung carcinoma cells and its
487 association with suppression of the transformed phenotype. Oncogene 2003;22(30): 4627-4635.
488 [23] Scharadin TM, Jiang H, Jans R, Rorke EA, Eckert RL. TIG3 tumor suppressor-dependent
489 organelle redistribution and apoptosis in skin cancer cells. PloS one 2011;6(8): e23230.
490 [24] Morales M, Arenas EJ, Urosevic J, Guiu M, Fernandez E, Planet E, et al. RARRES3
491 suppresses breast cancer lung metastasis by regulating adhesion and differentiation. EMBO
492 molecular medicine 2014;6(7): 865-881.
493 [25] Chen MW, Hua KT, Kao HJ, Chi CC, Wei LH, Johansson G, et al. H3K9 histone
494 methyltransferase G9a promotes lung cancer invasion and metastasis by silencing the cell
495 adhesion molecule Ep-CAM. Cancer research 2010;70(20): 7830-7840.
496 [26] Dong C, Wu Y, Yao J, Wang Y, Yu Y, Rychahou PG, et al. G9a interacts with Snail and
497 is critical for Snail-mediated E-cadherin repression in human breast cancer. The Journal of
498 clinical investigation 2012;122(4): 1469-1486.
499 [27] Hua KT, Wang MY, Chen MW, Wei LH, Chen CK, Ko CH, et al. The H3K9
500 methyltransferase G9a is a marker of aggressive ovarian cancer that promotes peritoneal
501 metastasis. Molecular cancer 2014;13: 189.
502 [28] Lu Z, Tian Y, Salwen HR, Chlenski A, Godley LA, Raj JU, et al. Histone-lysine
503 methyltransferase EHMT2 is involved in proliferation, apoptosis, cell invasion, and DNA
504 methylation of human neuroblastoma cells. Anti-cancer drugs 2013;24(5): 484-493. 505 [29] Ren A, Qiu Y, Cui H, Fu G. Inhibition of H3K9 methyltransferase G9a induces
506 autophagy and apoptosis in oral squamous cell carcinoma. Biochemical and biophysical research
507 communications 2015;459(1): 10-17.
508 [30] Li KC, Hua KT, Lin YS, Su CY, Ko JY, Hsiao M, et al. Inhibition of G9a induces
509 DUSP4-dependent autophagic cell death in head and neck squamous cell carcinoma. Molecular
510 cancer 2014;13: 172.
511 [31] Chen YJ, Yeh SH, Chen JT, Wu CC, Hsu MT, Tsai SF, et al. Chromosomal changes and
512 clonality relationship between primary and recurrent hepatocellular carcinoma. Gastroenterology
513 2000;119(2): 431-440.
514 [32] Lin YW, Sheu JC, Huang GT, Lee HS, Chen CH, Wang JT, et al. Chromosomal
515 abnormality in hepatocellular carcinoma by comparative genomic hybridisation in Taiwan.
516 European journal of cancer 1999;35(4): 652-658.
517 [33] Moinzadeh P, Breuhahn K, Stutzer H, Schirmacher P. Chromosome alterations in human
518 hepatocellular carcinomas correlate with aetiology and histological grade--results of an
519 explorative CGH meta-analysis. British journal of cancer 2005;92(5): 935-941.
520 [34] Pang A, Ng IO, Fan ST, Kwong YL. Clinicopathologic significance of genetic alterations
521 in hepatocellular carcinoma. Cancer genetics and cytogenetics 2003;146(1): 8-15.
522 [35] Chochi Y, Kawauchi S, Nakao M, Furuya T, Hashimoto K, Oga A, et al. A copy number
523 gain of the 6p arm is linked with advanced hepatocellular carcinoma: an array-based comparative
524 genomic hybridization study. The Journal of pathology 2009;217(5): 677-684. 525 [36] Sonoki T, Harder L, Horsman DE, Karran L, Taniguchi I, Willis TG, et al. Cyclin D3 is a
526 target gene of t(6;14)(p21.1;q32.3) of mature B-cell malignancies. Blood 2001;98(9): 2837-2844.
527 [37] Gorringe KL, Boussioutas A, Bowtell DD, Melbourne Gastric Cancer Group PMMAF.
528 Novel regions of chromosomal amplification at 6p21, 5p13, and 12q14 in gastric cancer
529 identified by array comparative genomic hybridization. Genes, chromosomes & cancer
530 2005;42(3): 247-259.
531 [38] Wong CM, Wong CC, Ng YL, Au SL, Ko FC, Ng IO. Transcriptional repressive H3K9
532 and H3K27 methylations contribute to DNMT1-mediated DNA methylation recovery. PloS one
533 2011;6(2): e16702.
534 [39] Lee SH, Kim J, Kim WH, Lee YM. Hypoxic silencing of tumor suppressor RUNX3 by
535 histone modification in gastric cancer cells. Oncogene 2009;28(2): 184-194.
536 [40] Lee JS, Kim Y, Kim IS, Kim B, Choi HJ, Lee JM, et al. Negative regulation of hypoxic
537 responses via induced Reptin methylation. Molecular cell 2010;39(1): 71-85.
538 [41] Artal-Martinez de Narvajas A, Gomez TS, Zhang JS, Mann AO, Taoda Y, Gorman JA, et
539 al. Epigenetic regulation of autophagy by the methyltransferase G9a. Molecular and cellular
540 biology 2013;33(20): 3983-3993.
541 [42] Ding J, Li T, Wang X, Zhao E, Choi JH, Yang L, et al. The histone H3 methyltransferase
542 G9A epigenetically activates the serine-glycine synthesis pathway to sustain cancer cell survival
543 and proliferation. Cell metabolism 2013;18(6): 896-907.
544 [43] Wang D, Dubois RN. Eicosanoids and cancer. Nature reviews Cancer 2010;10(3): 181-
545 193. 546 [44] Hsu TH, Chu CC, Jiang SY, Hung MW, Ni WC, Lin HE, et al. Expression of the class II
547 tumor suppressor gene RIG1 is directly regulated by p53 tumor suppressor in cancer cell lines.
548 FEBS letters 2012;586(9): 1287-1293.
549 [45] Hsu TH, Jiang SY, Chang WL, Eckert RL, Scharadin TM, Chang TC. Involvement of
550 RARRES3 in the regulation of Wnt proteins acylation and signaling activities in human breast
551 cancer cells. Cell death and differentiation 2015;22(9): 1561.
552 [46] Sturniolo MT, Dashti SR, Deucher A, Rorke EA, Broome AM, Chandraratna RA, et al. A
553 novel tumor suppressor protein promotes keratinocyte terminal differentiation via activation of
554 type I transglutaminase. The Journal of biological chemistry 2003;278(48): 48066-48073.
555
556 Figure Legend
557 Figure 1: Frequent up-regulation of G9a in human HCCs. (A) G9a mRNA expression was
558 significantly increased by 4.5 fold in 16 paired HCC samples compared with their non-tumorous
559 (NT) counterpart as revealed by RNA-Seq analysis (P < 0.0001, Wilcoxon signed rank test).
560 Data were presented as FPKM (fragments per kilo base of transcript sequences per aligned
561 million reads). The horizontal lines indicated median expression levels. (B) Significant up-
562 regulation of G9a was validated in an expand sample cohort containing 92 paired HCC and their
563 corresponding NT samples and 5 normal livers (NL) by qRT-PCR. HPRT was used as
564 endogenous control for normalization. G9a expression in primary HCC was increased by 2.7 fold
565 as compared with their adjacent NT samples (P < 0.0001, Wilcoxon signed rank test) and 5.72
566 fold when compared with normal livers (P < 0.0001, Mann-Whitney U-test). (C) Up-regulation
567 of G9a (>2 fold, i.e. log2 (HCC/NT > 1)) was found in 68% (63/92) of primary HCC samples. 568 Only 4 HCC samples showed down-regulation of G9a. (D) Significant up-regulation of G9a was
569 observed in 50 pairs of HCC samples available in TCGA RNA-Seq dataset (P < 0.0001,
570 Wilcoxon signed rank test). The expression of G9a was increased by 1.97 fold in HCC as
571 compared with NT livers. Data were presented as RSEM (RNA-Seq expression estimation by
572 Expectation-Maximization) normalized count. (E) Up-regulation of G9a (>2 fold) was found in
573 60% (30/50) of TCGA HCC samples. (F) The expression of G9a increased step-wisely along
574 with HCC disease progression. G9a mRNA expression level was progressively increased from
575 normal liver without background disease (NL) (N = 6; median = 0.950) to chronic hepatitis (CH)
576 (N = 36; median = 1.043) and cirrhotic liver (CL) (N = 48; median =1.289), then to early HCC
577 (N = 31; median = 2.458) and advanced HCC (N =56; median = 3.856) (P < 0.0001, Kruskal-
578 Wallis test). (G) G9a overexpression was significantly associated with advanced pTNM stage (P
579 = 0.0195, t-test), the presence of venous invasion (P = 0.0042), tumor microsatellite (P = 0.0080)
580 and absence of tumor encapsulation (P = 0.0145). The qRT-PCR data are presenting as ∆∆Ct (i.e.
581 log2 fold change HCC/NT liver).
582 Figure 2: Gene copy number gain contributed to the frequent up-regulation of G9a. (A) and
583 (B) Gene copy number gain (≥ 3 copies) of G9a was detected in 60% of primary HCC (N = 32)
584 as revealed by TaqMan gene copy number assay. (C) G9a mRNA expression was positively
585 correlated with G9a gene copy number alternation (P < 0.0001, R2 = 0.2384, linear regression).
586 (D) TCGA gene copy number data showed that G9a gene copy number gain and amplification
587 was detected in 43% of all its HCC samples (N = 254). (E) G9a gene copy number gain was
588 positively correlated with increased G9a mRNA expression in TCGA HCC sample cohort (P <
589 0.0001, One-Way ANOVA). 590 Figure 3: Loss of miR-1 contributed to G9a up-regulation in human HCC. (A) Two PX459
591 plasmids with different single guide RNAs (sgRNAs) targeting the genome sequence at the
592 beginning and the end of G9a-3’UTR were employed to create double-strand break
593 simultaneously and then lead to complete deletion of G9a 3’UTR via non-homologous end
594 joining repair mechanism. Genome sequence of two G9a-3’UTR deleted cell clones BEL7402-
595 G9a-Δ3UTR-#42 and -#52 showed that the 322 bp G9a-3’UTR was completely deleted. The
596 underlined sequences were the expected editing sites of CRISPR/Cas9 system. (B) After deletion
597 of G9a-3’UTR, the expression of G9a was significantly increased in both mRNA and protein
598 levels. (C) RNA hybrid predicted a thermokinetically stable duplex to be formed between miR-1
599 and G9a-3’UTR. The miR-1 binding site on G9a-3’UTR is evolutionarily conserved across
600 different species. (D) The expression of miR-1 was analyzed by qRT-PCR in 32 pairs of human
601 HCCs. miR-1 was significantly down-regulated in human HCC when compared with their
602 corresponding NT counterpart (P = 0.0002, Wilcoxon signed-rank test). (E) Expression of miR-1
603 was negatively correlated with G9a expression in human HCC (R2 = 0.2581, P < 0.0001, linear
604 regression). (F) Wild type and mutant (Mut) miR-1 binding site of G9a 3’UTR were cloned into
605 pmiRGLO vector. (G) miR-1 significantly repressed luciferase activity of WT G9a 3’UTR but
606 not in the Mut G9a-3’UTR nor the empty vector control. (H) Exogenously overexpression of
607 miR-1 precuorsor repressed endogenous G9a protein expression in HCC cell lines. *** P <0.001
608 Figure 4: G9a is responsible for H3K9me2 in HCC. (A) Overexpression of G9a was found in
609 HCC cell lines including HepG2, Hep3B, SMMC-7721, BEL7402 and MHCC97L when
610 compared with immortalized normal liver cell line THLE-3. Both the short form (G9a-s, 140
611 KDa) and long form (G9a-L, 165 KDa) of G9a can be detected in Western blot. The relative G9a
612 protein expression in HCC cell line was determined with Image J and compared to THLE-3. (B) 613 G9a stable knockdown cell model was established in BEL7402 and SMMC-7721 cells by
614 lentiviral delivery of shRNA sequences targeting G9a coding region. Two shRNA sequences
615 (shG9a #69 and #70) were used. Knockdown efficiency was verified at both protein level by
616 Western blotting (upper panel) and mRNA level by qRT-PCR (lower panel). NTC: non-target
617 control. (C) The single guide RNAs were designed to target the exon 7 of G9a to disrupt protein
618 translation of both G9a isoforms. (D) The G9a protein was completely depleted as shown by
619 Western blotting. (E) Knockout of G9a in both BEL7402 and SMMC-7721 cell lines effectively
620 decreased H3K9me2 level without affecting H3K9me3, H3K4me3 and H3K27me3 levels.
621 Figure 5: Knockdown and knockout of G9a suppressed HCC proliferation and migration
622 in vitro. (A) RNA sequencing data in 16 paired HCC samples showed that G9a mRNA
623 expression was positively correlated with proliferation marker Ki67 in HCCs and NT livers (R2 =
624 0.7192, P < 0.0001, linear regression). (B) and (C) Knockdown (shG9a #69 and #70) and
625 knockout (sg#3 and #4) of G9a in both BEL7402 and SMMC-7721 cell lines significantly
626 reduced HCC cell proliferation when compared with their non-target control or wild type cells.
627 (D) and (E) Knockdown and knockout of G9a in both BEL7402 and SMMC-7721 cell lines
628 significantly suppressed HCC cell colony formation ability. The cell colonies formed were
629 counted as average colony numbers in three wells of each 6-well plate. Each sample was tested
630 in triplicate. (F) and (G) Knockdown and knockout of G9a in both BEL7402 and SMMC-7721
631 cell lines significantly suppressed HCC cell migration as shown by transwell cell migration assay.
632 The migrated cells were counted as average cell numbers in three random areas in each transwell
633 membrane. Each sample was tested in triplicate. ** P < 0.01, *** P < 0.001, t-test.
634 Figure 6: Knockdown and knockout of G9a inhibited HCC tumorigenicity and metastasis
635 in vivo. (A) and (B) G9a stable knockdown (shG9a) and its non-target control BEL7402 or 636 SMMC-7721 cells were injected into BALB/c nude mice subcutaneously. Tumor size was
637 monitored every 3 days and weighed after harvest. G9a knockdown significantly suppressed
638 HCC tumor growth. (C) and (D) Knockout of G9a significantly inhibited HCC tumorigenicity
639 and lung metastasis in vivo as demonstrated by orthotopic tumor implantation experiment in
640 nude mice. (E) The GI50 of G9a small molecule inhibitors UNC0638 (GI50 = 7.325µM) and
641 BIX01294 (GI50 = 5.225 µM) were determined in BEL7402 cells. (F) UNC0638 and BIX01294
642 effectively inhibited HCC cell growth at the concentration of 5µM after 48 hours of treatment.
643 The morphology of the cells was also altered upon treatment. (G) Treatment of UNC0638 and
644 BIX01294 at 5µM in BEL7402 cell specifically attenuated G9a-mediated H3K9me2 level
645 without affecting other histone modificaitons. * P < 0.05, ** P < 0.01, *** P < 0.001, t-test.
646 Figure 7: Suppression of Retinoic Acid Receptor Responder Protein 3 (RARRES3)
647 contributed to oncogenic function of G9a. (A) The transcriptome profiles of G9a stable
648 knockdown and non-target control BEL7402 and SMMC-7721 cell lines were introgerrated by
649 RNA-Seq and subjected to differential gene expression analysis. After filtering the low exprssion
650 genes (with FPKM < 1), there are 140 and 77 genes up-regulated (> 2 fold) in BEL7402 and
651 SMMC-7721, respectively. Among them, 16 genes were commonly up-regulated in both cell
652 lines. RARRES3 was one of the most up-regulated genes as shown in the heat map diagram. (B)
653 Aligned RNA-sequencing reads visualized through USCS genome browser revealed the
654 expression levels of G9a and RARRES3 in HCC cell lines. The data showed that G9a was
655 successfully knocked down in both BEL7402 and SMMC-7721 cells. RARRES3 mRNA
656 expression was increased by 4.24 fold in SMMC-7721 cells and 2.93 fold in BEL7402 cells upon
657 G9a knockdown. (C) Expression level of RARRES3 in 16 pairs of HBV associated human HCC
658 samples determined by RNA-Seq. Data were presented in FPKM. The scatter plot showed the 659 significant down-regulation of RARRES3 in primary HCC (P < 0.0001, Wilcoxon signed rand
660 test). Median expression level was indicated by horizontal lines. The mRNA expression of
661 RARRES3 in 16 paired HCC samples was negatively correlated with mRNA expression of G9a.
662 (R2 = 0.2867, P = 0.0016, linear regression). (D) Knockdown and knockout of G9a significantly
663 up-regulated RARRES3 mRNA expression in both BEL7402 and SMMC-7721 cell lines
664 compared with non-target control and wild type cells. (E) The mRNA expression of RARRES3
665 was significantly up-regulated upon treatment of G9a specific small molecule inhibitors,
666 UNC0638 and BIX01294, in both BEL7402 and SMMC-7721 cell lines. (F) Knockout of G9a
667 significantly diminished the G9a binding and H3K9me2 level at the promoter region of
668 RARRES3 as determined by ChIP assay. (G) Knockdown of RARRES3 in PLC cells which has
669 higher level of endogenous RARRES3 increased its proliferation rate. (H) Stable knockdown of
670 RARRES3 by shRNA in MHCC97L increased cell migration rate. (I) Inactivation of RARRES3
671 by siRNA in BEL7402-G9a (-/-) cell lines recused the fast cell proliferating phenotype as
672 demonstrated by BrdU incorporation assay. ** P < 0.01, *** P < 0.001, t-test.
673 Supplementary Figure 1: Frequent up-regulation of G9a in multiple cancers. Significant up-
674 regulation of G9a was also observed in multiple cancer types including bladder urothelial
675 carcinoma (BLCA), breast invasive carcinoma (BRCA), colorectal adenocarcinoma
676 (COADREAD), head and neck squamous cell carcinoma (HNSC), kidney renal clear cell
677 carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), liver hepatocellular carcinoma
678 (LIHC), lung adenocarcinoma (LUAD), and lung squamous cell carcinoma (LUSC) (Wilcoxon
679 signed ranked test). The mRNA expression data of G9a was retrieved from TCGA RNA-Seq
680 datasets. Each type of cancer contains paired tumors and their corresponding non-tumor
681 counterpart. 682 Supplementary Figure 2: Chromosome 6p21 was frequently gained or amplified in human
683 HCC. According to oncogenomic database for HCC (OncoDB.HCC), the frequent gain or
684 amplification of chromosome 6p21, where G9a is located, was observed in all CGH studies. (N =
685 14)
686 Supplementary Figure 3: In silico analysis of G9a 3’UTR using miRANDA and TargetScan.
687 MiR-1 and miR-613 were commonly predicated by both miRANDA and TargetScan as the 688 potential post-transcriptional regulators of G9a.
689 Supplementary Figure 4: Depletion of G9a induces cell apoptosis and autophagy. (A)
690 Knockout of G9a induced cell apoptosis in SMMC7721 cells upon 48 hours of starvation. (B)
691 Knockout of G9a induced autophagy in SMMC7721 cells. *** P < 0.001, t-test.
692 Supplementary Figure 5: knockout of G9a inhibited HCC metastasis in vivo. G9a knockout
693 (Ga9 sg#3) and wild type (WT) BEL7402 cells were injected into BALB/c nude mice by tail-
694 vein injection. The mice were dissected 4 weeks later and the formation of lung metastasis was
695 detected by ex-vivo bioluminescent imaging. The result showed that knockout of G9a
696 significantly inhibited HCC lung metastasis in vivo.
697 Supplementary Figure 6: Treatment of G9a inhibitors specifically suppressed H3K9me2.
698 HCC cell cells were treated with at 0.5µM and 1.0µM UNC0638 and BIX01294. The change of
699 global H3K9me2, H3K4me3 and H3K27me3 levels were detected with Western blot.
700 Supplementary Figure 7: Inhibition of G9a by small molecule inhibitor UNC0642
701 suppressed tumor growth in vivo. (A) Chemical structure of UNC0642 which is a newly
702 identified G9a specific inhibitor with good pharmacokinetic (PK) properties and is suitable for in
703 vivo study. (B) Treatment of UNC0642 at 5µM in BEL7402 and SMMC7721 cells specifically 704 attenuated G9a-mediated H3K9me2 level without affecting other histone modificaitons. (C)
705 Nude mice bearing subcutaneous tumour were treated with UNC0642 daily by intraperitoneal
706 injection at 5mg/kg. The tumour volume was monitored daily and the mice were dissected after
707 23 days of tumour growth and 17 days of UNC0642 treatment. * P < 0.05, t-test
708 Supplementary Figure 8: Frequent down-regulation of RARRES3 in human HCCs. (A)
709 Significant down-regulation of RARRES3 was validated in 50 pairs of HCC samples from 710 TCGA RNA-Seq dataset (P = 0.0041, Wilcoxon signed rank test). Data were presented as RSEM
711 normalized count. (B) Down-regulation of RARRES3 (< 0.5 fold) was found in 48% (24/50) of
712 TCGA HCC samples. (C) The mRNA expression of RARRES3 in HCC cell lines (n = 15) was
713 negatively correlated with mRNA expression of G9a (R2 = 0.2807, P = 0.0042, linear regression).
714 (D) Overexpressing G9a significantly reduced RARRES3 level in HCC cells as demonstrated in
715 G9a 3’UTR deleted BEL7402 cell model. ***P < 0.001, t-test.
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730 731 Highlights
732
733 • G9a was frequently up-regulated in human HCC and associated with HCC 734 aggressiveness. 735 • G9a promoted HCC growth and metastasis both in vitro and in vivo. 736 • Up-regulation of G9a in HCC was attributed to gene amplification and loss of miR-1. 737 • G9a epigenetically silenced the expression of tumor suppressor gene RARRES in HCC. 738 • Targeting G9a by small molecular inhibitors suppressed HCC growth. 739
740
741