DOCSLIB.ORG

Viewed in a Web Browser (Figure 3)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Viewed in a Web Browser (Figure 3) Microbial Cell Factories BioMed Central Research Open Access Structural genomics of human proteins – target selection and generation of a public catalogue of expression clones Konrad Büssow*1,2, Christoph Scheich1,2, Volker Sievert1,2, Ulrich Harttig1,4,5, Jörg Schultz3,8, Bernd Simon3, Peer Bork3, Hans Lehrach1,2 and Udo Heinemann1,6,7 Address: 1Protein Structure Factory, Heubnerweg 6, 14059 Berlin, Germany, 2Max-Planck-Institut für Molekulare Genetik, Ihnestr. 73, 14195 Berlin, Germany, 3EMBL Heidelberg, Meyerhofstr. 1, 69117 Heidelberg, Germany, 4RZPD German Resource Center for Genome Research GmbH, Heubnerweg 6, 14059 Berlin, Germany, 5DIFE, Arthur-Scheunert-Allee 114–116, 14558 Nuthetal, Germany, 6Max-Delbrück-Centrum für Molekulare Medizin, Robert-Rössle-Str. 10, 13092 Berlin, Germany, 7Institut für Chemie/Kristallographie, Freie Universität, Takustr. 6, 14195 Berlin, Germany and 8Department of Bioinformatics, University of Würzburg, Biocenter, Am Hubland, 97074 Würzburg, Germany Email: Konrad Büssow* - [email protected]; Christoph Scheich - [email protected]; Volker Sievert - [email protected]; Ulrich Harttig - [email protected]; Jörg Schultz - [email protected]; Bernd Simon - [email protected]; Peer Bork - [email protected]; Hans Lehrach - [email protected]; Udo Heinemann - [email protected] * Corresponding author Published: 05 July 2005 Received: 23 May 2005 Accepted: 05 July 2005 Microbial Cell Factories 2005, 4:21 doi:10.1186/1475-2859-4-21 This article is available from: http://www.microbialcellfactories.com/content/4/1/21 © 2005 Büssow et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The availability of suitable recombinant protein is still a major bottleneck in protein structure analysis. The Protein Structure Factory, part of the international structural genomics initiative, targets human proteins for structure determination. It has implemented high throughput procedures for all steps from cloning to structure calculation. This article describes the selection of human target proteins for structure analysis, our high throughput cloning strategy, and the expression of human proteins in Escherichia coli host cells. Results and Conclusion: Protein expression and sequence data of 1414 E. coli expression clones representing 537 different proteins are presented. 139 human proteins (18%) could be expressed and purified in soluble form and with the expected size. All E. coli expression clones are publicly available to facilitate further functional characterisation of this set of human proteins. Background tein expression in small and large scale, biophysical pro- The Protein Structure Factory tein characterisation, crystallisation, X-ray diffraction and The Protein Structure Factory (PSF) is a joint endeavour of structure calculation. universities, research institutes and companies from the Berlin area [1,2]. It takes part in the international struc- It is known that eukaryotic proteins are often difficult to tural genomics initiative [3,4] and aims at the determina- express in Escherichia coli [5]. Only a certain fraction of tion of human protein structures by X-ray diffraction these proteins can be overproduced in E. coli in sufficient methods and NMR spectroscopy using standardised high- yield without formation of inclusion body aggregates or throughput procedures. A complete pipeline has been proteolytic degradation. Alternative expression systems established for this purpose that comprises cloning, pro- include cell cultures of various eukaryotic organisms and Page 1 of 13 (page number not for citation purposes) Microbial Cell Factories 2005, 4:21 http://www.microbialcellfactories.com/content/4/1/21 Pt5 (1-87) cell-free, in vitro protein expression. These systems have Olac (30-48) Olac (60-87) been greatly improved since 1999, when the PSF project XhoI (1) EcoRI (88) RBS (101-107) was initiated. In the meantime, E. coli [5-7] and wheat MRGSH6 (115-144) beta-lactamase BamHI (145) germ [8]in vitro protein synthesis is routinely used by (2434-3292) KpnI (167) SalI (173) structural genomics projects. At the PSF, yeast expression BglII (184) NotI (191) hosts, Saccharomyces cerevisiae and Pichia pastoris, were suc- Strep-II tag (199-222) pQStrep2 HindIII (224) cessfully established as alternative systems to E. coli, as 3499 bp λ tO terminator (245-330) BglI described in detail previously [9-11]. We will focus here (2627) on the results obtained with the E. coli expression system. rrnB T1 terminator (1102-1199) E. coli strains and vectors XbaI (1201) pMB1/ColE1 ori The T7 RNA polymerase-dependent E. coli expression vec- (1673) BamHI Kpn I tor system (pET-vectors) is a universal system to generate TAACTATGAGAGGATCGCATCACCATCACCATCACGGATCCGCATGCGAGCTCGGTACCC |||||| 110 120 130 140 150 160 recombinant protein for structural analysis [12]. pET vec- MRGSHHHHHHGSACELGTP tors are usually combined with the E. coli B strain BL21 His -tag 6 and derivatives that are engineered to carry the T7 RNA SmaI | SalI Bgl II Not I Hin dIII CGGGTCGACCTGCAAGATCTGCGGCCGCTTGGAGCCACCCGCAGTTCGAAAAATAAGCTT polymerase gene. These strains, however, have limitations |||||| 170 180 190 200 210 220 GRPARSAAAWSHPQFEK* in cloning and stable propagation of the expression con- Strep-tag II structs. Expression vectors which are regulated by the lac operator are independent of the host strain. Recombina- Pt5 (1-87) Olac (30-48) tion-deficient E. coli K-12 strains are suitable for cloning Olac (60-87) EcoRI (88) because of their high transformation rates and because XhoI (1) RBS (101-107) Met-Arg-His7 (115-141) they allow for stable propagation of recombinant con- TEV-site (166-189) beta-lactamase - + BamHI (184) structs. The strain SCS1 (Stratagene; hsdR17(rK mK ) recA1 (3738-4596) SalI (192) BglII (205) endA1 gyrA96 thi-1 relA1 supE44) was found to perform KpnI (216) BglI (3931) NotI (219) well at the PSF in cloning experiments. It grows relatively HindIII (239) pQTEV λ tO terminator (259-354) fast and allows for robust protein expression. 4803 bp rrnB T1 terminator (1116-1213) Affinity tags allow for standardised protein purification XbaI (1215) Q procedures. The first vector that was used routinely in the lacI pMB1/ColE1 ori (1301-2258) PSF, pQStrep2 (GenBank AY028642, Figure 1), is based (2977) XbaI (2505) on pQE-30 (Qiagen) and adds an N-terminal His-tag [13] for metal chelate affinity chromatography (IMAC) and a EcoRI GAATTCATTAAAGAGGAGAAATTAACTATGAAACATCACCATCACCATCACCATAGCGATTACGACATCCCCACTACT C-terminal Strep-tag II [14,15] to the expression product. |||||||| 90 100 110 120 130 140 150 160 pQStrep2 allows for an efficient two-step affinity purifica- MKHHHHHHHSDYDIPTT tion of the encoded protein, as demonstrated in a study of His7-tag BamHI Sal I Bgl II Kpn I Not I Hin dIII an SH3 domain [16]. The eluate of the initial IMAC is GAGAATCTTTATTTTCAGGGATCCGGGTCGACTGTTGATAGATCTCGGTACCGCGGCCGCTCGACCTGCAGCCAA |||||||| 170 180 190 200 210 220 230 240 directly loaded onto a Streptactin column. Thereby, only ENLYFQGSGSTVDRSRYRGRSTCSQ full-length expression products are purified and degrada- TEV protease cleavage site tion products are removed. However, the two tags, which are flexible unfolded peptides, remain on the protein and may interfere with protein crystallisation, although we PvuI (155) PstI (281) could show that crystal growth may be possible in their HincII (666) presence even for small proteins [16]. To exclude any neg- argU kan ative influence by the affinity tags, another vector, pQTEV PstI (773) (GenBank AY243506, Figure 1), was constructed. pQTEV pSE111 allows for expression of N-terminal His-tag fusion pro- 5.1 kb teins that contain a recognition site of the tobacco etch p15A ori virus (TEV) protease for proteolytic removal of the tag. EcoRI Q (~3400) lacI EcoRI (2232) Codon usage has a major influence on protein expression levels in E. coli [17], and eukaryotic sequences often con- VectorFigure maps1 tain codons that are rare in E. coli. Especially the arginine Vector maps. Vector maps of pQStrep2, pQTEV and pSE111 codons AGA and AGG lead to low protein yield [18]. This can be alleviated by introducing genes for overexpression Page 2 of 13 (page number not for citation purposes) Microbial Cell Factories 2005, 4:21 http://www.microbialcellfactories.com/content/4/1/21 of the corresponding tRNAs into the E. coli host cells. We structures which can usually only be crystallised as have used the plasmid pSE111 (Figure 1) carrying the domains, i.e. expression constructs lacking other domains argU gene for this purpose. pSE111 is compatible with have to be prepared. To identify coiled-coil proteins, the pQTEV and other common expression vectors. It carries program COILS was used [26-28]. the lacIQ gene for overexpression of the Lac repressor, which is required when using promoters regulated by lac • The cellular localisation of target proteins was assigned operators. pSE111 was used at the PSF in combination with the Meta_A(nnotator) [29,30]. Target proteins anno- with the expression vectors pQStrep2 and pGEX-6P-1. tated to be localised in the extracellular space, endoplas- Strains for overexpression of rare tRNAs are available from mic reticulum, Golgi stack, peroxisome or mitochondria Invitrogen (BL21
Load more

Recommended publications
  • University of California, San Diego
    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
    [Show full text]
  • Rabbit Anti-SEN1/FITC Conjugated Antibody
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-SEN1/FITC Conjugated antibody SL7576R-FITC Product Name: Anti-SEN1/FITC Chinese Name: FITC标记的细胞衰老相关蛋白1抗体 Cell senescence related gene complementation group B; Cellular senescence related protein 1; CSR; CSRB; MORF 4; MORF4; MORF4 protein; Mortality factor 4; SEN 1; Alias: SEN; Senescence (cellular) related 1; Senescence related cellular 1; Transcription factor like protein MORF4; MO4L1_HUMAN; Mortality factor 4-like protein 1; MORF- related gene 15 protein; Protein MSL3-1; Transcription factor-like protein MRG15. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Cow,Zebrafish, IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 27kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human Mortality factor 4-like protein 1 Lsotype: IgGwww.sunlongbiotech.com Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Cellular senescence, the terminal nondividing state that normal cells enter following completion of their proliferative potential, is the dominant phenotype in hybrids of Product Detail: normal and immortal cells.
    [Show full text]
  • BMC Genomics Biomed Central
    BMC Genomics BioMed Central Research article Open Access The functional modulation of epigenetic regulators by alternative splicing Sergio Lois1,2, Noemí Blanco1,2, Marian Martínez-Balbás*1,2 and Xavier de la Cruz*2,3 Address: 1Instituto de Biología Molecular de Barcelona. CID. Consejo Superior de Investigaciones Científicas (CSIC); 08028 Barcelona, Spain, 2Institut de Recerca Biomèdica-PCB; 08028 Barcelona, Spain and 3Institució Catalana de Recerca i Estudis Avançats (ICREA); Barcelona, Spain Email: Sergio Lois - [email protected]; Noemí Blanco - [email protected]; Marian Martínez-Balbás* - [email protected]; Xavier de la Cruz* - [email protected] * Corresponding authors Published: 25 July 2007 Received: 24 April 2007 Accepted: 25 July 2007 BMC Genomics 2007, 8:252 doi:10.1186/1471-2164-8-252 This article is available from: http://www.biomedcentral.com/1471-2164/8/252 © 2007 Lois et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Epigenetic regulators (histone acetyltransferases, methyltransferases, chromatin- remodelling enzymes, etc) play a fundamental role in the control of gene expression by modifying the local state of chromatin. However, due to their recent discovery, little is yet known about their own regulation. This paper addresses this point, focusing on alternative splicing regulation, a mechanism already known to play an important role in other protein families, e.g. transcription factors, membrane receptors, etc.
    [Show full text]
  • An Essential Role for Maternal Control of Nodal Signaling
    RESEARCH ARTICLE elife.elifesciences.org An essential role for maternal control of Nodal signaling Pooja Kumari1,2†, Patrick C Gilligan1†, Shimin Lim1,3, Long Duc Tran4, Sylke Winkler5, Robin Philp6‡, Karuna Sampath1,2,3* 1Temasek Life Sciences Laboratory, National University of Singapore, Singapore, Singapore; 2Department of Biological Sciences, National University of Singapore, Singapore, Singapore; 3School of Biological Sciences, Nanyang Technological University, Singapore, Singapore; 4Mechanobiology Institute, National University of Singapore, Singapore, Singapore; 5Department of Cell Biology and Genetics, Max Planck Institute for Molecular Cell Biology and Genetics, Dresden, Germany; 6Bioprocessing Technology Institute, A*STAR, Singapore, Singapore Abstract Growth factor signaling is essential for pattern formation, growth, differentiation, and maintenance of stem cell pluripotency. Nodal-related signaling factors are required for axis formation and germ layer specification from sea urchins to mammals. Maternal transcripts of the zebrafish Nodal factor, Squint (Sqt), are localized to future embryonic dorsal. The mechanisms by which maternal sqt/nodal RNA is localized and regulated have been unclear. Here, we show that maternal control of Nodal signaling via the conserved Y box-binding protein 1 (Ybx1) is essential. We identified Ybx1 via a proteomic screen. Ybx1 recognizes the 3’ untranslated region (UTR) of *For correspondence: karuna@ sqt RNA and prevents premature translation and Sqt/Nodal signaling. Maternal-effect mutations in tll.org.sg zebrafish ybx1 lead to deregulated Nodal signaling, gastrulation failure, and embryonic lethality. Implanted Nodal-coated beads phenocopy ybx1 mutant defects. Thus, Ybx1 prevents ectopic † These authors contributed Nodal activity, revealing a new paradigm in the regulation of Nodal signaling, which is likely to equally to this work be conserved.
    [Show full text]
  • Identifying the Optimal Gene and Gene Set in Hepatocellular Carcinoma Based on Differential Expression and Differential Co-Expression Algorithm
    1066 ONCOLOGY REPORTS 37: 1066-1074, 2017 Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm LI-YANG DONG1*, WEI-ZHONG ZHOU1*, JUN-WEI NI1, WEI XIANG1, WEN-HAO HU1, CHANG YU1 and HAI-YAN LI2 Departments of 1Invasive Technology and 2Rehabilitation, The First Affiliated Hospital of Wenzhou Medical University, Ouhai, Wenzhou, Zhejiang 325000, P.R. China Received June 23, 2016; Accepted August 10, 2016 DOI: 10.3892/or.2016.5333 * Abstract. The objective of this study was to identify the with ΔG = 18.681 and 24 HDE-HDC partitions in total. In optimal gene and gene set for hepatocellular carcinoma conclusion, we successfully investigated the optimal gene, (HCC) utilizing differential expression and differential MAPRE1, and gene set, nucleoside metabolic process, which co-expression (DEDC) algorithm. The DEDC algorithm may be potential biomarkers for targeted therapy and provide consisted of four parts: calculating differential expression significant insight for revealing the pathological mechanism (DE) by absolute t-value in t-statistics; computing differential underlying HCC. co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and Introduction the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different Hepatocellular carcinoma (HCC) is the fifth most common partitions to determine the optimal gene set with highest mean cancer worldwide and the third leading cause of cancer-related * minimum functional information (FI) gain (ΔG). The optimal mortality (1), making it urgent to identify early diagnostic thresholds divided genes into four partitions, high DE and markers and therapeutic targets (2).
    [Show full text]
  • Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother
    European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Downloaded From
    The MHC Class II Immunopeptidome of Lymph Nodes in Health and in Chemically Induced Colitis This information is current as Tim Fugmann, Adriana Sofron, Danilo Ritz, Franziska of October 2, 2021. Bootz and Dario Neri J Immunol published online 23 December 2016 http://www.jimmunol.org/content/early/2016/12/23/jimmun ol.1601157 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2016/12/23/jimmunol.160115 Material 7.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published December 23, 2016, doi:10.4049/jimmunol.1601157 The Journal of Immunology The MHC Class II Immunopeptidome of Lymph Nodes in Health and in Chemically Induced Colitis Tim Fugmann,* Adriana Sofron,† Danilo Ritz,* Franziska Bootz,† and Dario Neri† We recently described a mass spectrometry–based methodology that enables the confident identification of hundreds of peptides bound to murine MHC class II (MHCII) molecules.
    [Show full text]
  • Linkage Analysis in 15 Families, Physical And
    European Journal of Human Genetics (2002) 11, 145 – 154 ª 2002 Nature Publishing Group All rights reserved 1018 – 4813/02 $25.00 www.nature.com/ejhg ARTICLE Familial juvenile hyperuricaemic nephropathy (FJHN): linkage analysis in 15 families, physical and transcriptional characterisation of the FJHN critical region on chromosome 16p11.2 and the analysis of seven candidate genes Blanka Stibu˚ rkova´1, Jacek Majewski2, Katerˇina Hodanˇova´1, Lenka Ondrova´1, Marke´ta Jerˇa´bkova´1, Marie Zika´nova´1, Petr Vylet’al1, Ivan Sˇebesta3, Anthony Marinaki4, Anne Simmonds4, Gert Matthijs5, Jean-Pierre Fryns5, Rosa Torres6, Juan Garcı´a Puig7, Jurg Ott2 and Stanislav Kmoch*,1 1Center for Integrated Genomics, Institute for Inherited Metabolic Disorders, Charles University 1st School of Medicine and General Faculty Hospital Prague, Czech Republic; 2Laboratory of Statistical Genetics, Rockefeller University, New York, NY, USA; 3Department of Clinical Biochemistry, Charles University 1st School of Medicine and General Faculty Hospital Prague, Czech Republic; 4Purine Research Unit, GKT, Guy’s Hospital, London, UK; 5Center for Human Genetics, University of Leuven, Leuven, Belgium; 6Department of Clinical Biochemistry, La Paz Hospital, Madrid, Spain; 7Division of Internal Medicine, La Paz Hospital, Madrid, Spain Familial juvenile hyperuricaemic nephropathy (FJHN) is an autosomal dominant renal disease characterised by juvenile onset of hyperuricaemia, gouty arthritis, and progressive renal failure at an early age. Recent studies in four kindreds showed linkage of a gene for FJHN to the same genomic interval on chromosome 16p11.2, where the gene for the phenotypically similar medullary cystic disease type 2 (MCKD2) has been localised. In this study we performed linkage analysis in additional 15 FJHN families.
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Structural Insight Into the Mechanisms of Activation and Substrate
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 12-12-2016 Structural Insight into the Mechanisms of Activation and Substrate Specificity of Human Deubiquitinating Enzyme USP7 Alexandra Pozhidaeva University of Connecticut, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Pozhidaeva, Alexandra, "Structural Insight into the Mechanisms of Activation and Substrate Specificity of Human Deubiquitinating Enzyme USP7" (2016). Doctoral Dissertations. 1287. https://opencommons.uconn.edu/dissertations/1287 Structural Insight into the Mechanisms of Activation and Substrate Specificity of Human Deubiquitinating Enzyme USP7 Alexandra Pozhidaeva, PhD University of Connecticut, 2016 The major part of this thesis describes studies of human ubiquitin-specific protease 7 (USP7), a deubiquitinating enzyme that regulates cellular levels of key oncoproteins and tumor suppressors. Inactivation of USP7 has recently emerged as a new approach to treatment of malignancies. However, design of potent and specific small-molecule compounds requires detailed understanding of the molecular mechanisms of USP7 substrate recognition and regulation of its catalytic activity. The goal of this work was to explore these mechanisms using solution nuclear magnetic resonance spectroscopy in combination with other methods. In our studies of USP7 substrate recognition, we structurally characterized its interaction with ICP0 protein from Herpes Simplex virus 1 and identified a novel USP7 substrate-binding site harbored within its C-terminal region. To address the question of USP7 activity regulation, we investigated its interaction with ubiquitin, which was believed to cause structural rearrangement of USP7 active site from an unproductive to a catalytically competent conformation. Surprisingly, we showed that in solution USP7 – ubiquitin interaction alone is not sufficient for activation of the enzyme as was previously postulated.
    [Show full text]