TNFRSF19 Inhibits Tgfβ Signaling Through Interaction with Tgfβ

Author Manuscript Published OnlineFirst on May 7, 2018; DOI: 10.1158/0008-5472.CAN-17-3205 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

TNFRSF19 inhibits TGFβ signaling through an interaction with TGFβ receptor type I to promote tumorigenesis

Chengcheng Deng1,2, Yu-Xin Lin1,2, Xue-Kang Qi1,2, Gui-Ping He1, Yuchen Zhang1,

Hao-Jiong Zhang1, Miao Xu1, Qi-Sheng Feng1, Jin-Xin Bei1, Yi-Xin Zeng1 and Lin

Feng1

1Department of Experimental Research, Sun Yat-sen University Cancer Center, State Key

Laboratory Oncology in South China, 651 Dongfeng East Road, Guangzhou 510060, China.

2These authors contributed equally to this work.

Requests for reprints: Yi-Xin Zeng, State Key Laboratory of Oncology in Southern China, Sun

Yat-sen University Cancer Center, 651 Dongfeng East Road, Guangzhou 510060, China. Phone:

86-20-8734-3190; Fax: 86-20-8734-3171; E-mail: [email protected]. Or to Lin Feng, State

Key Laboratory of Oncology in Southern China, Sun Yat-sen University Cancer Center, 651

Dongfeng East Road, Guangzhou 510060, China. Phone: 86-20-8734-2626; Fax:

86-20-8734-3171; E-mail: [email protected]

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 7, 2018; DOI: 10.1158/0008-5472.CAN-17-3205 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Genetic susceptibility underlies the pathogenesis of cancer. We and others have

previously identified a novel susceptibility gene TNFRSF19, which encodes an

orphan member of the TNF receptor superfamily known to be associated with

nasopharyngeal carcinoma (NPC) and lung cancer risk. Here we show that

TNFRSF19 is highly expressed in NPC and is required for cell proliferation and NPC

development. However, unlike most of TNF receptors, TNFRSF19 was not involved

in NF-κB activation or associated with TRAF proteins. We identified TGFβ receptor

type-I (TβRI) as a specific binding partner for TNFRSF19. TNFRSF19 bound the

kinase domain of TβRI in the cytoplasm, thereby blocking Smad2/3 association with

TβRI and subsequent signal transduction. Ectopic expression of TNFRSF19 in normal

epithelial cells conferred resistance to the cell cycle block induced by TGFβ, whereas

knockout of TNFRSF19 in NPC cells unleashed a potent TGFβ response

characterized by upregulation of Smad2/3 phosphorylation and TGFβ target gene

transcription. Furthermore, elevated TNFRSF19 expression correlated with reduced

TGFβ activity and poor prognosis in NPC patients. Our data reveal that

gain-of-function of TNFRSF19 in NPC represents a mechanism by which tumor cells

evade the growth-inhibitory action of TGFβ.

Significance: TNFRSF19, a susceptibility gene for nasopharyngeal carcinoma and

other cancers, functions as a potent inhibitor of the TGFβ signaling pathway.

Introduction

Nasopharyngeal carcinoma (NPC) is a malignant tumor that originates in the

nasopharynx epithelium. Multiple factors, including genetic susceptibility,

Epstein-Barr virus (EBV) infection and environmental factors, contribute to NPC

development. NPC exhibits a striking geographic and ethnic distribution; the

incidence of NPC is unusually high in Southeast Asia, southern China and North

Africa. Additionally, familiar aggregation of NPC and the occurrence of multiple

cases of the disease in first-degree relatives have been reported in endemic regions,

strongly indicating that genetic susceptibility plays a key role in NPC (1,2). However,

little is known about the precise genetic changes attributable to the pathogenesis of

NPC (3-5).

The fundamental abnormality resulting in the development of cancer is the

uncontrolled cell proliferation. Cytokine transforming growth factor-β (TGFβ) is one

of the few classes of endogenous inhibitors of cell growth. TGFβ signals through a

complex of membrane-bound type I (TβRI) and type II (TβRII) receptors, both of

which are serine/threonine kinases. TβRII activates TβRI upon formation of the

ligand-receptor complex by phosphorylating the cytoplasmic GS domain of TβRI,

which turns on the kinase activity of TβRI, followed by the phosphorylation of

receptor-regulated Smads (R-Smads) including Smad2 and Smad3 at the C-terminal

SSXS motif. Phosphorylated R-Smads then form a trimeric complex with the

common mediator Smad4 (Co-Smad), which is translocated from the cytoplasm to

nucleus to cooperate with other transcriptional modulators to initiate the

transcriptional regulation of target genes. Several direct target genes of the TGFβ

pathway include plasminogen activator inhibitor 1 (PAI-1), the CDK inhibitors

p15INK4b and p21Cip1 and TGFβ itself. In addition to canonical Smad-dependent TGFβ

signaling, the TGFβ receptor complex also mediates non-Smad signaling, including

activation of the MAPK, Erk, p38 and JNK kinases (6). Under physiological

conditions, TGFβ arrests the cell cycle at G1 phase to inhibit cell proliferation; by

contrast, tumor cells often escape the antiproliferative effects of TGFβ by acquiring

loss-of-function mutations or deregulating the expression of various components in

the TGFβ pathway (7). Aberrations in TGFβ pathway genes have been reported in

NPC (8-10), and NPC cells often show a loss of TGFβ antiproliferative response

(11,12). However, it remains unclear what genetic mutations or the aberrant activities

of regulatory molecules are the cause of resistance to TGFβ in NPC.

Using a genome-wide association study (GWAS), we have previously identified

TNFRSF19 as a genetic susceptibility gene in NPC (13). Subsequently, TNFRSF19

has also been reported to be a lung cancer susceptibility gene in Han Chinese (14),

indicating that germline mutations in TNFRSF19 confer a predisposition to certain

cancers. TNFRSF19 (TNF Receptor Superfamily Member 19), also known as TROY,

belongs to the tumor necrosis factor (TNF) receptor superfamily, which commonly

transduces cytokine signals via a specific adaptor protein bound to the intracellular

domain. TNFRSF19 is unique because it does not bind to known TNF ligands and its

intracellular domain exhibits no sequence homology to any other characterized

members of the TNF receptor superfamily (15,16). High expression of TNFRSF19 is

associated with poor prognosis in various types of cancer (17-21). However, the

signal transduced by TNFRSF19 and molecular basis of TNFRSF19 in carcinogenesis

have not been explored. In this study, we characterize TNFRSF19 as a potent negative

regulator of the TGFβ receptor-induced signaling response and a key determinant of

NPC pathogenesis.

Materials and Methods

Cell lines, Transfection and Lentiviral Infection. The immortalized nasopharyngeal

epithelial cells NPEC2-Bmi1 and NPEC5-TERT were provided by Dr. Mu-Sheng

Zeng (SYSUCC) and were maintained in keratinocyte/serum-free medium

(Invitrogen). CNE-1 and HNE-1 cells were provided by Dr. Chao-Nan Qian

(SYSUCC) and maintained in Dulbecco’s Modified Eagle’s Medium (Invitrogen)

with 10% fetal bovine serum (Invitrogen) at 37°C and 5% CO2. All the NPE and NPC

cell lines used in this study were authenticated using short tandem repeat profiling. All

cell lines were tested Mycoplasma-free as determined by PCR-based method (16s

rDNA-F ： 5′-ACTCCTACGGGAGGCAGCAGTA-3′, 16s rDNA-R ：

5′-TGCACCATCTGTCACTCTGTTAACCTC-3′). Mycoplasma testing was carried

out every 2 or 3 weeks and the cells were not cultured for more than 2 months.

Transfection using PEI as well as lentiviral packaging and infection were performed

as previously described (22).

Constructs, Reagents and Antibodies. cDNA fragments encoding TNFRSF19.1

(referred as TNFRSF19), TNFRSF19.2, mouse Tory, TNFRSF21, LMP1, TGFβRI,

TGFβRII, Smad2, Smad3 and Smad4 were subcloned into pDONR201 (Invitrogen)

entry clones and subsequently transferred to gateway-compatible destination vectors.

Point mutants (T204D and K232R) and deletion mutants (ΔGS (delete 175-204 a.a.),

Δkinase (delete 208-503 a.a.) and ΔICD (delete 151-503 a.a.)) of TGFβR1 were

generated using site-directed mutagenesis PCR. All constructs were verified by

sequencing.

Recombinant human TGFβ1 (240-B) was obtained from R&D Systems; SB-431542

was from Selleckchem.

Rabbit anti-TNFRSF19 antisera were raised by immunizing rabbits with

GST-TNFRSF19 (residues 30-140) fusion proteins expressed in and purified from E.

coli. The antisera were affinity-purified using the AminoLink Plus Immobilization and

Purification Kit (Pierce). Antibodies against P21 (2947), PAI-1 (11907), p-Smad2

(3108), Smad2 (5339), p-Smad3 (9520), Smad3 (9523), Smad4 (9515), p-P38 (4511),

P38 (8690), p-IκBα (2859), IκBα (4814), Caspase-3 (9662), HA (3724) and GST

(2624) were obtained from Cell Signaling Technology (Danvers, MA). Antibodies

against TGFβRI (sc-398) and TGFβRII (sc-400) were from Santa Cruz Biotechnology

(Santa Cruz, CA). The antibody against GAPDH (60004-1-Ig) was from Proteintech.

Mouse anti-FLAG (F3165) and rabbit anti-FLAG (F7425) antibodies were from

Sigma-Aldrich (Poole, Dorset, UK).

Microarray Assay. Total RNA was isolated from CNE-1 and HNE-1 cells and their

TNFRSF19-knockout counterparts using TRIzol reagent (Invitrogen Corp,

Guangzhou, China) according to the manufacturer’s instructions. The concentration

and purity of total RNA were determined by spectrophotometry. RNA integrity was

confirmed by agarose gel electrophoresis. Control and TNFRSF19-knockout cells

were selected for microarray analysis. Human Genome U133 Plus 2.0 microarrays

(Affymetrix Corp., Santa Clara, CA, USA) were used to monitor changes in gene

expression. Total RNA was labeled and processed according to the manufacturer’s

instructions. The microarray analysis was performed by CapitalBio Corporation

(Beijing, China). A gene was considered to be differentially expressed if it was up- or

downregulated by at least 2-fold. Online CapitalBio Molecule Annotation System

(MAS) version 3.0 (http://bioinfo.capitalbio.com/mas3/) and Kyoto Encyclopedia of

Genes and Genomes (KEGG) databases were used to perform pathway analyses of the

differential genes.

GSEA Assay. Microarray data were downloaded from the GEO database

(http://www.ncbi.nlm.nih.gov/geo/) using the accession numbers indicated in Fig. 3c.

GSEA was performed using GSEA 2.2.4 (http://www.broadinstitute.org/gsea/).

Luciferase Reporter Assay. (CAGA)12-Luc and the control vector pRL-TK

(Promega) encoding Renilla luciferase were co-transfected into HEK293T cells or

NPC cells using PEI. Luciferase activity was measured 24 hrs later using the

Dual-Luciferase Reporter Assay System (Promega). The firefly luciferase activity

values were normalized to those of Renilla, and the ratios of firefly/Renilla activities

were determined. The experiments were independently performed in triplicate.

Immunofluorescence Analysis. Immunostaining was performed as previously

described (23). Briefly, cells were incubated with primary antibodies against Smad2

and then with Alexa Fluor Plus 488-conjugated goat antibodies against rabbit

(Invitrogen). The cells were counterstained with DAPI and imaged with a confocal

laser-scanning microscope (Olympus FV1000). The data were processed with Adobe

Photoshop 7.0 software.

Establishment of TNFRSF19-Knockout NPC Cell Lines. Gene knockout was

performed in cells using the CRISPR/Cas9 as previously described (24). The

sequences of guide RNAs (gRNAs) targeting exon 3 of human TNFRSF19 gene were

as follows: gRNA#1, CAAGAATTCAGGGATCGGTC and gRNA#2,

GTGTTCCCTGCAACCAGTGT. Knockout clones were verified by Western blotting

and Sanger sequencing (see the Supplementary material for detail).

Tandem Affinity Purification (TAP) and co-immunoprecipitation (co-IP). TAP

and co-IP were carried out as previously described (23). Briefly, HEK293T cells were

transfected with plasmids encoding C-terminal SFB-tagged (S-tag, flag epitope tag,

and streptavidin-binding peptide tag) TNFRSF19 to establish stable cells via

puromycin (2 μg/mL) selection. The cells were lysed in NETN buffer containing 50

mM β-glycerophosphate, 10 mM NaF, and 1 mg/mL each of pepstatin A and aprotinin.

The lysates were centrifuged at 12,000 rpm to remove debris and then incubated with

streptavidin-conjugated beads (Amersham) for 1 hr at 4°C. The beads were washed

five times with NETN buffer and followed by elution with NETN buffer containing 2

mg/mL biotin (Sigma). The elutes were incubated with S-protein beads (Novagen) for

4 hrs. After five washes, the bound proteins were analyzed by SDS-PAGE, and mass

spectrometry was performed by PTM BioLabs.

For co-immunoprecipitation experiments, cells were washed with ice-cold PBS and

then lysed in NETN buffer at 4°C for 30 min. The crude lysates were cleared by

centrifugation at 12,000 rpm and 4°C for 30 min, and the supernatants were incubated

with S-protein beads or anti-HA agarose (Sigma) at 4°C for 4 hrs to precipitate

SFB-tagged or HA-tagged proteins, respectively. For endogenous IP, the cell lysates

were incubated with control IgG or a protein-specific antibody overnight at 4°C,

followed by incubation with protein A/G PLUS-Agarose (Santa Cruz) at 4°C for 1 hr.

The immunocomplexes were washed four times with NETN buffer and then subjected

to SDS-PAGE and Western blotting.

Pull-Down Assay. GST, GST-fused TNFRSF19 extracellular domain (30-170 a.a.) or

intracellular domain (192-423 a.a.), GST-fused full-length TNFRSF19 without

transmembrane domain (30-170 plus 192-423 a.a.), and MBP-fused TGFβRI

extracellular domain (34-134 a.a.) or intracellular domain (148-504 a.a.) were

expressed in E. Coli BL21 cells. The GST fusion proteins were purified with

Glutathione Sepharose 4B (GE Healthcare), and the MBP fusion proteins were

purified with amylose beads (New England Biolabs) according to the manufacturers’

instructions. For the pull-down assay, bait fusion proteins were incubated with cell

lysates or target proteins in NETN buffer for 2 hrs at 4°C. The beads were washed

five times with NETN buffer and the bound proteins were separated by SDS-PAGE

and analyzed by Western blotting or mass spectrometry.

Patient Enrollment and Immunohistochemistry. A cohort of 140 NPC patients

(median age 44.8 years, range 15–74 years) who had undergone definitive treatment

with curative intent at our institute from 2003 to 2011 was evaluated. The cases were

selected based on the following criteria: pathologically confirmed NPC with available

biopsy specimens for tissues microarray (TMA) construction; no previous malignant

disease or second primary tumors; and no prior history of radiotherapy, chemotherapy

or surgery. All the selected NPC samples contained at least 70% carcinoma tissue as

determined by the examination of frozen sections. All patients were treated with

standard curative radiotherapy with or without chemotherapy. Protocols of the study

were approved by Ethic Committees of Sun Yat-sen University Cancer Center

(YB2013-04). This study was conducted under the provisions of the Declaration of

Helsinki and informed written consents were obtained from all patients before

inclusion. The clinical NPC samples were fixed in 10% formalin and embedded in

paraffin, and then sections of the embedded specimens were deparaffinized and

rehydrated. The slides were subjected to appropriate antigen retrieval protocols, and

endogenous peroxidase activity was blocked with 10% H2O2 for 10 min. The slides

were then exposed to anti-TNFRSF19 antibodies at 4°C overnight. Immunostaining

was performed using the Envision System (Dako). A semi-quantitative scoring

criterion was used for the IHC results, whereby both the staining intensity and

positive areas were recorded. The staining index (values 0–12) was obtained by

multiplying the intensity of TNFRSF19-positive stain (negative, 0; weak, 1; moderate,

2; or strong, 3) by the proportion of immunopositive cells of interest (<25%, 1;

25–50%, 2; 50–75%, 3; or ≥75%, 4). All scores were subdivided into two categories

according to a cutoff value of the ROC curve in the study cohort: low expression (≤7)

and high expression (>7).

Statistical Analysis. SPSS software version 16.0 was used to perform all statistical

analyses. Cumulative survival was calculated using Kaplan-Meier analysis, and

comparison between groups was performed using the log-rank test. Bivariate

correlations between study variables were determined using Pearson’s correlation

coefficients. Each experiment was performed at least three times. The significance of

variances between groups was determined by the t-test. All statistical tests were

two-sided, and P <0.05 was considered statistically significant.

Soft agar colony formation, tumor spheroid formation and xenograft studies.

All procedures were performed as previously described (24,25). All the animal

experiments were performed with the approval of Institutional Animal Care and Use

Committee of Sun Yat-sen University (reference no. GZR2016-105) and the animals

were handled in accordance with institutional guidelines. For xenograft studies,

female BALB/c nude mice (5-6 weeks old) were purchased from Shanghai

Laboratory Animal Center.

Results

High expression of TNFRSF19 in nasopharyngeal carcinoma

As our previous work suggested that TNFRSF19 is associated with nasopharyngeal

carcinoma (NPC) risk (13), we first evaluated TNFRSF19 expression in NPC patient

samples. A specific polyclonal antibody recognizing TNFRSF19 was raised and used

for immunohistochemistry (IHC) in NPC biopsies (Supplementary Fig. S1A) and

Western blotting (Supplementary Fig. S1B). We found that TNFRSF19 was highly

expressed in patient-derived NPC tissues, but it could be barely detected in normal

nasopharyngeal epithelial tissues (Fig. 1A). Similarly, TNFRSF19 was expressed in

NPC cell lines but not in the normal nasopharyngeal epithelial cell lines NPEC2-Bmi1,

NPEC5-Tert and NP69 (Fig. 1B). Additionally, Oncomine expression analysis

revealed high expression of TNFRSF19 in other human cancers (Fig. 1C), suggesting

that the high expression of TNFRSF19 is characteristic of multiple human cancer

types. To investigate whether TNFRSF19 expression serves as a novel prognostic

marker, the correlation of TNFRSF19 expression with NPC prognosis was evaluated.

Kaplan-Meier survival curves showed that patients with high TNFRSF19 expression

had a significantly poorer overall survival (OS) and distant metastasis-free survival

(DMFS) when compared with patients with low TNFRSF19 expression, as

demonstrated by the log-rank test (P < 0.001, Fig. 1D; P = 0.032, Fig. 1E). There was

no significant correlation between TNFRSF19 expression and recurrence-free survival

(P = 0.191, Fig. 1F). Additionally, the online database Kaplan–Meier Plotter also

revealed a statistically significant inverse correlation between high TNFRSF19

expression and overall survival in lung and gastric cancers (Fig. 1G). These data

indicate that TNFRSF19 may play an oncogenic role.

Loss of TNFRSF19 decreases tumorigenicity of NPC

To gain insights into the role of TNFRSF19 in cancer development, the TNFRSF19

gene was knocked out in two NPC cell lines, CNE-1 and HNE-1, using the

CRISPR-Cas9 genome editing system. Two independent sgRNAs with efficient

cleavage activity were selected (Supplementary Fig. S2A), and the genetic ablation of

TNFRSF19 was confirmed by Western blotting (Fig. 2A) and Sanger sequencing

(Supplementary Fig. S2B). Knockout of TNFRSF19 resulted in a substantially

reduced growth rate (Fig. 2B), lower plating efficiency (Fig. 2C) and colony-forming

capacity on soft agar (Fig. 2D) and reduced primary and secondary tumor spheroid

formation (Fig. 2E and F), indicating that the transformation ability was greatly

impaired by TNFRSF19 loss in vitro. To determine the role of TNFRSF19 in

tumorigenesis, we established xenograft tumors via subcutaneous inoculation of

wild-type (WT) and TNFRSF19-knockout (KO) NPC cells into the right and left

flanks of nude mice, respectively. TNFRSF19-knockout cells displayed a significant

inhibition of tumor growth compared with control cells (Fig. 2G and H). Furthermore,

knockout of TNFRSF19 resulted in a reduction of tumor-initiating ability, as

determined by limiting dilution transplantation analysis of NPC xenografts

(Supplementary Table S1). The above data indicate that TNFRSF19 is required for

cell growth and tumorigenesis of NPC.

TNFRSF19 interacts with TGFβ type-I receptor

The major signal transducers for the TNFR superfamily are TNF receptor associated

factors (TRAFs), which are linked to NF-κB activation (16). As a member of TNFRs,

some studies have shown that TNFRSF19 interacts with TRAF proteins and activates

the NF-κB pathway (19,21,26). The human TNFRSF19 gene encodes two transcripts:

TNFRSF19.1 and TNFRSF19.2, which share most of exons except the last one

(Supplementary Fig. S3A) and are both expressed in human cells (Supplementary Fig.

S3B and C). TNFRSF19.1 has 421 a.a. and lacks the TRAF-binding motif;

TNFRSF19.2 is shorter (417 a.a.) and has a distinct C-terminus with a potential

TRAF-binding consensus sequence (P/S/A/T)X(Q/E)E, 413SLQE416. Mouse Tnfrsf19,

commonly named as Troy, only has one transcript and the encoded protein containing

a different TRAF-binding motif 276TLQE279 (Supplementary Fig. S3A and D).

However, transient transfection of these TNFRSF19 constructs into HEK293T cells

did not lead to IκB phosphorylation or Caspase-3 cleavage, while a positive control

LMP1, an EBV oncoprotein acting as a constitutively active mimic of TNFR CD40

and binding TRAFs (27), potently stimulated IκB phosphorylation (Fig. 3A).

Consistently, co-immunoprecipitation (co-IP) revealed that TNFRSF19 transcript 1

and 2 or the mouse ortholog did not associate with TRAF2 or TRAF6, whereas

binding of TRAF2 to LMP1 was readily detectable (Fig. 3B). Therefore, it seems that

TNFRSF19 does not share the same set of signal transducers with other TNFRs and

may have different signaling outputs.

To gain insight into the biological pathway transduced by TNFRSF19, we studied the

protein interaction network of TNFRSF19. Tandem affinity purification (TAP) and

mass spectrometry (TAP-MS) were carried out in HEK293T cells stably expressing

SFB (S-FLAG-SBP) triple-tagged TNFRSF19 (transcript variant 1). Interestingly, MS

data revealed peptides that corresponded to TGFβ receptor type I (TβRI) (Fig. 3C).

TβRI was also identified via TAP in the NPC cell line HK1 (Supplementary Fig. S3E);

besides, the pull-down assay using TNFRSF19 intracellular domain as bait also

captured TβRI peptides in HEK293T cell lysates (Supplementary Fig. S3F), but no

TRAF proteins or death domain-containing proteins were found in these MS lists. To

verify the interaction of TNFRSF19 with TβRI, reciprocal co-IPs were performed in

HEK293T cells and showed that TβRI bound to TNFRSF19 in co-overexpression

experiment (Fig. 3D). Furthermore, endogenous TNFRSF19 was

co-immunoprecipitated with TβRI in HNE-1 and CNE-1 cells (Fig. 3E). In addition,

TNFRSF19 did not bind Smad2 or Smad4 (Fig. 3F). To further ensure the binding

specificity between TNFRSF19 and TβRI, another member of the TNF receptor

superfamily, TNFRSF21, which contains the death domain (28), was used as a control,

and the co-IP result suggested that only TNFRSF19 interacted with TβRI but not

TβRII in transiently transfected HEK293T cells (Fig. 3G). Collectively, these results

suggest that TNFRSF19 specifically binds TβRI in vivo.

Next, we sought to determine the regions responsible for the TNFRSF19-TβRI

interaction. To achieve this goal, bacterially expressed extra- and intracellular

domains of TNFRSF19 and TβRI were used in pull-down assays. The GST-fused

intracellular domain (ICD), but not the extracellular domain (ECD) of TNFRSF19,

was able to pull down TβRI (Fig. 3H). Conversely, GST-fused TNFRSF19 bound to

MBP-fused ICD but not to the ECD of TβRI (Fig. 3I). These results suggest that

TNFRSF19 binds directly to TβRI through the respective cytoplasmic domains. As

TNFRSF19 ICD does not harbor any known functional motif, we further dissected the

domains of TβRI ICD mediating the association with TNFRSF19. The cytoplasmic

region of TβRI is composed of a glycine- and serine-rich sequence, termed the GS

domain, followed by a kinase domain. A series of deletion mutants lacking the GS

domain, kinase domain or the entire ICD of TβRI was generated (Fig. 3J, right) and

the co-IP assay demonstrated that the GS domain was dispensable for

TβRI-TNFRSF19 interaction, but deletion of the kinase domain or the entire ICD of

TβRI abolished the TNFRSF19 association (Fig. 3J, left). Taken together, these data

suggest that TNFRSF19 binds to the kinase domain of TβRI in the cytoplasm.

TNFRSF19 blocks formation of the TGFβRI-Smad2/3 complex

Having established the interaction between TNFRSF19 and TβRI, we next asked how

the TβRI complex is regulated by TNFRSF19. Upon ligand stimulation, TβRI forms a

heteromeric complex with TβRII and is phosphorylated in the GS domain.

Phosphorylation induces a conformational change of TβRI and its subsequent

association and phosphorylation of the R-Smads, Smad2 and Smad3 via the kinase

domain (29-32) (Fig. 4A). We first examined whether the TNFRSF19 and TβRI

association is TGFβ-induced. As most TNFRSF19-positive NPC cells lost their

response to TGFβ (see below), we chose HaCaT, an immortalized human keratinocyte

cell line that is highly responsive to TGFβ and TNFRSF19-positive, to

immunoprecipiate endogenous TβRI before and after TGFβ treatment. The

TβRI-TβRII complex was induced after 1 hr of TGFβ treatment and declined after 6

hrs treatment, which correlated with the phosphorylation of Smad2; in contrast, a

constitutive interaction between TNFRSF19 and TβRI was observed regardless of the

presence of TGFβ (Fig. 4B). Additionally, we compared the interaction of TNFRSF19

with either active or inactive forms of TβRI. The T204D mutation in the GS domain

causes ligand- and TβRII-independent activation of TβRI, whereas the K232R

mutation leads to kinase inactivation (29). Co-IP experiment suggested that

TNFRSF19 bound to all forms of TβRI, and treatment with SB-431542, a small

molecular that inhibits the catalytic activity of TβRI, did not affect their interactions

(Fig. 4C). Thus, unlike TβRII and Smad2/3, the binding of TNFRSF19 to TβRI is

TGFβ-independent.

Next, we questioned whether TNFRSF19 affects the interaction of TβRI with the

upstream TβRII and the downstream R-Smads. Overexpression of TNFRSF19 did not

affect TβRI/II heterotetrameric receptor complex formation (Fig. 4D); however, the

interactions of Smad2/3 with TβRI were severely impaired by TNFRSF19

overexpression (Fig. 4E), and both wild-type and the constitutively active mutant

T204D of TβRI lost their abilities to associate with Smad2 in the presence of

exogenous TNFRSF19 (Fig. 4F). In agreement with the overexpression data,

knockout of TNFRSF19 in HNE-1 cells greatly induced endogenous TβRI-Smad2

complex formation (Fig. 4G). And as expected, the downstream event of

TβRI/R-Smads interaction, oligomerization of Smad2 with the Co-Smad, Smad4 was

inhibited by TNFRSF19 overexpression (Fig. 4H), and depletion of TNFRSF19 in

HNE-1 cells substantially increased Smad2-Smad4 complex (Fig. 4I). In summary,

TNFRSF19 competes with R-Smads for binding to the kinase domain of TβRI and

thereby blocks the recognition and activation of R-Smads and the subsequent

formation of an active R-Smad/Co-Smad complex.

TNFRSF19 inhibits TGFβ signaling

To investigate the biological significance of TNFRSF19 in the TGFβ pathway, we

compared the global gene expression profiles of control and TNFRSF19-knockout

cells using microarrays. A total of 143 differential genes were found between

wild-type (WT) and TNFRSF19 knockout (KO) HNE-1 cells (Fig. 5A). Strikingly,

functional profiling of these differentially expressed genes suggested that the TGFβ

signaling pathway was one of the most significantly affected pathways by the loss of

TNFRSF19 (Fig. 5B). Furthermore, after analysis of TNFRSF19 expression and

TGFβ-regulated gene signatures via gene set enrichment analysis (GSEA) in GEO

public NPC patient expression datasets (33), we found that TNFRSF19 levels were

inversely correlated with the gene signatures activated by TGFβ (Fig. 5C).

To validate the participation of TNFRSF19 in the TGFβ pathway, we used

(CAGA)12-Luc, a TGFβ-responsive luciferase reporter containing a Smad3/4-binding

box on the PAI-1 gene promoter (34), to determine whether TNFRSF19 affects

TGFβ-mediated transcriptional responses. Luciferase assays showed that loss of

TNFRSF19 dramatically increased the activity of the TGFβ/Smad-responsive reporter

in TGFβ-treated HNE-1 cells (Fig. 5D). Consistent with the reporter data, the protein

levels of P21 and PAI-1, two well-characterized direct transcriptional targets of TGFβ

pathway, were robustly upregulated in TNFRSF19 knockout cells than in control cells,

the latter responded poorly to TGFβ (Fig. 5E). Next, we examined the early mediators

of TGFβ signaling, e.g., TGFβ-induced phosphorylation of R-Smads. Smad2/3

phosphorylation was almost undetectable in HNE-1 WT cells even after TGFβ

stimulation; in contrast, much higher levels of basal and TGFβ-induced Smad2/3

phosphorylation were observed in TNFRSF19 KO cells, while p38 phosphorylation

was slightly increased (Fig. 5F). These data were in line with the finding that

TNFRSF19 prevented R-Smads from being recruited and activated by TβRI (Fig. 4).

To further examine the role of TNFRSF19 in the TGFβ pathway in vivo, we analyzed

the levels of P21 and phospho-Smad2 by IHC in NPC tumor xenografts, as shown in

Fig. 2H. The staining results revealed that tumors derived from TNFRSF19 KO cells

had higher levels of p21 and phosphorylated Smad2 compared with tumors derived

from control cells (Fig. 5G). Consistently, IHC in clinical specimens demonstrated a

negative correlation between TNFRSF19 and P21 and phospho-Smad2 levels (Fig.

5H). Taken together, these results indicate that TNFRSF19 inhibits TGFβ-induced

R-Smads phosphorylation and transcriptional responses in NPC.

Overexpression of TNFRSF19 confers resistance to growth inhibitory effect of

TGFβ

TGFβ acts as a tumor suppressor by inhibiting the growth of normal and premalignant

cells. We next determined the effects of TNFRSF19 gain-of-function on the

antiproliferative role of TGFβ in normal cells. Overexpression of TNFRSF19

abolished TGFβ-induced (CAGA)12-Luc reporter activation in HEK293T cells (Fig.

6A). When TNFRSF19 was transduced into a normal nasopharyngeal epithelial (NPE)

cell line, NPEC2-Bmi1, which does not express TNFRSF19 (Fig. 1B), cell

proliferation was accelerated (Fig. 6B), and inhibition of TGFβ-induced growth was

significantly alleviated compared with the control cells without TNFRSF19

transduction (Fig. 6C). In epithelial cells, TGFβ stimulates the transcription of

p15INK4b and/or p21Cip1, two cyclin-dependent kinase inhibitors, to arrest cell cycle

progression. Consequently, overexpression of TNFRSF19 substantially reduced the

induction of P21 and PAI-1 by TGFβ (Fig. 6D), while P15 was undetectable due to

homozygous deletion of the p15INK4b locus. The data suggest that TNFRSF19 reduces

transcriptional activation of TGFβ to bypass TGFβ-induced growth inhibition.

Consistently, TGFβ-induced phosphorylation of Smad2 was substantially inhibited by

ectopic expression of TNFRSF19 (Fig. 6E). Furthermore, the TGFβ-induced

cytoplasmic to nuclear translocation of Smad2 was suppressed by TNFRSF19 in NPE

cells (Fig. 6F), Thus, the overexpression data were consistent with the results

obtained from NPC knockout cells.

In addition to its tumor-suppressing activity, TGFβ also exhibits tumor-promoting

effects by assisting cell migration and cancer metastasis via

epithelial-to-mesenchymal transition (EMT) (7). However, loss of TNFRSF19 did not

change the level of E-cadherin, although N-cadherin levels increased. Besides, the

expression of E- and N-cadherin were insensitive to TGFβ in HNE-1 cells

(Supplementary Fig. S4A). Furthermore, TNFRSF19-deficient cells exhibited similar

migration ability compared with control cells (Supplementary Fig. S4B), suggesting

that at least in the context of NPC, TNFRSF19 mainly regulates the growth-inhibitory

function of TGFβ.

In summary, our results support a model in which TNFRSF19 functions as a key

repressor of TGFβ receptor-induced signaling responses and of TGFβ-dependent

antiproliferative effects in NPC (Fig. 7).

Discussion

Nasopharyngeal carcinoma is a special type of head and neck cancer. Strong ethnic

clustering and familiar aggregation of NPC indicates that genetic susceptibility plays

a significant role in this disease (1,35). However, even though numerous

mutations/variations have been discovered in NPC by multiple whole-genome or

exome sequencing studies over the years, the exact genetic perturbations resulting in

NPC are far from being fully understood (3).

We have previously identified TNFRSF19 as a susceptibility gene for NPC (13), and

another GWAS has reported that TNFRSF19 is a susceptibility factor in lung cancer

(14). TNFRSF19 belongs to the TNFR superfamily. The family members are

characterized by four conserved cysteine-rich domains in their extracellular domain

and a distinct intracellular domain that is responsible for TNFR signaling. In human, a

total of 29 TNFRs have been described to date. In general, members of the TNFR

superfamily can be divided into two groups: survival receptors and death receptors.

Survival receptors activate the NF-κB pathway by binding to TRAF proteins. Death

receptors mediate signal-induced cell death through their death domains (16).

TNFRSF19 is far less characterized in this family. TNFRSF19 does not bind to

TNF-related ligands and remains an orphan receptor to date (15). Its cytoplasmic

domain lacks death domain; additionally, despite the presence of a putative

TRAF-binding motif in the cytoplasmic region of human TNFRSF19.2 and mouse

Troy (Supplementary Fig. S3), they were unable to bind TRAF2 and TRAF6;

accordingly, overexpression or knockout of TNFRSF19 did not affect NF-κB activity

(Fig. 3A and B; Fig. 5E). Our results are in accordance with previous studies

conducted in other cell lines and mouse models (15,36). Moreover, unlike most

TNFRs, which are expressed in the immune system and play roles in innate and

adaptive immunity, TNFRSF19 is not present in lymphoid tissues but is highly

expressed in skin and hair follicles (15,37). Collectively, these findings indicate that

TNFRSF19 is functionally distinct from canonical TNFRs.

TNFRs utilize adaptor proteins to transduce and amplify receptor information to

different cell fates. To identify the adaptors for TNFRSF19, we performed affinity

purification of TNFRSF19. Unexpectedly, TGFβ type I receptor was captured as a

specific binding partner for the intracellular domain of TNFRSF19. Domain mapping

revealed that TNFRSF19 bound to the kinase domain of TβRI, which overlapped with

the binding region of R-Smads on TβRI (30-32) (Fig. 3J). However, unlike

TGFβRI/R-Smad complex formation, which is induced by TGFβ, TNFRSF19

constitutively associates with TβRI, thereby blocking the formation of the active

TβRI/R-Smad complex and the downstream R-Smad/Co-Smad complex (Fig. 4). The

constitutive interaction of TNFRSF19 with TβRI and the competition of R-Smads for

binding to the kinase domain inhibit leaky activation of the receptor in the absence of

TGFβ, thereby eliminating spurious signaling caused by receptor

oligomerization-induced R-Smads recruitment in the absence of ligand. Indeed,

depletion of TNFRSF19 results in active TβRI/R-Smad complex formation and TGFβ

pathway activation, even in the absence of ligand (Fig. 4G and I; Fig. 5). To our

knowledge, this is one of the very few examples of a repressor of the TGFβ pathway

via direct binding to TGFβ receptors, and this finding may advance our understanding

of the functional divergence of the TNFR superfamily.

Genetic alterations in the TGFβ pathway, such as the biallelic inactivation of

TGFBRII, Smad2 and Smad3 mutations and Smad4 deletion are often found in human

cancers (7,38). Notably, targeted deletion of Smad4 in the head and neck epithelium

of mice is sufficient to drive spontaneous head and neck squamous cell carcinomas

(HNSCC) (39). Loss of sensitivity to TGFβ-induced growth suppression has been

found in NPC (11,12). We identified TNFRSF19 as a key repressor of the TGFβ

pathway that is often overexpressed in NPC, and high levels of TNFRSF19 are

inversely correlated with TGFβ pathway activity in vivo, these evidences indicate that

the inactivation of TGFβ signaling in NPC could result from the gain-of-function of

TNFRSF19 rather than mutations in canonical TGFβ components. In addition to

TNFRSF19, other NPC susceptibility loci we have identified in 2010 include

MDS1-EVI1 and the CDKN2A-CDKN2B gene cluster (13). Interestingly, CDKN2B

(p15INK4b) is a TGFβ target gene that participates in the mediation of TGFβ-induced

cell cycle arrest (40), and MDS1-EVI1 is an oncoprotein that suppresses TGFβ

signaling by binding to Smad3 (41). The three NPC susceptibility genes seem to be

involved in the regulation of TGFβ signal transduction at different levels. Additionally,

TGFβRII has been shown to be downregulated in more than 50% of NPC (10).

Various genetic perturbations leading to the dysfunction of the same biological

pathway are common in cancers. Further study of the TGFβ pathway status in a large

cohort of NPC patients and evaluation of its association with prognosis are warranted.

The discovery that TNFRSF19 antagonizes TGFβ signaling by interacting with the

type I receptor and preventing its activation in a ligand-independent manner explains

how TNFRSF19 controls the sensitivity of cells to TGFβ signals. It is conceivable that

reactivation of TNFRSF19 in normal or premalignant epithelial cells can protect them

against small amounts of autocrine and paracrine TGFβ and eventually cause

uncontrolled cell growth. While expression of TNFRSF19 in human normal

nasopharyngeal epithelial cells is not associated with transformation, such as soft-agar

growth and the formation of tumors in xenograft mouse models, TNFRSF19 does

exert growth-promoting effects in NPE cells (Fig. 6B). Given that the etiology of

NPC is complex and involves predisposed genetic and environmental factors, it is

conceivable that multiple factors orchestrate the initiation of NPC. For example, EBV

has been considered as another key player in NPC pathogenesis and its latent to lytic

switch is induced by TGFβ (42,43). Thus, TNFRSF19 may also play roles in the

establishment of persistent EBV infection in the early stage of NPC development.

Future studies are needed to acquire a better understanding of gene-gene and

gene-environment interactions in the development of NPC.

In contrast to human TNFRSF19, its mouse ortholog Troy has been well studied in

mouse models. Using lineage tracing technology, Troy has been proposed as a stem

cell marker for stomach (44), kidney (45), intestine (20) and brain (46) in mice. Troy

also interacts with TGFβRI as its human orthologs (Supplementary Fig. S5A), and

therefore we generated tnfrsf19/troy-knockout mice using CRISPR-Cas9 technology

(Supplementary Fig. S5B and C). The isolated mouse embryonic fibroblasts (MEFs)

with a homozygous deletion of the tnfrsf19 gene were more sensitive to the

antiproliferative effects of TGFβ than the wild-type and heterozygous MEFs

(Supplementary Fig. S5D and E) and exhibited enhanced TGFβ signaling activity

(Supplementary Fig. S5F and G). However, the tnfrsf19-/- mice were alive at birth and

grew into adulthood without gross abnormalities compared with their littermates,

which is consistent with previous reports of tnfrsf19 knockout mouse models

generated by different gene-editing strategies and in different mice strains (36,47). It

could be result of the redundancy of other TNFR family members such as Edar (36).

Nonetheless, we showed that human TNFRSF19 is essential for the proliferation and

tumorigenicity of NPC cells. Future assessment of chemical induced tumor formation,

such as 4NQO (4-nitroquinoline 1-oxide)-induced head and neck squamous cell

carcinoma is needed in the Troy-knockout mouse model. One the other side, given the

gain-of-function property of TNFRSF19 in NPC, a transgenic mouse model would be

more valuable to define the role of TNFRSF19 in NPC development.

The cause of aberrant expression of TNFRSF19 in cancers is still elusive.

Tumor-specific expression of TNFRSF19 has been observed in NPC and other

cancers (18,19,21). However, whether the genetic variations cause reactivation of

TNFRSF19 remains uncertain. GWAS identified three SNPs within the TNFRSF19

region, rs1572072, rs9510787 and rs753955, but none of these SNPs are located in the

coding region or near the promoter of TNFRSF19 (13,14). Moreover, using

quantitative RT-PCR in various cell lines with or without TNFRSF19 expression, we

did not find concordance between the mRNA and protein expression levels

(Supplementary Fig. S3C). The reasons for the poor correlation of mRNA and protein

levels include post-transcriptional and post-translational modifications, necessitating

further investigations.

In conclusion, our results suggest that gain-of-function of TNFRSF19 in NPC inhibits

the tumor-suppressive role of the TGFβ pathway and promotes tumorigenesis. These

findings help pave the way toward a better understanding the molecular basis and

therapeutic potential of NPC.

Acknowledgments

We thank Drs. Junjie Chen and Kwok Wai Lo for helpful discussions. This work was

supported by the National Key R&D Program of China (Nos. 2016YF0902000 to

Y.-X. Zeng and 2017YFA0505600 to L. Feng), Major Project of Chinese National

Programs for Fundamental Research and Development (No. 2013CB910301 to Y.-X.

Zeng), the National Natural Science Foundation of China (Nos. 81672980 to L. Feng

and 81372882 to J.-X. Bei), the Key Program of the National Natural Science

Foundation of China (No. 81430059 to Y.-X. Zeng), the Health & Medical

Collaborative Innovation Project of Guangzhou City, China (No. 201803040003 to

Y.-X. Zeng) and the Foundation of the Ministry of Science and Technology of

Guangdong Province (No. 2015B050501005 to Y.-X. Zeng).

References 1. Wei WI, Sham JS. Nasopharyngeal carcinoma. Lancet 2005;365:2041-54 2. Razak AR, Siu LL, Liu FF, Ito E, O'Sullivan B, Chan K. Nasopharyngeal carcinoma: the next challenges. Eur J Cancer 2010;46:1967-78 3. Dai W, Zheng H, Cheung AK, Lung ML. Genetic and epigenetic landscape of nasopharyngeal

carcinoma. Chin Clin Oncol 2016;5:16 4. Bei JX, Zuo XY, Liu WS, Guo YM, Zeng YX. Genetic susceptibility to the endemic form of NPC. Chin Clin Oncol 2016;5:15 5. Hildesheim A, Wang CP. Genetic predisposition factors and nasopharyngeal carcinoma risk: a review of epidemiological association studies, 2000-2011: Rosetta Stone for NPC: genetics, viral infection, and other environmental factors. Semin Cancer Biol 2012;22:107-16 6. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 2003;425:577-84 7. Massague J. TGFbeta in Cancer. Cell 2008;134:215-30 8. Wei YS, Zhu YH, Du B, Yang ZH, Liang WB, Lv ML, et al. Association of transforming growth factor-beta1 gene polymorphisms with genetic susceptibility to nasopharyngeal carcinoma. Clinica chimica acta; international journal of clinical chemistry 2007;380:165-9 9. Zhang W, Zeng Z, Fan S, Wang J, Yang J, Zhou Y, et al. Evaluation of the prognostic value of TGF-beta superfamily type I receptor and TGF-beta type II receptor expression in nasopharyngeal carcinoma using high-throughput tissue microarrays. Journal of molecular histology 2012;43:297-306 10. Lyu X, Fang W, Cai L, Zheng H, Ye Y, Zhang L, et al. TGFbetaR2 is a major target of miR-93 in nasopharyngeal carcinoma aggressiveness. Molecular cancer 2014;13:51 11. Xiao J, Xiang Q, Xiao YC, Su ZJ, Huang ZF, Zhang QH, et al. The effect of transforming growth factor-beta1 on nasopharyngeal carcinoma cells: insensitive to cell growth but functional to TGF-beta/Smad pathway. J Exp Clin Cancer Res 2010;29:35 12. Lo AK, Dawson CW, Lo KW, Yu Y, Young LS. Upregulation of Id1 by Epstein-Barr virus-encoded LMP1 confers resistance to TGFbeta-mediated growth inhibition. Molecular cancer 2010;9:155 13. Bei JX, Li Y, Jia WH, Feng BJ, Zhou G, Chen LZ, et al. A genome-wide association study of nasopharyngeal carcinoma identifies three new susceptibility loci. Nature genetics 2010;42:599-603 14. Hu Z, Wu C, Shi Y, Guo H, Zhao X, Yin Z, et al. A genome-wide association study identifies two new lung cancer susceptibility loci at 13q12.12 and 22q12.2 in Han Chinese. Nature genetics 2011;43:792-6 15. Hu S, Tamada K, Ni J, Vincenz C, Chen L. Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics 1999;62:103-7 16. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 2001;104:487-501 17. Spanjaard RA, Whren KM, Graves C, Bhawan J. Tumor necrosis factor receptor superfamily member TROY is a novel melanoma biomarker and potential therapeutic target. International journal of cancer 2007;120:1304-10 18. Paulino VM, Yang Z, Kloss J, Ennis MJ, Armstrong BA, Loftus JC, et al. TROY (TNFRSF19) is overexpressed in advanced glial tumors and promotes glioblastoma cell invasion via Pyk2-Rac1 signaling. Molecular cancer research : MCR 2010;8:1558-67 19. Loftus JC, Dhruv H, Tuncali S, Kloss J, Yang Z, Schumacher CA, et al. TROY (TNFRSF19) promotes glioblastoma survival signaling and therapeutic resistance. Molecular cancer research : MCR 2013;11:865-74 20. Fafilek B, Krausova M, Vojtechova M, Pospichalova V, Tumova L, Sloncova E, et al. Troy, a

tumor necrosis factor receptor family member, interacts with lgr5 to inhibit wnt signaling in intestinal stem cells. Gastroenterology 2013;144:381-91 21. Schon S, Flierman I, Ofner A, Stahringer A, Holdt LM, Kolligs FT, et al. beta-catenin regulates NF-kappaB activity via TNFRSF19 in colorectal cancer cells. International journal of cancer 2014;135:1800-11 22. Feng L, Chen J. The E3 ligase RNF8 regulates KU80 removal and NHEJ repair. Nat Struct Mol Biol 2012;19:201-6 23. Feng L, Huang J, Chen J. MERIT40 facilitates BRCA1 localization and DNA damage repair. Genes & development 2009;23:719-28 24. Lian YF, Yuan J, Cui Q, Feng QS, Xu M, Bei JX, et al. Upregulation of KLHDC4 Predicts a Poor Prognosis in Human Nasopharyngeal Carcinoma. PloS one 2016;11:e0152820 25. Liang Y, Zhong Z, Huang Y, Deng W, Cao J, Tsao G, et al. Stem-like cancer cells are inducible by increasing genomic instability in cancer cells. The Journal of biological chemistry 2010;285:4931-40 26. Ding Z, Roos A, Kloss J, Dhruv H, Peng S, Pirrotte P, et al. A Novel Signaling Complex between TROY and EGFR Mediates Glioblastoma Cell Invasion. Mol Cancer Res 2018;16:322-32 27. Kaye KM, Devergne O, Harada JN, Izumi KM, Yalamanchili R, Kieff E, et al. Tumor necrosis factor receptor associated factor 2 is a mediator of NF-kappa B activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proceedings of the National Academy of Sciences of the United States of America 1996;93:11085-90 28. Pan G, Bauer JH, Haridas V, Wang S, Liu D, Yu G, et al. Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett 1998;431:351-6 29. Wieser R, Wrana JL, Massague J. GS domain mutations that constitutively activate T beta R-I, the downstream signaling component in the TGF-beta receptor complex. EMBO J 1995;14:2199-208 30. Feng XH, Derynck R. A kinase subdomain of transforming growth factor-beta (TGF-beta) type I receptor determines the TGF-beta intracellular signaling specificity. EMBO J 1997;16:3912-23 31. Chen YG, Hata A, Lo RS, Wotton D, Shi Y, Pavletich N, et al. Determinants of specificity in TGF-beta signal transduction. Genes & development 1998;12:2144-52 32. Huse M, Chen YG, Massague J, Kuriyan J. Crystal structure of the cytoplasmic domain of the type I TGF beta receptor in complex with FKBP12. Cell 1999;96:425-36 33. Sengupta S, den Boon JA, Chen IH, Newton MA, Dahl DB, Chen M, et al. Genome-wide expression profiling reveals EBV-associated inhibition of MHC class I expression in nasopharyngeal carcinoma. Cancer Res 2006;66:7999-8006 34. Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J 1998;17:3091-100 35. Lo KW, Huang DP. Genetic and epigenetic changes in nasopharyngeal carcinoma. Semin Cancer Biol 2002;12:451-62 36. Pispa J, Pummila M, Barker PA, Thesleff I, Mikkola ML. Edar and Troy signalling pathways act redundantly to regulate initiation of hair follicle development. Hum Mol Genet

2008;17:3380-91 37. Kojima T, Morikawa Y, Copeland NG, Gilbert DJ, Jenkins NA, Senba E, et al. TROY, a newly identified member of the tumor necrosis factor receptor superfamily, exhibits a homology with Edar and is expressed in embryonic skin and hair follicles. The Journal of biological chemistry 2000;275:20742-7 38. Siegel PM, Massague J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat Rev Cancer 2003;3:807-21 39. Lu SL, Herrington H, Wang XJ. Mouse models for human head and neck squamous cell carcinomas. Head Neck 2006;28:945-54 40. Hannon GJ, Beach D. p15INK4B is a potential effector of TGF-beta-induced cell cycle arrest. Nature 1994;371:257-61 41. Kurokawa M, Mitani K, Irie K, Matsuyama T, Takahashi T, Chiba S, et al. The oncoprotein Evi-1 represses TGF-beta signalling by inhibiting Smad3. Nature 1998;394:92-6 42. Liang CL, Chen JL, Hsu YP, Ou JT, Chang YS. Epstein-Barr virus BZLF1 gene is activated by transforming growth factor-beta through cooperativity of Smads and c-Jun/c-Fos proteins. The Journal of biological chemistry 2002;277:23345-57 43. Iempridee T, Das S, Xu I, Mertz JE. Transforming growth factor beta-induced reactivation of Epstein-Barr virus involves multiple Smad-binding elements cooperatively activating expression of the latent-lytic switch BZLF1 gene. J Virol 2011;85:7836-48 44. Stange DE, Koo BK, Huch M, Sibbel G, Basak O, Lyubimova A, et al. Differentiated Troy(+) Chief Cells Act as Reserve Stem Cells to Generate All Lineages of the Stomach Epithelium. Cell 2013;155:357-68 45. Schutgens F, Rookmaaker MB, Blokzijl F, van Boxtel R, Vries R, Cuppen E, et al. Troy/TNFRSF19 marks epithelial progenitor cells during mouse kidney development that continue to contribute to turnover in adult kidney. Proceedings of the National Academy of Sciences of the United States of America 2017;114:E11190-E8 46. Basak O, Krieger TG, Muraro MJ, Wiebrands K, Stange DE, Frias-Aldeguer J, et al. Troy+ brain stem cells cycle through quiescence and regulate their number by sensing niche occupancy. Proc Natl Acad Sci U S A 2018;115:E610-E9 47. Shao Z, Browning JL, Lee X, Scott ML, Shulga-Morskaya S, Allaire N, et al. TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration. Neuron 2005;45:353-9

Figure Legends

Figure 1. TNFRSF19 is highly expressed in NPC. A, (left) Immunohistochemistry

analysis of TNFRSF19 expression in 8 normal nasopharyngeal and 140 NPC tissues

(scale bar: 50 μm), together with an enlarged view of each in the corresponding inset.

(right) Scatterplots representing the IHC scores are shown on the left. B, Western blot

assay of TNFRSF19 expression in 3 normal nasopharyngeal epithelial cells and 6 29

NPC cell lines. C, Oncomine box plots of TNFRSF19 expression levels in multiple

advanced human cancers. D-F, Kaplan-Meier analysis of TNFRSF19 expression and

overall survival (D), distant-metastasis free survival (E) and recurrence-free survival

(F) in 140 NPC patients. G, Kaplan-Meier analysis of overall survival in lung (1,145

patients) and gastric cancer (631 patients) stratified by TNFRSF19 expression. The

p-values were calculated using the log-rank test.

Figure 2. TNFRSF19 is required for NPC tumorigenesis. A, Western blot analysis of

TNFRSF19 in wild-type (WT) and knockout (KO) cells. TNFRSF19 KO cells were

generated using the CRISPR-Cas9 system with two single-guide RNAs targeting exon

3, and clones 1# and 2# were from sgRNAs 1# and 2#, respectively. B, Proliferation

curve of HNE-1 WT or TNFRSF19 KO cells as measured by CCK-8 assay. Error bars

denote the standard deviations (n = 3). C and D, Knockout of TNFRSF19 reduced the

ability to form colonies on conventional plates (C) and soft agar (D). E and F,

Primary and secondary tumor sphere formation in ultra-low attachment plates of

CNE-1 and HNE-1 cells with or without TNFRSF19 KO. Secondary spheroids (F)

were obtained from the dissociation of primary spheroids (E) into single cells and

re-seeded. Error bars denote the standard deviation (n = 3). Scale bars: 50 μm. G,

Wild-type or TNFRSF19 KO cells were subcutaneously injected into the right and left

flanks of athymic BALB/c mice, respectively. Images were captured 7 weeks

post-implantation. H, Growth curves of the tumors formed by wild-type or

TNFRSF19 KO cells. Mean tumor volumes are plotted. Error bars denote the standard

deviation (n = 6).

Figure 3. TNFRSF19 interacts with type I TGFβ receptor. A, Lysates from HEK293T

cells transfected with human TNFRSF19.1, 19.2, mouse Troy and LMP1 constructs

were immunoblotted with the indicated antibodies. LMP1 served as a positive control

for NF-κB activation. B, (top) SFB-tagged TNFRSF19.1, 19.2 and mouse Troy or

LMP1 were transfected into HEK293T cells along with HA-TRAF2. The cell lysates

were precipitated with S-protein beads and immunoblotted with the indicated

antibodies. LMP1 served as a positive control for TRAF2 binding. (bottom) The

interaction of SFB-tagged TNFRSF19.1, 19.2 and mouse Troy with HA-TRAF6. C,

HEK293T cells stably expressing SFB-tagged TNFRSF19 were used for tandem

affinity purification (TAP). Silver staining of TAP and the number of peptides

identified by mass spectrometry are shown. D, Co-immunoprecipitation (co-IP) of

exogenous TGFβRI (TβRI) and TNFRSF19 (T19). HEK293T cells were transfected

with plasmids encoding C-terminal SFB-tagged TGFβRI and C-terminal HA-tagged

TNFRSF19. Cell lysates were precipitated with S-protein beads and immunoblotted

with the indicated antibodies. E, Interactions between endogenous TNFRSF19 and

TβRI in HNE-1 and CNE-1 cells were assessed by immunoprecipitation (IP) with

anti-TβRI antibody or control IgG and immunoblotting using anti-TNFRSF19 and

TβRI antibodies. Arrow: IgG heavy chain. F, Lysates from HEK293T cells expressing

HA-tagged Smad2, Smad4 and TβRI along with SFB-tagged TNFRSF19 were

immunoprecipitated with anti-HA agarose and immunoblotted with antibodies as

indicated. G, Co-IP of SFB-tagged TNFRSF19 or TNFRSF21 with HA-TβRI or

TβRII in transfected HEK293T cells. H, The intracellular domain of TNFRSF19

binds to TβRI. Bacterially expressed GST-extracellular domain (ECD) and

intracellular domain (ICD) fragments of TNFRSF19 or GST alone were incubated

with HNE-1 cell lysates. Proteins bound to glutathione sepharose beads were analyzed

by immunoblotting. GST fusion proteins are shown by Coomassie Brilliant Blue

(CBB) staining. I, TNFRSF19 directly binds to ICD of TβRI. MBP-tagged ECD or

ICD of TβRI fragments were co-incubated with GST-tagged TNFRSF19; proteins

bound to amylose beads were immunoblotted with anti-GST antibody. J, (left)

Schematic representation of the TGFβRI domain structure. SP: signal peptide; TM:

transmembrane domain. (right) Lysates from HEK293T cells expressing SFB-tagged

full-length (FL) or deletion mutants of TβRI with or without HA-tagged TNFRSF19

were subjected to immunoprecipitation (IP) with anti-HA agarose and

immunoblotting with anti-FLAG and anti-HA antibodies.

Figure 4. TNFRSF19 blocks TGFβRI from binding to R-Smads. A, Schematic

representation of TβRI activation and signal transduction via receptors. B, Cell lysates

from HaCaT cell line treated with TGFβ (5 ng/mL) for the indicated times were

immunoprecipitated (IP) using anti-TβRI antibody or control IgG, followed by

immunoblotting with the indicated antibodies. C, HEK293T cells were co-transfected

with plasmids encoding HA-tagged WT, T204D and K232R mutants of TβRI, along

with TNFRSF19-SFB. Following 1 hr of SB-431542 (10 μM) treatment or no

treatment, the cell lysates were precipitated with S-protein beads and immunoblotted

with the indicated antibodies. Phospho-Smad2 and PAI-1 represent early and late

response to TGFβ, respectively. D, Co-IP of SFB-tagged TβRII and HA-tagged TβRI

in the presence or absence of exogenous TNFRSF19 in transfected HEK293T cells. E,

Co-IP of SFB-tagged Smad2 or Smad3 with HA-TβRI in the presence or absence of

TNFRSF19 overexpression in transfected HEK293T cells. F, Co-IP of SFB-Smad2

with HA-tagged wild-type (WT), T204D or K232R mutant of TβRI with or without

co-transfection of TNFRSF19 in transfected HEK293T cells. G, Interaction of

endogenous TβRI and Smad2 in WT and TNFRSF19 KO HNE-1 cells with or without

TGFβ (5 ng/mL) treatment was analyzed by IP with anti-TβRI antibody followed by

IB with the indicated antibodies. Arrow: IgG heavy chain. H, Co-IP of SFB-Smad2

and Myc-Smad4 with or without TNFRSF19 overexpression in transfected HEK293T

cells. I, Endogenous Smad2-Smad4 interaction in WT and TNFRSF19 KO HNE-1

cells with or without TGFβ (5 ng/mL) treatment as analyzed by IP with anti-Smad2

antibody followed by IB with anti-Smad4 antibody.

Figure 5. TNFRSF19 suppresses TGFβ signaling in NPC. A, Double-log scatter plot

comparing the differential expression of mRNAs in control and TNFRSF19-knockout

(KO) HNE-1 cells. Downregulated genes are shown in green, and upregulated genes

are in red. B, KEGG pathway enrichment analysis of differentially expressed genes

between wild-type and TNFRSF19-knockout cells. C, GSEA plot showing that

TNFRSF19 expression is inversely correlated with TGFβ-activated gene signatures in

published NPC patient gene expression datasets (GSE12452, n = 31). ES: enrichment

score. NES: normalized enrichment score. D, Luciferase assay of the TGFβ reporter

(CAGA)12-Luc in WT or TNFRSF19 KO cells treated or not with TGFβ (5 ng/mL) for

24 hrs. Error bars denote the standard deviation (n = 3). E, Effects of TNFRSF19

knockout on TGFβ-induced P21 and PAI-1 expression. WT, TNFRSF19 KO CNE-1

or HNE-1 cells were starved overnight and then treated with TGFβ for 6 hrs; the

induction of target genes was examined by WB. F, Effects of TNFRSF19 KO on

TGFβ-induced phosphorylation of Smad2/3 and P38. Cells with or without

TNFRSF19 deletion were starved overnight and then stimulated with TGFβ for 1 hr,

and the phosphorylated and total proteins were immunoblotted with the indicated

antibodies. G, Immunohistochemical analysis of TNFRSF19 and phosphorylated

Smad2 and P21 in xenografts generated from WT and TNFRSF19-KO cells as shown

in 2H. Scale bars: 100 μm. H, Expression levels of p-Smad2 and P21 were inversely

associated with TNFRSF19 levels in 40 primary human NPC specimens. Two

representative cases are shown. Scale bar: 100 μm. The inset shows a magnified view.

Figure 6. Overexpression of TNFRSF19 confers resistance to TGFβ-mediated growth

inhibition in normal nasopharyngeal epithelial cells. A, Effect of TNFRSF19 on the

(CAGA)12-Luc transcriptional response induced by TGFβ (5 ng/mL) for 24 hrs in

293T cells. B, NPEC2-Bmi1 cells were infected with control lentivirus or lentivirus

expressing TNFRSF19. The cell proliferation was determined by CCK-8 assay. C,

NPEC2-Bmi1 cells with or without TNFRSF19 overexpression were cultured in the

absence or presence of TGFβ. After 48 hr incubation the cell viability were

determined by CCK-8 assay. D, Control or TNFRSF19-overexpressing NPEC2-Bmi1

cells were treated or not with various concentrations of TGFβ for 6 hrs; the inductions

of P21 and PAI-1 are shown. E, TNFRSF19 overexpression inhibits the

phosphorylation of Smad2 induced by 30 min of TGFβ treatment in NPE cells. F,

TNFRSF19 inhibits the nuclear translocation of Smad2 induced by TGFβ. (left)

Immunofluorescence images representing the subcellular localization of Smad2

before and after 30 min of stimulation with TGFβ in control or

TNFRSF19-overexpressing NPE cells. Scale bars: 50 μm. (right) Histogram

representing the percentage of cells displaying Smad2 distributed in the nuclear,

cytoplasmic or both compartments.

Figure 7. Working model of TNFRSF19-mediated inhibition of TGFβ signaling in

cancer.

TNFRSF19 inhibits TGFβ signaling through interaction with TGF β receptor type I to promote tumorigenesis

Chengcheng Deng, Yu-Xin Lin, Xue-Kang Qi, et al.

Cancer Res Published OnlineFirst May 7, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-3205

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/03/16/0008-5472.CAN-17-3205.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2018/05/05/0008-5472.CAN-17-3205. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.