Species Identification by Polymerase Chain Reaction of Staphylococcal

Species Identification by Polymerase Chain Reaction of Staphylococcal Isolates from the Skin and Ears of Dogs and Evaluation of Clinical Laboratory Standards Institute Interpretive Criteria for Canine Methcillin-resistant Staphylococcus pseudintermedius

Thesis

Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Graduate School of The Ohio State University

Jennifer Ruth Schissler, DVM

Graduate Program in Veterinary Clinical Sciences

The Ohio State University

2009

Thesis Committee

Dr. Andrew Hillier, Advisor

Dr. Lynette Cole

Dr. Wondwossen Gebreyes

Dr. Paivi Rajala-Schultz

Dr. Joshua Daniels

Jennifer Schissler, DVM

2009

[Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting ofii the pull quote text box.] Abstract

The Clinical and Laboratory Standards Institute has published (2008) new interpretive criteria for identification of methicillin resistance in veterinary staphylococci. The sensitivity of the 2008 interpretive criteria compared to previous

(2004) criteria was established in thirty canine clinical isolates of mecA gene–positive

Staphylococcus pseudintermedius. The minimum inhibitory concentration for oxacillin was determined by broth microdilution. The 2008 breakpoint of > 4µg/ml for methicillin resistance resulted in a sensitivity of 73.3% (22/30). The 2004 breakpoint guideline of ≥ 0.5 µg/ml resulted in a sensitivity of 97% (29/30). For oxacillin disk diffusion, the 2008 interpretive criterion of ≤10 mm for methicillin resistance resulted in a sensitivity of 70% (21/30). Application of the 2004 interpretive criterion of ≤ 17mm resulted in a sensitivity of 100% (30/30). For cefoxitin disk diffusion, the interpretive criterion of ≤ 21mm for methicillin resistance

(as used for S. aureus) resulted in a diagnostic sensitivity of 6.7% (2/30). The interpretive criterion of ≤ 24mm (as used for coagulase negative staphylococci) resulted in a diagnostic sensitivity of 43.3% (13/30). The 2008 interpretive criteria produced what we consider to be an unacceptable level of false negative results. This study also established that cefoxitin disk diffusion is an inappropriate screening test for methicillin resistance of canine S. pseudintermedius.

Pilot experiments to screen novel PCR primers for S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius were performed using type culture control strains. Target genes included hsp60, sodA, femA, and nuc. Three of 15 primers

(20%) failed to produce an amplicon of predicted size. Three (20%) successfully functioned for S. aureus and S. schleiferi. All 4 functional S. intermedius primers demonstrated cross- amplification in S. pseudintermedius type strains. After S. pseudintermedius sequences were available, it was determined that identical to near- identical S .intermedius primer annealing site sequences were present in this species.

A primer targeting nuc gene differentiated S. intermedius from S. pseudintermedius type strains. Three sodA primers for S. aureus, S. schleiferi, S. intermedius/pseudintermedius and one nuc primer for S. pseudintermedius were selected for further investigation.

A total of 91 isolates of S. pseudintermedius, S. schleiferi, and S. aureus previously identified via select biochemical testing or API ID 32 STAPH identification were used for PCR validation experiments. Identity was confirmed via

VITEK2 system. There was 29% (26/91) disagreement between VITEK2 results and results of previous identification methods. Previously identified S. schleiferi provided the greatest disagreement, 82 % (22/28). Supplemental testing was necessary for identification in a majority of isolates.

iii

The sodA- based primer for S. pseudintermedius provided a sensitivity of

100% and a specificity range of 6.7-22%. The sodA-based primer for S. schleiferi provided a sensitivity of 83% and a specificity range of 56-75%. The sodA-based primer for S. aureus provided a sensitivity of 97% and a specificity of 91%. The nuc- based primer for S. pseudintermedius provided a sensitivity range of 94-100% and specificity range of 22-96%. These primers did not provide sufficient sensitivity and specificity to discriminate between S. pseudintermedius, S. schleiferi, and S. aureus as a sole diagnostic test.

Dedication

This thesis is dedicated first and foremost to my parents Fred and Linda.

Thank you for nurturing my intellectual curiousity and supporting me wherever it may take me, even if it is far from home. You have provided great mentorship and friendship.

To my brother Eric: I wish you all the best in your future academic endeavors.

I am very proud of you- may we celebrate the completion of our theses together.

To my brother Bryan: you have my respect for being a good husband and father. It is unfortunate that I couldn’t spend as much time with Freddy and Abby as I would liked the last three years, but I hope they get to know Aunt Jenny and Uncle

Aaron soon.

To Aaron: I started this journey alone and somehow found the most

interesting person I know to spend the rest of it with. Your steadfastness and

dedication to us is a blessing. You have been incredibly supportive during the

construction of this weighty script. May this thesis be one of our many collective achievements. I hope this tome spends many a dusty year on a bookshelf in our home.

To our future children: if you are reading this now, stop here you have already read

the most interesting parts.

Acknowledgement

Andy Hillier and Lynette Cole, thank you for your guidance, sense of humor and demand for excellence throughout my residency. These three years have been the most challenging and formative thus far on both a personal and professional level.

Thank you for this life-changing opportunity. It was my goal to earn your professional trust and respect during my residency. Whever my future may take me, I hope to continue to earn it. Do not be surprised if I continue to seek your input in the future, as your opinions and experiences will remain valuable to me.

Wendy Lorch, I admire greatly your academic achievements, your intellect, and your cheerful and helping spirit. Thank you for your friendship in and your guidance. I wish you continued success in the future.

Michele Fox, thank you for your friendship. I look forward to our daily conversations and will miss your company. You have been a great model of patience, organization, and proficiency- an ideal technician.

I would like to thank the members of my thesis committee: Dr. Gebreyes, Dr.

Daniels, Dr. Rajala-Schultz, and Dr. Bannerman for their technical advice and encouragement.

Vita

February 3, 1980………………………………………...Born- Westminster, Colorado

2005……………………………………………...... DVM, Colorado State University

2006- Present…………………………….Graduate Teaching and Research Associate,

The Ohio State University

Publications

1. Schissler JR, Lorch G. Bacterial Dermatitis-Superficial. In: Lavoie J, Hinchcliff KW. Blackwell’s Five –Minute Veterinary Consult: Equine. 2nd Ed. Ames, Wiley-Blackwell. 2008; 122-123.

2. Smirnova NJ, Troyer JL, Schissler J, Terwee J, Poss M, Vandewoude S. Feline lentiviruses demonstrate differences in receptor repertoire and envelope structural elements. Virology 2005 Nov 10; 342(1): 60-76.

Fields of Study

Major Field: Veterinary Clinical Sciences

Studies in Veterinary Dermatology

vii

Table of Contents

Abstract………………………………………………………………………………..ii

Dedication……………………………………………………………………………..v

Acknowledgement……………………………………………………………………vi

Vita……………………………………………………………………………...... vii

List of Tables………………………………………………………………………..xvi

Chapter 1:Introduction…………………………………………………………….1

Chapter 2: Literature Review……………………………………………………...5

2.1 The Genus Staphylococcus……………………………………………………..5

2.1.1 Taxonomy…………………………………………………….....5

2.1.2 Staphylococci of Veterinary Interest……………………………6

2.1.2.1 S. intermedius and S. pseudintermedius………………...6

2.1.2.2. S. aureus………………………………………………8

2.1.2.3 S. schleiferi subsp. schleiferi and S. schleiferi subsp.

coagulans…………………………………………….10

2.2 Methicillin resistance in veterinary medicine……………………………………10

2.2.1 Methicillin- resistant S. pseudintermedius……………………………………..10

2.2.2 Methicillin- resistant S. aureus…………………………………...14

2.2.3 Methicillin- resistant S. schleiferi……………………………...17

viii

2.3 Identification of Staphylococcus species………………………...19

2.3.1 Phenotypic Identification………………………………19

2.3.1.1 Morphology…………………………………..19

2.3.1.2 Gram stain……………………………………20

2.3.1.3 Coagulase activity……………………………21

2.3.1.4 Catalase activity…………………………….. 21

2.3.1.5 Biochemical tests……………………………21

2.3.1.6.1 Expected results for S.

pseudintermedius, S. intermedius, S. schleiferi,

S. aureus…………………………………………..22

2.3.1.6.2 Phenotypic testing technologies……………31

2.3.1.6.3 Difficulties and discrepancies in phenotypic

technologies …………………………………………32

2.3.2 Genotypic identification……………………………………….34

2.3.2.1 Technologies…………………………………………34

2.3.2.2 PCR for identification of staphylococci……………..35

2.3.2.2.1 Genes of interest for identification………..36

2.3.2.2.2 femA gene…………………………………37

2.3.2.2.3 hsp60 gene…………………………………38

2.3.2.2.4 sodA gene………………………………..38

2.3.2.2.5 nuc gene…………………………………39

2.4 Detection of Methicillin resistance in staphylococci ……………………..40

2.4.1 Phenotypic identification………………………………………40

2.4.1.1 Oxacillin salt agar……………………………………41

2.4.1.2 Oxacillin minimum inhibitory concentration by broth

microdilution…………………………………………………42

2.4.1.3 Oxacillin disk diffusion………………………………43

2.4.1.4 Cefoxitin disk diffusion……………………………...44

2.4.1.5 β-lactamase production………………………………46

2.4.1.6 PBP2a latex agglutination test……………………….47

2.4.2 mecA PCR……………………………………………………...47

2.5 Superficial bacterial folliculitis in dogs………………………………….49

2.6 Mucous membrane staphylococcal colonization of dogs and cats………50

2.7 Zoonosis and reverse zoonosis…………………………………………...51

2.7.1 S. pseudintermedius……………………………………………...51

2.7.2 S. aureus………………………………………………………..53

Chapter 3 Evaluation of clinical and laboratory standards institute interpretive criteria for the detection of methicillin resistance in meca-positive staphylococcus pseudintermedius from the skin and ears of dogs……………………………………55

3.1 Abstract…………………………………………………………………..55

3.2 Introduction……………………………………………………………... 56

3.3 Materials and methods………………………………………………….58

3.3.1 Isolate selection criteria…………………………………….....58

3.3.2 Biochemical identification………………………………….. .58

3.3.3 Oxacillin broth microdilution…………………………………59

3.3.4 Oxacillin and cefoxitin Kirby-Bauer disk diffusion…………..59

3.3.5 Interpretation of results……………………………………...... 60

3.3.6 mecA PCR……………………………………………………..60

3.4 Results…………………………………………………………………...61

3.4.1 Isolates………………………………………………………... 61

3.4.2 Oxacillin broth microdilution, oxacillin Kirby Bauer disk

diffusion and cefoxitin disk diffusion results……………...... 62

3.5 Discussion………………………………………………………………. 62

3.6 Sources and manufacturers...... 68

Chapter 4: development of polymerase chain reaction primers for identification of

Staphylococcus aureus, Staphylococcus schleiferi, Staphylococcus intermedius and

Staphylococcus pseudintermedius………………………………………………………..69

4.1 Abstract………………………………………………………………….69

4.2 Introduction……………………………………………………………...70

4.3 Materials and methods…………………………………………………...72

4.3.1 Type cultures and control isolates…………………………….. 72

4.3.2 Primers and expected product sizes……………………………74

4.3.2.1 Target gene selection………………………………...74

4.3.2.2 Primer selection……………………………………...74

4.3.2.3 Primer preparation…………………………………...75

4.3.2.4 Primers used in pilot studies…………………………76

4.3.2.5 DNA extraction………………………………………79

4.3.2.6 PCR conditions………………………………………79

4.3.2.7 Gel electrophoresis…………………………………...79

4.4 Results of pilot studies…………………………………………………...80

4.4.1 hsp60 primers……………………………………… ………….80

4.4.2 sodA primers…………………………………………………...81

4.4.3 femA primers………………………………………………….. 82

4.4.4 nuc primer……………………………………………………...83

4.5 Discussion………………………………………………………………..83

4.6 Conclusion……………………………………………………………….87

xii

Chapter 5: Polymerase chain reaction and biochemical identification of

Staphylococcus aureus, Staphylococcus schleiferi, staphylococcus intermedius, andStaphylococcus pseudintermedius from the skin and mucous membranes of dogs………………………………………………………………………………….95

5.1 Abstract …………………………………………………………………95

5.2 Introduction……………………………………………………………...96

5.3 Materials and Methods…………………………………………………..98

5.3.1 Isolates origin and previous identification methods…………..98

5.3. 1. 1 S. (pseud)intermedius isolates……………………...98

5.3.1.2 S.(pseud)intermedius selection criteria………………98

5.3.1.3 S. schleiferi isolates…………………………………..98

5.3.1.4 S. schleiferi selection criteria………………………...98

5.3.1.5 S. aureus isolates……………………………………..99

5.3.1.6 S. aureus selection criteria…………………………...99

5.3.1.7 S. aureus and S. schleiferi biochemical

identification………………………………………………..100

5.3.2 Biochemical identification…………………………………....100

5.3.2.1 VITEK2 biochemical identification………………...101

5.3.2.2 Supplemental biochemical identification…………...101

xiii

5.3.3 Type cultures and controls……………………………………102

5.3.4 Primers and expected product sizes…………………………..102

5.3.5 DNA extraction……………………………………………….105

5.3.6 PCR conditions……………………………………………….105

5.3.7 Gel Electrophoresis…………………………………………...106

5.4 Results…………………………………………………………………..106

5.4.1 Isolates………………………………………………………..106

5.4.2 VITEK2 Identification of Isolates……………………………107

5.4.2.1 VITEK2 Results: S.(pseud) intermedius identified

previously via API ID 32 STAPH…………………………107

5.4.2.2 VITEK2 results for previously identified

S. schleiferi ………………………………………………………109

5.4.2.3 VITEK2 Results for previously identified

S. aureus………………………………………………………….111

5.4.3 PCR Identification of isolates………………………………..113

5.4.3.1 PCR Identification of S. pseudintermedius isolates..113

5.4.3.2 PCR Identification of S. schleiferi isolates…………116

5.4.3.3 PCR Identification of S. aureus isolates……………118

5.4.3.4 PCR Identification of ODH identified S. chromogenes

isolates……………………………………………………..120

xiv

5.4.3.3.1 Biochemical characteristics of ODH identified

S. chromogenes isolates……………………………120

5.4.3.3.2 Results of PCR Identification of ODH

identified S. chromogenes isolates…………………121

5.4.3.3.3 PCR Identification of type strain isolates...122

5.5 Discussion………………………………………………………………122

5.6 Conclusion……………………………………………………………...128

5.7 Sources and Manufacturers…………………………………………….129

Chapter 6: Conclusions…..………………………………………………………... 130

References…………………………………………………………………………. 134

Appendix… ………………………………………………………………………...150

List of Tables

Table 1: Phenotypic characteristics of S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius………………………………………………………………………23

Table 2: Phenotypic characteristics of S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius……………………………………………………………………..24

Table 3: Differential characteristics of S. aureus, S. schleiferi subsp. coagulans and schleiferi, S. intermedius, and S. pseudintermedius………………………………….25

Table 4: Phenotypic characteristics of S. intermedius, and S. pseudintermedius API

ID 32 STAPH………………………………………………………………………...28

Table 5: Phenotypic characteristics of S. intermedius, and S. pseudintermedius, stand-alone tests……………………………………………………………………...29

Table 6: Phenotypic characteristics of S. intermedius, and S. pseudintermedius, stand- alone tests……….……………………………………………………………………30

xvi

Table 7: Current (2008) and previous (2004) Clinical and Laboratory Standards

Institute (CLSI) interpretive criteria for veterinary coagulase-positive staphylococci for oxacillin broth microdilution, oxacillin disk diffusion, and the 2008 cefoxitin disk diffusion interpretive criteria for coagulase-negative staphylococci (CNS) and

Staphylococcus aureus……………………………………………………………….65

Table 8: Current (2008) and previous (2004) CLSI interpretive criteria results in canine mecA PCR positive S. pseudintermedius………………………...... 66

Table 9: Current (2008) and previous (2004) CLSI interpretive criteria results in canine mecA PCR positive S. pseudintermedius………………………...... 67

Table 10: hsp60 primer sets utilized for pilot studies with expected amplicon size…76

Table 11: sodA primer sets utilized for pilot studies with expected amplicon size…………………………………………………………………………………...77

Table 12: femA primer sets utilized for pilot studies with expected amplicon size…………………………………………………………………………………...78

Table 13: nuc primer set utilized for pilot studies with expected amplicon size…………………………………………………………………………………...78

Table 14 Results for hsp60 pilot study primers……………………………………..89

Table 15 Results for sodA pilot study primers..……………………………………90

Table 16 Results for femA pilot study primers………………………………………91

xvii

Table 17 Results for nuc pilot study primer for S. pseudintermedius……………….91

Table 18 sodA and nuc primer sets selected for identification of S. aureus, S. schleiferi, and S. intermedius/pseudintermedius with expected amplicon size……...92

Table 19: Differential characteristics of S. aureus, S. schleiferi subsp. coagulans and schleiferi, S. intermedius, S. pseudintermedius, and S. chromogenes……………...102

Table 20: sodA and nuc primer sets selected for identification of S. aureus, S. schleiferi, and S. intermedius/pseudintermedius with expected amplicon size…….104

Table 21: VITEK2 Identification of canine-origin isolates previously identified via

API ID 32 STAPH as S.(pseud) intermedius with supplemental slide agglutination and Voges-Proskauer tests…………………………………………………………108

Table 22: VITEK2 identification and supplemental test results of previously identified canine- origin S. schleiferi…………………………………...110

Table 23: VITEK2 identification and supplemental biochemical test results of previously identified canine- origin S. aureus ……………………………………..113

Table 24: PCR results for ODH confirmed canine-origin S. pseudintermedius utilizing sodA and nuc primers……………………………………………………..115

Table 25: Sensitivity and specificity of sodA S. intermedius primers; first run results for ODH-confirmed S. pseudintermedius, S. schleiferi, and S. aureus……..116

xviii

Table 26: Sensitivity and specificity of sodA S. intermedius primers; second run results for ODH-confirmed S. aureus included…………………………………….116

Table 27: Sensitivity and specificity of nuc S. pseudintermedius primers; first run results for ODH-confirmed S. pseudintermedius, S. schleiferi, and S. aureus……..116

Table 28: Sensitivity and specificity of nuc S. pseudintermedius primers; sensitivity for second run results of S. pseudintermedius included………………..117

Table 29: PCR Results for ODH confirmed canine-origin S. schleiferi utilizing sodA and nuc primers…...………………………………………………………………...118

Table 30: Sensitivity and specificity of novel PCR for sodA S. schleiferi primers; first run results for S. pseudintermedius, S. schleiferi, and S. aureus………………...…118

Table 31: Sensitivity and specificity of novel PCR for sodA S. schleiferi primers; specificity for second run results of S. aureus included……………………………118

Table 32: PCR Results for ODA confirmed canine-origin S. aureus utilizing sodA and nuc primers…………………………………………….…………………...... 119

Table 33: Sensitivity and specificity of novel PCR for ODH confirmed canine-origin S. aureus utilizing sodA S. aureus primers…………………………120

Table 34: Sensitivity and specificity of novel PCR for ODH confirmed canine- origin S. aureus utilizing sodA S. auresu primers; specificity for second run results for

S. aureus included…………………………………………………………………120

xix

Table 35: PCR Results for isolates identified by ODH as S. chromogenes utilizing utilizing sodA and nuc primers……………………………………………………..121

Table 36: Differential characteristics of, S. schleiferi subsp. coagulans. S. schleiferi subsp. schleiferi, and S. chromogenes……………………………………………..128

Chapter 1: Introduction

Staphylococcus is a genus comprised of highly effective cutaneous and mucosal commensals of mammals, birds and reptiles worldwide. Staphylococci are opportunistic pathogens, capable of high morbidity and potential mortality of humans and both companion and production animals.

Otitis and pyoderma are common diagnoses 1in canine veterinary practice.1

Staphylococcus pseudintermedius, previously identified as Staphylococcus intermedius,2-4 is the most common etiologic agent in canine pyoderma5 and an agent commonly involved in canine otitis. S. pseudintermedius was established as a species in 2005 based upon isolate descriptions of the cat, horse, dog, and parrot.3 This species, rather than S. intermedius, was subsequently determined via gene sequencing to be the primary agent of canine pyoderma.4S. intermedius was determined to consist of three species, forming the Staphylococcus intermedius group (SIG): S. intermedius, S. pseudintermedius, and S. delphini.44 S. schleiferi subsp. schleiferi, S. schleiferi subsp. coagulans and S. aureus are isolated at a lesser frequency from superficial bacterial folliculitis and otitis of dogs 6-10,11

Methicillin-resistant S. pseudintermedius (MRSP), 12-17S. schleiferi (MRSS),7,

13, 18 and S. aureus (MRSA)6, 11 have been reported as a primary pathogen in canine

1 infections. Recognition of methicillin resistance in the canine is of practical significance, as cephalosporins are the most commonly prescribed antimicrobial for the treatment of canine superficial bacterial folliculitis,19 and by definition, methicillin resistant staphylococci are regarded to be resistant to all β-lactam antibiotics in vivo.20

Accurate detection of methicillin resistance is essential to appropriate selection of antimicrobials for treatment of canine infections. Furthermore, the recognition of methicillin resistance in domestic animals has become essential as zoonosis,21, 22,23, 24,25 and nosocomial transmission26 of canine and feline origin staphylococci have been documented. MRSA is of particular concern, as S. aureus is a very capable pathogen of humans. Cases of human MRSA associated with household pet and horse contact have been documented, but the direction of transmission remains unproven.27, 28 However, there is compelling evidence that

MRSA may have been introduced to domestic animal populations as a result of transmission from humans; clonal strains associated with human infections have been documented in dogs, cats, and horses.23

Species identification of staphylococci is essential for epidemiological study of S. pseudintermedius, S. schleiferi and S. aureus, and to assess risk of zoonotic transmission, primarily via identification of S. aureus. Detection of methicillin resistance is critical for informed patient care, including implementation of hospitalization procedures to minimize contamination and risk of nosocomial disease and zoonosis of these difficult to treat pathogens. Currently, species identification of

2 staphylococci is commonly performed via biochemical testing methods. These technologies rely upon recognition and interpretation of color changes, which is subject to human error. Additionally, some commercial systems do not identify S. pseudintermedius or S. schleiferi.

The gold standard for bacterial identification is 16sRNA sequencing. PCR is an attractive option for species identification of staphylococcal isolates because it carries the potential for high sensitivity, it is rapid, and more labor and cost effective than16srRNA sequencing. It may be more rapid than biochemical testing, and more accurate. PCR, gives a clear positive or negative result, eliminating subjectivity present in biochemical testing. At present, no rapid, molecular diagnostic has been developed for veterinary laboratory use. Phenotypic recognition is still essential for the identification of S. aureus as well as S. schleiferi and S. pseudintermedius

PCR of the mecA gene is the gold standard for detection of methicillin resistance.29 Biochemical testing, including oxacillin Kirby- Bauer disk diffusion and oxacillin broth microdilution are the methods most commonly used for detection of methicillin resistance. Interpretation of these methods requires use of breakpoint guidelines instituted by the Clinical Laboratory Standards Institute (CLSI)

Development of a PCR to identify S. pseudintermedius, S. aureus, and S. schleiferi as well as determine the presence of methicillin resistance would provide rapid and accurate results and avoid subjective interpretations common with biochemical testing techniques. However, because biochemical methods such as

Kirby-Bauer disk diffusion and/or broth microdilution techniques are necessary to

3 determine susceptibility to non β-lactam antimicrobials, these laboratory techniques are likely to remain in common use in veterinary diagnostic laboratories. Therefore, assessment of current CLSI guidelines for detection of methicillin resistance is warranted, as there have been significant changes from the criteria recommended for use in 2004 to the 2008 established guidelines.29

Chapter 2: Literature Review

2.1 The genus Staphylococcus

2.1.1 Taxonomy

Staphylococcus is a member of the Staphylococcaceae family, comprised also of the genera Gemella, Jeotgalicoccus, Macrococcus, Nosocomiicoccus, and

Salinicoccus. The taxonomic designation of the Staphylococcus genus has been reorganized on several occasions, including historical placement in the family

Micrococcaceae and more recently, Bacillaceae.30The genus Staphylococcus includes

41 species and 24 subspecies (www.bacterio.cict.fr): S. arlettae, S. aureus subsp. aureus, S. aureus subsp. anaerobius, S. auricularis, S. capitis subsp. capitis, S. capitis subsp. urealyticus, S. caprae, S. carnosus subsp. carnosus, S. carnosis subsp. utilis, S. caseolyticus, S. chromogenes, S. cohnii subsp. cohnii, S. cohnii subsp. urealyticus, S. condimenti, S. delphini, S. epidermidis, S. equorum subsp. equorum, S. equorum subsp. linens, S. felis, S. fleuretti, S. gallinarum, S. haemolyticus, S. hominis subsp. hominis, S. hominis subsp. novobiosepticus, S. hyicus subsp. chromogenes, S. hyicus subsp. hyicus , S. intermedius, S. kloosii, S. lentus, S. lugdenensis, S. lutrae, S. muscae, S. nepalensis, S. pasteuri, S. pettenkoferi, S. piscifermentans, S. pseudintermedius, S. pulvereri, S. saccharolyticus, S. saprophyticus subsp. bovis, S.

5 saprophyticus subsp. saprophyticus, S. schleiferi subsp. coagulans, S. schleiferi subsp. schleiferi, S. sciuri subsp. carnaticus, S. sciuri subsp. lentus, S. sciuri subsp. rodentium, S. sciuri subsp. sciuri, S. simiae, S. simulans, S. succinus subsp. casei, S. succinus subsp. succinus, S. vitulinus, S. warneri, and S. xylosus.

Of note, canine origin S. intermedius was recently reclassified as S. pseudintermedius, a novel species recognized in 2005. 43,2

2.1.2 Staphylococci of veterinary interest

Staphylococcal pathogens of animals include S. aureus, S. pseudintermedius,

S. schleiferi, S. delphini, S. epidermidis, S. hyicus, S. sciuri, and S. simulans. S. simulans, S. epidermidis, S. chromogenes and S. aureus are most frequently associated with mastitis in ruminants. S. hyicus is the agent of porcine exudative dermatitis. S. delphini has been isolated from skin lesions in the horse, mink, cow, dolphin, and pigeons. 31,4

2.1.2.1 S. intermedius and S. pseudintermedius

S. intermedius was described in 1976 by Hajek with a reported host distribution of dogs, pigeons, mink, and horses. S. intermedius was reported to be phenotypically variable with characteristics related to host species of origin.32 It was subsequently discovered that vast genetic diversity within S. intermedius was present,33 with isolates from the same host origin belonging to an identical ribotype cluster.34 The type strain ATCC 29663 is of pigeon origin. The species S.

6 pseudintermedius was established in 2005 via cat, dog, horse and parrot isolate description, the type strain LMG 22221 is of cat origin.3 Sequencing of 16srRNA placed S. pseudintermedius in close relation to S. delphini and S. intermedius. 3

Sequencing of the hsp60 and sodA genes further determined that previously described

S. intermedius was comprised of three genetically distinct species known as the S. intermedius group (SIG): S. intermedius, S. pseudintermedius, and S. delphini.4

S. pseudintermedius has taken the place of historically recognized S. intermedius as the primary pathogen of canine pyoderma 4, 11, 35, 36 and the most prevalent bacterial pathogen of canine otitis.6 This reclassification was independently confirmed by Sasaki and Bannoehr via gene sequencing of canine isolates.

Sequencing of the hsp60 and sodA gene of 78 canine pyoderma isolates was performed by Sasaki,4 and multilocus gene sequencing (pta, tuf, agrD, hsp60, and

16srRNA) of 89 canine isolates was performed by Bannoehr.35 S. pseudintermedius is host adapted to the dog and may have coevolved with the dog over 50 million years ago. 36 ,37,33 There are greater than 60 identified strains; some with worldwide clonal distribution.36

S. intermedius is a commensal and is the most frequently isolated staphylococcal organism from the mucous membranes of both healthy dogs and cats, and also those with inflammatory skin disease.38,39 Not only is it commonly associated with pyoderma and otitis of dogs and cats, but it also an opportunist causing post-surgical and secondary infection of many tissues.13, 40 It has also been shown that the frequency of recovery of S. (pseud)intermedius was significantly

7 higher from the carriage sites of dogs with inflammatory skin disease (n=59) than the carriage sites of healthy dogs (n=50); specifically the nares (p= 0.003) and inguinal region (p= 0.04). 38

At present S. intermedius is not considered to be a pathogen. Rather it is a commensal of the nares, with host range documentation limited to pigeons, as established by hsp60 and sodA gene sequencing of 11 total domestic and wild pigeon isolates.4

In light of these discoveries, it has been proposed that canine pyoderma isolates phenotypically identified as S. intermedius should be recognized as S. pseudintermedius unless proven otherwise by means of gene sequencing.2 Historical descriptions of canine S. intermedius isolates, particularly those of canine pyoderma origin, are henceforth reported in this document as S. (pseud)intermedius as proposed by Weese.41

The third 42member of the SIG, S. delphini,35 has been isolated from cows, mink, pigeons, dolphins, and horse pyoderma lesions.4, 35 The prevalence and clinical significance of this pathogen remains presently elusive, as it may have been historically misidentified as S. intermedius due to phenotypic similarities.4,35,3,42

2.1.2.2. S. aureus

S. aureus is a remarkably successful organism, with a worldwide geographic presence and broad species distribution, colonizing and infecting mammals, reptiles, and birds43 31with the potential for epidemic and opportunistic infection of multiple

8 organs. This phenomenon is explained in part by abundant genetic diversity.

Differential expression and acquisition of virulence factors impart host and tissue- specific adaptations.44

S. aureus is capable of economically devastating and difficult to eradicate syndromes of food-producing animals. Chronic bovine mastitis, is a host-specific44 and geographically wide spread infection.31 Culling is often necessary as control with antimicrobial treatments and sanitation efforts alone are not effective. S. aureus is a pathogen of boiler chickens, producing septicemia, abscesses, osteomyelitis, and necrotic chondritis.31,45 Pneumonia and osteomyelitis S. aureus syndrome has also been documented in production turkeys.46 Rabbit production facilities may also be afflicted; S. aureus pododermatitis, abscesses, and mastitis epidemics require culling for control. 47

S. aureus is a pathogen of canine pyoderma and canine otitis, although with a lower prevalence than S. (pseud)intermedius 6, 10, 11 S. aureus has been isolated from the skin and mucous membranes of healthy canine and feline patients as well as those with skin and otic disease.10, 38-40. There is a higher prevalence of S. aureus cutaneous isolation from cats39 relative to dogs,38 but S. (pseud)intermedius remains the most prevalent. Post-operative opportunistic and nosocomial infections in dogs are well documented, particularly methicillin resistant strains.48,49,50

2.1.2.3 S. schleiferi subsp. schleiferi and S. schleiferi subsp. coagulans

Reports of infection and colonization of S. schleiferi in veterinary medicine appears to be limited to the dog and cat. Reports of infection are limited to otitis and pyoderma. Because coagulase-negative staphylococci are often not identified at the species level, it is possible that the incidence and prevalence of S. schleiferi subsp. schleiferi may be underreported, as it is a coagulase-negative species. Additionally historically low identification and prevalence reporting of S. schleiferi subsp. coagulans in veterinary and human populations was likely influenced by misidentification due to the phenotypic similarity to S. aureus and

S.(pseud)intermedius. 51,52,53

S. schleiferi subsp. schleiferi and coagulans are occasionally isolated from superficial bacterial folliculitis of dogs 6-10 with one report of S. schleiferi subsp. schleiferi isolated from a cat with inflammatory skin disease.39 S. schleiferi subsp. coagulans was originally isolated and characterized from 21 canine otitis externa isolates54 and is an occasional pathogen of canine otitis, with a lesser prevalence than

S. (pseud)intermedius.55

2.2 Methicillin resistance in veterinary medicine

2.2.1 Methicillin- resistant S. pseudintermedius

The increasing prevalence of methicillin-resistant S. (pseud)intermedius

(MRSP) in veterinary medicine has impacted management and treatment of canine infection, particularly in canine bacterial folliculitis. In the past, S.

(pseud)intermedius was considered to be susceptible to β-lactamase antimicrobials and methicillin resistance S. (pseud)intermedius was seldom reported. In 1986,

Medleau investigated 197 S. (pseud) intermedius canine pyoderma isolates, and in

2001 Shimizu investigated of 90 clinical canine S. (pseud)intermedius isolates; neither reported methicillin resistance.56, 57. A 2004 van Diujkeren investigation yielded no report of methicillin resistance in 100 S. (pseud)intermedius canine (n=88) and feline (n=12) clinical isolates assessed via OSA screen.58 Pinchbeck reported only one isolate of MRSP from 203 isolates (originating from 40 dogs) of canine pyoderma lesions and mucosal staphylococcal carriage sites in 2006.10 However, incidence and prevalence of canine MRSP appears to have been geographically variable in the past, as incidences as high as 60% (91 canine dermatitis isolates) were reported in Spain as early as 1995.59 Since 1995, there have been multiple reports of veterinary MRSP in North America,38, 39,14, 50, 60, 61,13,62 Asia,63,64,57and Europe. 13, 16,

17, 21, 22, 38, 39, 50, 57, 60-64

A comprehensive study reported the prevalence of MRSP isolation in over

16,000 veterinary isolates obtained in Germany in 2007. The overall prevalence was

0.45% in this population. The prevalence in small animals was 0.80% in dogs

(61/7490), 0.1% in cats (6/3903), and in equidae was 0.10% (n=5; horses n=4,

67 donkey n=1). A study by Oliveria surveying resistance of S. (pseud)intermedius isolates from canine otitis externa, methicillin resistance was not present in 70 isolates obtained in Brazil from the year 2003.6 A recent study by Bemis investigated the prevalence of canine MRSP from 2001 to 2007 in clinical isolates from the

University of Tennessee Veterinary Teaching Hospital.15 There was a remarkable increase in frequency of methicillin resistance in submitted canine-origin S. pseudintermedius clinical isolates in a six year period from just under 5% in 2001

(136 canine isolates) to 30% (404 isolates) in 2007.14 Extensive antimicrobial history was not obtained in the Bemis and Ruscher studies and was not possible in the

Oliviera study, in which isolates were obtained from stray dogs.

Appropriate interpretation of prevalence studies requires examination of the populations assessed. Antimicrobial use in populations and individuals, frequency of hospital visits, and invasive procedures have been proven to increase risk of methicillin-resistant S. aureus (MRSA) in human populations. However, these risk factors have not yet been well evaluated in canine populations. The use of fluoroquinolones has been directly linked in human patients to increased risk of

MRSA.68Antimicrobial availability and national restrictions of veterinary antimicrobial use directly influence these pressures and may account for national and geographic differences in prevalence. In the United States, cephalosporins are most frequently prescribed for the treatment of canine superficial bacterial folliculitis.19

Therefore, its commonplace use may be increasing population selection pressure for methcillin resistance. Ruscher’s reported prevalence of MRSP isolated from dogs

(0.8%) in Germany was based upon isolates submitted in large part from primary care facilities, whereas Bemis assessed clinical isolates from patients visiting a university referral practice where the prevalence of MRSP was 30%. The latter study may have been biased towards patients with chronic or frequent hospital visits and antimicrobial

12 treatment, possibly increasing exposure to MRSP and selection for MRSP. Clinical isolates are likely to have a higher prevalence of methicillin resistance than isolates obtained by random surveillance of pyoderma lesions, as in practical situations, culture is performed when resistance is suspected. To the author’s knowledge, there are no published prospective reports assessing prevalence of MRSP in canine pyoderma lesions via active surveillance.

To assess the prevalence of carriage/colonization of methicillin resistant staphylococci in the canine and feline population, including healthy patients, dogs and cats have been screened at cutaneous and mucosal sites to assess for colonization.38, 39 In a study by Griffeth, 50 healthy dogs and 59 dogs with inflammatory skin disease were screened by obtaining samples from the anus, nares, buccal mucosa, dorsal head and inguinal area to determine the prevalence of MRSP at these carriage sites. S. (pseud)intermedius was isolated from the carriage sites of

92% of healthy dogs and 92% of dogs with inflammatory skin disease. Only 3% (one dog) of healthy dogs were culture positive for methicillin-resistant S.

(pseud)intermedius, compared to the 8% (four) of the dogs with inflammatory skin disease. When cats were similarly assessed by Abraham, 23% of the cats with inflammatory skin disease (11 of 48) were culture-positive for S.(pseud)intermedius at their carriage sites, and 22% (11 of 50) of healthy cats were culture-positive for

S.(pseud)intermedius at their carriage sites. There were no incidences of MRSP in cats with inflammatory skin disease, and two incidences of MRSP in healthy cats.39

These studies indicate that MRSP is present in healthy dog and cat populations. The presence of methicillin-resistance in populations may be a result of population selection for methicillin resistance. Of note, the studies by Griffeth and

Abraham did not assess previous antimicrobial use in detail for either their healthy subjects or those with inflammatory skin disease. Infections with MRSP appear to be higher in referral populations as the results of Bemis14 are compared with Ruscher15 who studied also primary care facilities. Lastly, geographic differences may exist as a result of prescribing practices and regulations, and population antimicrobial pressures.

2.2.2 Methicillin- resistant S. aureus

Methicillin resistance in S. aureus is particularly alarming as S. aureus is more host adapted to the human in comparison to S. pseudintermedius and S. schleiferi.

Although S. pseudintermedius and S. schleiferi are reported to cause human infections,69,52,70 the relative incidence is much lower in comparison to S. aureus. S. aureus, is a frequent and potentially fatal pathogen of immunocompromised and hospitalized humans. Zoonosis and reverse zoonosis have been documented with regard to cats, dogs, and horses.21, 23, 24, 49, 71The potentially zoonotic and well-adapted human pathogen, S. aureus is fortunately a less common pathogen in canine cutaneous and otic infections. 6, 10, 11

It has been proposed that methicillin resistant S. aureus (MRSA) is present in the pet population as a result of contact with colonized and infected humans.40,41 This

14 has been substantiated not just by documented instances of reverse zoonosis, but

Morris has noted that the SCC mec type II cassette element is well represented in

MRSA derived from cats; this SCC mec type is most commonly associated with nosocomial MRSA in humans.40 Furthermore, spa typing, pulse-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) of MRSA has revealed similarities between human, regionally predominant human strains and strains found in dogs and cats, with particular mention to EMRSA-15, MRSA-2

(Canada), ST22 MRSA (Germany).23,49,72,73,74 75

MRSA colonization of both healthy and inflamed skin of dogs and cats has been assessed by Griffeth and Abraham.39, 76 The nares, anus, buccal mucosa, inguinal skin and dorsal head skin were cultured for screening. With regard to healthy dogs, it was found that 10% (5 of 50) were colonized with S. aureus, and all isolates were susceptible to methicillin. Of dogs afflicted with inflammatory skin disease 8% (5/59) were culture positive for S. aureus at the aforementioned sites, and only one isolate was methicillin resistant.38 For cats with inflammatory skin disease

29% (14 of 48) were culture-positive for S. aureus at their carriage sites, and of those, only one cat yielded MRSA. In 50 healthy cats, 20% (10/50) were culture positive for

S. aureus at their carriage sites, and of those two cats yielded MRSA (4%). It was found that significantly more S. aureus isolates were recovered from carriage sites of cats with inflammatory skin disease (44) than the carriage sites of healthy cats (17) (P

< 0.001).39

These studies indicate that MRSA is present in healthy cat populations, with a higher prevalence of colonization in cats than dogs. Furthermore, mucosal carriage sites are infrequently colonized with S. aureus, let alone MRSA, in dogs in agreement with Pinchbeck.10 Of note, extensive history of the study subjects was not assessed so no conclusions can be drawn about the potential influences of previous antimicrobial exposure or contact with humans or animals frequenting hospital environments.

Colonization with MRSA appears to be transient when the animal is no longer exposed to an infected animal or human point source24 with one exception of a persistently nasal colonized kitten who maintained colonization for 9 months.23

Therefore, it is proposed that S. aureus is not a successful commensal in dogs and cats.24,41,77 Although nasal and anal mucosal decolonization attempts have been documented using topical vancomycin ointment, as is performed in humans,28 the necessity of active decolonization of household colonized pets remains controversial, as some suggest that it is not necessary once exposure to an infection source eliminated.41

MRSA infection of horses has been well documented and can cause a wide variety of opportunistic infections, including post-surgical infections, pneumonia, mastitis, metritis, sepsis, implant infection, and osteomyelitis.72, 78, 79

The rate of colonization of horses with MRSA appears to be geographically variable. MRSA colonization prevalence has been studied in community horses and horses at the time of admission to veterinary hospitals in several nations, with rates ranging from 0-10.9%. 41,71 There has been one report of a farm with a 43%

16 colonization rate.71, 80 This level of colonization suggests that S. aureus is possibly better host adapted to the horse than the dog or the cat. Similar to dog populations, human-type MRSA has been documented in infected horses, with mention of MRSA-

5 (Canadian) and USA500 classified by PFGE.23, 71 However, related strains have been recognized (ST8, ST254) that appear to be horse-adapted as they are not well represented in the human population. 73,81, 82ST398 has also been documented, and is significant as it is a major clone in food-producing animals suggesting that it has been introduced from these populations. 83

Unlike the dog and cat, risk factors have been assessed for MRSA colonization in horses. Aminoglycoside or ceftiofur administration has been associated with hospital-acquired MRSA, as well as previous colonization, colonized horses present on the farm of origin, antimicrobial administration within 30 days prior to presentation, and admission to a neonatal intensive care unit.84, 85 It has also been suggested that colonization is transient if the patient is removed from potential sources of infection.80

2.2.3 Methicillin- resistant S. schleiferi

Isolates of S. schleiferi from cases of pyoderma and otitis, and colonization isolates of dogs and cats have a relatively high documented prevalence of methicillin resistance (30-100%).7,13,1838,39Also unique to S. schleiferi, recognition of this species in dogs and cats is relatively recent, with the first reports in 2003 by Frank in the context of pyoderma; thus unlike S. (pseud)intermedius, there was no previously

17 published documentation of wide-scale methicillin susceptibility. For example, a retrospective investigation of canine clinical isolates by Jones determined that between the years 2001 and 2005, the prevalence of methicillin resistance in S. schleiferi remained between 40 and 55% with no increase over time; whereas for S.

(pseud)intermedius, prevalence of methicillin resistance rose from 2% to 16% over the same time period.18

Colonization with methicillin-resistant S. schleiferi (MRSS) in both healthy and inflamed skin dogs and cats has been assessed by Griffeth and Abraham.39, 76

The nares, anus, buccal mucosa, inguinal skin and dorsal head skin were cultured for screening. With regard to dogs with inflammatory skin disease, it was found that

10% (6 of 59) were colonized with S. schleiferi subsp. coagulans, and one of the 6 dogs was colonized with MRSS subsp. coagulans. Of healthy dogs, 2% (4/50) were culture positive for S. schleiferi subsp. coagulans at the aforementioned sites, and one of the two (50%) were methicillin resistant. Recovery of S. schleiferi from carriage sites of dogs with inflammatory skin disease was significantly greater than from carriage sites of healthy dogs (P = 0.04).38. In cats with inflammatory skin disease 2%

(1 of 48) were culture-positive for S. schleiferi subsp. schleiferi at carriage sites, and it was methicillin-resistant. Of 50 healthy cats, 2% (1/50) were culture positive for S. schleiferi subsp. coagulans from carriage sites, and it was not methicillin-resistant. 39

These studies indicate that MRSS can be isolated at a low frequency (2%) from carriage sites of healthy dogs and cats with a high prevalence (50-100%) of methicillin resistance.

Risk factors for methicillin-resistant S. schleiferi (MRSS) have not been explored specifically. However, Frank documented 15 dogs with S. schleiferi to have had recurrent bouts of pyoderma, and did not find S. schleiferi in dogs with first-time pyoderma.7 100% of the S. schleiferi subsp. schleiferi isolates were methicillin resistant (n=9) and 33% of the S. schleiferi subsp. coagulans were methicillin resistant. 7 An extensive antimicrobial history regarding type and duration of previously used antimicrobials has not been obtained for any of the aforementioned studies; therefore associations between MRSS and specific antimicrobial use are presently unknown.

There are no known cases of zoonotic or reverse zoonotic infections of S. schleiferi.

2.3 Identification of Staphylococcus species

2.3.1 Phenotypic Identification

2.3.1.1 Morphology

Staphylococcus members occur in clusters, pairs, tetrads and short, chains.

They are gram-positive, non-motile, non-spore forming, unencapsulated and catalase positive. Most are facultative anaerobes.30 Colonies are typically 3-8mm in diameter after 72 hours of incubation on blood agar, trypic soy agar or brain heart infusion agar. Colonies are typically opaque, smooth and entire, with species variable pigmentation. Hemolysis is also species variable.30

S. pseudintermedius colonies are hemolytic, non-pigmented, translucent, smooth, and slightly convex. They are 5-8 mm in diameter after 72 hours of incubation. S. aureus colonies are hemolytic, cream to yellow-orange in color, smooth, and raised. They are 6-8 mm in diameter after 72 hours of incubation. S. schleiferi colonies are hemolytic, non-pigmented, smooth, glossy and slightly convex.

They are 3-5 mm in diameter after 72 hours of incubation. 30

2.3.1.2 Gram stain

All members of Staphylococcus are gram positive. This differential stain requires sequential application of crystal violet (primary stain), iodine (mordant),

95% ethyl alcohol and acetone in equal parts (decolorizer), and safranin

(counterstain) to a slide with a thin application of bacteria. The crystal violet binds to the cell with the aid of iodine. Gram positive species possess a thick peptidoglycan layer and low lipid content, retaining the crystal violet in the presence of decolorizer.

Gram positive species thus stain violet. Due to high lipid content of the cell wall, gram negative species do not retain crystal violet in the presence of decolorizer. Gram negative species stain only with safranin, applied after the decolorization process, such that the gram negative bacteria are stained red. 86

2.3.1.3 Coagulase activity

Coagulase positive staphylococci are historically considered to be of clinical importance. Coagulase is thought to provide the bacteria with a fibrin coating to

20 evade opsonization and phagocytosis. Coagulase may be detected via slide test or tube coagulase test. The slide test detects bound coagulase, also termed ―clumping factor‖. A drop of rabbit plasma is mixed with a drop of emulsified bacteria.

Clumping occurs in the presence of coagulase-positive species. The tube coagulase test detects bound and free coagulase. Rabbit plasma (0.5 ml) is placed in a sterile tube, inoculated with bacteria, incubated at 35C for 4 hours and observed for clot formation.86

2.3.1.4 Catalase activity

All members of Staphylococcus are catalase positive. Catalase may be used to neutralize hydrogen peroxide and free radicals liberated from the myeloperoxidase system of phagocytic cells. The catalase test is used to differentiate staphylococci from other aerobic, gram positive cocci. Hydrogen peroxide (3%) is added to a test colony on a slide or added to colonies in situ on an agar slant. Bubbling indicates a positive result.86

2.3.1.5 Biochemical tests

Biochemical tests to identify clinically significant staphylococci include expression of coagulase, alkaline phosphatase, arginine arylamidase, pyrrolidonyl arylamidase, ornithine decarboxylase, urease, beta glucosidase, beta glucuronidase, and beta galactosidase. Arginine utilization, acetoin production, nitrate reduction, esculin hydrolysis, novobiocin resistance, and polymyxin B resistance are evaluated

21 as well as fermentation of the following sugars: trehalose, mannitol, mannose, turanose, xylose, cellobiose, arabinose, maltose, lactose, fructose, sucrose, N- acetylglucosamine, ribose, and raffinose.30, 86

2.3.1.6.1 Expected results for S. pseudintermedius, S. intermedius, S. schleiferi, S. aureus

Expected biochemical test results for S. pseudintermedius, S. intermedius, S. schleiferi, and S. aureus are listed in Table 1 and Table 2.

Table 1: Phenotypic characteristics of S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius

Expression

Coagulase Heat Arginine u

ClumpingFactor PolymyxinB r

Alkalinephosphatase Pyrrolidonyl arlamidase Ornithinedecarboxylase Urease Arginine aryla B B B Acetoinproduction Nitratereduction Esculinhydrolysis Novobiocinresistance

- - -

Glucuronidase Galactosidase

Glucosidase

stableNuclease

tilization

midase

esistance

S. aureus + + + + - - d - + - - + + + - - +

S. schleiferi - + + + + - - - - - + + + + - - - subsp. schleiferi S. schleiferi + - + + n n + n n n n + + + n - N subsp. coagulans S. intermedius + d + + + - + - d - + d - + - - -

S.pseudintermediu + - + + + n + n + - + n + + n - N * s

Key: +, positive; -, negative; d, 11-89% of strains positive; n, not determined; *, positive with STAPH-ZYM but negative with API STAPH tests3; +-, 90% or more strains weakly positive

[Type a quote from23 the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.] Table 2: Phenotypic characteristics of S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius

Fermentation

Xylose

Trehalose Mannitol Mannose Turanose Cellobiose Arabinose

------

L Maltose Lactose Sucrose Acetylglucoseamine Raffinose

D D D D D S. aureus + + + + - - - + + + + -

S. schleiferi d - + ------+ - subsp. schleiferi S. schleiferi - d + n - - - - d d n - subsp. coagulans S. intermedius + d + d - - - + d + + - - S.pseudintermediu + + + + - - - + + + + -

Key: +, positive; -, negative; d, 11-89% of strains positive; n, not determined; *, positive with STAPH-ZYM but negative with API STAPH tests3; +-, 90% or more strains weakly positive

24 [Type a quote from the document or the summary

of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.] Of note, S. schleiferi subsp. coagulans differs from subsp. schleiferi by urease production, coagulase production, and absence of clumping factor. Multiple test results for S. schleiferi subsp. coagulans are considered undetermined. The following table highlights key biochemical differences between the species of interest.

Table 3: Differential characteristics of S. aureus, S. schleiferi subsp. coagulans and

schleiferi, S. intermedius, and S. pseudintermedius

Expression of Fermentation of

Coagulase D D D

ClumpingFactor PolymyxinB r

Pyrrolidonyl ar Urease B B B Acetoinproduction Maltose Lactose Sucrose

- - -

Glucuronidase Galactosidase

Trehalose Mannitol Turanose

Glucosidase

esistance

lamidase

S. aureus + + - d + - - + + + + + + + +

S. schleiferi subsp. - + + - - - + + - d - - - - - schleiferi

S. schleiferi subsp. + - n + n n n + n - d n - d d coagulans S. intermedius + d + + d - + - - + d d +- d +

S. + - + + + - + + n + + + + + +

pseudintermedius

Key: +, positive; -, negative; d, 11-89% of strains positive; n, not determined

Phenotypic characteristics of S. intermedius were initially described as variable and related to host species of origin.32 It was later noted that vast genetic diversity within

S. intermedius was present,33 however, isolates from the same host origin belonged to an identical ribotype cluster34 In 2008, S. intermedius of canine origin was reclassified as S. pseudintermedius via sequencing and phylogenetic analysis of the sodA and hsp60 genes, including 48 strains from canine pyoderma lesions 4. It was then established that S. intermedius, as defined by pigeon origin type strain ATCC 29663, is hosted by feral and domestic pigeons, and not dogs.4,31 This distinction supports host co-evolution and clarifies some initial observations regarding diversity within S. intermedius; however, inclusion of S. intermedius into S. pseudintermedius presents a challenge with regard to biochemical discrimination between the species.

Importantly, since the reclassification of canine pyoderma-origin S. intermedius as S. pseudintermedius 4 it has been proposed that canine origin isolates phenotypically identified as S. intermedius should now be considered S. pseudintermedius unless proven otherwise by molecular genotyping techniques.2,31 However, now that S. pseudintermedius designation has subsumed S. intermedius in dogs, S. pseudintermedius biochemical characteristics described in the initial classification schemes and reference texts prior to the reclassification event, and also characteristics described in reference texts, may not represent the true diversity of biochemical characteristics within this newly recognized species. 2,31

In Sasaki et al, an extensive evaluation of biochemical characteristics was performed utilizing the API ID 32 STAPHa system and supplemental stand-alone biochemical tests.4 These results demonstrated both inter and intra-species variability in

S. intermedius and S. pseudintermedius (Table 4,3.2, 3.3). Of note, there were three characteristics that were 100% discriminatory between S. pseudintermedius (n=83) and S. intermedius (n=12): presence of arginine dihydrolase in S. pseudintermedius, fermentation of β-gentiobiose by S. intermedius, and anaerobic fermentation of D- mannitol by S. pseudintermedius (Table 4,3.2). Of note, S. pseudintermedius was initially described and referenced as acetoin positive.3 However, S. intermedius was described as acetoin negative both prior to and after this reclassification.30, 86 A 1992 report cited 99% acetoin negativity in 80 S. intermedius isolates, including 53 of canine origin, using a stand-alone VP test. 87 The method of assessment of acetoin production appears to impact results. In Sasaki et al, 90% of phylogenetically confirmed S. pseudintermedius were acetoin negative with the API ID 32 STAPHa system, and only 33% were negative with a stand-alone VP test. Therefore, contrary to initial descriptions, acetoin production may not be adequate to differentiate between S. intermedius and S. pseudintermedius.

Therefore, absence of acetoin production in a coagulase positive canine staphylococcal isolate is consistent with an identification of S. pseudintermedius, but a positive result cannot discriminate S. pseudintermedius from S. schleiferi or S. aureus as these species are acetoin production positive.53, 88, 89

Table 4: Phenotypic characteristics of S. intermedius, and S. pseudintermedius API ID 32 STAPH 4

Glucuronidase Galactosidase

- -

Arginine arylamidase Arginine phosphatase Alkaline B B hydrolysis Esculin production Acetoin resistance Novobiocin

Arginine dihydrolase Arginine

Production Urease dihydrolase Ornithine arlamidase Pyrrolidonyl reduction Nitrate

)

SP(n=

100 100 0 100 0 99 0 100 0 100 10 0

ive

(n=12)

% % Posit SI 100 0 0 100 0 100 0 100 0 100 0 0

Key: SI, S. intermedius; SP, S.pseudintermedius

[Type a quote from the document or the summary of an interesting point. You can position 28

Table 5: Phenotypic characteristics of S. intermedius, and S. pseudintermedius API ID 32 STAPH 4

Cellbiose

Maltose Mannitol Ribose

acetylglucosamine

Mannose

- -

- - -

Lactose

Fermentation Fructose D Saccharose N Turanose Arabinose

D Trehalose D D

Raffinose

100 100 91 100 100 46 0 100 0 100 10 0 0

% % Positive 100 100 91 73 100 100 0 100 0 100 18 0 0

Key: SI, S. intermedius; SP, S.pseudintermedius

[Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.] [Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull29 quote text box.]

Table 6: Phenotypic characteristics of S. intermedius, and S. pseudintermedius, stand-alone tests 4

% Positive Fermentation/Production

S. intermedius (n=12) S. pseudintermedius (n=83)

100 0 D-Mannitol (anaerobically)

0 92 D-Galactose

0 0 Arbutin

100 0 β-gentiobiose

0 17 D-Turanose

0 66 Acetoin

2.3.1.6.2 Phenotypic testing technologies

Commercial systems for identification of multiple staphylococcal species, including S. aureus, S. intermedius, and S. schleiferi, are available.30 Manual kits and automated biochemical test systems are the most commonly used to identify staphylococci via assessment of key characteristics of fermentation, enzyme expression, and susceptibility to select antimicrobials. Manual kits for species identification, such as the API ID 32 STAPH, a rely upon interpretation of color change in mini-test wells/cupules containing modified and chromogenic substrates. Optical instrument readings can also be employed to improve accuracy of interpretation. Automated systems, such as the VITEK2, a provide a panel of positive and negative individual test results. Both manual and automated systems utilize databases to assign probability of the identification and pinpoint any individual test results discordant with the identification.

Subcultures of the clinical sample are required prior to use of these tests.

The relative infancy of S. pseudintermedius must be appreciated, as the databases for these products may not include S. pseudintermedius. This may lead to misidentification, particularly in human-oriented systems such as Staph-Zymb and API

ID 32 STAPH a that may identify the isolate as S. aureus; or VITEK2 a that may identify the isolate as S. intermedius.69

Fatty acid profiling 90,91 via computer assisted high-resolution gas-liquid chromatography is a specialized technique which is less commonly performed, but is useful for identification of staphylococci. Automated systems are also available, utilizing pattern recognition software and databases to provide identification probability.90

2.3.1.6.3 Difficulties and discrepancies in phenotypic technologies

Biochemical testing methods are fallible. Some require recognition of color change, which may be subjective. Biochemical testing also relies upon evaluation of characteristics which may be variably expressed, leading to misidentification. An appreciation of these factors is essential when interpreting contradictory or unexpected results that may arise with these methods.

Phenotypic biochemical test kits, such as the API ID 32 STAPHa and BBL

Crystal Identification Systems Gram Positive ID Kitc although cost efficient and convenient, do not reliably differentiate veterinary strains of S. aureus and

S.(pseud)intermedius,92 nor reliably identify S. schleiferi subsp. coagulans.53, 92 The identification of S. schleiferi subsp coagulans and S .intermedius group members require supplemental biochemical testing that is not included in the kit.7, 53

Several studies have compared the precision and accuracy of commercial identification kits for identification of staphylococci89, including S. schleiferi,53 and S. aureus. 93 The identification of S. schleiferi was particularly problematic in the past as commercial tests did not include S. schleiferi subsp. coagulans in their identification code database. 53

Furthermore, as previously mentioned, there are contradictory reports regarding the VP test for acetoin production in S. pseudintermedius with many reports regarding S intermedius previous to reclassification as VP negative.30, 86 However, S. pseudintermedius was initially described and referenced as acetoin positive. 3 This variability may have not only been influenced by differential expression and host species of origin in earlier reports, but also method of detection; it has been shown that the API

ID 32 STAPH kita had fewer VP positive results (10%) versus a stand-alone tube test

(66% ) in genotypically confirmed S. pseudintermedius from the skin of dogs.4 Similarly with S. schleiferi, the urease reaction appears to be dependent upon the method of evaluation, and subspecies represented.53 Because S. intermedius, S. pseudintermedius, and the majority of S. aureus are urease positive, when differentiating amongst these species, this variability may be inconsequential. However, when differentiating S. schleiferi subsp. schleiferi from other coagulase negative staphylococci a positive urease result may be problematic.53

Coagulase production is an essential characteristic in the identification and description of staphylococci. Two techniques for assessment of coagulase are employed: the slide test and the tube test. The tube test detects both bound and free coagulase. The tube test should be assessed at both 4 and 24 hours, as some strains may require longer than 4 hours for clot formation. Importantly, some rare strains of coagulase positive staphylococci are negative in tube and slide coagulase tests. For this reason, rapid latex agglutination tests for coagulase are employed by some laboratories.20

The rapid slide test detects bound coagulase, also termed ―clumping factor.‖ As a sole test of coagulase production for the species of our interest, the slide test is flawed

33 because S. schleiferi subsp. coagulans, S. intermedius, and S. pseudintermedius produce only free coagulase, detected only by the tube methodology. Up to 15% of human S. aureus may also be negative.20 Therefore, isolates of these species may be misidentified as a coagulase negative staphylococcus if a slide coagulase test is used alone. Thus, a negative slide coagulase test is paired with a positive urease result can be problematic, leading to misidentification of S. schleiferi subsp. coagulans as S. schleiferi subsp. schleiferi or S. chromogenes.30

2.3.2 Genotypic identification

2.3.2.1 Technologies

Sequencing of 16s ribosomal RNA (16srRNA), is considered to be the gold standard in bacterial identification, surpassing the accuracy of phenotypic identification.

The 16srRNA gene is highly conserved within a species and between species of the same genus. This technology has been the basis of phylogeny of bacterial species, allowing for reorganization of bacterial species, and classification and identification of ambiguous species.94 Complete 16srRNA sequencing of multiple clinical isolates is presently impractical due to high cost, low availability and the requirement for sophisticated and advanced equipment. Considerable effort has been made to identify staphylococcal species isolates with abbreviated segments of 16srRNA and non-coding spacer regions between 16s, 23s, and 5srRNA genetic loci by means of PCR.92,95,96,97,98,99,100 However, intraspecies heterogeneity remains even in truncated segments of 16srRNA.92,95,101

Sequencing of 16srRNA was performed for the 2005 description of S. pseudintermedius3 as well as in prior and subsequent investigations of canine S.

(pseud)intermedius and S. pseudintermedius, respectively. 14, 60, 98This method has also been used to identify S. schleiferi species.7, 53, 55, 70 16srRNA sequencing is most frequently used in a research setting to confirm results of phenotypic identification techniques or to identify clinically rare species, such as S. (pseud)intermedius in humans.3 Due to potential ambiguity of discriminatory phenotypic features, this technique is frequently documented in the identification of S. schleiferi spp. and S. intermedius group species 3, 14, 100

PCR-based species identification is a desirable method because it is accurate, rapid, and more labor and cost effective than16srRNA sequencing. This technique requires strategic targeting and amplification of genes (amplicons) that are highly conserved yet interspecies- size and sequence-variable in order to circumvent costly sequencing. Amplicons are resolved by gel electrophoresis, with size dependent migration distance through the gel, producing species predictive patterns and identifiable fragment sizes. Genes targeted for staphylococci will be described in greater detail in section 2.2.2.2.

PCR targeting of highly conserved genes may be difficult if there is a high level of interspecies conservation. Restriction enzymes, that cleave specific short gene sequences, may be strategically employed to highlight minor conserved interspecies sequence differences. Therefore, entire gene segments amplified by PCR that may be otherwise identical in size are digested with these enzymes, producing fragment lengths that are species-specific based on location or absence of restriction. This technique is termed polymerase chain reaction restriction fragment length polymorphisms (PCR-

RFLP). However, given that very small gene segments are recognized by restriction

35 enzymes, multiple restriction patterns may occur within the same bacterial species due to minor sequence variability amongst strains.

RFLP has been successfully used to identify CNS of human origin targeting the tuf gene with greater success than API 32 STAPH IDa and Crystal GP/ID BBLb phenotypic kits.102 RFLP-PCR targeting the gap gene with AluI digestion of S. aureus is a highly specific means of identification relative to human CPS.103 RFLP can also be employed at the 16s internal transcribed spacer region to identify S. intermedius and S. aureus.99 Importantly, S. pseudintermedius PCR-RFLP of the pta locus with MboI restriction has recently been described and was successful in unique identification of the phenotypically similar S. pseudintermedius and S. intermedius.36 Importantly, S. schleiferi and S. intermedius do not contain a restriction site in this technique and produce an identical amplicon length and S. aureus produced a unique RFLP pattern.

Therefore it does not distinguish S. schleiferi and S. intermedius. The development of this technique is significant, as sequencing is no longer needed to differentiate S. intermedius from S. pseudintermedius.

2.3.2.2 PCR for identification of staphylococci

PCR is a highly sensitive technique that is more labor and cost efficient than16srRNA sequencing. It is more accurate as biochemical tests as a means of identification as biochemical testing often requires interpretations of color change, and may also be subject to intraspecies variability. PCR, however, is dichotomous, providing either a positive or negative result.

PCR technique involves strategic targeting and amplification segments of genes chosen for high fidelity and species specificity. This allows for design of unique, complementary DNA primers that anneal to DNA flanking the DNA sequence

(amplicon) of interest. PCR requires annealing of the primer to the sample (template)

DNA, and extension of the complementary DNA.104 The heat stable enzyme, Taq polymerase, is necessary to synthesize the amplicons during the extension phase in the presence of free nucleotides. PCR is performed in a thermocycler unit, that repeatedly providing temperature cycles optimal for the three phases of PCR: 1) denaturation of

DNA, 2) primer annealing to the DNA, 3) extension to produce amplicons of unique length.104 When repeated, this ultimately results in exponential production of millions of amplicons. Amplicons are resolved by gel electrophoresis, with size dependent migration distance through the gel, producing species predictive patterns and identifiable fragment sizes.

2.3.2.2.1 Genes of interest for identification

Designed primers must reliably anneal to the template for multiple isolates of the same species. Therefore, conserved genes are ideal PCR amplicon targets, sequence conservation in the area of primer annealing must be consistent, and the gene target must be present in multiple isolates. Such conserved genes are typically essential for microbial function.

2.3.2.2.2 femA gene

The gene femA is a genetic factor essential for methicillin resistance.105, 106 femA has been previously utilized in a multiplex PCR to identify staphylococcal species in which one forward consensus primer was used, with species specific reverse primers for

S. aureus, S. epidermidis, S. hominis, S. saprophyticus and S. simulans.107 femA PCR is a food safety tool as it is sensitive and specific in identifying S. aureus in milk.108

Amplification of the femA gene has also proven useful in multiplex PCR assays in the identification of human MRSA isolates, coupled with amplification of mecA. The presence of femA is an indication of CPS, such as S. aureus, discriminating MRSA from methicillin resistant CNS. 109, 110

2.3.2.2.3 hsp60 gene

The heat shock protein 60 (hsp60) gene encodes housekeeping proteins that assist in appropriate protein folding, also known as chaperonins, which are essential in both prokaryotic and eukaryotic life.111 hsp60 has been sequenced in over 40 staphylococcal species, including S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius.4,

112,113,114 The hsp60 has proven to be more discriminatory than 16srRNA gene sequences for differentiating strains belonging to staphylococcus and as such have contributed to the phylogeny of staphylococci.113,4 16srRNA sequences S. intermedius, S. schleiferi, and S. pseudintermedius are >99% identical and cannot be used to differentiate these species alone.3,115,114hsp60 sequencing was essential in both the first report of methicillin- resistant S. pseudintermedius in humans and dogs at a veterinary teaching hospital64 and the subsequent reclassification of canine S. intermedius as S. pseudintermedius4 To the

38 author’s knowledge, an hsp60-based PCR for the identification of staphylococci has not been reported.

2.3.2.2.4 sodA gene

The manganese-dependent superoxide dismutase (SOD) is encoded by sodA gene.

The enzyme SOD allows for intracellular survival of S. aureus within macrophages in the presence of superoxide and hydrogen peroxide.116 SodA has been found to have a greater degree of interspecies divergence amongst staphylococci than 16srRNA, making this gene an ideal discriminative target.117 Of veterinary interest, there is significant divergence between S. intermedius the species S. schleiferi subsp. coagulans (77.4% identity) and S. schleiferi subsp. schleiferi (77.9% identity).117 sodA has been sequenced in over 40 staphylococcal species, including S. aureus, S. schleiferi, S. intermedius, and

S. pseudintermedius.4,117,118 sodA sequencing was essential in both the first report of methicillin-resistant S. pseudintermedius in humans and dogs at a veterinary teaching hospital64 and the subsequent reclassification of canine S. intermedius as S. pseudintermedius.4

Species-specific sodA PCR developed to identify staphylococci of veterinary interest, including S. hyicus,119 S.(pseud)intermedius and S. aureus,120 as well as select species of

CNS.121,122, 123 have been reported. To the author’s knowledge, a sodA-based PCR for the identification and discrimination of S. aureus, S. intermedius, S. pseudintermedius, and S. schleiferi has not been reported.

2.3.2.2.5 nuc gene

Heat-stable nuclease, thermonuclease is encoded by the nuc gene. Amplification of the nuc gene has proven highly sensitive and specific in multiplex PCR assays in the rapid identification of human MRSA isolates, coupled with amplification of mecA.124125

S. (pseud)intermedius from the dog, cat, camel and human have been successfully identified with nuc PCR.126 Pigeon origin S. intermedius ATCC 29663 and pigeon (now considered the hosts of ―true‖ S. intermedius isolates were also successfully identified..

Of note, this investigation occurred prior to the description of S. pseudintermedius and reclassification of canine origin S. intermedius as S. pseudintermedius, suggesting that this method may not differentiate S. intermedius from canine S. pseudintermedius. This

PCR was not specific for equine origin S. (pseud)intermedius; however, initial identification of isolates was phenotypically based and isolate identity was not confirmed with 16srRNA sequencing. Importantly, this technique was also highly specific, and did not amplify S. schleiferi subsp. schleiferi, S. schleiferi subsp. coagulans, or S. aureus.126

To the author’s knowledge, there has not been reported a nuc-based PCR for the identification and discrimination of S. aureus, S. intermedius, S. pseudintermedius, and S. schleiferi

2.4 Detection of methicillin resistance in staphylococci

2.4.1 Phenotypic identification

Identification of methicillin resistance in staphylococcus is clinically important, as all methicillin-resistant staphylococci are, by convention, regarded to be resistant to all β- lactam antibiotics in vivo regardless of disk diffusion or broth microdilution results of

40 other β-lactams.20,29 Methicillin resistance is imparted by penicillin binding protein 2a

(PBP2a) which is encoded by the gene mecA present within the mobile genetic element,

SCCmec.127 PBP2a has a much lower binding affinity for β lactam antimicrobials. Thus in PBP2a mediated methicillin resistance; β lactam antimicrobials do not impede the activity of the PBPs. Transpeptidation of peptidoglycan continues unabated, the cell wall maintains its integrity, and the bacterium does not succumb. PBP2a production can be directly assessed via latex agglutination assay.

Methicillin resistance may also be observed in mecA-negative isolates that produce high levels of β-lactamase. Therefore, β-lactamase assessment may be needed to confirm methicillin resistance in a minority of isolates.

Oxacillin disk diffusion, oxacillin broth microdilution, and oxacillin salt agar screen are commonly used to detect methicillin resistance. Oxacillin is the penicillinase- stable β-lactam of choice in diagnostic microbiology, as it is more stable than methicillin.

Although it may be more correct to classify staphylococci as oxacillin resistant, traditional convention dictates a methicillin-resistant designation.

2.4.1.1 Oxacillin salt agar

The oxacillin salt agar (OSA) test is a sensitive test for methicillin resistance in human origin mecA positive S. aureus and coagulase negative staphylococci.128 This method is sensitive in the detection of canine mecA-positive methicillin-resistant S. aureus,50 S.(pseud)intermedius17, 50 and CNS.50

Most commercial OSA products are comprised of Mueller-Hinton agar supplemented with 6.0 μg/ml oxacillin and 4% NaCl, and are most frequently used for the detection of MRSA. The NaCl content is present as a selective feature; to discourage

41 growth of non- staphylococcal organisms, and to encourage growth of MRSA is it is known to grow at a higher NaCl concentration. The isolate is considered methicillin- resistant if more than one colony grows on the agar. It is recommended that examination occur at both 24 and 48 hours, as a growth may only be visible after 48 hours for CNS.50

Some agars are chromogenic, generating a color change with mannitol fermentation.

This is intended to screen S. aureus from other staphylococci. However, color change with agar utilizing aniline blue can occur in the presence of coagulase negative staphylococci, requiring further identification methods to confirm the presence of S. aureus.129 The reported sensitivity and specificity of detection of methicillin resistance in human MRSA isolates is variable, ranging from 50.8% - 78% and 45.8-97.9%, respectively.130,129,131

2.4.1.2 Oxacillin minimum inhibitory concentration by broth microdilution

The minimum inhibitory concentration (MIC) is the lowest concentration of antimicrobial that inhibits bacterial growth. The MIC in practice is the concentration of antimicrobial (μg/ml) at which there is no visible microbial growth. Because the concentrations of antimicrobials tested are often based on discrete serial two-fold dilutions, the MIC in practice is an estimate of the true MIC. This MIC is often determined via antimicrobial dilutions in agar or broth media. Broth microdilution testing for oxacillin is performed utilizing Mueller-Hinton broth supplemented with 5% NaCl.

Semi-automated systems such as the Sensititred may be used with CLSI recommended dilution ranges and breakpoints. The oxacillin Etesta method does not involve discrete two fold dilutions, rather a concentration gradient strip of oxacillin. The Etesta method

42 for determination of MIC proved to be 100% sensitive and 100% specific in 51 mecA- positive and 50 mecA-negative human S. aureus isolates, respectively utilizing CLSI established breakpoints.132. The oxacillin Etesta was shown to be 100% sensitive in 31

PBP2a-positive canine isolates of S.(pseud)intermedius, S. schleiferi and S. aureus,60 and also in 88 isolates of mecA-positive canine S. pseudintermedius14 utilizing 2004 CLSI oxacillin breakpoint recommendation of ≥ 0.5μg/ml. The technique was found to be

100% specific in 16 isolates of methicillin-susceptible S. intermedius and 90% specific in

10 S. schleiferi subsp. coagulans isolates.60

2.4.1.3 Oxacillin disk diffusion

Oxacillin disk diffusion is a CLSI recommended method for methicillin resistance screening in veterinary CPS. Bacteria are suspended in sterile, deionized water and adjusted to a 0.5 McFarland standard. Suspensions are swabbed onto Mueller-Hinton agar to make lawns, and disks containing oxacillin (1 μg) are applied. The plate was assessed after 24 hours of incubation at 35ºC and the zone of inhibition diameter for each antimicrobial disk is recorded in millimeters. Oxacillin disk diffusion found to be 100% sensitive for PBP2a-positive canine origin S.(pseud)intermedius (9 isolates), S. schleiferi subsp. coagulans (13 isolates), and S. aureus (4 isolates) with 2004 CLSI CNS interpretive criteria.60 With the same interpretive criteria, the test was found to be 89% specific in PBP2a-negative S.(pseud)intermedius (18 isolates) and 100% specific for

PBP2a-negative S. schleiferi subsp coagulans.60 In a more recent investigation with 116 mecA-positive isolates of canine S. pseudintermedius, oxacillin disk diffusion was 93% sensitive with 2004 CLSI CNS interpretive breakpoint of ≤ 17mm.14 However, when the

2008 CLSI recommended breakpoint of ≤ 13mm was employed with these isolates,

14.9% of the isolates were falsely determined to be methicillin susceptible, demonstrating that the 2004 breakpoint of ≤ 17mm is more sensitive.14

2.4.1.4 Cefoxitin disk diffusion

Cefoxitin disk diffusion is a CLSI approved method for screening for human methicillin-resistant S. aureus (MRSA). Bacteria are suspended in sterile, deionized water and adjusted to a 0.5 McFarland standard. Suspensions are swabbed onto Mueller-

Hinton agar to make lawns, and disks containing cefoxitin (30 μg) are applied. Plates are assessed after 24 hours of incubation at 35ºC, and the zone of inhibition diameter is recorded in millimeters according to CLSI recommendations.29

Heterogenous populations of methicillin-resistant MRSA are of increasing concern as identification of methicillin resistance in these populations may not be possible with OSA or oxacillin disk diffusion. Cefoxitin disk diffusion is recommended in the identification of MRSA.29 This technique is utilized in the detection of MRSA as the presence of cephamycins may induce PBP2a production in heterogenous, low-level MRSA populations133 and is seemingly unaffected by hyperproduction of penicillinases that may give misleading results with oxacillin disk diffusion.20 It has been shown that for heterogenous populations of MRSA, cefoxitin disk diffusion was superior to OSA and oxacillin disk diffusion, with 100% sensitivity for all heterogenous isolates using mecA

PCR as the gold standard.134 Cefoxitin disk diffusion has been shown to have superior sensitivity to oxacillin disk diffusion in the identification of non-heterogenous mecA PCR positive S. aureus human isolates.135,136,137,138,139 Cefoxitin disk diffusion has been

44 reported to be 84.6%-100% sensitive and 87.5%-100% specific for mecA-positive and mecA-negative human origin S. aureus, respectively.131,135,132

The sensitivity of this diagnostic test appears to be species-dependent, demonstrating poor sensitivity in mecA PCR positive Staphylococcus simulans,

Staphylococcus cohnii, and Staphylococcus hominis, and Staphylococcus saprophyticus.140 The CLSI does not have specific recommendations for cefoxitin disk diffusion for veterinary coagulase positive staphylococci (CPS), but the guidelines published in 2004 broadly states that human CNS interpretive criteria should be applied to veterinary CPS,29 implying that cefoxitin disk diffusion may be used. In contrast the

2008 CLSI document states that interpretive criteria for human S. aureus should be applied for veterinary CPS. A previous study of canine origin in PBP2a-positive S.

(pseud)intermedius, S. aureus, and S. schleiferi subsp. coagulans, assessed the sensitivity of the CNS breakpoint criteria for cefoxitin disk diffusion.60 Cefoxitin disk diffusion was found to be 44% sensitive for S. (pseud)intermedius (9 isolates), 46% sensitive for S. schleiferi subsp. coagulans (13 isolates), and 100% sensitive for the detection of methicillin resistance in S. aureus (4 isolates) with 2004 CLSI CNS interpretive criteria.60

In a 2009 investigation with 116 isolates of canine S. pseudintermedius, there was only

34% sensitivity of Cefoxitin disk diffusion with mecA PCR under 2008 CLSI guidelines.14 Although lacking in sensitivity for non- S. aureus isolates, cefoxitin disk diffusion was 100% specific in canine PBP2a-positive CPS isolates with 2004 CLSI CNS interpretive criteria60 and mecA-positive isolates of canine S. pseudintermedius.14

2.4.1.5 β-lactamase production

Staphylococci produce extracellular β-lactamases, encoded by the plasmid transmitted blaZ gene. β-lactamases render some antibiotics, such as amoxicillin, ineffective by hydrolysis of the antimicrobial. β-lactamase production is induced by the presence of the antimicrobial.141 Hyperproduction of penicillinases may result in borderline resistant isolate populations with oxacillin MICs at or just above the susceptibility breakpoint.142,143 Methicillin resistance or borderline methicillin resistance may also be a result of oxacillin and penicillin-specific β-lactamases. Borderline strains show a classically decreased oxacillin MIC value in the presence of β-lactamase inactivating sulbactam and clavulanate.144 Because such strains are often mecA negative and give contradictory, or susceptible, results with oxacillin disk diffusion and OSA,145 identification of these populations require assessment of β-lactamase production.

This may be evaluated genotypically via PCR of the blaZ gene, a commercially available technique (Pathoproof Mastitis PCR assay).146 Color-based indicators of β- lactamase production are also available, in strip form, which may be applied to agar (β - lactamase identification sticks). Other methods include Nitrocefin broth, slide, and disk methods, cefinase test, and cloverleaf test.146A study of 50 canine origin blaZ-positive S.

(pseud)intermedius, demonstrated that the cloverleaf method is the most sensitive

(97.4%) and specific (100%), followed by identification sticks, cefinase and Nitrocefin based tests.146 All tests were 100% specific. The cloverleaf method is less often performed as it is time-consuming.

2.4.1.6 PBP2a latex agglutination test

PBP2a is encoded by the gene mecA, present within the mobile staphylococcal chromosomal cassette element, SCCmec.127 PBP2a has a much lower binding affinity for

β-lactam antimicrobials, which forms the basis for resistance. PBP2a as well as mecA

PCR are considered the gold standard tests for methicillin resistance (CLSI).The rapid latex agglutination test is commercially available (Oxoid) and requires colonies subcultured on Mueller-Hinton or other non NaCL-containing agar. Visible agglutination of latex particles coated with PBP2a monoclonal antibodies indicates a positive result.

This test has been shown to have 92.3% sensitivity (n=39) and 79.2% specificity (n=24) relative to mecA PCR positive human-origin S. aureus, and was found to be more sensitive than oxacillin and cefoxitin disk diffusion testing.131 Sensitivity and specificity for detection of methicillin resistance is further increased with the addition of other phenotypic testing methods including oxacillin and cefoxitin disk diffusion.131 Although both PBP2a latex agglutination and mecA PCR are considered gold standard tests for mecA-mediated methicillin resistance, results for individual isolates may occasionally differ in canine CPS that share other phenotypic features of methicillin resistance.60, 62

2.4.2 mecA PCR

mecA encodes PBP2a, a 76-kDa PBP. PBPs are involved in the essential transpeptidation of peptidoglycan in the gram positive bacterial cell wall. β–lactam antibiotics bind covalently to these proteins, rendering them inactive, leading to death of the bacterium.142 mecA and associated regulatory genes are located on a mobile staphylococcal cassette chromosome (SCC) element. To date, in staphylococci, there are

47 seven known SCCmec types (I-VII). SCCmec identity is established through sequencing,

PCR and restriction fragment length analysis methods. SCCmec types and classification primers may be species-specific.147 S. pseudintermedius of dogs has shown to possess

SCCmec types II, III, and the newly described VII.147 SCCmec type III is most frequently documented in canine staphylococci,147 with all 61 mecA positive canine S. pseudintermedius clinical isolates characterized as SCCmec type III in a German investigation.15

mecA is highly conserved, and PCR can be used to amplify the mecA gene, if present, regardless of SCCmec type. mecA PCR is considered the gold standard for detection of methicillin resistance in staphylococci.142 Traditional and real-time methods can be used to assess for the presence of mecA in canine CPS.14, 60

Rarely, oxacillin-susceptible mecA positive S. aureus have been identified;148 such strains are thought to be heteroresistant. Identification of such strains via mecA gene

PCR may avoid use of β–lactams and subsequent selection for high-level homoresistance.

These strains may exist due to lack of gene expression or expression of non-functional protein due to frame shift mutations that results in a stop codon or significantly alter the ultrastructure of the protein.

The most common mechanism of methicillin resistance is the acquisition of mecA and the subsequent production of PBP2a. However, discrepant results amongst phenotypic tests for methicillin resistance and between phenotypic and genotypic methods occur. These findings may be due in-part to heteroresistance or alternative mechanisms of methicillin resistance. Heteroresistant populations are defined as a less than 1% isolate composition of high-level methicillin-resistant clones.145,149,142

Heteroresistant populations may appear to be susceptible or borderline on routine phenotypic testing methods, which may lead to inappropriate antimicrobial use and subsequent clinical failure.142 Further, such populations have the capacity to become uniformly resistant when exposed to β-lactam antimicrobials in vivo due to selective pressures.149,142 Borderline resistance is defined as isolate populations with oxacillin

MICs at or just above the susceptibility breakpoint.142 These populations may be mecA positive, containing heterogenous strains that produce PBP2a that have a small population of clones that may resistant at high oxacillin concentrations.150 Non-mecA positive borderline strains may possess high levels of β-lactamase or have modified intrinsic PBP proteins with less affinity for β- lactams.20,142

Some borderline resistant isolates may not grow on OSA, but will show methicillin resistance by disk diffusion methods. 151 Similarly, the OSA method has proven to correlate 100% with mecA PCR, providing a negative result for mecA-negative hyperpenicillinase producing strains of S. aureus (n=10).145 It has also been found that borderline, heteroresistant strains of S. aureus gave variable results with oxacillin disk diffusion and OSA tests.145

The reality of heteroresistance, alternative resistance mechanisms, and borderline resistance within staphylococcal populations, ideally necessitates employment of one or several phenotypic tests of methicillin resistance combined with mecA PCR to establish the phenotype and genotype such that antimicrobial selection is appropriate and effective.

2.5 Superficial bacterial folliculitis in dogs

Superficial bacterial folliculitis is the most common skin infection of dogs.1,152

The signature primary lesion of superficial bacterial folliculitis is a folliculocentric pustule. This lesion arises as the infection is confined to the hair follicle, follicular epithelium and the surrounding epidermis. The pustule will rupture resulting in secondary lesions including epidermal collarettes, and crusts. The folliculocentric nature of the infection may result in epilation and grossly visible alopecia. Post-inflammatory hyperpigmentation may also be observed.

Canine superficial bacterial folliculitis occurs secondary to inflammatory skin disease, including but not limited to: atopic dermatitis, cutaneous adverse food reaction, flea bite hypersensitivity, and ectoparasitism. Metabolic disease, including diabetes mellitus, hypothyroidism, and hyperadrenocorticism, compromise local immune system function and may also predispose the patient to superficial bacterial folliculitis.

Diseases specific to the hair follicle, including dermatophytosis, demodicosis, sterile inflammatory folliculitis (sebaceous adenitis, alopecia areata, pseudopelade), and follicular dysplasia may result in follicular hyperkeratosis, predisposing to bacterial folliculitis as well.

2.6 Mucous membrane staphylococcal colonization of dogs and cats

Mucous membrane colonization has been well described in canine S.

(pseud)intermedius with relation to superficial bacterial folliculitis and inflammatory skin disease10,38 and has also been documented to occur in the cat.39 Pulse-field gel electrophoresis (PFGE) has demonstrated that S.(pseud)intermedius strains colonizing

50 mucous membranes may be identical to those present in superficial bacterial folliculitis of an individual with individually heterogenous strains.10 Ribotyping has demonstrated that strains responsible for bacterial folliculitis differ from those found at carriage sites of healthy dogs. 153

S. aureus is a commensal organism, colonizing the mucous membranes of dogs and cats.10, 39, 76 S. schleiferi subsp. schleiferi as well as S. schleiferi subsp. coagulans have been isolated from the mucous membranes of dogs as have coagulase negative staphylococci 10,76

2. 7 Zoonosis and reverse zoonosis

2.7.1 S. pseudintermedius

The incidence of reported human infections with S.(pseud)intermedius is seldom reported36, 69and is thought to occur most frequently in the context of canine bite injury.

Of interest, S. pseudintermedius was recently reported as a pathogen in the context of a single report of cardioverter-defibrillator infection, and the source of the infection was unknown.69 Single cases of bacteremia,154, 155 pneumonia,156 otitis,25post-surgical incision infection,157 and brain abscess158 have also been reported. A case report also described a human with middle ear infection from which S. (pseud)intermedius was isolated; the family dog also cultured positive for S.(pseud)intermedius. Zoonotic infection and colonization of humans is believed to be rare, even amongst veterinarians in frequent contact with the pathogen. A 1989 study by Talan evaluated nasal pharyngeal swabs of

144 veterinary staff members. Only one person was colonized with S.

(pseud)intermedius.159

As S. pseudintermedius from human-origin isolates has recently been definitively identified by genotyping, 4, 69,36 it is likely that previous reports of human S. intermedius infections particularly in the context of canine bite wounds, represented S. pseudintermedius infections. S. pseudintermedius and S. intermedius are often not included in pathogen databases of commercial identification systems, particularly technologies used in human laboratories, misidentification with other coagulase-positive staphylococci is possible (especially S. aureus).69,159, 160 Therefore, there remains a possibility that the true incidence of S. pseudintermedius human infection has been underappreciated. However, overwhelming anecdotal evidence supports the opinion that

S. pseudintermedius is a rare zoonotic pathogen, as veterinarians with high exposure via infected animals are typically never infected.

Human carriage of S. (pseud)intermedius by veterinary professionals and pet owners in contact with infected pets, has been identified on multiple occasions,16, 21, 22, 64 and is of increasing interest amongst investigators interested in the epidemiology of this pathogen, and transmission of methicillin resistance as the prevalence of MRSP rises. S

.pseudintermedius appears to be carried transiently by humans. A study of 13 dogs with

S. (pseud)intermedius deep pyoderma demonstrated carriage in 6/13 in-contact owners; a significantly higher positive proportion than a set of 13 human controls (1/13). After lesions were resolved, all owners were cultured and were negative.21

Nosocomial transmission of MRSP within veterinary hospitals is of increasing concern. Nosocomial transmission was documented in a Dutch veterinary hospital: five animals developed MRSP post-surgically, and 4/22 environmental samples were culture positive as well as 4/7 staff members. The PFGE pattern of all MRSP isolates was

52 identical. Because the patients did not directly come into contact with each other, the investigator concluded that nosocomial transmission was responsible, likely via veterinarians and veterinary technicians.16

Sasaki documented carriage of MRSP from a veterinary staff member and 17 dogs. The PFGE pattern was similar to some of the dogs, suggesting dog to human transmission.

At present, MRSP is a rare pathogen of humans. However, transient colonization of humans is possible. In a clinical setting, human colonization and environmental contamination may significant risks of infection for post-surgical and immunocompromised veterinary patients.

2.7.2 S. aureus

Several circumstantial cases of human MRSA infections have been associated with household pet contact.27,28 Although the same strain could be proven, the direction of transmission was speculative. Because animals have been proven to carry strains of

MRSA commonly found in humans, typing is not helpful in determination of direction of transfer. Circumstantial evidence for zoonotic MRSA infections of humans in contact with infected or colonized horses has been presented as well.71

2.8 Sources and Manufacturers:

a. bioMerieux Hazelwood, MO

b. Rosco Diagnostica, Denmark

c. BD, Franklin Lakes, NJ

d. Sensititre COMEQ3F panel, Trek Diagnostic Systems, Cleveland, OH

e. AB Biodisk, Solna, Sweden

Chapter 3: Evaluation of Clinical and Laboratory Standards Institute Interpretive Criteria for the Detection of Methicillin Resistance in mecA-Positive Staphylococcus pseudintermedius from the Skin and Ears Of Dogs

3.1 Abstract

The Clinical and Laboratory Standards Institute has published (2008) new interpretive criteria for the identification of methicillin resistance in staphylococci isolated from animals. The sensitivity of the 2008 interpretive criteria for mecA gene– positive Staphylococcus pseudintermedius, in comparison to the previous (2004) criteria, was investigated. Thirty clinical isolates of methicillin-resistant S. pseudintermedius from dogs were used. The presence of the mecA gene was determined by polymerase chain reaction. The minimum inhibitory concentration for oxacillin was determined by broth microdilution. The 2008 breakpoint of > 4µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 73.3% (22/30). The 2004 breakpoint guideline of ≥ 0.5

µg/ml resulted in a diagnostic sensitivity of 97% (29/30). For oxacillin disk diffusion, the 2008 interpretive criterion of ≤10 mm for methicillin resistance resulted in a sensitivity of 70% (21/30). If intermediate isolates (11 or 12 mm) were considered resistant, the sensitivity was 93% (28/30). If intermediate isolates (11 or 12mm) were considered resistant, the sensitivity was 93% (28/30). Application of the 2004 interpretive criterion of ≤ 17mm resulted in a diagnostic sensitivity of 100% (30/30). For cefoxitin disk diffusion, the interpretive criterion of ≤ 21mm for methicillin resistance (as used for

S. aureus) resulted in a diagnostic sensitivity of 6.7% (2/30). The interpretive criterion of

≤ 24mm (as used for coagulase negative staphylococci) resulted in a diagnostic sensitivity of 43.3% (13/30). Using 2008 interpretive criteria, all three tests produced what we consider to be an unacceptable level of false negative results. Our findings also suggest that cefoxitin disk diffusion is an inappropriate screening test for methicillin resistance of canine S. pseudintermedius.

3.2 Introduction

Staphylococcus pseudintermedius, previously identified as Staphylococcus intermedius2-4,is the most common etiologic agent in canine pyoderma5 and an agent commonly involved in canine otitis.5, 6 Methicillin-resistant S. pseudintermedius (MRSP) has been increasingly reported as a primary pathogen in canine infections.12-17

All methicillin-resistant staphylococci are, by convention, regarded to be resistant to all β-lactam antibiotics in vivo.20, 29 Cephalosporins are the most common antimicrobials used to treat S. pseudintermedius infections in dogs,19 but are not efficacious for the treatment of MRSP infections. Thus, accurate determination of methicillin resistance is of critical importance to the clinician and the canine patient.

Methicillin resistance is imparted by penicillin-binding protein 2a (PBP2a), which is encoded by the gene mecA.127, 142 The gold standard for diagnosis of methicillin resistance is detection of mecA via polymerase chain reaction (PCR).29, 142

Veterinary microbiology laboratories rely on a variety of laboratory tests to identify methicillin resistance, and few laboratories at this time, if any, are known to perform PCR for mecA on a routine diagnostic basis. The most commonly used laboratory tests use oxacillin as a surrogate for methicillin in the following formats: broth

56 microdilution (MIC), disk diffusion, and testing on oxacillin salt agar. Disk diffusion testing using cefoxitin as a surrogate for oxacillin has also been suggested.142

The Clinical and Laboratory Standards Institute (CLSI) has published new (2008) performance standards for antimicrobial susceptibility testing of bacteria isolated from animals,29 and new interpretive criteria for the determination of oxacillin susceptibility and resistance in staphylococci were specified. The 2008 document states that

Staphylococcus aureus interpretive criteria should be applied to the veterinary coagulase- positive staphylococci such as S. intermedius. The previous (2004) CLSI (formerly

NCCLS) document recommended application of non-S. aureus Staphylococcus spp. interpretive criteria (coagulase-negative staphylococci criteria) to veterinary coagulase- positive staphylococci. The S. aureus and Staphylococcus spp. oxacillin interpretive criteria, as applied to veterinary coagulase-positive Staphyloccci, differ in MIC breakpoints and disk diffusion cut-off values. The S. aureus-based criteria, as recommended in 2008, consist of smaller disk diffusion inhibition zone diameters and greater MIC breakpoints than the 2004 Staphylococus spp-based criteria. Therefore, the

2008 criteria are a more stringent basis for the determination of oxacillin resistance in veterinary coagulase-positive staphylococci than the 2004 criteria.

Prompted by the release of the 2008 CLSI interpretive criteria the present study investigated whether the new breakpoints would accurately detect oxacillin resistance in mecA-positive S. pseudintermedius isolated from canine patients at The Ohio State

University Veterinary Teaching Hospital (Columbus, OH). The goal of this study was to compare the 2008 and 2004 CLSI interpretive criteria for identifying the oxacillin- resistance phenotype of PCR-confirmed mecA-positive MRSP clinical isolates from dogs.

3.3 Materials and methods

3.3.1 Isolate selection criteria

The specimens included in this study were selected from a pathogen data bank of clinical isolates collected from February 2007 to September 2008 from the clinical microbiology laboratory at the Veterinary Teaching Hospital at The Ohio State

University. The bank included all isolates of coagulase positive staphylococci that were suspected to be methicillin resistant on the basis of resistance or intermediate susceptibility to oxacillin on disk diffusion test and, in some instances, oxacillin salt agar testing. Subsequently, mecA PCR was performed on all banked isolates. Isolates were frozen at -80ºC in trypticase soy broth and 20% dimethyl sulfoxide for up to 20 months, and were prepared from a single colony.

The criteria used for selection of isolates included: 1) each isolate originated from a unique canine patient, 2) was associated with clinically apparent infection of the skin

(wounds, lesions of pyoderma, incisions) or ear (external ear canal, middle ear), 3) was positive for mecA, and 4) was identified as S. pseudintermedius.

3.3.2 Biochemical identification

The isolates were subcultured from freezer storage and streaked onto trypticase soy agar supplemented with 5% sheep’s blood.a One isolated colony was further subcultured for subsequent biochemical identification and susceptibility testing.

Reagents from commercial sources were used whenever possible for biochemical testing, and all incubations occurred at 35° C in ambient air. The coagulase testa was interpreted

58 at 24 hours. Phenol-redb tests of trehalosec and lactosec fermentation were interpreted at

48 hours. Mannitol salt agara was used to assess fermentation of mannitol and interpreted at 48 hours. The Voges-Proskauer testd was interpreted after 48 hours of incubation.

Quality control strains S .intermedius ATCC (American Type Culture Collection) 29663

Staphylococcus schleiferi subsp coagulans ATCC 49545, and S. aureus ATCC 8325 were included as controls for identification

3.3.3 Oxacillin broth microdilution

Microdilution testing for oxacillin MIC assessment was perfomed with Mueller-

Hinton brothe supplemented with 5% NaCl. The MIC determined for each isolate using a semi-automated system.f CLSI protocols and instrument manufacturer instructions were followed.

3.3.4 Oxacillin and cefoxitin Kirby-Bauer disk diffusion

Bacteria were suspended in sterile, deionized water and adjusted to a 0.5

McFarland standard for Kirby-Bauer disk diffusion testing. Suspensions were swabbed onto Mueller-Hinton agara to make lawns, and disks containing oxacillin (1 μg) and cefoxitin (30 μg) were applied.a The plate was assessed after 24 hours of incubation at

35ºC, and the zone of inhibition diameter for each antimicrobial disc was recorded in millimeters. Quality control strains S .intermedius ATCC (American Type Culture

Collection) 29663 Staphylococcus schleiferi subsp coagulans ATCC 49545, S. aureus

ATCC 8325, Staphylococcus aureus ATCC 43300, Staphylococcus aureus ATCC 25923, and Staphylococcus pseudintermedius LMG 22221, were included as controls for disk diffusion.

3.3.5 Interpretation of results

Isolates were evaluated for methicillin resistance using 2008 CLSI S. aureus– based interpretive criteria and 2004 Staphylococcus spp.–based criteria for oxacillin broth microdilution testing and Kirby–Bauer disk diffusion tests. Isolates were also evaluated on the cefoxitin disk diffusion test comparing the interpretive criteria used for S. aureus and coagulase-negative staphylococci (CNS; Table 7).

3.3.6 mecA PCR

Prior to DNA extraction for mecA PCR, isolates were subcultured in Brain Heart

Infusion broth. Genomic DNA was prepared using a commercially available extraction kit per manufacturer instructions for gram positive bacteria.g The mecA PCR was performed with previously described primers:161 (mecA-F:

TCCAGATTACAACTTCACCAGG and mecA-R: CCACTTCATATCTTGTAACG with an expected amplicon size of 162 base pairs). Included in all PCR reactions were positive

ATCC 43300 methicillin-resistant S. aureus subsp. aureus and no template negative controls. Additional methicillin-susceptible staphylococcal controls: ATCC 49545,

ATCC 29663, LMG 22221, ATCC 8325, ATCC 29523 were also performed. PCR reactions were performed using commercially available beads.h A final reaction volume of 25µl with 1µl of template DNA was used. Amplification was performed using a thermocycleri under the following conditions: initial denaturation at 95ºC for 5 min followed by 30 cycles of 95ºC for 1 min, 54ºC for 1 min, 72ºC for 1 min, and a final

60 extension step of 72ºC for 7 min. A 1% agarose gel was used for electrophoresis after staining with ethidium bromide. Gels were visualized under ultraviolet illumination.

3.4 Results

3.4.1 Isolates

Thirty isolates met all the criteria and thus were included in the study. All isolates were identified as S. pseudintermedius (previously S. intermedius in dogs) and were coagulase positive,, VP negative, positive for fermentation of lactose and trehalose, and negative for fermentation of mannitol. The specific results and interpretation of each test for each isolate are presented in Tables 8 and 9.

3.4.2 Oxacillin broth microdilution, oxacillin Kirby-Bauer disk diffusion and cefoxitin disk diffusion results

The 2008 breakpoint of > 4µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 73.3% (22/30) for mecA-positive S. pseudintermedius. The 2004 breakpoint guideline of > 0.5 µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 97% (29/30). The 2008 CLSI intrepretive guideline of ≤ 10mm for methicillin resistance resulted in a diagnostic sensitivity of 70% (21/30) for mecA- positive S. pseudintermedius. If intermediate isolates (11 or 12mm zone of inhibition) are considered resistant (as may occur in clinical interpretations), the diagnostic sensitivity was 93% (28/30). Application of the 2004 interpretive criterion of ≤ 17mm for methicillin resistance in S. aureus resulted in a diagnostic sensitivity of 100% (30/30).

The interpretive criterion of ≤ 21mm for methicillin resistance (as used for S. aureus) resulted in a diagnostic sensitivity of 6.7% (2/30) for mecA-positive S. pseudintermedius.

The interpretive criterion of ≤ 24mm for methicillin resistance (as used for coagulase negative staphylococci) resulted in a diagnostic sensitivity of 43.3% (13/30).

3.5 Discussion

The 2008 interpretive criteria failed to detect methicillin resistance in some clinical mecA-positive isolates of S. pseudintermedius from the skin and ears of dogs.

The most sensitive method for phenotypic recognition of methicillin resistance in this limited cohort of mecA-positive S. pseudintermedius isolates, was oxacillin Kirby- Bauer disk diffusion under the 2004 interpretive criteria, with 100% sensitivity; the 2008 criteria failed to identify two methicillin-resistant isolates. The 2008 interpretive criteria for oxacillin broth microdilution failed to identify methicillin resistance in 26.6% of isolates in this study. The 2004 interpretive criteria were more sensitive, although methicillin resistance was unrecognized in a single isolate (Isolate 1).

Cefoxitin disk diffusion was the least sensitive method. Interpretive criteria specific for veterinary staphylococci, including S. pseudintermedius, remain to be established. Use of CNS and S.aureus interpretive guidelines in this cohort of isolates failed to identify methicillin resistance in 57.7% and 93.3% of isolates, respectively. This finding is consistent with a previous study60 wherein the sensitivity of CNS interpretive criteria in PBP2a-positive S. intermedius was found to be 44% (9 isolates tested) and

17% (24 isolates tested). In contrast, cefoxitin disk diffusion has been reported to be

84.6%-100% sensitive and 87.5%-100% specific for mecA-positive and -negative human

62 origin S. aureus, respectively.131, 135In a previous study,60 cefoxitin disk diffusion was

100% specific in 74 isolates with CNS interpretive criteria. Specificity could not be assessed in the work presented here as mecA-negative isolates were not evaluated. The use of cefoxitin disk diffusion for detecting the methicillin-resistant phenotype of S. pseudintermedius from dogs requires further investigation.

Isolate 1, though mecA-positive, was not identified as methicillin-resistant with oxacillin broth microdilution 2004 nor 2008 interpretive criteria. Discordance between the presence of mecA and the absence of a corresponding oxacillin-resistant phenotype has been recognized previously in veterinary isolates of S. aureus, S. intermedius, and S. schleiferi162 as well as human isolates of S. aureus.148 However, in Isolate 1, methicillin resistance was detected via oxacillin disk diffusion (2004 and 2008 interpretive criteria) and via cefoxitin disk diffusion (2004 CNS interpretive criteria), which is consistent with a PBP2a-positive phenotype.

mecA-negative clinical isolates were not evaluated in the this study. Therefore specificity and expectation for false positive results for these methods was not determined. A cohort of 44 mecA-negative canine S. pseudintermedius isolates was recently evaluated by Bemis et al.14 The specificity of oxacillin broth microdilution was

99.4%, and 100% with 2004 and 2008 criteria, respectively.14

The superior sensitivity of the 2004 oxacillin Kirby-Bauer disk diffusion criteria was similarly demonstrated in 230 mec-A positive canine S. pseudintermedius isolates by

Bemis et al.14 Oxacillin Kirby-Bauer disk diffusion resulted in a sensitivity of 99.1% and

85.1% with 2004 and 2008 criteria, respectively.14 Bemis et al. evaluated cefoxitin disk diffusion in 88 mecA-positive and 204 mecA-negative canine S. pseudintermedius

63 isolates. Although highly specific (100%), the cefoxitin disk Kirby-Bauer disk diffusion method was also found to be the least sensitive method; sensitivities were 85.3% and

70.9% with utilization of the 2004 and 2008 criteria, respectively.14

Of note, the diagnostic sensitivities for cefoxitin disk testing reported by Bemis et al. (85.3% and 70.9%) are higher than that of the work presented here (6.7% and 43.3%).

The reason for this difference is speculative, and may reflect increased accuracy via larger cohort size of that study, or regional strain differences. The study also did not restrict number of isolates included per patient; however, the frequency of such inclusions was not reported. Inclusion of concurrent or subsequent isolates from the same individual may have inadvertently selected for clonal isolates which were cefoxitin- sensitive. However, clonality is not restricted to the individual, and evaluation of clonality was not undertaken in this study, nor the study by Bemis et al. Despite this disagreement in sensitivity, the work presented here confirms the superior sensitivity of oxacillin Kirby-Bauer disk diffusion interpreted with 2004 CLSI criteria and the inferior sensitivity of cefoxitin disk diffusion in the evaluation of methicillin resistance in canine- origin S. pseudintermedius isolates in a geographically separate population.

Using 2008 interpretive criteria, all three test methods evaluated would have given what we consider to be an unacceptable level of false negative results. This may have lead to inappropriate treatment if susceptibility to other beta lactam antibiotics was identified and reported in isolates falsely determined to be methicillin susceptible. Our study suggests that application of the 2004 CLSI criteria for oxacillin disk diffusion and oxacillin broth microdilution test produces superior sensitivity for the detection of methicillin-resistant S. pseudintermedius in comparison to the 2008 criteria.

Furthermore, the findings presented here demonstrate that an unacceptably higher rate of false negative results occur with application of the 2008 CLSI criteria, consistent with the recent work published by Bemis et al. Therefore, it is advised that veterinary diagnostic laboratories abstain from using the 2008 CLSI criteria when evaluating methicillin resistance in canine S. pseudintermedius. The 2004 CLSI criteria for oxacillin Kirby-

Bauer disk diffusion and oxacillin broth microdilution should be used to evaluate methicillin resistance in canine S. pseudintermedius isolates. In addition, our findings confirm that cefoxitin disk diffusion, regardless of CNS or S. aureus CLSI interpretive guidelines, is an inappropriate screening test for methicillin resistance in S. pseudintermedius isolated from dogs.

Table 7: Current (2008) and previous (2004) Clinical and Laboratory Standards

Staphylococcus aureus.

Oxacillin broth microdilution (MIC, μg/ml) 2004 CLSI guidelines 2008 CLSI guidelines Susceptible Resistant Susceptible Resistant ≤0.25 ≥0.5 ≤2 ≥4 Oxacillin disk diffusion (zone diameter, mm) 2004 CLSI guidelines 2008 CLSI guidelines Susceptible Intermediate Resistant Susceptible Intermediate Resistant ≥18 — ≤17 ≥13 11–12 ≤10 Cefoxitin disk diffusion (zone diameter, mm) CNS CLSI guidelines S. aureus CLSI guidelines Susceptible Resistant Susceptible Resistant ≥25 ≤24 ≥22 ≤21

Table 8: Current (2008) and previous (2004) CLSI interpretive criteria results in canine mecA PCR positive S.

pseudintermedius.

Oxacillin broth microdilution Oxacillin disk diffusion Cefoxitin disk diffusion Zone Zone MIC 2004 2008 diameter 2004 2008 diameter CNS Staphylococcus aureus Isolate (µg/ml) criteria criteria (mm) criteria criteria (mm) criteria criteria 1 0.25 S S 0 R 24 R S 2 0.5 R S 14 R S 28 S S 3 1 R S 12 R I 25 S S 4 1 R S 12 R I 26 S S 5 1 R S 10 R R 27 S S 6 1 R S 1 R R 26 S S 66 7 2 R S 2 R R 24 R S 8 2 R S 2 R R 25 S S 9 4 R R 12 R I 25 S S 10 4 R R 4 R R 22 R S 11 4 R R 4 R R 25 S S 12 4 R R 9 R R 24 R S 13 4 R R 0 R R 25 S S 14 >4 R R 12 R I 20 R R 15 >4 R R 11 R I 26 S S 16 >4 R R 14 R S 26 S S 17 >4 R R 0 R R 25 S S 18 >4 R R 0 R R 21 R R 19 >4 R R 0 R R 24 R S 20 >4 R R 0 R R 24 R S

Key* MIC = Minimum inhibitory concentration; CNS = coagulase-negative staphylococci; S = Susceptible; R = Resistant;

I = Intermediate.

[Type a quote from the document or the summary Table 9: Current (2008) and previous (2004) CLSI interpretive criteria results in canine mecA PCR positive

S. pseudintermedius.

67 25 >4 R R 12 R I 26 S S

26 >4 R R 0 R R 23 R S 27 >4 R R 0 R R 24 R S 28 >4 R R 0 R R 22 R S 29 >4 R R 0 R R 24 R S 30 >4 R R 0 R R 25 S S ATCC 0.25 S S 21 S S 39 S S 29663 LMG 0.25 S S 24 S S 38 S S 22221 ATCC 0.25 S S 24 S S 39 S S 8325 ATCC 0.25 S S 20 S S 27 S S 2 9523 ATCC 0.25 S S 25 S S 37 S S 49545 ATCC >4 R R 0 R R 0 R R 43300 Key: * MIC = Minimum inhibitory concentration; CNS = coagulase-negative staphylococci; S = Susceptible; R = Resistant;

I = Intermediate. [Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting67 of the pull quote text box.] [Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box 3.6 Sources and manufacturers:

f. BD, Franklin Lakes, NJ

g. Difco Laboratories Inc ., Sparks, MD

h. Sigma-Aldrich, St. Louis, MO

i. Remel Inc., Lenexa, KS

j. Trek Diagnostic Systems, Cleveland, OH

k. Sensititre COMEQ3F panel, Trek Diagnostic Systems, Cleveland, OH

l. Qiagen DNeasy® Blood and Tissue Kit, Qiagen Inc., Valencia, CA

h. illustra™ puReTaq™ Ready-To-Go PCR Beads, GE Healthcare Technologies,

Piscataway, NJ.

i. PTC-100 Programmable Thermal Controller, MJ Research Inc., Watertown, MA.

Chapter 4: Development of Polymerase Chain Reaction Primers for Identification Of Staphylococcus aureus, Staphylococcus schleiferi, StaphylococcusiIntermedius and Staphylococcus pseudintermedius

4.1 Abstract

Pilot experiments to screen computer-generated and manually-developed PCR primers for S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius were performed using type culture control strains of staphylococci of interest. Target genes included hsp60, sodA, femA, and nuc. A total of 15 primers were designed and investigated with type control strains. Three of 15 primers (20%) failed to produce an amplicon of the predicted size in the target staphylococcal species. Three of 15 primers

(20%) produced an amplicon of predicted size strictly in S. aureus and S. schleiferi.. All

4 functional S. intermedius primers demonstrated cross amplification in S. pseudintermedius type strains LMG 22219 and LMG 22221. These primers were designed prior to recognition of S. pseudintermedius as a significant canine pathogen, and prior to banking of gene sequences of S. pseudintermedius. It was determined after S . pseudintermedius sequences were available, that significant gene homology between S. intermedius and S. pseudintermedius is present, with 91% and 99% homology in sodA and hsp 60 genes, respectively. Furthermore, identical to near-identical S .intermedius primer annealing site sequences were present and similarly located in these S.

69 pseudintermedius genes, indicating that homology was responsible for cross amplification with the sodA and hsp60 primers. One manually-designed primer targeting nuc consistently differentiated S. intermedius from the S. pseudintermedius type strains.

Three sodA primers for S. aureus, S. schleiferi, S. intermedius/pseudintermedius and one nuc primer for S. pseudintermedius were selected for further investigations of efficacy with clinical isolates based upon repeatable success in pilot studies (see Chapter 5).

4.2 Introduction

PCR is an attractive option for species identification of staphylococcal isolates because it carries the potential for high sensitivity, it is rapid, and more labor and cost effective than16srRNA sequencing. It may be more rapid than biochemical testing, and more accurate as biochemical tests often require subjective interpretations of color change, and may also be subject to intraspecies variability. PCR, however, will give a clear positive or negative result. The PCR technique involves strategic targeting and amplification segments of genes of high fidelity. Amongst the targeted species, these genes must also be sequence-variable in order to design unique primers flanking the amplicon of interest to produce amplicons of unique length. Amplicons are resolved by gel electrophoresis, with size dependent migration distance through the gel, producing species predictive patterns and identifiable fragment sizes.

Gene targets for PCR are often highly conserved to minimize intraspecies variability. The gene must also be present in all strains. Therefore, target genes are often chosen that are essential for the function of the organism. Both computer and manually

70 generated primers may be utilized; banked gene sequences form the basis of primer design and selection.

Superoxide dismutase (product of the sodA gene) is responsible for intracellular survival of staphylococci within macrophages, and had been utilized in PCR identification of S. hyicus, S. (pseud)intermedius and S. aureus.119, 120 This gene has also significantly contributed to the phylogeny of Staphylococcus and the recent reclassification of S. intermedius and identification of S. pseudintermedius in clinical settings were possible via sequencing of this gene.4,64 The femA gene encodes the factor essential for methicillin resistance, and has been used to identify human MRSA, S. epidermidis, S. hominis, S. saprophyticus, and S. simulans.107 The heat shock protein gene, hsp60, encodes a chaperone essential for prokaryotic and eukaryotic life. It has not yet been documented as a target gene for PCR in clinically-relevant staphylococci. This gene has contributed significantly to the phylogeny of Staphylococcus. 113

Thermonuclease, encoded on the nuc gene has been utilized to identify MRSA isolates, as well as S. (pseud)intermedius.124, 126

To the author’s knowledge, there is no one PCR method documented that identifies and distinguishes S. pseudintermedius, S. intermedius, and S. schleiferi. A recent PCR- RFLP technique targeting the pta locus was described that successfully identifies S. intermedius and S. pseudintermedius. This technique however has no additional utility for the species of interest, as it produces an identical pattern result for both S. schleiferi and S. aureus.36

4.3 Materials and methods

4.3.1 Type cultures and control isolates

Pilot experiments to screen PCR primers were performed using type culture control strains of staphylococci of interest. Type cultures of Staphylococcus epidermidis,

Escherichia coli, and Enterococcus faecalis were also used in pilot experiments to screen for specificity of primers. Staphylococcal type culture strains of interest were to be used as positive and negative controls for subsequent PCR experiments after primers were chosen. All reactions were performed a minimum of three times.

The following American Type Culture Collection (ATCC) specimens were used, with species and origin in parentheses, as catalogued by the ATCC: Staphylococcus aureus 25923, Staphylococcus intermedius 29663 (pigeon nares), Staphylococcus intermedius 49051 (origin not noted by ATCC), Staphylococcus intermedius 51874

(canine furuncle), Staphylococcus schleiferi subsp coagulans 49545 (canine external ear otitis), Staphylococcus epidermidis 49641 (clinical sample), Enterococcus faecalis 51299

(peritoneal fluid) and Escherichia coli 39418 (origin not noted by ATCC). A

Staphylococcus aureus isolate from the National Collection of Type Cultures (NCTC) of the Health Protection Agency, United Kingdom, NCTC 8325 (conjunctiva and corneal ulcer) was also used. Two strains of genotypically-confirmed S. pseudintermedius were obtained from the Laboratorium voor Microbiologie, University of Ghent (LMG) collection: 22219 (feline lung), and 22221 (canine ear).

At the time of writing, there are no deposited strains characterized as S. pseudintermedius in the ATCC and NCTC databases, with the exception of ATCC

49444/ NCTC 7428 which was originally deposited as S. aureus subsp. aureus and determined to be S. pseudintermedius via partial sodA gene sequencing (GenBank reference number FJ872832). To the author’s knowledge, there is no documented sequencing of the previously deposited S. intermedius ATCC isolates to confirm their identity, with the notable exception of S. intermedius ATCC 29663, the pigeon-origin type strain of S. intermedius established by Sasaki via sequencing of hsp60 and sodA genes. Both type strains LMG 22221 and LMG 22219 have been proven genotypically dissimilar to S. intermedius ATCC 29663, and therefore serve as type strains for S. pseudintermedius. Other type strains were not sequenced in that study.4 Therefore, it is possible that with gene sequencing, it may be established that previously banked S. intermedius are indeed S. pseudintermedius. ATCC 51874 is of particular interest, as it is of canine furuncle origin. Initial type strains for pilot studies were selected prior to studies establishing S. pseudintermedius as the primary pathogen of canine pyoderma, and also prior to deposition of S. pseudintermedius ATCC 49444, LMG 22221, and LMG

22219 gene sequences in GenBank. Following publication of the Sasaki study,4 LMG

22221 and LMG 22219 were obtained for further investigation.

All type cultures were prepared and subcultured according to manufacturers’ instructions. Single colony isolates were stored at -80ºC in brain heart infusion media.a

4.3.2 Primers and expected product sizes

4.3.2.1 Target gene selection

The genes femA, sodA, hsp60, and nuc were selected, as all are highly conserved genes and all contain species-specific sequences for S. aureus, S. schleiferi, S. intermedius and S. pseudintermedius deposited in GenBank (www.ncbi.nlm.nih.gov) with the exception of the S. pseudintermedius femA gene.

4.3.2.2 Primer selection

Beacon Designer computer softwareb was used to design unique PCR primers for

S. intermedius, S. aureus and S. schleiferi. Primer design for S. pseudintermedius was also included following publication of the Sasaki study that established its role as the primary pathogen in canine pyoderma. Primers were further validated for cross- hybridization using the GenBank database (www.ncbi.nlm.nih.gov). Fifteen forward and reverse primers pairs were designed to amplify segments of the femA, sodA, and hsp60 genes of discriminatory base pair length for S. aureus, S. intermedius, S. schleiferi, and S. pseudintermedius species. Primer sets selected were rated as ―good‖, ―very good‖, or

―excellent‖ by the software after analyzing for hairloop and primer-dimer formation.

Based on design and software analysis utilizing the GenBank database and NCBI

BLAST application (http://blast.ncbi.nlm.nih.gov), each species-specific designed primer was not anticipated to cross amplify with non staphylococcal species, and was not anticipated to amplify or cross hybridize with the other staphylococcal species of interest.

Primers were chosen to minimize hairpin and primer-dimer formation and to anneal within the temperature range of 50°C to 60°C.

Manually-designed primers were used for sodA and nuc genes as the Beacon

Designer software program could not suggest a discriminatory primer for S. pseudintermedius and S. intermedius, nor could it assign a ―good‖ designation to software-generated primer pairs. Manually designed primers were developed utilizing the BLAST application to directly align two specified species-specific sequences for the gene in question. Primers were designed to exploit differences in short base-pair sequences to produce species-specific amplification products of discriminatory size.

Primers were also chosen based upon GC base pair content (approximately 50% or higher) to maximize annealing stability. Primers chosen had predicted annealing between

50°C and 60°C when assessed by the Beacon Designer software.

4.3.2.3 Primer preparation

Lyophilized primer was obtainedc with a weight provided in µg. Molecular grade water was added to create a 1 mM stock solution.f The stock solution was diluted to create 10 μM working solutions. Stock and working solutions were stored at -80°C.

4.3.2.4 Primers used in pilot studies

Table 10: hsp60 primer sets utilized for pilot studies with expected amplicon size.

hsp 60 # Gene accession number Sense Primer Antisense Primer Product (bp) SA 1 AF053568 ATGGCTTGAACACTGAACTTG AGATTGGACGATTAGATTGAACC 201

SA 2 AF053568 CTCAAGCAATGATTCAAGAAGG TCAAGTTCAGTGTTCAAGCC 274

SS 3 AF033622 CCAGTAGGTATCCGTCAAGG CGATTTGCTCTAATAAAGGTAGG 382

SI 4 AF019773 GTTGGTAATGACGGTGTTATCTC CGCATCGCCTTCTACTTCG 270

SI 5 AF019773 AGTCGGTATTCGCCAAGGTATC TCCATCGCTTCAGAAATGATTCG 274

SP 6 AB327162 GCAATTTGACCGTGGCTAC CCTTCTACTTCGTCCGCTAC 189

Key: bp= base pair; SA= S. aureus, SS= S. schleiferi, SI= S. intermedius, SP= S. pseudintermedius

[Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box

Table 11: sodA primer sets utilized for pilot studies with expected amplicon size.

sodA # Gene accession number Sense Primer Antisense Primer Product (bp) SA 7 AY485191.1 ACAGAGTTAGAGCATCAATCAC GACCACCGCCATTATTACG 97

77 SS 8 AJ343955 TTCGTAATAATGGTGGTGGAC CTATCTTGGTTAGGAGTCGTTA 232

SI 9 AJ343914 CCATCACAGTAAGCATCATAACAC CAACAAGCCAAGCCCAACC 320

SP 10 AB327161 ATCCATCATAGCAAGCATCATAAC TGACCGCCACCATTATTACG 154

SP* 11 AB327161 TAGACAGCGTACCTGAAAACTTACGTA CAACAAGCCAAGCCCAACC 219

Key: bp= base pair, SA= S. aureus, SS= S. schleiferi, SI= S. intermedius, SP= S. pseudintermedius, *= manually designed

Table 12: femA primer sets utilized for pilot studies with expected amplicon size.

femA # Gene accession number Sense Primer Antisense Primer Product (bp) SA 12 M23918 TTATACTGTGACGATGAATGC CGCTACCAATGACAATGC 182

SS 13 AF099967 AATGGTGTGAAAGTCCGCTATC GCTTGATTCGCTTCTAGTTGTTG 320 78

SI 14 AF144662 TCAAGAAGCGGAACAATTACAAG ATTCAATGACATCTGCGTTATAGC 287

Key: bp= base pair, SA= S. aureus, SS= S. schleiferi, SI= S. intermedius, SP= S. pseudintermedius

Table 13: nuc primer set utilized for pilot studies with expected amplicon size.

Nuc # Gene accession Sense Primer Antisense Primer Product (bp) number SP* 15 AB327164 CAGGCGTTTTAATCCTCGTCAT GCTAATTTTACATTAAACATTTCGT 376

Key: bp= base pairs, SA= S. aureus, SS= S. schleiferi, SI= S. intermedius, SP= S. pseudintermedius, *= manually designed

[Type a quote from the document or the summary [Typeof an a interestingquote from point. the78 document You can orposition the summary the text of boxan interesting anywhere point.in the Youdocument. can position Use the the Text text Box boxTools anywhere tab to inchange the document. the formatting Use the of thTexte pull Box Toolsquote tab text to changebox.] the formatting of the pull quote text box.] 4.3.2.5 DNA extraction

Stored frozen isolates were thawed and streaked for isolation onto trypticase soy agar plate with 5% sheep bloodd and incubated for 24 hours at 35ºC. A single colony was selected with a sterile cotton tipped applicator that was subsequently submerged into brain heart infusion brotha and incubated at 35ºC for 24 hours. Genomic DNA was prepared from 1 ml of inoculated broth using a commercially available extraction kit per manufacturer instructions for gram positive bacteria.e

4.3.2.6 PCR conditions

A final PCR reaction volume of 20 µl was achieved by adding 1 µl of template

DNA to 19µl mastermix. Each 8x mastermix volume consisted of 106 µl of molecular grade waterf, 20 µl of 25mM MgClg, 4 µl of 10mM dNTPh, 20 µl reaction bufferi, and 4.8

µl of 10 µM forward and reverse primer solution.

Amplification was performed using a thermocyclerj under the following conditions: initial denaturation at 95ºC for 5 min followed by 30 cycles of 95ºC for 1 min, 54ºC for 1 min, 72ºC for 1 min, and a final extension step of 72ºC for 7 min.

Products were stored at 4ºC until use.

Prior to loading, 2 ul of bromophenol bluek was added to aid in visualization of reaction loading and electrophoretic migration.

4.3.2.7 Gel electrophoresis

TBE bufferl was used to create 0.5X running buffer. 125cc of TBE was added to

2.5 grams of technology grade agarosem and melted to create a 1% agarose gel. 6.125 μl

79 of 1% ethidium bromiden was added to the gel prior to curing in the gel mold. After curing, the gels were submerged in buffer, and stained samples loaded into the wells of the gel. A DNA laddero was added to flanking wells of each run. A no-template control was used in each run. Electrophoresis was performed at 180 volts for 90 minutes.

Gels were visualized under ultraviolet illumination. Gel images were captured and gel lanes digitally labeled by use of a image capture image software.p

4.4 Results of pilot studies

4.4.1 hsp60 primers

S. aureus primer 1 successfully produced a 201 base-pair product with S. aureus

NCTC 8325 and did not produce products for S. pseudintermedius LMG 22219 and LMG

22221, S. intermedius ATCC 29663, and S. schleiferi ATCC 49545. This was a repeatable result.

S. aureus primer 2 produced an approximately 450 base pair product for S. pseudintermedius LMG 22221 and LMG 22219. It did not produce a product for S. intermedius ATCC 29663, nor S. schleiferi ATCC 49545 or S. aureus NCTC 8325. This result was not repeatable, as in two subsequent runs, no product was amplified for the aforementioned type strains.

S. schleiferi primer 3 successfully produced a 382 base-pair product for S. schleiferi ATCC 49545. However, it also produced a 382 base pair amplicon for S. pseudintermedius LMG 22221 and LMG 22219 and S. intermedius ATCC 29663. This was a repeatable result.

S. intermedius primer 4 successfully produced a 270 base-pair product with S. intermedius ATCC 29663 and ATCC 49051, as well as S. pseudintermedius LMG 22219 and LMG 22221. Primer 4 did not produce amplicons for S. schleiferi ATCC 49545, nor

S. aureus NCTC 8325. This was a repeatable result.

S. intermedius primer 5 successfully produced a 274 base-pair amplicon for S. intermedius ATCC 29663 and ATCC 49051, as well as S. pseudintermedius LMG 22219 and LMG 22221. Primer 5 did not produce an amplicon for S. schleiferi ATCC 49545 nor

S. aureus NCTC 8325. This result was repeatable on a second occasion. However, on another occasion did not produce any amplicons for any of the aforementioned staphylococcal type strains.

S. pseudintermedius primer 6 successfully produced a189 base-pair amplicon for

S. pseudintermedius LMG 22219 and LMG 22221, as well as S. intermedius ATCC

296643 and ATCC 49051. Importantly, primer 6 did not produce an amplicon for S. intermedius type strain ATCC 29663. Primer 6 also did not produce an amplicon for S. schleiferi ATCC 49545, nor S. aureus 8325. This was a repeatable result.

4.4.2 sodA primers

S. aureus primer 7 successfully produced a 97 base pair amplicon for S. aureus

NCTC 8325 and ATCC 25923, and did not produce amplicons for S. pseudintermedius

LMG 22219 and LMG 22221, S. intermedius 29663, and S. schleiferi ATCC 49545. This was a repeatable result.

S. schleiferi primer 8 successfully produced a 232 base pair amplicon for S. schleiferi ATCC 49545. Primer 8 also did not produce an amplicon for S.

81 pseudintermedius LMG 22221 and LMG 22219; nor S. intermedius ATCC 29663 or

ATCC 49051. This was a repeatable result.

S. intermedius primer 9 successfully produced a 320 base pair amplicon for S. intermedius ATCC 29663 and ATCC 49051, as well as S. pseudintermedius LMG 22219 and LMG 22221. Primer 9 did not produce an amplicon for S. schleiferi ATCC 49545 nor

S. aureus NCTC 8325. This was a repeatable result.

S. pseudintermedius primer 10 successfully produced a154 base pair amplicon for

S. pseudintermedius LMG 22219 and LMG 22221, as well as S. intermedius ATCC

29663 and ATCC 49051. Primer 10 produced a 154 base pair product on one occasion for S. schleiferi ATCC 49545. Primer 10 never produced an amplicon for S. aureus

NCTC 8325, and failed to produce an amplicon for S. schleiferi ATCC 49545 on two other occasions.

S. pseudintermedius primer 11 did not produce any amplicons for the aforementioned type strains. This was a repeatable result.

4.4.3 femA primers

S. aureus primer 12 successfully produced a 182 base pair amplicon for S. aureus

NCTC 8325 on one occasion, but did not amplify on two occasions. On one occasion an amplicon of approximately 182 base pair was produced for S. pseudintermedius LMG

22219 and LMG 22221. Primer 12 did not produce amplicons for S. intermedius ATCC

29663, nor S. schleiferi ATCC 49545.

S. schleiferi primer 13 did not produce amplicons for any of the aforementioned type strains.

S. intermedius primer 14 successfully produced a 287 base pair amplicon for S. pseudintermedius LMG 22219 and LMG 22221 as well as S. intermedius ATCC 29663 and ATCC 49051. Primer 14 never produced an amplicon for S. aureus NCTC 8325 nor

S. schleiferi ATCC 49545.

4.4.4 nuc primer

S. pseudintermedius primer 15 successfully produced a 387 base pair amplicon for

S. pseudintermedius LMG 22219 and LMG 22221 as well as S. intermedius ATCC 49051 and ATCC 51874. Primer 15 did not produce an amplicon for S. aureus NCTC 8325 nor

S. schleiferi 49545.

4.5 Discussion

Three of 15 primers (20%) produced an amplicon of predicted size strictly in the target staphylococcal species, including S. aureus and S. schleiferi. However, three of 15 primers (20%) failed to produce an amplicon of the predicted size in the target staphylococcal species: primers 2, 11, and 13. Primer 11 was manually designed, rather than generated from Beacon Design software. Primer 2 produced an unanticipated amplicon of approximate 450 base pair size. This result was not repeatable. Sequencing of the amplicon following gel DNA purification, and subsequent BLAST analysis would be necessary to attempt to identify the amplicon gene and species of origin.

S. schleiferi primer 3 produced amplicons for S. intermedius ATCC 29663 and S. pseudintermedius LMG 22219 and 22221 at the hsp60 locus. S. aureus primer 12 amplified also S. pseudintermedius LMG 22219 and 22221 at the femA locus as well. At

83 present it should be noted that S. pseudintermedius LMG 22219 and LMG 22221 femA sequences have not yet been deposited. Therefore, the Beacon Design software could not have anticipated cross-amplification at the time of primer design. In the case of primer 3, targeting the hsp60 locus of S. schleiferi, cross amplification of S. intermedius ATCC

29663 and S. pseudintermedius LMG 222219 and LMG 22221 occurred. BLAST alignment of the S. schleiferi sequence of the hsp60 target with the available S. pseudintermedius hsp60 sequence can now be performed. BLAST alignment of these two sequences (accession numbers AF033622 and EU157486.1) indicates no significant sequence similarity between S. schleiferi and S. pseudintermedius in the hsp60 gene, as is also the case with S. schleiferi and S. intermedius (accession number AF019773).

Therefore, homology seems to be an unlikely explanation for cross amplification.

DNA contamination of primers, DNA extracts, or any of the reagents should be considered if an amplicon is produced in the incorrect species, or an unanticipated amplicon size is produced. However, the no template negative control and positive control was functional for all tests. Intraspecies variability may also explain cross- amplification phenomena. Although the selected PCR genes are highly conserved, interspecies genetic variability is present, whilst maintaining gene function, and thus exploited for PCR. Intraspecies variability may also similarly occur, and nevertheless result in a functional gene. Unfortunately, genetic breadth cannot be well assessed or predicted with design software, as such assessments are limited by the number of isolates with deposited sequences. Typically a very select group of well-characterized isolates have been sequenced for any given gene. Therefore, although screening of the NCBI nucleotide database via the BLAST function provides vital information for primer design,

84 it supplies limited information in terms of global intraspecies variability. Another explanation for unanticipated cross-amplification is incomplete anticipation of promiscuous primer annealing by the primer design software. Lastly, it should be noted that given the high sequence homology between the staphylococcal species of interest for any given gene, that Beacon Design software settings were adjusted for permissiveness.

For all four functional S. intermedius primers: 4, 5, 9, and 14, cross amplification of S. pseudintermedius type strains LMG 22219 and 22221 occurred. Of note, these pilot studies commenced prior to Sasaki’s investigation that established S. pseudintermedius as the true pathogen of canine pyoderma via hsp60 and sodA sequencing. Prior to this discovery, targeted amplification of S. pseudintermedius hsp60, sodA, and femA loci was not an initial goal of primer design. To the author’s knowledge, no gene sequences of S. pseudintermedius had been deposited at the time of initial primer design. Therefore, during initial primer development, not only was S. pseudintermedius unrecognized as a key canine pathogen requiring identification, but also cross-amplification of S. intermedius primers with S. pseudintermedius could not have been anticipated during primer screening due to absence of sequence banking. Importantly, the accession number used (AB327164) for initial S. intermedius primer design represents a deposited sequence of ATCC 29663, the sodA and hsp60 sequenced type strain of S. intermedius. However, for all 4 functional S. intermedius primers, cross amplification of S. pseudintermedius type strains LMG 22219 and LMG 22221 occurred.

The success of S. intermedius designed primers for amplification in S. pseudintermedius type strains is explained by the high level of sequence homology in these species at the hsp60 and sodA loci. BLAST program generated sequence alignment

85 indicates 99% sequence identity (547/552 base pair) between the S. pseudintermedius and

S. intermedius hsp60 genes (accession numbers AB327162 and AF019773), and 91% sequence identity (394/429 base pair) between the S. pseudintermedius and S. intermedius sodA genes (accession numbers AJ343914 and AB327161). When exact positions of primer binding sites were assessed in aligned S. pseudintermedius and S. intermedius sodA and hsp60 gene sequences, complete to near complete identity was present at primer binding sites.

Ironically, Sasaki’s sequencing of these highly homologous genes distinguished isolates of S. pseudintermedius from S. intermedius, forming the basis of the correct identification of S. pseudintermedius as the primary agent of canine pyoderma. Complete gene sequencing and computer-generated phylogenetic analysis was necessary to prove these species differences. In contrast, PCR may produce an identical or similarly sized amplicon in two bacterial species if primer binding site sequences are identical and similarly positioned in the gene. As such, this situation fails to exploit conserved interspecies sequence differences contained within the amplicon or elsewhere in the gene of interest. Therefore, amplicons of identical size were produced in S. pseudintermedius with the S. intermedius-designed primers. Because there is no currently banked sequence for the S. pseudintermedius femA gene, it may only be assumed that primer binding site sequence and position homology was similarly responsible for amplification in S. pseudintermedius LMG 22219 and LMG 22221 with primer 14.

Primer 15, targeting the nuc gene, was unique in consistently differentiating S. intermedius ATCC 29663 from the S. pseudintermedius type strains LMG 22219 and

LMG 22221. This S. pseudintermedius primer pair was manually designed to possess

86 this level of discrimination by annealing to S. pseudintermedius nuc regions non- homologous with those of S. intermedius. Therefore, there was selective amplification of

S. pseudintermedius with no intended S. intermedius amplification product. The nuc gene was selected for this task, as BLAST program generated sequence alignment of the

S. pseudintermedius nuc gene and the S. intermedius nuc gene indicated a relatively low sequence homology of 83% (1037/1239 base pair), in comparison with the greater homology of S. intermedius and S. pseudintermedius at the hsp60 (99%) and sodA loci

(91%). Importantly, the accession numbers (AB327164.1, AB327164) used to align the sequences and for primer design represent deposited sequences of type strains LMG

22219 and ATCC 29663, respectively, which have been identified via gene sequencing.

As previously discussed, to the author’s knowledge, there is no documented sequencing of the previously deposited S. intermedius ATCC isolates to confirm their identity, in light of recent discoveries. The notable exception is S. intermedius ATCC

29663, the pigeon-origin type strain of S. intermedius. Therefore, the possibility remains that human clinical isolate-origin S. intermedius ATCC 49051, and canine furuncle-origin

ATCC 51874 are indeed S. pseudintermedius. This would further explain the amplification of these type strains with the nuc gene primer 15, which did not produce an amplicon in the presence of S. intermedius ATCC 29663 DNA, but was functional for S. pseudintermedius LMG 22219 and LMG 22221.

4.6 Conclusion

Based upon reliable success in these pilot studies, the sodA primers 7, 8, and 9 for

S. aureus, S. schleiferi and S. intermedius/pseudintermedius, respectively and the nuc

87 primer 15 for S. pseudintermedius were selected. Primers are displayed in Table 8. The efficacies of the primers were further investigated with a series of biochemically identified canine isolates to determine PCR primer sensitivity and specificity (see

Chapter 5).

Table 14: Results for hsp60 pilot study primers

hsp 60 Product size for type strain (bp) # Expected size NCTC ATCC ATCC ATCC LMG ATCC (bp) 8325 49545 29663 49051 22221 22219 SA 1 201 201 0 0 0 0 0

SA 2 274 0 0 ~450* ~450* ~450* ~450*

SS 3 382 0 382 382 0 382 382

SI 4 270 0 0 270 270 270 270

SI 5 274 0 0 274* 274* 274* 274*

SP 6 189 0 0 189 189 189 189

Key: (*)= no product on one or more occasions, bp= base pair, SA= S. aureus, SS= S. schleiferi, SI-=

S. intermedius, SP= S. pseudintermedius

[Type a quote from89 the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.]

Table 15: Results for sodA pilot study primers

sodA Product size for type strain (bp) # Expected size NCTC ATCC ATCC ATCC LMG ATCC (bp) 8325 49545 29663 49051 22221 22219 SA 7 97 97 0 0 0 0 0

SS 8 232 0 232 0 0 0 0

90 SI

9 320 0 0 320 320 320 320

SP 10 154 0 154** 154 154 154 154 SP 11 219 0 0 0 0 0 0

Key: (**)=product on one or more occasions, bp= base pair, SA= S. aureus, SS= S. schleiferi,

SI-= S. intermedius, SP= S. pseudintermedius

[Type a quote from90 the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.]

Table 16: Results for femA pilot study primers femA Product size for type strain (bp) # Expected size NCTC ATCC ATCC ATCC LMG LMG (bp) 8325 49545 29663 49051 22221 22219 SA 12 182 182* 0 0 0 182* 182*

SS 13 320 0 0 0 0 0 0

SI 14 287 0 0 287 287 287 287

91 Key: (*)= no product on one or more occasions, bp= base pair, SA= S. aureus, SS= S. schleiferi,

SI-= S. intermedius, SP= S. pseudintermedius

Table 17: Results for nuc pilot study primer for S. pseudintermedius Nuc Product size for type strain (bp) # Expected size NCTC ATCC ATCC ATCC ATCC LMG LMG (bp) 8325 49545 29663 49051 51874 22221 22219 SP 15 376 0 0 0 376 376 376 376 Key: bp= base pair, SA= S. aureus, SS= S. schleiferi, SI-= S. intermedius, SP= S. pseudintermedius

[Type a quote from91 the document or the summary of an interesting point. You can position the text box anywhere in the document. Use the Text Box Tools tab to change the formatting of the pull quote text box.] Table 18. sodA and nuc primer sets selected for identification of S. aureus, S. schleiferi, and

S. intermedius/pseudintermedius with expected amplicon size.

sodA Sense Primer Antisense Primer Product (bp)

SA ACAGAGTTAGAGCATCAATCAC GACCACCGCCATTATTACG 97

SS TTCGTAATAATGGTGGTGGAC CTATCTTGGTTAGGAGTCGTTAC 232

SI, SP CCATCACAGTAAGCATCATAACAC CAACAAGCCAAGCCCAACC 320

Nuc Sense Primer Antisense Primer Product (bp)

92 SP CAGGCGTTTTAATCCTCGTCAT GCTAATTTTACATTAAACATTTCGT 376

Key: bp= base pairs, A= S. aureus, SS= S. schleiferi, SI-= S. intermedius, SP= S. pseudintermedius

[Type a quote from the document or the summary of an interesting point. You can position the text box anywhere in the document.92 Use the Text Box Tools tab to change the formatting of the pull quote text box.] 4.7 Sources and manufacturers:

a. BBL Brain heart infusion media, Becton Dickenson, Franklin Lakes, NJ

b. Beacon Designer software, Premier Biosoft International,Palo Alto, CA

c. Integrated DNA Technologies, Inc., Skokie, IL

d. BBL Trypticase soy agar with 5% sheep blood, Becton Dickenson, Franklin

Lakes, NJ

e. Qiagen DNeasy® Blood and Tissue Kit, Qiagen Inc., Valencia, CA

f. Mo Bio Laboratories, Carlsbad, CA

g. PCR Core Kit 25mM MgCl2 stock solution, Roche Diagnostics Corporation,

Indianapolis, IN

h. PCR Core Kit dNTP stock solution, 10nM, Roche Diagnostics Corporation,

Indianapolis, IN

i. PCR Core Kit Reaction Buffer 10x, Roche Diagnostics Corporation, Indianapolis,

IN PCR Core Kit Reaction Buffer 10x, Roche Diagnostics Corporation,

Indianapolis, IN

j. PTC-100 Programmable Thermal Controller, MJ Research Inc., Watertown, MA

k. 10X Blue Juice™ Gel Loading Buffer, Invitrogen Corporation, Carlsbad, CA

l. Lonza, Allendale, NJ

m. SeaKem Gold agarose, Fisher Scientific, Pittsburgh, PA

n. Ethidium bromide, 1% Solution Molecular Biology, Fisher Scientific, Pittsburgh,

o. 100 bp DNA ladder, Invitrogen Corporation, Carlsbad, CA

93 p. Gel Doc 2000 gel documentation system, bio-Rad Laboratories Inc., Hercules,

Chapter 5: Polymerase Chain Reaction and Biochemical Identification of Staphylococcus aureus, Staphylococcus schleiferi, Staphylococcus intermedius, and Staphylococcus pseudintermedius from the Skin and Mucous Membranes ff Dogs

5.1 Abstract

Validation experiments for computer-generated and manually-developed PCR primers for S. aureus, S. schleiferi, S. intermedius, and S. pseudintermedius were performed using clinical isolates of staphylococci of interest. A total of 91 isolates of S . pseudintermedius, S. schleiferi, and S. aureus previously identified via select biochemical testing or API ID 32 STAPH identification were used for validation experiments.

Identity of the isolates was confirmed via VITEK2 identification. There was 29%

(26/91) disagreement between VITEK2 results and results of previous identification methods and supplemental testing was necessary for final phenotypic identification in a majority of isolates. Identification of previously identified S. schleiferi via VITEK2 provided the greatest degree of disagreement, 82 % (22/28).

The sodA- based primer for S. pseudintermedius provided a sensitivity of 100% and a specificity range of 6.7-22%. The sodA-based primer for S. schleiferi provided a sensitivity of 83% and a specificity range of 56-75%. The sodA-based primer for S. aureus provided a sensitivity range of 97% and a specificity of 91%. The nuc- based primer for S. pseudintermedius provided a sensitivity range of 94-100% and a specificity range of 22-96% . Novel sodA, and nuc gene-based PCR did not provide sufficient

95 sensitivity and specificity to discriminate S. pseudintermedius, S. schleiferi, and S. aureus as a sole diagnostic test.

5.2 Introduction

The potential for high accuracy, cost-effectiveness, and rapid turn-around time makes PCR is an attractive option for species identification of staphylococcal isolates.

PCR provides a dichotomous positive or negative result, and is less cost and labor intensive compared to 16srRNA sequencing, the gold-standard of bacterial identification.

Manual kits and automated biochemical test systems assess of key characteristics of fermentation, enzyme expression, and susceptibility to select antimicrobials. Manual kits for species identification, such as the API ID 32 STAPH, a rely upon interpretation of color change in mini-test wells/cupules containing modified and chromogenic substrates.

Automated systems, such as the VITEK2, a provide a panel of positive and negative individual test results. Both manual and automated systems utilize databases to assign probability of the identification and pinpoint any individual test results discordant with the identification.

Amongst S. pseudintermedius, S. intermedius, S. schleiferi, and S. aureus there remain discrepancies regarding results of biochemical tests. For example, now that S. pseudintermedius designation now includes previously recognized S. intermedius in dogs,

S. pseudintermedius biochemical characteristics described in the initial classification schemes and reference texts prior to the reclassification event, and also characteristics described in reference texts, may not represent the true diversity of biochemical characteristics within this newly recognized species.4, 31 For example, S.

96 pseudintermedius was initially described and referenced as acetoin positive.3 However,

S. intermedius was described as acetoin negative both prior to and after this reclassification.30, 86 The relative infancy of S. pseudintermedius must be appreciated, as the databases for these products may not include S. pseudintermedius. This may lead to misidentification, particularly in human-oriented systems such as API ID 32 STAPH a or

VITEK2 a that may identify the isolate as S. intermedius.69

In specific clinical situations, such as cultures obtained from a superficial canine pyoderma lesion, key biochemical tests rather than a panel of multiple tests, may be performed to differentiate between coagulase positive agents of canine pyoderma: S. aureus, S. pseudintermedius, and S. schleiferi subsp. coagulans.79, 9 When such biochemical tests are used, whether a part of commercial systems or as singular tests, it should be recognized that the biochemical methods may have differing expected results.

In Sasaki et al, 90% of phylogenetically confirmed S. pseudintermedius were acetoin negative with the API ID 32 STAPHa system, and only 33% were negative with a stand- alone VP test.4

Although PCR may be able to circumvent these discrepancies, to the author’s knowledge, there is no one PCR method documented that identifies and distinguishes S. pseudintermedius, S. intermedius, and S. schleiferi. In the current study, we aim to validate PCR primers targeting sodA and nuc gene segments with biochemically identified clinical isolates of S. pseudintermedius, S. aureus, and S. schleiferi.

5.3 Materials and Methods

5.3.1 Isolates origin and previous identification methods

5.3. 1. 1 S. (pseud)intermedius isolates

Isolates previously identified as S. intermedius were selected from a pathogen bank established and described previously by Pinchbeck.10 The isolates selected were previously obtained from canine patients as described by Pinchbeck, and identified by the

API ID 32 STAPHa commercial identification system according to manufacturer’s instructions. Isolates had been stored at -80ºC in brain heart infusion mediab and had originated from a single colony from the cultured organism from each patient.

5.3.1.2 S.(pseud)intermedius selection criteria

Criteria for selection in the current study included: 1) previous identification of S. intermedius ≥ 99% via API ID 32 STAPHa system, 2) each isolate originated from a unique canine patient, and 3) isolate originated from pustules of canine bacterial folliculitis. The criterion of identification of S. intermedius, rather than S. pseudintermedius, was instituted prior to establishment of S. pseudintermedius as the primary pathogen of canine pyoderma. The API ID 32 STAPHa system, at the time of writing, does not include S. pseudintermedius in the result database.

5.3.1.3 S. schleiferi isolates

Isolates previously identified as S. schleiferi subsp. coagulans or S. schleiferi subsp. schleiferi were selected from a pathogen bank of canine isolates obtained from anal, nasal, axillary, and ears of healthy dogs and lesions of dogs with skin disease.

Isolates were frozen at -80ºC, in brain heart infusion mediab and were prepared from a single colony.

5.3.1.4 S. schleiferi selection criteria

The criteria used for selection of isolates included: 1) previous biochemical identification consistent with S. schleiferi subsp. coagulans or S. schleiferi subsp. schleiferi subsp coagulans (see section 5.3.1.7 )or 2) previous identification of S. schleiferi ≥ 99% via API ID 32 STAPHa system, 3) isolate originated from anal mucosa, nasal mucosa, or ears of healthy dogs; or originated from cutaneous lesions from dogs, and 4) each isolate originated from a unique canine patient.

The selection criterion 3 was expanded to include S. schleiferi from mucosal carriage sites in order to increase the number of isolates available for PCR validation, as

S. schleiferi is an infrequent pathogen of canine pyoderma in our population of patients.

5.3.1.5 S. aureus isolates

Isolates previously identified as S. aureus were selected from a bank of canine isolates obtained from anal, nasal, axillary, and ears of healthy dogs and lesions of dogs with skin disease. Isolates were frozen at -80ºC in brain heart infusion media,b and were prepared from a single colony.

5.3.1.6 S. aureus selection criteria

The criteria used for selection of isolates included: 1) previous biochemical identification consistent with S. aureus (see section 5.3.1.7 ), 2) isolate originated from

99 anal mucosa, nasal mucosa, or ears of healthy dogs, or skin lesions from dogs with cutaneous disease, and 3) each isolate originated from a unique canine patient.

Selection criteria was expanded for S. aureus to increase the number of isolates tested, as S. aureus is an infrequent pathogen of canine pyoderma in our population of patients.

5.3.1.7 S. aureus and S. schleiferi biochemical identification

Reagents from commercial sources were used whenever possible for biochemical testing, and all incubations occurred at 35° C in ambient air.

The isolates were subcultured from freezer storage and streaked onto mannitol salt agarb plate to assess fermentation of mannitol. Results were interpreted at 48 hours.

One isolated colony was further subcultured on trypticase soy agar b plates with 5% sheep blood. Colony morphology and hemolysis was described and reported. A gram stain was performed. The tube coagulase testb was interpreted at 4 and 24 hours.

The Voges-Proskauerc test was interpreted after 48 hours of incubation.

Bacteria were suspended in sterile, deionized water and adjusted to a 0.5

McFarland standard for Kirby-Bauer disk diffusion testing. Suspensions were swabbed onto Mueller-Hintonb agar to make lawns, and disks containing polymyxin B (300 U)b were applied. The plate was assessed after 24 hours of incubation at 35ºC, and the zone of inhibition diameter for the antimicrobial disc was recorded in millimeters.

100

5.3.2.1 VITEK2 biochemical identification

Banked isolates were stored at -80ºC in brain heart infusion mediab Banked isolates were streaked for isolation on trypticase soy agar b with 5% sheep blood and a representative colony was selected with a sterile cotton-tipped applicator to inoculate brain heart infusion media. The subculture was incubated for 24 hours at 35ºC. The isolate was stored at -80ºC until submission to the Ohio Department of Health (ODH) for identification via VITEK2 system.a See Appendix for biochemical tests included.

5.3.2.2 Supplemental biochemical identification

The isolates were subcultured from freezer storage and streaked onto trypticase soy agar supplemented with 5% sheep’s blood.b One isolated colony was further subcultured for subsequent biochemical identification and susceptibility testing.

For the slide agglutination test for clumping factor, a drop of sterile saline is placed on a glass slide. A sterile loop is used to choose several colonies from the agar.

The loop is emulsified in the saline. A loopful of plasma is added to the suspension. The test is positive if clumping occurs immediately.

The Voges-Proskauer testc was interpreted after 48 hours of incubation. Trehalose fermentation test: Phenol-redd tests of trehalosee and mannitolb fermentation were interpreted at 48 hours.

For β-glucuronidase and β-galactosidase tests, five drops of sterile distilled water was added to each test tube containing the test substrates. f Each test was heavily inoculated with a loopful of organism from a 24-hour subculture. A bright yellow color at any time during the 2 hour incubation was considered positive.

101

Table 19: Differential characteristics of S. aureus, S. schleiferi subsp. coagulans and schleiferi, S. intermedius, S. pseudintermedius, and S. chromogenes

D NitrateReduction OrnithineDecarboxylase

ClumpingFactor LatexCoagulase Urease B B Voges Proskauer

- -

Glucuronidase Galactosidase

Trehalose

Test

S. aureus + + d - - + + + -

S. schleiferi subsp. + _ - - + + d + - schleiferi

S. schleiferi subsp. - + + n n + - + n coagulans S. intermedius d + + - + - + + -

S. pseudintermedius - + + - + + + + n

S. chromogenes - - + - - - + + -

Key: +, positive; -, negative; d, 11-89% of strains positive; n, not determined; +-, 90% or more strains weakly positive

102

5.3.3 Type cultures and controls

DNA extracts of staphylococcal type culture strains of interest were used as positive and negative template controls for subsequent PCR experiments. The following

American Type Culture Collection (ATCC) specimens were used, with species and origin in parentheses, as catalogued by the ATCC: Staphylococcus intermedius 29663 (pigeon nares), and Staphylococcus schleiferi subsp coagulans 49545 (canine external ear otitis).

A Staphylococcus aureus isolate from the National Collection of Type Cultures (NCTC) of the Health Protection Agency, United Kingdom, NCTC 8325 (conjunctiva and corneal ulcer) was also used. Genotypically-confirmed of Staphylococcus pseudintermedius was used, and were obtained from the Laboratorium voor Microbiologie, University of Ghent

(LMG) collection, LMG 22219 (feline lung).

All type cultures were prepared and subcultured according to manufacturers’ instructions. Single colony isolates were stored at -80ºC in brain heart infusion mediab prior to DNA extraction.

5.3.4 Primers and expected product sizes

Beacon Designerg computer software was used to design unique PCR primers for

S. intermedius, S. aureus and S. schleiferi. Primers were designed utilizing sequences obtained from the GenBank search program, NCBI. Four forward and reverse primers pairs were selected based upon successful identification performances with type cultures

(Chapter 4). Three primer pairs selected were designed to amplify segments of the sodA gene, producing amplicons of discriminatory base pair (bp) length for S. aureus, S. intermedius, S. schleiferi. A primer pair was also manually designed and selected to amplify a segment of the nuc gene in S. pseudintermedius species (Table 20).

103

Table 20: sodA and nuc primer sets selected for identification of S. aureus, S. schleiferi, and

S. intermedius/pseudintermedius with expected amplicon size.

sodA Sense Primer Antisense Primer Product (bp)

SA ACAGAGTTAGAGCATCAATCAC GACCACCGCCATTATTACG 97

SS TTCGTAATAATGGTGGTGGAC CTATCTTGGTTAGGAGTCGTTAC 232

SI, SP CCATCACAGTAAGCATCATAACAC CAACAAGCCAAGCCCAACC 320

Nuc Sense Primer Antisense Primer Product (bp)

SP CAGGCGTTTTAATCCTCGTCAT GCTAATTTTACATTAAACATTTCGT 376

104

Key: bp= base pairs, A= S. aureus, SS= S. schleiferi, SI-= S. intermedius, SP= S. pseudintermedius

104

[

T 5.3.5 DNA extraction

Stored frozen isolates were thawed and streaked for isolation onto trypticase soy agar plate with 5% sheep blood band incubated for 24 hours at 37 ºC. A single colony was selected with a sterile cotton tipped applicator that was subsequently submerged into brain heart infusion brothb and incubated at 37ºC for 24 hours. Genomic DNA was prepared from 1 ml of inoculated broth using a commercially available extraction kit per manufacturer instructions for gram positive bacteria.h

5.3.6 PCR conditions

A final PCR reaction volume of 20 µl was achieved by adding 1 µl of template

DNA to 19µl mastermix. Each 8x mastermix volume consisted of 106 µl of molecular

i j j j grade water, 20 µl of 25 mM MgCl2, 4 µl of 10nM dNTP, 20 µl of 10x reaction buffer, and 4.8 µl of 10 µM forward and reverse primer solution.

Amplification was performed using a thermocyclerk under the following conditions: initial denaturation at 95ºC for 5 min followed by 30 cycles of 95ºC for 1 min, 54ºC for 1 min, 72ºC for 1 min, and a final extension step of 72ºC for 7 min.

Products were stored at 4ºC until use.

Prior to loading, 2 ul of 10X Blue Juice™ bromophenol blue loading bufferl was added to aid in visualization of reaction loading and electrophoretic migration.

The following type strain isolates were used with PCR validation experiments: S. intermedius ATCC 29663, S. pseudintermedius LMG 22219, S. schleiferi ATCC 49545, and S. aureus NCTC 8325. For each run with the sodA S. aureus primer pair, NCTC

8325 was run as a positive control. For each run with the sodA S. intermedius primer pair,

105

ATCC 29663 and LMG 22219 were used as positive controls. For each run with the nuc

S. pseudintermedius primer pair, ATCC 29663 and LMG 22219 were used as negative and positive controls, respectively. For each run with the sodA S. aureus primer pair,

NCTC 8325 was used as a positive control. For each run, a no template control was used.

5.3.7 Gel Electrophoresis

TBE buffer was used to create 0.5X lysis buffer.m 125cc of TBE was added to 2.5 mg of technology grade agarosen and melted to create a 1% agarose gel. Ethidium bromideo was added to the gel prior to curing in the gel mold. After curing, the gels were submerged in buffer, and stained samples loaded into the wells of the gel. A 100 bp

DNA laddern was added to flanking wells of each run. A no-template control was used in each run. Electrophoresis was performed at 180 volts for 90 minutes.

Gels were visualized under ultraviolet illumination. Gel images were captured and gel lanes digitally labeled by use of a image capture image software.p

5.4 Results

5.4.1 Isolates

Thirty isolates previously identified as S. intermedius by API ID 32 STAPH met the inclusion criteria. A total of 28 isolates previously identified as S. schleiferi subsp coagulans met the initial inclusion criteria. Eight isolates met the API ID 32 STAPH inclusion criterion, and 20 isolates via results of previous mannitol salt agar, coagulase,

Voges-Proskauer and polymyxin B Kirby-Bauer disk diffusion tests. A total of 33 isolates previously identified as S. aureus met the inclusion criteria via results of previous

106 mannitol salt agar, coagulase, Voges-Proskauer and polymyxin B Kirby-Bauer disk diffusion tests. The isolates were subsequently utilized for VITEK2 species confirmation and for use in PCR validation experiments.

5.4.2 VITEK2 Identification of Isolates

There were 91 total isolates evaluated, 65 (71%) with a VITEK2 identification in complete agreement with results of previous identification methods. Previously identified

S. schleiferi, had the least agreement, with 6 of 28 (21%) in complete agreement with results of previous identification methods.

5.4.2.1 VITEK2 Results: S. (pseud)intermedius identified previously via API ID 32

STAPH

For previously identified S. intermedius, there was 93% complete agreement with

VITEK2 identification (28/30). Supplemental biochemical tests formed the basis of a final identification of S. intermedius in all 30 isolates. Two isolates were determined to not be of staphylococcal origin. VITEK2 identification results and results of supplemental coagulase and Voges-Proskauer testing are presented in Table 21.

107

Table 21: VITEK2 Identification of canine-origin isolates previously identified via

API ID 32 STAPH as S.(pseud) intermedius with supplemental slide agglutination and Voges-Proskauer tests

Isolate # Vitek Identification Clumping VP β-Gal Final ODH Identification (n=30) factor 4370 S. intermedius - - S. intermedius 4473 S. intermedius + - S. intermedius 4738 S. intermedius + - S. intermedius 4832 S. intermedius - - S. intermedius 470 S. intermedius + - S. intermedius 713 S. intermedius + - S. intermedius 769 S. intermedius + - S. intermedius 873 S. intermedius - - S. intermedius 929 S. intermedius + - S. intermedius 1559 S. intermedius + - S. intermedius 1701 S. intermedius + - S. intermedius 1956 S. intermedius + - S. intermedius 2105 S. intermedius + - S. intermedius 2291 S. intermedius - - S. intermedius 2313 S. intermedius + - S. intermedius 2360 S. intermedius + - S. intermedius 2388 S. intermedius + - S. intermedius 2419 S. intermedius + - S. intermedius 2440 S. intermedius + - S. intermedius 2459 S. intermedius + - S. intermedius 2669 S. intermedius + - S. intermedius 3092 S. intermedius + - S. intermedius 3134.2 S. intermedius + - S. intermedius 3161 S. intermedius + - S. intermedius 3213 S. intermedius - - S. intermedius 3269 S. intermedius - - S. intermedius 3305 S. intermedius + - S. intermedius 3386 S. intermedius - - S. intermedius 2219 S. intermedius/aureus + - + S. intermedius 508 S. lugdunensis + + S. intermedius Key: --= negative, += positive, VP= Voges-Proskauer Test f, β-G= β-galactosidase test,

108

5.4.2.2 VITEK2 results for previously identified S. schleiferi

Eight isolates were identified as S. schleiferi by the API ID 32 STAPH system.

Twenty isolates were identified as S. schleiferi via previously described individual biochemical testing and polymyxin B Kirby-Bauer disk diffusion. There were 12/28

(42%) isolates with a final identification of S. schleiferi. Of previously identified S. schleiferi isolates, there was 21% complete agreement with VITEK2 identification (6/28).

Supplemental biochemical tests were performed to confirm the identification of S. schleiferi subsp schleiferi or S. schleiferi subsp coagulans in the 12 isolates. VITEK2 identification results and results of supplemental coagulase and Voges-Proskauer testing are presented in Table 22.

109

Table 22: VITEK2 identification and supplemental test results of previously identified canine- origin S. schleiferi

Supplemental Tests n=28 Vitek Identification C V β M T U L Final ODH ID 509* S. schleiferi - - - S. schleiferi 1560* S. schleiferi + + S.subsp.coagulans 2388* S. schleiferi - - + S. subsp. coagulans 0118 S. schleiferi - + S. subsp. schleiferi 0181 S. schleiferi - - S. subsp. schleiferi 0251 S. schleiferi + + S. subsp. coagulans 3134* S. aureus + - S. subsp. coagulans 0115 S. aureus + - S. subsp. coagulans 149 S. aureus + + - S. subsp. coagulans 3222* S. chromogenes - + + + S. subsp. schleiferi 0267 S. chromogenes - + - S. subsp. schleiferi 2233* S. hyicus + + - S. subsp. coagulans 0154 S. intermedius + - S. intermedius 063 S. schleiferi/ chromogenes/ - + + + S. chromogenes warneri 049 S. chromogenes/hyicus/ - + - + S. chromogenes schleiferi 052 S. chromogenes/hyicus/ - + - + S. chromogenes schleiferi 058 S. chromogenes/ hyicus/ - + - + S. chromogenes Schleiferi 0217 S. chromogenes/hyicus - - - + S. chromogenes schleiferi 0237 S. chromogenes/hyicus/ - - - + S. chromogenes schleiferi 0102 S. hyicus/chromogenes + + - + S. chromogenes

0165 S. hyicus/chromogenes + + - + S. chromogenes 0238 S. hyicus/chromogenes - + - + S. chromogenes 0249 S. hyicus/chromogenes - + - + S. chromogenes 2626* S. aureus/chromogenes - + - + + S. chromogenes 0206 S. + - - + - S. chromogenes aureus/chromogenes/hyicus 290 S. aureus/chromogenes + + - + - S. chromogenes 0152 Enterococcus hirae - - E.hirae 70304 Gram negative rods + - N/A *

Key: *= identified previously by ID 32 API Staph, b n= negative, p= positive, C= slide agglutination test, V= Voges-Proskauer Test f, β= β-glucuronidase test, M= mannitol fermentation test, T= trehalose fermentation, U= urease production test, L= latex test; S. subsp. coagulans= S. schleiferi subsp. coagulans, S. subsp. schleiferi = S. schleiferi subsp. schleiferi.

110

5.4.2.3 VITEK2 Results for Previously Identified S. aureus

Of previously identified S. aureus isolates, there was 85% complete agreement with VITEK2 identification (29/34). Supplemental biochemical tests formed the basis of a final identification of S. aureus in all 97% (33 of 34) isolates. VITEK2 identification results and results of supplemental coagulase and Voges-Proskauer testing are presented in Table 23.

111

Table 23: VITEK2 identification and supplemental biochemical test results of

previously identified canine- origin S. aureus

Supplemental Tests Isolate # Vitek Identification C V β-1 β -2 O N L Final ODH ID (n=33) 03 S. aureus + - S. aureus 0031 S. aureus + - S. aureus 0070 S. aureus + - S. aureus 0078 S. aureus + - S. aureus 0095 S. aureus + - S. aureus 0083 S. aureus + - S. aureus 0255 S. aureus + + S. aureus 0283 S. aureus + + S. aureus 0291 S. aureus + - S. aureus 0290 S. aureus + - S. aureus 0279 S. aureus + + S. aureus 0270 S. aureus + + S. aureus 0220 S. aureus + - S. aureus 0261 S. aureus + + S. aureus 0212 S. aureus + - S. aureus 0223 S. aureus + - S. aureus 0233 S. aureus + - S. aureus 0222 S. aureus + - S. aureus 0003.1 S. aureus + - S. aureus 0236 S. aureus + + S. aureus 0226 S. aureus + - S. aureus 0250 S. aureus + + S. aureus 0251 S. aureus + + S. aureus 0195 S. aureus + + S. aureus 0109 S. aureus + - S. aureus 0169 S. aureus + + S. aureus 0136 S. aureus + - S. aureus 0003.2 S. aureus + - S. aureus 0117 S. aureus + - S. aureus 0154.2 S. intermedius + - + S. intermedius 0133 S. chromogenes + - + + S. aureus 328 S. lugdenensis + - - S. aureus 0237 S. aureus/hyicus/ S. aureus + + - - Schleiferi 0280 S. aureus/intermedius + + - S. aureus Key: + = positive, - = negative. C= slide agglutination test, V= Voges-Proskauer f Test, β-1= β-glucuronidase test, β-2= β-galactosidase test, O= ornithine decarboxylase test, N= nitrate reduction test, L= latex test

112

5.4.3 PCR Identification of isolates

5.4.3.1 PCR Identification of S. pseudintermedius isolates

Isolates with a final identification of S. intermedius presented in the preceding text will be referenced as S. pseudintermedius, as it is now accepted that biochemical identification of S. intermedius in the dog may be considered consistent with identification of S. pseudintermedius.

PCR results for individual isolates are described in Table 23. A total of 33 isolates were evaluated. Sensitivity and specificity results for S. intermedius sodA primers are displayed in Tables 25 and 26. Sensitivity and specificity results for S. pseudintermedius nuc primers are displayed in Tables 27 and 28.

The sensitivity of the S. intermedius sodA primers was 100% for S. pseudintermedius isolates. The specificity was 29% for the first run with all isolates. The primers were run utilized with S. aureus isolates a second time. The second run provided fewer false positive results in the S. aureus isolates, with a specificity of 40%. There were no repeat extractions of S. aureus between the two runs, but the primers were re- aliquotted.

The sensitivity of the S. pseudintermedius nuc primers was 94% for the S. pseudintermedius isolates, and the specificity of the primers was 97% with the first run with all isolates. The primers were run with S. pseudintermedius isolates a second time.

The second run provided more false negative positive results in the S. pseudintermedius isolates, with a sensitivity of 61%. There were no repeat extractions of S. pseudintermedius between the two runs, but the primers were re-aliquotted.

113

Table 24: PCR results for ODH confirmed canine-origin S. pseudintermedius

utilizing sodA and nuc primers.

Isolate SI SS SA SP.1 SP.2 (n=31) 4370 + - - + + 4473 + - - + + 4738 + - - + + 4832 + - - + + 470 + - - + + 713 + - - + + 769 + - - + - 873 + - - + - 929 + - - + - 1559 + - - + + 1701 + - - + + 1956 + - - + + 2105 + - - + + 2291 + - - + + 2313 + - - + + 2360 + - - + + 2388 + - - + + 2419 + - - + - 2440 + - - + - 2459 + - - + - 2669 + - - + - 3092 + - - + - 3134.2 + - - + - 3161 + - - - - 3213 + - - + - 3269 + - - + + 3305 + - - + + 3386 + -- -- + + 2219 + - - + + 508 + - - - - 0154 + + - + + Total Pos 31 1 0 29 19 Key: += positive, - = negative, SI= S. intermedius primers, SA= S. aureus primers, SS= S. schleiferi primers, SP.1=S. pseudintermedius primers, run 1; SP.2= S. pseudintermedius primers, run 2.

114

Table 25: Sensitivity and specificity of sodA S. intermedius primers; first run results for ODH-confirmed S. pseudintermedius, S. schleiferi, and S. aureus.

S. pseudintermedius Biochemical Biochemical

+ -

PCR + 31 42

PCR - 0 3

Sensitivity= 100% (31/31) Specificity= 6.7 (3/45)

Table 26: Sensitivity and specificity of sodA S. intermedius primers; second run results for ODH-confirmed S. aureus included.

S. pseudintermedius Biochemical Biochemical + - PCR + 31 35 PCR - 0 10

Sensitivity= 100% (31/31) Specificity= 22% (10/45)

Table 27: Sensitivity and specificity of nuc S. pseudintermedius primers; first run results for ODH-confirmed S. pseudintermedius, S. schleiferi, and S. aureus.

S. pseudintermedius Biochemical Biochemical + - PCR + 29 2 PCR - 2 43

Sensitivity= 94% (29/31) Specificity= 96% (43/45)

115

Table 28: Sensitivity and specificity of nuc S. pseudintermedius primers; sensitivity for second run results of S. pseudintermedius included.

S. pseudintermedius Biochemical Biochemical + - PCR + 19 2 PCR - 12 43

Sensitivity= 61% (19/31) Specificity= 96% (43/45)

5.4.3.2 PCR Identification of S. schleiferi isolates

PCR results for individual isolates are described in Table 15a. A total of 12 isolates were evaluated. Sensitivity and specificity results for S. schleiferi sodA primers are displayed in Tables 30 and 31.

The sensitivity of the S. schleiferi sodA primers was 83% for S. schleiferi isolates.

The specificity was 79% for the first run with all isolates. The primers were run with S. aureus isolates a second time. The second run demonstrated more false positive results in the S. aureus isolates, with a specificity of 64%. S. aureus isolates 0195 and 223 were re- extracted between runs. After repeating the extraction for the two isolates, isolate 0195 was no longer positive. The remaining isolate extractions were unchanged.

116

Table 29: PCR Results for ODH confirmed canine-origin S. schleiferi utilizing sodA and nuc primers

Isolate # SI SS SA SP (n=12) 509 + + - - 1560 + + - + 2388 - + - - 0118 + + + - 0181 + + + - 0251.1 + + + - 3134.1 + - - - 0115 + - + - 149 + + - - 3222 - + - - 0267 + + - - 2233 + + - - Total Pos 10 10 4 1 Key: += positive, -= negative, SI= S. intermedius primers, SA= S. aureus primers, SS= S. schleiferi primers, SP.1= S. pseudintermedius primers, run 1; SP.2= S. pseudintermedius primers, run 2.

Table 30: Sensitivity and specificity of novel PCR for sodA S. schleiferi primers; first run results for S. pseudintermedius, S. schleiferi, and S. aureus.

S. schleiferi Biochemical + Biochemical - PCR + 10 16 PCR - 2 48

Sensitivity= 83% (10/12) Specificity= 75% (48/64)

117

Table 31: Sensitivity and specificity of novel PCR for sodA S. schleiferi primers; specificity for second run results of S. aureus included.

S. schleiferi Biochemical Biochemical + - PCR + 10 28 PCR - 2 36

Sensitivity= 83% (10/12) Specificity= 56% (36/64)

5.4.3.3 PCR Identification of S. aureus isolates

PCR results for individual isolates are described in Table 16a. A total of 12 isolates were evaluated. Sensitivity and specificity results for S. aureus sodA primers are displayed in Tables 33 and 34.

The sensitivity of the S. aureus sodA primers was 97% for S. aureus isolates. The specificity was 91% for the first run with all isolates. The primers were run with S. schleiferi isolates a second time. The second run demonstrated 27 false positive results in the S. schleiferi isolates, with a specificity of 37.1%.

118

Table 32: PCR Results for ODA confirmed canine-origin S. aureus utilizing sodA and nuc primers.

Isolate # SI.1 SI.2 SS.1 SS.2 SA SP (n=33) 03 + + - + + - 0031 + + - + + - 0070 + + - + + - 0078 + + + + + - 0095 + + + + + - 0083 + - - - + - 0255 + + - + + - 0283 + + - + + - 0291 + - + + + - 0290 + + - + + - 0279 + + + + + - 0270 - - - - + - 0220 + + - - + - 0261 + + - + + - 0212 + + + + + - 0223 + + + - + + 0233 + + - + + - 0222 + + + + + - 0003.1 + + + + + - 0236 + + + + + - 0226 + + + + + - 0250 + + - + - - 0251 + - - + + - 0195 + + - - + - 0109 + + - + + - 0169 + + + + + - 0136 + + - + + - 0003.2 + - + + + - 0117 + + + + + - 0133 + - + + + - 328 + + - + + - 0237 - - + + + - 0280 + - - - + - Total Pos 31 25 15 27 32 1 Key: += positive, -= negative, SI= S. intermedius primers, SA= S. aureus primers, SS= S. schleiferi primers, SP.1= S. pseudintermedius primers, run 1; SP.2= S. pseudintermedius primers, run 2.

119

Table 33: Sensitivity and specificity of novel PCR for ODH confirmed canine-origin S. aureus utilizing sodA S. aureus primers.

S. aureus Biochemical + Biochemical - PCR + 32 4 PCR - 1 39

Sensitivity= 97% (32/33) Specificity= 91% (39/43)

Table 34: Sensitivity and specificity of novel PCR for ODH confirmed canine-origin

S. aureus utilizing sodA S. auresu primers; specificity for second run results for S. aureus included.

S. aureus Biochemical Biochemical + - PCR + 32 28 PCR - 1 16

Sensitivity= 97% (32/33) Specificity= 37% (36/64)

5.4.3.3 PCR Identification of ODH identified S. chromogenes isolates

5.4.3.3.1 Biochemical characteristics of ODH identified S. chromogenes isolates

Eight isolates (049, 052, 058, 0102, 0165, 238, 249 and 290) met the criteria for identification of S. schleiferi as outlined in Chapter 3. Briefly, they were lactose and trehalose fermentation positive (via VITEK2), Voges-Proskauer positive (with supplemental testing) and historically mannitol salt agar negative (via initial inclusion criteria for Chapter 5).

120

5.4.3.3.2 Results of PCR Identification of ODH identified S. chromogenes isolates

PCR results for individual isolates are described in Table 35. A total of 13 isolates were identified as S. chromogenes. These isolates were not included in previous calculations for specificity given their biochemical similarity to S. schleiferi.

Table 35: PCR Results for isolates identified by ODH as S. chromogenes utilizing utilizing sodA and nuc primers

Isolate # SI SS SA SP (n=13) 049* + + - - 052* + + - - 058* - + - - 0102* - + + - 0165* + + + - 238* + + + - 249* + + - - 290* - + - - 063 + + - - 0206 + + - - 0217 + + + - 0237 - + + - 2626 - + - - Total Pos 15 18 7 1

Key: += positive, -= negative, SI= S. intermedius primers, SA= S. aureus primers, SS= S. schleiferi primers, SP.1= S. pseudintermedius primers, run 1; SP.2= S. pseudintermedius primers, run 2. *=8 isolates biochemically consistent with S. schleiferi identified by ODH as S. chromogenes

121

5.4.3.3 PCR Identification of type strain isolates

Primer pairs produced expected results in all positive control type strains with no false negative results. For each run with the nuc S. pseudintermedius primer pair, ATCC

29663 and LMG 22219 provided a negative and positive result, respectively. For each run, a no template control was used and was negative.

5.5 Discussion

Accurate identification of the isolates was essential to the validation of the PCR, and contradictions in identification of isolates must be evaluated critically. The VITEK2 system when used in isolation, did not demonstrate complete agreement with previous identification methods, particularly in previously identified S. schleiferi isolates, regardless of the previous method of identification: API ID 32 STAPH identification or stand-alone testing.

Of interest were eight isolates that satisfied criteria for identification of S. schleiferi as outlined in Chapter 3, but were assigned a final identification of S. chromogenes by the ODH as a result of supplemental urease testing. The 8 isolates were determined to be S. chromogenes because they were urease positive, a result contradictory to the identification of S. schleiferi as reported by VITEK2. However, S. schleiferi subsp. coagulans is urease positive. S. chromogenes, like S. schleiferi, is anticipated to be lactose and trehalose fermentation positive. However, it should be

Voges-Proskauer negative, and all 8 isolates were Voges-Proskauer positive. Therefore it is proposed that the 8 isolates in question (049, 052, 058, 0102, 0165, 238, 249 and 290) be interpreted as S. schleiferi and considered for inclusion in PCR validation. Expected

122 biochemical results for S. schleiferi subsp schleiferi, S. schleiferi subsp. coagulans, and S. chromogenes are displayed in Table 19.

The basis for identification of S. chromogenes, formed on a urease and slide agglutination results, was tenuous in some isolates. Of the 8 isolates, 3 were slide agglutination test positive, inconsistent with the final identification of S. chromogenes by the ODH. Further, the combination of a urease positive result and clumping factor positive result, present in these 3 isolates, was not consistent with the expected results for

S. schleiferi subsp. coagulans, S. schleiferi subsp. schleiferi nor S. chromogenes. A false negative agglutination result would explain this incongruous result pair. False positive results for the slide agglutination test are not unusual, as they may occur with tests read after 10 seconds has passed.30 Latex agglutination tests for clumping factor may have a higher sensitivity and specificity than slide agglutination tests. A latex agglutination coagulase test was performed in only one of the isolates in question, isolate 290.

Although identified as S. chromogenes, the negative latex result does not rule out S. schleiferi subsp schleiferi identification in this isolate.

A total of 14/28 isolates (50%) previously identified as S. schleiferi were assigned a final identification by the ODH incongruous with their Voges-Proskauer test; 4 isolates with a negative result identified as S. schleiferi, and 10 isolates with a positive result identified as S. chromogenes.

One isolate (0154) previously identified as S. schleiferi, was identified as S. intermedius via VITEK2 with a probability of 99.00. This isolate was previously identified as S. schleiferi subsp coagulans via the aforementioned biochemical tests and polymyxin B Kirby-Bauer disk diffusion. In addition to the VITEK2 results, a

123 supplemental Voges-Proskauer test was negative; supportive of the identification of S. pseudintermedius.

Two isolates previously identified as S. schleiferi were determined to be morphologically and phenotypically inconsistent with the genus Staphylococcus. Isolate

70304, previously identified as S. schleiferi by API ID 32 STAPH, was found to contain gram negative rods. No further identification was performed. VITEK2 identified isolate

0152 as Enterococcus hirae with a probability of 98.71. Given that the isolates were previously identified in the past via the API ID 32 STAPH system, it is most feasible that the culture samples were contaminated.

In comparison to isolates previously identified as S. schleiferi, those previously identified as S. (pseud)intermedius, displayed a higher level of agreement with the

VITEK2 results, with only two isolates (2219 and 508) yielding results other than S. intermedius. However isolate 508 was Voges-Proskauer test positive, a result unexpected for S. intermedius. Also, a total of 7 isolates (23%) were assigned a final identification of

S. intermedius with a negative clumping factor result.

The VITEK2 system also had a relatively high level of agreement for isolates previously identified as S. aureus with only 5/33 (15%) yielding results other than S. aureus. However, final identifications contradictory to the Voges-Proskauer supplemental test occurred in 22/33 of these isolates (65%).

One isolate previously identified as S. aureus, 0154.2, was identified as S. intermedius via VITEK2 with a probability of 99.00. In addition to the VITEK2 results, a supplemental Voges-Proskauer test performed was negative and a β-galactosidase test was positive; supportive of the identification of S. intermedius.

124

The VITEK2 system provides convenience, precision and the ability to assess 43 phenotypic features as well as assign a probability of identification. However, supplemental tests were required in a majority of isolates, particularly for identification of S. schleiferi. Subjective assessments were necessary in the presence of contradictory results.

The inconsistencies, in previous phenotypic identification with VITEK2 identification, well as incongruous biochemical results relative to final ODH identifications, highlight the subjectivity and fallibility of phenotypic identification methods. These are the quandaries we sought to avoid with a PCR methodology.

Moreover, in order to properly validate our novel PCR, definitive identification of our isolates is essential.

Therefore, a more costly approach, sequencing of the 16srRNA locus, or the genes sodA or hsp60 locus is optimal for identification of these isolates and would have provided indisputable identifications of including S. pseudintermedius versus S. intermedius. Sequencing may also be utilized in a limited subset of isolates, namely those identified as S. chromogenes that possess phenotypic features consistent with S. schleiferi subsp. coagulans. Such sequencing would prove that VITEK2 misidentified S. schleiferi isolates, or if confirmatory for S. chromogenes would suggest that S. chromogenes may be underappreciated as a commensal of canine mucous membranes, or agent in canine pyoderma, depending on method and location of specific isolate retrieval.

The most sensitive primer pair was the sodA-based primer for S. aureus, with

100% sensitivity. Unfortunately, because the specificity was merely 29%, in isolation this test is acceptable for screening at best. S. aureus, specifically MRSA would

125 potentially be the most important organism to identify given the increased potential for zoonosis. At this point in time, because the PCR requires a minimum processing time of

24 hours to obtain a pure isolate, the mannitol salt agar screen provides a reliable screening and confirmatory test for S. aureus that can be reported within 24 hours. The mannitol salt agar screen has a reported sensitivity of 100% and specificity of 100% in human isolates of S. aureus,163 with only rare MSA negative fermenting isolates have been reported.164

The nuc-based S. pseudintermedius primer may possess the ability to discriminate

S. intermedius from S. pseudintermedius. However, to further assess this, previously reported ATCC S. intermedius 45901 and 51874 should be sequenced to confirm they are indeed S. pseudintermedius and not S. intermedius as reported. This discriminative ability should be confirmed by using sequencing-confirmed isolates of S. intermedius and

S. pseudintermedius. The ability to discriminate may be useful in a research setting; however for a diagnostic in a practical small animal veterinary hospital setting it is not necessary, as it is presumed that S. pseudintermedius is the pathogen of the dog and furthermore if both S. intermedius and S. pseudintermedius contribute to pyoderma, such identification would not impact treatment nor current interpretation of zoonotic risk. Of note this primer pair was the most sensitive (94%) and specific (97%) primer pair.

However, one run provided a sensitivity of 61%. This variability is concerning and further runs would need to be preformed to determine the accuracy of the diagnostic. In a research setting, or practical setting, a PCR that was multiplexed also with primers for mecA, may be a useful tool for the detection of methicillin-resistant S. pseudintermedius, a pathogen that appears to be increasing in prevalence in small animal practice.14

126

The least sensitive primer pair was the sodA-based primer for the identification of

S. schleiferi. This is unfortunate, as this species is often the most challenging to identify via biochemical methods, as evidenced by lack of agreement found in this study, and also reported variability and undetermined biochemical testing results (see Table 1, Chapter

2).

There is neither a highly sensitive nor specific means of identifying all of the species of interest when all primers are assessed as a group. As noted in Chapter 4, there were additional primers developed that appeared to be functional with pilot testing, specifically the femA-based primer for S. intermedius/S. pseudintermedius, and the hsp60-based primer for S. aureus. Other genes may also be explored for design of primers, such as the elongation factor tu gene, tuf. Importantly, sequence confirmation of

S. schleiferi isolates would be ideal for PCR validation purposes, particularly in this species.

127

Table 36: Differential characteristics of, S. schleiferi subsp. coagulans. S. schleiferi

subsp. schleiferi, and S. chromogenes.

Expression of Fermentation of

lamidase

esistance

Glucosidase

Trehalo Mannitol Turanose

Glucuronidase Galactosidase

- - -

Pyrrolidonyl ar Pyrrolidonyl Urease B B B production Acetoin Maltose Lactose Sucrose

Clumping Factor Clumping r B Polymyxin

Coagulase D D D S. chromogenes - - d + + - - - - + + + d d +

S. schleiferi subsp. - + + - - - + + - d - - - - - schleiferi

S. schleiferi subsp. + - n + n n n + n - d n - d d coagulans

Key: +, positive; -, negative; d, 11-89% of strains positive; n, not determined.

5.6 Conclusion

Novel sodA, and nuc gene-based PCR did not provide sufficient sensitivity and specificity to discriminate S. pseudintermedius, S. schleiferi, and S. aureus as a sole diagnostic test. The S. pseudintermedius nuc-based primer was the most sensitive and specific PCR test, and may be useful as a adjunct diagnostic or developed as a multiplex

PCR to screen for methicillin-resistant S. pseudintermedius. The conflicting results of previous select biochemical tests and API ID 32 STAPH in comparison with VITEK2

128 results is supportive of the notion that identification of S. schleiferi is method-variable.

Sequenced isolates should be considered for use in future validation experiments.

5.7 Sources and Manufacturers:

a. bioMerieux Hazelwood, MO

b Becton Dickenson, Franklin Lakes, NJ

c. Remel Inc., Lenexa, KS

d. Difco Laboratories Inc ., Sparks, MD

e. Sigma-Aldrich, St. Louis, MO

f. New England Biolabs, Ipswich, MA

g. Premier Biosoft International, Palo Alto, CA

h. Qiagen DNeasy® Blood and Tissue Kit, Qiagen Inc., Valencia, CA

i. Mo Bio Laboratories, Carlsbad, CA

j. Roche Diagnostics Corporation, Indianapolis, IN

k.PTC-100 Programmable Thermal Controller, MJ Research Inc., Watertown, MA

l. Invitrogen Corporation, Carlsbad, CA

m. Lonza, Allendale, NJ

n. SeaKem Gold agarose, Fisher Scientific, Pittsburgh, PA

o. Ethidium bromide, 1% Solution Molecular Biology, Fisher Scientific, Pittsburgh,

p.Gel Doc 2000 gel documentation system, bio-Rad Laboratories Inc., Hercules, CA

129

Chapter 6: Conclusions

A novel PCR for the identification of S. pseudintermedius, S. schleiferi, and S. aureus was attempted. This method was not successful in identifying all three species with a high level (>90%) of sensitivity and specificity for each species. However, individual primers of high sensitivity or specificity may be used in specific circumstances in a research setting as screening or confirmatory tool, respectively. To date there is no unified PCR method published that identifies these three species.

During the course of these studies it was determined that S. pseudintermedius, not

S. intermedius is the primary pathogen of canine pyoderma, and that S intermedius is a commensal of the pigeon nares. Since the reclassification of S. intermedius into the S. intermedius Group, including S. intermedius, S. pseudintermedius, and S. delphini, there has been no documentation of S. intermedius as a canine commensal, nor pathogen.

Furthermore, it has not been shown to be a pathogen of any companion animal.

Therefore genotypic distinction between S. intermedius and S. pseudintermedius for the purpose of use with clinical isolates may not be relevant. However, for the purposes of epidemiological and phylogenetic study, this distinction is essential. During the time- frame of these studies, a novel PCR-RFLP technique was developed to distinguish S. intermedius from S. pseudintermedius; therefore, gene sequencing is no longer necessary

130 to distinguish the species.36 No such technique has been additionally described to differentiate and identify S. schleiferi and S. aureus, and the aforementioned technique does not accomplish this task.

At present, there is no indication that treatment measures for S. aureus, S. pseudintermedius and S. schleiferi pyoderma and otitis should be tailored according to staphylococcal species. Nevertheless, identification of S. aureus, a capable opportunistic pathogen of both humans and animals, is of particular concern, because appears to possess the greatest potential for zoonosis and reverse zoonosis. Rapid identification of

MRSA, from environmental and clinical isolates via multiplex PCR, would be quite helpful in determining hospital procedures for hospitalized patients, including appropriate sanitation, as well as isolation and strategic trafficking of patients and staff to prevent zoonosis and nosocomial disease. A PCR could allow for rapid detection in the span of hours. Unless molecular techniques circumvent the necessity for pure culture isolation, turn-around times for identification and assessments of antimicrobial susceptibility will continue to exceed 24 hours. A real-time, one step method that does not require pure culture could provide results in hours. These methods are typically developed and employed after a traditional method, as described in our studies, has proven to be of sufficient sensitivity and specificity.

At present, no rapid, molecular diagnostic has been developed for veterinary laboratory use. Phenotypic recognition is still essential for the identification of S. aureus as well as S. schleiferi and S. pseudintermedius.. Until the necessity for pure culture can be bypassed, the mannitol salt agar screen maintains its superiority as a relatively rapid

131

(within 24 hours) diagnostic for detection of S. aureus; and in some products, will also concurrently screen for methicillin resistance.

Identification of methicillin resistance, regardless of staphylococcal species is of vital clinical importance, as it significantly impacts treatment strategy. The CLSI interpretation criteria for detection of methicillin resistance were evaluated in Chapter 3, and it was concluded that the 2004 criteria has superior sensitivity in comparison to the

2008 criteria. PCR of the mecA gene remains the gold standard for identification of methicillin resistance. Once pure culture is obtained, PCR is a more rapid method of detection than Kirby-Bauer disk diffusion or broth microdilution because subsequent incubation of the sample with antimicrobial is not required. Although mecA PCR is the gold standard, oxacillin Kirby-Bauer disk diffusion and oxacillin broth microdilution techniques, under the 2004 criteria, were shown to provide a high level of sensitivity.

Importantly, both techniques remain to be highly practical and necessary for clinical microbiology laboratories. Although mecA PCR can detect the gene for methicillin resistance, this technique does not provide information about resistance in other drug classes; therefore informed decisions regarding antimicrobial selection cannot be made without the implementation of Kirby-Bauer disk diffusion or broth microdilution techniques. Therefore, abandonment of these techniques is unlikely to occur in the foreseeable future, until genotypic tests for the detection of other forms of antimicrobial resistance are also developed for practical use.

The insensitivity of cefoxitin for detection of methicillin resistance in S. pseudintermedius was confirmed. This technique is both highly sensitive and specific for detection of methicillin resistance in human MRSA, an intriguing contrast. This contrast

132 highlights that well-founded and studied features of human MRSA, when applied to veterinary staphylococci as fact, are simply assumptions. Therefore, it would be of interest to perform an identical study evaluating not only cefoxitin disk diffusion, but also oxacillin disk diffusion and broth microdilution in canine isolates of S. aureus, S. schleiferi, and coagulase negative staphylococci to determine of the guidelines are appropriate for these species as well. Discovery of staphylococcal species variability in phenotypic detection of methicillin resistance would result in significant impact in antimicrobial selection practices for canine staphylococcal pyoderma and otitis.

Furthermore, it would necessitate routine species identification of veterinary staphylococci.

Although differences in sensitivity of the 2004 and 2008 criteria for the detection of methicillin resistance in S. pseudintermedius was proven, this discovery does not prove that these differences would indeed impact clinical outcome when used to dictate the appropriateness of β-lactam antimicrobials. A prospective, double blinded study would be necessary to evaluate this. It should be noted that the phenomenon of methicillin (and oxacillin) as measures of in vivo resistance to all β-lactam antimicrobials is most well characterized in human MRSA. There has been no study to substantiate this phenomenon in veterinary staphylococcal species.

Currently, the application of PCR and other molecular based technologies’ for staphylococcal species identification and identification of antimicrobial resistance remain narrow. Until such techniques are developed to be more practical and inclusive, phenotypic tests of species identification and antimicrobial resistance remain essential.

133

References

1. Hill PB, Lo A, Eden CA, Huntley S, Morey V, Ramsey S, Richardson C, Smith DJ, Sutton C, Taylor MD, Thorpe E, Tidmarsh R, Williams V. Survey of the prevalence, diagnosis and treatment of dermatological conditions in small animals in general practice. Vet Rec 2006 Apr 22;158(16):533-9.

2. Devriese LA, Hermans K, Baele M, Haesebrouck F. Staphylococcus pseudintermedius versus staphylococcus intermedius. Vet Microbiol 2009 Jan 1;133(1- 2):206-7.

3. Devriese LA, Vancanneyt M, Baele M, Vaneechoutte M, De Graef E, Snauwaert C, Cleenwerck I, Dawyndt P, Swings J, Decostere A, Haesebrouck F. Staphylococcus pseudintermedius sp. nov., a coagulase-positive species from animals. Int J Syst Evol Microbiol 2005 Jul;55(Pt 4):1569-73.

4. Sasaki T, Kikuchi K, Tanaka Y, Takahashi N, Kamata S, Hiramatsu K. Reclassification of phenotypically identified staphylococcus intermedius strains. J Clin Microbiol 2007 Sep;45(9):2770-8.

5. Scott DW, Miller WH, Griffin CE, editor. Muller and Kirk’s dermatology. 6th ed. Philadelphia, PA: WB Saunders; 2001.

6. Oliveira LC, Leite CA, Brilhante RS, Carvalho CB. Comparative study of the microbial profile from bilateral canine otitis externa. Can Vet J 2008 Aug;49(8):785-8.

7. Frank LA, Kania SA, Hnilica KA, Wilkes RP, Bemis DA. Isolation of staphylococcus schleiferi from dogs with pyoderma. J Am Vet Med Assoc 2003 Feb 15;222(4):451-4.

8. Bes M, Guerin-Faublee V, Freney J, Etienne J. Isolation of staphylococcus schleiferi subspecies coagulans from two cases of canine pyoderma. Vet Rec 2002 Apr 13;150(15):487-8.

9. May ER, Hnilica KA, Frank LA, Jones RD, Bemis DA. Isolation of staphylococcus schleiferi from healthy dogs and dogs with otitis, pyoderma, or both. J Am Vet Med Assoc 2005 Sep 15;227(6):928-31.

10. Pinchbeck LR, Cole LK, Hillier A, Kowalski JJ, Rajala-Schultz PJ, Bannerman TL, York S. Genotypic relatedness of staphylococcal strains isolated from pustules and carriage sites in dogs with superficial bacterial folliculitis. Am J Vet Res 2006 Aug;67(8):1337-46.

134

11. Hauschild T, Wojcik A. Species distribution and properties of staphylococci from canine dermatitis. Res Vet Sci 2007 Feb;82(1):1-6.

12. Loeffler A, Linek M, Moodley A, Guardabassi L, Sung JM, Winkler M, Weiss R, Lloyd DH. First report of multiresistant, mecA-positive staphylococcus intermedius in europe: 12 cases from a veterinary dermatology referral clinic in germany. Vet Dermatol 2007 Dec;18(6):412-21.

13. Morris DO, Rook KA, Shofer FS, Rankin SC. Screening of staphylococcus aureus, staphylococcus intermedius, and staphylococcus schleiferi isolates obtained from small companion animals for antimicrobial resistance: A retrospective review of 749 isolates (2003-04). Vet Dermatol 2006 Oct;17(5):332-7.

14. Bemis DA, Jones RD, Frank LA, Kania SA. Evaluation of susceptibility test breakpoints used to predict mecA-mediated resistance in staphylococcus pseudintermedius isolated from dogs. J Vet Diagn Invest 2009 Jan;21(1):53-8.

15. Ruscher C, Lubke-Becker A, Wleklinski CG, Soba A, Wieler LH, Walther B. Prevalence of methicillin-resistant staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Vet Microbiol 2008 Oct 31.

16. van Duijkeren E, Houwers DJ, Schoormans A, Broekhuizen-Stins MJ, Ikawaty R, Fluit AC, Wagenaar JA. Transmission of methicillin-resistant staphylococcus intermedius between humans and animals. Vet Microbiol 2008 Apr 1;128(1-2):213-5.

17. Zubeir IE, Kanbar T, Alber J, Lammler C, Akineden O, Weiss R, Zschock M. Phenotypic and genotypic characteristics of methicillin/oxacillin-resistant staphylococcus intermedius isolated from clinical specimens during routine veterinary microbiological examinations. Vet Microbiol 2007 Mar 31;121(1-2):170-6.

18. Jones RD, Kania SA, Rohrbach BW, Frank LA, Bemis DA. Prevalence of oxacillin- and multidrug-resistant staphylococci in clinical samples from dogs: 1,772 samples (2001-2005). J Am Vet Med Assoc 2007 Jan 15;230(2):221-7.

19. Rantala M, Holso K, Lillas A, Huovinen P, Kaartinen L. Survey of condition-based prescribing of antimicrobial drugs for dogs at a veterinary teaching hospital. Vet Rec 2004 Aug 28;155(9):259-62.

20. Brown DF, Edwards DI, Hawkey PM, Morrison D, Ridgway GL, Towner KJ, Wren MW, Joint Working Party of the British Society for Antimicrobial Chemotherapy, Hospital Infection Society, Infection Control Nurses Association. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant staphylococcus aureus (MRSA). J Antimicrob Chemother 2005 Dec;56(6):1000-18.

135

21. Guardabassi L, Loeber ME, Jacobson A. Transmission of multiple antimicrobial- resistant staphylococcus intermedius between dogs affected by deep pyoderma and their owners. Vet Microbiol 2004 Jan 14;98(1):23-7.

22. Guardabassi L, Schwarz S, Lloyd DH. Pet animals as reservoirs of antimicrobial- resistant bacteria. J Antimicrob Chemother 2004 Aug;54(2):321-32.

23. Weese JS, Dick H, Willey BM, McGeer A, Kreiswirth BN, Innis B, Low DE. Suspected transmission of methicillin-resistant staphylococcus aureus between domestic pets and humans in veterinary clinics and in the household. Vet Microbiol 2006 Jun 15;115(1-3):148-55.

24. Vitale CB, Gross TL, Weese JS. Methicillin-resistant staphylococcus aureus in cat and owner. Emerg Infect Dis 2006 Dec;12(12):1998-2000.

25. Kikuchi K, Karasawa T, Piao C, Itoda I, Hidai H, Yamaura H, Totsuka K, Morikawa T, Takayama M. Molecular confirmation of transmission route of staphylococcus intermedius in mastoid cavity infection from dog saliva. J Infect Chemother 2004 Feb;10(1):46-8.

26. van Duijkeren E, Houwers DJ, Schoormans A, Broekhuizen-Stins MJ, Ikawaty R, Fluit AC, Wagenaar JA. Transmission of methicillin-resistant staphylococcus intermedius between humans and animals. Vet Microbiol 2008 Apr 1;128(1-2):213-5.

27. Sing A, Tuschak C, Hormansdorfer S. Methicillin-resistant staphylococcus aureus in a family and its pet cat. N Engl J Med 2008 Mar 13;358(11):1200-1.

28. Manian FA. Asymptomatic nasal carriage of mupirocin-resistant, methicillin- resistant staphylococcus aureus (MRSA) in a pet dog associated with MRSA infection in household contacts. Clin Infect Dis 2003 Jan 15;36(2):e26-8.

29. [Anonymous]Clinical and laboratory standards institute (CLSI). In: Wayne, PA: ; 2008.

30. Murray PR, Baron EJ, Jorgensen JH, Landry ML, Pfaller MA, editors. Manual of clinical microbiology. Ninth ed. Washington, D.C.: ASM Press; 2007. 390-411 p.

31. Lindsay JA, editor. Staphylococcus: Molecular genetics. Norfolk, UK: Caister Academic Press; 2008. 255-269 p.

32. Hajek V. Staphylococcus intermedius, a new species isolated fromanimals. International Journal of Systematic and Evolutionary Microbiology 1976;26:401.

33. Wakita Y, Shimizu A, Hajek V, Kawano J, Yamashita K. Characterization of staphylococcus intermedius from pigeons, dogs, foxes, mink, and horses by pulsed-field gel electrophoresis. J Vet Med Sci 2002 Mar;64(3):237-43.

136

34. Aarestrup FM. Comparative ribotyping of staphylococcus intermedius isolated from members of the canoidea gives possible evidence for host-specificity and co- evolution of bacteria and hosts. Int J Syst Evol Microbiol 2001 Jul;51(Pt 4):1343-7.

35. Bannoehr J, Ben Zakour NL, Waller AS, Guardabassi L, Thoday KL, van den Broek AH, Fitzgerald JR. Population genetic structure of the staphylococcus intermedius group: Insights into agr diversification and the emergence of methicillin-resistant strains. J Bacteriol 2007 Dec;189(23):8685-92.

36. Bannoehr J, Franco A, Iurescia M, Battisti A, Fitzgerald JR. Molecular diagnostic identification of staphylococcus pseudintermedius. J Clin Microbiol 2009 Feb;47(2):469- 71.

37. Ji G, Pei W, Zhang L, Qiu R, Lin J, Benito Y, Lina G, Novick RP. Staphylococcus intermedius produces a functional agr autoinducing peptide containing a cyclic lactone. J Bacteriol 2005 May;187(9):3139-50.

38. Griffeth GC, Morris DO, Abraham JL, Shofer FS, Rankin SC. Screening for skin carriage of methicillin-resistant coagulase-positive staphylococci and staphylococcus schleiferi in dogs with healthy and inflamed skin. Vet Dermatol 2008 Jun;19(3):142-9.

39. Abraham JL, Morris DO, Griffeth GC, Shofer FS, Rankin SC. Surveillance of healthy cats and cats with inflammatory skin disease for colonization of the skin by methicillin-resistant coagulase-positive staphylococci and staphylococcus schleiferi ssp. schleiferi. Vet Dermatol 2007 Aug;18(4):252-9.

40. Morris DO, Mauldin EA, O'Shea K, Shofer FS, Rankin SC. Clinical, microbiological, and molecular characterization of methicillin-resistant staphylococcus aureus infections of cats. Am J Vet Res 2006 Aug;67(8):1421-5.

41. Weese JS, van Duijkeren E. Methicillin-resistant staphylococcus aureus and staphylococcus pseudintermedius in veterinary medicine. Vet Microbiol 2009 Feb 5.

42. Becker K, Harmsen D, Mellmann A, Meier C, Schumann P, Peters G, von Eiff C. Development and evaluation of a quality-controlled ribosomal sequence database for 16S ribosomal DNA-based identification of staphylococcus species. J Clin Microbiol 2004 Nov;42(11):4988-95.

43. Briscoe JA, Morris DO, Rankin SC, Hendrick MJ, Rosenthal KL. Methicillin- resistant staphylococcus aureus-associated dermatitis in a congo african grey parrot (psittacus erithacus erithacus). J Avian Med Surg 2008 Dec;22(4):336-43.

44. van Leeuwen WB, Melles DC, Alaidan A, Al-Ahdal M, Boelens HA, Snijders SV, Wertheim H, van Duijkeren E, Peeters JK, van der Spek PJ, Gorkink R, Simons G, Verbrugh HA, van Belkum A. Host- and tissue-specific pathogenic traits of staphylococcus aureus. J Bacteriol 2005 Jul;187(13):4584-91.

137

45. McNamee PT, McCullagh JJ, Rodgers JD, Thorp BH, Ball HJ, Connor TJ, McConaghy D, Smyth JA. Development of an experimental model of bacterial chondronecrosis with osteomyelitis in broilers following exposure to staphylococcus aureus by aerosol, and inoculation with chicken anaemia and infectious bursal disease viruses. Avian Pathol 1999 Feb;28(1):26-35.

46. Alfonso M, Barnes HJ. Neonatal osteomyelitis associated with staphylococcus aureus in turkey poults. Avian Dis 2006 Mar;50(1):148-51.

47. Hermans K, Devriese LA, Haesebrouck F. Rabbit staphylococcosis: Difficult solutions for serious problems. Vet Microbiol 2003 Jan 2;91(1):57-64.

48. McLean CL, Ness MG. Meticillin-resistant staphylococcus aureus in a veterinary orthopaedic referral hospital: Staff nasal colonisation and incidence of clinical cases. J Small Anim Pract 2008 Apr;49(4):170-7.

49. Grinberg A, Kingsbury DD, Gibson IR, Kirby BM, Mack HJ, Morrison D. Clinically overt infections with methicillin-resistant staphylococcus aureus in animals in new zealand: A pilot study. N Z Vet J 2008 Oct;56(5):237-42.

50. Gortel K, Campbell KL, Kakoma I, Whittem T, Schaeffer DJ, Weisiger RM. Methicillin resistance among staphylococci isolated from dogs. Am J Vet Res 1999 Dec;60(12):1526-30.

51. Leung MJ, Nuttall N, Mazur M, Taddei TL, McComish M, Pearman JW. Case of staphylococcus schleiferi endocarditis and a simple scheme to identify clumping factor- positive staphylococci. J Clin Microbiol 1999 Oct;37(10):3353-6.

52. Calvo J, Hernandez JL, Farinas MC, Garcia-Palomo D, Aguero J. Osteomyelitis caused by staphylococcus schleiferi and evidence of misidentification of this staphylococcus species by an automated bacterial identification system. J Clin Microbiol 2000 Oct;38(10):3887-9.

53. Zdovc I, Ocepek M, Pirs T, Krt B, Pinter L. Microbiological features of staphylococcus schleiferi subsp. coagulans, isolated from dogs and possible misidentification with other canine coagulase-positive staphylococci. J Vet Med B Infect Dis Vet Public Health 2004 Dec;51(10):449-54.

54. Igimi S, Takahashi E, Mitsuoka T. Staphylococcus schleiferi subsp. coagulans subsp. nov., isolated from the external auditory meatus of dogs with external ear otitis. Int J Syst Bacteriol 1990 Oct;40(4):409-11.

55. Yamashita K, Shimizu A, Kawano J, Uchida E, Haruna A, Igimi S. Isolation and characterization of staphylococci from external auditory meatus of dogs with or without otitis externa with special reference to staphylococcus schleiferi subsp. coagulans isolates. J Vet Med Sci 2005 Mar;67(3):263-8.

138

56. Medleau L, Long RE, Brown J, Miller WH. Frequency and antimicrobial susceptibility of staphylococcus species isolated from canine pyodermas. Am J Vet Res 1986 Feb;47(2):229-31.

57. Shimizu A, Wakita Y, Nagase S, Okabe M, Koji T, Hayashi T, Nagase N, Sasaki A, Kawano J, Yamashita K, Takagi M. Antimicrobial susceptibility of staphylococcus intermedius isolated from healthy and diseased dogs. J Vet Med Sci 2001 Mar;63(3):357- 60.

58. van Duijkeren E, Box AT, Heck ME, Wannet WJ, Fluit AC. Methicillin-resistant staphylococci isolated from animals. Vet Microbiol 2004 Oct 5;103(1-2):91-7.

59. Piriz S, de la Fuente R, Valle J, Mateos E, Hurtado MA, Cid D, Ruiz-Santaquiteria JA, Vadillo S. Comparative in vitro activity of 11 beta-lactam antibiotics against 91 staphylococcus intermedius strains isolated from staphylococcal dermatitis in dogs. Zentralbl Veterinarmed B 1995 Jul;42(5):293-300.

60. Bemis DA, Jones RD, Hiatt LE, Ofori ED, Rohrbach BW, Frank LA, Kania SA. Comparison of tests to detect oxacillin resistance in staphylococcus intermedius, staphylococcus schleiferi, and staphylococcus aureus isolates from canine hosts. J Clin Microbiol 2006 Sep;44(9):3374-6.

61. Hanselman BA, Kruth S, Weese JS. Methicillin-resistant staphylococcal colonization in dogs entering a veterinary teaching hospital. Vet Microbiol 2008 Jan 1;126(1-3):277-81.

62. Kania SA, Williamson NL, Frank LA, Wilkes RP, Jones RD, Bemis DA. Methicillin resistance of staphylococci isolated from the skin of dogs with pyoderma. Am J Vet Res 2004 Sep;65(9):1265-8.

63. Epstein CR, Yam WC, Peiris JS, Epstein RJ. Methicillin-resistant commensal staphylococci in healthy dogs as a potential zoonotic reservoir for community-acquired antibiotic resistance. Infect Genet Evol 2008 Nov 27.

64. Sasaki T, Kikuchi K, Tanaka Y, Takahashi N, Kamata S, Hiramatsu K. Methicillin- resistant staphylococcus pseudintermedius in a veterinary teaching hospital. J Clin Microbiol 2007 Apr;45(4):1118-25.

65. Piriz S, Valle J, Mateos EM, de la Fuente R, Cid D, Ruiz-Santaquiteria JA, Vadillo S. In vitro activity of fifteen antimicrobial agents against methicillin-resistant and methicillin-susceptible staphylococcus intermedius. J Vet Pharmacol Ther 1996 Apr;19(2):118-23.

139

66. Loeffler A, Boag AK, Sung J, Lindsay JA, Guardabassi L, Dalsgaard A, Smith H, Stevens KB, Lloyd DH. Prevalence of methicillin-resistant staphylococcus aureus among staff and pets in a small animal referral hospital in the UK. J Antimicrob Chemother 2005 Oct;56(4):692-7.

67. Ruscher C, Lubke-Becker A, Wleklinski CG, Soba A, Wieler LH, Walther B. Prevalence of methicillin-resistant staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Vet Microbiol 2008 Oct 31.

68. Nadesalingam K, Conway SP, Denton M. Risk factors for acquisition of methicillin-resistant staphylococcus aureus (MRSA) by patients with cystic fibrosis. J Cyst Fibros 2005 Mar;4(1):49-52.

69. Van Hoovels L, Vankeerberghen A, Boel A, Van Vaerenbergh K, De Beenhouwer H. First case of staphylococcus pseudintermedius infection in a human. J Clin Microbiol 2006 Dec;44(12):4609-12.

70. Kluytmans J, Berg H, Steegh P, Vandenesch F, Etienne J, van Belkum A. Outbreak of staphylococcus schleiferi wound infections: Strain characterization by randomly amplified polymorphic DNA analysis, PCR ribotyping, conventional ribotyping, and pulsed-field gel electrophoresis. J Clin Microbiol 1998 Aug;36(8):2214-9.

71. Weese JS, Rousseau J, Traub-Dargatz JL, Willey BM, McGeer AJ, Low DE. Community-associated methicillin-resistant staphylococcus aureus in horses and humans who work with horses. J Am Vet Med Assoc 2005 Feb 15;226(4):580-3.

72. Baptiste KE, Williams K, Willams NJ, Wattret A, Clegg PD, Dawson S, Corkill JE, O'Neill T, Hart CA. Methicillin-resistant staphylococci in companion animals. Emerg Infect Dis 2005 Dec;11(12):1942-4.

73. Moodley A, Stegger M, Bagcigil AF, Baptiste KE, Loeffler A, Lloyd DH, Williams NJ, Leonard N, Abbott Y, Skov R, Guardabassi L. Spa typing of methicillin- resistant staphylococcus aureus isolated from domestic animals and veterinary staff in the UK and ireland. J Antimicrob Chemother 2006 Dec;58(6):1118-23.

74. Malik S, Coombs GW, O'Brien FG, Peng H, Barton MD. Molecular typing of methicillin-resistant staphylococci isolated from cats and dogs. J Antimicrob Chemother 2006 Aug;58(2):428-31.

75. Strommenger B, Kehrenberg C, Kettlitz C, Cuny C, Verspohl J, Witte W, Schwarz S. Molecular characterization of methicillin-resistant staphylococcus aureus strains from pet animals and their relationship to human isolates. J Antimicrob Chemother 2006 Mar;57(3):461-5.

140

76. Griffeth GC, Morris DO, Abraham JL, Shofer FS, Rankin SC. Screening for skin carriage of methicillin-resistant coagulase-positive staphylococci and staphylococcus schleiferi in dogs with healthy and inflamed skin. Vet Dermatol 2008 Jun;19(3):142-9.

77. Weese JS, Faires M, Rousseau J, Bersenas AM, Mathews KA. Cluster of methicillin-resistant staphylococcus aureus colonization in a small animal intensive care unit. J Am Vet Med Assoc 2007 Nov 1;231(9):1361-4.

78. Shimizu A, Kawano J, Yamamoto C, Kakutani O, Anzai T, Kamada M. Genetic analysis of equine methicillin-resistant staphylococcus aureus by pulsed-field gel electrophoresis. J Vet Med Sci 1997 Oct;59(10):935-7.

79. Middleton JR, Fales WH, Luby CD, Oaks JL, Sanchez S, Kinyon JM, Wu CC, Maddox CW, Welsh RD, Hartmann F. Surveillance of staphylococcus aureus in veterinary teaching hospitals. J Clin Microbiol 2005 Jun;43(6):2916-9.

80. Weese JS, Rousseau J. Attempted eradication of methicillin-resistant staphylococcus aureus colonisation in horses on two farms. Equine Vet J 2005 Nov;37(6):510-4.

81. Cuny C, Strommenger B, Witte W, Stanek C. Clusters of infections in horses with MRSA ST1, ST254, and ST398 in a veterinary hospital. Microb Drug Resist 2008 Dec;14(4):307-10.

82. Moodley A, Nightingale EC, Stegger M, Nielsen SS, Skov RL, Guardabassi L. High risk for nasal carriage of methicillin-resistant staphylococcus aureus among danish veterinary practitioners. Scand J Work Environ Health 2008 Apr;34(2):151-7.

83. Van den Eede A, Martens A, Lipinska U, Struelens M, Deplano A, Denis O, Haesebrouck F, Gasthuys F, Hermans K. High occurrence of methicillin-resistant staphylococcus aureus ST398 in equine nasal samples. Vet Microbiol 2009 Jan 1;133(1- 2):138-44.

84. Weese JS, Rousseau J, Willey BM, Archambault M, McGeer A, Low DE. Methicillin-resistant staphylococcus aureus in horses at a veterinary teaching hospital: Frequency, characterization, and association with clinical disease. J Vet Intern Med 2006 Jan-Feb;20(1):182-6.

85. Weese JS, Lefebvre SL. Risk factors for methicillin-resistant staphylococcus aureus colonization in horses admitted to a veterinary teaching hospital. Can Vet J 2007 Sep;48(9):921-6.

86. Koneman EW, Allen SD, Janda WN, Schreckenberger PC, Winn WC, editors. Color atlas and textbook of diagnostic microbiology. Fifth ed. Philadelphia: Lippencott- Raven; 1997.

141

87. Roberson JR, Fox LK, Hancock DD, Besser TE. Evaluation of methods for differentiation of coagulase-positive staphylococci. J Clin Microbiol 1992 Dec;30(12):3217-9.

88. Kloos WE, George CG. Identification of staphylococcus species and subspecies with the MicroScan pos ID and rapid pos ID panel systems. J Clin Microbiol 1991 Apr;29(4):738-44.

89. Layer F, Ghebremedhin B, Moder KA, Konig W, Konig B. Comparative study using various methods for identification of staphylococcus species in clinical specimens. J Clin Microbiol 2006 Aug;44(8):2824-30.

90. Stoakes L, John MA, Lannigan R, Schieven BC, Ramos M, Harley D, Hussain Z. Gas-liquid chromatography of cellular fatty acids for identification of staphylococci. J Clin Microbiol 1994 Aug;32(8):1908-10.

91. Kotilainen P, Huovinen P, Eerola E. Application of gas-liquid chromatographic analysis of cellular fatty acids for species identification and typing of coagulase-negative staphylococci. J Clin Microbiol 1991 Feb;29(2):315-22.

92. Couto I, Pereira S, Miragaia M, Sanches IS, de Lencastre H. Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR. J Clin Microbiol 2001 Sep;39(9):3099-103.

93. Ligozzi M, Bernini C, Bonora MG, De Fatima M, Zuliani J, Fontana R. Evaluation of the VITEK 2 system for identification and antimicrobial susceptibility testing of medically relevant gram-positive cocci. J Clin Microbiol 2002 May;40(5):1681-6.

94. Woo PC, Lau SK, Teng JL, Tse H, Yuen KY. Then and now: Use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories. Clin Microbiol Infect 2008 Oct;14(10):908-34.

95. Couzinet S, Jay C, Barras C, Vachon R, Vernet G, Ninet B, Jan I, Minazio MA, Francois P, Lew D, Troesch A, Schrenzel J. High-density DNA probe arrays for identification of staphylococci to the species level. J Microbiol Methods 2005 May;61(2):201-8.

96. Skow A, Mangold KA, Tajuddin M, Huntington A, Fritz B, Thomson RB,Jr, Kaul KL. Species-level identification of staphylococcal isolates by real-time PCR and melt curve analysis. J Clin Microbiol 2005 Jun;43(6):2876-80.

97. Shittu A, Lin J, Morrison D, Kolawole D. Identification and molecular characterization of mannitol salt positive, coagulase-negative staphylococci from nasal samples of medical personnel and students. J Med Microbiol 2006 Mar;55(Pt 3):317-24.

142

98. Wakita Y, Kawano J, Shimizu A, Hajek V, Tomisaka E, Yasuda R, Matsuo E. Development of a PCR test for the identification of staphylococcus intermedius based on the 16S rDNA sequence. J Vet Med Sci 2002 Jul;64(7):603-5.

99. Sudagidan M, Yenidunya AF, Gunes H. Identification of staphylococci by 16S internal transcribed spacer rRNA gene restriction fragment length polymorphism. J Med Microbiol 2005 Sep;54(Pt 9):823-6.

100. Woo PC, Leung AS, Leung KW, Yuen KY. Identification of slide coagulase positive, tube coagulase negative staphylococcus aureus by 16S ribosomal RNA gene sequencing. Mol Pathol 2001 Aug;54(4):244-7.

101. Heikens E, Fleer A, Paauw A, Florijn A, Fluit AC. Comparison of genotypic and phenotypic methods for species-level identification of clinical isolates of coagulase- negative staphylococci. J Clin Microbiol 2005 May;43(5):2286-90.

102. Alexopoulou K, Foka A, Petinaki E, Jelastopulu E, Dimitracopoulos G, Spiliopoulou I. Comparison of two commercial methods with PCR restriction fragment length polymorphism of the tuf gene in the identification of coagulase-negative staphylococci. Lett Appl Microbiol 2006 Oct;43(4):450-4.

103. Yugueros J, Temprano A, Berzal B, Sanchez M, Hernanz C, Luengo JM, Naharro G. Glyceraldehyde-3-phosphate dehydrogenase-encoding gene as a useful taxonomic tool for staphylococcus spp. J Clin Microbiol 2000 Dec;38(12):4351-5.

104. Snyder L, Champness W, editors. Molecular genetics of bacteria. Washington, D.C.: ASM Press; 1997. 418-419 p.

105. Berger-Bachi B, Barberis-Maino L, Strassle A, Kayser FH. FemA, a host- mediated factor essential for methicillin resistance in staphylococcus aureus: Molecular cloning and characterization. Mol Gen Genet 1989 Oct;219(1-2):263-9.

106. Maidhof H, Reinicke B, Blumel P, Berger-Bachi B, Labischinski H. femA, which encodes a factor essential for expression of methicillin resistance, affects glycine content of peptidoglycan in methicillin-resistant and methicillin-susceptible staphylococcus aureus strains. J Bacteriol 1991 Jun;173(11):3507-13.

107. Vannuffel P, Heusterspreute M, Bouyer M, Vandercam B, Philippe M, Gala JL. Molecular characterization of femA from staphylococcus hominis and staphylococcus saprophyticus, and femA-based discrimination of staphylococcal species. Res Microbiol 1999 Mar;150(2):129-41.

108. Riyaz-Ul-Hassan S, Verma V, Qazi GN. Evaluation of three different molecular markers for the detection of staphylococcus aureus by polymerase chain reaction. Food Microbiol 2008 May;25(3):452-9.

143

109. Sareyyupoglu B, Ozyurt M, Haznedaroglu T, Ardic N. Detection of methicillin and mupirocin resistance in staphylococcal hospital isolates with a touchdown multiplex polymerase chain reaction. Folia Microbiol (Praha) 2008;53(4):363-7.

110. Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, Gregson DB, Louie T, Conly JM. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol 2004 Nov;42(11):4947-55.

111. Craig EA, Gambill BD, Nelson RJ. Heat shock proteins: Molecular chaperones of protein biogenesis. Microbiol Rev 1993 Jun;57(2):402-14.

112. Goh SH, Santucci Z, Kloos WE, Faltyn M, George CG, Driedger D, Hemmingsen SM. Identification of staphylococcus species and subspecies by the chaperonin 60 gene identification method and reverse checkerboard hybridization. J Clin Microbiol 1997 Dec;35(12):3116-21.

113. Kwok AY, Chow AW. Phylogenetic study of staphylococcus and macrococcus species based on partial hsp60 gene sequences. Int J Syst Evol Microbiol 2003 Jan;53(Pt 1):87-92.

114. Takahashi T, Kaneko M, Mori Y, Tsuji M, Kikuchi N, Hiramune T. Phylogenetic analyses of staphylococcus based on the 16S rDNA sequence and assignment of clinical isolates from animals. J Vet Med Sci 1997 Sep;59(9):775-83.

115. Takahashi T, Satoh I, Kikuchi N. Phylogenetic relationships of 38 taxa of the genus staphylococcus based on 16S rRNA gene sequence analysis. Int J Syst Bacteriol 1999 Apr;49 Pt 2:725-8.

116. Das D, Saha SS, Bishayi B. Intracellular survival of staphylococcus aureus: Correlating production of catalase and superoxide dismutase with levels of inflammatory cytokines. Inflamm Res 2008 Jul;57(7):340-9.

117. Poyart C, Quesne G, Boumaila C, Trieu-Cuot P. Rapid and accurate species-level identification of coagulase-negative staphylococci by using the sodA gene as a target. J Clin Microbiol 2001 Dec;39(12):4296-301.

118. Sivadon V, Rottman M, Quincampoix JC, Avettand V, Chaverot S, de Mazancourt P, Trieu-Cuot P, Gaillard JL. Use of sodA sequencing for the identification of clinical isolates of coagulase-negative staphylococci. Clin Microbiol Infect 2004 Oct;10(10):939-42.

144

119. Voytenko AV, Kanbar T, Alber J, Lammler C, Weiss R, Prenger-Berninghoff E, Zschock M, Akineden O, Hassan AA, Dmitrenko OA. Identification of staphylococcus hyicus by polymerase chain reaction mediated amplification of species specific sequences of superoxide dismutase A encoding gene sodA. Vet Microbiol 2006 Aug 25;116(1- 3):211-6.

120. Baron F, Cochet MF, Pellerin JL, Ben Zakour N, Lebon A, Navarro A, Proudy I, Le Loir Y, Gautier M. Development of a PCR test to differentiate between staphylococcus aureus and staphylococcus intermedius. J Food Prot 2004 Oct;67(10):2302-5.

121. Iwase T, Seki K, Shinji H, Mizunoe Y, Masuda S. Development of a real-time PCR assay for the detection and identification of staphylococcus capitis, staphylococcus haemolyticus and staphylococcus warneri. J Med Microbiol 2007 Oct;56(Pt 10):1346-9.

122. Blaiotta G, Casaburi A, Villani F. Identification and differentiation of staphylococcus carnosus and staphylococcus simulans by species-specific PCR assays of sodA genes. Syst Appl Microbiol 2005 Aug;28(6):519-26.

123. Blaiotta G, Ercolini D, Mauriello G, Salzano G, Villani F. Rapid and reliable identification of staphylococcus equorum by a species-specific PCR assay targeting the sodA gene. Syst Appl Microbiol 2004 Nov;27(6):696-702.

124. Hogg GM, McKenna JP, Ong G. Rapid detection of methicillin-susceptible and methicillin-resistant staphylococcus aureus directly from positive BacT/Alert blood culture bottles using real-time polymerase chain reaction: Evaluation and comparison of 4 DNA extraction methods. Diagn Microbiol Infect Dis 2008 Aug;61(4):446-52.

125. Costa AM, Kay I, Palladino S. Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction. Diagn Microbiol Infect Dis 2005 Jan;51(1):13-7.

126. Becker K, von Eiff C, Keller B, Bruck M, Etienne J, Peters G. Thermonuclease gene as a target for specific identification of staphylococcus intermedius isolates: Use of a PCR-DNA enzyme immunoassay. Diagn Microbiol Infect Dis 2005 Apr;51(4):237-44.

127. Niemeyer DM, Pucci MJ, Thanassi JA, Sharma VK, Archer GL. Role of mecA transcriptional regulation in the phenotypic expression of methicillin resistance in staphylococcus aureus. J Bacteriol 1996 Sep;178(18):5464-71.

128. Kohner P, Uhl J, Kolbert C, Persing D, Cockerill F,3rd. Comparison of susceptibility testing methods with mecA gene analysis for determining oxacillin (methicillin) resistance in clinical isolates of staphylococcus aureus and coagulase- negative staphylococcus spp. J Clin Microbiol 1999 Sep;37(9):2952-61.

145

129. Blanc DS, Wenger A, Bille J. Evaluation of a novel medium for screening specimens from hospitalized patients to detect methicillin-resistant staphylococcus aureus. J Clin Microbiol 2003 Aug;41(8):3499-502.

130. Apfalter P, Assadian O, Kalczyk A, Lindenmann V, Makristathis A, Mustafa S, Rotter M, Hirschl AM. Performance of a new chromogenic oxacillin resistance screen medium (oxoid) in the detection and presumptive identification of methicillin-resistant staphylococcus aureus. Diagn Microbiol Infect Dis 2002 Oct;44(2):209-11.

131. Baddour MM, AbuElKheir MM, Fatani AJ. Comparison of mecA polymerase chain reaction with phenotypic methods for the detection of methicillin-resistant staphylococcus aureus. Curr Microbiol 2007 Dec;55(6):473-9.

132. Mimica MJ, Berezin EN, Carvalho RL, Mimica IM, Mimica LM, Safadi MA, Schneider E, Caiaffa-Filho HH. Detection of methicillin resistance in staphylococcus aureus isolated from pediatric patients: Is the cefoxitin disk diffusion test accurate enough? Braz J Infect Dis 2007 Aug;11(4):415-7.

133. Murakami K, Nomura K, Doi M, Yoshida T. Increased susceptibility to cephamycin-type antibiotics of methicillin-resistant staphylococcus aureus defective in penicillin-binding protein 2. Antimicrob Agents Chemother 1987 Sep;31(9):1423-5.

134. Felten A, Grandry B, Lagrange PH, Casin I. Evaluation of three techniques for detection of low-level methicillin-resistant staphylococcus aureus (MRSA): A disk diffusion method with cefoxitin and moxalactam, the vitek 2 system, and the MRSA- screen latex agglutination test. J Clin Microbiol 2002 Aug;40(8):2766-71.

135. Bosgelmez-Tinaz G, Ulusoy S, Aridogan B, Coskun-Ari F. Evaluation of different methods to detect oxacillin resistance in staphylococcus aureus and their clinical laboratory utility. Eur J Clin Microbiol Infect Dis 2006 Jun;25(6):410-2.

136. Boutiba-Ben Boubaker I, Ben Abbes R, Ben Abdallah H, Mamlouk K, Mahjoubi F, Kammoun A, Hammami A, Ben Redjeb S. Evaluation of a cefoxitin disk diffusion test for the routine detection of methicillin-resistant staphylococcus aureus. Clin Microbiol Infect 2004 Aug;10(8):762-5.

137. Skov R, Smyth R, Larsen AR, Bolmstrom A, Karlsson A, Mills K, Frimodt- Moller N, Kahlmeter G. Phenotypic detection of methicillin resistance in staphylococcus aureus by disk diffusion testing and etest on mueller-hinton agar. J Clin Microbiol 2006 Dec;44(12):4395-9.

138. Skov R, Smyth R, Clausen M, Larsen AR, Frimodt-Moller N, Olsson-Liljequist B, Kahlmeter G. Evaluation of a cefoxitin 30 microg disc on iso-sensitest agar for detection of methicillin-resistant staphylococcus aureus. J Antimicrob Chemother 2003 Aug;52(2):204-7.

146

139. Cauwelier B, Gordts B, Descheemaecker P, Van Landuyt H. Evaluation of a disk diffusion method with cefoxitin (30 microg) for detection of methicillin-resistant staphylococcus aureus. Eur J Clin Microbiol Infect Dis 2004 May;23(5):389-92.

140. John MA, Burden J, Stuart JI, Reyes RC, Lannigan R, Milburn S, Diagre D, Wilson B, Hussain Z. Comparison of three phenotypic techniques for detection of methicillin resistance in staphylococcus spp. reveals a species-dependent performance. J Antimicrob Chemother 2009 Mar;63(3):493-6.

141. Schaechter M, Engleberg NC, Eisenstain BI, Medoff G, editors. Mechanisms of microbial disease. Third ed. Baltimore: Lippincott Williams and Wilkins; 1999. 55-58 p.

142. Chambers HF. Methicillin resistance in staphylococci: Molecular and biochemical basis and clinical implications. Clin Microbiol Rev 1997 Oct;10(4):781-91.

143. Keseru JS, Gal Z, Barabas G, Benko I, Szabo I. Investigation of beta-lactamases in clinical isolates of staphylococcus aureus for further explanation of borderline methicillin resistance. Chemotherapy 2005 Oct;51(6):300-4.

144. Gal Z, Kovacs P, Hernadi F, Barabas G, Kiss L, Igloi A, Szabo I. Investigation of oxacillin-hydrolyzing beta-lactamase in borderline methicillin-resistant clinical isolates of staphylococcus aureus. Chemotherapy 2001 Jul-Aug;47(4):233-8.

145. Nicola F, Bantar C, Canigia LF, Relloso S, Bianchini H, Smayevsky J. Comparison of several methods to determine methicillin-resistance in staphylococcus aureus with focus on borderline strains. Diagn Microbiol Infect Dis 2000 Feb;36(2):91-3.

146. Pitkala A, Salmikivi L, Bredbacka P, Myllyniemi AL, Koskinen MT. Comparison of tests for detection of beta-lactamase-producing staphylococci. J Clin Microbiol 2007 Jun;45(6):2031-3.

147. Descloux S, Rossano A, Perreten V. Characterization of new staphylococcal cassette chromosome mec (SCCmec) and topoisomerase genes in fluoroquinolone- and methicillin-resistant staphylococcus pseudintermedius. J Clin Microbiol 2008 May;46(5):1818-23.

148. Hososaka Y, Hanaki H, Endo H, Suzuki Y, Nagasawa Z, Otsuka Y, Nakae T, Sunakawa K. Characterization of oxacillin-susceptible mecA-positive staphylococcus aureus: A new type of MRSA. J Infect Chemother 2007 Apr;13(2):79-86.

149. Araj GF, Talhouk RS, Simaan CJ, Maasad MJ. Discrepancies between mecA PCR and conventional tests used for detection of methicillin resistant staphylococcus aureus. Int J Antimicrob Agents 1999 Jan;11(1):47-52.

147

150. Gerberding JL, Miick C, Liu HH, Chambers HF. Comparison of conventional susceptibility tests with direct detection of penicillin-binding protein 2a in borderline oxacillin-resistant strains of staphylococcus aureus. Antimicrob Agents Chemother 1991 Dec;35(12):2574-9.

151. Resende CA, Figueiredo AM. Discrimination of methicillin-resistant staphylococcus aureus from borderline-resistant and susceptible isolates by different methods. J Med Microbiol 1997 Feb;46(2):145-9.

152. Hill PB, Moriello KA. Canine pyoderma. J Am Vet Med Assoc 1994 Feb 1;204(3):334-40.

153. Pedersen K, Wegener HC. Antimicrobial susceptibility and rRNA gene restriction patterns among staphylococcus intermedius from healthy dogs and from dogs suffering from pyoderma or otitis externa. Acta Vet Scand 1995;36(3):335-42.

154. Vandenesch F, Celard M, Arpin D, Bes M, Greenland T, Etienne J. Catheter- related bacteremia associated with coagulase-positive staphylococcus intermedius. J Clin Microbiol 1995 Sep;33(9):2508-10.

155. Campanile F, Bongiorno D, Borbone S, Venditti M, Giannella M, Franchi C, Stefani S. Characterization of a variant of the SCCmec element in a bloodstream isolate of staphylococcus intermedius. Microb Drug Resist 2007 Spring;13(1):7-10.

156. Gerstadt K, Daly JS, Mitchell M, Wessolossky M, Cheeseman SH. Methicillin- resistant staphylococcus intermedius pneumonia following coronary artery bypass grafting. Clin Infect Dis 1999 Jul;29(1):218-9.

157. Lee J. Staphylococcus intermedius isolated from dog-bite wounds. J Infect 1994 Jul;29(1):105.

158. Atalay B, Ergin F, Cekinmez M, Caner H, Altinors N. Brain abscess caused by staphylococcus intermedius. Acta Neurochir (Wien) 2005 Mar;147(3):347,8; discussion 348.

159. Talan DA, Staatz D, Staatz A, Overturf GD. Frequency of staphylococcus intermedius as human nasopharyngeal flora. J Clin Microbiol 1989 Oct;27(10):2393.

160. Pottumarthy S, Schapiro JM, Prentice JL, Houze YB, Swanzy SR, Fang FC, Cookson BT. Clinical isolates of staphylococcus intermedius masquerading as methicillin-resistant staphylococcus aureus. J Clin Microbiol 2004 Dec;42(12):5881-4.

161. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant staphylococcus aureus. Antimicrob Agents Chemother 2002 Jul;46(7):2155-61.

148

162. Bemis DA, Jones RD, Hiatt LE, Ofori ED, Rohrbach BW, Frank LA, Kania SA. Comparison of tests to detect oxacillin resistance in staphylococcus intermedius, staphylococcus schleiferi, and staphylococcus aureus isolates from canine hosts. J Clin Microbiol 2006 Sep;44(9):3374-6.

163. Ercis S, Sancak B, Hascelik G. A comparison of PCR detection of mecA with oxacillin disk susceptibility testing in different media and sceptor automated system for both staphylococcus aureus and coagulase-negative staphylococci isolates. Indian J Med Microbiol 2008 Jan-Mar;26(1):21-4.

164. Ishii Y, Alba J, Maehara C, Murakami H, Matsumoto T, Tateda K, Furuya N, Iwata M, Yamaguchi K. Identification of biochemically atypical staphylococcus aureus clinical isolates with three automated identification systems. J Med Microbiol 2006 Apr;55(Pt 4):387-92.

149

Appendix

150

Appendix: Biochemical substrates utilized by VITEK2 system

D-Amygdalin Ala-Phe-Pro Arylamidase Leucine Arylamidase Alanine Arylamidase D-Ribose Novobiocin Resistance D-Raffinose Optochin Resistance Phosphatidylinositol Phospholipase Cyclodextrin L-Proline Arylamidase Tyrosine Arylamidase L-Lactate alkalinization 6.5% salt 0/129 resistance D-Xylose L-Aspartate Arylamidase Beta Glucuronidase D-Sorbitol Lactose D-Mannitol Salicin Arginine Dihydrolase 1 Beta Galactopyranosidase Alpha-Galactosidase Urease N-Acetyl-D-Glucosamine D-Mannose Saccharose/Sucrose Beta-Galactosidase Alpha-Mannosidase L-Pyrrolidonyl-Arylamidase Polymixin B Resistance D-Maltose Methyl-B-D-Glucopyranoside D-Trehalose Alpha-Glucosidase Phosphatase Beta-Glucuronidase D-Galactose Bacitracin Resistance Pullulan Arginine Dihydrolase 2

151