UvA-DARE (Digital Academic Repository)

B and T cell crosstalk in anti-bacterial immune responses de Wit, J.

Publication date 2012 Document Version Final published version

Link to publication

Citation for published version (APA): de Wit, J. (2012). B and T cell crosstalk in anti-bacterial immune responses.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:02 Oct 2021 B and T cell crosstalk in anti-bacterial immune responses

Jelle de Wit B and T cell crosstalk in anti-bacterial immune responses

B and T cell crosstalk in anti-bacterial immune responses

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel op woensdag 4 juli 2012, te 14:00 uur

door Jelle de Wit

geboren te Heemskerk Promotiecommissie

Promotores: Prof. dr. S.M. van Ham Prof. dr. J.J. Neefjes

Overige leden: Prof. dr. L.A. Aarden Prof. dr. M.L. Kapsenberg Prof. dr. R.A.W. van Lier Prof. dr. J. Borst Prof. dr. H. Spits Prof. dr. F.A. Ossendorp Prof. dr. W.J. Stiekema

Faculteit der Natuurwetenschappen, Wiskunde en Informatica

The work described in this thesis was performed at the department of Immunopathology, Sanquin Blood Supply, Amsterdam, The Netherlands.

Financial support for the printing of this thesis was provided by: Sanquin Research, Amnis - part of EMD Millipore, Sanquin Reagents, Carl Zeiss Netherlands and BD Biosciences.

ISBN 978-90-9026580-3 © 2012 Jelle de Wit Printed by Offpage, Amsterdam, The Netherlands. Contents

page Chapter 1 General introduction 7

Chapter 2 BCR-mediated internalization of Salmonella: a novel pathway 27 for autonomous B cell activation and antibody production

Chapter 3 Human Salmonella-specific B cells solicit optimal T cell aid by 51 IL-6 dependent induction of IL-21 in plastic CD4+ Th cells

Chapter 4 IL-21 limits T helper effector cell differentiation by antagonizing 77 IL-2 signaling

Chapter 5 CD5 costimulation induces stable human Th17 development by 95 promoting IL-23R expression and sustained STAT3 activation Supplement To the editor: Generation of Th17 from human naive CD4+ T cells 115 preferentially occurs from FOXP3+ Treg upon costimulation via CD28 or CD5 Response: Priming of human naive CD4+ T cells via CD5 costimulation requires IL-6 for optimal Th17 development

Chapter 6 Salmonella selectively infects antigen-specific B lymphocytes for 123 survival and systemic dissemination

Chapter 7 Antigen-specific B cells reactivate an effective cytotoxic Tcell 141 response against phagocytosed Salmonella through cross- presentation

Chapter 8 Summarizing Discussion 163

Nederlandse samenvatting 185 Samenvatting voor niet-ingewijden 191 Curriculum Vitae 195 Dankwoord 197

General introduction 1 Chapter 1

8 General introduction

Humans are daily exposed to many potentially harmful microorganisms, like viruses and 1 r e t p a h C bacteria. Our immune system helps us to defend ourselves against those microorganisms. The immune response can be divided into an innate immune response and an acquired immune response. Innate immunity forms the first line of defense and broadly senses pathogens via expression of pattern-recognition receptors on innate cells. Important cells participating in the innate response and sensing for infection are macrophages, neutrophils and dendritic cells. As a second line of defense, we developped the acquired immune system. In contrast to the innate immune response, the acquired immune response is antigen specific. Its effector arm consists of specialized cells that recognize specific antigens of the pathogen and induce a much more efficient clearance. Furthermore, after the first encounter with a pathogen, the acquired immune response develops so called cellular memory against this specific pathogen. Upon reinfection, the acquired immune response is reactivated much faster to clear the infection. Both T cells and B cells take part in the acquired immune response. T cells become activated via antigen presentation by antigen presenting cells (APC), like dendritic cells and B cells. B cells can recognize specific antigens via their B cell receptor (BCR). Upon recognition and internalization, B cells present antigen to CD4+ T cells to attract help for antibody production. Eventually these processes lead to B cell differentiation into plasma cells in which antibodies are secreted with the same specificity as their BCR. This results in a humoral response with antibodies that specifically bind to the pathogen, thereby neutralizing the pathogen and enable their clearance via specialized cells.

B cell activation Before B cells initiate a humoral response against a specific pathogen, B cells first need to be activated before they differentiate into antibody-secreting plasma cells. Activation occurs via B cell receptor signaling. B cells express an antigen-specific BCR at their cell surface. The BCR-complex consist of a surface immunoglobulin, which bind specific antigens, and the signaling complex CD79a and CD79b, which have ITAM motifs that initiate intracellular signaling. Antigen binding of BCR causes microclustering ofthe BCRs1, which initiates pre-activation. Further clustering results in transphosphorylation of the ITAM motifs on CD79a and CD79b and a signaling cascade is started, which results in proliferation and secretion of antibodies.2 Upon activation with certain antigens, B cells can rapidly produce low-affinity antibodies.3 Alternatively, antigen-activated B cells acquire CD4+ T cell help in lymph nodes leading to germinal center (GC) formation. Here, activated B cells undergo somatic hypermutation and generate antibodies withhigh bindings-affinity (see below).4, 5 To attract T cell help, B cells need to process the BCR- bound antigen to present specific peptides to antigen-specific Tcells.6 Upon antigen

9 Chapter 1

recognition these T cells provide help in the form of ligation of CD40 on the activated B cell by CD40L on the T cells. Costimulation via CD40 forms the second obligatory signal of T-cell dependent B cell activation as it delivers a prosurvival signal to the B cell and drives it into cell cycle. Finally, cytokines secreted by T cells, like IL-21, may strongly enhance the humoral response of B cells by enhancing B cell proliferation and/or B cell differentiation into plasma cells .

Immunoglobulins The humoral response consists of antibodies that are secreted by plasma cells. Recognition of antigens via the BCR activates B cells and induces antibody secretion. In B cells the rearranged immunoglobulin locus gives rise to the membrane bound BCR. Upon B cell differentiation into antibody-secreting plasma cells, the membrane anchor is deleted and the immunoglobulins get secreted. Antibodies, or immunoglobulins, consist of a variable domain and a constant domain. The variable domain of the immunoglobulin binds to a specific antigen and is different for every immunoglobulin and thus also the BCR. The variable domain therefore determines the antigen-specificity of the B cells. The constant domain determines the isotype of the immunoglobulin. Five different isotypes exist in human: IgM, IgD, IgG, IgA and IgE. Human IgG can further be divided into four subclasses

Figure 1. Isotype switching. Next to the VDJ segments, encoding for the variable part of an immunoglobulin, different gene segments are found. Each segment encodes for a different isotype and has its own switch region (s). Switching occurs by recombination between these switch regions, with exclusion of the intermediary DNA.

10 General introduction

(IgG1, IgG2, IgG3 and IgG4) and IgA has two subclasses (IgA1 and IgA2). 1 r e t p a h C Gene segments encoding the variable and the different constant domains are located on the same DNA fragment (Figure 1). The variable segments are assembled to the constant region that lies closest to the variable part. A process named isotype switching, or class switching, generates different antibody subclasses. Induction of isotype switching is predominantly mediated by CD40-CD40L interactions between B and T cells7, 8, and is influenced by various cytokines.9-15 Every constant region encoding a different isotype has its own switch region, which are used in isotype switching (Figure 1). In this process, DNA encoding an isotype is excluded and thereby another constant region lies closest to the variable VDJ segments. This results in an antibody with the same variable domain, but a different isotype. Activation induced cytidine deaminase (AID) plays an important role in this process. AID inhibits DNA repair and thereby enhances DNA strand breaks, especially at the switch regions.16 An exception to this process is IgD, which does not have its own switch region. Alternative splicing of RNA determines the IgM or IgD isotype.17 Therefore, IgM and IgD can be expressed on the same B cell. Since each isotype induces different responses, B cells induce switching from one isotype into another isotype. Upon activation of naive B cells, IgM is first secreted. Monomeric IgM usually has a low affinity for its specific antigen. However, IgM is mainly secreted as a pentameric structure, enhancing its avidity by generating multimeric interactions with a pathogen. The main function of IgM is opsonization of antigens for destruction and complement activation.18 IgD levels are very low in the circulation, and for a long time its functions were not completely understood.19 Now, IgD has been shown to have a role in mucosal immunity, by binding to microbial factors as well as respiratory bacteria and viruses.20, 21 Furthermore, IgD binding to basophils can induce secretion of inflammatory cytokines like IL-4, IL-13 and TNF.22 IgG is the dominant isotype in the circulation. Except for IgG4, binding of IgG to a pathogen can activate the complement cascade resulting in clearance of the pathogen. In addition, binding to different Fcγ-receptors (FcγR) can alter cellular responses.23 FcγR can be divided into three classes (I, II and III) and can have stimulatory or inhibitory effects. IgG1 and IgG3 can bind to FcγRI, FcγRII and FcγRIII, while IgG4 binds only to FcγRII and FcγRIII. IgG2 only binds to FcγRII.23 IgA levels in serum are lower than IgG, but at mucosal surfaces (i.e. the intestines) IgA levels are much higher than IgG.24 In the serum, IgA is mainly a monomer, but at the mucosa IgA is a dimer. IgA mainly protects mucosal surfaces by neutralizing toxins, or preventing bacteria and viruses to bind to the mucosal surfaces.25 IgE is present at the lowest serum concentration. It is required for anti-parasitic immune responses by forming the bridging molecule between the parasite and the innate immune cells that attack the parasite; mast cells, basophils and eosinophils express FcεR which binds parasite-specific IgE. Binding

11 Chapter 1

of IgE to the parasite results in FcεR crosslinking, which forms the essential trigger for degranulation of anti-parasitic effector molecules. In line with this trigger function, IgE is also associated with hypersensitivity and allergic reactions, mediated by mast cells, basophils and eosinophils .

Antigen presentation To activate T cells, peptides of the antigen need be presented by antigen presenting cells (APCs) to activate T cells. APCs present peptides via two kinds of major histocompatibility complexes (MHC). Peptides presented via MHC class I activate CD8+ cytotoxic T cells (CTLs), whereas peptides via MHC class II activate CD4+ T helper cells. Classically, three APCs are described: dendritic cells, macrophages and B cells. Nowadays, basophils are also claimed to have antigen presenting capacity albeit that these data are still controversial.26, 27 The most common and well studied antigen presenting cell is the dendritic cell (DC), which is specialized in antigen uptake. DCs can take up pathogens, like Salmonella, and present them to both T helper cells and CTLs.28 However, B cells can also take up antigens via their specific BCR.29 This specificity of antigen uptake by the BCR makes B cells different from macrophages and DCs. The BCR mediated uptake leads to concentration of antigens and small amounts of antigen can be presented to T cells.30 Antigen presentation routes are classically divided into MHC class I and MHC class II- mediated, for endogenous and exogenous antigen respectively (Figure 2). Endogenous antigens are located intracellularly, in a virus infected cell for example. To clear the intracellular infection, a CD8+ cytotoxic T cell response is required in order to kill the infected cell. Endogenous antigens are processed by the proteasome and transported into the endoplasmatic reticulum via TAP. Here they are loaded on MHC class I, to activate a cytotoxic T cell response. Exogenous antigens, residing extracellularly, are sampled by APC. Internalization of the antigens leads to vesicles containing the antigen intracellularly. These vesicles are then processed via the endolysosomal pathway. Antigen containing vesicles fuse with MHC class II containing compartments31 and antigen is degraded in small peptides. MHC class II molecules contain class II associated invariant chain peptide (CLIP) in this peptide binding groove.32 In order to load antigenic peptides on MHC class II, CLIP is exchanged by peptides. The specialized chaperone HLA-DM catalyzes CLIP release and high affinity peptides are loaded into the peptide binding groove of MHC class II.33 HLA-DO, present in the antigen loading compartment of B cells, regulates the HLA-DM mediated peptide exchange.34, 35 Via antigen presentation on MHC class II a CD4+ T helper cell response is induced. The T helper cells secrete inflammatory cytokines that attract or aid other immune cells to clear the infection. Over the past decade, evidence was found that these two pathways are not strictly

12 General introduction

36, 37 separated. Extracellularly antigen, which is normally presented via MHC class II, can 1 r e t p a h C be processed and loaded on MHC class I via a pathway called cross-presentation. Via cross-presentation, facultative intracellular pathogens can also be processed to induce a cytotoxic T cell response. Furthermore, by cross-presenting exogenous antigen, APCs do not have to be infected themselves to prime a cytotoxic T cell response.28 The precise mechanisms of cross-presentation are not clear and currently more than one pathway has been shown to be involved. A “cytosolic pathway” has been described, in which antigens gain access to the cytosol via retrograde transport and translocation over the ER membrane. Subsequently, antigens are degraded by the proteasome and loaded onto MHC class I via the classical antigen presentation route.38 A second pathway, the “vacuolar pathway” is not dependent on a cytosolic step. Antigenic peptides are generated by antigen proteolysis in the internalized vesicles. These peptides bind to MHC class I which is localized into the endolysosomal pathway upon endocytosis.39 Both cross-presentation routes have been studied intensively in DCs.40-42 B cells can also cross present antigens and efficiently activate CTLs.43, 44 Besides cross-presenting extracellular antigen onto MHC class I, DCs and B cells can also present endogenous antigens on MHC class II, in a process called “reverse cross- presentation”. By autophagy, endogenous antigen can be processed via the endolysosomal pathway and presented on MHC class II.45, 46

Figure 2. Antigen presentation via MHC class I and MHC class II. Endogenous antigens residing in the cytosol (bottem part) are degraded into peptides that transported into the endoplasmatic reticulum (ER).Here, peptides are loaded to MHC class I molecules, which are transported via Golgi apparatus to the cell surface and activate CD8+ cytotoxic T cells. Exogenous antigens are internalized into vesicles, which fuse with MHC class II containing vesicles. Peptides are loaded on MHC class II and presented to CD4+ T helper cells.

13 Chapter 1

Figure 3. T cell differentiation induced by cytokines. Cytokines produced by antigen presenting cells (APC) induces differentiation of naive T cells (Tn) into various T helper subsets.

T cell differentiation Peptides presentend on MHC class II molecules can be recognized by a specific T cell receptor (TCR). Upon TCR recognition of a specific peptide presented by the APC (signal 1), naive CD4+ T helper cells become activated.47 Concurrent costimulation via CD28 provides a survival signal (signal 2) and drives the activated CD4+ T cells into proliferation.48 In addition, cytokines produced by the APC or cell-associated factors (signal 3) play a central role in the differentiation of naive T cells into a specific T helper subset with specialized functional characteristics (Figure 3).49 These subsets are characterized by specific transcription factors and the production of hallmark cytokines. The two classical subsets were the T helper (Th) 1 and Th2 subsets,50 but over the last two decades new subsets have been characterized, such as induced regulatory T cells (iTreg), Th17 and follicuclar T helper cells (Tfh).51-57 Besides TCR stimulation (signal 1) and costimulation (signal 2), IL-12 secretion by the APC induces naive T cells to differentiate into Th1 subset, which is characterized by the transcription factor T-bet and the secretion of IFN-γ.58, 59 The secreted IFN-γ has been demonstrated to improve Th1 differentiation as well.59 Th1 cells are involved in the cellular immunity against intracellular microorganisms, but do not help B cells in antibody production.57, 60 In vitro studies have shown that presence of both IL-4 and IL-2 are essential in the differentiation towards Th2 cells.61-64 IL-4, which is essential in Th2 differentiation, is also the key cytokine of this subset. The B cell molecule OX40L was shown to induce IL-4 secretion in T cells, thereby promoting Th2 differentiation.65 Next to IL-4, Th2 cells also produce IL-5 and IL-13 and express the specific transcription factor GATA3.66, 67 Th2 cells help in the defense against helminths and were previously thought

14 General introduction

to be the main helper cells for providing aid to antibody secretion by B cells. iTregs are 1 r e t p a h C induced by TGF-β and, at least in mice, constitutively express Foxp-3.49, 52, 68 Via production of IL-10 or TGF-β, iTregs have essential roles in maintenance of peripheral tolerance and preventing autoimmunity.69 In the past decennium, Th17 cells were discovered, which are characterized by the transcription factor ROR-γt and the secretion of IL-17. The induction of Th17 differentiation in human is still a matter of debate. Although in mice it is clear that IL-6 and TGF-β induce Th17 differentiation, in human it is accepted to be the combination of IL-23, IL-1β, TGF-β and IL-6.55, 70 Even under those conditions however, the induction of Th17 is still sub-optimal, since the amount of differentiated Th17 cells are relatively low. The cytokines produced by Th17 cells allow Th17 cells to induce other immune and nonimmune cells. IL-17 has broad effects on many cell types and induce the production of proinflammatory cytokines and chemokines to attract neutrophils to the site of inflammation to strengthen host defense.71 Follicular T helper cells were characterized about 12 years ago.56 Main characteristics of Tfh cells are expression of the chemokine receptor CXCR5, ICOS and PD-1 and the secretion of IL-21. Recently, Bcl-6 was identified to be the specific transcription factor of this T cell subset.72, 73 Tfh aid B cells in the germinal center to generate an effective humoral immune reponse (see below). Until recently, differentiated Th cells were thought to be fixed in their differentiation status and to confer the same functional characteristics to their daughter cells after reactivation. However, recent studies show that differentiated cells retain the flexibility to dedifferentiate or redifferentiate.49, 74, 75 Cytokine production by T cells does not determine a specific T helper subset anymore. Th17 cells were demonstrated to produce the Th1 associated cytokine IFN-γ, especially in vivo.76, 77 Additionally, in vitro stimulation of Th17 by IL-12 or IL-4 can convert them into IFN-γ producing Th1 or IL-4 producing Th2 cells, respectively.57 Although Th1 cells could not obtain Th17 characteristics, it has been shown that Th1 cells produce the Th2 cytokine IL-13 under certain circumstances.78 The other way around, Th2 cells producing IFN-γ were also demonstrated in transfer studies in mice.79 These data suggest flexibility in cytokine production by different T helper subsets. Specific transcription factors might therefore be more suitable to identify different subsets. However, expression levels of these transcription factors might vary or different transcription factors are expressed simultaneously.80, 81 This suggest a strong plasticity between different T helper subsets, implying flexible Th response upon different stimulations.

B cells and T cells in the germinal center Naive B cells originate in the bone marrow, and enter the blood stream to migrate to the periphery, to the spleen and other secondary lymphoid organs. In secondary lymphoid

15 Chapter 1

organs lymphocytes are segregated in different zones, the B cells zone and the T cells zone. Expression of specific chemokine receptors determines this localization. Migration to the B cell zone requires CXCR5, while CCR7 is required for T cell zone migration.82 To become activated, B cells have to bind specific antigens via their specific BCR. The precise mechanism how antigen is delivered to B cells it not known. It is possible that B cells in the periphery encounter antigens and migrate to the secondary lymphoid organs. It is also possible that dendritic cells that have sampled antigen in the periphery deliver antigens to B cells.83 Upon antigen ligation to the BCR, T cell dependent antigens are processed and activated B cells migrate to the border of the B cell zone to come into contact with T cells. T cell migration to the B-T cell border is not completely understood. It is likely that naive T cells are activated by dendritic cells, which induces temporarily upregulation of CXCR5. This allows T cells to migrate to the B cell area. T cells which are stimulated by the antigens presented by B cells express CD40L which induces costimulation to B cells. This CD40-CD40L interaction allows B cells to further differentiate and proliferate.84 As a result, the B cells can become a plasmablast and migrate to extrafollicular sites. Plasmablasts produce antigen-specific antibodies, but they have a low affinity. In contrast, after contact with T cells on the border of the B and T cell zone, some B cells return to the center of the B cell zone and proliferate, forming a germinal center (GC).85 During proliferation both class switching and somatic hypermutation are initiated. Somatic hypermutation is a process in which random mutations are introduced in the DNA encoding the BCR. Somatic hypermutation results in selection of BCR with high affinity for theantigen, resulting in secretion of high affinity antibodies. Finally, these B cell exit the follicle and differentiate into memory B cells that circulate in the periphery, and long-lived plasma cells, which reside in the bone marrow.86 The formation of a GC requires the expression of Bcl-6 protein.87, 88 Bcl-6 is highly expressed in GC B cells. It enhances B cell proliferation, but also inhibits DNA-damage responses, which enhances class switching and somatic hypermutation.89, 90 Furthermore, Bcl-6 inhibits expression of Blimp-1, a protein necessary for plasma cell differentiation.91 Expression of Bcl-6 requires IL-21 signaling.92 The most potent cell providing IL-21 to the B cell is the follicular T helper (Tfh) cell.

Follicular T helper cells and B cell help The origin of the Tfh cells is not completely clear. T cell activation by APCs induces expression of CXCR5 that allows T cells to migrate to the B-T cell border, to interact with B cells. In contrast to other Th subsets that downregulate CXCR5 expression rapidly, Tfh cells constitutively express CXCR5. Despite of the expression of CXCR5, these extrafollicular T cells do not migrate towards its related chemokine CXCL13 in the B cell

16 General introduction

93 follicle. Presumably, the expression of CCR7 maintain their presence in the T cell zone. 1 r e t p a h C The CXCR5+, extrafollicular T cells are suggested to be pre-Tfh cells. The pre-Tfh cells are different from so called “GC-Tfh cells”, Tfh cells that express PD-1 and do migrate into the germinal center. Pre-Tfh cells interact with B cells at the border of the follicle and form stable interactions.54 It is possible that due to this interaction, pre-Tfh cells obtain the capacity to migrate into the germinal center and become full, GC-Tfh cells. Upon recognition of B cells presenting the specific antigen, Tfh are induced to secrete IL-21. The precise mechanism that induces GC-Tfh differentatiation and IL-21 secretion is not completely known. The expression of ICOSL on B cells or SAP expression on T cells has been linked to Tfh formation94, 95, but it is still not clear which B-T cell interaction is critical. The induction of Tfh cell differentiation is very beneficial for B cells. IL-21 secretion by Tfh cells provides significant help to B cells. IL-21 has been show to be a major factor in antibody secretion, isotype switching and proliferation of B cells.96 Not only Tfh, also Th1 and Th2 cells have been shown to interact with B cells and provide help in antibody secretion. Since it now have become clear that Th subsets have the potential to redifferentiate from on Th subset into another57, 74, 75, it is possible that Tfh cells display characteristics of Th1 or Th2 cells. On the other hand, it is possible that Th1 or Th2 cells obtain Tfh cell characteristics, via interaction with B cells, becoming GC-Tfh cells. Overall, B cells seem to be very important in the induction of Tfh differentiation, thereby providing optimal help for themselves in antibody production. The precise induction of Tfh cells is still not completely understood and remains a matter of debate.

Salmonella infection A well studied pathogen is the Salmonella bacterium. Salmonellae are facultative intracellular, Gram-negative bacteria. Salmonella typhi can infect humans and causes thypoid fever, resulting in 20 million illnesses and 600 000 deaths annually.97 Salmonella enterica serovar typhimurium, also called S. typhimurium causes typhoid like disease in mice, and is generally accepted as an experimental model for human typhoid disease.97 To invade other cells, Salmonella makes use of specific virulence factors, called the Type III Secretion Systems (TTSS). The TTSS consist of sophisticated secretion devises that inject effector proteins into the cell.98 This results in altered actin cytoskeleton allowing phagosomal cup formation, followed by entry of Salmonella into the cell. After invasion, Salmonella resides intracellular in a Salmonella containing vacuole (SCV). Here, other effector proteins are secreted by Salmonella, enabling intracellular trafficking and replication within the SCV.99 Furthermore, via secretion of effector proteins in the cytosol, Salmonella inhibits fusion of the SCV with lysosomes, preventing lysosomal degradation and antigen presentation.100 Salmonella replicates intracellularly 101, 102 and escapes

17 Chapter 1

detection by the immune system.103, 104 The common route of infection is oral ingestion ofSalmonella . In the intestines,Salmonella crosses the epithelial barrier via microfold cells, or M cells. M cells are located in dome region of the Peyer’s Patches and are specialized in transportation of nutrients across the epithelial barrier. Microorganisms misuse M cells to invade the epithelium. After M cells transcytosis, the microorganisms meet up with the underlying immune cells.105 Besides entry via M cells, sampling by DCs might also form a way for bacterial invasion. DCs can protrude dendrites in between the epithelial layer into the intestinal lumen. This enables sampling of microorganisms in the lumen, and transportation to the basolateral side of the lumen.106 The bacteria are ultimately internalized by macrophages, DCs and neutrophils, residing at the Peyer’s Patches, which have been implicated in their localized spreading to the mesenteric lymph nodes. Next, Salmonella spreads via the mesenteric lymph nodes to the liver, bone marrow and spleen and causes systemic infection.107 The precise route of systemic spread is not completely clear. So far, a role for neutrophils and dendritic cells has been suggested.108, 109 Since Salmonella is a facultative intracellular bacterium, the immune system has to clear both extracellular as well as intracellular bacteria. Indeed, it has been demonstrated that both humoral and cellular responses are required for clearance of Salmonella.110, 111 The initiated humoral response helps in the clearance of extracellular bacteria, whereas the cytotoxic T cell response combat intracellular residing Salmonella.

B cells and Salmonella infection The role of B cells in the clearance of Salmonella infection is evident. B cell deficient mice are less resistant to oral infection of virulent Salmonella.97 The impaired resistance could result from a lack of protective antibodies. Activated B cells secrete Salmonella-specific antibodies, which opsonize Salmonella to induce clearance. However, the antibody response is not the only role B cells play in the defense against Salmonella infection. Transfer of immune serum does not make B cell deficient mice resistant to oral infection with virulent Salmonella.112 Since T cells are crucial in clearance of Salmonella 113, a role for B cells in T cell activation is possible. Although B cells are not required to induce a primary T cell response, they do play an important role in the expansion of antigen- specific Th1 cells.114, 115 The activation of a CD8+ CTL response is also much weaker in B cell deficient mice.114 This implies a dual role for B cells in the protection against Salmonella infection: secretion of specific antibodies and induction of beneficial T cell responses.

18 General introduction

Scope of this thesis 1 r e t p a h C

This thesis addresses how B cells acquire antigen of pathogens and how the crosstalk between B and T cells affects the humoral and cellular immune response against bacterial infections. The role for B cells in antibody formation, and its MHC II-mediated antigen presenting capacity to obtain T cell help has been accepted as general knowledge for many years. So far however, B cells were not thought to be able to internalize particulate antigen. In Chapter 2, the phagocytic capacity of B cells was investigated, using beads and the bacterium Salmonella typhimurium as a model system. We show that primary B cells phagocytose anti-BCR coated beads as well as whole Salmonellae and that phagocytosis forms a very efficient pathway to attract CD4+ T cell help. In Chapter 3 we investigated if pathogen-activated B cells affect CD4+ T cell differentiation and how this relates to CD4+ T cell aid to B cells for antibody production. We demonstrate that B cells induce primarily a T cells response with mixed Th1 and Tfh characteristics. Differentiation towards a Tfh subset is dependent on IL-6 signaling. The suppression of IL-4 production and B cell mediated induction of IL-21 secretion leads to optimal B cell help in antibody production. In Chapter 4, we investigated the role of the cytokines IL-21 and IL-2 in CD4+ T cell differentiation. We show that IL-21 decreases Th differentiation by downmodulation of endogenous IL-2 transcription. We conclude that IL-21 may function as a negative feedback mechanism to downmodulate the immune response in the germinal center. Although cytokines play an important role in T cell differentiation, costimulation is also able to steer the T cell response. We demonstrate in Chapter 5 that costimulation via CD5 is superior to classical CD28 costimulation in the induction of Th17 cells. CD5 costimulation induces prolonged STAT3 activation, resulting in better maintenance of the Th17 phenotype via IL-23 signaling.Although B cells elicit a humoral response and activate T helper cells upon Salmonella infection, these responses cannot deal with intracellularly surviving Salmonella. Since B cells can phagocytose Salmonella, we investigated the role of B cells in dissemination of the bacterium. In Chapter 6 we show that after phagocytosis Salmonella survives in a latent state within B cells, and is excreted at later time points to infect other tissues, resulting in systemic spreading of the bacterium. Salmonella thus misuses the specificity of the acquired immune system to disseminate. To deal with intracellular Salmonella, a cytotoxic T cell response is desirable and indeed, has been shown to be required in animal models. In Chapter 7, we show that Salmonella-specific B cells are also able to induce a Salmonella-specific recall response of both central memory and effector memory CD8+ T cells, via efficient cross-presentation. All results are summarized and discussed in Chapter 8.

19 Chapter 1

References

1. Weber, M., B. Treanor, D. Depoil, H. Shinohara, N. E. Harwood, M. Hikida, T. Kurosaki, and F. D. Batista. 2008. Phospholipase C-gamma2 and Vav cooperate within signaling microclusters to propagate B cell spreading in response to membrane-bound antigen. J. Exp. Med. 205: 853-868. 2. Niiro, H., and E. A. Clark. 2002. Regulation of B-cell fate by antigen-receptor signals. Nat. Rev. Immunol. 2: 945-956. 3. MacLennan, I. C., K. M. Toellner, A. F. Cunningham, K. Serre, D. M. Sze, E. Zuniga, M. C. Cook, and C. G. Vinuesa. 2003. Extrafollicular antibody responses. Immunol. Rev. 194: 8-18. 4. MacLennan, I. C. 1994. Germinal centers. Annu. Rev. Immunol. 12: 117-139. 5. Rajewsky, K. 1996. Clonal selection and learning in the antibody system. Nature 381: 751-758. 6. Mitchison, N. A. 2004. T-cell-B-cell cooperation. Nat. Rev. Immunol. 4: 308-312. 7. Korthauer, U., D. Graf, H. W. Mages, F. Briere, M. Padayachee, S. Malcolm, A. G. Ugazio, L. D. Notarangelo, R. J. Levinsky, and R. A. Kroczek. 1993. Defective expression of T-cell CD40 ligand causes X-linked immunodeficiency with hyper-IgM. Nature 361: 539-541. 8. Gray, D., K. Siepmann, and G. Wohlleben. 1994. CD40 ligation in B cell activation, isotype switching and memory development. Semin. Immunol. 6: 303-310. 9. Tangye, S. G., A. Ferguson, D. T. Avery, C. S. Ma, and P. D. Hodgkin. 2002. Isotype switching by human B cells is division-associated and regulated by cytokines. J. Immunol. 169: 4298-4306. 10. Wagner, E. F., M. Hleb, N. Hanna, and S. Sharma. 1998. A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation. J. Immunol. 161: 1123-1131. 11. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, M. R. de Waal, and J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U. S. A 90: 3730-3734. 12. Kindler, V., and R. H. Zubler. 1997. Memory, but not naive, peripheral blood B lymphocytes differentiate into Ig-secreting cells after CD40 ligation and costimulation with IL-4 and the differentiation factors IL-2, IL-10, and IL-3. J. Immunol. 159: 2085-2090. 13. Arpin, C., J. Dechanet, K. C. Van, P. Merville, G. Grouard, F. Briere, J. Banchereau, and Y. J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268: 720-722. 14. Kuchen, S., R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger. 2007. Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J. Immunol. 179: 5886-5896. 15. Good, K. L., V. L. Bryant, and S. G. Tangye. 2006. Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL-21. J. Immunol. 177: 5236-5247. 16. Manis, J. P., M. Tian, and F. W. Alt. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23: 31-39. 17. Yuan, D., P. L. Witte, J. Tan, J. Hawley, and T. Dang. 1996. Regulation of IgM and IgD heavy chain gene expression: effect of abrogation of intergenic transcriptional termination. J. Immunol. 157: 2073-2081. 18. Cooper, N. R. 1985. The classical complement pathway: activation and regulation of the first complement component. Adv. Immunol. 37: 151-216. 19. Schroeder, H. W., Jr., and L. Cavacini. 2010. Structure and function of immunoglobulins. J. Allergy Clin. Immunol. 125: S41-S52. 20. Chen, K., and A. Cerutti. 2011. The function and regulation of immunoglobulin D.Curr. Opin. Immunol. 23: 345-352. 21. Chen, K., and A. Cerutti. 2010. New insights into the enigma of immunoglobulin D. Immunol. Rev. 237:

20 General introduction

160-179. 1 r e t p a h C 22. Chen, K., W. Xu, M. Wilson, B. He, N. W. Miller, E. Bengten, E. S. Edholm, P. A. Santini, P. Rath, A. Chiu, M. Cattalini, J. Litzman, B. Bussel, B. Huang, A. Meini, K. Riesbeck, C. Cunningham-Rundles, A. Plebani, and A. Cerutti. 2009. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils. Nat. Immunol. 10: 889-898. 23. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu. Rev. Immunol. 19: 275-290. 24. Woof, J. M., and J. Mestecky. 2005. Mucosal immunoglobulins. Immunol. Rev. 206: 64-82. 25. Macpherson, A. J., L. Hunziker, K. McCoy, and A. Lamarre. 2001. IgA responses in the intestinal mucosa against pathogenic and non-pathogenic microorganisms. Microbes. Infect. 3: 1021-1035. 26. Mikhak, Z., and A. D. Luster. 2009. The emergence of basophils as antigen-presenting cells in Th2 inflammatory responses. J. Mol. Cell Biol. 1: 69-71. 27. Eckl-Dorna, J., A. Ellinger, K. Blatt, V. Ghanim, I. Steiner, M. Pavelka, P. Valent, R. Valenta, andV. Niederberger. 2012. Basophils are not the key antigen-presenting cells in allergic patients. Allergy. 28. Salerno-Goncalves, R., and M. B. Sztein. 2009. Priming of Salmonella enterica serovar typhi-specific CD8(+) T cells by suicide dendritic cell cross-presentation in humans. PLoS. One. 4: e5879. 29. Reth, M. 1994. B cell antigen receptors. Curr. Opin. Immunol. 6: 3-8. 30. Rivera, A., C. C. Chen, N. Ron, J. P. Dougherty, and Y. Ron. 2001. Role of B cells as antigen-presenting cells in vivo revisited: antigen-specific B cells are essential for T cell expansion in lymph nodes and for systemic T cell responses to low antigen concentrations. Int. Immunol. 13: 1583-1593. 31. Clark, M. R., D. Massenburg, K. Siemasko, P. Hou, and M. Zhang. 2004. B-cell antigen receptor signaling requirements for targeting antigen to the MHC class II presentation pathway. Curr. Opin. Immunol. 16: 382-387. 32. Roche, P. A., and P. Cresswell. 1990. Invariant chain association with HLA-DR molecules inhibits immunogenic peptide binding. Nature 345: 615-618. 33. Ullrich, H. J., K. Doring, U. Gruneberg, F. Jahnig, J. Trowsdale, and S. M. van Ham. 1997. Interaction between HLA-DM and HLA-DR involves regions that undergo conformational changes at lysosomal pH. Proc. Natl. Acad. Sci. U. S. A 94: 13163-13168. 34. Denzin, L. K., D. B. Sant’Angelo, C. Hammond, M. J. Surman, and P. Cresswell. 1997. Negative regulation by HLA-DO of MHC class II-restricted antigen processing. Science 278: 106-109. 35. van Ham, S. M., E. P. Tjin, B. F. Lillemeier, U. Gruneberg, K. E. van Meijgaarden, L. Pastoors, D. Verwoerd, A. Tulp, B. Canas, D. Rahman, T. H. Ottenhoff, D. J. Pappin, J. Trowsdale, and J. Neefjes. 1997. HLA-DO is a negative modulator of HLA-DM-mediated MHC class II peptide loading. Curr. Biol. 7: 950-957. 36. Reis e Sousa, and R. N. Germain. 1995. Major histocompatibility complex class I presentation of peptides derived from soluble exogenous antigen by a subset of cells engaged in phagocytosis. J. Exp. Med. 182: 841-851. 37. Giodini, A., C. Rahner, and P. Cresswell. 2009. Receptor-mediated phagocytosis elicits cross-presentation in nonprofessional antigen-presenting cells. Proc. Natl. Acad. Sci. U. S. A 106: 3324-3329. 38. Huang, A. Y., A. T. Bruce, D. M. Pardoll, and H. I. Levitsky. 1996. In vivo cross-priming of MHC class I-restricted antigens requires the TAP transporter. Immunity. 4: 349-355. 39. Ramachandra, L., D. Simmons, and C. V. Harding. 2009. MHC molecules and microbial antigen processing in phagosomes. Curr. Opin. Immunol. 21: 98-104. 40. Heath, W. R., and F. R. Carbone. 2001. Cross-presentation, dendritic cells, tolerance and immunity.Annu. Rev. Immunol. 19: 47-64. 41. Amigorena, S., and A. Savina. 2010. Intracellular mechanisms of antigen cross presentation in dendritic cells. Curr. Opin. Immunol. 22: 109-117. 42. van, M. N., M. G. Camps, S. Khan, D. V. Filippov, J. J. Weterings, J. M. Griffith, H. J. Geuze, H. T. van, J. S.

21 Chapter 1

Verbeek, C. J. Melief, and F. Ossendorp. 2009. Antigen storage compartments in mature dendritic cells facilitate prolonged cytotoxic T lymphocyte cross-priming capacity. Proc. Natl. Acad. Sci. U. S. A 106: 6730-6735. 43. Heit, A., K. M. Huster, F. Schmitz, M. Schiemann, D. H. Busch, and H. Wagner. 2004. CpG-DNA aided cross- priming by cross-presenting B cells. J. Immunol. 172: 1501-1507. 44. Jiang, W., M. M. Lederman, C. V. Harding, and S. F. Sieg. 2011. Presentation of soluble antigens to CD8+ T cells by CpG oligodeoxynucleotide-primed human naive B cells. J. Immunol. 186: 2080-2086. 45. Dani, A., A. Chaudhry, P. Mukherjee, D. Rajagopal, S. Bhatia, A. George, V. Bal, S. Rath, and S. Mayor. 2004. The pathway for MHCII-mediated presentation of endogenous proteins involves peptide transport to the endo-lysosomal compartment. J. Cell Sci. 117: 4219-4230. 46. Dengjel, J., O. Schoor, R. Fischer, M. Reich, M. Kraus, M. Muller, K. Kreymborg, F. Altenberend, J. Brandenburg, H. Kalbacher, R. Brock, C. Driessen, H. G. Rammensee, and S. Stevanovic. 2005. Autophagy promotes MHC class II presentation of peptides from intracellular source proteins. Proc. Natl. Acad. Sci. U. S. A 102: 7922-7927. 47. Smith-Garvin, J. E., G. A. Koretzky, and M. S. Jordan. 2009. T cell activation.Annu. Rev. Immunol. 27: 591- 619. 48. Acuto, O., and F. Michel. 2003. CD28-mediated co-stimulation: a quantitative support for TCR signalling. Nat. Rev. Immunol. 3: 939-951. 49. Zhu, J., H. Yamane, and W. E. Paul. 2010. Differentiation of effector CD4 T cell populations. Annu. Rev. Immunol. 28: 445-489. 50. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, and R. L. Coffman. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136: 2348-2357. 51. Shevach, E. M. 2002. CD4+ CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2: 389-400. 52. Sakaguchi, S., T. Yamaguchi, T. Nomura, and M. Ono. 2008. Regulatory T cells and immune tolerance. Cell 133: 775-787. 53. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6: 1123-1132. 54. Okada, T., M. J. Miller, I. Parker, M. F. Krummel, M. Neighbors, S. B. Hartley, A. O’Garra, M. D. Cahalan, and J. G. Cyster. 2005. Antigen-engaged B cells undergo chemotaxis toward the T zone and form motile conjugates with helper T cells. PLoS. Biol. 3: e150. 55. Manel, N., D. Unutmaz, and D. R. Littman. 2008. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat. Immunol. 9: 641-649. 56. Breitfeld, D., L. Ohl, E. Kremmer, J. Ellwart, F. Sallusto, M. Lipp, and R. Forster. 2000. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp. Med. 192: 1545-1552. 57. Zhou, L., M. M. Chong, and D. R. Littman. 2009. Plasticity of CD4+ T cell lineage differentiation.Immunity. 30: 646-655. 58. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, and K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260: 547-549. 59. Lighvani, A. A., D. M. Frucht, D. Jankovic, H. Yamane, J. Aliberti, B. D. Hissong, B. V. Nguyen, M. Gadina, A. Sher, W. E. Paul, and J. J. O’Shea. 2001. T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. U. S. A 98: 15137-15142.

22 General introduction

60. Morita, R., N. Schmitt, S. E. Bentebibel, R. Ranganathan, L. Bourdery, G. Zurawski, E. Foucat, M. Dullaers, 1 r e t p a h C S. Oh, N. Sabzghabaei, E. M. Lavecchio, M. Punaro, V. Pascual, J. Banchereau, and H. Ueno. 2011. Human blood CXCR5(+)CD4(+) T cells are counterparts of T follicular cells and contain specific subsets that differentially support antibody secretion. Immunity. 34: 108-121. 61. Cote-Sierra, J., G. Foucras, L. Guo, L. Chiodetti, H. A. Young, J. Hu-Li, J. Zhu, and W. E. Paul. 2004. Interleukin 2 plays a central role in Th2 differentiation. Proc. Natl. Acad. Sci. U. S. A 101: 3880-3885. 62. Hsieh, C. S., A. B. Heimberger, J. S. Gold, A. O’Garra, and K. M. Murphy. 1992. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an alpha beta T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. U. S. A 89: 6065-6069. 63. Rocken, M., J. H. Saurat, and C. Hauser. 1992. A common precursor for CD4+ T cells producing IL-2 or IL-4. J. Immunol. 148: 1031-1036. 64. Sad, S., and T. R. Mosmann. 1994. Single IL-2-secreting precursor CD4 T cell can develop into either Th1 or Th2 cytokine secretion phenotype. J. Immunol. 153: 3514-3522. 65. Flynn, S., K. M. Toellner, C. Raykundalia, M. Goodall, and P. Lane. 1998. CD4 T cell cytokine differentiation: the B cell activation molecule, OX40 ligand, instructs CD4 T cells to express interleukin 4 and upregulates expression of the chemokine receptor, Blr-1. J. Exp. Med. 188: 297-304. 66. Swain, S. L., A. D. Weinberg, M. English, and G. Huston. 1990. IL-4 directs the development of Th2-like helper effectors. J. Immunol. 145: 3796-3806. 67. Zheng, W., and R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89: 587-596. 68. Josefowicz, S. Z., and A. Rudensky. 2009. Control of regulatory T cell lineage commitment and maintenance. Immunity. 30: 616-625. 69. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M. Wahl. 2003. Conversion of peripheral CD4+. J. Exp. Med. 198: 1875-1886. 70. Volpe, E., N. Servant, R. Zollinger, S. I. Bogiatzi, P. Hupe, E. Barillot, and V. Soumelis. 2008. A critical function for transforming growth factor-beta, interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses. Nat. Immunol. 9: 650-657. 71. Korn, T., E. Bettelli, M. Oukka, and V. K. Kuchroo. 2009. IL-17 and Th17 Cells. Annu. Rev. Immunol. 27: 485-517. 72. Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J. Immunol. 173: 68-78. 73. Yu, D., S. Rao, L. M. Tsai, S. K. Lee, Y. He, E. L. Sutcliffe, M. Srivastava, M. Linterman, L. Zheng, N. Simpson, J. I. Ellyard, I. A. Parish, C. S. Ma, Q. J. Li, C. R. Parish, C. R. Mackay, and C. G. Vinuesa. 2009. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity. 31: 457- 468. 74. O’Shea, J. J., and W. E. Paul. 2010. Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells. Science 327: 1098-1102. 75. Murphy, K. M., and B. Stockinger. 2010. Effector T cell plasticity: flexibility in the face of changing circumstances. Nat. Immunol. 11: 674-680. 76. Wilson, N. J., K. Boniface, J. R. Chan, B. S. McKenzie, W. M. Blumenschein, J. D. Mattson, B. Basham, K. Smith, T. Chen, F. Morel, J. C. Lecron, R. A. Kastelein, D. J. Cua, T. K. McClanahan, E. P. Bowman, and M. R. de Waal. 2007. Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat. Immunol. 8: 950-957. 77. Chen, Z., C. M. Tato, L. Muul, A. Laurence, and J. J. O’Shea. 2007. Distinct regulation of interleukin-17 in human T helper lymphocytes. Arthritis Rheum. 56: 2936-2946.

23 Chapter 1

78. Hayashi, N., T. Yoshimoto, K. Izuhara, K. Matsui, T. Tanaka, and K. Nakanishi. 2007. T helper 1 cells stimulated with ovalbumin and IL-18 induce airway hyperresponsiveness and lung fibrosis by IFN-gamma and IL-13 production. Proc. Natl. Acad. Sci. U. S. A 104: 14765-14770. 79. Lohning, M., A. N. Hegazy, D. D. Pinschewer, D. Busse, K. S. Lang, T. Hofer, A. Radbruch, R. M. Zinkernagel, and H. Hengartner. 2008. Long-lived virus-reactive memory T cells generated from purified cytokine- secreting T helper type 1 and type 2 effectors. J. Exp. Med. 205: 53-61. 80. Zhou, L., J. E. Lopes, M. M. Chong, I. I. Ivanov, R. Min, G. D. Victora, Y. Shen, J. Du, Y. P. Rubtsov, A. Y. Rudensky, S. F. Ziegler, and D. R. Littman. 2008. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature 453: 236-240. 81. Koch, M. A., G. Tucker-Heard, N. R. Perdue, J. R. Killebrew, K. B. Urdahl, and D. J. Campbell. 2009. The transcription factor T-bet controls regulatory T cell homeostasis and function during type 1 inflammation. Nat. Immunol. 10: 595-602. 82. Cyster, J. G. 2005. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu. Rev. Immunol. 23: 127-159. 83. Gonzalez, S. F., S. E. Degn, L. A. Pitcher, M. Woodruff, B. A. Heesters, and M. C. Carroll. 2011. Trafficking of B cell antigen in lymph nodes. Annu. Rev. Immunol. 29: 215-233. 84. Laman, J. D., E. Claassen, and R. J. Noelle. 1996. Functions of CD40 and its ligand, gp39 (CD40L).Crit Rev. Immunol. 16: 59-108. 85. Allen, C. D., T. Okada, and J. G. Cyster. 2007. Germinal-center organization and cellular dynamics. Immunity. 27: 190-202. 86. Tarlinton, D. M., and K. G. Smith. 2000. Dissecting affinity maturation: a model explaining selection of antibody-forming cells and memory B cells in the germinal centre. Immunol. Today 21: 436-441. 87. Dent, A. L., A. L. Shaffer, X. Yu, D. Allman, and L. M. Staudt. 1997. Control of inflammation, cytokine expression, and germinal center formation by BCL-6. Science 276: 589-592. 88. Fukuda, T., T. Yoshida, S. Okada, M. Hatano, T. Miki, K. Ishibashi, S. Okabe, H. Koseki, S. Hirosawa, M. Taniguchi, N. Miyasaka, and T. Tokuhisa. 1997. Disruption of the Bcl6 gene results in an impaired germinal center formation. J. Exp. Med. 186: 439-448. 89. Basso, K., M. Saito, P. Sumazin, A. A. Margolin, K. Wang, W. K. Lim, Y. Kitagawa, C. Schneider, M. J. Alvarez, A. Califano, and R. Dalla-Favera. 2010. Integrated biochemical and computational approach identifies BCL6 direct target genes controlling multiple pathways in normal germinal center B cells.Blood 115: 975- 984. 90. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity. 13: 199-212. 91. Tunyaplin, C., A. L. Shaffer, C. D. Angelin-Duclos, X. Yu, L. M. Staudt, and K. L. Calame. 2004. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation. J. Immunol. 173: 1158-1165. 92. Linterman, M. A., L. Beaton, D. Yu, R. R. Ramiscal, M. Srivastava, J. J. Hogan, N. K. Verma, M. J. Smyth, R. J. Rigby, and C. G. Vinuesa. 2010. IL-21 acts directly on B cells to regulate Bcl-6 expression and germinal center responses. J. Exp. Med. 207: 353-363. 93. Odegard, J. M., B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity. J. Exp. Med. 205: 2873-2886. 94. Nurieva, R. I., Y. Chung, D. Hwang, X. O. Yang, H. S. Kang, L. Ma, Y. H. Wang, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2008. Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages. Immunity. 29: 138-149. 95. Qi, H., J. L. Cannons, F. Klauschen, P. L. Schwartzberg, and R. N. Germain. 2008. SAP-controlled T-B cell interactions underlie germinal centre formation. Nature 455: 764-769.

24 General introduction

96. Ettinger, R., S. Kuchen, and P. E. Lipsky. 2008. The role of IL-21 in regulating B-cell function in health and 1 r e t p a h C disease. Immunol. Rev. 223: 60-86. 97. Mittrucker, H. W., and S. H. Kaufmann. 2000. Immune response to infection with Salmonella typhimurium in mice. J. Leukoc. Biol. 67: 457-463. 98. Galan, J. E., and H. Wolf-Watz. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444: 567-573. 99. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden. 1996. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium.Proc. Natl. Acad. Sci. U. S. A 93: 2593-2597. 100. Uchiya, K., M. A. Barbieri, K. Funato, A. H. Shah, P. D. Stahl, and E. A. Groisman. 1999. A Salmonella virulence protein that inhibits cellular trafficking. EMBO J. 18: 3924-3933. 101. Fields, P. I., R. V. Swanson, C. G. Haidaris, and F. Heffron. 1986. Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent. Proc. Natl. Acad. Sci. U. S. A 83: 5189-5193. 102. Meresse, S., K. E. Unsworth, A. Habermann, G. Griffiths, F. Fang, M. J. Martinez-Lorenzo, S. R. Waterman, J. P. Gorvel, and D. W. Holden. 2001. Remodelling of the actin cytoskeleton is essential for replication of intravacuolar Salmonella. Cell Microbiol. 3: 567-577. 103. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies for overcoming host innate and adaptive immune responses. Nat. Immunol. 3: 1033-1040. 104. Zwart, W., A. Griekspoor, C. Kuijl, M. Marsman, R. J. van, H. Janssen, J. Calafat, H. M. van, L. Janssen, L. M. van, K. Jalink, and J. Neefjes. 2005. Spatial separation of HLA-DM/HLA-DR interactions within MIIC and phagosome-induced immune escape. Immunity. 22: 221-233. 105. Gullberg, E., M. Leonard, J. Karlsson, A. M. Hopkins, D. Brayden, A. W. Baird, and P. Artursson. 2000. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochem. Biophys. Res. Commun. 279: 808-813. 106. Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P. Kraehenbuhl, and P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat. Immunol. 2: 361-367. 107. Gasem, M. H., M. Keuter, W. M. Dolmans, D. Van, V, R. Djokomoeljanto, and J. W. Van Der Meer. 2003. Persistence of Salmonellae in blood and bone marrow: randomized controlled trial comparing ciprofloxacin and chloramphenicol treatments against enteric fever. Antimicrob. Agents Chemother. 47: 1727-1731. 108. Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le, R. Berggren, W. T. Parks, and F. C. Fang. 1999. Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 401: 804-808. 109. Richter-Dahlfors, A., A. M. Buchan, and B. B. Finlay. 1997. Murine salmonellosis studied by confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts a cytotoxic effect on phagocytes in vivo. J. Exp. Med. 186: 569-580. 110. Eisenstein, T. K., L. M. Killar, and B. M. Sultzer. 1984. Immunity to infection with Salmonella typhimurium: mouse-strain differences in vaccine- and serum-mediated protection. J. Infect. Dis. 150: 425-435. 111. Mastroeni, P., B. Villarreal-Ramos, and C. E. Hormaeche. 1993. Adoptive transfer of immunity to oral challenge with virulent salmonellae in innately susceptible BALB/c mice requires both immune serum and T cells. Infect. Immun. 61: 3981-3984. 112. Mastroeni, P., C. Simmons, R. Fowler, C. E. Hormaeche, and G. Dougan. 2000. Igh-6(-/-) (B-cell-deficient) mice fail to mount solid acquired resistance to oral challenge with virulent Salmonella enterica serovar typhimurium and show impaired Th1 T-cell responses to Salmonella antigens. Infect. Immun. 68: 46-53. 113. Hess, J., C. Ladel, D. Miko, and S. H. Kaufmann. 1996. Salmonella typhimurium aroA- infection in gene- targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial

25 Chapter 1

clearance independent of intracellular location. J. Immunol. 156: 3321-3326. 114. Ugrinovic, S., N. Menager, N. Goh, and P. Mastroeni. 2003. Characterization and development of T-Cell immune responses in B-cell-deficient (Igh-6(-/-)) mice with Salmonella enterica serovar Typhimurium infection. Infect. Immun. 71: 6808-6819. 115. Barr, T. A., S. Brown, P. Mastroeni, and D. Gray. 2010. TLR and B cell receptor signals to B cells differentially program primary and memory Th1 responses to Salmonella enterica. J. Immunol. 185: 2783-2789.

26 BCR-mediated internalization of Salmonella: a novel pathway for autonomous B cell activation and antibody production 2

Yuri Souwer, Alexander Griekspoor, Tineke Jorritsma, Jelle de Wit, Hans Janssen, Jacques Neefjes and S. Marieke van Ham Y.S. & A.G. contributed equally to this work.

J Immunol. 2009 Jun 15;182(12):7473-81 Chapter 2

Abstract

The present paradigm is that primary B cells are non-phagocytosing cells. Here, we demonstrate that human primary B cells are able to internalize bacteria when the bacteria are recognized the B cell receptor (BCR). BCR-mediated internalization of Salmonella typhimurium results B cell differentiation and secretion of anti-Salmonella Ab by the Salmonella-specific B cells. In addition, BCR-mediated internalization leads to efficient Ag delivery to the MHC class II Ag loading compartments, eventhough Salmonella remains vital intracellularly in primary B cells. Consequently, BCR-mediated bacterial uptake induces efficient CD4+ T cell help, which boosts Salmonella-specific Ab production. BCR-mediated internalization of Salmonella by B cells is superior over extracellular Ag extraction to induce rapid and specific humoral immune responses and efficiently combat infection.

28 BCR-mediated bacterial uptake

Introduction

Defense against pathogens is essential for survival and is controlled by the innate and acquired arms of the immune system. Ag presentation by B lymphocytes is needed to 1, 2 generate high-affinity Abs. Development of an effective humoral immune response is 2 r e t p a h C mediated by two actions of the BCR: transmembrane signaling through BCR-complexes to induce B cell differentiation and Ag internalization for processing followed by MHC class II-mediated presentation to acquire T cell help. The proper execution of both actions requires binding of a polyvalent Ag to multiple BCR molecules. Indeed, many B cell Ags are polyvalent as they are bound in multiple copies to the particulate surfaces of microbes or cells.3 The role of CD4+ T cells in the induction of protective immunity against pathogens is well established.4, 5 CD4+ T cell activation requires MHC class II Ag presentation after Ag processing in the endocytic pathway and subsequent binding of antigenic peptides to MHC class II molecules, a process controlled by the MHC class II chaperones HLA- DM and HLA-DO.6-8 B cells use their BCR to concentrate specific Ag to the Ag loading compartments (termed MIIC for MHC class II containing compartment)4 for loading of Ag onto newly synthesized MHC class II molecules.3 Besides internalization of Ag, the BCR drives intracellular targeting by accelerating the delivery of Ag to MIICs.9 Furthermore, BCR signaling ignited by Ag induces acidification of the MIICs which favors Ag loading onto newly synthesized MHC class II molecules.10 Together, these cellular adaptations enable B cells to preferentially present specific Ags that have been internalized via the BCR to CD4+ T cells. Since primary B cells are considered to be not phagocytic, it is unclear how they acquire Ags from bacteria for Ag presentation. B cells can present particulate Ags in the context of MHC class II11-14 and are able to extract Ag from a non-internalizable surface.15 Studies on MHC-mediated presentation of BCR-specific Ags are mainly performed with soluble Ags or with pre-crosslinked anti-BCR Abs. We used Salmonella typhimurium as a model system to study MHC class II Ag presentation of particulate, polyvalent Ags and B cell activation. Being facultative intracellular pathogens, immunity to Salmonella requires adequate humoral and cell-mediated immune responses.16, 17 Salmonella invades host macrophages, but also many other cells and establishes an intracellular niche inside discrete vacuoles, known as Salmonella-containing vacuoles or SCV.18 This feature of Salmonella is considered crucial for their survival and pathogenicity.19, 20 In this report we show that B cells are highly efficient phagocytes of inert particles, like beads, when these particles are recognized by the BCR. B cells are thus ligand-selective phagocytic cells. BCR-mediated internalization of Salmonella generates autonomous B

29 Chapter 2

cell activation and rapid anti-Salmonella Ab secretion. Immediate intimate contact and fusion occurs between MIICs and SCVs. Consequently, Ag presentation and proliferation of Salmonella-specific CD4+ T cells is induced. Although BCR-mediated internalization suffices to drive Ab production, T cell help further improves the response. The observation that B cells can proliferate and differentiate autonomously after Salmonella uptake is important in light of remaining Ab responses to pathogens when CD4+ T cell help fails, as is the case in HIV patients.

Materials and methods

Antibodies, beads and fluorophores Goat anti-mouse IgG-conjugated Dynabeads M-450 (Dynal Biotech, Oslo, Norway) were coated with mAb anti-human IgM (MH15, Sanquin, Amsterdam, The Netherlands). The anti-human IgM antibody (MH15) was mixed with mAb anti-S. typhimurium LPS (1E6, Biodesign International, Kennebunk, ME) and rat anti-mouse IgG1 (RM161.1, Sanquin) to generate BCR-LPS tetrameric Ab complexes. The mAb anti-human HLA-DR (L243)21 was used to block MHC class II-TCR interaction in T cell proliferation assays. For immunoelectron microscopy (EM), mAb anti-human CD63 (435, Sanquin), rabbit anti mouse (Nordic, Tilburg, The Netherlands) and gold (10 nm) conjugated protein-A (EM

Lab, Utrecht University, The Netherlands) were used. F(ab)2 fragments of MH15 were generated by standard pepsin digestion. PE-conjugated anti-IgM was obtained from Sanquin (MH15-PE), anti-CD27-PE and IgG1- PE isotype control from BD Biosciences (San Jose, CA). Fluorescent secondary Ab goat anti-mouse Alexa Fluor 633 and Texas Red-phalloidin were obtained from Molecular Probes (Leiden, the Netherlands) and DAPI from Sigma-Aldrich (Steinheim, Germany).

Transfectant cell lines The pcDNA3 DOβGFP22 and DR1βGFP23 constructs have been described before. DOβGFP and DR1βGFP were demonstrated to form complexes with their respective endogenous α-chain. Transfections were performed by electroporation using a Gene Pulser II with Capacitance Extender (Bio-Rad Laboratories, Hercules, CA). Stable transfectants of the human B cell line Ramos were selected and maintained in RPMI 1640 supplemented with 5% FCS (Bodinco, Alkmaar, the Netherlands), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine, 50 μM 2-ME in the presence of 2000 µg/ml G418 (Gibco, Paisley, UK). Stable expression of the GFP-tagged proteins was verified by Western blotting and ensured by regular selection of positive cells by FACS sorting.

30 BCR-mediated bacterial uptake

NIH3T3 fibroblasts expressing human CD40L (3T3-CD40L)24 were cultured in IMDM medium, supplemented with 5% FCS (Bodinco), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine, 50 μM 2-ME and 500 µg/ml G418 (Gibco, Paisley, UK). 3T3-CD40L cells were harvested, irradiated with 30 Gy (Gammator M38-1, MDS Nordion, 4

Ottawa, ON, Canada) and seeded without antibiotics in 96 wells flat bottom plates (2x10 2 r e t p a h C cells per well) to form a confluent monolayer overnight.

Bacterial Strains Salmonella typhimurium SL1344 (Salmonella),25 GFP-Salmonella26 and mRFP-Salmonella27 were described before. GFP-Salmonella defective in SPI-1 (invA mutant) or SPI-2 (ssrA mutant) were a kind gift from M. Rescigno. Staphylococcus aureus expressing GFP (RN4220 with pWVW189GFP) was a kind gift from S.A.J. Zaat. Bacteria were grown in Luria-Bertani (LB) broth with antibiotics overnight at 37°C while shaking, subcultured at a dilution of 1:33 in fresh LB media, and incubated at 37°C while shaking for 3.5 hours. Bacteria were washed twice with PBS, incubated 1:25 with the BCR-LPS tetrameric Ab complexes for 30 min at room temperature, and washed twice to remove unbound Abs. Dead Salmonellae are bacteria fixed with paraformaldehyde (3.7% in PBS).

Lymphocyte isolation and proliferation assay Human PBMCs were isolated by centrifugation on a Ficoll-Hypaque gradient (Axis-Shield PoC AS, Oslo, Norway) from a buffycoat obtained from healthy donors after informed consent (Sanquin). B and T cells were subsequently purified using anti-CD19 and anti-CD4, anti-CD8 Dynabeads and DETACHaBEAD (Dynal Biotech), according to the manufacturer’s instructions. B lymphocytes were incubated for 40 minutes at 37°C with Salmonella without antibiotics. Next, cells were washed four times and cultured for 1h in medium containing 100 µg/ml gentamycin (Invitrogen) to eliminate non-internalized bacteria. Cells were washed and cultured in RPMI 1640 medium w/o phenol red, supplemented with 5% FCS (Bodinco), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine, 50 μM 2-ME, 20 μg/ ml human apo-transferrin ((Sigma-Aldrich), depleted for human IgG with protein G sepharose (Amersham, Sweden)) and 10 µg/ml gentamycin. 1x105 B cells and 5x104 T cells were cultured in 200 μl at 37°C in the presence of 5% CO2 in 96 wells round bottom plates (Greiner Bio-One, Frickenhausen, Germany). The maximum proliferation capacity of T lymphocytes (varying between 35 to 60x103 cpm) was established by stimulation with anti-CD3 (CLB.T3/4.E, Sanquin) and anti-CD28 (CLB.CD28/1, Sanquin) which were both used at 1 μg/ml. After 5 and 12 days, 150 μl of supernatant was collected for Ab measurement and fresh medium was added. To study the kinetics of Ag presentation,

31 Chapter 2

B cells incubated with Salmonellae were irradiated with 60 Gy at indicated time points before incubation with T cells. For B/T cell proliferation assays, after 5 days of culturing [3H]-thymidine (GE Healthcare, Buckinghamshire, UK) was added at a final concentration of 1 μCi/ml (37 kBq/ml) for 16 hours. Cells were harvested on glass fibre filters (Wallac, Turku, Finland) and radioactivity was measured with 1205 Betaplate liquid scintillation counter (Wallac). For blocking experiments, B cells were pre-incubated with 5 μg/ml anti- HLA-DR (L243) for 30 minutes before T cells were added. For the antigen-specificity assay, CD4+ T cells were CFSE labeled and cocultured with B cells that had taken up Salmonellae. The dividing T cells were sorted after 6 days and cultured with 10 IU/ml IL-2 (Chiron, Emeryville, USA) for 6 more days. PBMCs were labeled with CFSE and incubated with Tetanus Toxoid (Statens Serum Institut, Copenhagen, Denmark; 7,5 μg/ml) for 11 days, with 10 IU/ml IL-2 added on day 6, and proliferating CD4+ T cells were sorted. B cells from the same donor were incubated with Salmonellae and PBMCs from the same donor with Tetanus Toxoid, irradiated after 18 hours and then the sorted T cells were added for 2 days before [3H]-thymidine was added for 16 hours.

FACS analyses Freshly isolated primary B cells were incubated with Salmonella, washed four times and cultured for 1 hour in media containing 100 µg/ml gentamycin. Cells were incubated with directly labeled Abs, for LPS staining cells were incubated with anti-LPS Ab and subsequently with Alexa Fluor 633-conjugated goat-anti-mouse Ab. Cells were washed with PBS containing 0.1% BSA. Lymphocytes were gated by forward and side scatter and dead cells were excluded by staining with DAPI. 200,000 events were acquired on a LSR II (Becton Dickinson, San Jose, CA) and analyzed using FACSDiva software (Becton Dickinson). FACS sorting of B cells that had internalized uncoated living bacteria was performed on a MoFlo Sorter (Dakocytomation, Glostrup, Denmark), populations were >75% purified.

Live cell imaging and electron microscopy analyses For CLSM analysis, coverslips were coated with 1 mg/ml Poly-L-lysine (Sigma-Aldrich co., Steinheim, Germany) for 1h and washed thoroughly with aquadest and dried on air. Cells were allowed to attach on the coated coverslips for 15 min and subsequently beads or Salmonellae were added. For visualization of the actin cytoskeleton, cells were fixed with 3.7% paraformaldehyde and stained with TexasRed-phalloidin and DAPI. Confocal analysis was performed at 37°C using a Leica TCS SP confocal laser scanning microscope equipped with an Argon/Krypton laser, 63x oil objective; NA 1.4 (Leica Microsystems, Heidelberg, Germany). Green fluorescence was detected at λ>515 nm after excitation at 488 nm. For

32 BCR-mediated bacterial uptake dual analyses, green fluorescence was detected at 520–560 nm. Red fluorochromes were excited at 568 nm and detected at λ>585 nm. All experiments presented were repeated several times on different days, and results were consistent and reproducible. Further image processing was performed using the ImageJ software package.

For EM, cells were allowed to take up beads or bacteria for 40 min or 4 hours (to study 2 r e t p a h C MIIC-SCV fusion), fixed in a mixture of paraformaldehyde (4%) and glutaraldehyde (0.5%). After embedding in a mixture of methyl-cellulose and uranyl acetate, ultrathin sections were stained and analyzed with a Philips CM10 electron microscope (Eindhoven, the Netherlands).

Plating Assay For enumeration of intracellular surviving bacteria, freshly isolated primary B cells were incubated with anti-IgM coatedSalmonellae and Ramos cells with uncoated Salmonellae as a control, washed and cultured in medium with 10 µg/ml gentamycin as described above. At the indicated time points cells were washed with PBS and lysed in 0.1% Triton X-100 (Merck) for 10 min on ice, washed with PBS and a dilution series was plated onto LB agar plates. Plates were incubated overnight at 37°C and colonies were counted.

ELISA assays To determine IgM levels in culture supernatants, flat bottom MaxiSorb plates (Nunc, Roskilde, Denmark) were coated with polyclonal anti-IgM (SH15, Sanquin) in 100 μl PBS, pH 7.4 (NPBI International BV, Emmer-Compascuum, the Netherlands) overnight at room temperature. Plates were washed with PBS/0.02%Tween-20 (Mallinckrodt Baker, Deventer, the Netherlands) and samples were incubated for 2 hours in high performance ELISA buffer (HPE, Sanquin). As a standard, pooled human serum was used. Plates were washed and incubated for 1 hour with 1 μg/ml mAb anti-human IgM-HRP (MH15-HRP, Sanquin). Whole cell-Salmonella ELISA was performed by coating overnight at 37°C of Salmonellae to maxisorb plates in 100 μl 0.1M Na-bicarbonate at pH 9.6 supplemented with 10 µg/ml gentamycin. Plates were washed extensively with PBS/0.02%Tween-20 and supernatants were incubated in HPE. Plates were washed and incubated for 1 hour with 1 μg/ml mAb anti-human IgM-HRP (MH15-HRP, Sanquin). After washing, peroxidase activity was visualized by incubation with 100μl 3,5,3’,5’-tetramethylbenzidine (Merck, Darmstadt, Germany), 100 μg/ml in 0.11 M Na- acetate, pH 5.5, containing 0.003% H2O2 (Merck). The reaction was stopped by addition of an equal volume of 2M H2SO4 (Merck) and the absorbance at 450 nm and 540 nm was measured immediately in a Titertek plate reader. Results were calculated with LOGIT

33 Chapter 2

software (http://www.xs4all.nl/~ednieuw/Logit/logit.htm).

Statistical analysis Statistical significance was determined using the Mann Whitney U test.

Results

Efficient BCR-mediated phagocytosis of large particulate antigens by B cells Unlike other professional antigen presenting cells, primary B cells show very limited phagocytic capacity. Antigen uptake by B cells is critically dependent on the selectivity of the B cell receptor (BCR).10, 28 The current view on BCR mediated antigen uptake by B

Figure 1. Efficient BCR-mediated phagocytosis of large particulate antigens. (A) Living Ramos B cells expressing DR-GFP and anti-IgM coated beads were imaged every 30 seconds. Depicted are time points after initial contact, top panel: transmission image, bottom panel: GFP signal. Scale bar = 10µm. Images are frames from Movie 1. (B) Ramos cells were fixed 10 min after addition of anti-IgM coated beads and analyzed by cryo-electron microscopy. Scalebar = 500nm. Zoom-ins of the thin membrane extrusions surrounding the bead are shown for indicated regions. The tip of the protrusion is indicated with an arrowhead in inset 2. (C) Cells were fixed 10 min after addition of anti-IgM coated beads and processed for immuno-fluorescence confocal microscopy. Depicted is the overlay of the signals from DAPI nuclear staining (blue), phalloidin stained actin-cytoskeleton (red), and DR-GFP (lower left cell only). Scalebar = 10µm. Figure represents one section from a Z-stack. A 3D reconstruction is provided as Movie 4.

34 BCR-mediated bacterial uptake cells mainly centers on soluble antigens like small foreign proteins or shedded bacterial coat products.29 Accordingly, most B cell activation studies involve the global triggering of BCR using soluble cross-linking antigens rather than pathogen-associated antigens. We opted to study BCR-mediated recognition of particulate antigens in B cells by inducing

localized clustering of the BCR using beads decorated with mAb against the BCR. When 2 r e t p a h C anti-IgM coated beads contacted a Ramos B cell stably expressing MHC class II HLA-DR1 tagged with GFP (DR-GFP, which localizes to the plasma membrane and lysosomal MIIC vesicles), rapid and efficient internalization of the bead ensued (Figure 1A + Movie 1). Ramos cells polarized themselves towards the contact site during uptake of the beads such that the nucleus moved to the side opposite of the bead, analogous to the situation following T helper cell contact30 or following cytotoxic T lymphocyte (CTL)-target cell interactions31. Internalization reached completion within 10 to 20 min, and required an intact cytoskeleton (as the microtubule-disruptive agent nocodazole prevented phagocytosis, Movie 2). In addition, uptake was BCR dependent as beads coated with an irrelevant antibody were not internalized (Movie 3). Ramos cells do not express Fcγ receptors, which excludes their involvement in bead uptake. A detailed analysis by cryo- electron microscopy revealed some of the impressive cellular events underlying uptake of large particulate antigens. During the initial phase of contact, Ramos cells surrounded the bead with a surprisingly thin double membrane originating from the cell surface (Figure 1B). Staining with phalloidin of Ramos cells in the process of bead-phagocytosis revealed extensive actin fibers in the membrane protrusions surrounding the bead (Figure 1C + Movie 4). Together, these data show that B cells are able to internalize inert particles in a process that fulfills the criteria of phagocytosis. Thus, different from the general concept that primary B cells are essentially non-phagocytic cells, B cells are very efficient phagocytes when particle recognition is facilitated by the BCR.

B cell lines can internalize Salmonella via their BCR We generated a stable transfectant of the Ramos B cell line with the MHC class II Ag presentation chaperone HLA-DO tagged with GFP (DO-GFP). DO-GFP localizes tothe MIICs in living cells. As the Ag specificity of the BCR of Ramos cells is unknown, we coated the bacteria with anti-IgM-anti-LPS tetrameric Ab complexes. Within one minute following first contact Ramos cells efficiently internalized GFP-Salmonellae coated with tetrameric Ab complexes (Figure 2A + Movie 5). Uncoated Salmonellae were ignored by Ramos B cells (Movie 6), showing that Salmonella by itself is not able to invade the Ramos B cell line. To investigate the internalization process in more detail, we used cryo- electron microscopy (EM) on Ramos cells shortly after encounter of the coated bacteria. This showed the formation of a phagocytic cup and the extension of pseudopodia around

35 Chapter 2

Figure 2. Efficient BCR-mediated internalization of Salmonella. (A) Living Ramos cells, expressing DO-GFP, and GFP-expressing Salmonella were imaged every 3 seconds. Depicted are time points after initial contact. GFP signal is projected on top of the transmission image. Scale bar = 10µm. Images are frames from Movie 5. (B) Electron microscopic analysis of Ramos cells in the process of phagocytosing anti-BCR coated Salmonella. Scale bar = 800nm. Note the cup shaped pseudopodia of the B cell at contact places with the bacteria. (C) Living Ramos cells, expressing DO-GFP and mRFP-Salmonella were imaged every 10 seconds. Depicted are time points after initial contact, top panel: transmission image, middle panel: GFP signal, bottom panel: overlay of GFP and mRFP signal. Scale bar = 5µm. Inset shows zoom-in on bacterium. Images are frames from Movie 7. (D) Living Ramos cells, expressing DR-GFP and mRFP-Salmonella were imaged every 10 seconds. Depicted are indicated time points after initial contact, top panel: transmission image, middle panel: GFP signal, bottom panel: overlay of GFP and mRFP signal. Scale bar = 5µm. Inset shows zoom-in on bacterium. Images are frames from Movie 8. (E) Immunoelectron microscopic analysis of primary B cells with internalized anti-BCR coated Salmonella and CD63 (10nm gold particles). Black asterisks mark bacteria, the white asterisk marks an MIIC; arrows indicate fusion events with MIICs.

the bacteria, demonstrating that B cells actually seem to phagocytose the Salmonella bacteria (Figure 2B). To study the interaction between the green MIICs in Ramos DO-GFP with the Salmonella-containing vacuoles (SCVs), we used a red mRFP-Salmonella. Ramos DO-GFP cells incubated with coated mRFP-Salmonella showed bacterial uptake and rapid translocation of the MIICs to the SCV (Figure 2C + Movie 7). Multiple intimate contact events were observed between the membrane of the SCV and the DO-GFP positive MIICs, suggesting fusion events of the MIICs with the SCV immediately after bacterial uptake.

36 BCR-mediated bacterial uptake

To study the acquisition of MHC class II molecules on the SCV membrane, we used Ramos cells expressing DR-GFP. MHC class II molecules already localized to the membrane of the SCV during the actual process of BCR-mediated uptake of coated mRFP-Salmonella (Figure 2D + Movie 8). Similar to the DO+ vesicles, we observed extensive docking of +

DR-GFP vesicles with the SCV membrane within minutes after entry. Because molecular 2 r e t p a h C exchange between the MIIC vesicles and the SCV is critical for generation of MHC class II molecules complexed with Salmonella Ags, we visualized MIIC-SCV fusion by EM. Indeed, fusion between the characteristic multivesicular MIICs and the SCV was frequently observed. Immunostaining showed that, next to the MIICs, the SCV membrane stained positive for CD63 (Figure 2E). Quantification of the fusion events between MIICs and 100 SCVs showed that in 10% of the SCVs the actual process of MIIC-SCV fusion was captured in the time frame of cell fixation. Thus, the combined acquisition of MHC class II on the SCV and the frequent fusion events between SCV and MIICs generates all conditions required for Ag presentation of Salmonella Ags.

BCR-mediated internalization of Salmonella by primary human B cells Since Ramos cells are at least 1.5 times larger than primary B cells, we tested whether primary B cells could internalize Salmonella as well. To distinguish between binding of bacteria to the BCR and actual uptake, we used a mAb against Salmonella-LPS. Completely internalized GFP-positive bacteria will not be stained, while extracellular and partially engulfed bacteria will be accessible to the anti-LPS antibody. Incubation of primary human B cells with uncoated GFP-Salmonella consistently revealed a small but significant population of B cells (4.3%, SD=1.1, n=6) that recognized and internalized the native bacterium via direct recognition of Salmonella Ags by the B cell’s BCR (Figure 3A). A similar proportion of primary B cells recognized and captured dead uncoated GFP- Salmonella via their BCR (4.1%, SD=1.5, n=4), but failed to internalize dead Salmonellae since these B cells stained all positive for LPS (Figure 3A). Analysis by confocal microscopy confirmed that internalized viable Salmonellae are completely taken up by primary B cells, resulting in one to three intracellular bacteria per B cell (Figure 3B, left panel). Incubation with fixed bacteria only showed binding but no uptake of Salmonella (Figure 3B, right panel). To adress the possible involvement of Fc receptors on primary B cells, we preincubated primary B cells with F(ab)2 fragments of the anti-IgM antibody MH15 to block the internalization of anti-IgM coatedSalmonella by primary B cells. This resulted in inhibition of 80%, illustrating that internalization is indeed BCR-mediated (Supplementary Figure 1). Ideally, we would also like to block BCR-mediated internalization ofSalmonella via direct recognition of Salmonella-antigens by the BCR. However, since blocking of the antigen-binding site of the BCR is impossible due to lack of anti-idiotype antibodies, we

37 Chapter 2

Figure 3. BCR-mediated internalization and survival of Salmonella in primary B cells. (A) CD19+ B cells were incubated with viable GFP-Salmonellae for 40 minutes and FACS analyzed. Anti-LPS-APC versus GFP scatter plots are depicted. (B) Living primary human B cells were incubated with viable (left) or dead (right) GFP- Salmonella for 40 min and imaged using confocal microscopy. Left panel: transmission image, right panel: GFP signal projected on transmission image. Scalebar = 5µm. (C) Ramos B cells were incubated with viable GFP- Salmonella for 40 min, stained with an antibody against Salmonella LPS and analyzed by FACS. Depicted are anti-LPS-APC vs. GFP scatter plots of 50.000 events. (D) CD19+ B cells were incubated with viable wild-type GFP-Salmonellae or mutant for SPI-1 (invA-) or SPI-2 (ssrA-) for 40 minutes and analyzed by FACS. Intracellular indicates B cells that are GFP+/LPS- and extracellular indicates GFP+/LPS+ B cells. Data are from two independent experiments with cells from four different donors, error bars indicate SEM.(E) B cells were incubated with anti- IgM coated Salmonellae and Ramos cells with uncoated Salmonellae, lysed and plated onto LB agar plates. Data are from duplicates of experiments performed with B cells from two individual donors, error bars indicate SEM.

studied the effect of BCR internalization before addition of the bacteria on the efficiency of bacterial uptake. We combined antibodies against the heavy chain of IgM with cross- linking goat-anti-mouse antibodies. This resulted in a partial internalization of the BCR (MFI for membrane-bound IgM dropped from 3767 to 2275) and a concommitant reduction in GFP+/LPS- B cells that had completely internalized Salmonella (Supplementary Figure 2). In addition, Ramos cells efficiently internalized GFP-Salmonella in a BCR dependent manner only when Salmonella was coated with anti-IgM (Figure 3C). No GFP-positive Ramos cells were found without the anti-IgM coat, showing that Salmonella is unable to infect Ramos cells autonomously. As a control for IgM type BCR-mediated uptake of Ramos, Salmonella coated with anti-IgG were incubated with Ramos cells, and (similar

38 BCR-mediated bacterial uptake to uncoated bacteria) these were not internalized. Incubation of the IgG-type BCR expressing B cell line Cess with anti-IgG coated bacteria showed that the anti-IgG coated bacteria were efficiently taken up by Cess (data not shown). Up to 90% of the Ramos cells acquired one or more anti-IgM coated bacteria. However, about 25% of Ramos cells

contained internalized GFP-Salmonella only, while more than 60% of Ramos cells were 2 r e t p a h C also positive for LPS staining. Confocal microscopy of cells labeled by anti-LPS antibodies showed that these represented Ramos cells that had internalized some but not all bound bacteria (data not shown). Since dead bacteria were not internalized, Salmonella may be requiring both recognition by BCR and bacterial-mediated processes to enter primary human B cells. Salmonella can invade host cells by expressing type III secretion systems (TTSS) encoded either by Salmonella pathogenicity island 1 (SPI-1) to translocate effector proteins into host cell cytoplasm that trigger internalization of the bacteria or by SPI-2 to modulate intracellular trafficking and replication Salmonellaof within a modified vacuolar compartment. Recent studies however have modified this concept to some extent as they show a partial overlap in SPI-1 and SPI-2 functions32. To address involvement of these TTSS, we used Salmonellae defective in SPI-1 (invA mutant) or SPI-2 (ssrA mutant). Incubation of primary B cells with SPI-1 defective Salmonellae showed a reduction in internalized bacteria and no bacteria adhering to primary B cells. Incubation with SPI-2 defectiveSalmonellae showed a milder reduction in internalized bacteria and a minimal reduction in adhering bacteria (Figure 3D). This indicates that SPI-1 is involved in attachment to primary B cells in conjunction with the BCR. Components of SPI-1, and to a lesser extent SPI-2, are involved in BCR- mediated uptake of Salmonella by primary B cells. Phagocytosed Salmonellae grow in many cell types but can efficiently be destroyed in specialized cells like macrophages and neutrophils33. To examine survival of internalized Salmonella in primary B cells, we performed plating assays. B cells were incubated with anti-IgM coated Salmonellae, washed and cells with internalized bacteria were followed in time. At different time points, cells were lysed and intracellular bacteria were plated onto agar. Internalized Salmonellae remained vital for the 18 hrs that we tested (Figure 3E). Ramos cells incubated with uncoated Salmonellae were used as a control, since uncoated Salmonellae are not taken up by Ramos cells (Movie 6). Indeed, hardly any Salmonellae were recovered after incubation with Ramos (Figure 3E). Thus, Salmonella survives intracellularly after BCR-mediated internalization by primary B cells. Which peripheral B cell type is able to internalize Salmonella? Most peripheral B cells express the IgM surface immunoglobulin receptor34. To confirm that internalization of Salmonella occurs via the BCR, we analyzed IgM expression on Salmonella-containing B cells. This showed that B cells that have internalized Salmonella expressed surface IgM

39 Chapter 2

Figure 4. Both naive and memory B cells internalize Salmonella. (A) Primary B cells were incubated with GFP-Salmonellae and stained for IgM before and after FACS-sorting. The open histogram represents the IgG1 isotype control. (B) The cells from 3A were analyzed for expression of CD27. Percentages of CD27+ B cells are given. For IgG1 isotype control, see 3A.

(Figure 4A). The mean fluorescence intensity (MFI) of IgM for the total B cell pool is 478 and for the Salmonella-containing B cells 825. Two major subsets of B cells can be identified in adult peripheral blood according to the expression of CD27. CD27 expressing B cells comprise memory B cells while CD27-negative B cells represent naive and transitional B cells35. FACS analysis showed that IgM memory B cells (CD27+) internalized Salmonella more efficiently than IgM+CD27- naive B cells (Figure 4B). Although a proportion of the naive IgM+ B cells are able to take up Salmonella, Salmonella is preferentially internalized by the circulating IgM+ memory B cells.

Presentation of BCR internalized Ags by B cells to T cells When Salmonella survives within the phagosome (see Figure 3D) following BCR-mediated internalization, does this result in MHC class II mediated presentation ofSalmonella Ags? To test this, primary human B cells were incubated with anti-IgM-coated Salmonellae to achieve BCR-mediated uptake by all IgM+ B cells and maximize the number of Ag presenting B cells. These cells were subsequently cultured in the presence or absence of autologous primary T cells. After 5 days,3 [ H]-thymidine was added and cells were harvested after 18 hours. Incubation of B cells with anti-BCR coated Salmonella induces proliferation of the B cells (Figure 5A), demonstrating that BCR-ligation and BCR-mediated internalization of Salmonella effectively activated B cells. B cells incubated with coated Salmonella and cultured with autologous T cells results in an Ag-specific proliferation of T cells (Figure 5A). To study whether primary B cells with a BCR directed against Salmonella also induce T cell proliferation, we incubated uncoated Salmonella with primary B cells (Figure 5B, left panel). Addition of autologous T cells yielded a Salmonella-specific T cell proliferation response. B cells incubated with uncoated dead Salmonella that could not be internalized were able to induce T cell proliferation (Figure 5B,right panel). However, T cell proliferation is optimal when viable Salmonellae have been internalized by B cells (Figure 5B: left

40 BCR-mediated bacterial uptake versus right panel). Incubation of only T cells with uncoated or coated bacteria did not result in B cell-independent proliferation of the T cells (data not shown). To demonstrate that the T cell proliferation in Figure 5B was indeed induced by the fraction of B cells that had captured Salmonella, we FACS-sorted the GFP-Salmonella

positive B cells in fractions positive and negative for anti-LPS staining and cultured 2 r e t p a h C these with autologous T cells. T cells only proliferated when cultured with B cells that had captured GFP-Salmonella (Figure 5C). It may be that complete internalization is not required for Ag presentation but that only capturing of the bacteria by the BCR suffices. We can however not exclude that GFP-Salmonella+/LPS+ B cells also contain completely internalized bacteria as we have shown that B cells are able to take up more than one Salmonella. Moreover, even though Salmonella survives in the vacuole and suppresses MHC class II Ag presentation in phagosomes,27 Salmonella Ags are still efficiently presented by B cells. This probably reflects Ag degradation and loading on MHC class II molecules in normal MIICs after content exchange between phagosome and MIICs due to

Figure 5. BCR-mediated uptake of Salmonella induces Ag presentation by B cells. (A) BCR-induced internalization results in proliferation of B cells and Ag specific T cells. B cells (B) were either or not incubated with viable anti-BCR coated (C) Salmonella in the presence or absence of autologous T cells (T), as indicated. Results are shown as percentage of maximal stimulation of T cells with anti-CD3 and -CD28 Abs. (B) The same experimental setup as in Figure 4A was performed with uncoated (U) viable and dead Salmonellae. Data are from four independent experiments of different donors, error bars indicate SEM. B:T represents the ratio of different amounts of B cells added to a fixed amount of T cells. Experiments with uncoated and coatedSalmonellae were performed in parallel using the same donor. (C) B cells incubated with viable uncoated GFP-Salmonella were FACS-sorted as indicated and incubated for 6 days with T cells. Data are from two independent experiments with cells from different donors, error bars indicate SEM. (D) Salmonella-primed or Staphylococcus-primed T cells were restimulated for 2 days with autologous B cells that were incubated with viable Salmonella or Staphylococcus or restimulated with PBMCs incubated with Tetanus Toxoid. Data are representative for three independent experiments with different donors, error bars indicate SEM. (E) T cells (T) were cultured with B cells (B) that had taken up uncoated (U) or anti-BCR coated (C) Salmonella either or not in the presence of the MHC class II antigen presentation blocking antibody L243. (F) Ag presentation by B cells starts immediately after internalization of the Salmonellae. B cells (B) were either or not incubated with uncoated (U) or anti-BCR coated (C) Salmonella and irradiated with 60 Gy at different time-points before T cells (T) were added. Data are representative for four independent experiments of different donors.

41 Chapter 2

the observed intimate contact and extensive fusion events. To demonstrate the antigen-specificity of the proliferating T cells, we performed restimulation assays in which we sorted the T cells which proliferated in response to B cells that had taken up Salmonella, and restimulated these Salmonella-primed T cells with autologous B cells that had taken up Salmonella or Staphylococci. This showed that the Salmonella-primed T cells are indeed for the large part antigen-specific, as they proliferate better in response to B cells that had internalizedSalmonella than B cells that had internalized Staphylococcus or control B cells without bacteria. As a control, T cells primed against Staphylococcus did proliferate in response to B cells that had internalized Staphylococcus, demonstrating that these B cells did present Staphylococci antigens to CD4+ T cells (Figure 5D, left panel). In addition, we restimulatedSalmonella -primed T cells with PBMCs presenting Tetanus Toxoid Ags. This showed no response of the Salmonella- primed T cells, while Tetanus Toxoid-primed T cells from the same donor proliferated after restimulation (Figure 5D,right panel). Furthermore, we performed blocking assays to show that the T cell response depends on the MHC class II antigen presentation pathway with L243, an antibody that blocks the MHC class II-TCR interaction (Figure 5E). The induction of T cell activation depended on presentation of Salmonella antigens via MHC class II (HLA-DR), as the T cells failed to respond after blocking of MHC class II with L243. The observation that fusion of MIICs with the phagosome occurs swiftly prompted us to examine whether this had consequences for Ag presentation. When we irradiated B cells immediately after incubation with anti-IgM coated Salmonellae, no proliferation of B or T cells was observed after six days. B cells apparently need to be viable to process and present Salmonella-Ags to T cells. To study the kinetics of Ag presentation, B cells were incubated with native or anti-IgM coated Salmonellae and B cells were irradiated at several time points before incubation with T cells. After 5 days, [3H]-thymidine was added and cells were harvested after 18 hours. Non-infected B cells did not induce T cell proliferation after irradiation. Anti-BCR coated Salmonella internalized by IgM+ B cells start to induce proliferation of T cells immediately (red line) and uncoated Salmonella internalized by BCR-reactive B cells four hours after uptake of the Salmonella (blue line) (Figure 5F). Ag presentation thus starts at times corresponding to the earliest phases of BCR-induced internalization and rapid fusion with the MIICs. Primary B cells rapidly present Ags of internalized Salmonella, even if the bacterium survives inside a B cell.

BCR-mediated internalization induces IgM secretion To test if BCR-mediated internalization of Salmonella leads to differentiation of B cells into Ab secreting cells, supernatants of B cells that internalized bacteria were tested for

42 BCR-mediated bacterial uptake the presence of human IgM after culture. After 5 days incubation with viable uncoated bacteria, no strong induction of IgM secretion following BCR-mediated internalization was detectable (Figure 6A, left panel). When the Salmonellae were coated with anti-IgM Abs, B cells produced four times more IgM than uncoated bacteria. Addition of T cells did

not increase IgM production in the first 5 days, indicating that IgM production resulted 2 r e t p a h C from a T cell independent activation of B cells (Figure 6A,left panel). T cell help did occur within 12 days, leading to a strong increase in IgM production (Figure 6A, right panel). Thus, BCR-mediated internalization of Salmonella induces autonomous IgM secretion by B cells, whereas T cell help is required during the late stage of Ig secretion by B cells. IgG production of B cells incubated with Salmonellae did not significantly surpass IgG production levels from B and T cells that were not incubated with Salmonellae (data not shown). This is in line with the observation that the B cells that take up Salmonella are IgM+ memory B cells. It also indicates that BCR-mediated internalization of Salmonella by the naive IgM+ B cell pool does not induce immunoglobulin class switching under our culture conditions. When B cells that internalize Salmonella through the BCR are activated, they might produce Salmonella-specific Abs. We incubated uncoated, viable GFP-Salmonellae with primary B cells and FACS-sorted the GFP+ B cells. We cultured the sorted B cells on a monolayer of fibroblasts expressing human CD40L to provide costimulation. After 12 days, total human IgM as well as Salmonella-reactive Abs were quantified. B cells that internalized Salmonella produced more total IgM than B cells that did not take up Salmonella (Figure 6B, upper left panel). The production of Salmonella-reactive Abs was measured using a whole cell-Salmonella ELISA. Strikingly, the sorted Salmonella-

Figure 6. BCR-mediated internalization induces IgM production and B cells with a BCR reactive forSalmonella Ags produce anti- Salmonella IgM. (A) B cells (B) were either or not incubated with uncoated (U) or anti- BCR coated (C) Salmonella in the presence or absence of autologous T cells (T). After 5 (black bars, left panel) and 12 days (grey bars, right panel) total secreted human IgM was determined. (B) B cells either or not incubated with viable uncoated GFP-Salmonella were FACS-sorted and cultured on a monolayer of irradiated, CD40L-expressing fibroblasts for 12 days and supernatant was analyzed for total IgM production and Salmonella-reactive IgM production. White bars represent B cells and black bars represent Salmonella-positive B cells. Anti-Salmonella IgM was divided on the total amount of IgM measured in the supernatants (right panel, P = 0.006). Data are representative for 3 independent experiments of different donors.

43 Chapter 2

containing B cells produced significant amounts of anti-Salmonella-IgM (Figure 6B, lower left panel), unlike control B cells from the same donor. Correction of the anti-Salmonella reactive IgM for total IgM production by the B cells revealed that the sorted Bcells produced significantly higher levels of anti-Salmonella IgM compared to control B cells (Figure 6B, right panel). The production of significantly higher levels of anti-Salmonella IgM clearly shows the involvement of the BCR in internalization of Salmonellae. If the BCR would not be involved, but bacterial internalization and subsequent B cell activation would solely depend on TLR stimulation and/or co-stimulation, the B cells that had taken up Salmonella would not be able to produce Salmonella-specific IgM. Thus, BCR-mediated internalization of Salmonella forms an efficient pathway to induce differentiation of Salmonella-specific B cells and production of Salmonella-reactive IgM Abs.

Discussion

B cells may encounter Ags as free Ag or delivered by Dendritic cells (DCs).36 DCs are equipped with both nondegradative and degradative Ag uptake pathways to facilitate Ag presentation to both B and T cells. Blood DCs can capture and transport particulate Ags such as invading bacteria to the spleen, where they promote differentiation of marginal zone B cells into IgM secreting plasma cells.37 We here show a pathway independent of DCs and macrophages. In contrast to the dogma that mammalian B cells lack the ability to ingest pathogens and are only involved in the adaptive phase of the immune response38 or that entry of Salmonella in B cells is a random process,39 primary B cells can internalize Salmonella via their specific BCR. So far, the general concept for Ag presentation of bacterial peptides by B cells was that B cells extract proteins from the surface of DCs or bacteria or bind shedded bacterial proteins.15 Indeed, this may occur for dead or lysed bacteria killed by Abs and complement or after antibiotic treatment. Our observation that recognition via the BCR of dead bacteria without internalization induces Ag presentation to T cells is in line with this concept. However, internalization of viable bacteria leads to superior CD4+ T cell activation and instantaneous generation of anti-Salmonella Abs by autonomous activation of the Salmonella-reactive B cells. It has been proposed that Abs made by IgM memory B cells are the first line defense mechanism against all infections and that Abs produced by IgM memory B cells are the only B cell defense against T-independent Ags.40 IgM+ memory B cells in peripheral blood represent circulating splenic marginal zone B cells in charge of T-independent responses.41 Since marginal zone B cells express a BCR of polyreactive nature,42 this could explain the relatively high numbers of CD27+ B cells that take up Salmonellae. As for IgM+ memory B

44 BCR-mediated bacterial uptake cells, a subset of mature naive B cells in peripheral blood are polyreactive.43 Combined, the primary B cells that we found to internalize Salmonella seem to represent naive and IgM+ memory B cells with a polyreactive BCR. How do these findings relate in the involvement of B cells inSalmonella infection? Studies

in B cell deficient mice show that B cells are necessary for efficient protection against 2 r e t p a h C both primary and secondary infection with Salmonella.44 Passive transfer of Salmonella- immune serum could not restore resistance of mice to Salmonella,45 demonstrating that high-affinity Ab production alone is not the only function of B cells in salmonellosis. Moreover, at the early stage of primary infection class-switched high-affinity Abs against Salmonella are not yet available and can not explain the importance of B cells at this stage. Therefore polyreactive, IgM+ memory B cells may well be involved in protection against primary infection via BCR-mediated internalization ofSalmonella and rapid generation of protecting Salmonella-reactive IgM Abs. B cell deficient Igh-6-/- mice have impaired Th1 T-cell responses from the early stage of Salmonella infection, showing that B cells play an essential role in the initiation of T-cell-mediated protection as well46. The importance of B cells in this line of immune defense may relate to their property to present Ags to T cells. It remained unclear how Ag presentation was achieved as processing and presentation of Ags by naive B cells was not observed. Here, we provide a missing link in these observations by showing that the IgM+ B cells can internalize viable bacteria and very efficiently induce T helper activation. However, IgM secretion can also be induced by BCR-mediated Salmonella uptake and activation alone, albeit less efficient than observed with additional CD4+ T cell help. The rapid secretion of IgM before B cells encounter CD4+ T cells represents a first line of specific immune responses to pathogens and may represent the remaining humoral response when CD4+ T cell help fails, as is the case in HIV patients. In conclusion, we demonstrate for the first time that bacterial uptake via the BCR by B cells forms a highly efficient pathway to generate an immediate anti-microbial humoral immune response.

Acknowledgements

We are grateful to Lauran Oomen and Lenny Brocks for support with CLSM imaging, Erik Mul, Floris van Alphen, Anita Pfauth and Frank van Diepen for excellent FACS sorting, Hanny Klaasse Bos for technical support and Nico Ong for photography. We thank S.A.J. Zaat (Academic Medical Center, Department of Medical Microbiology) and W. van Wamel (Erasmus University Medical Center, Department of Medical Microbiology, Rotterdam, The Netherlands) for S. aureus RN4220 pWVW189, and A. Cheung (Dartmouth Medical

45 Chapter 2

School, Departments of Microbiology and Immunology, Hanover, U.S.A.) for pALC1484 used to construct pWVW189. We thank M. Rescigno (European Institute of Oncology, Milan, Italy) for the Salmonella mutant strains.

Supplementals

Supplemental Figure S1. locking of the BCR with F(ab)2

fragments. Primary B cells were pre-incubated with F(ab)2 fragments of the anti-IgM antibody before incubation with anti-IgM coated Salmonellae. Data are from five different donors, error bars respresent SEM.

Supplemental Figure S2. BCR internalization before incubation with bacteria. Primary B cells were pre-incubated with an anti-IgM antibody followed by incubation with a goat- anti-mouse antibody to achieve partial BCR internalization before incubation with uncoated Salmonellae. Data are one representative set of experiments from four different donors.

46 BCR-mediated bacterial uptake

References

1. Rajewsky, K. 1996. Clonal selection and learning in the antibody system. Nature 381: 751-758. 2. Banchereau, J., F. Bazan, D. Blanchard, F. Briere, J. P. Galizzi, C. van Kooten, Y. J. Liu, F. Rousset, and S. Saeland. 1994. The CD40 antigen and its ligand. Annu. Rev. Immunol. 12: 881-922. 3. Clark, M. R., D. Massenburg, K. Siemasko, P. Hou, and M. Zhang. 2004. B-cell antigen receptor signaling 2 r e t p a h C requirements for targeting antigen to the MHC class II presentation pathway. Curr. Opin. Immunol. 16: 382-387. 4. McSorley, S. J., B. T. Cookson, and M. K. Jenkins. 2000. Characterization of CD4+ T cell responses during natural infection with Salmonella typhimurium. J. Immunol. 164: 986-993. 5. Mittrucker, H. W., and S. H. Kaufmann. 2000. Immune response to infection with Salmonella typhimurium in mice. J. Leukoc. Biol. 67: 457-463. 6. Liljedahl, M., T. Kuwana, W. P. Fung-Leung, M. R. Jackson, P. A. Peterson, and L. Karlsson. 1996. HLA-DO is a lysosomal resident which requires association with HLA-DM for efficient intracellular transport. EMBO J. 15: 4817-4824. 7. Denzin, L. K., D. B. Sant’Angelo, C. Hammond, M. J. Surman, and P. Cresswell. 1997. Negative regulation by HLA-DO of MHC class II-restricted antigen processing. Science 278: 106-109. 8. van Ham, M., M. van Lith, B. Lillemeier, E. Tjin, U. Gruneberg, D. Rahman, L. Pastoors, K. van Meijgaarden, C. Roucard, J. Trowsdale, T. Ottenhoff, D. Pappin, and J. Neefjes. 2000. Modulation of themajor histocompatibility complex class II-associated peptide repertoire by human histocompatibility leukocyte antigen (HLA)-DO. J. Exp. Med. 191: 1127-1136. 9. Aluvihare, V. R., A. A. Khamlichi, G. T. Williams, L. Adorini, and M. S. Neuberger. 1997. Acceleration of intracellular targeting of antigen by the B-cell antigen receptor: importance depends on the nature of the antigen-antibody interaction. EMBO J. 16: 3553-3562. 10. Clark, M. R., D. Massenburg, M. Zhang, and K. Siemasko. 2003. Molecular mechanisms of B cell antigen receptor trafficking. Ann. N. Y. Acad. Sci. 987: 26-37. 11. Malynn, B. A., D. T. Romeo, and H. H. Wortis. 1985. Antigen-specific B cells efficiently present low doses of antigen for induction of T cell proliferation. J. Immunol. 135: 980-988. 12. Lombardi, G., F. del Gallo, D. Vismara, E. Piccolella, C. de Martino, C. Garzelli, C. Puglisi, and V. Colizzi. 1987. Epstein-Barr virus-transformed B cells process and present Mycobacterium tuberculosis particulate antigens to T-cell clones. Cell Immunol. 107: 281-292. 13. Zhang, Y. P., S. J. Tzartos, and H. Wekerle. 1988. B-T lymphocyte interactions in experimental autoimmune myasthenia gravis: antigen presentation by rat/mouse hybridoma lines secreting monoclonal antibodies against the nicotinic acetylcholine receptor. Eur. J. Immunol. 18: 211-218. 14. Vidard, L., M. Kovacsovics-Bankowski, S. K. Kraeft, L. B. Chen, B. Benacerraf, and K. L. Rock. 1996. Analysis of MHC class II presentation of particulate antigens of B lymphocytes. J. Immunol. 156: 2809-2818. 15. Batista, F. D., and M. S. Neuberger. 2000. B cells extract and present immobilized antigen: implications for affinity discrimination. EMBO J. 19: 513-520. 16. Eisenstein, T. K., L. M. Killar, and B. M. Sultzer. 1984. Immunity to infection with Salmonella typhimurium: mouse-strain differences in vaccine- and serum-mediated protection. J. Infect. Dis. 150: 425-435. 17. Mastroeni, P., B. Villarreal-Ramos, and C. E. Hormaeche. 1993. Adoptive transfer of immunity to oral challenge with virulent salmonellae in innately susceptible BALB/c mice requires both immune serum and T cells. Infect. Immun. 61: 3981-3984. 18. Gorvel, J. P., and S. Meresse. 2001. Maturation steps of the Salmonella-containing vacuole. Microbes. Infect. 3: 1299-1303. 19. Fields, P. I., R. V. Swanson, C. G. Haidaris, and F. Heffron. 1986. Mutants of Salmonella typhimurium that

47 Chapter 2

cannot survive within the macrophage are avirulent. Proc. Natl. Acad. Sci. U. S. A 83: 5189-5193. 20. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden. 1996. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proc. Natl. Acad. Sci. U. S. A 93: 2593-2597. 21. Lampson, L. A., and R. Levy. 1980. Two populations of Ia-like molecules on a human B cell line.J Immunol. 125: 293-299. 22. van Ham, S. M., E. P. Tjin, B. F. Lillemeier, U. Gruneberg, K. E. van Meijgaarden, L. Pastoors, D. Verwoerd, A. Tulp, B. Canas, D. Rahman, T. H. Ottenhoff, D. J. Pappin, J. Trowsdale, and J. Neefjes. 1997. HLA-DO is a negative modulator of HLA-DM-mediated MHC class II peptide loading. Curr. Biol. 7: 950-957. 23. Wubbolts, R., M. Fernandez-Borja, L. Oomen, D. Verwoerd, H. Janssen, J. Calafat, A. Tulp, S. Dusseljee, and J. Neefjes. 1996. Direct vesicular transport of MHC class II molecules from lysosomal structures to the cell surface. J. Cell Biol. 135: 611-622. 24. Urashima, M., D. Chauhan, H. Uchiyama, G. J. Freeman, and K. C. Anderson. 1995. CD40 ligand triggered interleukin-6 secretion in multiple myeloma. Blood 85: 1903-1912. 25. Meresse, S., O. Steele-Mortimer, B. B. Finlay, and J. P. Gorvel. 1999. The rab7 GTPase controls the maturation of Salmonella typhimurium-containing vacuoles in HeLa cells. EMBO J. 18: 4394-4403. 26. Marsman, M., I. Jordens, C. Kuijl, L. Janssen, and J. Neefjes. 2004. Dynein-mediated vesicle transport controls intracellular Salmonella replication. Mol. Biol. Cell 15: 2954-2964. 27. Zwart, W., A. Griekspoor, C. Kuijl, M. Marsman, J. van Rheenen, H. Janssen, J. Calafat, M. van Ham, L. Janssen, M. van Lith, K. Jalink, and J. Neefjes. 2005. Spatial separation of HLA-DM/HLA-DR interactions within MIIC and phagosome-induced immune escape. Immunity. 22: 221-233. 28. Tolar, P., H. W. Sohn, and S. K. Pierce. 2005. The initiation of antigen-induced B cell antigen receptor signaling viewed in living cells by fluorescence resonance energy transfer. Nat. Immunol. 6: 1168-1176. 29. Lee, J. A., R. S. Sinkovits, D. Mock, E. L. Rab, J. Cai, P. Yang, B. Saunders, R. C. Hsueh, S. Choi, S. Subramaniam, and R. H. Scheuermann. 2006. Components of the antigen processing and presentation pathway revealed by gene expression microarray analysis following B cell antigen receptor (BCR) stimulation.BMC. Bioinformatics. 7: 237. 30. Kupfer, A., and S. J. Singer. 1989. The specific interaction of helper T cells and antigen-presenting B cells. IV. Membrane and cytoskeletal reorganizations in the bound T cell as a function of antigen dose. J. Exp. Med. 170: 1697-1713. 31. Bossi, G., C. Trambas, S. Booth, R. Clark, J. Stinchcombe, and G. M. Griffiths. 2002. The secretory synapse: the secrets of a serial killer. Immunol. Rev. 189: 152-160. 32. Steele-Mortimer, O. 2008. The Salmonella-containing vacuole: moving with the times. Curr. Opin. Microbiol. 11: 38-45. 33. Fierer, J. 2001. Polymorphonuclear leukocytes and innate immunity to Salmonella infections in mice. Microbes. Infect. 3: 1233-1237. 34. Hoffkes, H. G., G. Schmidtke, M. Uppenkamp, and U. Schmucker. 1996. Multiparametric immunophenotyping of B cells in peripheral blood of healthy adults by flow cytometry. Clin. Diagn. Lab Immunol. 3: 30-36. 35. Wirths, S., and A. Lanzavecchia. 2005. ABCB1 transporter discriminates human resting naive B cells from cycling transitional and memory B cells. Eur. J. Immunol. 35: 3433-3441. 36. Balazs, M., F. Martin, T. Zhou, and J. Kearney. 2002. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses. Immunity. 17: 341-352. 37. Martin, F., A. M. Oliver, and J. F. Kearney. 2001. Marginal zone and B1 B cells unite in the early response against T-independent blood-borne particulate antigens. Immunity. 14: 617-629. 38. Li, J., D. R. Barreda, Y. A. Zhang, H. Boshra, A. E. Gelman, S. Lapatra, L. Tort, and J. O. Sunyer. 2006. B lymphocytes from early vertebrates have potent phagocytic and microbicidal abilities. Nat. Immunol. 7:

48 BCR-mediated bacterial uptake

1116-1124. 39. Geddes, K., F. Cruz, and F. Heffron. 2007. Analysis of cells targeted by Salmonella type III secretion in vivo. PLoS. Pathog. 3: e196. 40. Carsetti, R., M. M. Rosado, and H. Wardmann. 2004. Peripheral development of B cells in mouse and man. Immunol. Rev. 197: 179-191. 41. Weller, S., M. C. Braun, B. K. Tan, A. Rosenwald, C. Cordier, M. E. Conley, A. Plebani, D. S. Kumararatne, 2 r e t p a h C D. Bonnet, O. Tournilhac, G. Tchernia, B. Steiniger, L. M. Staudt, J. L. Casanova, C. A. Reynaud, and J. C. Weill. 2004. Human blood IgM “memory” B cells are circulating splenic marginal zone B cells harboring a prediversified immunoglobulin repertoire. Blood 104: 3647-3654. 42. Dammers, P. M., and F. G. Kroese. 2005. Recruitment and selection of marginal zone B cells is independent of exogenous antigens. Eur. J. Immunol. 35: 2089-2099. 43. Tsuiji, M., S. Yurasov, K. Velinzon, S. Thomas, M. C. Nussenzweig, and H. Wardemann. 2006. A checkpoint for autoreactivity in human IgM+ memory B cell development. J. Exp. Med. 203: 393-400. 44. Mittrucker, H. W., B. Raupach, A. Kohler, and S. H. Kaufmann. 2000. Cutting edge: role of B lymphocytes in protective immunity against Salmonella typhimurium infection. J. Immunol. 164: 1648-1652. 45. Mastroeni, P., C. Simmons, R. Fowler, C. E. Hormaeche, and G. Dougan. 2000. Igh-6(-/-) (B-cell-deficient) mice fail to mount solid acquired resistance to oral challenge with virulent Salmonella enterica serovar typhimurium and show impaired Th1 T-cell responses to Salmonella antigens. Infect. Immun. 68: 46-53. 46. Ugrinovic, S., N. Menager, N. Goh, and P. Mastroeni. 2003. Characterization and development of T-Cell immune responses in B-cell-deficient (Igh-6(-/-)) mice with Salmonella enterica serovar Typhimurium infection. Infect. Immun. 71: 6808-6819.

49

Human Salmonella-specific B cells solicit optimal T cell aid by IL-6 dependent induction of IL-21 in plastic CD4+ Th cells 3

Jelle de Wit, Tineke Jorritsma, Hanny Klaasse Bos, Yuri Souwer, Jacques Neefjes and S. Marieke van Ham

manuscript in preparation Chapter 3

Abstract

B cells mediate humoral immunity against pathogens, but also direct CD4+ responses. In mice, Salmonella-infected dendritic cells (DCs) and B cells induce Th1 polarization, which aids the cytotoxic response against Salmonella. Here, we demonstrate that human Salmonella-infected B cells strongly induced IL-21 in naive and memory Th cells, leading to prominent formation of IFN-γ+/IL-21+ double positive cells that share lineage characteristics of both Th1 (T-bet) and follicular T helper (Tfh) cells. IL-21 strongly promoted antibody secretion and suppressed Th2 formation. Exogenous IL-4 inhibited IL- 21 production, demonstrating mutual exclusive actions for IL-4 and IL-21 in Salmonella- specific immunity. B cells induced IL-21 via IL-6 in naive+ CD4 cells, but IL-6 was not required for reactivation of IFN-γ+/IL-21+ CD4+ memory. Induction of IL-21 was B cell- specific, asSalmonella -infected DCs induced classical Th1 polarization. Thus,Salmonella - infected B cells direct an optimal pathogen-specific CD4+ T cell response by exploiting Th1/ Tfh plasticity. Induction of a T cell subset coexpressing IL-21 and IFN-γ combines IL-21- mediated T cell aid for antibody production, while maintaining Th1 cytokine expression to support the cellular immune defenses against Salmonella.

52 The B-T cell network for IL-6 induced IL-21 secretion

Introduction

The immune response against pathogens consists of a multi-layered network that aims to combine pathogen-specific immunity with minimal tissue damage. Upon infection, immune specificity is orchestrated via regulation of the adaptive humoral and cellular immune responses that direct the innate immune response towards the most efficient elimination of the invaders. Central in the humoral response is activation and differentiation of antigen-specific B cells to generate pathogen-specific antibodies to neutralize the pathogen and/or enhance elimination by complement and Fc-receptor mediated routes. 3 r e t p a h C B cell differentiation mostly requires T cell help1 via CD40-CD154 (CD40L) interactions, whereby class switching to the correct antibody isotype is (in part) regulated by specific cytokines derived from defined effector CD4+ Th subsets. Classically, activated dendritic cells regulate which effector T helper (Th) subset is formed during infection and gives B cell aid. Recently, the picture is emerging that B-T cell interactions are not one-sided events. The clinical effects of B cell depletion with anti-CD20 monoclonal antibodies showed that B cells have immune functions beyond antibody formation.2, 3 Specifically, B cells seem to regulate memory CD4+ T cell responses, which in turn may affect cellular immune responses including those by phagocytes and cytotoxic T lymphocytes (CTLs). This role of B cells seems most prominent during memory reactivation upon antigen recall.4-7 We have demonstrated that antigen-specific B cells phagocytose pathogenic bacteria via their specific B cell receptor (BCR).8 This results in activation of B cells and CD4+ T helper cells, leading to specific antibody secretion. It is not known whether uptake of bacterial pathogens by B cells forms a means to direct the type of CD4+ T cell response. Th1 cells secreting IFN-γ and Th2 cell secreting IL-4 are well known to participate in B cell help and antibody secretion.9-14 Recently, follicular T helper cells (Tfh) have been put forward as the most important cell type that specializes in B cell help by virtue of its localization near or in the B cell follicles and its pronounced support of various B cell functions. Tfh cells are characterized by IL-21 as a hallmark cytokine and by specific surface markers, like CXCR5. IL-21 plays a major role in B cell help. IL-21 is more potent than IL-10 or IL-4 in inducing B cell proliferation both in mice and human and enhances antibody production of IgM, IgG and IgA.15 In human, the role of IL-21 in class switching of IgM+ B cells is less clear, but enhanced class switching of human naive B cells to IgG3 and IgA and stimulation of plasma cell differentiation has been described.10, 15-17 Although the transcription factor Bcl-6 is required for Tfh differentiation and has been put forward as the master regulator for Tfh cells,18, 19 the origin of the Tfh cell and its relation to other Th subsets remain matter of intense ongoing research. Recent findings point to plasticity between Tfh cells and other effector Th cells and the concept that Tfh form a

53 Chapter 3

functional distinct lineage has been challenged.20-26 Activation of mouse naive T cells in presence of IL-12, induced a temporarily Th1/Tfh mixed phenotype, expressing both Tfh (Bcl-6) and Th1 (T-bet) characteristics, before becoming full Th1 cells and suppressing the Tfh phenotype.27 Furthermore, in mice, several Tfh subset with IFN-γ and IL-4 secreting potential may exist in the T cell zones.28-30 Alternatively, these cells may be T cells with Th1 or Th2 characteristics that upon interaction with B cells differentiate into Tfh cells that migrate into the germinal center31 In human, little is known about plasticity between Tfh and other Th subsets. Human blood CXCR5+CD4+ T cells were reported to contain specific subsets, with alteration of polarization in autoimmunity.32 Small IFN-γ+/IL-21+ double positive populations have been described in healthy CD4+ memory cells and in inflammatory bowel disease, but their function remained unclear.33, 34 Here we have studied B cell−T cell interactions that play a role in human antibody formation against a genuine pathogen: Salmonella thyphimurium. During infection with facultative intracellularSalmonella , both B cells and T cells play a critical role in clearance of the pathogen: via antibodies and induction of Th1 and CTL responses.35-37 Although usually eliciting Th2 responses,38-41 B cells specifically reactivate Th1 cells uponSalmonella infection in mice.4, 6, 42 We show that Salmonella-infected human B cells induce both IFN-γ and IL-21 in CD4+ T cells, in part via polarization towards IFN-γ+/IL-21+ double positive population. Stable coexpression of T-bet and Bcl-6 showed that these IFN-γ+/IL-21+ cells form a plastic intermediate between the Th1 and Tfh subsets. IL-21 strongly promoted antibody secretion. Salmonella-infected B cells induced little IL-4 and IL-4 antagonized IL-21 expression. Salmonella-infected DCs did not induce IL-21, implying that IL-21 was specifically induced by B cells, as confirmed by identifying the B cell cytokine IL-6 as critical factor. These data show that human B can exploit CD4+ T cell plasticity to generate the cytokine cocktails for optimal support of immune responses against specific pathogens.

Materials and methods

Antibodies mAb anti-human IgM (MH15, Sanquin, Amsterdam, The Netherlands) was mixed with rat anti-mouse IgG1 antibody (RM161.1, Sanquin) and mAb anti-S. typhimurium LPS (1E6, Biodesign International, Kennebunk, ME) to generate BCR-LPS tetrameric antibody complexes, used to coat bacteria as previously described.8 The following blocking antibodies were used: anti-IL-21 (Peprotech, Rocky Hill, NJ), anti-IL-4 (eBioscience, San Diego, CA), anti-IFN-γ (U-CyTech Biosciences, Utrecht, The Netherlands), anti-IL-12p35 (B-T21, Gen Probe, San Diego, CA), and anti-IL-6 (Sanquin). The following labeled anti-

54 The B-T cell network for IL-6 induced IL-21 secretion human mAbs were obtained from BD Biosciences (San Jose, CA): anti-IFN-γ, anti-IL-4, anti-CD4. Anti-IL-21 and anti-T-bet were obtained from eBioscience, and anti-PD-1, anti-Bcl-6 and anti-CXCR5 were obtained from R&D Systems (Abingdon, UK). DAPI was obtained from Sigma-Aldrich (Steinheim, Germany) and CFSE (Invitrogen, Paisley, UK) labeling was used in proliferation assays.

Bacterial growth conditions S. typhimurium SL1344 and GFP-Salmonella were grown in Luria-Bertani (LB) broth with carbenicillin (Sigma-Aldrich, St Louis, MO) to maintain GFP expression. Bacteria were 3 r e t p a h C cultured overnight at 37°C while shaking, subcultured at a dilution of 1:33 in fresh LB media, and incubated at 37°C while shaking for 3 hours to obtain exponentially growing bacteria. For coating, bacteria were washed twice with PBS and incubated with BCR-LPS tetrameric antibody complexes for 30 minutes at room temperature and washed twice with PBS to remove unbound antibodies.

Lymphocyte isolation Human PBMCs were isolated by centrifugation on a Ficoll-Hypaque gradient (Axis- Shield PoC AS, Oslo, Norway) from a buffycoat obtained from healthy donors (Sanquin). All donors provided written informed consent in accordance with the protocol of the local institutional review board, the Medical Ethics Committee of Sanquin Blood Supply (Amsterdam, The Netherlands), and the Medical Ethics Committee of Sanquin approved the study. B and T cells were subsequently purified using anti-CD19 and anti-CD4 Dynabeads and DETACHaBEAD (Invitrogen), according to the manufacturer’s instructions. From CD4+ T cells, untouched naive CD4+ T cells (CD4+CD45RO-) were purified via MACS isolation kit using CD45RO-PE and anti-PE beads (Miltenyi Biotech, Bergisch Gladbach, Germany). Untouched memory CD4+ T cells were isolated via MACS isolation using CD45RA-PE and anti-PE beads. Populations were >98% purified. Monocytes were isolated by positive selection using CD14 microbeads and a magnetic cell separator (MACS, Miltenyi Biotec, Bergisch Gladbach, Germany). Monocytes were cultured at a concentration of 1×106 cells/ml in 20 ml Cellgro medium (CellGenix, Freiburg, Germany) supplemented with GM-CSF (1,000 IU/ml; Cellgenix) and IL-4 (800 IU/ml) in a 80 cm2 cell culture flask (Nunc, Roskilde Denmark) to generate immature DCs. At day 7, the DCs were harvested and washed with antibiotic free medium.

Salmonella infection B lymphocytes or dendritic cells were incubated for 45 minutes at 37°C with Salmonella without antibiotics. Next, cells were washed to remove unbound bacteria four times and

55 Chapter 3

cultured for 1 hour in medium containing 100 µg/ml gentamycin (Invitrogen) to eliminate non-phagocytosed bacteria. Cells were washed and cultured in RPMI 1640 medium w/o phenol red (Lonza, Basel, Switserland), supplemented with 5% FCS (Bodinco, Alkmaar, The Netherlands), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine (Invitrogen), 50 μM 2-ME, 20 μg/ml human apo-transferrin ((Sigma-Aldrich), depleted for human IgG with protein G sepharose (Amersham, Uppsala, Sweden)) and 10 µg/ ml gentamycin. 1x105 Salmonella-infected cells were cultured with 5x104 CD4+ T cells. The following cytokines were added when described: IL-21 (50 ng/ml; Invitrogen), IFN-γ (Immukine; 1000 IU/ml; Boehringer Ingelheim, Ingelheim am Rhein, Germany), IL-4 (50 ng/ml; Janssen Biochemica, Beerse, Belgium), IL-13 (Sanquin). 20,000 events were acquired on a LSR II (BD) and analyzed with FlowJo (v7.6.5 Treestar Inc.).

Flow cytometry Proliferation was measured after 6 days of by culture of CFSE labeled B and T cells. DAPI was used to analyze living cells. To study T cell polarization, we used intracellular cytokine stainings. B cells and T cells were cultured for 11 days. Cytokine production was measured by intracellular staining after restimulation with 0.1 µg/ml PMA, 1 µg/ml ionomycin and 10 µg/ml brefeldin A (Sigma-Aldrich) for 5 hours. Cells were washed twice with PBS, fixed with 4% paraformaldehyde (Merck, Darmstadt, Germany) for 15 minutes and after washing with PBS and PBS containing 1% BSA (Sigma-Aldrich), permeabilized with 0.5% saponin (Calbiochem, CA) in PBS containing 1% BSA and incubated with fluorescent antibodies for 30 minutes at room temperature. 20,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD).

ELISA assays To determine IgM, IgG (subclasses) and IgA levels in culture supernatants, flat bottom MaxiSorb plates (Nunc, Roskilde, Denmark) were coated with polyclonal anti-IgM (SH15, Sanquin), anti-IgG (MH-16, Sanquin), anti-IgG1 (MH161-1, Sanquin), anti-IgG2 (MH162-1, Sanquin), anti-IgG3 (MH163-1, Sanquin), anti-IgG4 (MH164-1, Sanquin) or anti-IgA (Dako) in 100 μl PBS, overnight at room temperature. Plates were washed with PBS/0.02%Tween-20 (Mallinckrodt Baker, Deventer, the Netherlands). After washing, samples were incubated for 2 hours in high performance ELISA buffer (HPE, Sanquin). As a standard, pooled human serum was used. Plates were washed and incubated for 1 hour with 1 μg/ml mAb anti-IgM-HRP (MH15-HRP, Sanquin), anti-IgG (MH16-1-HRP, Sanquin), also for IgG subclasses, or anti-IgA (MH14, Sanquin). After washing, peroxidase activity was visualized by incubation with 100 μl 3,5,3’,5’-tetramethylbenzidine (Merck,

Darmstadt, Germany), 100 μg/ml in 0.11 M Na-acetate, pH 5.5, containing 0.003% H2O2

56 The B-T cell network for IL-6 induced IL-21 secretion

(Merck). The reaction was stopped by addition of an equal volume of 2M H2SO4 (Merck) and the absorbance at 450 nm and 540 nm was measured immediately in a Titertek plate reader.

RNA isolation, cDNA synthesis and real-time semi-quantitative RT-PCR RT-PCR has been described before.74 Briefly, RNA was reverse transcribed to cDNA using random hexamers in combination with Superscript II and a RNase H-reverse transcriptase kit. Primers for 18S rRNA, IL12p40 and IL6 were developed to span exon-intron junctions to prevent amplification of genomic DNA (primer sets in supplemental Table 1). Primers 3 r e t p a h C were validated on cDNA of total CD4+ T cells. Product specificity of each primer set was verified by agarose gel electrophoresis and sequence analysis of the amplified PCR product. Gene expression levels were measured in triplicate reactions for each sample in the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR green method (Applied Biosystems). All results were normalized to the internal control 18S rRNA, and are expressed relative to the expression levels found in naive CD4+ T cells stimulated with non-infected B cells.

Statistical analysis Statistical differences were determined by a paired Student’s t test, using GraphPad Prism (version 5.01, GraphPad Software, San Diego, CA).

Results

Salmonella-infected B cells induce T cell polarization towards IFN-γ and IL-21 The humoral response against Salmonella is supported by CD4+ T cell help. To study the role of T cell help in antibody production, primary human B cells that have internalized Salmonella were cultured with autologous CD4+ T cells. Since a minor population of B cells (around 2-4%, ref. 8) is specific for Salmonella antigens, bacteria were coated with anti-IgM antibodies, to enhance BCR-mediated uptake by IgM+ B cells. This increased the number of Salmonella-internalizing B cells up to 60%, without affecting B cell function (ref. 8 and data not shown). Salmonella-infected B cells induced T cell proliferation (Figure 1A and ref. 8) and cytokine secretion (Figure 1B). As observed in mice,42 B cells induced IFN-γ. Costaining with anti-IL21 mAb showed strong IL-21 expression, yielding IL-21+ single positive (SP) and IFN-γ SP cells, but also a prominent IFN-γ+/IL-21+ double positive (DP) population (Figure 1B-D). As Salmonella-infected B cells induced little IL-4 in the T cells (Figure 1B-C), only few IL-4+/IL-21+ DP were induced. IL-17 induction was very low

57 Chapter 3

Figure 1. T cells are polarized towards an IFN-γ+/IL-21+ phenotype by Salmonella-infected B cells. (A) CFSE labeled CD4+ T cells were cultured with autologous B cells that were incubated with Salmonella (Bsal+T) or not (B+T). Proliferation was measured at day 6. Data shown are from 14 individual experiments with different donors, combined in one graph (right) with mean + SEM. (B) B and T cells were cultured as described in (A). After 11 days of culture, cells were restimulated for 5 hours with PMA, ionomycin and BFA and analyzed for IFN-γ, IL-4, and IL-21 cytokine production by intracellular staining. Percentages of IFN-γ+, IL-4+, IL-21+ cells (C) or double positive populations (D) of six experiments with different donors are combined.

and IL-10 could not be detected (data not shown). Coculture with human B cells infected with non-coated Salmonella showed similar Th polarization, confirming that the coating procedure did not affect T cell polarization (data not shown).

IL-21-induction is a B cell-specific process uponSalmonella infection Does induction of a Th21+ phenotype by Salmonella-infected APC depend on B cells? Internalization of Salmonella by monocyte-derived human DCs also induced CD4+ T cell proliferation (Figure 2A). In contrast to B cells (Figure 2B-C), Salmonella-infected DCs did not induce polarization towards IL-21+ (Figure 2D-E). Only IFN-γ polarization was induced. In line with the absence of IL-21, Salmonella-infected DCs induced less CXCR5 in the CD4+ T cells than Salmonella-infected B cells (Figure 2F). Thus, upon infection withSalmonella , B cells specifically induce Tfh-like characteristics in CD4+ T cells.

Salmonella-infected B cells induce Tfh-like cells upon naive T cell priming and reactivation of memory CD4+ T cells The pathways of Tfh differentiation are still incompletely understood. In some models, B cells are proposed to mainly serve as a last step to stabilize the Tfh phenotype that has initially been induced by DCs.31 Therefore, we investigated if the observed induction of IL- 21 only resulted from reactivation of memory CD4+ T cells or whether naive cells could also be primed towards IL-21. Similar to mice,42 human Salmonella-infected B cells activated both naive and memory CD4+ T cells (Figure 3A). Priming of naive CD4+ T cells induced

58 The B-T cell network for IL-6 induced IL-21 secretion 3 r e t p a h C

Figure 2. DCs skew CD4+ T cell polarization towards IFN-γ secreting cells. Dendritic cells or B cells were incubated with Salmonella and cocultured with autologous T cells. (A) Proliferation of CFSE labeled T cells was measured at day 6. T cell polarization induced by B cells(B and C) or DCs (D and E) was measured at day 11 after 5 hours of restimulation with PMA, ionomycin and BFA. Data shown are from one representative experiment(B and D) of four individual experiments with different donors in which Salmonella-infected DCs and Salmonella- infected B cells were directly compared (C and E) with mean + SEM. (F) CXCR5 expression of stimulated T cells was measured at day 11. Data are from one representative experiment of four individual experiments with different donors.

Figure 3. B cell induce IL-21 in both naive and memory CD4+ T cells. B cells were incubated with Salmonella and cocultured with either total CD4+ T cells, naive CD4+ T cells or memory CD4+ T cells. (A) Proliferation of T cells at day 6 was measured by CFSE. Data shown are from seven individual experiments with different donors. (B) T cell polarization was measured at day 11, after 5 hours stimulation with PMA, ionomycin and BFA. Data shown are from two individual experiments with different donors directly comparing polarization of total, naive and memory CD4+ T cells. (C- D) CXCR5 and PD-1 expression was measured at day 11 of naive (C) or memory (D) CD4+ T cells, cultured as described in (B). FACS plots are shown from one representative donor. Bars show number of positive cells (mean + SEM) from two experiments with different donors

59 Chapter 3

comparable T cell polarization as observed upon CD4+ memory reactivation and strongly skewed towards IFN-γ and IL-21 expression, and to a lesser extent to IL-4 (Figure 3B). We next analyzed if IL-21 expression correlated with expression of Tfh-markers. Salmonella- infected B cells induced expression of both CXCR5 and PD-1 in primed naive T cells, with a prominent population expressing both CXCR5 and PD-1 (Figure 3C). Reactivated memory T cells showed less CXCR5 expression and little PD-1 (Figure 3D). This indicates that, although Salmonella-infected human B cells skew both naive and memory T cells towards IL-21 expression, primed naive T cells shows characteristics of fully differentiated GC-Tfh cells (CXCR5+/PD-1+), whereas reactivated memory T cells show a stronger resemblance to pre-Tfh cells (CXCR5+/PD-1-).43, 44

B cell-induced IFN-γ+/IL-21+ DP CD4+ T cells show features of both Th1 and Tfh Salmonella-infected B cells induced IFN-γ+/IL-21+ DP cells both through priming of naive CD4+ T cells and upon reactivation (Figure 4A-B). The phenotype of this unusual T cell subset was further analyzed in activated naive and memory T cells. Intracellular staining of primed naive T cells at day 11 showed higher expression of the Tfh specific transcription factor Bcl-6 in IFN-γ+/IL-21+ DP cells compared to the IFN-γ+ SP population (Figure 4A), albeit at lower levels than in IL-21+ SP cells. The IFN-γ+/IL-21+ population also strongly expressed the T-bet, even at higher levels than the IFN-γ+ SP population. Stimulation of memory T cells by Salmonella-infected B cells induced comparable Bcl-6 expression in IL-21+ SP and IFN-γ+/IL-21+ cells and more than in the IFN-γ+ SP population (Figure 4B). Similar to primed naive T cells, the IFN-γ+/IL-21+ population observed after antigen recall showed higher T-bet expression than the SP populations. The observed coexpression of Bcl-6 and T-bet shows that the IFN-γ+/IL-21+ population shares characteristics of the Th1 and Tfh transcription programs. This indicates that Salmonella-infected B cells induce a CD4+ T cell population that forms a Th1/Tfh intermediate. In mice a Th1/Tfh intermediate was described recently to be a form of early Th1 differentiation with gradual loss of Tfh characteristics after day 5.45 Our data showed stable Th1/Tfh formation at day 11 after B cell-induced T cell activation. To investigate if the stability of the Th1/Tfh phenotype required the continued presence of B cells, proliferating T cells that were activated by Salmonella-infected B cells were sorted after six days and further cultured either alone or in the presence of autologous Salmonella-infected B cells, infected DCs, or with anti- CD3 and anti-CD28 antibodies. In all conditions tested, the cytokine pattern secreted by the activated CD4+ T cells did not change (Figure 4C) and the IFN-γ+/IL-21+ DP population remained stable (Figure 4D).

60 The B-T cell network for IL-6 induced IL-21 secretion 3 r e t p a h C

Figure 4. IFN-γ+/IL-21+ DP CD4+ T cells express both T-bet and Bcl-6. Salmonella-infected B cells were cultured with naive (A) or memory (B) CD4+ T cells and analyzed on day 11 for expression of Bcl-6 and T-bet. Cells were gated on IL-21+ single positive (SP; red), IFN-γ+/IL-21+ double positive (DP; blue), IFN-γ+ single positive (orange) or IL-21-/IFN-γ- double negative (negative; grey) populations. Bars show MFI depicted as mean + SEM from two experiments with different donors. FACS plots with corresponding MFI are shown from one representative donor. (C-D) T cells activated bySalmonella -infected B cells were sorted after 6 days of culture and restimulated by Salmonella-infected B cells, Salmonella-infected DCs or via anti-CD3 and anti-CD28 antibodies. T cell polarization was measured 6 days after restimulation. Data shown are mean + SEM of triplicate measurements from one representative out of two experiments with different donors. FACS plots are shown fromone representative donor.

Memory T cells are the main source of providing help in antibody secretion Since Salmonella-infected B cells, but not Salmonella-infected DCs, specifically induce CD4+ T cells with Tfh characteristics in addition to Th1, we investigated if these cells were able to provide help for B cell proliferation and antibody secretion. Salmonella-infection of human primary B cells induced some B cell proliferation, but proliferation was strongly enhanced in the presence of autologous CD4+ T cells (Figure 5A-B). Besides enhancing B cell expansion, the activated T cells enhanced IgM, IgG and IgA secretion by Salmonella- infected B cells (Figure 5C). Analysis of IgG subclass distribution showed that secreted

61 Chapter 3

IgG mainly belonged to the IgG1 subclass (Figure 5D). Thus, the interaction between Salmonella B cells and T cells results in Tfh and Th1-prone T cell polarization, which in turn promotes both B cell expansion and B cell differentiation into antibody-secreting cells. Cocultures of Salmonella-infected B cells with naive or memory T cells showed that primed naive T cells did support both IgM and IgG production, but that reactivated memory T cell were significantly superior in providing help to B cells for immunoglobulin

Figure 5. Autologous T cells enhance proliferation and immunoglobulin production of Salmonella-infected B cells. CFSE labeled B cells (either or not incubated with Salmonella) were cultured alone or in the presence of CD4+ T cells. Proliferation of B cells was measured at day 6. Data shown are from one representative experiment (A) of nine independent experiments using different donors (B), with mean + SEM. (C-D) Secreted antibodies were measured in the supernatant after 12 days of culture. Data shown are mean + SEM of twelve (IgM and IgG) or five (IgA, IgG1-4) individual experiments with different donors. (E) B cells were incubated with Salmonella and cocultured with either naive, memory or total CD4+ T cells. Immunoglobulin secretion in the supernatant was measured at day 12 of culture. Data shown are from eight individual experiments with different donors.(F) Cells were cultured as described, with or without addition of extra IL-21 (50 ng/ml). Immunoglobulin levels in the supernatant were measured at day 12. Data shown are from seven individual experiments with different donors.

62 The B-T cell network for IL-6 induced IL-21 secretion secretion and were responsible for the main antibody promoting effect of total+ CD4 T cells (Figure 5E). We tested whether this could be due to differences in the production of IL-21 in the different activated T cells, but could not detect this (Figure 3B). In fact, addition of exogenous IL-21 to cocultures containing either total CD4+ T cells or naive CD4+ T cells did not enhance antibody secretion in the B-Tnaive cocultures to the levels observed in total T cells (Figure 5F). This indicates that additional factors from memory T cells are essential for optimal stimulation of B cells for antibody production.

Different functions of IL-4 and IL-21 in stimulation and differentiation of human B cells 3 r e t p a h C Salmonella infected B cells polarize T cells towards IFN-γ and IL-21, but minor induction of IL-4 (Figure 1). IFN-γ is important for the clearance of intracellular Salmonella by macrophages and cytotoxic T cells,36, 46, 47 but was also reported to be involved in B cell help.9, 14 IL-4 was originally considered the classical cytokine for B cell help,48, 49 until the more recent discovery of IL-21 as mediator for B cell help.10 Which of these cytokines contribute to help for Salmonella-infected B cells? Blocking of IL-21 in Salmonella- containing B-T cocultures attenuated both IgM and IgG secretion, while blocking of IFN-γ or IL-4 did not affect IgM or IgG secretion (Figure 6A and B). This suggests that IL-21 is critical for an optimal T-cell mediated antibody response against Salmonella.

Figure 6. Blocking of IL-21 reduces both IgM and IgG antibody secretion by Salmonella B cells. B cells incubated with Salmonella were cocultured with autologous CD4+ T cells, in the presence of either anti- IL-21 (10 µg/ml), anti-IFN-γ (10 µg/ ml) or anti-IL-4 (10 µg/ml) blocking antibodies. Secreted IgM (A) and IgG (B) in the supernatant were measured at day 12. Data shown are mean + SEM of four individual experiments with different donors.

As the individual cytokines in the B-T cocultures may both affect B and T cell function. Therefore, cytokines were added to B cells that had been activated by anti-IgM-coated Salmonella in the absence of T cell help. IFN-γ had no effect on B cell proliferation (Figure 7A) or antibody secretion (Figure S1). IL-4 strongly induced proliferation of Salmonella- infected B cells and enhanced IgM secretion (Figure 7B). The Tfh cytokine IL-21 did not alter B cell proliferation, but secretion of both IgM and IgG were respectively 5-fold and 18-fold enhanced (Figure 7B). The combination of IL-4 and IL-21 did not further enhance

63 Chapter 3

B cell proliferation, but showed an additive effect on IgM and IgG secretion. Thus, IL-4 induces proliferation of B cells, and might thereby enhance antibody levels. IL-21 on the other hand does not induce B cell proliferation, but is superior in the induction of the antibody secretion program in B cells. In presence of T cells, extra IL-4 again enhanced B cell proliferation (Figure 7C-D). Surprisingly, while IL-4 enhanced B cell proliferation, secretion of both IgM and IgG were strongly reduced (Figure 7E). A similar reduction in immunoglobulin secretion was obtained by addition of IL-13, another Th2 cytokine (Figure S2). The addition of IL-21 to the human B-T cell cocultures reduced B cell proliferation (Figure 7C-D), but it significantly improved IgG secretion by Salmonella-infected B cells, while IgM secretion was not further enhanced (Figure 7E). Addition of IFN-γ had no effect on proliferation (Figure 7C-D), but did enhance IgM antibody secretion (Figure S2). Thus, although IL-4 has a direct positive effect on proliferation and antibody secretion of isolated B cells, in T cell mediated activation it strongly negatively affects antibody secretion. In contrast, IL-21 enhances both T cell dependent and independent-antibody secretion without

Figure 7. IL-21 reduces T cell mediated B cell proliferation, but enhances IgG secretion. (A-B) CFSE labeled B cells with Salmonella were cultured in presence of IFN-γ (1000 IU/ml), IL-4 (50 ng/ml) or IL-21 (50 ng/ml). (A) Proliferation was measured at day 6. Data shown are mean ± SEM of at least four individual experiments with different donors. (B) Antibody secretion was measured at day 12. Data shown are mean ± SEM of eight individual experiments with different donors. (C-E) CFSE labeled B cells with Salmonella were cocultured with T cells, in the presence of different cytokines.(C-D) Proliferation of the B cells was measured at day 6. Data are shown as one representative experiment (C) of four individual experiments with different donors(D) with mean + SEM. (E) Antibody secretion was measured at day 12. Data shown are from twelve individual experiments with different donors.

64 The B-T cell network for IL-6 induced IL-21 secretion stimulating B cell proliferation.

IL-21 and IL-4 show reciprocal regulation Since IL-21 stimulated antibody secretion, and IL-4 decreased antibody secretion only in the presence of CD4+ T cells, the effects of these cytokines on T cell polarization were further investigated. While addition of IL-4 had no significant effect on T cell proliferation in the B-T cocultures (Figure 8A), extra IL-4 enhanced differentiation towards IL-4+ T cells, and reduced differentiation towards IL-21+ T cells (Figure 8B-C). The negative effect of IL-4 on IL-21 induction in CD4+ T cells may explain why IL-4 is detrimental for T cell-dependent, 3 r e t p a h C but not for T cell-independent antibody production. Addition of a combination of IL-4 and IL-21 to the B-T cocultures partially restored IgM and completely restored IgG secretion (Figure 8D), demonstrating that IL-4 suppresses T cell aid to Salmonella-infected B cells via inhibition of CD4+ T cell polarization towards IL-21.

Figure 8. IL-4 attenuates IL-21+ T cell polarization while IL-21 downmodulates IL-4+ T cell polarization. Salmonella-infected B cells were cocultured with autologous T cells in the presence of either IL-21 (50 ng/ml) or IL-4 (50 ng/ml). (A) Proliferation of CFSE labeled CD4+ T cells was measured at day 6. Data shown are mean + SEM from thirteen different experiments with different donors. (B) T cell polarization was measured at day 11 after 5 hours restimulation with PMA, ionomycin and BFA. Data shown are from one representative experiment out of nine individual experiments with different donors, combined in (C) and (E), with mean + SEM. (D) IgM and IgG levels were measured at day 12. Data shown are mean + SEM of twelve individual experiments with different donors. (F) Proliferation of CFSE labeled B cells was measured at day 6. Data shown are mean + SEM from at least four different experiments with different donors.

65 Chapter 3

Reciprocally, addition of extra IL-21 to the coculture of Salmonella B cells and T cells enhanced proliferation of the T cells (Figure 8A), but reduced the amount of IL-4+ cells (Figure 8B and E). Exogenous IL-21 also downmodulated induction of the amount of IL- 21+ SP and IFN-γ+/IL-21+ DP cells. Although IL-21+ T cell differentiation was attenuated, the extra IL-21 added provided direct help to B cells to secrete antibodies. Since IL-4 enhances B cell proliferation, the reduction of IL-4+ T cells caused by additional IL-21 might explain the decrease in B cell proliferation caused by exogenous IL-21 (Figure 7D-E). Indeed, addition of IL-4 next to IL-21 restored B cell proliferation (Figure 8F). In conclusion, IL-21 suppresses Th2 differentiation and thereby B cell proliferation. Yet, the strong induction of antibody secretion by IL-21 is still favorable for B cells and antibody responses in the defense against Salmonella.

Tfh induction by B cells is mediated via IL-6 Since IL-12 was reported to be involved in induction of Tfh differentiation,27, 50 we investigated if Salmonella-infected B cells polarized CD4+ T cells towards IL-21 via IL-

Figure 9. Blocking of IL-6 reduces IL-21+ Tfh differentiation of naive T cells. (A) CD4+ T cells were cultured with autologous Salmonella-infected B cells (Bsal+T) or non-infected B cells (B+T). After 12 hours, B cells were separated and IL-12p40 mRNA levels were analyzed. Data shown are from one experiment. (B) Salmonella-infected B cells were cocultured with naive or memory T cells, either or not in the presence of anti-IL-12p35 mAb (10 µg/ml). T cell polarization was measured at day 11 after 5 hours restimulation with PMA, ionomycin and BFA. Data shown are relative percentage of IL-21+ cells with mean + SEM from three different experiments with different donors. (C) Cells were cultured as described in (A), and IL-6 mRNA levels in B cells were measured after 12 hours. (D-E) B and T cells were cultured as described in (B) in the presence of either anti-IL-6 mAb (10 µg/ml), anti-IL-21 mAb (10 µg/ml) or both blocking antibodies. Relative percentages of IL-21+ (D) and IFN-γ+ (E) T cells were measured at day 11, after restimulation with PMA, ionomycin and BFA. Data shown are mean + SEM from three different experiments with different donors.

66 The B-T cell network for IL-6 induced IL-21 secretion

12. Salmonella-infected B cells had enhanced levels of IL12p40 mRNA (Figure 9A). IL-12 protein however, could not be detected in the supernatant (data not shown). Moreover, blocking antibodies directed against IL12p35 had no effect on IL-21 induction in both naive and memory T cells (Figure 9B). In other cell systems in mice and human, IL-6, either or not in combination with IL-21, were described to mediate Tfh differentiation.27, 50-53 Since enhanced IL6 mRNA levels were also detected in Salmonella-infected B cells (Figure 9C), we studied the effects of IL-6 and IL-21 in our system. Blocking IL-6 reduced differentiation towards IL-21+ in naive T cells (Figure 9D), while IFN-γ production was not affected (Figure 9E). Addition of blocking IL-21 antibodies had no obvious effect on 3 r e t p a h C Tfh cell differentiation, not by itself or in combination with IL-6 blockage. Memory T cell differentiation towards IL-21 or IFN-γ was not affected by either IL-6 or IL-21 (Figure 9D and E). In conclusion, while reactivation of memory IL-21+ T cells does not depend on IL- 6, CD4+ T cell differentiation towards an IL-21+ phenotype upon naive T cell priming does require IL-6.

Discussion

The role of B cells in anti-bacterial immune responses is evident, since antibodies are required for good protection.35 Where for many years Th2 cytokines, like IL-4, were thought to be most important for B cell differentiation,11-13 now the Tfh cytokine IL-21 has emerged as new key player.54 DCs are required for naive CD4+ T cell differentiation into specific subsets and thus seem to determine the type of Th cell aid offered to B cells. Antigen-activated B cells may play a role as APC in naive Th priming and are essential regulators of CD4+ T cell memory.42, 55-60 This implies that B-T cell interactions in fact lead to bidirectional signaling, where each cell type controls differentiation of the other. Little is known about reciprocal regulation of human B-T cell responses in antigen-specific systems.40, 41, 57 We used a physiological model using Salmonella-infected human primary B cells to study bidirectional regulation of B-T cell differentiation in a cognate setting and relate this to the efficiency of T cell aid for antibody production. In Salmonella infection in mice B cells elicit Th1 polarization,42 in contrast to other systems were B cells mainly support Th2.38-41 Also in human, Salmonella-infected B cells yielded prominent IFN-γ+ expression in naive and memory CD4+ T cells. IL-21 was also strongly induced, giving rise to IFN-γ+ SP, IL-21 SP and IFN-γ+/IL-21+ DP populations. Control of Salmonella infection depends on IFN-γ+ Th cells aiding macrophages in bacterial clearance and supporting reactivation of Salmonella-specific CTLs.36, 37, 61 IL-21 was also implicated in help for chronic CD8+ T cell responses,62 indicating that concurrent IFN-γ

67 Chapter 3

and IL-21 expression may optimally support CTL-driven immunity againstSalmonella . The main function of IL-21 however, probably lies in its importance for the humoral response against Salmonella. While IFN-γ did not contribute to IgM and IgG secretion, IL-21 was crucial for antibody production, as observed before in non-cognate human B-T systems.16 Both IL-21 and IL-4 support B cells.10-13, 63-65 We also observed a beneficial effect of IL-4 on isolated B cells, most significantly via support of B cell expansion. In presence of T cells, IL-4 strongly inhibited antibody production. Previously, IL-4 was demonstrated to be detrimental for IL-21-mediated antibody secretion during B-T interactions,10, 66 but the underlying mechanism was not elucidated. Here we demonstrate that IL-21 and IL-4 exhibit strong reciprocal negative regulation. Salmonella-infected B cells induce superior levels of IL-21 compared to IL-4. As IL-21 most strongly supported antibody secretion, Salmonella-infected B cells thus polarize T cells to secrete those cytokines that are most optimal for B cell aid. In our system IL-4 and IL-21 have mutual exclusive functions. In vivo, it may well be that IL-21 and IL-4 are expressed consecutively, with each performing specific functions for B cells at specific times. In helminth infection in mice,cells coexpressing IL-21 and IL-4 were observed.29, 30 Thus mutual interference of IL-4 and IL-21 expression may be alleviated by yet unidentified signals of specific pathogens. Specific induction of IL-21 in CD4+ T cells by Salmonella-infected B cells, but not by DCs, correlated with enhanced expression of CXCR5 and Bcl-6, suggesting that B cells induced Tfh-like cells. Our data show that upon phagocytosis of Salmonella, human B cells differentiate naive Th cells and reactivate memory T cellsin vitro to secrete a similar cytokine pallet. Whereas, primed naive T cells (CXCR5+/PD-1+) resembled GC-Tfh cells, reactivated memory T cells, not coexpressing PD-1, were more similar to pre-Tfh cells. Nevertheless, these memory cells are superior in help for antibody production. Whether the latter relates to the phenotypic differences observed remains to be elucidated. In Salmonella infection in vivo, B cells play a role as APC in regulation of +CD4 T cell responses.67, 68 In contrast to Salmonella-infected DCs, B cells confer specific signals to skew Th cell differentiation towards Tfh-like cells. The pathways regulating Tfh differentiation are under debate. ICOS has been postulated to induce Tfh differentiation,69 but seems not to play a role in our system (data not shown). Cytokine signaling via IL-21, IL-6 or IL-12 were all implicated.27, 50, 51, 53, 70 In mice, IL-12 induces transient expression of IL-21 during Th1 differentiation.27 Although this also involves coexpression of IL-21 and IFN-γ, we did not observe a role for IL-12. Instead, Salmonella-infected B cells induce IL-21 in naive T cells via IL-6. Nakayamada and coworkers postulate that IL-12 acting through STAT4 leads to transient IL-21 expression, as upregulation of T-bet attenuates IL-21 expression in the late phase of Th1 differentiation.27 In contrast, IL-6 acting through STAT3 did not induce T-bet, yielding a stable IL-21+ phenotype. Indeed, in our system, IL-21 expression was

68 The B-T cell network for IL-6 induced IL-21 secretion sustained throughout the complete differentiation phase of naive Th cells. In contrast to mice,27 also the IFN-γ+/IL-21+ DP CD4+ T cell population is stable, in spite of high T-bet expression. Thus, in human T-bet is not detrimental for IL-21 induction. It is likely that IL-21 induction is our system is indeed mediated by pSTAT3.24, 71-73 This however, requires further investigation. The IFN-γ+/IL-21+ DP population induced by Salmonella-infected B cells forms a plastic intermediate between Th1 and Tfh, as the Th1 (T-bet+/IFN-γ+) and Tfh differentiation (Bcl- 6+/ CXCR5+/IL-21+) programs are simultaneously executed. This concurs with the recent indications of plasticity between Tfh and other effector Th subsets.24-26 It also shows 3 r e t p a h C that the classical paradigm of pathogen-driven Th polarization to defined subsets with specific effector functions needs to be reevaluated. We have shown that specific APCs, like Salmonella-activated B cells can exploit plasticity between Tfh and Th1 to generate an optimal immune response for clearance of the bacteria. While the Th1 phenotype supports the cellular immune response, simultaneous induction of a Tfh-like phenotype provides optimal B cell aid for effective humoral immunity. Thus, the emerging concept of plastic intermediates between Th subsets adds another level in B cell mediated regulation of integrated and pathogen-optimized immune responses.

Acknowledgements

We are grateful to Erik Mul and Floris van Alphen for excellent FACS sorting. We thank Anja ten Brinke and Gijs van Schijndel for their help in the DC culture. This work was supported by grants from the Landsteiner Foundation for Blood Research (LSBR, grant 0533 and 0816) and Sanquin Blood Supply PPOC (PPOC 09-032).

Supplementals

Table S1 Primers IL6 F: GTACATCCTCGACGGCATC R: CCAGGCAAGTCTCCTCATTG IL12p40 F: AGACCTTTCTAAGATGCGAGG R: CTGCAGAGAGTGTAGCAGC

69 Chapter 3

Figure S1. Salmonella-infected B cells were cultured in the presence of IFN-γ (1000 IU/ml). The levels of secreted IgM (A) and IgG (B) were measured at day 12. Data shown are mean ± SEM of two experiments with different donors.

Figure S2. Salmonella-infected B cells were cocultured with autologous T cells in the presence of either IL-13 (50 ng/ml) or IFN-γ (1000 IU/ml). The levels of secreted IgM (A) and IgG (B) were measured at day 12. Data shown are mean ± SEM of ten (IL-13) or four (IFN-γ) experiments with different donors.

70 The B-T cell network for IL-6 induced IL-21 secretion

References

1. Zubler, R. H. 2001. Naive and memory B cells in T-cell-dependent and T-independent responses. Springer Semin. Immunopathol. 23: 405-419. 2. Bouaziz, J. D., K. Yanaba, G. M. Venturi, Y. Wang, R. M. Tisch, J. C. Poe, and T. F. Tedder. 2007. Therapeutic B cell depletion impairs adaptive and autoreactive CD4+ T cell activation in mice.Proc. Natl. Acad. Sci. U. S. A 104: 20878-20883. 3. Dilillo, D. J., K. Yanaba, and T. F. Tedder. 2010. B cells are required for optimal CD4+ and CD8+ T cell tumor immunity: therapeutic B cell depletion enhances B16 melanoma growth in mice. J. Immunol. 184: 4006- 4016. 4. Whitmire, J. K., M. S. Asano, S. M. Kaech, S. Sarkar, L. G. Hannum, M. J. Shlomchik, and R. Ahmed. 2009. Requirement of B cells for generating CD4+ T cell memory. J. Immunol. 182: 1868-1876. 3 r e t p a h C 5. Stephens, R., and J. Langhorne. 2006. Priming of CD4+ T cells and development of CD4+ T cell memory; lessons for malaria. Parasite Immunol. 28: 25-30. 6. van Essen, D., P. Dullforce, T. Brocker, and D. Gray. 2000. Cellular interactions involved in Th cell memory. J. Immunol. 165: 3640-3646. 7. Liu, Q., Z. Liu, C. T. Rozo, H. A. Hamed, F. Alem, J. F. Urban, Jr., and W. C. Gause. 2007. The role of B cells in the development of CD4 effector T cells during a polarized Th2 immune response. J. Immunol. 179: 3821-3830. 8. Souwer, Y., A. Griekspoor, T. Jorritsma, W. J. de, H. Janssen, J. Neefjes, and S. M. van Ham. 2009. B cell receptor-mediated internalization of salmonella: a novel pathway for autonomous B cell activation and antibody production. J. Immunol. 182: 7473-7481. 9. Toellner, K. M., S. A. Luther, D. M. Sze, R. K. Choy, D. R. Taylor, I. C. MacLennan, and H. Acha-Orbea. 1998. T helper 1 (Th1) and Th2 characteristics start to develop during T cell priming and are associated with an immediate ability to induce immunoglobulin class switching. J. Exp. Med. 187: 1193-1204. 10. Avery, D. T., V. L. Bryant, C. S. Ma, M. R. de Waal, and S. G. Tangye. 2008. IL-21-induced isotype switching to IgG and IgA by human naive B cells is differentially regulated by IL-4. J. Immunol. 181: 1767-1779. 11. Ford, D., C. Sheehan, C. Girasole, R. Priester, N. Kouttab, J. Tigges, T. C. King, A. Luciani, J. W. Morgan, and A. L. Maizel. 1999. The human B cell response to IL-13 is dependent on cellular phenotype as well as mode of activation. J. Immunol. 163: 3185-3193. 12. Wagner, E. F., M. Hleb, N. Hanna, and S. Sharma. 1998. A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation. J. Immunol. 161: 1123-1131. 13. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, M. R. de Waal, and J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U. S. A 90: 3730-3734. 14. Stavnezer, J. 2000. Molecular processes that regulate class switching. Curr. Top. Microbiol. Immunol. 245: 127-168. 15. Good, K. L., V. L. Bryant, and S. G. Tangye. 2006. Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL-21. J. Immunol. 177: 5236-5247. 16. Bryant, V. L., C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, M. R. de Waal, and S. G. Tangye. 2007. Cytokine-mediated regulation of human B cell differentiation into Ig-secreting cells: predominant role of IL-21 produced by CXCR5+ T follicular helper cells. J. Immunol. 179: 8180-8190. 17. Kuchen, S., R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger. 2007. Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J. Immunol. 179: 5886-5896.

71 Chapter 3

18. Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J. Immunol. 173: 68-78. 19. Yu, D., S. Rao, L. M. Tsai, S. K. Lee, Y. He, E. L. Sutcliffe, M. Srivastava, M. Linterman, L. Zheng, N. Simpson, J. I. Ellyard, I. A. Parish, C. S. Ma, Q. J. Li, C. R. Parish, C. R. Mackay, and C. G. Vinuesa. 2009. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity. 31: 457- 468. 20. Fazilleau, N., L. Mark, L. J. McHeyzer-Williams, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells: lineage and location. Immunity. 30: 324-335. 21. Yusuf, I., R. Kageyama, L. Monticelli, R. J. Johnston, D. DiToro, K. Hansen, B. Barnett, and S. Crotty. 2010. Germinal center T follicular helper cell IL-4 production is dependent on signaling lymphocytic activation molecule receptor (CD150). J. Immunol. 185: 190-202. 22. Johnston, R. J., A. C. Poholek, D. DiToro, I. Yusuf, D. Eto, B. Barnett, A. L. Dent, J. Craft, and S. Crotty. 2009. Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science 325: 1006-1010. 23. Linterman, M. A., W. Pierson, S. K. Lee, A. Kallies, S. Kawamoto, T. F. Rayner, M. Srivastava, D. P. Divekar, L. Beaton, J. J. Hogan, S. Fagarasan, A. Liston, K. G. Smith, and C. G. Vinuesa. 2011. Foxp3+ follicular regulatory T cells control the germinal center response. Nat. Med. 17: 975-982. 24. Lu, K. T., Y. Kanno, J. L. Cannons, R. Handon, P. Bible, A. G. Elkahloun, S. M. Anderson, L. Wei, H. Sun, J. J. O’Shea, and P. L. Schwartzberg. 2011. Functional and epigenetic studies reveal multistep differentiation and plasticity of in vitro-generated and in vivo-derived follicular T helper cells. Immunity. 35: 622-632. 25. Crotty, S. 2011. Follicular helper CD4 T cells (TFH). Annu. Rev. Immunol. 29: 621-663. 26. Deenick, E. K., and C. S. Ma. 2011. The regulation and role of T follicular helper cells in immunity. Immunology 134: 361-367. 27. Nakayamada, S., Y. Kanno, H. Takahashi, D. Jankovic, K. T. Lu, T. A. Johnson, H. W. Sun, G. Vahedi, O. Hakim, R. Handon, P. L. Schwartzberg, G. L. Hager, and J. J. O’Shea. 2011. Early Th1 cell differentiation is marked by a Tfh cell-like transition. Immunity. 35: 919-931. 28. Reinhardt, R. L., H. E. Liang, and R. M. Locksley. 2009. Cytokine-secreting follicular T cells shape the antibody repertoire. Nat. Immunol. 10: 385-393. 29. Zaretsky, A. G., J. J. Taylor, I. L. King, F. A. Marshall, M. Mohrs, and E. J. Pearce. 2009. T follicular helper cells differentiate from Th2 cells in response to helminth antigens. J. Exp. Med. 206: 991-999. 30. King, I. L., and M. Mohrs. 2009. IL-4-producing CD4+ T cells in reactive lymph nodes during helminth infection are T follicular helper cells. J. Exp. Med. 206: 1001-1007. 31. Linterman, M. A., and C. G. Vinuesa. 2010. Signals that influence T follicular helper cell differentiation and function. Semin. Immunopathol. 32: 183-196. 32. Morita, R., N. Schmitt, S. E. Bentebibel, R. Ranganathan, L. Bourdery, G. Zurawski, E. Foucat, M. Dullaers, S. Oh, N. Sabzghabaei, E. M. Lavecchio, M. Punaro, V. Pascual, J. Banchereau, and H. Ueno. 2011. Human blood CXCR5(+)CD4(+) T cells are counterparts of T follicular cells and contain specific subsets that differentially support antibody secretion. Immunity. 34: 108-121. 33. Onoda, T., M. Rahman, H. Nara, A. Araki, K. Makabe, K. Tsumoto, I. Kumagai, T. Kudo, N. Ishii, N. Tanaka, K. Sugamura, K. Hayasaka, and H. Asao. 2007. Human CD4+ central and effector memory T cells produce IL-21: effect on cytokine-driven proliferation of CD4+ T cell subsets.Int. Immunol. 19: 1191-1199. 34. Sarra, M., I. Monteleone, C. Stolfi, M. C. Fantini, P. Sileri, G. Sica, R. Tersigni, T. T. Macdonald, F. Pallone, and G. Monteleone. 2010. Interferon-gamma-expressing cells are a major source of interleukin-21 in inflammatory bowel diseases. Inflamm. Bowel. Dis. 16: 1332-1339. 35. McSorley, S. J., and M. K. Jenkins. 2000. Antibody is required for protection against virulent but not

72 The B-T cell network for IL-6 induced IL-21 secretion

attenuated Salmonella enterica serovar typhimurium. Infect. Immun. 68: 3344-3348. 36. Hess, J., C. Ladel, D. Miko, and S. H. Kaufmann. 1996. Salmonella typhimurium aroA- infection in gene- targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. J. Immunol. 156: 3321-3326. 37. de Wit J., Y. Souwer, T. Jorritsma, B. H. Klaasse, B. A. ten, J. Neefjes, and S. M. van Ham. 2010. Antigen- specific B cells reactivate an effective cytotoxic T cell response against phagocytosed Salmonella through cross-presentation. PLoS. One. 5: e13016. 38. Linton, P. J., B. Bautista, E. Biederman, E. S. Bradley, J. Harbertson, R. M. Kondrack, R. C. Padrick, and L. M. Bradley. 2003. Costimulation via OX40L expressed by B cells is sufficient to determine the extent of primary CD4 cell expansion and Th2 cytokine secretion in vivo. J. Exp. Med. 197: 875-883. 39. Ronet, C., H. Voigt, H. Himmelrich, M. A. Doucey, T. Y. Hauyon-La, M. Revaz-Breton, F. Tacchini-Cottier, C. Bron, J. Louis, and P. Launois. 2008. Leishmania major-specific B cells are necessary for Th2 cell 3 r e t p a h C development and susceptibility to L. major LV39 in BALB/c mice. J. Immunol. 180: 4825-4835. 40. Stockinger, B., T. Zal, A. Zal, and D. Gray. 1996. B cells solicit their own help from T cells. J. Exp. Med. 183: 891-899. 41. Macaulay, A. E., R. H. DeKruyff, C. C. Goodnow, and D. T. Umetsu. 1997. Antigen-specific Bcells preferentially induce CD4+ T cells to produce IL-4. J. Immunol. 158: 4171-4179. 42. Barr, T. A., S. Brown, P. Mastroeni, and D. Gray. 2010. TLR and B cell receptor signals to B cells differentially program primary and memory Th1 responses to Salmonella enterica. J. Immunol. 185: 2783-2789. 43. Haynes, N. M., C. D. Allen, R. Lesley, K. M. Ansel, N. Killeen, and J. G. Cyster. 2007. Role of CXCR5 and CCR7 in follicular Th cell positioning and appearance of a programmed cell death gene-1high germinal center- associated subpopulation. J. Immunol. 179: 5099-5108. 44. Linterman, M. A., R. J. Rigby, R. Wong, D. Silva, D. Withers, G. Anderson, N. K. Verma, R. Brink, A. Hutloff, C. C. Goodnow, and C. G. Vinuesa. 2009. Roquin differentiates the specialized functions of duplicated T cell costimulatory receptor genes CD28 and ICOS. Immunity. 30: 228-241. 45. Johnston, R. J., Y. S. Choi, J. A. Diamond, J. A. Yang, and S. Crotty. 2012. STAT5 is a potent negative regulator of TFH cell differentiation. J. Exp. Med. 209: 243-250. 46. Kagaya, K., K. Watanabe, and Y. Fukazawa. 1989. Capacity of recombinant gamma interferon to activate macrophages for Salmonella-killing activity. Infect. Immun. 57: 609-615. 47. Edwards, C. K., III, S. M. Ghiasuddin, L. M. Yunger, R. M. Lorence, S. Arkins, R. Dantzer, and K. W. Kelley. 1992. In vivo administration of recombinant growth hormone or gamma interferon activities macrophages: enhanced resistance to experimental Salmonella typhimurium infection is correlated with generation of reactive oxygen intermediates. Infect. Immun. 60: 2514-2521. 48. Hamaoka, T., and S. Ono. 1986. Regulation of B-cell differentiation: interactions of factors and corresponding receptors. Annu. Rev. Immunol. 4: 167-204. 49. Romagnani, S. 1991. Type 1 T helper and type 2 T helper cells: functions, regulation and role in protection and disease. Int. J. Clin. Lab Res. 21: 152-158. 50. Ma, C. S., S. Suryani, D. T. Avery, A. Chan, R. Nanan, B. Santner-Nanan, E. K. Deenick, and S. G. Tangye. 2009. Early commitment of naive human CD4(+) T cells to the T follicular helper (T(FH)) cell lineage is induced by IL-12. Immunol. Cell Biol. 87: 590-600. 51. Vogelzang, A., H. M. McGuire, D. Yu, J. Sprent, C. R. Mackay, and C. King. 2008. A fundamental role for interleukin-21 in the generation of T follicular helper cells. Immunity. 29: 127-137. 52. Nurieva, R. I., Y. Chung, D. Hwang, X. O. Yang, H. S. Kang, L. Ma, Y. H. Wang, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2008. Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages. Immunity. 29: 138-149. 53. Eto, D., C. Lao, D. DiToro, B. Barnett, T. C. Escobar, R. Kageyama, I. Yusuf, and S. Crotty. 2011. IL-21 and IL-6

73 Chapter 3

are critical for different aspects of B cell immunity and redundantly induce optimal follicular helper CD4 T cell (Tfh) differentiation. PLoS. One. 6: e17739. 54. Ettinger, R., S. Kuchen, and P. E. Lipsky. 2008. The role of IL-21 in regulating B-cell function in health and disease. Immunol. Rev. 223: 60-86. 55. Constant, S. L. 1999. B lymphocytes as antigen-presenting cells for CD4+ T cell priming in vivo.J. Immunol. 162: 5695-5703. 56. Kurt-Jones, E. A., D. Liano, K. A. HayGlass, B. Benacerraf, M. S. Sy, and A. K. Abbas. 1988. The role of antigen-presenting B cells in T cell priming in vivo. Studies of B cell-deficient mice.J. Immunol. 140: 3773- 3778. 57. Crawford, A., M. Macleod, T. Schumacher, L. Corlett, and D. Gray. 2006. Primary T cell expansion and differentiation in vivo requires antigen presentation by B cells. J. Immunol. 176: 3498-3506. 58. Mastroeni, P., and N. Menager. 2003. Development of acquired immunity to Salmonella. J. Med. Microbiol. 52: 453-459. 59. Pepper, M., and M. K. Jenkins. 2011. Origins of CD4(+) effector and central memory T cells.Nat. Immunol. 12: 467-471. 60. Jenkins, M. K., E. Burrell, and J. D. Ashwell. 1990. Antigen presentation by resting B cells. Effectiveness at inducing T cell proliferation is determined by costimulatory signals, not T cell receptor occupancy. J. Immunol. 144: 1585-1590. 61. Spörri, R., N. Joller, U. Albers, H. Hilbi, and A. Oxenius. 2006. MyD88-dependent IFN-gamma production by NK cells is key for control of Legionella pneumophila infection. J. Immunol. 176: 6162-6171. 62. Yi, J. S., M. Du, and A. J. Zajac. 2009. A vital role for interleukin-21 in the control of a chronic viral infection. Science 324: 1572-1576. 63. Kindler, V., and R. H. Zubler. 1997. Memory, but not naive, peripheral blood B lymphocytes differentiate into Ig-secreting cells after CD40 ligation and costimulation with IL-4 and the differentiation factors IL-2, IL-10, and IL-3. J. Immunol. 159: 2085-2090. 64. Tangye, S. G., D. T. Avery, E. K. Deenick, and P. D. Hodgkin. 2003. Intrinsic differences in the proliferation of naive and memory human B cells as a mechanism for enhanced secondary immune responses. J. Immunol. 170: 686-694. 65. Arpin, C., J. Dechanet, K. C. Van, P. Merville, G. Grouard, F. Briere, J. Banchereau, and Y. J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268: 720-722. 66. Ettinger, R., G. P. Sims, A. M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky. 2005. IL-21 induces differentiation of human naive and memory B cells into antibody-secreting plasma cells. J. Immunol. 175: 7867-7879. 67. Mastroeni, P., A. Vazquez-Torres, F. C. Fang, Y. Xu, S. Khan, C. E. Hormaeche, and G. Dougan. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. II. Effects on microbial proliferation and host survival in vivo. J. Exp. Med. 192: 237-248. 68. Mastroeni, P., B. Villarreal-Ramos, and C. E. Hormaeche. 1992. Role of T cells, TNF alpha and IFN gamma in recall of immunity to oral challenge with virulent salmonellae in mice vaccinated with live attenuated aro- Salmonella vaccines. Microb. Pathog. 13: 477-491. 69. Choi, Y. S., R. Kageyama, D. Eto, T. C. Escobar, R. J. Johnston, L. Monticelli, C. Lao, and S. Crotty. 2011. ICOS receptor instructs T follicular helper cell versus effector cell differentiation via induction ofthe transcriptional repressor Bcl6. Immunity. 34: 932-946. 70. Schmitt, N., R. Morita, L. Bourdery, S. E. Bentebibel, S. M. Zurawski, J. Banchereau, and H. Ueno. 2009. Human dendritic cells induce the differentiation of interleukin-21-producing T follicular helper-like cells through interleukin-12. Immunity. 31: 158-169. 71. Wei, L., A. Laurence, K. M. Elias, and J. J. O’Shea. 2007. IL-21 is produced by Th17 cells and drives IL-17

74 The B-T cell network for IL-6 induced IL-21 secretion

production in a STAT3-dependent manner. J. Biol. Chem. 282: 34605-34610. 72. Ma, C. S., D. T. Avery, A. Chan, M. Batten, J. Bustamante, S. Boisson-Dupuis, P. D. Arkwright, A. Y. Kreins, D. Averbuch, D. Engelhard, K. Magdorf, S. S. Kilic, Y. Minegishi, S. Nonoyama, M. A. French, S. Choo, J. M. Smart, J. Peake, M. Wong, P. Gray, M. C. Cook, D. A. Fulcher, J. L. Casanova, E. K. Deenick, and S. G. Tangye. 2012. Functional STAT3 deficiency compromises the generation of human T follicular helper cells. Blood. 73. de Wit, J., Y. Souwer, A. J. van Beelen, G. R. de, F. J. Muller, B. H. Klaasse, T. Jorritsma, M. L. Kapsenberg, E. C. de Jong, and S. M. van Ham. 2011. CD5 costimulation induces stable Th17 development by promoting IL-23R expression and sustained STAT3 activation. Blood 118: 6107-6114. 74. Souwer, Y., A. Griekspoor, T. Jorritsma, W. J. de, H. Janssen, J. Neefjes, and S. M. van Ham. 2009. B cell receptor-mediated internalization of salmonella: a novel pathway for autonomous B cell activation and antibody production. J. Immunol. 182: 7473-7481. 3 r e t p a h C

75

IL-21 limits T helper effector cell differentiation by antagonizing IL-2 signaling 4

Jelle de Wit, Tineke Jorritsma, Hanny Klaasse Bos, Jacques Neefjes and S. Marieke van Ham

manuscript in preparation Chapter 4

Abstract

Follicular T helper cells (Tfh) provide B cell help to generate long-lived humoral immunity. Opposing signals from the antagonists Bcl-6 and BLIMP-1 drive differentiation of CXCR5+/ Bcl-6hi Tfh versus CXCR5-/BLIMP-1hi non-Tfh effector cells. High IL-2R signaling induces BLIMP-1 and leads to effector cell formation. B cells favor Tfh development, but the key regulators remain poorly defined. Using Salmonella-infected human B cells, we show that the Tfh cytokine IL-21 regulates the contraction phase of activated CD4+ T cells. IL- 21 counteracts effector cell formation through inhibition of endogenous IL-2 synthesis and subsequent downmodulation of T-bet and BLIMP-1. Expression of T-bet and BLIMP-1 and secretion of Th1 and Tfh effector cytokines were rescued by exogenous IL-2 in the presence of antigen-presenting B cells. Thus, IL-21 targets the IL-2/BLIMP axis upon CD4+ T cell activation, whereby the fate of the activated T cell pool is regulated by the balance between locally available IL-2 and IL-21. We define a regulatory function of IL-21 that may control T cell activation and prevents uncontrolled inflammatory responses in lymph nodes.

78 Regulatory role of IL-21 and IL-2 in T helper effector function

Introduction

Effective antibody responses are critical for clearance of bacterial infection andoften dependent on T cell help. Upon activation by pathogens, B and T cells migrate to secondary lymphoid tissues and both reside temporarily at the border of the B and T cell zones.1-4 Here, activated CD4+ T cells provide survival signals to antigen-presenting B cells via CD40 costimulation and cytokines.1 This results in further B cell differentiation, germinal center formation and production of high affinity, class switched antibodies. IL-21 producing follicular T helper (Tfh) cells provide specialized help to B cells5, 6 by enhancing B cell expansion, class switching and plasma cell differentiation.7-10 Vice versa, a picture is emerging that B cells are essential for Tfh differentiation and the regulation of CD4+ memory responses.11 This may be explained by the fact that after 3 to 4 days of T cell activation antigen-specific DCs probably die in the lymph nodes and B cells become 4 r e t p a h C the primary APCs. Strong, clonal expansion of antigen-specific B cells and colocalization of activated B and T cells provide excellent conditions for B-cell mediated regulation of T cell fate.11 The molecular pathways by which B cells regulate CD4+ T cell differentiation remain poorly defined. Tfh cells express the transcription factor Bcl-6, which induces CXCR5 for Tfh migration near or into the B cell areas of the lymph node.2, 12, 13 Tfh cells share characteristics with central memory T cells (Tcm), that also express Bcl-6 andCXCR5 and also reside at the B-T cell border. In contrast, effector memory cells (Tem) arise from effector cells that express the transcription factor BLIMP-1. Bcl-6 and BLIMP-1 are mutually antagonistic,14 but may be coexpressed at certain levels (ref 15 and de Wit, Jorritsma, Klaasse Bos, Souwer, Neefjes, van Ham; Human Salmonella-specific B cells solicit optimal T cell aid by IL-6 dependent induction of IL-21 in plastic CD4+ Th cells, manuscript in preparation). It is clear that B cells and costimulation via ICOS is needed for Tfh and Tcm formation for induction of Bcl-6.16, 17 Next to the ICOS/Bcl-6 pathway, IL-2R signaling is also involved in the bifurcation between Tfh versus non-Tfh effector cell differentiation.17-19 Low IL-2R signaling favors Tfh differentiation. Strong IL-2R signaling activates STAT5 which induces BLIMP-1 and non-Tfh effector cell formation. BLIMP-1 forms a negative feedback loop, inhibiting endogenous IL-2 transcription.20, 21 IL-2 mediated induction of BLIMP-1 was described to repress Bcl- 6.18, 22 In mice expression of the high affinity IL-2Rα chain is significantly lower in CXCR5+ cells, compared to the CXCR5- population, confirming the negative role of IL-2 for Tfh generation.18, 23 Almost nothing is known about the regulation of Tfh differentiation by IL-2 in human. As ICOS does not induce IL-2,24 the regulation of the IL-2/BLIMP-1 axis in CD4+ T cell differentiation remains to be elucidated.

79 Chapter 4

On resting CD4+ T cells, the IL-2R consist of the low affinity IL-2Rβ and the common 25, 26 γ-chain (γc). Upon T cell activation the high affinity IL-2Rα (CD25) is expressed. IL- 2Rα expression is maintained by IL-2R signaling via STAT5 activation.27 Most IL-2 is produced within a few hours of CD4+ T cell activation and remains high during a few days. Upon cognate interaction, IL-2 enhances the secondary phase of T cell expansion and differentiation into cytokine-secreting effector cells.28-30 26, 31 A possible candidate in the regulation of the IL-2/BLIMP-1 axis in CD4+ T cell differentiation is IL-21. IL-21 has been implicated in T cell contraction and also plays a role in Tfh formation, as IL-21-/- mice show reduced Tfh frequencies.16, 32-34 Moreover, IL-21 was named in Tfh maintenance.2 We previously demonstrated that upon Salmonella-infection, human B cells can drive production of IL-21 in activated CD4+ T cells (de Wit, Jorritsma, Klaasse Bos, Souwer, Neefjes, van Ham; Human Salmonella-specific B cells solicit optimal T cell aid by IL-6 dependent induction of IL-21 in plastic CD4+ Th cells, manuscript in preparation). In this study, we show that effector cell differentiation of both naive and memoryT cells is severely attenuated by IL-21 in absence of exogenous IL-2. We show that IL-21 inhibits endogenous IL2 transcription leading to reduced IL-2Rα expression, contraction of the T cell pool and downmodulated T-bet and BLIMP-1. Exogenous IL-2 overrules the suppressive effect of IL-21 and restores effector cell formation. IL-21 thus provides a negative feedback signal that prevents unbridled expansion of effector T cells.

Materials and methods

Antibodies mAb anti-human IgM (MH15, Sanquin, Amsterdam, The Netherlands) was mixed with rat anti-mouse IgG1 antibody (RM161.1, Sanquin) and mAb anti-S. typhimurium LPS (1E6, Biodesign International, Kennebunk, ME) to generate BCR-LPS tetrameric antibody complexes, used to coat bacteria as previously described.42 The following labeled anti- human mAbs were obtained from BD Biosciences (San Jose, CA): anti-IFN-γ, anti-IL-4, and anti-CD4. Anti-IL-21 and was obtained from eBioscience and DAPI from Sigma-Aldrich (Steinheim, Germany). CFSE (Invitrogen, Paisley, UK) labeling was used in proliferation assays.

Bacterial growth conditions S. typhimurium SL1344 and GFP-Salmonella were grown in Luria-Bertani (LB) broth with carbenicillin (Sigma-Aldrich, St Louis, MO) to maintain GFP expression. Bacteria were cultured overnight at 37°C while shaking, subcultured at a dilution of 1:33 in fresh LB

80 Regulatory role of IL-21 and IL-2 in T helper effector function media, and incubated at 37°C while shaking for 3 hours to obtain exponentially growing bacteria. For coating, bacteria were washed twice with PBS and incubated with BCR-LPS tetrameric antibody complexes for 30 minutes at room temperature and washed twice with PBS to remove unbound antibodies.

Lymphocyte isolation Human PBMCs were isolated by centrifugation on a Ficoll-Hypaque gradient (Axis- Shield PoC AS, Oslo, Norway) from a buffycoat obtained from healthy donors (Sanquin). All donors provided written informed consent in accordance with the protocol of the local institutional review board, the Medical Ethics Committee of Sanquin Blood Supply (Amsterdam, The Netherlands), and the Medical Ethics Committee of Sanquin approved the study. B and T cells were subsequently purified using anti-CD19 and anti-CD4 Dynabeads and DETACHaBEAD (Invitrogen), according to the manufacturer’s instructions. 4 r e t p a h C From CD4+ T cells, untouched naive CD4+ T cells (CD4+CD45RO-) were purified via MACS isolation kit using CD45RO-PE (Sanquin) and anti-PE beads (Miltenyi Biotech, Bergisch Gladbach, Germany). Untouched memory CD4+ T cells were isolated via MACS isolation using CD45RA-PE (Sanquin) and anti-PE beads. Populations were >98% purified.

Salmonella infection B lymphocytes were incubated for 45 minutes at 37°C with Salmonella without antibiotics. Next, cells were washed to remove unbound bacteria four times and cultured for 1 hour in medium containing 100 µg/ml gentamycin (Invitrogen) to eliminate non-phagocytosed bacteria. Cells were washed and cultured in RPMI 1640 medium w/o phenol red (Gibco), supplemented with 5% FCS (Bodinco, Alkmaar, The Netherlands), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine (Invitrogen), 50 μM 2-ME, 20 μg/ml human apo-transferrin ((Sigma-Aldrich), depleted for human IgG with protein G sepharose (Amersham, Uppsala, Sweden)) and 10 µg/ml gentamycin. 1x105 Salmonella-infected cells were cultured with 5x104 CD4+ T cells. The following cytokines were added when described: IL-21 (50 ng/ml; Invitrogen) and IL-2 (10 U/mL, Chiron, Emeryville, USA). 20,000 events were acquired on a LSR II (BD) and analyzed with FlowJo (v7.6.5 Treestar Inc.).

ELISA assays To determine IgM and IgG levels in culture supernatants, flat bottom MaxiSorb plates (Nunc, Roskilde, Denmark) were coated with polyclonal anti-IgM (SH15, Sanquin) or anti-IgG (MH-16, Sanquin) in 100 μl PBS, overnight at room temperature. Plates were

81 Chapter 4

washed with PBS/0.02%Tween-20 (Mallinckrodt Baker, Deventer, the Netherlands). After washing, samples were incubated for 2 hours in high performance ELISA buffer (HPE, Sanquin). As a standard, pooled human serum was used. Plates were washed and incubated for 1 hour with 1 μg/ml mAb anti-IgM-HRP (MH15-HRP, Sanquin) or anti-IgG (MH16-1-HRP, Sanquin). After washing, peroxidase activity was visualized by incubation with 100 μl 3,5,3’,5’-tetramethylbenzidine (Merck, Darmstadt, Germany), 100 μg/ml in

0.11 M Na-acetate, pH 5.5, containing 0.003% H2O2 (Merck). The reaction was stopped

by addition of an equal volume of 2M H2SO4 (Merck) and the absorbance at 450 nm and 540 nm was measured immediately in a Titertek plate reader.

Flow cytometry Proliferation was measured after 6 days of by culture of CFSE labeled B and T cells. DAPI was used to analyze living cells. To study T cell polarization, B cells and T cells were cultured for 11 days. Cytokine production was measured by intracellular staining after restimulation with 0.1 µg/ml PMA, 1 µg/ml ionomycin and 10 µg/ml brefeldin A (Sigma- Aldrich) for 5 hours. Cells were washed twice with PBS, fixed with 4% paraformaldehyde (Merck, Darmstadt, Germany) for 15 minutes and after washing with PBS and PBS containing 1% BSA (Sigma-Aldrich), permeabilized with 0.5% saponin (Calbiochem, CA) in PBS containing 1% BSA and incubated with fluorescent antibodies for 30 minutes at room temperature. 20,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD).

RNA isolation, cDNA synthesis and real-time semi-quantitative RT-PCR RT-PCR has been described before.42 Briefly, RNA was reverse transcribed to cDNA using random hexamers in combination with Superscript II and a RNase H-reverse transcriptase kit. Primers for 18S rRNA, IL2, IL2RA, IL2RB, IL2RG, IL21R, TBX21, and PRDM1 were developed to span exon-intron junctions to prevent amplification of genomic DNA (primer sets in supplemental Table 1). Primers were validated on cDNA of total CD4+ T cells. Product specificity of each primer set was verified by agarose gel electrophoresis and sequence analysis of the amplified PCR product. Gene expression levels were measured in triplicate reactions for each sample in the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR green method (Applied Biosystems). All results were normalized to the internal control 18S rRNA, and are expressed relative to the expression levels found in naive CD4+ T cells stimulated with Salmonella-infected B cells at day 3.

82 Regulatory role of IL-21 and IL-2 in T helper effector function

Statistical analysis Statistical differences were determined by a paired Student’s t test, using GraphPad Prism (version 5.01, GraphPad Software, San Diego, CA).

Results

IL-21 and IL-2 enhance B cell proliferation and antibody secretion Previously we showed that human Salmonella-infected B cells induce prominent IL-21- secretion in activated CD4+ T cells, resulting in optimal B cell help for antibody secretion. Enhanced antibody secretion was mediated by the Tfh key cytokine, IL-21. Blocking IL- 21 reduced antibody secretion, whereas extra IL-21 enhanced antibody levels (ref7, 35 and Figure 1A and C). Now we studied the effect of IL-21 and IL-2 on B and T cell 4 r e t p a h C proliferation and help in antibody secretion. Addition of IL-2 resulted in significant induction of both IgM and IgG secretion by Salmonella-infected B cells (Figure 1A). When IL-2 and IL-21 were combined, a strong synergy was observed both in antibody production and B cell proliferation. Thus, the presence of both IL-21 and IL-2 strongly

Figure 1. IL-21 and IL-2 enhance B cell proliferation and antibody secretion. (A) Salmonella-infected B cells were cultured in absence or presence of IL-21, IL-2 or both. Antibody secretion was measured at day 12. Data are mean + SEM from 19 experiments with different donors. (B) B cells were cultured as described in A and proliferation was measured at day 6. Data are mean + SEM from six experiments with different donors. (C) Salmonella-infected B cells were cocultured with autologous CD4+ T helper cells, in absence of presence of IL-21, IL-2 or both. Antibody secretion was measured at day 12. Data are mean + SEM from 19 experiments with different donors.(D) Proliferation of B cells, described in C, was measured at day 6. Data are mean + SEM from nine experiments with different donors.

83 Chapter 4

contribute to B cell differentiation. Coculture with autologous T cells strongly enhanced both IgM and IgG production and B cell proliferation (Figure 1B and 1D). When either IL-21 or IL-2 was added, IgM secretion was not longer enhanced, but both conditions slightly enhanced IgG production (Figure 1C). IL-2 in combination with IL-21 still strongly synergistically enhanced both IgM and IgG secretion. Proliferation of B cells in coculture

Figure 2. IL-21 negatively regulates Th skewing and proliferation. (A-C) Salmonella infected B cells were cocultured with total CD4+ T cells (A), naive CD4+ T cells (B) or memory CD4+ T cells (C), in absence or presence of IL-21. T cell polarization was measured at day 11. Data are mean + SEM from 12 (total CD4+ T cells) or at least four (naive and memory CD4+ T cells) experiments with different donors.(D-F) Proliferation of CFSE labeled CD4+ T cells (total, naive or memory) after six days of coculture with Salmonella-infected B cells in presence of IL-21. Data are from one representative experiment, of 10 experiments using different donors. (E-F) Percentages of CD4+ T cells in the proliferating gate of n=10 are shown as mean + SEM in E and MFI of proliferating cells of n=2 are shown as mean + SEM in F. (G) Proliferating CD4+ T cells were measured at day 11, of cultures described in D. Data shown are representative for two experiments using different donors. Percentages of CD4+ T cells in the proliferating gate (H) or MFI of proliferating cells (I) of n=2 are combined and shown as mean + SEM.

84 Regulatory role of IL-21 and IL-2 in T helper effector function with autologous T cells was differentially regulated in presence of extra IL-21 and IL-2 (Figure 1D). Addition of IL-21 reduced B cell proliferation by 40%, while addition of IL-2 enhanced B cell proliferation slightly. The combination of exogenous IL-21 and IL-2 resulted in an increase in B cell proliferation up to 32% of proliferated B cells. Thus, in absence of T cells, IL-21 and IL-2 have a positive effect on B cells and enhance antibody secretion and proliferation. In presence of T cells, IL-21 still enhances IgG secretion, but B cell proliferation is reduced. Addition of IL-2 overrules the reduction in B cell proliferation and becomes a synergizing factor to stimulate antibody secretion even further.

IL-21 limits late phase T cell expansion and negatively regulates effector T cell formation The opposite effect of IL-21 and IL-2 on T cell-dependent B cell proliferation could result from altered T helper cell differentiation, which would affect T cell help to B cells. Previously, we demonstrated that in the presence of exogenous IL-2 Salmonella-infected 4 r e t p a h C B cells induce preferential CD4+ T cell polarization towards IL-21 and IFN-γ producing subsets with only limited outgrowth of IL-4 producing T cells (de Wit, Jorritsma, Klaasse Bos, Souwer, Neefjes, van Ham; Human Salmonella-specific B cells solicit optimal T cell aid by IL-6 dependent induction of IL-21 in plastic CD4+ Th cells, manuscript submitted). Strikingly, in absence of exogenous IL-2 addition of IL-21 to the coculture of Salmonella B cells and CD4+ T cells strongly inhibited outgrowth of Th1, Tfh and Th2 effector cells (Figure 2A). When investigating naive T cell priming and reactivation of memory cells separately, addition of IL-21 decreased Th1, Tfh and Th2 effector cell differentiation during naive T cell priming (Figure 2B), and Th1 and Tfh expansion of reactivated memory T cells (Figure 2C). Th2 effector cell expansion of reactivated memory T cells was not affected by IL-21. We next investigated in which phase of T cell differentiation IL-21 showed its most prominent regulatory effect. During the first six days of naive T cell priming IL-21 induced a slightly higher cell division rate, as demonstrated by a lower MFI of CFSE- labeled dividing cells, but this did not result in more cells in the proliferating gate (Figure 2D and E). Memory T cell proliferation at day 6 was enhanced by IL-21, both in absolute cell number and in division rate (Figure 2D and F). When analyzed at later stages of T cell differentiation, exogenous IL-21 strongly decreased the number of proliferating cells at day 11, in both naive and memory T cells (Figure 2G and H) without affecting division rate, demonstrating that IL-21 promoted contraction of the activated T cells in the second phase of T cell differentiation.

Exogenous IL-2 overcomes negative regulatory effect of IL-21 on effector cell differentiation Since IL-2 enhances T cell expansion in the second phase of T cell activation, we

85 Chapter 4

investigated if IL-2 could overcome the negative regulation by IL-21. Addition ofIL-2 alone showed no effect on naive T cell proliferation (Figure 3C and D, left). IL-2 could

Figure 3. Exogenous IL-2 recovers the IL-21 decrease in T cell proliferation. Salmonella-infected B cells were cocultured with CFSE labeled total (A and B), naive (C and D) or memory (E and F) CD4+ T cells, in absence (no cyto) or presence of IL-21, IL-2 or both. IL-2 was added either directly at the start of the culture, or at day 6 and day 8. Proliferation was determined at day 6 and day 11 of culture. Data shown are representative (A, C, and E) of two experiments with different donors. (B, D, and F) Percentage of CD4+ T cells in the proliferating gate at day 6 (left) or day 11 (right) of n=2 were combined in a graph and shown as mean + SEM.

86 Regulatory role of IL-21 and IL-2 in T helper effector function partially restore the negative effects of IL-21 both in early and late phase of T cell priming (Figure 3C and D, right). Even addition of IL-2 only during the second phase of T cell priming (day 6 and day 8) was sufficient to rescue T cell proliferation from the negative effects of exogenous IL-21 (Figure 3D, right). Extra IL-2 during reactivation of memory cells further enhanced IL-21 mediated proliferation of T cells during the first phase of activation, whereas IL-2 alone had no added effect (Figure 3E and F). In the second phase, IL-2 completely restored the IL-21-mediated inhibition of T cell proliferation, even when added only at day 6 and 8. Thus, the presence of IL-2 in the second phase of CD4+ T cell differentiation is enough to counteract the constraint of IL-21 on T cell proliferation. Since IL-2 can overcome the negative regulation of IL-21 on T cell proliferation, does IL-2 also rescue effector T cell differentiation? Again, Salmonella-infected B cells were cocultured with either naive or memory T cells, in absence or presence of IL-21. IL-2 was added at the start of culture, or later in time, at day 6 and day 8. Addition of IL-2 alone had 4 r e t p a h C limited effects on naive T cell differentiation. In combination with IL-21, the addition of IL-2 indeed restored differentiation of naive T cells towards Th1 and Tfh effector cells (Figure 4A), irrespective if IL-2 was added early or late during priming. In contrast, the IL-21 mediated decrease in Th2 effector cell formation was not restored by IL-2. Upon memory T cell reactivation, IL-2 itself showed a trend towards enhanced effector T cell

Figure 4. IL-21 mediated decrease in T cell polarization is restored by early or late IL-2. Salmonella-infected B cells were cocultured with naive (A) or memory (B) CD4+ T cells, in absence or presence of IL-21, and/or IL-2 added either at the start of the culture, or at day 6 and day 8. CD4+ T cell polarization was measured at day 11. Data shown are from at least four different experiments using different donors (mean + SEM).

87 Chapter 4

expansion of all subsets when added later in culture. Addition of IL-2 during the second phase of T cell reactivation almost completely restored Th1 effector cell formation and partially rescued Tfh effector cell differentiation. As seen with naive T cell differentiation, IL-2 could not restore expansion of Th2 effector cells upon reactivation of memory T cells. Thus, IL-2 not only neutralizes the negative effects of IL-21 on proliferation, but also restores the IL-21-mediated block on effector T cell differentiation.

IL-21 affects effector cell differentiation by inhibiting IL-2 and subsequent BLIMP-1 expression To investigate whether IL-21 has a inhibitory effect on endogenous IL-2 production by in activated CD4+ T cells, T cells were sorted from a coculture with Salmonella-infected B cells at different time points, and mRNA levels of IL-2 were determined. In absence of extra cytokines, IL2 transcription in naive T cells was upregulated in time (Figure 5A). IL-21 completely abolished endogenous IL2 transcription (Figure 5A). In addition, transcription of IL2RA was also strongly attenuated (Figure 5B), while IL2RB transcription was only

slightly reduced, and only showed lower mRNA levels at day 11 (Figure 5C). IL2RG (γc) expression was not affected (Figure 5D). These data are in line with the fact that IL-2 expression levels strongly regulate IL2RA transcription while moderately upregulating IL2RB.36 In contrast, IL21R transcription in naive T cells was increased by exogenous IL-21 (Figure 5E), already at day 3 of T cell activation and remained high over time. Memory

Figure 5. IL-21 decreases IL-2 and IL-2R transcription. Salmonella-infected B cells were cocultured with naive (A-E) or memory (F-J) CD4+ T cells, in absence or presence of IL-21. Relative expression of IL2 (A and F), IL2RA (B and G), IL2RB (C and H), IL2RG (D and I) and IL21R (F and J) mRNA compared tot 18S mRNA was measured in CD4+ T cells that were isolated by FACS sorting from the cocultures at day 3, day 6 and day 11. Data are mean + SEM of a duplicate measurement of one experiment. mRNA levels are expressed relative to naive CD4+ T cells stimulated by Salmonella-infected B cells, at day 3.

88 Regulatory role of IL-21 and IL-2 in T helper effector function

T cells were similarly affected by addition of IL-21 (Figure 5F-I). IL2 as well as IL2RA transcription were decreased by extra IL-21 (Figure 5F and G), although less compared to naive T cells. Transcription of the low affinity IL2RB was not affected by IL-21 in memory cells (Figure 5H). The mRNA levels of IL-21R were less upregulated compared to naive T cells, but still showed a small increase upon addition of IL-21 (Figure 5J). Thus, IL-21 inhibits IL-2 production and IL-2R signaling during priming of naive CD4+ T cells and upon reactivation of memory CD4+ T cells. The addition of IL-21 decreases both IL2 and IL2RA transcription in naive and memory T cells. However, IL2RA transcription is regulated by IL-2 signaling itself. The question remains, if IL-21 inhibits only IL2 transcription or also directly IL2RA. To address this question, we analyzed sorted T cells that were activated by Salmonella-infected B cells. The presence of IL-21 again inhibited IL2 (Figure 6A) and IL2RA transcription (Figure 6B). However, whereas exogenous IL-2 could not restore endogenous IL2 transcription, IL2RA 4 r e t p a h C levels were restored at day 6. The mRNA levels at day 11 were somewhat decreased, probably by consumption of all exogenous IL-2. IL2RB and IL21R remain more or less stable (Figure 6C and D). This implies that in absence of exogenous IL-2, IL-21 targets IL2 transcription, leading to downmodulated IL2RA transcription. IL-2 signaling via STAT5 induces T-bet and BLIMP-1. In concordance, in the absence of IL-2, IL-21 also downmodulated transcription of TBX21 (the gene encoding T-bet; Figure 6E) and PRDM1 (the gene encoding BLIMP-1; Figure 6F) in the second phase of T cell differentiation.

Figure 6. IL-21 inhibits IL-2 and subsequently BLIMP-1 transcription. CD4+ T cells were cocultured with Salmonella-infected B cells, in absence or presence of IL-21 or IL-21 and IL-2. Expression of IL2 (A), IL2RA (B), IL2RB (C), IL21R (D), TBX21 (E) and PRDM1 (F) mRNA compared tot 18S mRNA was measured in CD4+ T cells that were isolated by FACS sorting from the cocultures at day 3, day 6 and day 11. Data are mean + SEM of a duplicate measurement of one experiment. Expression levels are expressed relative to CD4+ T cells, cultured with non-infected B cells, at day 3.

89 Chapter 4

Taken together, these data show that IL-21 inhibits endogenous IL-2 production, resulting in decreased IL-2 dependent BLIMP-1 expression which inhibits full effector T cell differentiation and limits the size of the activated T cell pool.

Discussion

With the discovery of follicular T helper cells, a new subset was described that was capable to migrate into the B cell follicles by CXCR5 expression, and provide B cell help via IL-21 secretion. Little is known about the induction and maintenance of this Tfh subset, as well as the regulation of this Tfh subset inside the B cell follicle. The Tfh cytokine IL-21 has been associated with autoimmunity and elevated T cell apoptosis.37 Retraction of effector T cells after clearance of infection is of great importance to prevent autoimmunity and return to homeostasis. Moreover, since regulatory T cells do not express CXCR5, they are unable to migrate into the B cell follicle to dampen the immune response after infection. We here showed that a balance between IL-21 and IL-2 signaling determines the fate of the Th response. Cytokines play a role in the degree of contraction after antigen withdrawal.31 Although IL-21 has been described to maintain Tfh phenotype,2 we observed that an excess of IL-21 inhibits T cell expansion and attenuates the production of Th effector cytokines. We demonstrated that IL-21 suppresses autologous IL2 transcription, resulting in an impaired IL-2Rα expression. Lower expression of IL-2Rα has been associated before with IL-21 secreting Tfh cells.19 T cell expansion and effector function are decreased by IL-21, probably as a result of reduced IL-2 signaling since additional IL-2 could restore these effects. Suboptimal IL-2 signaling was shown before to impair T cell expansion.31 Hence, IL-21 induces self-destruction of Tfh cells. In addition, non-Tfh cells might also receive IL- 21 signaling at the border of the B-T cell zone, where IL-21 induces T cell contraction. IL-2 signaling can prevent IL-21 induced Tfh self-destruction. This renders Tfh cells growing in the presence of IL-21 highly dependent on (exogenous) IL-2. If autologous IL-2 secretion is reduced at the second stage of T cell activation,25 IL-21 can strongly enhance contraction of T cells. IL-21 can also influence T cell memory development. Generation of Tem highly depends on IL-2.25, 36, 38, 39 Since IL-21 reduces IL2 transcription, it might also favor Tcm formation, rather than Tem. This can only be concluded when we have more insight in the effects of IL-21 on Tem and Tcm development. IL-21 may also induce Tfh cells. Tfh differentiation requires expression of the transcription factor Bcl-6, via ICOS or other signaling.16, 34, 40, 41 Since IL-2 activation of STAT5 negatively

90 Regulatory role of IL-21 and IL-2 in T helper effector function influences Tfh differentiation,18 IL-2 signaling has to be repressed. IL-21 might directly inhibit IL2 transcription, or via early transient expression of BLIMP-1. BLIMP-1 inhibits IL2 transcription and thereby also represses its own transcription.20, 21 This may involve IL-21 signaling via STAT3, but this part of the cytokine network is as yet unclear. In conclusion, we propose a model in which IL-21 regulates immune responses by controlling a cytokine negative feedback loop to downmodulate T cell effector functions and enhance T cell constriction. First, CXCR5+ Tfh cells producing IL-21 are found in the germinal center, to support B cells in antibody production and class switching in response to an infection. After clearance of infection and following B cell migration fromthe germinal center, IL-21 now causes contraction of effector cells and prevents uncontrolled inflammatory responses.

Acknowledgements 4 r e t p a h C

We are grateful to Erik Mul and Floris van Alphen for excellent FACS sorting. We thank Lucien Aarden for helpful discussions. This work was supported by grants from the Landsteiner Foundation for Blood Research (LSBR, grant 0533) and Sanquin Blood Supply PPOC (PPOC 09-032).

91 Chapter 4

References

1. Okada, T., M. J. Miller, I. Parker, M. F. Krummel, M. Neighbors, S. B. Hartley, A. O’Garra, M. D. Cahalan, and J. G. Cyster. 2005. Antigen-engaged B cells undergo chemotaxis toward the T zone and form motile conjugates with helper T cells. PLoS. Biol. 3: e150. 2. Linterman, M. A., and C. G. Vinuesa. 2010. Signals that influence T follicular helper cell differentiation and function. Semin. Immunopathol. 32: 183-196. 3. Moser, B., and P. Loetscher. 2001. Lymphocyte traffic control by chemokines. Nat. Immunol. 2: 123-128. 4. Ansel, K. M., L. J. McHeyzer-Williams, V. N. Ngo, M. G. McHeyzer-Williams, and J. G. Cyster. 1999. In vivo- activated CD4 T cells upregulate CXC chemokine receptor 5 and reprogram their response to lymphoid chemokines. J. Exp. Med. 190: 1123-1134. 5. Breitfeld, D., L. Ohl, E. Kremmer, J. Ellwart, F. Sallusto, M. Lipp, and R. Forster. 2000. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp. Med. 192: 1545-1552. 6. Crotty, S. 2011. Follicular helper CD4 T cells (TFH). Annu. Rev. Immunol. 29: 621-663. 7. Good, K. L., V. L. Bryant, and S. G. Tangye. 2006. Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL-21. J. Immunol. 177: 5236-5247. 8. Avery, D. T., V. L. Bryant, C. S. Ma, M. R. de Waal, and S. G. Tangye. 2008. IL-21-induced isotype switching to IgG and IgA by human naive B cells is differentially regulated by IL-4. J. Immunol. 181: 1767-1779. 9. Bryant, V. L., C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, M. R. de Waal, and S. G. Tangye. 2007. Cytokine-mediated regulation of human B cell differentiation into Ig-secreting cells: predominant role of IL-21 produced by CXCR5+ T follicular helper cells. J. Immunol. 179: 8180-8190. 10. Kuchen, S., R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger. 2007. Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J. Immunol. 179: 5886-5896. 11. Lund, F. E., and T. D. Randall. 2010. Effector and regulatory B cells: modulators of CD4(+) T cell immunity. Nat. Rev. Immunol. 10: 236-247. 12. Fazilleau, N., L. Mark, L. J. McHeyzer-Williams, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells: lineage and location. Immunity. 30: 324-335. 13. McHeyzer-Williams, L. J., N. Pelletier, L. Mark, N. Fazilleau, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells as cognate regulators of B cell immunity. Curr. Opin. Immunol. 21: 266-273. 14. Johnston, R. J., A. C. Poholek, D. DiToro, I. Yusuf, D. Eto, B. Barnett, A. L. Dent, J. Craft, and S. Crotty. 2009. Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science 325: 1006-1010. 15. Oestreich, K. J., S. E. Mohn, and A. S. Weinmann. 2012. Molecular mechanisms that control the expression and activity of Bcl-6 in T(H)1 cells to regulate flexibility with a T(FH)-like gene profile. Nat. Immunol. 13: 405-411. 16. Choi, Y. S., R. Kageyama, D. Eto, T. C. Escobar, R. J. Johnston, L. Monticelli, C. Lao, and S. Crotty. 2011. ICOS receptor instructs T follicular helper cell versus effector cell differentiation via induction ofthe transcriptional repressor Bcl6. Immunity. 34: 932-946. 17. Pepper, M., A. J. Pagan, B. Z. Igyarto, J. J. Taylor, and M. K. Jenkins. 2011. Opposing signals from the Bcl6 transcription factor and the interleukin-2 receptor generate T helper 1 central and effector memory cells. Immunity. 35: 583-595. 18. Johnston, R. J., Y. S. Choi, J. A. Diamond, J. A. Yang, and S. Crotty. 2012. STAT5 is a potent negative regulator of TFH cell differentiation. J. Exp. Med. 209: 243-250. 19. Liao, W., J. X. Lin, L. Wang, P. Li, and W. J. Leonard. 2011. Modulation of cytokine receptors by IL-2 broadly

92 Regulatory role of IL-21 and IL-2 in T helper effector function

regulates differentiation into helper T cell lineages. Nat. Immunol. 12: 551-559. 20. Gong, D., and T. R. Malek. 2007. Cytokine-dependent Blimp-1 expression in activated T cells inhibits IL-2 production. J. Immunol. 178: 242-252. 21. Martins, G. A., L. Cimmino, J. Liao, E. Magnusdottir, and K. Calame. 2008. Blimp-1 directly represses Il2 and the Il2 activator Fos, attenuating T cell proliferation and survival. J. Exp. Med. 205: 1959-1965. 22. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity. 13: 199-212. 23. Nurieva, R. I., A. Podd, Y. Chen, A. M. Alekseev, M. Yu, X. Qi, H. Huang, R. Wen, J. Wang, H. S. Li, S. S. Watowich, H. Qi, C. Dong, and D. Wang. 2012. STAT5 negatively regulates T follicular helper (Tfh) cell generation and function. J. Biol. Chem. 24. Harada, Y., D. Ohgai, R. Watanabe, K. Okano, O. Koiwai, K. Tanabe, H. Toma, A. Altman, and R. Abe. 2003. A single amino acid alteration in cytoplasmic domain determines IL-2 promoter activation by ligation of CD28 but not inducible costimulator (ICOS). J. Exp. Med. 197: 257-262. 25. Malek, T. R., and I. Castro. 2010. Interleukin-2 receptor signaling: at the interface between tolerance and immunity. Immunity. 33: 153-165. 26. Boyman, O., and J. Sprent. 2012. The role of interleukin-2 during homeostasis and activation of the

immune system. Nat. Rev. Immunol. 12: 180-190. 4 r e t p a h C 27. Kim, H. P., J. Kelly, and W. J. Leonard. 2001. The basis for IL-2-induced IL-2 receptor alpha chain gene regulation: importance of two widely separated IL-2 response elements. Immunity. 15: 159-172. 28. D’Souza, W. N., and L. Lefrancois. 2003. IL-2 is not required for the initiation of CD8 T cell cycling but sustains expansion. J. Immunol. 171: 5727-5735. 29. Yu, A., J. Zhou, N. Marten, C. C. Bergmann, M. Mammolenti, R. B. Levy, and T. R. Malek. 2003. Efficient induction of primary and secondary T cell-dependent immune responses in vivo in the absence of functional IL-2 and IL-15 receptors. J. Immunol. 170: 236-242. 30. Kelly, E., A. Won, Y. Refaeli, and P. L. Van. 2002. IL-2 and related cytokines can promote T cell survival by activating AKT. J. Immunol. 168: 597-603. 31. McKinstry, K. K., T. M. Strutt, and S. L. Swain. 2010. Regulation of CD4+ T-cell contraction during pathogen challenge. Immunol. Rev. 236: 110-124. 32. Datta, S., and N. E. Sarvetnick. 2008. IL-21 limits peripheral lymphocyte numbers through Tcell homeostatic mechanisms. PLoS. One. 3: e3118. 33. Datta, S., and N. Sarvetnick. 2009. Lymphocyte proliferation in immune-mediated diseases. Trends Immunol. 30: 430-438. 34. Eto, D., C. Lao, D. DiToro, B. Barnett, T. C. Escobar, R. Kageyama, I. Yusuf, and S. Crotty. 2011. IL-21 and IL-6 are critical for different aspects of B cell immunity and redundantly induce optimal follicular helper CD4 T cell (Tfh) differentiation. PLoS. One. 6: e17739. 35. Ettinger, R., G. P. Sims, A. M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky. 2005. IL-21 induces differentiation of human naive and memory B cells into antibody-secreting plasma cells. J. Immunol. 175: 7867-7879. 36. Hoyer, K. K., H. Dooms, L. Barron, and A. K. Abbas. 2008. Interleukin-2 in the development and control of inflammatory disease. Immunol. Rev. 226: 19-28. 37. Jones, J. L., C. L. Phuah, A. L. Cox, S. A. Thompson, M. Ban, J. Shawcross, A. Walton, S. J. Sawcer, A. Compston, and A. J. Coles. 2009. IL-21 drives secondary autoimmunity in patients with multiple sclerosis, following therapeutic lymphocyte depletion with alemtuzumab (Campath-1H). J. Clin. Invest 119: 2052- 2061. 38. Pepper, M., and M. K. Jenkins. 2011. Origins of CD4(+) effector and central memory T cells.Nat. Immunol. 12: 467-471.

93 Chapter 4

39. Dooms, H., K. Wolslegel, P. Lin, and A. K. Abbas. 2007. Interleukin-2 enhances CD4+ T cell memory by promoting the generation of IL-7R alpha-expressing cells. J. Exp. Med. 204: 547-557. 40. Yu, D., S. Rao, L. M. Tsai, S. K. Lee, Y. He, E. L. Sutcliffe, M. Srivastava, M. Linterman, L. Zheng, N. Simpson, J. I. Ellyard, I. A. Parish, C. S. Ma, Q. J. Li, C. R. Parish, C. R. Mackay, and C. G. Vinuesa. 2009. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity. 31: 457- 468. 41. Ma, C. S., S. Suryani, D. T. Avery, A. Chan, R. Nanan, B. Santner-Nanan, E. K. Deenick, and S. G. Tangye. 2009. Early commitment of naive human CD4(+) T cells to the T follicular helper (T(FH)) cell lineage is induced by IL-12. Immunol. Cell Biol. 87: 590-600. 42. Souwer, Y., A. Griekspoor, T. Jorritsma, W. J. de, H. Janssen, J. Neefjes, and S. M. van Ham. 2009. B cell receptor-mediated internalization of salmonella: a novel pathway for autonomous B cell activation and antibody production. J. Immunol. 182: 7473-7481. 43. Avery, D. T., E. K. Deenick, C. S. Ma, S. Suryani, N. Simpson, G. Y. Chew, T. D. Chan, U. Palendira, J. Bustamante, S. Boisson-Dupuis, S. Choo, K. E. Bleasel, J. Peake, C. King, M. A. French, D. Engelhard, S. Al- Hajjar, S. Al-Muhsen, K. Magdorf, J. Roesler, P. D. Arkwright, P. Hissaria, D. S. Riminton, M. Wong, R. Brink, D. A. Fulcher, J. L. Casanova, M. C. Cook, and S. G. Tangye. 2010. B cell-intrinsic signaling through IL-21 receptor and STAT3 is required for establishing long-lived antibody responses in humans. J. Exp. Med. 207: 155-171.

94 CD5 costimulates for stable human Th17 development by promoting IL-23R expression and sustained STAT3 activation 5

Jelle de Wit, Yuri Souwer, Astrid J. van Beelen, Rosa de Groot, Femke J. M. Muller, Hanny Klaasse Bos, Tineke Jorritsma, Martien L. Kapsenberg, Esther C. de Jong and S. Marieke van Ham J.W. & Y.S. and E.C.J., M.L.K. & S.M.H contributed equally to this work.

Blood. 2011 Dec 1;118(23):6107-14 Chapter 5

Abstract

Interleukin-17 (IL-17) producing CD4+ T helper (Th17) cells are important for immunity against extracellular pathogens and in autoimmune diseases. The factors that drive Th17 development in human remain a matter of debate. Here we show that, compared to classical CD28 costimulation, alternative costimulation via the CD5 or CD6 lymphocyte receptors forms a superior pathway for human Th17-priming. In the presence of the Th17-promoting cytokines IL-1β, IL-6, IL-23 and transforming growth factor-β (TGF-β), CD5 costimulation induces more Th17 cells that produce higher amounts of IL-17, which is preceded by prolonged activation of signal transducer and activator of transcription 3 (STAT3), a key regulator in Th17 differentiation, and enhanced levels of the IL-17- associated transcription factor retinoid-related orphan receptor-γt (ROR-γt). Strikingly, these Th17-promoting signals critically depend on CD5-induced elevation ofIL-23 receptor (IL-23R) expression. The present data favor the novel concept that alternative costimulation via CD5, rather than classical costimulation via CD28, primes naive T cells for stable Th17 development through promoting the expression of IL-23R.

96 Non-classical CD5 costimulation primes for Th17

Introduction

Interleukin-17 (IL-17) producing CD4+ T helper (Th17) cells are important in immunity against extracellular pathogens, in particular at the mucosa, and are implicated in a variety of immune-mediated inflammatory disorders. Like for other effector T cell types, Th17 cells develop from naive CD4+ T cells in response to APC-derived signals. Whereas the cytokines IL-1β, IL-6, IL-23 and transforming growth factor-β (TGF-β) have been identified to support Th17 differentiation in both mice and human, there is less consensus on the costimulatory signals that drive the development of human Th17 cells.1-4 A basic principle of T cell activation is that proper stimulation of naive T cells requires costimulation via CD28 for survival and expansion, which licenses their subsequent development into distinct effector Th subsets driven by appropriate signal 3 factors. Surprisingly, two recent studies reported that Th17 development is selectively inhibited by CD28 costimulation.5, 6 One of these studies suggested that human Th17 development is alternatively mediated via ligation of the inducible costimulator (ICOS).6 Among the other molecules that may alternatively costimulate CD4+ T cells are the lymphocyte receptor CD5 and CD6.7, 8 CD5 and CD6 are both group B members of the Scavenger Receptor Cystein-Rich domains superfamily (SRCR-SF). CD5 and CD6 share important structural and functional properties 5 r e t p a h C and have probably arisen from a common ancestral gene. During interaction between antigen presenting cell (APC) and T cell, CD5 and CD6 form part of the immunological synapse.9, 10 This localization makes them well positioned to modulate the signals that follow antigen-specific T cell receptor (TCR) ligation. For CD5, this concept has been most clearly demonstrated. CD5 plays a role in the late events of synapse-mediated signal transduction, whereby the large cytoplasmatic domain of CD5 can recruit both positive and negative regulators of T cell signaling. Consequently, CD5 is a modulator of T cell responses with both stimulatory and inhibitory activities.8, 11 In the thymus, CD5 plays a role in regulating TCR-mediated expansion and survival during T cell ontogeny.7, 8, 12 In peripheral resting CD4+ T cells, CD5 costimulation results in proliferation levels as high as obtained with classical CD28-mediated costimulation. A possible role of CD5-mediated costimulation of T cells in Th17 cell development is favored by the finding that mice deficient in signaling between CD5 and CK-2, a pro-survival serine/threonine kinase that associates with CD5, show diminished populations of IL-17-expressing T cells in the central nervous system, in a model of experimental autoimmune encephalomyelitis.13 In the present study we show that costimulation via CD5 or CD6 is superior to classical CD28 costimulation in driving Th17 cell development from human naive CD4+ T cells. CD5 induces high and consistent levels of IL-17, indicating the induction of stable terminal differentiation. Indeed, CD5 promotes elevated expression of various intracellular factors that support both induction

97 Chapter 5

and stabilization of IL-17 expression in T cells, such as activated signal transducer and activator of transcription 3 (STAT3), retinoid-related orphan receptor-γt (ROR-γt) and IL- 23 receptor (IL-23R). Additional CD28 ligation abrogates the effects of CD5 costimulation and down-modulates expression of Th17-stabilizing factors. Thus, antigen presentation in conjunction with alternative costimulation seems to form a potent combination for Th17 development, a concept that suggests involvement of immune components other than classical mature APCs as driving force for the Th17 immune response.

Materials and methods

Reagents The following labeled anti-human mAbs were obtained from BD Biosciences (San Jose, CA): IFN-γ-FITC, CD4-APC, strep-PE, pSTAT3-PE, IL-2-APC and IgG1-PerCP/Cy5.5 isotype control. FITC-conjugated antibody IgG1, IgG2a and IgG2b, IgG1-PE and IgG-APC isotype controls were obtained from DAKO (Glostrup, Denmark). IL-17-PE and IL-17-PerCP/Cy5.5 labeled antibody was obtained from eBioscience (San Diego, CA). CD45RA-FITC and CD45RO-PE were obtained from Sanquin Blood Supply (Amsterdam, The Netherlands), IL-23R-biotin from R&D Systems (Minneapolis, MN) and DAPI from Sigma-Aldrich (Steinheim, Germany).

Purification of human naive CD4+ T lymphocytes from human adult blood Human PBMCs were isolated by density gradient centrifugation on Ficoll-Hypaque (Axis- Shield PoC AS, Oslo, Norway) or on Lymphoprep (Nycomed, Oslo, Norway) from a buffycoat obtained from healthy donors (Sanquin). All donors provided written informed consent in accordance with the protocol of the local institutional review board, the Medical Ethics Committee of Sanquin Blood Supply (Amsterdam, The Netherlands), and the Medical Ethics Committee of Sanquin approved the study. From the PBMCs, untouched+ CD4 cells were purified with a MACS Isolation kit for CD4+ cells (Miltenyi Biotech, Bergisch Gladbach, Germany). Subsequently, naive CD4+ T cells were FACS sorted on a FACS Aria (BD Biosystems) as CD4+CD45RA+CD45RO-. Populations were >99% purified.

In vitro differentiation of naive +CD4 T cells Nunc MaxiSorp 96-well plates (Nunc, Roskilde, Denmark) were coated overnight with different combinations of anti-CD3 (1X1, 1 µg/mL, Sanquin), anti-CD28 (CLB.CD28/1, 1 µg/mL, Sanquin), anti-CD5 (UCHT2, 1 µg/mL, BD Bioscience or CLB.T1/1, 1 µg/mL, Sanquin), anti-CD6 (M-T605, 1 µg/mL, BD Bioscience), and anti-birch-pollen-antigen

98 Non-classical CD5 costimulation primes for Th17

(anti-Betv1, 5H2, 1 µg/mL, Sanquin). After extensive washing the plates, 5x104 freshly purified naive CD4+ T cells were cultured in Iscove’s modified Dulbecco’s medium (IMDM, Lonza, Verviers, Belgium) supplemented with 5% human serum AB (Lonza), 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM L-Glutamine, 50 μM β-mercaptoethanol (Sigma-Aldrich). If described, the following cytokines or antibodies were added: anti- IFNγ antibody (10 μg/mL, U-CyTech Biosciences, Utrecht, The Netherlands), IL-23 (30 ng/ mL, R&D Systems, Minneapolis, MN), IL-1β (10 ng/mL, Cell Genix, Freiburg, Germany), IL-6 (10 ng/mL, Sanquin), TGF-β1 (10 ng/mL, R&D Systems), IL-12 (10 ng/mL, Roche, Woerden, The Netherlands). After four days, cells were transferred to 96-wells round bottom plate (Greiner Bio-One, Frickenhausen, Germany) and from now every two days half of the medium was replaced by new medium without extra cytokines, except with addition of IL-2 (10 U/mL, Chiron, Emeryville, USA) and wells were splitted if necessary.

RNA isolation, cDNA synthesis and real-time semi-quantitative RT-PCR RT-PCR has been described before.14 Briefly, RNA was reverse transcribed to cDNA using random hexamers in combination with Superscript II and a RNase H-reverse transcriptase kit. Primers for 18S rRNA, RORC, IL17A, IL17F, IL21, IL23R and IL-2 were developed to span exon-intron junctions to prevent amplification of genomic DNA (primer setsin 5 r e t p a h C supplemental Table 1). Primers were validated on cDNA of total CD4+ T cells cultured in Th17 inducing conditions. Product specificity of each primer set was verified by agarose gel electrophoresis and sequence analysis of the amplified PCR product. Gene expression levels were measured in triplicate reactions for each sample in the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR green method (Applied Biosystems). All results were normalized to the internal control 18S rRNA, and are expressed relative to the expression levels found in naive CD4+ T cells stimulated with anti-CD3/anti-CD28 in medium only.

Surface and intracellular staining for FACS analyses and CFSE labeling After 11 days of incubation, cytokine secretion was measured by intracellular staining after restimulation with 0,1 µg/mL phorbal myristate acetate (PMA), 1 µg/mL ionomycin and 10 µg/mL brefeldin A (Sigma-Aldrich) for 5 hours. Cells were washed twice with PBS, fixed with 4% paraformaldehyde (Merck, Darmstadt, Germany) for 15 minutes and after washing twice with PBS, permeabilized with 0,5% saponin (Calbiochem, CA) in PBS containing 1% bovine serum albumin (BSA; Sigma-Aldrich) and incubated with fluorescent antibodies for 30 minutes at room temperature. All plasma membrane stainings were performed for 15 minutes at room temperature and washed after each incubation with PBS containing 0,1% BSA. 20.000 events were acquired on a LSR II (BD) and analyzed

99 Chapter 5

with FlowJo (Treestar Inc.). Phospho-STAT3 stainings were performed as suggested by the manufacturer of the antibody. Lymphocytes were gated by forward and side scatter. In samples exclusively stained for plasma membrane markers, dead cells were excluded by being positive for DAPI staining. CFSE (Invitrogen, Paisley, UK) labeling was used in proliferation assays.

Cytokine ELISA For measurements of cytokine levels, different cytokine ELISA were performed on the supernatant after 11 days of incubation. Prior to measuring, cells were restimulated with 1 μg/mL anti-CD3 (clone 1XE, Sanquin) and 50nM PdBu (Sigma-Aldrich) for 24 hours. IL-17 levels were measured using coated anti-IL17A (eBio64CAP17, eBioscience) and biotinylated anti-IL-17A (eBio64DEC17, eBioscience), and recombinant IL-17A from R&D Systems was used as a standard. IFN-γ levels were measured using a standard ELISA kit (Pelikine, Sanquin).

Statistical analyses Data were analyzed for statistical significance using the pairedt -test with GraphPad Prism 5.0 software (GraphPad Software, San Diego, CA).

Results

CD5 is superior to CD28 in priming and stabilization of Th17 differentiation In a basic series of experiments we compared the effects of CD28 and CD5 costimulation on development of effector T cells upon CD3-stimulation of highly purified human naive CD4+CD45RA+CD45RO- T cells in the absence or presence of cytokines that promote the development of either Th1 (IL-12) or Th17 (IL-6, TGF-β, IL-1β, IL-23) cells. Naive T cells were activated by plate-bound antibodies against CD3 and CD28 or CD5. The production of Th1 (interferon-γ; IFN-γ) or Th17 (IL-17) signature cytokines was subsequently determined by ELISA. In the absence of Th1 or Th17 cytokines (Th0 condition), small amounts of IFN-γ and no IL-17 were detected, both after CD28 and CD5 costimulation (Figure 1A). In Th1 polarizing conditions, both CD5 and CD28 costimulation induced IFN- γ, but CD28 was highly superior to CD5. As expected, IL-17 production was only detected in Th17-inducing conditions (Figure 1A, right panel). Importantly, although detectable both after CD28 and CD5 costimulation, IL-17 production was substantial higher after CD5 costimulation. This CD5 costimulatory effect on IL-17 production was also found with a different CD5 antibody, recognizing a different epitope,15 demonstrating that the effect cannot be

100 Non-classical CD5 costimulation primes for Th17 5 r e t p a h C

Figure 1. CD5 is superior to CD28 in Th17 differentiation. (A) Naive CD4+CD45RA+CD45RO- T cells were stimulated via plate bound antibodies directed against CD3/CD28 or CD3/CD5 in Th0, Th1 (+ IL-12) or Th17 polarizing conditions (IL-23, IL-1β, IL-6, TGF-β and anti-IFN-γ). IFN-γ and IL-17 levels were measured by ELISA at day 12, after 24 hrs of restimulation with a CD3-specific mAb (1 μg/mL) and PdBu (50 nM). Data shown are from one representative experiment of four independent experiments with different donors.(B) ELISA of IL-17A and IFN-γ of naive T cells stimulated via CD3/CD28 or CD3/CD5 in Th17-polarising conditions as described under (A). After 11 days of culture, cells were restimulated for 24 hrs with anti-CD3/PdBu. Average IL-17 production levels; CD3/CD28: 0.45 ng/mL and CD3/CD5: 6.4 ng/mL IL-17. Average IFN-γ production levels; CD3/CD28: 0.3 ng/mL and CD3/CD5: 0.7 ng/mL IFN-γ. Data are shown as mean of 19 individual experiments with different donors. (C) Naive T cells were stimulated via CD3/CD28 (left) or CD3/CD5 antibodies (right) in Th17 polarizing conditions as described under (A). Intracellular levels of IFN-γ and IL-17A levels were measured at day 11, after 5 hrs of restimulation with PMA, ionomycin and BFA. FACS plots shown are from one representative of 18 different donors, shown combined in a graph (D). (E) Correlation between IL-17 production measured by ELISA and IL- 17 expression measured by intracellular cytokine staining. CD3/CD28 stimulated cells (gray) does not show a correlation (R = 0.21, P = 0.3982), while CD3/CD5 (black) does show a significant correlation (R = 0.78, P= 0.0002). Data are of seventeen independent experiments using different donors. (F) Real-time semi-quantitative PCR of mRNA expression of IL17A and IL17F of naive T cells stimulated via coated antibodies directed against CD3/ CD28 or CD3/CD5 in Th17-polarising conditions. Samples were measured after 3 days, 6 days and 11 days of culture and the expression is relative to CD3/CD28 stimulated naive cells in medium, at day 3. Data shown are mean ± SD of triplo measurement from one representative experiment of four independent experiments using different donors.(G) CFSE labeled naive CD4+ T cells were stimulated by plate bound antibodies directed against CD3 (fixed at 1 μg/mL) in combination with increasing concentration of either CD28-, CD5- or irrelevant Betv1- specific antibody. Proliferation was measured after 3 day culture in Th17 inducing conditions. Data are shown as mean ± SD for two different donors.

101 Chapter 5

attributed to particular effects of the antibodies used in this study (supplemental Figure 1). In a more detailed analysis of 19 donors, the average IL-17 production was more than ten-fold higher (Figure 1B). In these Th17-driving conditions, some IFN-γ production could be found, which was not significantly different upon CD28 or CD5 costimulation. However, these amounts of IFN-γ were marginal compared to very high amounts of IFN-γ produced in the Th1-polarizing conditions after classical CD28 costimulation (Figure 1A). CD5-mediated costimulation in the presence of Th17-inducing cytokines also induced enhanced numbers of IL-17-producing cells (Figure 1C, right panel). The percentage of IL- 17-producing cells at day 11, as analyzed by intracellular cytokine staining in 18 donors, was significantly higher than upon stimulation via CD28 (Figure 1D). The validity of the data on IL-17 production upon CD5 costimulation is stressed by the fact that the amount of secreted IL-17 correlated very well to the number of CD5-induced Th17 cells (Figure 1E). The IL-17-promoting effect of CD5 costimulation was evident both on the level of production of high amounts of IL-17 protein (Figure 1A-C) and very strong induction of IL- 17 mRNA (Figure 1F), underscoring that CD5 affects IL-17 production at the level of gene transcription. In contrast to naive T cells, CD28 and CD5 costimulation of CD4+CD45RA- CD45RO+ memory T helper cells induced similar frequencies of Th17 (supplemental Figure 2), probably because memory T cells are less dependent on costimulation. These experiments thus reveal the crucial finding that CD5 costimulation selectively favors Th17- over Th1-driven polarization of naive T cells. This finding is probably not associated with obvious differences in the ability of naive CD4+ T cells to respond to the different costimulatory signals, since costimulation via CD28 or CD5 induced similar proliferation profiles in the naive T cells (Figure 1G and supplemental Figure 3). To address if alternative stimulation by another member of the same group B scavenger receptor cysteine-rich (SRCR) superfamily also induced superior Th17 priming, we assessed costimulation via CD6, the other lymphoid family member closely related to CD5. CD6- mediated costimulation was also effective in inducing IL-17 production, to levels that are comparable to CD5 costimulation (supplemental Figure 4). No synergy between CD5 and CD6 was observed (supplemental Figure 5), suggesting that these molecules activate the same signal transduction pathways for Th17 development.

High-strength CD28 costimulation inhibits CD5-mediated Th17 development Recent studies have indicated that CD28 signaling suppresses cytokine or ICOS- costimulated Th17 differentiation.5, 6 Strikingly, additional CD28 ligation almost completely abrogated CD5-induced IL-17 production (Figure 2A). This attenuation of IL-17 production by additional CD28 costimulation was not caused by dilution of plate-bound antibodies direct to CD5 and CD3, since additional coating with irrelevant antibodies did

102 Non-classical CD5 costimulation primes for Th17 5 r e t p a h C

Figure 2. CD5-mediated Th17 development is attenuated by CD28 costimulation. (A) Naive T cells were stimulated with plate bound antibodies directed against CD3/CD5, CD3/CD5/CD28 (1 μg/mL) in Th17 polarizing conditions (IL-23, IL-1β, IL-6, TGF-β and anti-IFN-γ). At day 12, IL-17 levels were measured by ELISA after 24h hour of restimulation with anti-CD3/PdBu. Data are of nine independent experiments of individual donors.(B) Naive T cells were stimulated via CD3/CD5, CD3/CD5/CD28 or CD3/CD5/Betv1 (1 μg/mL) in Th17 polarizing conditions as described under (A). At day 12, IL-17 levels were measured by ELISA after 24h hour of restimulation with anti-CD3/PdBu. Data shown are from one representative experiment of four independent experiments using different donors. (C) Naive T cells were stimulated via plate bound antibodies directed against CD3/CD5 in combinations with various concentrations of coated CD28-specific antibody. After culturing with Th17 polarizing conditions for 11 days, cells were restimulated with anti-CD3/PdBU for 24 hrs and IL-17 levels were measured by ELISA. One representative experiment is shown of two individual experiments using different donors. (D) CFSE labeled naive T cells were stimulated via CD3- specific antibodies (left) or CD3/CD5 in combination with various concentrations of CD28 specific antibody as described under (C). Proliferation was measured at day 4. Data shown are from one representative experiment of three independent experiments using different donors. (E) Real-time semi-quantitative PCR of mRNA expression of IL2 of naive T cells stimulated via coated antibodies directed against CD3/CD28 or CD3/CD5 in Th17-polarising conditions. Samples were measured after 18 and 72 hours of culture. Data shown are mean ± SD of triplo measurement from one representative experiment of two independent experiments using different donors. (F) Intracellular IL-2 was measured by FACS staining of naive T cells stimulated via CD3/CD28 or CD3/CD5 for 18 and 72 hours. Data shown are from one representative experiment of four independent experiments using different donors.(G) Naive T cells were stimulated via CD3/ CD28 or CD3/CD5 in Th17 inducing conditions, in addition of extra IL-2 (100 U/mL) or IL-21 (10 ng/mL). IL-17 expression was measured at day 11 by intracellular cytokine staining. (H) Real-time semi-quantitative PCR of mRNA expression of IL21 of naive T cells stimulated as described under (E). Samples were measured after 3 days, 6 days and 11 days of culture. Data shown are mean ± SD of triplo measurement from one representative experiment of two independent experiments using different donors.

103 Chapter 5

not inhibit CD5-induced IL-17 production (Figure 2B). Variation in the relative amount of CD28 costimulation revealed that inhibition of CD5-induced IL-17 production by CD28 costimulation is dose-dependent and that IL-17 production is not affected by low level of CD28 costimulation (Figure 2C). The inhibition of CD5-induced Th17 differentiation by CD28 could not be attributed to down-modulation of cell proliferation (Figure 2D) or increased cell death as the recovery of viable cells and the relative percentage of apoptotic cells were unaffected (supplemental Figure 6). In mice, the down-modulatory effect of CD28 was attributed to the combined action of IFN-γ and IL-2.5 The use of anti-IFN-γ antibodies in our experiments ruled out a role for IFN-γ. CD5 indeed induces less IL-2 than CD28, both on mRNA and protein levels (Figure 2E and F). Therefore, we examined the effects of addition of extra IL-2 upon CD5 costimulation, albeit that our culture system contains IL-1β, which is knownto relieve IL-2 inhibition of Th17.1, 16 Consistent with these reports, we did not observe suppressive effects of IL-2 on CD5-mediated Th17 differentiation (Figure 2G). Human Th17 differentiation by ICOS induces IL-21 which contributes to Th17 differentiation.6 In contrast in our experiments, CD5-mediated Th17 differentiation was not accompanied by IL-21 induction. IL-21 mRNA levels were low for both CD28 and CD5 costimulation (Figure 2H), in line with earlier observations showing absence of IL-21 in human Th17 cells.1 Addition of extra IL-21 to CD3/CD5 stimulated cells did also not boost Th17 development (Figure 2G). Thus, the differences between CD5 and CD28 in Th17 development can not be attributed to differential regulation by IL-2 or IL-21.

CD5 enhances IL-23R expression and promotes STAT3 activation and RORC transcription We next explored to what extent CD5 costimulation promoted expression of factors involved in induction and maintenance of de novo IL-17 transcription. These factors include, expression of the receptor for IL-23 17-20, the phosphorylation of the STAT3 17, 21 and the expression of the transcription factor ROR-γt.22, 23 Naive T cells stimulated via CD5 express significantly more IL-23R, both in terms of percentages of IL-23R-expressing cells (Figure 3A) and in the level of IL-23R expression (MFI) (Figure 3B). As expected, enhanced IL-23R expression has an important role in the elevated amounts of IL-17 in the CD5- costimulated T cells, since FACS sorting of IL23R+ and IL23R- populations at day 4 after CD3/CD5 stimulation demonstrated that the level of IL-17 production correlates with the presence of IL23R on the activated T cells (Figure 3C,D). Next, intracellular FACS staining showed that STAT3 phosphorylation spiked within the first hour after CD28 and CD5 costimulation. However, after one day the drop in phospho- STAT3 was followed by a secondary and stronger wave of phosphorylation, which peaked at 72 hours (Figure 4A). Albeit that the differences are small, CD5 costimulation resulted

104 Non-classical CD5 costimulation primes for Th17

Figure 3. CD5 induces elevated levels of IL-23R. (A) Naive T cells were stimulated via CD3/CD28 or CD3/CD5 in Th17-polarising conditions. IL-23R expression was measured by FACS at day 3, day 6 and day 11. Data shown are mean ± SEM of nine individual experiments using different donors. (B) IL-23R expression of stimulated naive T cells described under (A) was measured by FACS. Data shown are from one representative experiment of nine independent experiments using different donors. (C) Naive T cells were stimulated via plate bound antibodies directed against CD3/CD5 in Th17 inducing conditions. IL-23R+ and IL-23R- cells were sorted at day 4 and cultured for another 7 days. IL-17 was measured by ELISA after 24h stimulation with anti-CD3/PdBu (right panel). Data shown are from one representative experiment of three independent experiments with different donors; n.d., not detectable. (D) Naive T cells were stimulated with CD3/CD28 or CD3/CD28 and sorted for IL- 5 r e t p a h C 23R expression as described in (C). IL-17 was measured 7 days after sorting of anti-CD3/PdBu stimulated cells (24h). Data shown are from three individual experiments using different donors. in a significantly less pronounced drop at 18 hours (Figure 4B) and a significantly higher secondary peak at 72 hours (Figure 4C). In addition, CD5 costimulation also induced at day 6 a significantly higher peak of mRNA transcription of RORC, the gene encoding the human ortholog of ROR-γt (Figure 4D). Thus, compared to classical costimulation, alternative CD5 signaling induces a prolonged phosphorylation of STAT3 over time, and enhances ROR-γt levels. Ligation of both CD28 and CD5 abrogated the positive effects of CD5 costimulation on IL-23R expression and STAT3 phosphorylation (Figure 4E-G).

Prolonged STAT3 activation and enhanced ROR-γt expression in CD5-costimulated T cells result from elevated expression of IL-23R Since mouse model experiments have shown that Th17 development is stabilized by IL-23 signaling, we have analyzed the role of elevated expression of IL-23R in CD5-mediated Th17 development in more detail. Omission of IL-23 in the medium strongly reduced the IL-17- producing capacity of CD5-costimulated T cells (Figure 5A). Most importantly, exclusion of IL-23 abrogated the CD5-specific rise in phospho-STAT3 at 72 hrs and rendered the level of STAT3 phosphorylation by CD5 equal to that induced by CD28 (Figure 5B and C). In addition, omission of IL-23 abrogated the CD5-specific enhancement of transcription

105 Chapter 5

Figure 4. CD5 costimulation enhances prolonged STAT3 activation and ROR-γt transcription. (A) Naive T cells were stimulated by plate bound antibodies directed against CD3/CD28 or CD3/CD5 and cultured with Th17 inducing conditions. Phospho-STAT3 levels were measured by FACS. Data shown are means from eight individual experiments with different donors. (B and C) Phospho-STAT3 was measured after 18h (B) or 72h (C) of naive T cells stimulated as described under (A). Data shown are means ± SD from eight individual experiments using different donors. (D) Real-time semi-quantitative PCR of mRNA expression of RORC of naive T cells stimulated via coated antibodies directed against CD3/CD28 or CD3/CD5 in Th17-polarising conditions. Samples were measured after 3 days, 6 days and 11 days of culture and the expression is relative to CD3/CD28 stimulated naive cells in medium, at day 3. Data shown are mean ± SD of triplo measurement from one representative experiment out of four independent experiments using different donors. (E) Naive T cells were stimulated via CD3/CD28, CD3/CD5 or CD3/CD5/CD28 in Th17 inducing conditions. Phospho-STAT3 levels were measured by FACS. (F) Phospho-STAT3 levels at 72 hours, of cells stimulated as described under (E). Data shown are from three individual experiments with different donors. (G) Naive T cells were stimulated via CD3/CD28, CD3/CD5 or CD3/CD5/CD28 in Th17 inducing conditions. IL-23R expression was measured by FACS at day 3 and day 6. Data shown are from one representative experiment of four independent experiments using different donors. of ROR-γt at day 6 (Figure 5D). These data strongly suggest that the CD5-associated prolongation of STAT3 activation and the enhanced ROR-γt transcription results from the indirect effects of CD5-induced elevation of IL-23R expression. Interstingly, absence of IL-23 did not affect the levels of IL-23R expression (Figure 5E and F), implying that the elevated expression of IL-23R is not regulated via IL-23 signaling itself but mediated via the CD5 signaling pathway.

Discussion Since the discovery of the IL-17 producing T helper subset, the requirement of the cytokines IL-23, IL-6, IL-1β and TGF-β for the differentiation of mouse and human naive CD4+ T cells into Th17 lineage has been established.1-4 However, the possible contribution of costimulatory signals in Th17 differentiation has remained poorly defined. Inthis study we demonstrate that non-classical costimulation via CD5 firmly favors human Th17

106 Non-classical CD5 costimulation primes for Th17

Figure 5. CD5 induces prolonged STAT3 activation and RORC transcription via elevation of IL-23R. (A) Naive T cells were stimulated with plate bound antibodies directed against CD3/CD5 and cultured in presence in Th17 polarizing conditions (IL-23, IL-1β, IL-6, TGF-β and anti-IFN-γ), or cultured without IL-23. At day 11 IL- 17 production was measured by intracellular FACS staining, after 5 hrs of restimulation with PMA, ionomycin and BFA. Data shown are from twelve individual experiments using different donors. (B) Naive T cells were stimulated via CD3/CD28 or CD3/CD5 and cultured with Th17 inducing cytokines or without IL-23. Phospho- STAT3 levels were measured by FACS. Data shown are means from six individual experiments using different donors. (C) Phospho-STAT3 levels were measured at 72 hours by FACS, as described under (B). Data shown 5 r e t p a h C are means from six individual experiments using different donors. (D-E) mRNA expression of RORC (D) and IL23R (E) was measured of naive T cells, stimulated as described under (C). Data shown are mean ± SD of triplo measurement from one representative experiment of two individual experiments with different donors. (F) Naive T cells were stimulated with plate bound antibodies directed against CD3/CD5 and cultured in presence in Th17 polarizing conditions without IL-23. IL-23R expression was measured by FACS at day 3, day 6 and day 11. Data shown are from one representative experiment out of four independent experiments using different donors. development in vitro, via the upregulation of IL-23R. The Th17-stimulatory capacity of CD5 is shared with CD6, another lymphoid member of the SRCR superfamily, a finding that may not be fully surprising as CD5 and CD6 share various other functional properties.24-26 Strikingly, additional ligation of CD28 impairs CD5-induced IL-17 production. This suggests that optimal Th17 induction via CD5 cannot be elicited by activated professional APCs showing high expression of the CD28 ligands CD80 and CD86. Indeed, mature mouse bone marrow-derived dendritic cells (DCs) and mature human monocyte-derived DCs are less efficient than immature DCs in supporting Th17 differentiation.5 However, DC subsets in different tissue compartments express variable degrees of costimulatory molecules. An interesting example in this respect is that mouse CD103+ lamina propria DCs, which are vital in retinoic acid-dependent acquisition of robust Th17 responses in vivo 27, 28, express high levels of major histocompatibility complex class (MHC) II and functional CCR7, but do not upregulate CD80 and CD86 spontaneously or after LPS stimulation in vitro.29 Alternatively, activated B cells express relatively low amounts of costimulatory

107 Chapter 5

molecules and recent data have also linked B cells to Th17 responses.30 Basically, there are two ways of how naïve T cells might be costimulated via CD5 or CD6. Firstly, CD5 and CD6 can be ligated by endogenous protein ligands on antigen- presenting cells. Although these ligands for CD5 remain poorly identified, B cells express the postulated CD5 ligands CD72 and CD5 itself.31, 32 The CD6 ligands ALCAM and protein 3A11 are broadly expressed on many cell types, including DCs and B cells.33 Thus, certain DC subsets and B cells may provide both antigen and CD5/CD6-costimulation for the development of antigen-specific Th17 cells. Secondly, both CD5 and CD6 are implicated as pathogen-recognition receptors (PRRs) of diverse microbe-derived carbohydrates. Polysaccharide β-glycan, present on fungi like Candida albicans, can bind and activate CD5 34 and CD6 can be activated via bacterial LTA or LPS.35 Various studies have stressed the role of Th17 cells in bacterial and fungal infection in mouse models (reviewed in 36) and protection against mucocutaneous Candida albicans infection in humans (reviewed in 37). In addition, Th17 differentiation was more recently shown to be directed by the composition of the intestinal bacteria and a role for PRRs was implicated.38, 39 The gut mirobiota may be linked to Th17-mediated chronic inflammatory diseases, since dysbiosis of the microbial flora is observed in patients with Crohn’s disease and ulcerative colitis 40 and the severity of dextran sulfate sodium-induced colitis is less in CD5-/- mice than in wild-type mice.41 In a murine glomerulonephritis model, treatment of mice with CD5Fc inhibited disease.42 Recently, IL-17 producing Th17 cells in the kidney have been shown to contribute to the immunopathogenesis of glomerulonephritis.43 Clearly, the in vivo role of alternative costimulation in Th17 development warrants further research. Indeed, the Th17-promoting role of CD5 is supported by in vivo data in mice, showing that deficient signaling of CD5 to CK2, a major downstream effector kinase of CD5, results in reduced populations of IL-17+ T helper cells in the central nervous system in an EAE model.13 By showing the potential relevance of the CD5/Th17 axis in multiple sclerosis, these data urge for studies on the role of CD5 in other Th17 associated disease, like psoriasis and inflammatory bowel diseases.

Acknowledgements

We thank Erik Mul, Floris van Alphen and Toni van Capel for excellent cell sorting by flow cytometry. This work was supported by grants from the Landsteiner Foundation for Blood Research (LSBR, grant 0533 and 0816).

108 Non-classical CD5 costimulation primes for Th17

Supplemental Data

Table S1

Primers

IL-2 F: ATGCCCAAGAAGGCCACAG R: TGATATTGCTGATTAAGTCCC IL17A F: GAAGACCTCATTGGTGTCAC R: CCTCATTGCGGTGGAGATTC IL17F F: CTGGAATTACACTGTCACTTG R: CTGGAAAGAAACAGAGCAGC IL21 F: GTCATCTGTCTGATGGTCATC R: CCACTCACAGTTTGTCTCTAC

IL23R 5 r e t p a h C F: ACATGTGAAGAGTTTAGAGAC R: TGCCTAGTGCGTTTGCTGC RORC F: CCTGACAGAGATAGAGCACC R: GTTCCCACATCTCCCACATG

Figure S1. Another CD5 antibody also induces superior Th17 differentiation. Naive T cells were stimulated via plate bound antibodies directed against CD3/CD28 or CD3/CD5 (clone CLB-T1/1, Sanquin) and cultured in Th17 polarizing conditions (IL-23, IL-1β, IL- 6, TGF-β and anti-IFN-γ). Intracellular IL-17 levels were measured at day 11 after 5 hrs of restimulation with PMA, ionomycin and BFA. Data shown are means from seven individual experiments using different donors.

Figure S2. CD28 and CD5 induce similar Th17 differentiation in memory T cells. Memory T cells (CD4+CD45RA-CD45RO+) were stimulated via plate bound antibodies directed against CD3/CD28 or CD3/CD5 and cultured in Th17 polarizing conditions (IL-23, IL-1β, IL- 6, TGF-β and anti-IFN-γ). Intracellular IL-17 levels were measured at day 11 after 5 hrs of restimulation with PMA, ionomycin and BFA. Data shown are from one representative experiment of five individual experiments using different donors.

109 Chapter 5

Figure S3. CD28 and CD5 induce similar proliferation of naive T cells. CFSE labeled naive CD4+ T cells were stimulated by plate bound antibody against CD3 (fixed at 1 ug/mL) in combinations with various concentrations of coated CD28-specific, CD5-specific or irrelevant Betv1-specific antibody. Proliferation was measured after 3 day culture in Th17 polarizing conditions (IL-23, IL-1β, IL-6, TGF-β and anti-IFN-γ). Data shown are from one representative experiment of four independent experiments using different donors.

Figure S4. CD6 costimulation induces Th17 differentiation comparable to CD5.Naive T cells were stimulated via plate bound antibodies directed against CD3/CD28, CD3/CD6 or CD3/CD5 and cultured in Th17 inducing conditions (IL-23, IL-1β, IL-6, TGF-β and anti- IFN-γ). Intracellular IL-17 levels were measured at day 11 after 5 hrs restimulation with PMA, ionomycin and BFA. Data shown are means from eight individual experiments using different donors.

Figure S5. CD5 and CD6 do not synergize in Th17 induction. Naive T cells were stimulated coated antibodies directed against CD3/CD5 or CD3/CD5/CD6 and cultured in Th17 inducing conditions. Intracellular IL-17 levels were measured at day 11 after 5 hrs restimulation with PMA, ionomycin and BFA. Data shown are means from four individual experiments using different donors.

Figure S6. Additional CD28 stimulation does not alter the viability of CD5 stimulated cells. Naive T cells were stimulated via coated antibodies directed against CD3/CD28, CD3/CD5 or CD3/CD5/CD28 and cultured in Th17 inducing conditions. Viability of the cells was measured using DAPI staining at day 4. Data shown are means ± SEM from two individual experiments using different donors.

110 Non-classical CD5 costimulation primes for Th17

References

1. Manel, N., D. Unutmaz, and D. R. Littman. 2008. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat. Immunol. 9: 641-649. 2. Volpe, E., N. Servant, R. Zollinger, S. I. Bogiatzi, P. Hupe, E. Barillot, and V. Soumelis. 2008. A critical function for transforming growth factor-beta, interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses. Nat. Immunol. 9: 650-657. 3. Wilson, N. J., K. Boniface, J. R. Chan, B. S. McKenzie, W. M. Blumenschein, J. D. Mattson, B. Basham, K. Smith, T. Chen, F. Morel, J. C. Lecron, R. A. Kastelein, D. J. Cua, T. K. McClanahan, E. P. Bowman, and M. R. de Waal. 2007. Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat. Immunol. 8: 950-957. 4. Yang, L., D. E. Anderson, C. Baecher-Allan, W. D. Hastings, E. Bettelli, M. Oukka, V. K. Kuchroo, and D. A. Hafler. 2008. IL-21 and TGF-beta are required for differentiation of human T(H)17 cells.Nature 454: 350- 352. 5. Bouguermouh, S., G. Fortin, N. Baba, M. Rubio, and M. Sarfati. 2009. CD28 co-stimulation down regulates Th17 development. PLoS. One. 4: e5087. 6. Paulos, C. M., C. Carpenito, G. Plesa, M. M. Suhoski, A. Varela-Rohena, T. N. Golovina, R. G. Carroll, J. L. Riley, and C. H. June. 2010. The inducible costimulator (ICOS) is critical for the development of human T(H)17 cells. Sci. Transl. Med. 2: 55ra78. 7. Ceuppens, J. L., and M. L. Baroja. 1986. Monoclonal antibodies to the CD5 antigen can provide the necessary second signal for activation of isolated resting T cells by solid-phase-bound OKT3. J. Immunol. 5 r e t p a h C 137: 1816-1821. 8. Spertini,F., W. Stohl, N. Ramesh, C. Moody, and R. S. Geha. 1991. Induction of human T cell proliferation by a monoclonal antibody to CD5. J. Immunol. 146: 47-52. 9. Brossard, C., M. Semichon, A. Trautmann, and G. Bismuth. 2003. CD5 inhibits signaling at the immunological synapse without impairing its formation. J. Immunol. 170: 4623-4629. 10. Gimferrer, I., M. Farnos, M. Calvo, M. Mittelbrunn, C. Enrich, F. Sanchez-Madrid, J. Vives, and F. Lozano. 2003. The accessory molecules CD5 and CD6 associate on the membrane of lymphoid T cells. J. Biol. Chem. 278: 8564-8571. 11. Verwilghen, J., G. H. Kingsley, J. L. Ceuppens, and G. S. Panayi. 1992. Inhibition of synovial fluid T cell proliferation by anti-CD5 monoclonal antibodies. A potential mechanism for their immunotherapeutic action in vivo. Arthritis Rheum. 35: 1445-1451. 12. Stanton, T., T. L. Stevens, J. A. Ledbetter, and D. Wofsy. 1986. Anti-Ly-1 antibody induces interleukin 2 release from T cells. J. Immunol. 136: 1734-1737. 13. Axtell, R. C., L. Xu, S. R. Barnum, and C. Raman. 2006. CD5-CK2 binding/activation-deficient mice are resistant to experimental autoimmune encephalomyelitis: protection is associated with diminished populations of IL-17-expressing T cells in the central nervous system. J. Immunol. 177: 8542-8549. 14. Souwer, Y., M. E. Chamuleau, A. A. van de Loosdrecht, E. Tolosa, T. Jorritsma, J. J. Muris, M. J. Dinnissen- van Poppel, S. N. Snel, van de Corp, G. J. Ossenkoppele, C. J. Meijer, J. J. Neefjes, and H. S. Marieke van. 2009. Detection of aberrant transcription of major histocompatibility complex class II antigen presentation genes in chronic lymphocytic leukaemia identifies HLA-DOA mRNA as a prognostic factor for survival. Br. J. Haematol. 145: 334-343. 15. McMichael, A. J., P. C. L. Beverley, S. Cobbold, M. J. Crumpton, W. Gilks, F. M. Gotch, N. Hogg, M. Horton, N. Ling, I. C. M. MacLennan, D. Y. Mason, C. Milstein, D. SpiegelHalter, and H. Waldman. 1987. Leucocyte Typing III: White Cell Differentiation Antigens. Oxford University Press, Oxford.

111 Chapter 5

16. Kryczek, I., S. Wei, L. Zou, S. Altuwaijri, W. Szeliga, J. Kolls, A. Chang, and W. Zou. 2007. Cutting edge: Th17 and regulatory T cell dynamics and the regulation by IL-2 in the tumor microenvironment. J. Immunol. 178: 6730-6733. 17. Yang, X. O., A. D. Panopoulos, R. Nurieva, S. H. Chang, D. Wang, S. S. Watowich, and C. Dong. 2007. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J. Biol. Chem. 282: 9358-9363. 18. Zhou, L., I. I. Ivanov, R. Spolski, R. Min, K. Shenderov, T. Egawa, D. E. Levy, W. J. Leonard, and D. R. Littman. 2007. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat. Immunol. 8: 967-974. 19. McGeachy, M. J., Y. Chen, C. M. Tato, A. Laurence, B. Joyce-Shaikh, W. M. Blumenschein, T. K. McClanahan, J. J. O’Shea, and D. J. Cua. 2009. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells in vivo. Nat. Immunol. 10: 314-324. 20. Stritesky, G. L., N. Yeh, and M. H. Kaplan. 2008. IL-23 promotes maintenance but not commitment to the Th17 lineage. J. Immunol. 181: 5948-5955. 21. Harris, T. J., J. F. Grosso, H. R. Yen, H. Xin, M. Kortylewski, E. Albesiano, E. L. Hipkiss, D. Getnet, M. V. Goldberg, C. H. Maris, F. Housseau, H. Yu, D. M. Pardoll, and C. G. Drake. 2007. Cutting edge: An in vivo requirement for STAT3 signaling in TH17 development and TH17-dependent autoimmunity. J. Immunol. 179: 4313-4317. 22. Ivanov, I. I., B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J. Lafaille, D. J. Cua, and D. R. Littman. 2006. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126: 1121-1133. 23. Yang, X. O., B. P. Pappu, R. Nurieva, A. Akimzhanov, H. S. Kang, Y. Chung, L. Ma, B. Shah, A. D. Panopoulos, K. S. Schluns, S. S. Watowich, Q. Tian, A. M. Jetten, and C. Dong. 2008. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity. 28: 29-39. 24. Freeman, M., J. Ashkenas, D. J. Rees, D. M. Kingsley, N. G. Copeland, N. A. Jenkins, and M. Krieger. 1990. An ancient, highly conserved family of cysteine-rich protein domains revealed by cloning type I and type II murine macrophage scavenger receptors. Proc. Natl. Acad. Sci. U. S. A 87: 8810-8814. 25. Jones, N. H., M. L. Clabby, D. P. Dialynas, H. J. Huang, L. A. Herzenberg, and J. L. Strominger. 1986. Isolation of complementary DNA clones encoding the human lymphocyte glycoprotein T1/Leu-1. Nature 323: 346- 349. 26. Aruffo, A., M. B. Melnick, P. S. Linsley, and B. Seed. 1991. The lymphocyte glycoprotein CD6 contains a repeated domain structure characteristic of a new family of cell surface and secreted proteins. J. Exp. Med. 174: 949-952. 27. Laffont, S., K. R. Siddiqui, and F. Powrie. 2010. Intestinal inflammation abrogates the tolerogenic properties of MLN CD103+ dendritic cells. Eur. J. Immunol. 40: 1877-1883. 28. Hall, J. A., J. L. Cannons, J. R. Grainger, L. M. Dos Santos, T. W. Hand, S. Naik, E. A. Wohlfert, D. B. Chou, G. Oldenhove, M. Robinson, M. E. Grigg, R. Kastenmayer, P. L. Schwartzberg, and Y. Belkaid. 2011. Essential Role for Retinoic Acid in the Promotion of CD4(+) T Cell Effector Responses via Retinoic Acid Receptor Alpha. Immunity. 34: 435-447. 29. Monteleone, I., A. M. Platt, E. Jaensson, W. W. Agace, and A. M. Mowat. 2008. IL-10-dependent partial refractoriness to Toll-like receptor stimulation modulates gut mucosal dendritic cell function. Eur. J. Immunol. 38: 1533-1547. 30. van de Veerdonk, F. L., B. Lauwerys, R. J. Marijnissen, K. Timmermans, P. F. Di, M. I. Koenders, I. Gutierrez- Roelens, P. Durez, M. G. Netea, J. W. van der Meer, W. B. van den Berg, and L. A. Joosten. 2011. The anti- CD20 antibody rituximab reduces the T helper 17 response. Arthritis Rheum. 31. Brown, M. H., and E. Lacey. 2010. A ligand for CD5 is CD5. J. Immunol. 185: 6068-6074. 32. Van, d., V, H. von, I, W. Luo, J. R. Parnes, and K. Thielemans. 1991. The B-cell surface protein CD72/Lyb-2

112 Non-classical CD5 costimulation primes for Th17

is the ligand for CD5. Nature 351: 662-665. 33. Saifullah, M. K., D. A. Fox, S. Sarkar, S. M. Abidi, J. Endres, J. Piktel, T. M. Haqqi, and N. G. Singer. 2004. Expression and characterization of a novel CD6 ligand in cells derived from joint and epithelial tissues. J. Immunol. 173: 6125-6133. 34. Vera, J., R. Fenutria, O. Canadas, M. Figueras, R. Mota, M. R. Sarrias, D. L. Williams, C. Casals, J. Yelamos, and F. Lozano. 2009. The CD5 ectodomain interacts with conserved fungal cell wall components and protects from zymosan-induced septic shock-like syndrome.Proc. Natl. Acad. Sci. U. S. A 106: 1506-1511. 35. Sarrias, M. R., M. Farnos, R. Mota, F. Sanchez-Barbero, A. Ibanez, I. Gimferrer, J. Vera, R. Fenutria, C. Casals, J. Yelamos, and F. Lozano. 2007. CD6 binds to pathogen-associated molecular patterns and protects from LPS-induced septic shock. Proc. Natl. Acad. Sci. U. S. A 104: 11724-11729. 36. Dubin, P. J., and J. K. Kolls. 2008. Th17 cytokines and mucosal immunity. Immunol. Rev. 226: 160-171. 37. Puel, A., C. Picard, S. Cypowyj, D. Lilic, L. Abel, and J. L. Casanova. 2010. Inborn errors of mucocutaneous immunity to Candida albicans in humans: a role for IL-17 cytokines? Curr. Opin. Immunol. 22: 467-474. 38. Ivanov, I. I., K. Atarashi, N. Manel, E. L. Brodie, T. Shima, U. Karaoz, D. Wei, K. C. Goldfarb, C. A. Santee, S. V. Lynch, T. Tanoue, A. Imaoka, K. Itoh, K. Takeda, Y. Umesaki, K. Honda, and D. R. Littman. 2009. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485-498. 39. Ivanov, I. I., R. L. Frutos, N. Manel, K. Yoshinaga, D. B. Rifkin, R. B. Sartor, B. B. Finlay, and D. R. Littman. 2008. Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host. Microbe 4: 337-349. 40. Chassaing, B., and A. Darfeuille-Michaud. 2011. The commensal microbiota and enteropathogens in the pathogenesis of inflammatory bowel diseases. Gastroenterology 140: 1720-1728. 41. Dasu, T., J. E. Qualls, H. Tuna, C. Raman, D. A. Cohen, and S. Bondada. 2008. CD5 plays an inhibitory role 5 r e t p a h C in the suppressive function of murine CD4(+) CD25(+) T(reg) cells. Immunol. Lett. 119: 103-113. 42. Biancone, L., M. A. Bowen, A. Lim, A. Aruffo, G. Andres, and I. Stamenkovic. 1996. Identification of a novel inducible cell-surface ligand of CD5 on activated lymphocytes. J. Exp. Med. 184: 811-819. 43. Paust, H. J., J. E. Turner, O. M. Steinmetz, A. Peters, F. Heymann, C. Holscher, G. Wolf, C. Kurts, H. W. Mittrucker, R. A. Stahl, and U. Panzer. 2009. The IL-23/Th17 axis contributes to renal injury in experimental glomerulonephritis. J. Am. Soc. Nephrol. 20: 969-979.

113

Response to a Letter: Priming of human naive CD4+ T cells via CD5 costimulation requires IL-6 for optimal Th17 + development 5

Jelle de Wit, Yuri Souwer, Femke J. M. Muller, Hanny Klaasse Bos, Tineke Jorritsma, Martien L. Kapsenberg, Esther C. de Jong and S. Marieke van Ham J.W. & Y.S. and E.C.J., M.L.K. & S.M.H contributed equally to this work.

Blood. 2012 May 17;119(20):4812-13 Chapter 5+

To the editor: Generation of Th17 from human naive CD4+ T cells preferentially occurs from FOXP3+ Treg upon costimulation via CD28 or CD5 Maha Ayyoub, Caroline Raffin and Danila Valmori

Th17 cells are a subset of CD4+ T helper cells specialized in the protection against fungi and extra-cellular bacteria, but also involved in the pathogenesis of autoimmune diseas- es. Whereas differentiation of murine Th17 is readily achieved in vitro by TCR-mediated stimulation of naive CD4+ T cells in the presence of TGF-β and IL-6, differentiation of human Th17 from naive CD4+ T cells has proved more difficult to obtain. De Wit J. and colleagues have recently reported in Blood1 that costimulation via CD5, a member of the scavenger receptor cystein-rich superfamily, rather than CD28, promotes in vitro differ- entiation of human Th17 from circulating naive CD4+ T cells in the presence of Th17 po- larizing cytokines. On the other hand, we have previously reported that human Th17 are preferentially generated in vitro from NTreg, a subset of naive FOXP3+CD25+CD127- Treg that we have previously identified,2 rather than from conventional naive FOXP3-CD25- CD4+ T cells (Nconv).3 The IL-1/IL-1RI system plays a major role in the differentiation of Th17 both in mouse models and from human NTreg.4, 5 To comparatively assess the ef- fects of costimulation via CD5 on the differentiation of Th17 from Nconv and NTreg, we isolated the two populations, ex vivo, by cell sorting (Figure 1A) and stimulated them in vitro with anti-CD3 together with anti-CD28 or anti-CD5 mAb in the presence of IL-2 alone or with Th17 or Th1 polarizing factors. As illustrated in Figure 1B, differentiation of IL-17-secreting cells from Nconv under Th17 polarizing conditions was moderately en- hanced by costimulation via CD5, as compared to CD28, but remained overall low. Con- sistent with our previous data,3 differentiation of Th17 was significantly more efficiently obtained from NTreg than from Nconv. In addition, in contrast to Nconv, the proportion of Th17 differentiating from NTreg was not significantly different upon costimulation via CD28 or CD5. De Wit J. et al. proposed that costimulation via CD5 induces increased IL- 23R expression, resulting in increased activation of STAT3 by IL-23 and consequent RORγt transcription. We detected significant induction of RORγt expression in both Nconv and NTreg stimulated under Th17 conditions as compared to neutral conditions, andtoa similar extent following costimulation via CD5 or CD28 (Figure 1B). We found that IL-23R expression was increased in both Nconv and NTreg under Th17 polarizing conditions, but failed to detect a significant difference following costimulation via CD5 as compared to CD28 (Figure 1C). In addition, consistent with our previous findings, we detected a sig- nificantly increased expression of IL-1RI in NTreg as compared to Nconv, in all conditions (Figure 1C). In conclusion, efficient differentiation of NTreg to Th17 occurs following in

116 Letter to the Editor vitro stimulation of circulating naive CD4+ T cells in the presence of Th17 polarizing fac- tors. We observed no significant advantage to CD5 costimulation as compared to CD28. Furthermore, differentiation of human Th17 cells from conventional naive+ CD4 T cells in this model system remains less efficient than that from NTreg, even in the presence of CD5 costimulation. 5 r e t p a h C +

Figure 1. Human Th17 cells are preferentially generated from naive FOXP3+ Treg upon costimulation via CD28 or CD5. (A) CD4+ T cells isolated by magnetic cell sorting from healthy donors’ PBMC were stained with CD4, CD45RA, CCR7, CD25 and CD127 specific mAb and naive (N, CD45RA+CCR7+) CD4+ T cells were sorted into NTreg and Nconv populations according to CD25 and CD127 expression, as shown. Aliquots of sorted populations were stained with anti-FOXP3 mAb and analyzed by flow cytometry. (B) Sorted populations were stimulated in vitro with anti-CD2/3/28 or anti-CD2/3/5 coated beads in the absence or presence of Th1 (IL-12, 10 ng/mL) or Th17 (TGF-β, 5 ng/mL; IL-1β, 10 ng/mL; IL-23, 100 ng/mL) polarizing factors and cultured in the presence of IL-2. Aliquots of day 12 cultures were stimulated in the presence of PMA (100 ng/mL) and ionomycin (1 μg/mL) for 4 hours (the last 3 in the presence of brefeldin A, 10 μg/mL), stained with IL-17A and RORγt specific mAb and analyzed by flow cytometry. The proportions of IL-17+ and RORγt+ cells in the cultures are shown (mean ± SEM, n=4). (C) Aliquots of day 7 cultures, obtained as in (B), were stained with fluorochrome-labeled anti-IL-1RI mAb or with unlabeled anti-IL-23R antibodies followed by fluorochrome-labeled goat anti-rabbit Ig antibodies and analyzed by flow cytometry. The proportions of IL-23R+ and IL-1RI+ cells in the cultures are shown (mean ± SEM, n=4).

117 Chapter 5+

Acknowledgements

The study was supported by the Institut National du Cancer (France) and the Cancéropôle Îlede-France (France). C. Raffin is supported through a fellowship from the Ligue Contre le Cancer (France).

References

1. de Wit, J., Y. Souwer, A. J. van Beelen, G. R. de, F. J. Muller, B. H. Klaasse, T. Jorritsma, M. L. Kapsenberg, E. C. de Jong, and S. M. van Ham. 2011. CD5 costimulation induces stable Th17 development by promoting IL-23R expression and sustained STAT3 activation. Blood 118: 6107-6114. 2. Valmori, D., A. Merlo, N. E. Souleimanian, C. S. Hesdorffer, and M. Ayyoub. 2005. A peripheral circulating compartment of natural naive CD4 Tregs. J. Clin. Invest 115: 1953-1962. 3. Valmori, D., C. Raffin, I. Raimbaud, and M. Ayyoub. 2010. Human RORgammat+ TH17 cells preferentially differentiate from naive FOXP3+Treg in the presence of lineage-specific polarizing factors. Proc. Natl. Acad. Sci. U. S. A 107: 19402-19407. 4. Chung, Y., S. H. Chang, G. J. Martinez, X. O. Yang, R. Nurieva, H. S. Kang, L. Ma, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2009. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling. Immunity. 30: 576-587. 5. Raffin, C., I. Raimbaud, D. Valmori, and M. Ayyoub. 2011. Ex vivo IL-1 receptor type I expression in human CD4+ T cells identifies an early intermediate in the differentiation of Th17 from FOXP3+ naive regulatory T cells. J. Immunol. 187: 5196-5202.

118 Response to a Letter

Response: Priming of human naive CD4+ T cells via CD5 costimulation requires IL-6 for optimal Th17 development Jelle de Wit, Yuri Souwer, Femke J. M. Muller, Hanny Klaasse Bos, Tineke Jorritsma, Martien L. Kapsenberg, Esther C. de Jong, S. Marieke van Ham

With interest we read the letter by Ayyoub and coworkers who compare the efficacy of Th17 differentiation from naive FOXP3+CD25+CD127- NTregs and conventional naive T cells.1 We previously reported that compared to CD28, alternative costimulation via CD5 enhanced Th17 differentiation from CD4+CD45RA+CD4RO- naive T cells.2 CD5 promotes Th17 development through elevation of IL-23R expression, resulting in prolonged STAT3 activation and enhanced levels of ROR-γt. Ayyoub and coworkers also observed increased Th17 induction in naive CD4+ T cells by CD5. Costimulation of NTregs via CD28 or CD5 both induce more Th17, from which the authors conclude that Th17 differentiation from conventional naive CD4+ T cells is less efficient. We are pleased that our data on naive CD4+ T cells are confirmed, but observed a relatively weak efficiency of Th17 differentia- tion using naive CD4+ T cells. Moreover, no enhanced CD5-mediated expression of IL-23R 5 r e t p a h C and ROR-γt was observed. We noticed that the experiments were performed in absence of IL-6, which has been reported to be required for optimal Th17 development.3 Although not shown in our publication, we extensively investigated the contribution of IL-6 in the development of Th17 cells from naive CD4+ T cells (Figure 1). This data underlines the importance of IL-6 in Th17 development, especially upon CD5 costimulation. Without +

Figure 1. CD5 costimulation requires IL-6 for optimal Th17 differentiation. (A) FACS-sorted naive CD4+CD45RA+CD45RO- T cells were stimulated via platecoated CD3/CD28 or CD3/CD5 antibodies under Th17 polarizing conditions (30 ng/ml IL-23, 10 ng/ml IL-1β, 10 ng/ml IL-6, 10 ng/ml TGF-β and 10μg/ml anti-IFN-γ) in the presence of 10 U/ml IL-2. Intracellular levels of IL-17A were measured at day 11 after 5 hrs of restimula- tion with PMA, ionomycin and BFA. Data are from 7 independent experiments of individual donors. Statistical analyses were performed with paired t-test. (B) Naive T cells were stimulated by plate bound CD3/CD28 or CD3/CD5 antibodies and cultured in Th17 inducing conditions. Phospho-STAT3 levels were measured by FACS. Data shown are from 6 individual experiments with different donors, with mean + SD.(C and D) Real time semi- quantitative PCR (ABI PRISM 7000, SYBR green method) of IL23R (C) and RORC2 (D) mRNA expression of naive T cells stimulated for 3 days via coated CD3/CD28 or CD3/CD5 antibodies under Th17-polarising conditions. Results were normalized to 18S rRNA. Data shown are mean ± SD of triplicate measurement from 1 representa- tive experiment out of 3 independent experiments using different donors.

119 Chapter 5+

IL-6, CD5 costimulation was still superior for Th17 induction, in agreement with Ayyoub’s findings, but the efficiency of Th17 differentiation was strongly reduced (Figure 1A). In mice Nishihara and coworkers showed that IL-6 requirement of conventional naive CD4+ T cells for Th17 development is mediated by STAT3.4 Indeed, omission of IL-6 abrogated STAT3 activation by CD28 or CD5 costimulation within the first 18 hours (Figure 1B). Es- pecially for CD5-costimulation, this was followed by less pSTAT3 induction at later time points (Figure 1B). In line with this, IL-23R levels were also decreased in absence of IL-6 (Figure 1C). Again the strongest impact was observed on CD5-stimulated cells (± 80% reduction versus ± 35% with CD28, p<0.05, paired t-test, n=3). As expected,2 this also cor- related with strongly decreased levels of ROR-γt (p<0.05, paired t-test, n=3) (Figure 1D). Thus, IL-6 plays an important role in Th17 differentiation from naive CD4+ T cells, not only upon classical CD28 stimulation,3 but even more strongly in CD5 stimulation. The lack of IL-6 may explain why Ayyoub and coworkers did not observe increased IL-23R or ROR-γt in CD5-stimulated naive CD4+ T cells. Interestingly, their data also show that NTreg still efficiently form Th17 without IL-6. This may reflect earlier observations showing reduced IL-6R signaling in natural Tregs compared to CD4+CD25- T cells and only weak IL-6-induced STAT3 activation in Tregs compared to strong pSTAT3 induction in CD4+CD25− T cells.5 It is tempting to speculate that the latter also explains why CD5 is not superior to CD28 in NTreg costimulation. Taken together, the data of Ayyoub and coworkers show interesting new insights. To ascertain however if Th17 development from NTreg is superior to that from conventional naive CD4+ T cells, the concept that in different CD4+ subsets Th17 dif- ferentiation may be controlled by distinct regulatory factors should be integrated in the comparison. We look forward to further studies that will address this issue.

Acknowledgements

This work was supported by grants from the Landsteiner Foundation for Blood Research (grants 0533 and 0816) and Sanquin Blood Supply Foundation (PPOC 09-032).

120 Response to a Letter

References

1. Ayyoub, M., C. Raffin, and D. Valmori. 2012. Generation of Th17 from human naive CD4+ T cells prefer- entially occurs from FOXP3+ Treg upon co-stimulation via CD28 or CD5. Blood. 2. de Wit, J., Y. Souwer, A. J. van Beelen, G. R. de, F. J. Muller, B. H. Klaasse, T. Jorritsma, M. L. Kapsenberg, E. C. de Jong, and S. M. van Ham. 2011. CD5 costimulation induces stable Th17 development by promoting IL-23R expression and sustained STAT3 activation. Blood 118: 6107-6114. 3. Zhou, L., I. I. Ivanov, R. Spolski, R. Min, K. Shenderov, T. Egawa, D. E. Levy, W. J. Leonard, and D. R. Littman. 2007. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat. Immunol. 8: 967-974. 4. Nishihara, M., H. Ogura, N. Ueda, M. Tsuruoka, C. Kitabayashi, F. Tsuji, H. Aono, K. Ishihara, E. Huseby, U. A. Betz, M. Murakami, and T. Hirano. 2007. IL-6-gp130-STAT3 in T cells directs the development of IL-17+ Th with a minimum effect on that of Treg in the steady state. Int. Immunol. 19: 695-702. 5. Oberg, H. H., D. Wesch, S. Grussel, S. Rose-John, and D. Kabelitz. 2006. Differential expression of CD126 and CD130 mediates different STAT-3 phosphorylation in CD4+. Int. Immunol. 18: 555-563. 5 r e t p a h C +

121

Selective infection of antigen- specific B lymphocytes by Salmonella mediates bacterial survival and systemic spreading of infection 6

Yuri Souwer, Alexander Griekspoor, Jelle de Wit, Chiara Martinoli, Elena Zagato, Hans Janssen, Tineke Jorritsma, Yotam E. Bar-Ephraïm, Maria Rescigno, Jacques Neefjes and S. Marieke van Ham Y.S. & A.G. contributed equally to this work.

manuscript in preparation Chapter 6

Abstract

The bacterial pathogen Salmonella causes worldwide disease. A major route of intestinal entry involves M cells, providing access to B cell-rich Peyer’s Patches. Primary human B cells phagocytose Salmonella typhimurium upon recognition by the specific surface Ig receptor (BCR). As it is unclear how Salmonella disseminates systemically, we studied whether Salmonella can use B cells as a transport device for spreading. After phagocytosis by B cells, Salmonella survives intracellularly in a non-replicative state which is actively maintained by the B cell. Salmonella is later excreted followed by reproductive infection of other cell types. Salmonella-specific B cells thus act both as a survival niche and a reservoir for reinfection. Adoptive transfer of antigen-specific B cells before oral infection of mice showed that these B cells mediate in vivo systemic spreading of Salmonella to spleen and blood. This is a first example of a pathogen that abuses the specific cells of the adaptive immune system as transport vehicle for dissemination of infection.

124 B cells as specific bacterial transport vehicles

Introduction

Salmonella enterica is a Gram-negative, enteric pathogen responsible for diseases that lead to significant morbidity and mortality.1 After oral uptake, the bacterium crosses the intestinal epithelium via transcytosis of specialized M cells2 or via luminal capture by sampling dendritic cells.3,4 They are eventually internalized by macrophages, dendritic cells and neutrophils in the lamina propia.5,6 Cellular entry is actively induced by the bacterium through an array of effector proteins that orchestrate uptake by manipulating the host’s cellular machinery.7 Salmonella directs host cells during infection to alter the actin cytoskeleton allowing phagosomal cup formation and entry of the relatively large pathogen into host cells. Salmonella introduces bacterial effector proteins in the host cytosol via the Salmonella Type III Secretion System (TTSS). Salmonella can infect most cell types to form an intracellular vacuole called the Salmonella-containing vacuole (SCV). Here, another set of effectors is introduced into the host cytosol for vacuole maintenance and interference with the endosomal system to obtain nutrients and to prevent maturation and fusion with lysosomes.8,9 This involves the Akt-AS160-Rab14 cascade and PAK4.10 Salmonella replicates in an expanding SCV11,12 and may thus escape detection by the immune system.13,14 Although Salmonella replicates in the phagosomes, it remains unclear how the bacteria are released from the infected cell. Obvious mechanisms would involve apoptosis or necrosis of the infected cell, but such is not established. When Salmonella has passed the intestinal epithelium, it spreads via mesenteric lymph 15 nodes to liver, bone marrow and spleen where replication continues and disease ensues. 6 r e t p a h C How Salmonella reaches these organs is unclear. So far, dendritic cells, macrophages, neutrophils and CD18-expressing phagocytes have been implicated.4,16 Neutrophils however exhibit efficient bactericidal mechanisms17,6 that render these cells less favorite as vehicles for systemic bacterial dissemination. Similar to HIV (reviewed in 18), dendritic cells and macrophages may act as pathogen carriers for spreading of the infection, but are unlikely to cause spreading beyond mesenteric lymph nodes. We recently showed that primary human antigen-specific B cells are able to internalize Salmonella after recognition by the B cell receptor (BCR).19 As Salmonella gains immediate access to the B cell-rich areas of the Peyer Patches after intestinal invasion, it may be that B cells mediate spreading of Salmonella infection as well. Here we show that Salmonella can indeed use antigen-specific B cells as transport vehicle for spreading within the host. Salmonella survives intracellularly in a non-replicative state that is actively maintained by the B cell. Ultimately, Salmonella is excreted by the B cell followed by reinfection and replication in other cell types. Adoptive transfer of B cells with transgenic BCRs that specifically recognize hen egg lysozyme (HEL)-expressing Salmonella showed that

125 Chapter 6

Salmonella-specific B cells contribute to the in vivo systemic dissemination ofSalmonella in mice after oral administration of the bacteria. The antigen-specific B cells thus act as antigen-specific reservoirs and transport vehicles to release Salmonella at distant sites for further infection. These data provide the first example of the use of the adaptive immune system by bacterial pathogens for spreading infection in a situation analogous to the involvement of innate cells in spreading of HIV.

Materials and methods

Mice C57BL/6 mice (6–8 weeks old) were purchased from Harlan (Udine, Italy). BCR-HEL VDJ knock-in mice (a kind gift of Dr. J. Cyster, University of California, San Francisco) were bred under specific pathogen-free conditions at Charles River Laboratories. All experiments were performed in accordance with the guidelines established in the Principles of Laboratory Animal Care (directive 86/609/EEC).

Evaluation of Salmonella spreading in vivo CD43- naïve B cells were purified from spleens of BCR-HEL VDJ knock-in mice with CD43 (Ly-48) Microbeads (Miltenyi Biotec, Bologna, Italy) according to the manufacturer’s instructions. 106-2X105 cells were injected intravenously into C57BL/6 mice (14 mice per group) one day before oral infections. For evaluation of bacterial colonization experiments mice received 6x106 CFUs of HEL surface-expressing S. typhimurium SL1344 while transferred B cells were labeled with CFSE (2,5 μM) to monitor their spreading. 0, 24 and 72 hours after infection blood, spleens, mesenteric lymph nodes and liver were collected and processed; a fixed number of cells was lysed with 0.5% sodium-deoxycholate and plated onto TB-agar plates for CFU counting 12 hr later. In spleens and mesenteric lymph nodes the presence of CFSE positive B cells was assessed by FACS at the different time points.

Antibodies and bacterial strains mAb anti-human IgM (MH15, Sanquin, Amsterdam, The Netherlands) was mixed with rat anti-mouse IgG1 antibody (RM161.1, Sanquin) and mAb anti-S. typhimurium LPS (1E6, Biodesign International, Kennebunk, ME) to generate BCR-LPS tetrameric antibody

complexes. F(ab)2 fragments of MH15 were generated by standard pepsin digestion. Fluorescent secondary antibodies and Texas Red-phalloidin were from Molecular Probes (Leiden, The Netherlands). GFP-S. typhimurium SL1344 has been described.20 The S.

126 B cells as specific bacterial transport vehicles typhimurium strain 14028 containing the lux operon of P. luminescens (luxCDABE) was a kind gift from S. Vesterlund21 and K. Nealson. Exponentially grown bacteria were washed with PBS, incubated with BCR-LPS tetrameric antibody complexes for 30 min at RT, and washed twice to remove unbound antibodies. Surface HEL-expressing S. typhimurium SL1344 was generated by electroporating bacteria with a pVUB4 vector (kindly provided by P. Cornelis, Flanders Institute for Biotechnology, Brussels, Belgium22) in which inactive HEL-encoding gene was cloned in frame with the one encoding for OprI protein from P. aeruginosa under the control of LacZ promoter. HEL expression was induced by the addition of 1 mmol/L isopropyl-L-thio-B-D-galactopyranoside to exponentially growing bacteria.23

Lymphocyte isolation, infections and cell lines Isolation of human B cells from peripheral blood and culturing of the Ramos B cell line and NIH3T3 fibroblasts expressing human CD40L (3T3-CD40L) have been described,19 purity of peripheral B cells was determined by FACS analysis and was always >99%. B lymphocytes with viable uncoated bacteria and Ramos cells with viable anti-IgM coated bacteria were incubated at 20 bacteria per cell for 40 min at 37°C w/o antibiotics while tumbling. Next, cells were washed four times and cultured for 1h in media containing 100 µg/ml gentamycin (Invitrogen) to eliminate non-phagocytosed bacteria. Cells were cultured in RPMI 1640 medium with 5% FCS, p/s, 2 mM L-Glutamine, 50 μM 2-mercaptoethanol, 20 μg/ml human apo-transferrin ((Sigma-Aldrich) depleted for human IgG with prot-G

sepharose) and 10 µg/ml Gentamycin. 6 r e t p a h C

Live cell imaging and EM analyses Wide field microscopy was performed at 37ºC using 6-well plates (coated with Poly-L Lysine) and a Zeiss Axiovert 200 M microscope equipped with a FluorArc fluorescence lamp, motorized scanning stage, 63x LD Achroplan objective; NA 0.75 and climate chamber. Images were acquired using a Zeiss AxioCam MRm Rev.2 CCD in combination with the manufacturer’s AxioVision software. All experiments presented were repeated several times on different days, and results were consistent and reproducible. Further image processing was performed using the ImageJ software package. For EM, cells were allowed to take up anti-IgM coated bacteria for 4 hr before fixation in a mixture of paraformaldehyde (4%) and glutaraldehyde (0.5%). After embedding in a mixture of methyl cellulose and uranyl acetate, ultrathin sections were stained and analyzed with a Philips CM electron microscope.

127 Chapter 6

Intracellular survival and growth assays Human primary B cells were incubated in parallel experiments with either GFP- or Lux- expressing Salmonella. The percentage of living cells and GFP levels were determined using a FACS Calibur (Becton Dickinson). Bioluminescence was measured for 5s in a luminometer (Berthold). Bacterial growth was determined by dividing the relative bioluminescence signal by the relative number of GFP+ living B cells, resulting in the amount of light produced per bacteria containing B cell. For induction of apoptosis, cells were treated with 0.1 µM Edelfosine (Biomol).24

Imagestream analysis Primary B cells were incubated with anti-BCR coated, GFP-expressing Salmonella for 1 h in medium without antibiotics, and after washing cultured in the presence of gentamycin. B cell membrane was stained with CD20-PerCP/Cy5.5 (BD) and cells were analysed by ImagestreamX (Amnis) at indicated timepoints. Analyses were performed using IDEAS software (Amnis). Single cells were gated on Salmonella positivity, and only cells and Salmonella detected in the focal plane were selected for further analysis. Extracellular and intracellular Salmonella were discriminated by deltacentroid-xy analysis, measuring the distance of Salmonella to the center of the cell. The numbers of intracellular Salmonella were analyzed using the spot-count feature.

Bacterial excretion assay To visualize bacterial excretion, human primary B cells were incubated with uncoated GFP-Salmonella and followed using wide field microscopy in medium containing anti- LPS antibodies coupled to TexasRed. To quantify excretion, cells were stained with DAPI (Sigma-Aldrich) to exclude dead cells and anti-LPS coupled to APC and fixed with 3.7% formaldehyde before analysis using a LSR II (Becton Dickinson). For the increase in LPS levels, the initial level at time point 0 was set to 1. The percentage of excreted bacteria was calculated as the loss of GFP+/LPS- B cells compared to time point 0. To discriminate between bacterium and B cell-induced excretion, cells were cultured in medium containing 10µg/ml tetracycline to arrest intracellular bacteria (bacteriostatic capacity was verified using lux-Salmonella in Ramos cells).

Statistical analysis Kaplan-Meier plots and long-rank tests were used to assess survival differences of adoptively transferred mice after virulent S. typhimurium infection. Statistic calculations were performed by JMP 5.1 software (SAS, Cary, NC).

128 B cells as specific bacterial transport vehicles

Results

Salmonella survives in human primary antigen-specific B cells in a nonreplicative state We recently demonstrated that primary antigen-specific B cells phagocytose Salmonella typhimurium when the bacteria are recognized by the antigen-specific BCR.19 We now studied the fate of internalised Salmonella in more detail. To enhance the number of primary B cells that phagocytose bacteria for some of our experiments, we coated Salmonella with anti-LPS and anti-IgM tetrameric antibody complexes. These complexes bridge the bacterium and the BCR on B cells, leading to BCR crosslinking and uptake of Salmonella. Electron microscopy of primary human B cells incubated with Salmonella indeed demonstrate the occurrence of phagocytosis as it shows bacteria residing in phagosomes (Figure 1A). Pre-incubation of primary B cells with F(ab)2 fragments of the anti-IgM antibody before exposure to anti-IgM coated GFP-expressing Salmonella dramatically reduces the amount of GFP-Salmonella positive B cells, demonstrating that phagocytosis of Salmonella by B cells is mediated by the BCR (Figure 1B). To study the fate of Salmonella in B cells over extended periods of time, time-lapse imaging of GFP-tagged Salmonella containing B cells was performed using wide-field microscopy to limit phototoxicity. Phagocytosed GFP-Salmonella replicated in the Ramos B cell line (Figure 2A, top panel; see also Movie S1). Interestingly, no multiplication was detected in human primary B cells (Figure 2A, bottom panel; see also Movie S2). To quantify these

observations, we performed parallel experiments to compare GFP-Salmonella (detected 6 r e t p a h C by flow cytometry) with light producing lux-Salmonella (detected by luminometry). Light production by lux-Salmonella requires ATP and is thus a marker for bacterial viability,21 while the GFP signal only indicates the cellular presence of the bacteria. GFP-Salmonella

Figure 1. BCR-mediated internalization of Salmonella by primary human B cells. (A) Immunocryoelectron micrograph of primary human B cells that had phagocytosed anti-BCR coated Salmonella. Gold particles indicate staining for CD63, black asterisks mark bacteria, N marks the nucleus and PM the plasma membrane. (B) Primary B

cells were either or not pre-incubated with F(ab)2 fragments of the anti-IgM antibody before incubation with live anti-IgM coated GFP- expressing Salmonella. After extensive washing, cells were fixed and analyzed by FACS indicating a strong reduction in GFP-Salmonella

following competition with F(ab)2 for BCR interactions. Shown is a representative plot of 5 donors tested.

129 Chapter 6

Figure 2. Primary human B cells form a survival niche for intracellular Salmonella. (A) Widefield fluorescence microscopy of living Ramos and primary human B cells with phagocytosed anti-IgM coated GFP-Salmonella. Depicted are GFP signals projected on the transmission image. Scalebar = 10µm. Number of bacteria in the visualized cell is given in the lower right corner. Lower left corner: time after Salmonella infection. Images are frames from Movie S1 and S2. (B) Analysis of Ramos and primary human B cells incubated with living anti-IgM coated lux- expressing (top left panel) or GFP-expressing (top right panel) Salmonella. The ratio of lux over GFP shows the amount of light produced per GFP- Salmonella positive B cell (bottom left panel), indicating intracellular Salmonella viability. The mean fluorescence of the GFP positive population, set arbitrarily at 1 at the beginning of the experiment, shows that the GFP signal increases in Ramos B cells, whereas it decreased in primary human B cells (bottom right panel). A representative example of three independent experiments is shown. (C) B cells were infected with anti-BCR coated GFP-expressing Salmonella before exposure to Edelfosine to induce apoptosis. Cells were imaged over a 14h period. Top panel: transmission image, bottom panel: GFP-signal. Scalebar = 10µm. Images are frames from Movie S3.

was used to determine the number of infected B cells at the different time points. Figure 2B shows that the GFP-Salmonella phagocytosed by Ramos cells expanded intracellularly. Over a time course of 10h, the lux activity increased strongly (Figure 2B, top left panel), while the number of Ramos cells positive for GFP-Salmonella remained nearly constant (Figure 2B, top right panel). This implies an increase in the amount of light produced per GFP-Salmonella positive Ramos cell (Figure 2B, bottom left panel), confirming an increase in numbers of bacteria per Ramos cell over time. In accordance, the GFP signal per Ramos cell increased (Figure 2B, bottom right panel) while lux activity decreased over time when Salmonella was phagocytosed by primary human B cells (Figure 2B, top left panel). This was not due to intracellular killing of Salmonella as the fraction of GFP-Salmonella containing B cells declined equally fast (Figure 2B, top right panel). In fact, the amount of light produced per living GFP-Salmonella positive B cell remained constant during the course of the experiment (Figure 2B, bottom left panel), showing that the GFP-positive Salmonella remained viable in primary human B cells, albeit under conditions of inhibited replication. Thus, these data confirm the wide-field microscopy data in Figure 2A and show that Salmonella does not replicate in primary B cells. Unlike specialized phagocytic

130 B cells as specific bacterial transport vehicles immune cells such as macrophages, neutrophils, or B cells from early vertebrates,25 human B cells are apparently inefficient in producing the microbicidal conditions that are required to eliminate Salmonella. We next investigated whether primary B cells actively suppress Salmonella growth. We selectively induced apoptosis of human primary B cells (without affectingSalmonella ; not shown) and measured Salmonella replication. Intracellular replication of Salmonella was no longer suppressed 2h after induction of apoptosis in primary B cells with the alkyl- lysophopholipid Edelfosine24 (Figure 2C; see also Movie S3), demonstrating that growth arrest of Salmonella requires viable primary B cells. These data suggest that primary human B cells, unlike human B cell lines, actively suppress multiplication of intracellular Salmonella within the SCV.

Salmonella is excreted by infected B cells The observation that the number of primary B cells that had phagocytosed Salmonella 6 r e t p a h C

Figure 3. Salmonella is actively excreted by B cells. (A) Primary B cells having phagocytosed anti-BCR coated GFP-Salmonella on a monolayer of 3T3-CD40L fibroblasts were imaged using widefield fluorescence microscopy. Depicted is the GFP signal projected on the transmission image with images taken every 30 min. Scalebar = 10µm. Arrows indicate the B cell, white arrow: B cells moves op top of the monolayer, black arrow: B cells moves below the monolayer. Images are frames from Movie S4. (B) Primary B cells having phagocytosed anti- BCR coated GFP-Salmonella on a monolayer of 3T3-CD40L fibroblasts were imaged using widefield fluorescence microscopy in the presence of TexasRed labeled anti-LPS mAbs. Depicted are GFP and Texas-Red signals projected on the transmission image. Scalebar = 10µm. Images are frames from Movie S5. (C) Quantification of Salmonella secretion from B cells. Primary B cells were incubated with live uncoated GFP-Salmonella. Cells were stained with antibodies against LPS, fixed and analyzed using FACS. Left panel: increase in cell surface exposed LPS from bacteria exposed at the cell surface after initial uptake by B cells. Middle panel: percentage of B cells having excreted Salmonella as calculated from the percentage of B cells containing GFP-Salmonella followed in time. Right panel: left and middle panels are projected to illustrate that both processes show similar kinetics. Error bars represent SD from three independent experiments. (D) Primary B cells were incubated with live uncoated GFP-expressing Salmonella and followed for the time points indicated. The fraction of living B cells is plotted to demonstrate that loss of GFP-Salmonella positive B cells is not correlated with cell death.

131 Chapter 6

dropped during prolonged culture of the Salmonella-containing B cells (Figure 2B, top right panel) suggested that Salmonella might be released from the B cells over time. To visualize the fate of phagocytosed Salmonella in B cells, primary human B cells infected with GFP-Salmonella were co-cultured on a monolayer of CD40L-expressing 3T3 cells and analyzed by time-lapse wide-field microscopy. Primary B cells that had phagocytosed GFP-Salmonella showed extensive invasive behavior by continuously moving under and over the 3T3-CD40L monolayer (Figure 3A; see also Movie S4). At later time points, a fraction of GFP-Salmonella appeared to be released from the B cell. To visualize this in more detail, GFP-Salmonella infected primary B cells were cultured in the presence of a low concentration of Texas-Red labeled anti-LPS mAb in the medium. GFP-Salmonella will attract and concentrate this antibody only upon exposure to the extracellular medium and are excluded from antibody recognition when confined to the B cell interior. Figure 3B shows a B cell with phagocytosed GFP-Salmonella that becomes accessible for anti-LPS antibodies in the medium after 5-8 hr of culture (Movie S5). Salmonella excretion from primary B cells was quantified using FACS by detecting GFP-Salmonella and LPS-positive B cells. A strong increase in cell surface exposed LPS on cells that were initially GFP- Salmonella positive and LPS negative was observed (Figure 3C, left panel). This suggests that a large fraction of the phagocytosed Salmonella were exocytosed as in the example shown in Figure 3B. Accordingly, the population of GFP-Salmonella positive/LPS-negative B cells declined over time (Figure 3C, middle panel) with kinetics that were identical to the acquired LPS signal (Figure 3C, right panel), inferring an increased excretion. GFP- Salmonella infection of primary B cells did not affect B cell viability or induced apoptosis (Figure 3D). Note that during the first phase of excretion Salmonella was released,

Figure 4. Quantification of the fate of the GFP-expressing Salmonella in infected B cells. (A) B cells were infected with anti-BCR coated GFP-expressing Salmonella (green). The plasma membrane of the B cells (red) was stained using an anti-CD20 mAb to discriminate between intracellular and extracellular Salmonella. (B) The relative amount of intracellular Salmonella were measured immediately after infection (0 h), or 4h and 18h post-infection. Error bars represent SD from two independent experiments. (C) The number of Salmonella per B cell was measured immediately after infection and 18h post-infection. A representative experiment of two individual experiments is shown.

132 B cells as specific bacterial transport vehicles but remained associated to the B cells, hence the increased staining with the anti-LPS antibodies in the first 10h. The bacterium was later released from the B cell, leveling off further LPS labeling. Loss of the GFP-Salmonella signal from infected primary B cells increased over an 18h period in our experiments at which point more than 50% of the bacteria were released from B cells. Bacterial excretion was further quantified by Imagestream analyses. This technique directly combines quantitative information obtained by flow cytometery with the visual information of subcellular bacterial localization by microscopy. Specific gating of B cells that had phagocytosed bacteria enabled exact follow-up of B cells with internalized bacteria over time (Figure 4A). Analysis showed a gradual decrease of intracellular Salmonella within 18 hrs of infection (Figure 4B). In addition, we tracked the numbers of internalized Salmonella per B cell over time, by separating the B cells that had phagocytosed Salmonella into different pools based on the GFP-signal per B cell (supplemental Figure 1). Immediately after infection, B cells had internalized between 1 and 4 bacteria per cell. Only 1 or 2 bacteria remained per B cell 18 hours later (Figure 4C). In conclusion, our data show that a substantial fraction of phagocytosedSalmonella is slowly secreted during the first 24 hrs. This mechanism is not tightly regulated as secretion occurs at an almost linear rate over the first 10 hours of culture post-infection.

Excretion of Salmonella is a B cell autonomous process The excretion of Salmonella may be controlled by the pathogen or by the B cells. In

our experiments we added antibiotic gentamycin at low concentrations to the medium 6 r e t p a h C Figure 5. After excretion by B cells, Salmonella is capable of infecting secondary host cells. (A) Left panel: the effect of antibiotics on the growth of lux- Salmonella in Ramos B cells. Right panel: the same FACS analysis with primary B cells as in 2C was performed in presence of either Gentamycin or Tetracycline to discriminate between host and bacteria mediated excretion. (B) Quantification of Salmonella secretion from B cells. Primary B cells were incubated with live uncoated GFP-Salmonella in presence of either Gentamycin or Tetracycline to discriminate between host versus bacterial-mediated excretion. Cells were stained with antibodies against LPS, fixed and analyzed using FACS. Increase in cell surface LPS levels is similar in the presence of Gentamycin and Tetracycline, indicating that viableSalmonella are not required for excretion. (C) Primary B cells having phagocytosed anti-IgM coated GFP-Salmonella on a monolayer of 3T3-CD40L fibroblasts were imaged using widefield fluorescence microscopy for the times indicated. Imaging conditions are similar as in 2A. GFP-Salmonella is excreted from a primary B cell (white arrowhead), followed by infection of the 3T3-CD40L monolayer (outline of infected cell marked by a dashed line). Inset shows zoom-in on primary B cell excreting GFP-Salmonella. Images are frames from Movie S6.

133 Chapter 6

to eliminate extracellular Salmonella (and prevent overgrowth of the cells by free Salmonella), as gentamycin does not affect intracellular Salmonella replication (see Figure 2A). Unlike gentamycin, the antibiotics tetracycline and erythromycin are able to enter phagosomes and eliminate intracellular Salmonella.26 We validated this by testing growth of lux-Salmonella in Ramos cells. Tetracyclin and erythromycin inhibited intracellular Salmonella growth in Ramos cells (Figure 5A, left panel). In addition, no viable Salmonella bacteria were recovered in plating assays of infected B cells, while bacterial colonies were obtained from Salmonella-containing B cells exposed to gentamycin (data not shown). Salmonella secretion by primary B cells was measured in the presence of either gentamycin or tetracycline to test whether viable bacteria were required for B cell secretion. Tetracycline did not affect excretion of GFP-Salmonella from primary B cells. In fact, this occurred equally efficient as B cell excretion in the presence of gentamycin (Figure 5A, right panel), indicating that viability ofSalmonella is not required for excretion. This was further confirmed by the observation that cell surface LPS levels increased at a similar rate when infected B cells were cultured in the presence of tetracycline as in the presence of gentamycin (Figure 5B). While Salmonella actively participates in uptake after capture by the BCR,19 excretion does not require viable Salmonella.

Excretion of Salmonella from B cells allows reproductive reinfection of other cell types As Salmonella survives within antigen-specific B cells, Salmonella could also infect other cell types when released from B cells at distant sites. We co-cultured primary human B cells containing phagocytosed GFP-Salmonella on a monolayer of 3T3-CD40L and followed the behavior of Salmonella using time-lapse wide-field microscopy. Figure 5C shows an example of a phagocytosed GFP-Salmonella entering the field of imaging. The GFP- Salmonella is released from the B cells and infects the underlying fibroblast monolayer, followed by rapid expansion inside these fibroblasts (see Movie S6). The released bacteria not only infected but also resumed replication in the fibroblast monolayer, demonstrating that its passage through primary B cells had not disabled bacterial replication in an irreversible manner. Collectively these data suggest that Salmonella can use primary Salmonella-specific B cells as a survival reservoir and transport vehicle allowing escape from immune attack and transfer to distant locations.

Salmonella-specific B cells mediate spreading in acute in vivo infection Our observations imply that the availability of B cells with pathogen-specific BCRs may support spreading of infection when used as carriers for Salmonella. In vivo, Salmonella first encounters B cells after crossing the intestinal epithelium via the M cells. The M cells are directly located over the gut-associated lymphoid tissue (GALT) sites where many

134 B cells as specific bacterial transport vehicles

B cells reside in Peyer’s patches. Among preferred distant sites of persistent infection for Salmonella are the spleen and mesenteric lymph nodes. Indeed, Salmonella has been isolated from splenic macrophages and splenic B cells of orogastrically infected mice.27 How Salmonella spreads from the GALT to peripheral compartments is unclear. Transport of viable Salmonella by neutrophils16 is probably inefficient given their efficient bactericidal capacity.5 Also macrophages and DCs have been implicated, but their spreading beyond the mesenteric lymph nodes is unlikely. Antigen-specific B cells as transport vehicles have not been considered. To test this optionin vivo, different numbers of CD43- naive murine B cells carrying a BCR specific for the HEL antigen were adoptively transferred into WT C57BL/6 mice. One day after transfer, mice were orally infected with surface HEL-expressing Salmonella. To directly establish if HEL-specific B cells circulate and mediate systemic dissemination of HEL-expressing Salmonella, we investigated both B cell and bacterial recovery from mesenteric lymph nodes, spleen and blood in the different experimental settings, 24 and 72 h after oral infection. Various organs or blood were collected and cells and Salmonella isolated. Transferred CFSE-labeled B cells were detected in the mesenteric lymph nodes and spleen and there were no signs of evident expansion (Figure 6A). Salmonella infection did not affect HEL+-B cell recovery from the organs. Lysis of organs recovered from infected mice followed by plating of 6 r e t p a h C

Figure 6. Salmonella-specific B cells form a survival niche that support invivo Salmonella spreading to systemic sites. C57BL/6 mice were adoptively transferred with 0, 2x105 or 106 HEL-specific CD43- naïve B cells labeled with CFSE, as indicated. Mice were orally infected with surface HEL-expressing Salmonella one day after B cell transfer. (A) Distribution of CFSE-labeled HEL-specific B cells in the mesenteric lymph nodes (mLN) and spleen before infection (BI), and 24 or 72 hours post-infection, as indicated. One representative example from 3 experiments with 4 mice for each experimental setting is shown. (B) Recovery of viable bacteria 72 hours post-infection from mesenteric lymph nodes (mLN) spleen (SP) and blood (BL) in infected mice transferred with 0, 2x105 or 106 HEL-specific B cells. Depicted are colony-forming units (CFU)/105 eukaryotic cells. One representative example from 3 experiments with 4 mice for each experimental setting is shown.

135 Chapter 6

the bacteria revealed the number of Colony Forming Units (CFU) in each compartment. Oral infection of mice with HEL-expressing Salmonella without adoptive B cell transfer resulted after 72 h after infection in prominent infiltration of the mesenteric lymph nodes and limited spreading to the spleen (Figure 6B). No bacteria were detected in circulating blood cells at the time of sampling, which points to low numbers of Salmonella infected cells in blood or a relative short transit time of the cells. Transfer of HEL-specific B cells slighty reduced bacterial dissemination to the mesenteric lymph nodes, but substantially enhanced spreading of Salmonella to the spleen (Figure 6B). In addition, Salmonella was now retrieved systemically from circulating cells in the blood compartment (Figure 6B). These data show that in this oral-infection model antigen-specific B cells do not only promote local spreading of Salmonella to the mesenteric lymph nodes, but strongly support systemic dissemination ofSalmonella into the circulating blood pool and spleen. B cells thus form a novel player in the repertoire of immune cells that can be captured by pathogens for spreading and infection of distant sites.

Discussion

Recent data indicated that B cells from early vertebrates act as efficient phagocytes unlike mammalian B cells that did not show phagocytic behavior.25 We demonstrated that human B cells have not lost this phagocytic capacity but require the BCR for phagocytosis of particles or pathogens.19 Phagocytosed Salmonella infects and grows in many cell types, but can only be efficiently destroyed in specialized cells like macrophages and neutrophils by the NADPH-oxidase system.5 We previously noticed survival of Salmonella in B cells after BCR-mediated internalization and now studied the fate of these phagocytosed Salmonellae and the consequences for dissemination of infection in vivo. We demonstrated that Salmonella can be excreted from primary B cells in time. The factors controlling Salmonella excretion are unclear. Our data suggest that the B cell rather than the bacterium controls this process, as both living and dead Salmonella can be excreted. Since many bacterial pathogens manipulate the host cell cell biology for survival, uptake by pathogen-specific B cells followed by release of the pathogen at distant sites may be a more general mechanism for pathogen spreading. Identification and manipulation of signaling pathways to prevent excretion would be a possible means to limit systemic spreading of Salmonella and potentially of other pathogens by B cells. Does BCR-mediated immune escape and spreading by B cells play an important role during Salmonella infection? The bacteria will potentially encounter specific B cells very early during infection as they cross the intestinal epithelium and enter the GALT sites.

136 B cells as specific bacterial transport vehicles

Among preferred sites of persistent infection are localized mesenteric lymph nodes and the more distant spleen. Salmonella was thought to reach these locations after transport by neutrophils,16 a notion difficult to match with the efficient bactericidal capacity of neutrophils.5 Our experiments indicate that Salmonella-specific B cells act as transport cariers for the in vivo spreading of Salmonella to the distant sites. In the event of excretion in B cell rich areas like the spleen and GALT, the bacterium might even go through multiple rounds of uptake (by other resident Salmonella-specific B cells), dissemination, and excretion. Salmonella thus abuses the specificity of the adaptive immune system to hide from the early innate immune defenses while hitch-hiking inside the B cell ensures systemic spreading of the infection. Dissemination of Salmonella to mesenteric lymph nodes does not require B cells, consistent with the concept that Salmonella-infected DCs can reach the mesenteric lymph nodes and may thus mediate this localized transport.4,3,28 Salmonella survives in phagosomes in primary human B cells in a growth arrested manner. Salmonella replicates in other cell types via a pathway involving activation of the kinase Akt1.10 In B cells, Akt-signalling is negatively regulated after BCR-triggering by Rap1 and Rap2 GTPases.29 Whether this explains the control of Salmonella replication in human primary B cells remains to be established. An effective CD8+ cytotoxic T cell response is essential to control Salmonella infection,30,31 possibly to eliminate Salmonella hiding inside cells. Our data show that also systemic spreading of Salmonella will be limited by elimination of the intracellular bacteria in B cells. Thus, vaccination strategies that aim to induce both Salmonella-specific antibodies andSalmonella -restricted CD8+ T cells may

yield strong synergistic effects. 6 r e t p a h C In the larger concept of coevolution of pathogens and the eukaryotic immune system, it is striking that Salmonella abuses the specificity of the adaptive immune system. Previously, it was shown that cells of the innate system and erythrocytes can be used by pathogens for systemic spreading of infection within immunocompetent hosts. Examples include HIV (DCs)32 and P. falciparum (erythrocytes).33 The adaptive immune system has evolved to clear infection, while simultaneously generating immunological memory to ensure rapid immunity against reinfection. We now show that pathogen-recognizing immune cells from the adaptive immune system can be applied by bacteria to escape direct recognition by other immune cells and to mediate bacterial dissemination. Although the adaptive immune system responds to pathogens to limit infection, some pathogens, as illustrated here for Salmonella, have adapted to this response and use this specific system for survival and systemic spreading.

137 Chapter 6

Acknowledgements

We thank Marije Marsman and Coenraad Kuyl for discussions and help with the Salmonella experiments, Lauran Oomen and Lenny Brocks for support with CLSM imaging, Erik Mul, Floris van Alphen, Anita Pfauth and Frank van Diepen for flow cytometry and Nico Ong for photography. This work was supported by grants from the Dutch Cancer Society KWF (grant NKI 2001-2415), the Landsteiner Foundation for Blood Research (LSBR, grant 0533), Sanquin Blood Supply PPOC (PPOC 09-032) and the Netherlands Scientific Organization N.W.O.

Supplemental

Figure S1. GFP-Salmonella distribution per cell after 0 hours. B cells were infected with anti- BCR coated GFP-expressing Salmonella and the number of intracellular Salmonella was analyzed by ImagestreamX. Using IDEAS spot-count feature the numbers of intracellular Salmonella were discriminated by either one, two or three and more Salmonella per cell. Shown are examples of Salmonella count from one representative experiment of two independent experiments.

138 B cells as specific bacterial transport vehicles

References

1. Jones, B. D., and S. Falkow. 1996. Salmonellosis: host immune responses and bacterial virulence determinants. Annu. Rev. Immunol. 14: 533-561. 2. Jepson, M. A., and M. A. Clark. 2001. The role of M cells in Salmonella infection.Microbes. Infect. 3: 1183- 1190. 3. Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P. Kraehenbuhl, and P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat. Immunol. 2: 361-367. 4. Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le, R. Berggren, W. T. Parks, and F. C. Fang. 1999. Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 401: 804-808. 5. Fierer, J. 2001. Polymorphonuclear leukocytes and innate immunity to Salmonella infections in mice. Microbes. Infect. 3: 1233-1237. 6. Wick, M. J. 2004. Living in the danger zone: innate immunity to Salmonella. Curr. Opin. Microbiol. 7: 51- 57. 7. Patel, J. C., and J. E. Galan. 2005. Manipulation of the host actin cytoskeleton by Salmonella--all in the name of entry. Curr. Opin. Microbiol. 8: 10-15. 8. Gorvel, J. P., and S. Meresse. 2001. Maturation steps of the Salmonella-containing vacuole. Microbes. Infect. 3: 1299-1303. 9. Holden, D. W. 2002. Trafficking of the Salmonella vacuole in macrophages. Traffic. 3: 161-169. 10. Kuijl, C., N. D. Savage, M. Marsman, A. W. Tuin, L. Janssen, D. A. Egan, M. Ketema, N. R. van den, S. J. van den Eeden, A. Geluk, A. Poot, M. G. van der, R. L. Beijersbergen, H. Overkleeft, T. H. Ottenhoff, and J. Neefjes. 2007. Intracellular bacterial growth is controlled by a kinase network around PKB/AKT1. Nature 450: 725-730. 11. Fields, P. I., R. V. Swanson, C. G. Haidaris, and F. Heffron. 1986. Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent. Proc. Natl. Acad. Sci. U. S. A 83: 5189-5193. 6 r e t p a h C 12. Meresse, S., K. E. Unsworth, A. Habermann, G. Griffiths, F. Fang, M. J. Martinez-Lorenzo, S. R. Waterman, J. P. Gorvel, and D. W. Holden. 2001. Remodelling of the actin cytoskeleton is essential for replication of intravacuolar Salmonella. Cell Microbiol. 3: 567-577. 13. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies for overcoming host innate and adaptive immune responses. Nat. Immunol. 3: 1033-1040. 14. Zwart, W., A. Griekspoor, C. Kuijl, M. Marsman, J. van Rheenen, H. Janssen, J. Calafat, M. van Ham, L. Janssen, M. van Lith, K. Jalink, and J. Neefjes. 2005. Spatial separation of HLA-DM/HLA-DR interactions within MIIC and phagosome-induced immune escape. Immunity. 22: 221-233. 15. Gasem, M. H., M. Keuter, W. M. Dolmans, D. Van, V, R. Djokomoeljanto, and J. W. Van Der Meer. 2003. Persistence of Salmonellae in blood and bone marrow: randomized controlled trial comparing ciprofloxacin and chloramphenicol treatments against enteric fever. Antimicrob. Agents Chemother. 47: 1727-1731. 16. Richter-Dahlfors, A., A. M. Buchan, and B. B. Finlay. 1997. Murine salmonellosis studied by confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts a cytotoxic effect on phagocytes in vivo. J. Exp. Med. 186: 569-580. 17. Mastroeni, P. 2002. Immunity to systemic Salmonella infections. Curr. Mol. Med. 2: 393-406. 18. Wu, L., and V. N. KewalRamani. 2006. Dendritic-cell interactions with HIV: infection and viral dissemination. Nat. Rev. Immunol. 6: 859-868. 19. Souwer, Y., A. Griekspoor, T. Jorritsma, J. de Wit, H. Janssen, J. Neefjes, and S. M. van Ham. 2009. B cell

139 Chapter 6

receptor-mediated internalization of salmonella: a novel pathway for autonomous B cell activation and antibody production. J. Immunol. 182: 7473-7481. 20. Marsman, M., I. Jordens, C. Kuijl, L. Janssen, and J. Neefjes. 2004. Dynein-mediated vesicle transport controls intracellular Salmonella replication. Mol. Biol. Cell 15: 2954-2964. 21. Vesterlund, S., J. Paltta, A. Laukova, M. Karp, and A. C. Ouwehand. 2004. Rapid screening method for the detection of antimicrobial substances. J. Microbiol. Methods 57: 23-31. 22. Cornelis, P., J. C. Sierra, A. Lim, Jr., A. Malur, S. Tungpradabkul, H. Tazka, A. Leitao, C. V. Martins, C. di Perna, L. Brys, P. De Baetseller, and R. Hamers. 1996. Development of new cloning vectors for the production of immunogenic outer membrane fusion proteins in Escherichia coli. Biotechnology (N. Y. ) 14: 203-208. 23. Martinoli,C., A. Chiavelli, and M. Rescigno. 2007. Entry route of Salmonella typhimurium directs the type of induced immune response. Immunity. 27: 975-984. 24. Ruiter, G. A., S. F. Zerp, H. Bartelink, W. J. van Blitterswijk, and M. Verheij. 1999. Alkyl-lysophospholipids activate the SAPK/JNK pathway and enhance radiation-induced apoptosis. Cancer Res. 59: 2457-2463. 25. Li, J., D. R. Barreda, Y. A. Zhang, H. Boshra, A. E. Gelman, S. Lapatra, L. Tort, and J. O. Sunyer. 2006. B lymphocytes from early vertebrates have potent phagocytic and microbicidal abilities. Nat. Immunol. 7: 1116-1124. 26. Kihlstrom, E., and L. Andaker. 1985. Inability of gentamicin and fosfomycin to eliminate intracellular Enterobacteriaceae. J. Antimicrob. Chemother. 15: 723-728. 27. Rosales-Reyes, R., C. Alpuche-Aranda, M. L. Ramirez-Aguilar, A. D. Castro-Eguiluz, and V. Ortiz- Navarrete. 2005. Survival of Salmonella enterica serovar Typhimurium within late endosomal-lysosomal compartments of B lymphocytes is associated with the inability to use the vacuolar alternative major histocompatibility complex class I antigen-processing pathway. Infect. Immun. 73: 3937-3944. 28. Bogunovic, M., F. Ginhoux, J. Helft, L. Shang, D. Hashimoto, M. Greter, K. Liu, C. Jakubzick, M. A. Ingersoll, M. Leboeuf, E. R. Stanley, M. Nussenzweig, S. A. Lira, G. J. Randolph, and M. Merad. 2009. Origin of the lamina propria dendritic cell network. Immunity. 31: 513-525. 29. Christian, S. L., R. L. Lee, S. J. McLeod, A. E. Burgess, A. H. Li, M. Dang-Lawson, K. B. Lin, and M. R. Gold. 2003. Activation of the Rap GTPases in B lymphocytes modulates B cell antigen receptor-induced activation of Akt but has no effect on MAPK activation. J. Biol. Chem. 278: 41756-41767. 30. de Wit, J., Y. Souwer, T. Jorritsma, B. H. Klaasse, A. ten Brinke, J. Neefjes, and S. M. van Ham. 2010. Antigen-specific B cells reactivate an effective cytotoxic T cell response against phagocytosed Salmonella through cross-presentation. PLoS. One. 5: e13016. 31. Salerno-Goncalves, R., and M. B. Sztein. 2009. Priming of Salmonella enterica serovar typhi-specific CD8(+) T cells by suicide dendritic cell cross-presentation in humans. PLoS. One. 4: e5879. 32. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. KewalRamani, D. R. Littman, C. G. Figdor, and Y. van Kooyk. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100: 587-597. 33. Miller, L. H., D. I. Baruch, K. Marsh, and O. K. Doumbo. 2002. The pathogenic basis of malaria. Nature 415: 673-679.

140 Antigen-specific B cells reactivate an effective cytotoxic T cell response against phagocytosed Salmonella through cross- presentation 7

Jelle de Wit, Yuri Souwer, Tineke Jorritsma, Hanny Klaasse Bos, Anja ten Brinke, Jacques Neefjes and S. Marieke van Ham

PLoS One. 2010 Sep 27;5(9):e13016 Chapter 7

Abstract

The eradication of facultative intracellular bacterial pathogens, like Salmonella typhi, requires the concerted action of both the humoral immune response and the cytotoxic CD8+ T cell response. Dendritic cells (DCs) are considered to orchestrate the cytotoxic CD8+ T cell response via cross-presentation of bacterial antigens onto MHC class I molecules. Cross-presentation of Salmonella by DCs however, is accompanied by the induction of apoptosis in the DCs. Besides antibody production, B cells are required to clear Salmonella infection for other unknown reasons. Here we show that Salmonella- specific B cells that phagocytoseSalmonella upon BCR-ligation reactivate human memory CD8+ T cells via cross-presentation yielding aSalmonella -specific cytotoxic T cell response. The reactivation of CD8+ T cells is dependent on CD4+ T cell help. Unlike the DCs, B cell- mediated cross-presentation ofSalmonella does not coincide with apoptosis. B cells form a new player in the activation of the cytotoxic effector arm of the immune response and the generation of effective adaptive immunity inSalmonella infection.

142 Cross-presentation by B cells

Introduction

Salmonella is a pathogenic bacterium that causes severe disease in mice and man. Salmonella typhi (Salmonella enterica serovar Typhi) causes invasive diseases in human, which has many features in common with Salmonella typhimurium in mice. The gastrointestinal tract is the major site of primary infection of the host and has to be passed before systemic infection can occur. One way to infect the host cells is via sampling of bacteria by DCs in the intestine. In vitro studies showed that DCs located in the lamina propria under the gut epithelium of the small bowel extend processes across the tight junctions between the epithelial cells and capture bacteria from the luminal side of the gut.1, 2 The major route of infection however, is via microfold cells or M cells.3, 4 The specialized antigen-sampling M cells are located in the dome region of the Peyer’s Patches and are efficient in transportation of macromolecules and microorganisms to the underlying immune cells.2, 5 Like other Gram-negative bacteria, Salmonella uses specific virulence factors to invade other cell types, called the Type III Secretion System (TTSS). Many Salmonella virulence genes are clustered in Salmonella pathogenicity islands (SPIs). SPI-1 and SPI-2 encode TTSSs that mediate the injection of effector proteins into the host cell cytoplasm via sophisticated secretion devices.6 SPI-1 is associated with invasion of intestinal epithelia and enhanced intestinal inflammation in the infected host.7, 8 SPI-2 modulates intracellular trafficking and enables replication within a modified vacuolar compartment, called the Salmonella-containing vacuole (SCV) 9-11 and enhances inflammation during enteric phase.12, 13 Salmonella activates the PKB/Akt1 pathway to prevent maturation of SCV into destructive phagolysosomes, thus manipulating the host for its own survival.14 After transcytosis by M cells, Salmonella reaches the subepithelial dome of the Peyer’s patches and encounters an extensive network of resident macrophages, DCs and great 7 r e t p a h C numbers of B cells.15, 16 Instead of being immediately destroyed by these cells, Salmonella have evolved several mechanisms to survive in the harsh milieu of phagosomal compartments 17 and can be cytotoxic to macrophages by inducing apoptosis in vitro.18, 19 Recently, we showed that recognition ofSalmonella via the specific B cell receptor (BCR) on B cells results in internalization ofSalmonella . Salmonella is able to survive intracellularly in primary B cells in a non-replicative state.20 Following uptake of Salmonella, B cells do not go into apoptosis, but differentiate and start to produce Salmonella-specific antibodies. In addition, BCR-mediated phagocytosis of Salmonella by B cells leads to antigen presentation via MHC class II and subsequent CD4+ T cell activation, which in turn boosts antibody production by the infected B cell. Antibody transfer studies have shown that the requirement for B cells in the clearance of

143 Chapter 7

Salmonella does not solely depend on antibody formation.21 Which additional immune responses need B cell involvement remains unclear. For clearance of Salmonella, not only the humoral immune response is required, but also the activation of cytotoxic CD8+ T cells is needed to eliminate Salmonella-infected cells. Recently, DCs have been shown to activate Salmonella-specific CD8+ memory T cells after direct uptake of bacteria or via suicide cross-presentation after uptake of S. typhi-infected human cells.22 As the generation of Salmonella antigens for MHC class II molecules is an efficient process in infected B cells, we tested whether BCR-mediated phagocytosis also leads to cross- presentation of Salmonella antigens via the MHC class I pathway of B cells and whether this elicits a cytotoxic T cell response against Salmonella-infected cells. Here we show that Salmonella-specific primary B cells that have internalized Salmonella do cross-present Salmonella antigens via MHC class I in a proteasome-dependent manner. Cross-presentation ofSalmonella antigens by B cells reactivatesSalmonella -specific CD8+ memory cells that acquire a cytotoxic phenotype and are efficient in killing ofSalmonella - infected cells. Thus, antigen-specific B cells are an under appreciated type of cell for the induction of a cytotoxic T cell response against facultative intracellular bacteria.

Materials and methods

Antibodies and fluorophores mAb anti-human IgM (MH15, Sanquin, Amsterdam, The Netherlands) was mixed with rat anti-mouse IgG1 antibody (RM161.1, Sanquin) and mAb anti-S. typhimurium LPS (1E6, Biodesign International, Kennebunk, ME) to generate BCR-LPS tetrameric antibody complexes, used to coat bacteria as previously described.20 Antagonist anti-human CD40 mouse monoclonal antibody was a kind gift of Dr. L. Boon. The following labeled anti-human mAbs were obtained from BD Biosciences (San Jose, CA): anti-IFN-γ-FITC, anti-CD27-PE, anti-CD107a-PE, anti-CD8-PerCP-Cy5.5, anti-CD4-APC, anti-CD45RO-PE, AnnexinV-APC and IgG1-PerCP-Cy5.5 isotype control. FITC-conjugated antibody IgG1, IgG2a and IgG2b, IgG1-PE and IgG1-APC isotype controls andPE- conjugated anti-CD8 blocking antibody were obtained from DAKO (Glostrup, Denmark). Anti-CD45RA-FITC and anti-CD45RO-FITC were obtained from Sanquin and DAPI from Sigma-Aldrich (Steinheim, Germany). CFSE (Invitrogen, Paisley, UK) labeling was used in proliferation assays.

Bacterial growth conditions GFP expressing-S. typhimurium SL1344 was described before.33 GFP-Salmonella defective

144 Cross-presentation by B cells in SPI-1 (invA mutant) or SPI-2 (ssrA mutant) were a kind gift of M. Rescigno (European Institute of Oncology, Milan, Italy). Staphylococcus aureus expressing GFP (RN4220 with pWVW189GFP) was kindly provided by S. A. J. Zaat (Academic Medical Center, Amsterdam, The Netherlands). All bacteria strains were grown overnight at 37ºC in Luria- Bertani (LB) broth with carbenicillin or chloramphenicol (Sigma-Aldrich, St Louis, MO) to maintain GFP expression while shaking, subcultured at a dilution of 1:33 in fresh LB medium and incubated while shaking at 37ºC for 3 to 4 hours to obtain exponentially growing bacteria. For coating, bacteria were washed twice with PBS and incubated with BCR-LPS tetrameric antibody complexes for 30 minutes at room temperature and washed twice with PBS to remove unbound antibodies. For experiments with dead Salmonella, bacteria were heat killed by incubation at 65°C for 15 minutes.

Lymphocyte isolation and B lymphocyte infection with Salmonella Human PBMCs were isolated by centrifugation on a Ficoll-Hypaque gradient (Axis- Shield PoC AS, Oslo, Norway) from a buffycoat obtained from healthy donors (Sanquin). All donors provided written informed consent in accordance with the protocol of the local institutional review board, the Medical Ethics Committee of Sanquin Bloodbank (Amsterdam, The Netherlands), and the Medical Ethics Committee of Sanquin approved the study. B and T cells were subsequently purified using anti-CD19, anti-CD4, anti-CD8 Dynabeads and DETACHaBEAD (Invitrogen), according to the manufacturer’s instructions. Monocytes were isolated by positive selection using CD14 microbeads and a magnetic cell separator (MACS, Miltenyi Biotec, Bergisch Gladbach, Germany). Monocytes were cultured at a concentration of 1×106 cells/ml in 20 ml Cellgro medium (CellGenix, Freiburg, Germany) supplemented with GM-CSF (1,000 IU/ml; Cellgenix) and IL-4 (800 IU/ml; Cellgenix) in a 80 cm2 cell culture flask (Nunc, Roskilde Denmark) to generate immature DCs. At day 6, the DCs were harvested and washed with antibiotic free medium. 7 r e t p a h C B lymphocytes or immature DCs were incubated for 45 minutes at 37°C with Salmonella without antibiotics. Next, cells were washed to remove unbound bacteria four times and cultured for 1 hour in medium containing 100 µg/ml gentamycin (Invitrogen) to eliminate non-phagocytosed bacteria. Cells were washed and cultured in RPMI 1640 medium w/o phenol red (Lonza, Basel, Switserland), supplemented with 5% FCS (Bodinco, Alkmaar, The Netherlands), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-Glutamine, 50 μM 2-ME, 20 μg/ml human apo-transferrin ((Sigma-Aldrich), depleted for human IgG with protein G sepharose (Amersham, Uppsala, Sweden)) and 10 µg/ml gentamycin.

Flow cytometry Unless described otherwise, 1x105 Salmonella-infected cells were cultured with 5x104

145 Chapter 7

CFSE-labeled T cells (CD8+ T cells alone or in 1:1 ratio with CD4+ T cells) for 6 days to activate and expand Salmonella-specific T cells. 50,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD). To test plasma membrane markers, 1x105 B cells with 5x104 T cells were cultured for 6 days and after addition of 10 IU/ ml IL-2 (Chiron, Emeryville) for another 6 days. All plasma membrane stainings were performed for 15 minutes at room temperature and washed after each incubation with PBS containing 0.1% BSA. 50,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD). Lymphocytes were gated by forward and side scatter. Dead cells were excluded based on their positive reaction to DAPI staining. + + - For some experiments, naïve T cells were sorted as CD8 CD45RA CD45RO (TN) and + - + + + - memory T cells as CD8 CD45RA CD45RO (TMEM), and CD8 CD45RO CD27 (TEM) and + + + CD8 CD45RO CD27 (TCM) cells. Populations were >98% purified.

TCR clonality CFSE labeled CD8+ T cells were stimulated with Salmonella-infected B cells or with anti- CD3 (1XE, 1 μg/ml) and anti-CD28 antibodies (CLB.CD28/1, 1 μg/ml). Proliferating and non-proliferating cells were sorted and DNA was isolated using QIAamp DNA Mini Kit, according to the manufacturer’s instructions (Qiagen, Valencia, CA). Next, TCR beta clonality was measured using the In Vivo Scribe TCRB Gene Clonality Assay for gel detection, according to manufacturer’s instructions (San Diego, CA)

Intracellular cytokine staining B cells and T cells were cultured for 12 days, and 10 IU/ml IL-2 was added at day 6 for T cell survival. Cytokine production was measured by intracellular staining after restimulation with 0.1 µg/ml PMA, 1 µg/ml ionomycin and 10 µg/ml brefeldin A (Sigma-Aldrich) for 5 hours. Cells were washed twice with PBS, fixed with 1% formaldehyde (Merck, Darmstadt, Germany) for 15 minutes and after washing twice with PBS, permeabilized with 0.5% saponin (Calbiochem, CA) in PBS containing 1% BSA (Sigma-Aldrich) and incubated with fluorescent antibodies for 30 minutes at room temperature. 50,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD).

CD8+ degranulation assay CD8+ T cells were primed by 6 day incubation of 1x105 Salmonella-infected B cells with 2.5x104 CD4+ T cells and 2.5x104 CD8+ T cells. The dividing T cells (CD8+CFSElow) were FACS sorted after 6 days on a MoFlo Sorter (Dakocytomation, Glostrup, Denmark) and cultured with 50 IU/ml IL-2 for 6 more days. Next, isolated autologous B cells were thawed and infected with Salmonella. For proteasome inhibition, MG-132 (Sigma-Aldrich) was added

146 Cross-presentation by B cells at a concentration of 20 μM before incubation with bacteria, and after infection, the cells were cultured overnight in presence of the inhibitor. Next, the cells with proteasome inhibitor were irradiated (30 Gy) to prevent further initiation of antigen presentation after washing the cells to remove the proteasome inhibitor. Cells were not irradiated in other experiments in which no proteasome inhibitor was used. Salmonella-infected B cells were incubated in medium containing 10 µg/ml gentamycin for 15 hours at 37ºC to allow processing and presentation ofSalmonella antigens. Subsequently, the B cells were incubated at 37ºC for 5 hours together with the primed Salmonella-specific CD8+ T cells in a ratio of 4:1, in the presence of anti-CD107a-PE labeled antibodies. Cells were washed twice with wash buffer (1 mM HEPES, 0.15 M NaCl, 5 mM KCl, 1.8 mM CaCl2, 1 M MgCl2, 0.1% BSA) and stained for CD8 and AnnexinV. After washing twice with washing buffer, DAPI was added and CD8+ T cells were analyzed for CD107a expression. 50,000 events were acquired on a LSR II (BD) and analyzed with FACSDiva software (BD).

51Cr release assay Salmonella-specific CD8+ T cells were activated and FACS sorted as described and expanded with 50 IU/ml IL-2. Autologous B cells were thawed and infected with Salmonella. After 15h, B cells were labeled with 51Cr (185MBq/ml; Perkin Elmer, Boston, MA) for 45 minutes at 37°C. After washing, the B cells were incubated in a 96-wells U-bottom plate (Costar Corning Inc., NY) with primed CD8+ T cells in a 1:2 ratio. Incubation in medium or in Triton X-100 (1% final concentration; Merck) was used to determine spontaneous and maximum 51Cr release, respectively. 51Cr release was measured in the supernatant using filters with a gamma counter (Cobra II, Canberra Packard, Mississauga, Canada). The percentage of specific cell lysis was calculated using the following formula: % specific lysis = [experimental release (cpm) – spontaneous release (cpm)]/[maximal release (cpm) – spontaneous release (cpm)] × 100%. 7 r e t p a h C

Statistical analysis Statistical differences were determined by a paired Student’s t test, using GraphPad Prism (version 5.01, GraphPad Software, San Diego, CA).

Results

Salmonella-infected B Cells Initiate a CD8+ T Cell Response To study MHC class I antigen presentation by B cells, we used Salmonella typhimurium as a model for cross-presentation against facultative intracellular bacteria. Previously,

147 Chapter 7

we showed that about 4% of the B cells recognize Salmonella by their BCR, phagocytose Salmonella, and subsequently initiate a CD4+ T cell response.20 Now, we investigated whether Salmonella-infected B cells are also capable to induce a cytotoxic CD8+ T cell response. B cells were incubated with Salmonella to allow phagocytosis of the bacteria by B cells. After extensive washing, theSalmonella -infected B cells were co-cultured with CFSE-labeled CD4+ and CD8+ T cells. As observed before, B cells that had phagocytosed Salmonella induced CD4+ T cell proliferation.20 Interestingly, a considerable amount of CD8+ T cells had proliferated as well (Figure 1A and B). Since the amount of B cells that specifically recognize Salmonella via the BCR is quite low, we maximized the T cells responses by enhancing the uptake of Salmonella by B cells using Salmonella coated with a tetrameric antibody complex, consisting of anti-LPS antibodies and anti-IgM- BCR antibodies. As a result, all B cells expressing an IgM-BCR, recognize Salmonella and phagocytose the bacterium via their BCR. This resulted in an uptake of Salmonella by 30% to 60% of the B cells (data not shown) and a strong increase in CD8+ T cell proliferation in B/T co-culture experiments. Next, we investigated the requirement of CD4+ T cell help for the proliferation of the CD8+ T cells. Salmonella-infected B cells were cultured with CD8+ T cells in the absence of CD4+ T cells. This situation almost completely abolished proliferation of the CD8+ T cells with both naturally phagocytosed Salmonella-infected B cells or coated Salmonella-infected B cells (Figure 1C and D). Thus, B cells infected by Salmonella act as antigen presenting cells and induce CD8+ T cell proliferation, but activation of CD8+ T cells requires the simultaneous CD4+ T cell activation to enable T cell help. To study which kind of help CD4+ T cells provide for CD8+ T cell proliferation, we looked at the requirement of IL-2, by adding blocking antibodies to the culture of infected B cells and CD4+ and CD8+ T cells. This resulted in a very strong reduction of CD8+ T cell proliferation (Figure S1). However, CD4+ T cell proliferation was also decreased (data not shown). Therefore we performed a converse experiment, by adding IL-2 instead of CD4+ cells to the co-culture of infected B cells and CD8+ T cells. This shows that substitution of CD4+ T cell help by IL-2 also induces CD8+ T cell proliferation by B cells that have phagocytosed Salmonella (Figure 1E). The addition of IL-2 to the co-culture with non- infected B cells did not induce significant proliferation of + CD8 T cells, indicating that IL-2 itself does not stimulate non-specific CD8+ T cell proliferation. Furthermore, the role of CD40 stimulation was studied. Since CD40-CD40L interactions do also play a role in CD4+ T cell activation, CD4+ T cell help was substituted by IL-2. Blocking CD40 resulted in reduction of CD8+ T cell proliferation (Figure 2E). Thus CD4+ T cells help is partially mediated by both IL-2 and CD40-CD40L interactions. Although CD8+ T cells proliferate only in presence Salmonella-infected B cells and CD4+ T cell help, we cannot exclude that the CD8+ T cell response is partly an effect of bystander

148 Cross-presentation by B cells

Figure 1. Salmonella-infected B cells induce CD8+ T cell proliferation with help of CD4+ T cells. (A) CFSE labeled CD8+ T cells were cultured alone (T), together with B cells (B + T) or together with B cells that had naturally + phagocytosed Salmonella (BSal* + T), in the presence of CD4 T cells. Proliferation was measured after 6 days.(B) CD8+ T cell proliferation was measured after culture with B cells that had naturally phagocytosed Salmonella + (BSal*) or anti-IgM-coated Salmonella (BSal), in presence of CD4 T cell help. The data are expressed as mean ± SEM, of seven independent experiments of different donors. (C) Proliferation of CFSE labeled CD8+ T cells 7 r e t p a h C (shown in A) in absence of CD4+ T cells. (D) CD8+ proliferation after culture with B cells that have naturally + phagocytosed (BSal*) or coated (BSal) Salmonella, in the presence of CD4 T cell help (black bars) or not (open bars). The data are expressed as mean ± SEM, of four independent experiments of different donors. (E) CD8+

T cells were cultured with B cells that had phagocytosed anti-IgM coated Salmonella (BSal), in absence of help (open bars), in presence of CD4+ T cell help (black bars), in addition of IL-2 (striped bars), or in addition of IL-2 plus anti-CD40 antibodies. Data shown are from one representative experiment of three independent experiments with different donors. (F) CD8+ T cells were primed with B cells that had naturally phagocytosed Salmonella and the proliferating CD8+ T cells were sorted after 6 days, expanded with IL-2. Resting CD8+ T cells were again CFSE labeled at day 13 and restimulated with autologous B cells or B cells that had phagocytosed

Salmonella naturally (BSal*) or coated Salmonella (BSal), in presence of IL-2 (50 IU/ml). The data are expressed as mean ± SEM, of two independent experiments of different donors. (G) CD8+ T cells were activated with B cells that had naturally phagocytosed Salmonella, or non-specific via anti-CD3 and anti-CD28 antibodies. CD8+ T cells were sorted after 6 days and TCR clonality was measured. Shown are two different V-J primer mixes, with a positive control (+), negative control (–), sorted proliferating CD8+ T cells upon infected B cells (Sal+), sorted non-proliferating CD8+ T cells upon infected B cells (Sal-) and non-specific stimulated CD8+ T cells (3/28). Data are of one experiment.

149 Chapter 7

proliferation, for instance via soluble factors. Therefore, we studied the T cell response in more detail. Culture supernatant of infected B cells in presence of CD4+ T cell help was not able to induce CD8+ T cell proliferation (data not shown). In addition, blocking experiments, in which CD8+ T cell activation was prevented via anti-CD8 blocking antibodies, resulted in a decrease of CD8+ T cell activation bySalmonella -infected B cells (Figure S1). To study Salmonella-specific T cell proliferation in more detail, restimulation of the T cells was studied. Proliferating CD8+ T cells which respond to Salmonella-infected B cells were sorted. These Salmonella-responsive T cells were restimulated with autologous B cells which were infected with Salmonella, or anti-IgM coated Salmonella to maximize the infection rate. During restimulation additional IL-2 was added for help, and CD8+ T cell proliferation was measured using CFSE labeling. This showed that CD8+ T cells are primary Salmonella-specific, because they proliferate mainly upon restimulation withSalmonella - infected B cells (Figure 1F). In addition, we analyzed clonality of the Salmonella-specific T cell response using a TCR beta clonality assay, as an additional indication for antigen- specific T cell activation. Proliferating+ CD8 T cells, which were activated by Salmonella- infected B cells, and non-proliferating CD8+ T cells, which did not respond, were both sorted and tested for clonal TCR beta gene rearrangements. Subsequently, CD8+ T cells were stimulated with anti-CD3 and anti-CD28 antibodies to obtain non-specific proliferated T cells. The CD8+ T cells which proliferate upon Salmonella-infected B cells show a clear clonality (Figure 1G). In contrast, neither CD8+ T cells did proliferate after culturing with infected B cells, nor non-specific CD8+ T cells proliferating cells show a clear TCR clonality. Thus, primary B cells which have phagocytosed Salmonella elicit CD8+ T cell proliferation, which is mainly Salmonella-specific.

Salmonella-infected B cells activate both the central memory and effector memory CD8+ compartment Do B cells elicit a naïve or a memory CD8+ cell response? To study this, we cultured the total CD8+ T cell population with or without Salmonella-infected B cells, in presence of + - + CD4 T cells for help, and determined the naïve (CD45RO CD27 ; TN), central memory + + + - (CD45RO CD27 ; TCM), effector memory (CD45RO CD27 ; TEM) or terminal effector - - + (CD45RO CD27 ; TE) phenotype of the CD8 T cells after prolonged culture. Upon 11 days of culture, purified CD8+ T cells show mainly a naïve phenotype. In contrast, following + activation with Salmonella-infected B cells, the CD8 population shifts towards the TEM phenotype (Figure 2A). CD8+ T cells that are activated with Salmonella-infected B cells + in the absence of CD4 T help, do not differentiate to a TEM phenotype (Figure 2B). Next, we investigated if Salmonella-infected B cells can prime naïve T cells at all. Therefore + - - we studied proliferation of sorted naïve (CD45RA CD45RO ; TN) or memory (CD45RA

150 Cross-presentation by B cells

+ + CD45RO ; TMEM) CD8 T cells in response to Salmonella-infected B cells. Figure 2C illustrates that the naïve CD8+ population do not proliferate over background values upon stimulation withSalmonella -infected B cells, whereas the memory CD8+ T cells proliferated + + vigorously. Further discrimination of the memory subset by sortingCM T (CD45RO CD27 ) + - + and TEM (CD45RO CD27 ) CD8 T cells, followed by co-culture with Salmonella-infected

B cells, showed that both TCM and TEM can be activated by Salmonella-infected B cells, although that TEM proliferate less compared to TCM (Figure 2D). Recent experiments in mice show that both TCM and TEM cells can arise from activation and proliferation of the

TCM compartment, whereas TEM cells are more terminally differentiated and therefore 23 proliferate poorly and only give rise to TEM progeny . Indeed, expansion of the sorted

TCM by Salmonella-infected B cells yielded offspring with both a CMT and a TEM phenotype, whereas TEM activation yielded mainlyEM T progeny (data not shown). In addition, the effectiveness of T cell activation by infected B cells was compared using another antigen

Figure 2. Salmonella-infected B cells reactivate a CD8+ memory response. (A) CD4+ and CD8+ T cells were cultured alone (T), together with B cells (B + T) or with anti-IgM- coated Salmonella-infected B cells

(BSal + T). After 11 days, cells were stained for CD45RO and CD27 to discriminate between the different

T cell populations: naïve (TN; CD45RA+CD27+), central memory + + (TCM; CD45RO CD27 ), effector + - memory (TEM; CD45RO CD27 )

and terminal effector (TE; CD45RA+CD27-) T cells. Gated CD8+ cells were analyzed. (B) Without CD4+ T cells, the differentiation of CD8+ T cells to effector memory is

attenuated. Data are mean ± SEM 7 r e t p a h C from five independent experiments. (C) Coated Salmonella-infected B cells activate proliferation of sorted + + CD8 CD45RO cells (TMEM), but not of + + purified CD8 CD45RA cells (TN) in the presence of CD4+ help. Data are mean ± SEM from four independent experiments. (D) Coated Salmonella- + + + + + - infected B cells activate proliferation of sorted CD8 CD45RO CD27 (TCM) and CD8 CD45RO CD27 (TEM) cells. + + + + Data are mean ± SEM from three independent experiments. (E) Sorted CD8 CD45RA (naïve, TN) or CD8 CD45RO

(memory, TMEM) T cells were cocultured with B cells or DCs, naturally infected with Salmonella (Sal*), in presence of CD4+ T cell help. Proliferation of the naïve or memory CD8+ T cells was measured at day 6. Data shown are from one representative experiment of two independent experiments with different donors.(F) Sorted naïve or memory CD8+ T cells were cocultured with B cells or DCs, infected with coated Salmonella (Sal), in presence of CD4+ T cell help. Proliferation of the naïve or memory CD8+ T cells was measured at day 6. Data shown are from one representative experiment of two independent experiments with different donors.

151 Chapter 7

presenting cell, a dendritic cell (DC). After uptake of Salmonella, the DCs matured (data + not shown) and were capable to activate both naïve (TN) and memory CD8 T cells (TMEM), whereas B cells could only reactivate memory +CD8 T cells (Figure 2E). However, the percentage of B cells that had taken up Salmonella was much lower compared to the DCs that had taken up Salmonella (Figure S2). To correct for these differences in uptake, we also used anti-IgM coatedSalmonella , to enhance the number of Salmonella-infected B cells. Indeed this yielded comparable amounts of Salmonella-infected B cells and DCs (Figure S2). In this setting,Salmonella -infected B cells were even superior in activation of memory CD8+ cells (Figure 2F). So, upon Salmonella-infection, B cells can reactive CD8+ memory cells in the same manner as DCs. In summary, these data show that Salmonella- infected B cells activate an effective recall response of memory CD8+ T cells, yielding

expansion of both the ”memory stem cell” containing TCM compartment and the memory

effector cell containing TEM compartments.

Activated Salmonella-specific CTLs are able to killSalmonella -infected cells Activation of cytotoxic CD8+ T cells by B cells is controversial. Earlier reports showed that B cells induce tolerance or anergy in CD8+ T cells. In contrast, we showed proliferation of CD8+ T cells upon activation by antigen-specific B cell upon phagocytosis ofSalmonella. Although this proliferation is unlikely to yield tolerance, proliferation itself does not guarantee that the activated CD8+ T cells have acquired a functional anti-bacterial phenotype. CD8+ T cells kill intracellular pathogens either via secretion of IFN-γ or via direct killing of the infected target cell 24. To investigate if Salmonella-containing B cells induce a functional CD8+ T cell response, IFN-γ secretion of the activated CD8+ T cells was measured. This showed that, after culture with Salmonella-infected B cells, the number of CD8+ T cells producing IFN-γ is increased to more than 65% (Figure 3A and 3B). Thus, cross-presentation of Salmonella antigens by B cells induces not only proliferation of the CD8+ T cells but also renders the cells functional in that it induces IFN-γ secretion. As these data demonstrate that B cells that had taken up Salmonella are able to functionally activate CD8+ T cells, the question remained if the activated+ CD8 T cells were Salmonella-specific and whether CD8+ T cells can acquire a cytotoxic phenotype through B cell-mediated activation. First, we investigated if the CD8+ T cells degranulate their cytotoxic granules upon recognition of Salmonella-infected target cells. For this we analyzed expression of the marker CD107a, which is expressed at the plasma membrane of CD8+ T cells upon degranulation. Salmonella-infected B cells were cultured together with CFSE labeled CD4+ and CD8+ T cells. The proliferating Salmonella-primed CD8+ T cells were sorted after 6 days, expanded and re-exposed to autologous B cells that had been infected to high percentages with anti-IgM-coated Salmonella after which

152 Cross-presentation by B cells

CD107a expression was measured. Upon re-exposure to Salmonella-infected B cells, the Salmonella-primed CD8+ T cells show a strong and significant increase of CD107a expression at the plasma membrane. Since the proliferating CD8+ T cells did not show degranulation when re-exposed to autologous, non-infected B cells, Salmonella-primed CD8+ T cells degranulate specifically upon recognition ofSalmonella -infected cells (Figure 3C). To exclude the possibility that the anti-IgM coating of Salmonella had affected our results, we also primed CD8+ T cells with Salmonella-specific B cells that had naturally phagocytosed Salmonella via their antigen-specific BCR. These primed CD8+ T cells degranulated specifically upon recognition of autologous B cells naturally infected with Salmonella, of which a relative small percentage (5-10%, data not shown) contained Salmonella-infected antigen-specific B cells (Figure 3D; middle bar). In addition, the naturally Salmonella-primed CD8+ T cells very efficiently degranulated upon contact

Figure 3. Salmonella-infected B cells induce Salmonella-specific CD8+ T cells to secrete IFN-γ and are cytotoxic. (A) CD4+ and CD8+ T cells were cultured alone (T), with B cells (B + T) or with anti-IgM-coated Salmonella-

+ 7 r e t p a h C infected B cells (BSal + T). After 11 days, CD8 T cells were stimulated for 5 hours with PMA, ionomycin and BFA and analyzed for IFN-γ production by intracellular FACS staining. A representative experiment of five independent experiments using cells from different healthy donors is shown. (B) Salmonella-infected B cells induce IFN-γ-expression by CD8+ T cells compared to non-infected B cells. Data are the mean ± SEM from five independent experiments of different donors and ** p < 0.01. (C) CD8+ T cells were primed with coated Salmonella-infected B cells and the proliferating CD8+ T cells were sorted after 6 days, expanded with IL-2 for another 6 days and restimulated with autologous B cells that had either or not phagocytosed Salmonella. Salmonella-specific degranulation was measured by CD107a expression at the plasma membrane CD8+ T cells. Data are means ± SEM of five independent experiments of different donors, and ** p < 0.01. (D) Proliferating CD8+ T cells primed with B cells that had naturally phagocytosed Salmonella were sorted and CD107a expression was measured upon re-encounter of B cells (T + B), B cells naturally infected with Salmonella (T + BSal*) or anti- + IgM-coated Salmonella (T + BSal). Data are of two experiments. (E) Sorted Salmonella-primed CD8 T cells (see C) specifically killSalmonella -infected B cells as measured by 51Cr release of autologous B cells that were either or not infected with Salmonella. Data are expressed as mean ± SEM, of six independent experiments of different donors, and ** p < 0.01. (F) Sorted Salmonella-primed CD8+ T cells (see C) do not kill Staphylococci-infected B cells as measured by 51Cr release of autologous B cells that were either infected with Salmonella or with Staphylococci. The data are expressed as mean ± SEM, of two independent experiments of different donors.

153 Chapter 7

with autologous B cells of which a higher percentage (26-46%, data not shown) of cells had been infected with anti-IgM coated Salmonella (Figure 3D; right bar). Finally, we investigated if degranulation of theSalmonella -specific CD8+ T cells also leads to death of the Salmonella-infected cells to determine the true cytotoxic efficacy of the lytic granules. CFSE labeled CD8+ T cells were primed by incubation with Salmonella-infected B cells. Proliferating CD8+CFSElow cells were sorted and expanded for another 6 days. Re-exposure of the Salmonella-primed T cells to Salmonella-infected, 51Cr-labeled autologous B cells demonstrated that the primed CD8+ T cells killed Salmonella-infected B cells but not non-infected B cells (Figure 3E). In addition, the Salmonella-primed CD8+ T cells were not able to kill B cells that had phagocytosed Staphyloccoci via BCR ligation (Figure 3F), demonstrating that the CD8+ cells are indeed at least partly Salmonella-specific and do not recognize autologous B cells that are activated via BCR-mediated uptake of other bacteria. Thus, activation of CD8+ T cells by B cells cross-presenting Salmonella antigens induces a cytotoxic phenotype in the CD8+ T cells that specifically mediates killing of Salmonella-infected cells.

Cross-presentation of Salmonella-antigens is partly proteasome dependent We showed that after phagocytosis of Salmonella, B cells are able to cross-present antigens to CD8+ T cells and thereby initiate a Salmonella-specific cytotoxic T cell response. The mechanism of cross-presentation of Salmonella antigens by B cells is unknown. One likely mechanism is that after phagocytosis, antigens are translocated from the Salmonella-containing vacuole (SCV) into the cytoplasm of B cells. Next, the antigens are degraded in the cytoplasm by proteasomes into small peptides, which are presented via the classical MHC class I antigen presentation route. To investigate this mechanism of cross-presentation, we used a chemical compound that specifically blocks the proteasome (MG-132). To study the effect of cross-presentation when blocking the proteasome, we used the CD107a degranulation assay. Re-exposure ofSalmonella -primed CD8+ T cell to autologous, Salmonella-infected B cells showed that Salmonella-infected B cells are much less efficient in inducing CD8+ T cell degranulation when proteasomes are inhibited (Figure 4). In addition, proteasome inhibition of the infected B cells also

Figure 4. Proteasome inhibition of Salmonella-infected B cells diminishes degranulation of Salmonella-specific CD8+ T cells. CD8+ T cells were activated by Salmonella-infected B cells and after 6 days, Salmonella-specific, proliferating CD8+ T cells were sorted. Next, the sorted CD8+ T cells were reactivated by non-

infected B cells (T + B) or Salmonella-infected B cells (T + BSal). Pre-treatment of B cells with proteasome inhibitor MG-132 (20 µM) before reactivation leads to a decrease in degranulation of the Salmonella-specific CD8+ T cells (T + B[MG-132]

Sal), as measured by CD107a expression. The data are expressed as mean ± SEM, of two independent experiments of different donors.

154 Cross-presentation by B cells prevents killing by Salmonella-specific CD8+ T cells (data not shown). This observation implies that the proteasome is somehow involved in cross-presentation of Salmonella antigens by B cells. How the proteasome is involved is unclear as proteasome inhibition has many secondary effects on the ubiquitin cycle, the modification of histones and the formation of multivesicular bodies 25.

B cells do not cross-present heat-killed Salmonella Salmonella survives inside a cell via expression of the TTSS that create an intracellular environment that neutralizes the destructive forces of the host cell 26. The TTSS components SPI-1 and SPI-2 play a role in this process by exporting proteins into the host cell. Because of the capacity of Salmonella to invade cells and to control its maintenance inside the cell via SPI-1 and SPI-2, it is possible that Salmonella itself might play a direct role in the cross-presentation pathway in B cells. To determine the role of SPI-1 and SPI-2 in cross-presentation of Salmonella by B cells, we analyzed CD8+ T cells proliferation via co-culture with CD4+ T cells and B cells that had phagocytosed anti-IgM-coated wild type Salmonella, or Salmonella with a mutation in SPI-1 (invA-) or SPI-2 (ssrA-). Both Salmonella mutants were still able to elicit a CD8+ T cell response, albeit at lower percentages of T cell proliferation compared to wild typeSalmonella (Figure 5A). Thus SPI-1 and SPI-2 each contribute to cross-presentation of Salmonella antigens by B cells, but are not essential. By creating an environment in which Salmonella itself cannot be killed, it is possible that the intracellular survival plays a role in the efficacy of cross-presentation of Salmonella antigens by B cells. To study the contribution of Salmonella on the efficacy of cross- presentation of Salmonella antigens, we compared the efficiency of living and dead 7 r e t p a h C

Figure 5. Induction of CTL response against Salmonella by B cells requires uptake of living Salmonella. (A) CD8+ T cells were labeled with CFSE and cultured with B cells that had phagocytosed either wild type Salmonella (WT), mutant for SPI-1 (invA-) or SPI-2 (ssrA-). Proliferation was measured after 6 days. Data shown are proliferation of CD8+ cells relative to wild type proliferation and are of two different donors; error bars are SEM. (B) Salmonella-specific T cells that were primed with B cells that had either internalized living (left panel) or dead Salmonella (right panel) were sorted and restimulated with B cells (T + B), B cells that had internalized living Salmonella (T + BSal) or dead Salmonella (T + BSal-hk). Degranulation was analyzed as CD107a expression by CD8+ T cells. (C) CD8+ T cell mediated kill was measured as the release of 51Cr by B cells. (B-C) Data are expressed as mean ± SEM, from four (live Salmonella primed) or two (dead Salmonella primed) independent experiments using material from different healthy donors.

155 Chapter 7

Salmonella to induce CTL activation. CD8+ T cells were primed with B cells infected with living or heat-killed Salmonella. After sorting and expansion, the Salmonella-primed T cells were re-exposed to autologous B cells that had either or not phagocytosed living or dead Salmonella. Cross-presentation of Salmonella antigen was measured by the extent of degranulation of the primed T cells using CD107a expression. CD8+ T cells that had been primed by B cells infected with living Salmonella efficiently degranulated upon recognition of autologous B cells that had phagocytosed living Salmonella (upregulation of CD107a to 60%), whereas the cells did not degranulate upon contact with B cells that had phagocytosed dead Salmonella (Figure 5B; left panel). This indicates either that B cells present different Salmonella antigens to CD8+ T cells from live or dead bacteria or that B cells cannot cross-present Salmonella antigens when the intracellular bacterium is not alive. Furthermore, CD8+ T cells that had been primed with B cells that had taken up dead Salmonella showed poor degranulation to B cells that had taken up either live or heat-killed Salmonella (Figure 5B; right panel), demonstrating that B cells indeed do not induce a cytotoxic CD8+ T cell response via cross-presentation ofSalmonella antigens from dead intracellular bacteria. This observation was confirmed by studying elimination of Salmonella-infected B cells by 51Cr-release (Figure 5C). Together, these results show that B cells are not able to cross-present antigens of deadSalmonella and that Salmonella contributes to the activation of a Salmonella-specific cytotoxic CD8+ memory response.

Discussion

Studies in B-cell-deficient mice showed that protective immunity to Salmonella strongly depends on B cells 27. This dependency does not only result from antibody generation, as passive transfer of Salmonella-immune serum cannot transfer resistance to Salmonella 28. In addition, B cells are involved in the generation of a profound CD4+ and CD8+ T cell response afterSalmonella infection,21 but the precise role of B cells remained unclear. We previously showed that human antigen-specific B cells that have internalized Salmonella via their BCR are able to induce a Salmonella-specific CD4+ T cell response which aids the humoral immune response against Salmonella.20 The data described here may explain the role of B cells in the immune response against Salmonella infection other than antibody formation. In contrast to data in mouse B cell lines, in which uptake of Salmonella does not lead to antigen cross-presentation via MHC class I,29 we now demonstrate that Salmonella-specific human primary B cells that have phagocytosed Salmonella via their BCR are capable to induce a strong recall response of cytotoxic CD8+ T cells after cross- presentation of Salmonella antigens. We previously showed that in the human Ramos B

156 Cross-presentation by B cells cell line, Salmonella is not only capable to survive, but also to replicate intracellularly. In contrast, in primary human B cells Salmonella survives, but is unable to replicate inside the B cell.20 A recent report shows that poor intracellular replication of Salmonella leads to reduced antigen presentation in DCs.30 In contrast, we found that Salmonella-specific primary B cells are efficient in cross-presentation of Salmonella antigens from the non- replicating bacteria and activate Salmonella-specific CD8+ cells that show a functional cytotoxic T cell response. Thus, primary human B cells are capable in cross-presentation of non-replicating Salmonella to CD8+ T cells. After internalization by the B cell,Salmonella survives in the SCV. For cross-presentation, Salmonella-antigens should be loaded onto MHC class I. The TTSS of Salmonella could play a role in delivery of antigens in the cytosol by injecting proteins directly into the cytosol.31 These proteins can be degraded by the proteasome and after transportation into the ER, loaded onto MHC class I molecules. We demonstrated that both SPI-1 and SPI-2 contribute to cross-presentation, but are not individually required. It is therefore likely that antigens excreted in the host cytosol by SPI-1 and SPI-2 are both used for antigen processing to MHC class I. This is in line with the observation that B cells could not cross-present Salmonella-specific antigens of heat-killedSalmonella in which SPI-1 or SPI-2 are no longer active. Although the exact molecular pathways of cross-presentation in B cells remain to be elucidated, it is clear that Salmonella itself appears to be involved in the generation of an effective cytotoxic +CD8 T cell response against the bacteria upon B cell infection. This phenomenon points to the occurrence of co-evolution of bacterial immune evasion and the generation of effective anti-bacterial immunity. Cross-presentation ofSalmonella antigens by B cells leads to activation of a CD8+ cytotoxic T cell response, but help of CD4+ T cells is required. The main factor of CD4+ T cell help seems to be IL-2, since replacement of CD4+ T cell help by addition of IL-2 is sufficient to elicit CD8+ T cell proliferation, induced by Salmonella infection of the B cells. The 7 r e t p a h C CD4+ dependency of the CD8+ response led us to investigate if the observed responses were in fact mere bystander activation. Proliferation upon restimulation ofSalmonella- primed CD8+ T cells implies Salmonella­-specificity of CD8+ T cell activation. In addition, the observations that CD8+ T cells activated by Salmonella-infected B cells specifically kill Salmonella-infected cells, but do not kill B cells infected with Staphylococci or dead Salmonella, demonstrate that the CD8+ T cell response upon Salmonella-infection of autologous B cells is at least in part Salmonella-specific. Various reports have described that B cells play a role in the expansion of Salmonella- specific T cells during reinfection, but less in the induction of +CD8 T cell responses in primary infection. The reason for this was not understood and has been attributed to the fact that antigen-specific B cells are probably the main B cell population with an antigen

157 Chapter 7

presenting function in Salmonella infection and that the frequency of antigen-specific B cells is elevated during a secondary infection (reviewed in 32). Our data now show that indeed the antigen-specific B cells are the cells that are responsible for efficient cross-presentation of Salmonella antigens. In addition, our data provide an additional explanation why B cells are mainly involved in the recall response;Salmonella -infected B cells do not prime naïve CD8+ T cells, but are very efficient in reactivation of cytotoxic CD8+ memory T cells. This implies that other APCs (e.g. DCs) are still needed to prime naïve CD8+ T cells. This priming by DCs might occur via antigen-presentation after phagocytosis of Salmonella itself, or via uptake of apoptotic bodies from other Salmonella-infected DCs. In secondary infections however B cells now seem to enter the stage as important APCs for the execution of the CD8+ recall response. DCs can still induce CD8+ proliferation via direct infection or via suicide cross-presentation upon ingestion of infected apoptotic 22 22 cells, but DCs were shown to mainly activate the TEM compartment. In contrast,

Salmonella-infected B cells efficiently activate the both theCM T and TEM compartments. This ensures not only the direct terminal differentiation of effector memory cells, but also the expansion of the Salmonella-specific CD8+ memory T cell compartment, which may both amplify the anti-Salmonella immune response and simultaneously ensure generation of anti-Salmonella memory for further reinfections. In summary, we propose a model on the role of B cells in the generation of the humoral and cellular immune response against Salmonella. After infection, Salmonella enters the body via DCs. The DC-mediated route ensures CD4+ T cell activation but is less effective in CD8+ T cell activation 30. The other part of entry for Salmonella is via M cells after which it encounters B cells, which are situated in the Peyer’s Patches, directly under the M cells. Salmonella-specific B cells internalize Salmonella via their BCR and are activated. Next, internalization of Salmonella leads to presentation of Salmonella antigens MHC class II molecules and activation of Salmonella-specific CD4+ T-helper cells that stimulate Salmonella-infected B cells to secrete Salmonella-specific antibodies,20 either locally or upon arrival or the infected B cells in the mesenteric lymph node. Upon re-infection, Salmonella-specific memory B cells ensure rapid antibody production but Salmonella- infected B cells also mediate a strong cytotoxic CD8+ recall response to eliminate infected cells. The Salmonella-specific CD4+ response that aided antibody production in early stages of the immune response is now also required for the activation of the cytotoxic memory T cell response against Salmonella. Thus, uptake of Salmonella by antigen- specific B cells may generate a survival niche for Salmonella, but at the same time it strongly contributes to the generation of effective anti-Salmonella immunity at multiple levels of the adaptive immune response.

158 Cross-presentation by B cells

Acknowledgements

We are grateful to Erik Mul and Floris van Alphen for excellent FACS sorting. We thank S.A.J. Zaat (Academic Medical Center, Department of Medical Microbiology) and W. van Wamel (Erasmus University Medical Center, Department of Medical Microbiology, Rotterdam, The Netherlands) for S. aureus RN4220 pWVW189, and A. Cheung (Dartmouth Medical School, Departments of Microbiology and Immunology, Hanover, U.S.A.) for pALC1484 used to construct pWVW189. We are grateful to and M. Rescigno (European Institute of Oncology, Milan, Italy) for the Salmonella mutant strains. We thank Dr. L. Boon for his kind gift of the mouse 5D12 monoclonal antibody, and Dr. E. van der Schoot for performance of the TCR clonality assay.

Supplementals

Figure S1. Blocking IL-2 or blocking CD8 reduces Salmonella- infected B cell mediated CD8+ T cell proliferation. Salmonella- infected B cells were cocultured with CFSE labeled CD8+ T cells and CD4+ T cells, in presence of IL-2 blocking antibodies or CD8 blocking antibodies. CD8+ T cell proliferation was measured after 6 days. Data shown are from one representative experiment of two independent experiments with different donors.

Figure S2. Uptake of Salmonella by B cells and DCs. Phagocytoses of Salmonella by B cells or DCs. B cells (upper panel) or DCs (lower panel) were naturally infected with GFP expressing Salmonella (Sal*, left) or infected with anti-IgM coated Salmonella (Sal, right). Salmonella positive cells were 7 r e t p a h C analyzed 1 hour after infection. Data shown are from one representative experiment of two independent experiments with different donors.

159 Chapter 7

References

1. Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P. Kraehenbuhl, and P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat. Immunol. 2: 361-367. 2. Rescigno, M., G. Rotta, B. Valzasina, and P. Ricciardi-Castagnoli. 2001. Dendritic cells shuttle microbes across gut epithelial monolayers. Immunobiology 204: 572-581. 3. Carter, P. B., and F. M. Collins. 1974. The route of enteric infection in normal mice.J Exp. Med. 139: 1189- 1203. 4. Jensen, V. B., J. T. Harty, and B. D. Jones. 1998. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer’s patches. Infect. Immun. 66: 3758-3766. 5. Gullberg, E., M. Leonard, J. Karlsson, A. M. Hopkins, D. Brayden, A. W. Baird, and P. Artursson. 2000. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochem. Biophys. Res. Commun. 279: 808-813. 6. Galan, J. E., and H. Wolf-Watz. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444: 567-573. 7. Zhang, S., L. G. Adams, J. Nunes, S. Khare, R. M. Tsolis, and A. J. Baumler. 2003. Secreted effector proteins of Salmonella enterica serotype typhimurium elicit host-specific chemokine profiles in animal models of typhoid fever and enterocolitis. Infect. Immun. 71: 4795-4803. 8. Zhou, D., and J. Galan. 2001. Salmonella entry into host cells: the work in concert of type III secreted effector proteins. Microbes. Infect. 3: 1293-1298. 9. Shea, J. E., C. R. Beuzon, C. Gleeson, R. Mundy, and D. W. Holden. 1999. Influence of the Salmonella typhimurium pathogenicity island 2 type III secretion system on bacterial growth in the mouse. Infect. Immun. 67: 213-219. 10. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden. 1996. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium.Proc. Natl. Acad. Sci. U. S. A 93: 2593-2597. 11. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. Identification of a pathogenicity island required for Salmonella survival in host cells. Proc. Natl. Acad. Sci. U. S. A 93: 7800-7804. 12. Coombes, B. K., B. A. Coburn, A. A. Potter, S. Gomis, K. Mirakhur, Y. Li, and B. B. Finlay. 2005. Analysis of the contribution of Salmonella pathogenicity islands 1 and 2 to enteric disease progression using a novel bovine ileal loop model and a murine model of infectious enterocolitis. Infect. Immun. 73: 7161-7169. 13. Coburn, B., Y. Li, D. Owen, B. A. Vallance, and B. B. Finlay. 2005. Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect. Immun. 73: 3219-3227. 14. Kuijl, C., N. D. Savage, M. Marsman, A. W. Tuin, L. Janssen, D. A. Egan, M. Ketema, N. R. van den, S. J. van den Eeden, A. Geluk, A. Poot, M. G. van der, R. L. Beijersbergen, H. Overkleeft, T. H. Ottenhoff, and J. Neefjes. 2007. Intracellular bacterial growth is controlled by a kinase network around PKB/AKT1. Nature 450: 725-730. 15. Neutra, M. R., E. Pringault, and J. P. Kraehenbuhl. 1996. Antigen sampling across epithelial barriers and induction of mucosal immune responses. Annu. Rev. Immunol. 14: 275-300. 16. Jones, B. D., and S. Falkow. 1996. Salmonellosis: host immune responses and bacterial virulence determinants. Annu. Rev. Immunol. 14: 533-561. 17. Foster, J. W., and M. P. Spector. 1995. How Salmonella survive against the odds. Annu. Rev. Microbiol. 49: 145-174. 18. Chen, L. M., K. Kaniga, and J. E. Galan. 1996. Salmonella spp. are cytotoxic for cultured macrophages.

160 Cross-presentation by B cells

Mol. Microbiol. 21: 1101-1115. 19. Monack, D. M., B. Raupach, A. E. Hromockyj, and S. Falkow. 1996. Salmonella typhimurium invasion induces apoptosis in infected macrophages. Proc. Natl. Acad. Sci. U. S. A 93: 9833-9838. 20. Souwer, Y., A. Griekspoor, T. Jorritsma, J. de Wit, H. Janssen, J. Neefjes, and S. M. van Ham. 2009. B cell receptor-mediated internalization of salmonella: a novel pathway for autonomous B cell activation and antibody production. J Immunol. 182: 7473-7481. 21. Ugrinovic, S., N. Menager, N. Goh, and P. Mastroeni. 2003. Characterization and development of T-Cell immune responses in B-cell-deficient (Igh-6(-/-)) mice with Salmonella enterica serovar Typhimurium infection. Infect. Immun. 71: 6808-6819. 22. Salerno-Goncalves, R., and M. B. Sztein. 2009. Priming of Salmonella enterica serovar typhi-specific CD8(+) T cells by suicide dendritic cell cross-presentation in humans. PLoS. ONE. 4: e5879. 23. Stemberger, C., M. Neuenhahn, F. E. Gebhardt, M. Schiemann, V. R. Buchholz, and D. H. Busch. 2009. Stem cell-like plasticity of naive and distinct memory CD8+ T cell subsets. Semin. Immunol. 21: 62-68. 24. Harty, J. T., and M. J. Bevan. 1999. Responses of CD8(+) T cells to intracellular bacteria. Curr. Opin. Immunol. 11: 89-93. 25. Dantuma, N. P., T. A. Groothuis, F. A. Salomons, and J. Neefjes. 2006. A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. J. Cell Biol. 173: 19-26. 26. Waterman, S. R., and D. W. Holden. 2003. Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol. 5: 501-511. 27. Mittrucker, H. W., B. Raupach, A. Kohler, and S. H. Kaufmann. 2000. Cutting edge: role of B lymphocytes in protective immunity against Salmonella typhimurium infection. J. Immunol. 164: 1648-1652. 28. Mastroeni, P., C. Simmons, R. Fowler, C. E. Hormaeche, and G. Dougan. 2000. Igh-6(-/-) (B-cell-deficient) mice fail to mount solid acquired resistance to oral challenge with virulent Salmonella enterica serovar typhimurium and show impaired Th1 T-cell responses to Salmonella antigens. Infect. Immun. 68: 46-53. 29. Rosales-Reyes, R., C. Alpuche-Aranda, M. L. Ramirez-Aguilar, A. D. Castro-Eguiluz, and V. Ortiz- Navarrete. 2005. Survival of Salmonella enterica serovar Typhimurium within late endosomal-lysosomal compartments of B lymphocytes is associated with the inability to use the vacuolar alternative major histocompatibility complex class I antigen-processing pathway. Infect. Immun. 73: 3937-3944. 30. Albaghdadi, H., N. Robinson, B. Finlay, L. Krishnan, and S. Sad. 2009. Selectively reduced intracellular proliferation of Salmonella enterica serovar typhimurium within APCs limits antigen presentation and development of a rapid CD8 T cell response. J. Immunol. 183: 3778-3787. 31. Russmann, H. 2003. Bacterial type III translocation: a unique mechanism for cytosolic display of

heterologous antigens by attenuated Salmonella. Int. J Med. Microbiol. 293: 107-112. 7 r e t p a h C 32. Ravindran, R., and S. J. McSorley. 2005. Tracking the dynamics of T-cell activation in response to Salmonella infection. Immunology 114: 450-458. 33. Marsman, M., I. Jordens, C. Kuijl, L. Janssen, and J. Neefjes. 2004. Dynein-mediated vesicle transport controls intracellular Salmonella replication. Mol. Biol. Cell 15: 2954-2964.

161

Summarizing discussion 8 Chapter 8

164 Summarizing discussion

Our immune system is indispensable in the defense against harmful pathogens. If the innate immune system fails to clear the pathogens immediately, an acquired immune response is initiated to protect against further infection and to help clearing the pathogens. T cells play a pivotal role in the acquired immune response. In the case of infection with Salmonella typhimurium, the bacteria cannot be cleared in absence of T cells.1 Two types of T cells are required for immunity against the facultative intracellular Salmonella bacterium. CD8+ cytotoxic T lymphocytes (CTLs) kill cells that are infected by Salmonella. This reduces immune escape and reduces further spreading of Salmonella through the body. CD4+ T helper cells are activated to elicit and support other anti-bacterial immune responses, such as antibody secretion by B cells and help for macrophage and CD8+ T cell responses. Antigen presenting cells play a crucial role to activate T cells. Dendritic cells (DCs) are specialized in the efficient internalization of all kinds of antigens, and subsequent presentation onto MHC class I and MHC class II, to activate CD8+ CTLs and CD4+ T helper cells respectively.2 B cells that recognize the same antigen via their B cell receptor (BCR) can obtain help from T helper cells and differentiate into plasma cells that secrete antigen-specific antibodies. It has become clear that antibody secretion is not the only role that B cells play in the acquired immune response.

Phagocytosis of bacteria by B cells The activation of B cells is initiated by binding of a specific antigen to the BCR. These antigens may bind as free antigens or are presented to the B cell by classical DCs3 or follicular dendritic cells (FDCs).4 Especially large antigens, for instance derived from bacteria, are thought to be provided by FDCs, since human B cells were considered to be unable to directly phagocytose large particles. According to dogma, FDCs, residing in the lymphoid follicles of the spleen, lymph nodes and mucosal tissue, bind incoming opsonized antigen via complement and Fc receptors and subsequently present these antigens to B cells.5 Also normal DCs were shown to present internalized antigen in an unprocessed form,3 which can be captured by B cells. Indeed, antigen extraction from the surface of other cells may be a way to internalize bacterial antigens, since B cells were shown to extract other antigens from a ‘non-internalizable’ solid surface.6 On the other hand, bacteria 8 r e t p a h C like Salmonella can also make direct contact with B cells. After crossing the epithelial barrier via M cells,7, 8 bacteria meet up with B cells in the lamina propria, after which both may translocate to regional lymph nodes or to B cell areas in the spleen and mucosa- associated lymphoid tissue.9 Can B cells therefore extract antigens from whole bacteria and process them to initiate T cell activation? Human B cell lines were demonstrated to present particulate antigens to MHC class II.10, 11 In Chapter 2, we show that the Ramos B cell line as well as primary B cells are able to phagocytose whole particles. Using anti-IgM

165 Chapter 8

coated beads to initiate binding to the IgM-BCR, Ramos cells internalize intact beads. In contrast, beads coated with non-specific antibodies are not phagocytosed. To investigate a more physiological model, we studied Salmonella bacteria and primary human B cells. We show that intact living Salmonella bacteria are phagocytosed by primary naive and memory B cells. The internalization ofSalmonella is mediated via the BCR. Internalization of Salmonella results in secretion of Salmonella-specific antibodies, confirming that internalization was mediated by B cells carrying a Salmonella-specific BCR. The relatively high percentage of circulating B cells that recognize Salmonella via their BCR may be explained by the expression of a polyreactive BCR (also reactive to other bacteria) by CD27 expressing circulating B cells.12 Internalization of Salmonella leads to effective antigen presentation and activation of CD4+ T helper cells that in turn help B cells to induce antibody secretion. Antibody levels increase significantly if B cells that had phagocytosed Salmonella were cocultured with autologous CD4+ T cells. Thus, phagocytosis of bacteria by primary B cells forms a new pathway to elicit efficient CD4+ T help for antibody production.

B cells as antigen presenting cells Activation of T helper cells by B cells demonstrates that the interaction between B and T cells is not only beneficial for B cells in antibody responses, but is also helpful for the induction of T cell responses. Hence, B cells are not only antibody secreting cells, but function also very efficiently as APC. The expression of an antigen-specific B cell receptor makes B cells unique in the selection of antigens to present to T cells, in contrast to DCs that sample all kind of different antigens. The specificity of the BCR selects for specific antigen to be internalized. DCs, on the other hand, internalize many different antigens simultaneously. In case of a limiting amount of a certain antigen, it is possible that DCs will not present this antigen, since other antigens are more abundant and are more likely to be presented. Thus, since their B cell receptor is antigen-specific, B cells can take up antigens at low concentrations and activate T cells responses in situations where DCs are less effective.13 B cells can activate both naive and memory T helper cells as effective as dendritic cellsin vitro.14 In vivo B cells are not obligatory for T cell activation, although depletion of B cells in mice reduces the magnitude of the T cell response.15-17 Naive T cells can be activated by B cells, but this seems to play a minor role in the initiation of a primary T cell responsein vivo.18 In the regulation of memory T cells however, B cells were shown to be critical.17-20 This suggests that other antigen presenting cells (e.g. DCs) induce the primary activation of naive T cells, whereas upon reimmunisation B cells become the main participating APC. Localization of T and B cells in the germinal center may play an important role in this

166 Summarizing discussion second phase. Activated T cells express CXCR5, which allows migration from the T cell zone to the border of the B cell follicle. Activated B cells also migrate to the B-T border. Here B and T cells can have strong interactions and induce two-way signaling: B cells obtain signals from T cells (e.g. CD40 and cytokine signaling) and T cells obtain signals from B cells (e.g. IL-6). The high number of antigen-specific B cells near memory CD4+ T cells after primary immunization may play a role in the preference of B cells as APC upon antigen recall.

B cells induce Th cell differentiation for optimal help The B and T cell crosstalk regulates differentiation of both cell types. T cells provide help in antibody response by B cells, B cells act on the differentiation of Th cells. The Th cell help in antibody secretion is partly cell-cell contact mediated via CD40-CD40L interaction, which promotes B cells proliferation and survival.21, 22 Upon CD40 ligation, B cells migrate into the follicle and start the formation of a germinal center.23 Furthermore, class switch recombination is induced. 24, 25 In addition, cytokines secreted by specific Th subsets play an important role in B cell help. The Th2 cytokine IL-4 was studied intensively,26-28 and also IL-10 and IL-17 have been implicated in the process.29 In the past decade, it has become clear that IL-21 forms probably the most crucial player in antibody secretion.30 In Chapter 3, we show that Salmonella-infected B cells polarize CD4+ T helper cells towards IFN-γ-secreting Th1 and IL-21-expressing Tfh. The classical Th2 cytokine IL-4 was induced to a lesser extent. The observation of a significant population of cells producing both IFN-γ and IL-21 let us further investigate the phenotype of this subset. This IFN-γ+/IL-21+ double positive (DP) population shows shared characteristic of both Th1 and Tfh cells, as demonstrated by expression of the subset-specific transcription factors T-bet (Th1) and Bcl-6 (Tfh). Johnston and colleagues demonstrated in mice that IL-12 induced IFN-γ+/ IL-21+ DP population, with a mixed Th1 and Tfh phenotype.31 In this mouse-model, IL- 21 expression and Bcl-6 expression were transitional and the Tfh phenotype was lost in time. In contrast, we showed that Salmonella-infected B cells induce Tfh differentiation via IL-6, and not via IL-12. IL-12 signaling via STAT4 induces T-bet, which leads to the decrease in IL-21. IL-6 activates STAT3 and is not associated with T-bet upregulation. Thus, 8 r e t p a h C in our system, the IL-6 induced IL-21 is not attenuated, resulting in a stable IFN-γ+/IL-21+ DP population. Expression of both Th1 (T-bet and IFN-γ) and Tfh (Bcl-6 and IL-21) characteristics suggests the transition of one T helper subset into another subset, indicating plasticity of T cell subsets.32-34 Plasticity of T helper subsets can be a very efficient way to attack a pathogen, like Salmonella, at a multidisciplinary level. Secretion of IFN-γ is important in Salmonella infection, and lead to activated macrophages that clear Salmonella.35-37

167 Chapter 8

Macrophages are resistant against bacterial infection and actively suppress intracellular bacterial replication.Salmonella replication in macrophages is suppressed by the protein Slc11A1 (also known as natural resistance-associated macrophage protein 1; NRAMP1) via impaired bacterial iron acquisition.38 In addition, IFN-γ was also demonstrated to contribute to the containment of Salmonella by macrophages via a similar mechanism.39 IL-21 has its main function in enhancing the humoral response, via stimulation of antibody secretion by B cells.40 Whether the IFN-γ+/IL-21+ DP population we observe finds its origin in a Th1 subset or is derived from Tfh precursor is currently unknown and remains to be resolved. Although IL-4 has been described to be an excellent player in B cell help,26, 27, 41, 42 in our B-T cell culture Th2 cells are induced to a lesser extent. Like other studies, we show that IL-4 is beneficial for B cell expansion and slightly induce antibody secretion.26-28, 43-46 In contrast, whereas IL-21 is superior in enhancing antibody secretion, B cell expansion was reduced. We and others demonstrated that IL-4 and IL-21 reciprocally regulate each other: IL-4 downmodulates IL-21+ Tfh differentiation,41, 47 whereas IL-21 decreases IL-4+ Th2 differentiation. Salmonella-infected B cells induce more Tfh differentiation, thereby repressing induction of expansion of the Th2 subset. To provide optimal help to B cells, Tfh should migrate into the germinal center (GC). This GC-Tfh subset is characterized by coexpression of CXCR5 and PD-1. Salmonella-infected B cells induce expression of CXCR5 and PD-1 especially in naive T cells. Memory T cells show a less pronounced CXCR5+PD-1+ phenotype. This might suggests that naive T cells are induced to migrate into the germinal center and provide optimal B cell help, while memory T cells reside at the B-T cell border. However, in our in vitro system, it is difficult to determine the contribution of migratory capacities of naive and memory T cells to B cell help, since no germinal centers are formed. Investigating migratory capacities of the different subsets could further determine the phenotype of this induced Th phenotype, and its contribution in antibody responses. Overall, Salmonella-specific B cells induce T cell differentiation which is optimal for B cell help in antibody secretion.

Induction of follicular T helper cells The pathways that induce Tfh cell differentiation and IL-21 secretion are still unclear. Over the past view years, different models have been proposed (reviewed in 48). A first model proposed that Tfh were derived from a precursor Th1, Th2, Th17 or iTreg subset.49 This model is in line with plasticity of T cells and might explain the existence of Tfh cells sharing characteristics of other Th subsets. A second model is that B cells are crucial in the Tfh response.50 In the absence of B cells, Tfh could not be detected.51-54 Crotty and coworkers proposed a model in which DCs activate CD4+ T cells and that B cells are important in the

168 Summarizing discussion maintenance of Tfh subset.48, 54 However, we demonstrated that DCs were not able to induce a proper IL-21+ Tfh subset, and that B cells themselves already induce a strong, stable Tfh differentiation. It has further been proposed that Tfh cells are a distinct CD4+ T cell subset. IL-6 and IL-21 were demonstrated as inducing factors, since they upregulate Bcl-6 and CXCR5, both key markers of Tfh cell differentiation.55, 56 This model however, has been challenged, since in vivo Tfh differentiation still occurs in absence of IL-6 or IL-21.57, 58 Although IL-21 seems not to be critical, is does show maintenance capacities of the Tfh phenotype.59 Finally, IL-12 has been implicated in Tfh cell differentiation.60 Our data in Chapter 3 shows no role of IL-12 in the induction of Tfh by B cells. However, blocking IL-6 does show a decrease in IL-21+ T cell differentiation from naive T cells. Signaling via the IL-6 receptor activates signal transducer and activator of transcription 3 (STAT3).61 IL-21 also induces STAT3 phosphorylation and both cytokines have been implicated to induce Bcl-6, which is the hallmark transcription factor for Tfh cells.56, 62 We did not find a significant role for IL-21 in Tfh differentiation. Signaling via STAT3 might play an important role in the induction of a Tfh subset in our system. In Chapter 5 we showed a link between CD5 costimulation and STAT3 activation. We also investigated a role for CD5inTfh differentiation. Blocking CD5 did not alter T cell proliferation, but did strongly decrease IL-21+ as well as IFN-γ+ T cell polarization (our unpublished observations). This suggests that in our Salmonella system CD5 plays a role in Th effector functions in a more general context. It is also possible that blocking with anti-CD5 mAbs disrupts the immunological synapse in such a way, that T cell activation is less efficient. Besides CD5, other cell-cell contact might also influence Tfh differentiation. Signaling lymphoidic activation molecule (SLAM) or the inducible costimulator (ICOS) were implicated in the Tfh differentiation.54, 63 The exact role of IL-6, IL-21, CD5 and possibly other STAT3 activating factors in the induction of Tfh cells has to be further investigated.

IL-2 and IL-21 in T cell differentiation Over the past few years it has become clear that IL-2 plays an important role in the differentiation of T helper cells. IL-2 signals via the IL-2R, which consists ofahigh affinity IL-2Rα (CD25), low affinity IL-2Rβ (CD122) and the common γ (γc) chain (CD132). 8 r e t p a h C IL-2 upregulates expression of IL-2Rα and IL-2Rβ, and promotes T cell survival and differentiation into effector and memory cells.64-66 Therefore, IL-2 was initially thought to be mainly involved in T cell expansion and a stimulatory factor for immune responses. Nowadays, our view on the functions of IL-2 has changed, and is still changing. Absence of IL-2 or IL-2R showed systemic, inflammatory autoimmunity rather than immunodeficiencies.67-70 Thus IL-2 was linked to immunosuppression, via Tregs, instead of immune activation. However, it is unclear how IL-2 is involved in Treg development.

169 Chapter 8

IL-2 is not necessary for induction of the Treg specific transcription factor, Foxp3,71 but likely enhances Foxp3 levels.72 Tregs are characterized by high expression of IL-2Rα,73 suggesting a high dependency on IL-2. Indeed, IL-2 was demonstrated to be critical in the survival of peripheral Tregs.74. It has become clear that IL-2 does not significantly contribute to the initial activation and survival of activated T cells. T cell receptor signaling was shown to be sufficient to induce expansion and induction of classic activation markers, such as CD44 and CD25.75, 76 However, a reduction in numbers of fully differentiated Th1 and Th2 cells was seen in absence of IL-2.64, 75-77 Thus, IL-2 seems to play a role in the second phase of T cell activation. Abbas and colleagues showed that IL-2 signaling is important in the generation of memory responses.78 IL-2 promotes expression of the IL-7R.78 IL-7R was shown to be indispensable for CD4+ T cell survival.79-81 IL-7R is normally downregulated after T cells activation, but IL-2 mediated re-expression of IL-7R leads to memory formation ofT helper cells.78 Besides enabling memory T cell formation, IL-2 has also been linked to differentiation of CD4+ T helper cells. Signaling via IL-2R leads to transcription of IL-12Rβ which induces expression of the Th1 associated transcription factors T-bet and Blimp-1, which favors Th1 skewing.82 The role of IL-2 signaling in Tfh differentiation is not fully understood. In mice it was described that the expression of IL-2Rα is significantly lower in cells expressing the Tfh marker CXCR5, compared to CXCR5- population.83 This may point to a negative role of IL-2 in Tfh differentiation, a concept supported by a recent paper, showing IL-2 mediated decrease of Tfh generation.31 In Chapter 4 we investigated the role of IL-2 and IL-21 on T cell differentiation. Addition of IL-21 leads to enhanced T cell proliferation in the first phase of activation. However, at the second phase of T cell activation, extra IL-21 has a negative role in proliferation and cytokine production by T cells is decreased. We showed that IL-21 inhibits autologous IL-2 transcription. As a result of less IL-2 production, IL-2R is also decreased, which could be restored by exogenous IL-2. The restore of IL-2 signaling by adding IL-2 also results in improved cytokine production, at levels similar to conditions with no extra IL-21. IL-2 signaling was described to induce Blimp-1 and T-bet.82, 84 In line with our observation that IL-21 inhibits autologous IL-2 transcription, we observed a suppressive effect in Blimp-1 and T-bet mRNA levels. Blimp-1 was shown to be highly expressed in Th1, Th2, Th17 and iTreg subsets (non-Tfh).52, 60, 85 Thus, IL-21 mediated inhibition of Blimp-1 might result in decreased Th differentiation towards non-Tfh subsets. The specific transcription factor for Tfh cells is Bcl-6.52, 56, 86 Blimp-1 and Bcl-6 are reciprocally antagonistic transcription factors.52 Since extra IL-21 decreases Blimp-1 transcription, one might expect a better induction of Tfh cells. However, we observed that IL-21 also attenuates Tfh differentiation.

170 Summarizing discussion

It is therefore interesting to investigate the effects of IL-21 on Bcl-6 levels in activated T cells that were stimulated in presence of IL-21. In our system, IL-2 seems to play a role especially in the second phase of activation, since adding IL-2 later in time was still sufficient to restore cytokine production. Naive and memory T cells respond similar to the addition of IL-21, which leads to decreased cytokine production and inhibition of autologous IL-2. Adding IL-2 could completely restore cytokine production in naive T cells. Memory T cells seem to be differently regulated. IL-21 also decreases full reactivation of memory Th cells but IL-2 could not completely counteract this downmodulatory effect. Thus, memory T cells are differently regulated by IL-21 and IL-2, but how remains to be elucidated. What may be the physiological use of downmodulation of Th effector functions through IL-21? Upon activation, Th cells that differentiate into Tfh cells acquire CXCR5 expression and migrate to the border of the B and T cell zone.87-89 Here they secrete IL-21 which is consumed by activated B cells to induce B cell differentiation and antibody production. After further differentiation of B cells into memory cells or antibody secreting plasma cells, B cells migrate out of the B cell zone or bone marrow. At this stage, IL-21 secreted by Tfh cells is no longer consumed and IL-21 could now provide a negative feedback loop to counteract continued effector function of the activated T cells. IL-21 produced in the germinal center will shut down GC-Tfh effector function. IL-21 production by pre-Tfh at the B-T border will also negatively regulate cytokine secretion by other subset that (transiently) express CXCR5 and also reside at the B-T border. Thus, IL-21 might form a self-regulatory mechanism to return to homeostasis after infection and to form a safety valve to prevent uncontrolled inflammatory responses. Further research will obtain more insight in this hypothesis.

Th17 differentiation Besides Th1 and Tfh polarization, B cells that have phagocytosedSalmonella also reactivate Th17 memory cells (our unpublished data). IL-17 attracts and activates neutrophils, which can participate in the clearance of Salmonella infection. Like for Tfh, the differentiation of naive CD4+ T cells into the Th17 subset is a matter of debate in human. The role of the 8 r e t p a h C cytokines IL-23, IL-1β, IL-6 and TGF-β has been established for the Th17 differentiation in mice and human.90-93 The role of costimulation in the differentiation into IL-17 secreting cells is poorly understood. Classical costimulation via CD28 has been described to downregulate Th17 responses.94 In Chapter 5, we demonstrate a role for non-classical costimulation via CD5 or CD6 in Th17 differentiation. In Th17 inducing conditions, CD5 or CD6 costimulation is superior to classical CD28 costimulation in the induction of Th17 cells. The superior induction of Th17 lineage can be explained by enhanced expression of IL-

171 Chapter 8

23R. IL-23R has been shown to be important in the stabilization of the Th17 phenotype.95 The CD5 mediated elevated expression of IL-23R results in prolonged activation of STAT3, a key regulator in Th17 differentiation. Impaired CD5 signaling has been associated with decreased Th17 differentiation in mice.96 Moreover, we show that CD28 stimulation decreases the CD5 induced Th17 differentiation. CD28 is defined as the classical costimulatory signal which in combination with T cell receptor signaling, induces T cell activation and proliferation.97 The CD28 ligands CD80 and CD86 are commonly expressed by activated antigen presenting cells. Thus, optimal Th17 differentiation via CD5 is unlikely to be induced by professional APC, expressing high levels of CD80/CD86. APCs expressing low levels of costimulatory molecules CD80/CD86 are more likely to better induce Th17 differentiation. A possibility is the human analogs of the CD103+ lamina propria DCs that have been described in mice.98 Upon LPS stimulationin vitro, these DCs upregulate MHC class II, but do not show increased levels of CD80 and CD86. Alternatively, B cells have also lower expression of these costimulatory molecules upon activation than DCs (our unpublished observations). Since they are very capable in CD4+ T cell activation, it might be interesting to study Th17 induction by B cells. The ligands for CD5 on antigen presenting cells are poorly defined. CD5, which can be expressed by B cells, is proposed to be the ligand for CD5 itself.99 Alternatively, CD5 and CD6 are also implicated as a pathogen recognition receptor. CD5 can bind polysaccharide β-glycan, which is present on fungi. Indeed, Candida albicans is associated with Th17 responses.100 LPS and LTA on the other hand can activate T cells via CD6,101 and may play a role in Th17 responses against intestinal bacteria.102 It would be interesting to further investigate the role of these ligands in Th17 differentiation. IL-17 secretion by Th17 cells attracts neutrophils, which help in the clearance of pathogens. In other systems, basophils, which are activated by the Th2 cytokine IL-4, were shown to be involved in the differentiation of T cells towards this Th2 subset. In this regard it is tempting to suggest that neutrophils may be involved in Th17 differentiation, either directly or indirectly through modulation of T cell interaction with more classical APCs. It would be interesting to study the role of neutrophils in Th17 differentiation.

B cells as a vehicle for Salmonella spreading Intestinal bacteria, such as Salmonella, can cross the epithelial barrier in the intestines to cause infections. Macrophages and neutrophils are specialized to destroy bacteria via the NADPH-oxidase system,103 preventing further spreading ofSalmonella . Upon crossing the intestinal epithelium, Salmonella can enter the Peyer’s Patches where many B cells reside. In Chapter 2 we have shown that B cells are also able to phagocytose Salmonella. However, unlike macrophages, B cells are not able to destroy the internalized bacterium.

172 Summarizing discussion

In Chapter 6 we demonstrated that Salmonella survives in B cells in a latent state. At later stages Salmonella is excreted from B cells and can reinfect other cell types, and resume replication. We show that both living and dead Salmonella are excreted, which implies a B cell mediated process. These data suggest that in vivo B cells may act as transport vehicles for Salmonella, enabling systemic spreading. In line with this concept, is our finding that replication of Salmonella is actively repressed in primary B cells, but not in the B cell line Ramos via a yet unidentified mechanism. Repression of replication probably enhances B cell survival. In addition,Salmonella does not induce apoptosis of the infected B cell. Others have shown that DCs and erythrocytes can be used by pathogens for systemic spreading.104, 105 In an animal model, we show that B cells indeed can be misused by Salmonella for systemic spreading to blood and spleen. These data imply that immunological targeting of intracellular Salmonella in B cells is not only important to eliminate a survival niche for Salmonella, but that it would also contribute to counteract and limit spreading of Salmonella infection. Indeed, a CTL response is required to clear Salmonella.106, 107

Cross-presentation by B cells To initiate a CTL response to clear intracellular residingSalmonella , bacterial antigens have to be presented via MHC class I to CD8+ T cells. Dendritic cells activateSalmonella -specific CD8+ CTLs via direct infection and cross-presentation or via suicide cross-presentation upon ingestion of infected apoptotic cells.107 B cells induce a strong anti-Salmonella CD4+ T helper response. In Chapter 7 we demonstrate that primary human B cells that have phagocytosed Salmonella also elicit a specific CD8+ CTL response after cross-presentation of Salmonella antigens. This in contrast to findings in mice, in which B cells were not able to present Salmonella antigens on MHC class I.108 This might be explained by the fact that Salmonella is not able to replicate in primary human B cells, but survives intracellularly. For infection and intracellular survival, Salmonella make use of its Type III Secretion System (TTSS), consisting of SPI-1 and SPI-2. Both inject effector proteins into the cell, allowing internalization and intracellular survival.109 Using Salmonella with a defect in SPI-1 or SPI-2, we demonstrated that both secretion devices contribute to cross- 8 r e t p a h C presentation of antigens to MHC class I. It is therefore likely that antigens secreted by the TTSS are processed and presented to CD8+ CTLs. The CD8+ T cell response initiated by B cells is a recall response of CD8 memory cells. This addresses the requirement of other professional APC cells like DCs to prime naive CD8+ T cells. Upon reinfection however, B cells seem to elicit a stronger CD8+ T cell response in which B cells activate both central memory and effector memory CD8+ T cells. DCs were shown to induce effector memory T cells, but not central memory.107 This suggests that DCs may be probably less important

173 Chapter 8

Figure 1. B cell responses upon Salmonella infection. Salmonellae that have crossed the intestinal epithelium are phagocytosed by resting B cells in the Peyer’s Patches, after which the B cells form a local survival reservoir for Salmonella. Migration ofSalmonella -infected cells and subsequent excretion ofSalmonella and infection of other tissues causes systemic spreading and dissemination ofSalmonella . B cells presentingSalmonella antigen can activate Th cells and induce follicular Th (Tfh) and Th1 differentiation. Plastic Tfh/Th1 or fully polarized Tfh cells enhance Salmonella-specific antibody production. Cross-presentation results in activation of memory CTL, partly via IL-2 mediated help by Th1 or plastic Tfh/Th1 cells. CTLs kill Salmonella-infected cells. The combined anti-Salmonella immune response counteracts the supportive function of B cells in further spreading of Salmonella infection.

174 Summarizing discussion upon reinfection withSalmonella . The CD8+ response was dependent on the help by CD4+ T helper cells, likely via IL-2. Thus, via cross-presentation, B cells enable the attack of intracellular residing Salmonella by CTLs.

Model of the role of B cells in Salmonella infection When we take our data together, the picture emerges that B cells play a dual role in the defense against bacterial infections, in that they are crucial for antibody secretion, but also can induce the appropriate anti-bacterial T cell responses. In the immune response against Salmonella we propose the following model. After oral ingestion,Salmonella can be taken up by specialized DCs via intestinal sampling (Figure 1).110, 111 This will result in DC differentiation, which induces their migration to the mesenteric lymph nodes, where they can prime Salmonella-specific naive CD4+ T cells, and naive CD8+ T cells. As Salmonella can also survive in DC,112, 113 migration of infected DC may also mediate infection of naive Salmonella-specific B cells in the lymph node. Although DC-sampling may be one route for bacterial entry, most invading Salmonella cross the epithelium via transcytosis through M cells. This route allows immediate access of the bacteria to the Peyer’s Patches that lie beneath the M cells. Therefore the B cell-rich Peyer’s Patches form another likely anatomic site where Salmonella will initially encounter B cells. B cell follicles in other sites of the gut associated lymphoid tissue may also play a role. Salmonella-specific B cells will phagocytose the whole bacterium via their specific BCR. Phagocytosis provides an intracellular survival reservoir for Salmonella, hiding for other immune cells. Subsequently, Salmonella can be excreted in the lamina propria and infect other cells to sustain the local survival reservoir. Alternatively, activated B cells that have phagocytosed Salmonella will migrate to mesenteric lymph nodes or spread via blood to spleen and liver. Both actions have consequences for Salmonella infection.

At the border of the B and T cell zone, activated B cells that have processed Salmonella antigen can activate CD4+ T helper cells (Figure 2). This B-T cell interaction induces T cell differentiation towards Th1, Tfh and a plastic Th1/Tfh intermediate. Alternatively, naive Th cells have been activated by DCs in the T cell zone and migrate to the B-T cell border, 8 r e t p a h C where they may receive further differentiation signals by the B cells. For memory CD4+ T cells, it less clear. Recently it was postulated that central memory CD4+ T cells also reside at the B-T border,114 where they may become reactivated by Salmonella-infected B cells during reinfection. Salmonella-specific activated T cells interact with Salmonella- specific B cells to induce further B cell differentiation. B cells having received further differentiation signals next migrate into the B cell follicle and start germinal center formation. Activated Tfh cells that express CXCR5 and PD-1 may migrate into the germinal

175 Chapter 8

center. Here, Tfh cells may provide further help in Salmonella-specific antibody production, among others via IL-21 secretion. Further B cell differentiation and migration away from the GC may lead to excess IL- 21. IL-21 production then negatively regulates differentiation of Tfh and other Th subsets via inhibition of IL-2 transcription. This negative feedback loop results in loss of effector functions of the Tfh cell and may for a safety loop to return to

Figure 2. B and T cell interaction in the germinal center. homeostasis after infection. Salmonella-infected B cells interact with Th cells at the border of the T and B cell zone. Cross talk results in Th differentiation towards Tfh and Th1. B cells migrate into the follicle and form Spreading of Salmonella-infected a germinal center (GC). CXCR5 and PD-1 expressing Tfh migrate B cells causes systemic spreading into the GC, providing B cell help via IL-21. B cells become antibody secreting cells (ASC). In the absence of activated B of Salmonella. Excretion of the cells, excess IL-21 affects further Th differentiation by inhibiting living bacteria leads to infection IL-2 transcription, resulting in loss of cytokine secretion and downmodulation of Th activation. of other cells (Figure 1). DCs and B cells however, will cross-present Salmonella antigens and elicit a CD8+ CTL response which kills Salmonella infected cells. IFN-γ, produced by activated CD4+ T helper cells, helps macrophages to destroy Salmonella. Additionally, IL-17 secretion will lead to activation of neutrophils, which will help to also clear Salmonella. Finally, antibodies secreted by B cells will opsonize extracellular Salmonella and further enhance clearance of the pathogen (Figure 1). Together our data show that phagocytosis of Salmonella by B cells may generate a survival niche and transport vehicle for Salmonella, but that simultaneously Salmonella-infected B cells induce an optimal anti-Salmonella response through activation of multiple arms of the adaptive immune response. This thesis thus forms a clear example how pathogens and the eukaryotic immune system have coevolved. It enables transient survival of the pathogen within the host, while simultaneously eliciting integrated pathogen-optimized immune responses that eventually clear the pathogen while minimizing host damage.

176 Summarizing discussion

References

1. Hess, J., C. Ladel, D. Miko, and S. H. Kaufmann. 1996. Salmonella typhimurium aroA- infection in gene- targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. J. Immunol. 156: 3321-3326. 2. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245- 252. 3. Bergtold, A., D. D. Desai, A. Gavhane, and R. Clynes. 2005. Cell surface recycling of internalized antigen permits dendritic cell priming of B cells. Immunity. 23: 503-514. 4. Balazs, M., F. Martin, T. Zhou, and J. Kearney. 2002. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses. Immunity. 17: 341-352. 5. Szakal, A. K., M. H. Kosco, and J. G. Tew. 1989. Microanatomy of lymphoid tissue during humoral immune responses: structure function relationships. Annu. Rev. Immunol. 7: 91-109. 6. Batista, F. D., and M. S. Neuberger. 2000. B cells extract and present immobilized antigen: implications for affinity discrimination. EMBO J. 19: 513-520. 7. Carter, P. B., and F. M. Collins. 1974. The route of enteric infection in normal mice.J Exp. Med. 139: 1189- 1203. 8. Jensen, V. B., J. T. Harty, and B. D. Jones. 1998. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer’s patches. Infect. Immun. 66: 3758-3766. 9. Berg, R. D. 1995. Bacterial translocation from the gastrointestinal tract. Trends Microbiol. 3: 149-154. 10. Lombardi, G., F. del Gallo, D. Vismara, E. Piccolella, C. de Martino, C. Garzelli, C. Puglisi, and V. Colizzi. 1987. Epstein-Barr virus-transformed B cells process and present Mycobacterium tuberculosis particulate antigens to T-cell clones. Cell Immunol. 107: 281-292. 11. Vidard, L., M. Kovacsovics-Bankowski, S. K. Kraeft, L. B. Chen, B. Benacerraf, and K. L. Rock. 1996. Analysis of MHC class II presentation of particulate antigens of B lymphocytes. J. Immunol. 156: 2809-2818. 12. Dammers, P. M., and F. G. Kroese. 2005. Recruitment and selection of marginal zone B cells is independent of exogenous antigens. Eur. J. Immunol. 35: 2089-2099. 13. Rivera, A., C. C. Chen, N. Ron, J. P. Dougherty, and Y. Ron. 2001. Role of B cells as antigen-presenting cells in vivo revisited: antigen-specific B cells are essential for T cell expansion in lymph nodes and for systemic T cell responses to low antigen concentrations. Int. Immunol. 13: 1583-1593. 14. Cassell, D. J., and R. H. Schwartz. 1994. A quantitative analysis of antigen-presenting cell function: activated B cells stimulate naive CD4 T cells but are inferior to dendritic cells in providing costimulation. J. Exp. Med. 180: 1829-1840. 15. Hayglass, K. T., S. J. Naides, C. F. Scott, Jr., B. Benacerraf, and M. S. Sy. 1986. T cell development in B cell- deficient mice. IV. The role of B cells as antigen-presenting cells in vivo. J. Immunol. 136: 823-829. 16. Kurt-Jones, E. A., D. Liano, K. A. HayGlass, B. Benacerraf, M. S. Sy, and A. K. Abbas. 1988. The role of

antigen-presenting B cells in T cell priming in vivo. Studies of B cell-deficient mice.J. Immunol. 140: 3773- 8 r e t p a h C 3778. 17. Linton, P. J., J. Harbertson, and L. M. Bradley. 2000. A critical role for B cells in the development of memory CD4 cells. J. Immunol. 165: 5558-5565. 18. Barr, T. A., S. Brown, P. Mastroeni, and D. Gray. 2010. TLR and B cell receptor signals to B cells differentially program primary and memory Th1 responses to Salmonella enterica. J. Immunol. 185: 2783-2789. 19. Crawford, A., M. Macleod, T. Schumacher, L. Corlett, and D. Gray. 2006. Primary T cell expansion and differentiation in vivo requires antigen presentation by B cells. J. Immunol. 176: 3498-3506. 20. Stephens, R., and J. Langhorne. 2006. Priming of CD4+ T cells and development of CD4+ T cell memory;

177 Chapter 8

lessons for malaria. Parasite Immunol. 28: 25-30. 21. Van Kooten C., and J. Banchereau. 2000. CD40-CD40 ligand. J. Leukoc. Biol. 67: 2-17. 22. Foy, T. M., M. McIlraith, S. R. Masters, J. J. Dunn, A. A. Rossini, L. D. Shultz, R. A. Hesselton, E. J. Wagar, P. E. Lipsky, R. J. Noelle, and D. L. Greiner. 1998. Blockade of CD40-CD154 interferes with human T cell engraftment in scid mice. Cell Transplant. 7: 25-35. 23. Han, S., K. Hathcock, B. Zheng, T. B. Kepler, R. Hodes, and G. Kelsoe. 1995. Cellular interaction in germinal centers. Roles of CD40 ligand and B7-2 in established germinal centers. J. Immunol. 155: 556-567. 24. Korthauer, U., D. Graf, H. W. Mages, F. Briere, M. Padayachee, S. Malcolm, A. G. Ugazio, L. D. Notarangelo, R. J. Levinsky, and R. A. Kroczek. 1993. Defective expression of T-cell CD40 ligand causes X-linked immunodeficiency with hyper-IgM. Nature 361: 539-541. 25. Gray, D., K. Siepmann, and G. Wohlleben. 1994. CD40 ligation in B cell activation, isotype switching and memory development. Semin. Immunol. 6: 303-310. 26. Ford, D., C. Sheehan, C. Girasole, R. Priester, N. Kouttab, J. Tigges, T. C. King, A. Luciani, J. W. Morgan, and A. L. Maizel. 1999. The human B cell response to IL-13 is dependent on cellular phenotype as well as mode of activation. J. Immunol. 163: 3185-3193. 27. Wagner, E. F., M. Hleb, N. Hanna, and S. Sharma. 1998. A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation. J. Immunol. 161: 1123-1131. 28. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, M. R. de Waal, and J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U. S. A 90: 3730-3734. 29. Morita, R., N. Schmitt, S. E. Bentebibel, R. Ranganathan, L. Bourdery, G. Zurawski, E. Foucat, M. Dullaers, S. Oh, N. Sabzghabaei, E. M. Lavecchio, M. Punaro, V. Pascual, J. Banchereau, and H. Ueno. 2011. Human blood CXCR5(+)CD4(+) T cells are counterparts of T follicular cells and contain specific subsets that differentially support antibody secretion. Immunity. 34: 108-121. 30. Ettinger, R., S. Kuchen, and P. E. Lipsky. 2008. The role of IL-21 in regulating B-cell function in health and disease. Immunol. Rev. 223: 60-86. 31. Johnston, R. J., Y. S. Choi, J. A. Diamond, J. A. Yang, and S. Crotty. 2012. STAT5 is a potent negative regulator of TFH cell differentiation. J. Exp. Med. 209: 243-250. 32. Lu, K. T., Y. Kanno, J. L. Cannons, R. Handon, P. Bible, A. G. Elkahloun, S. M. Anderson, L. Wei, H. Sun, J. J. O’Shea, and P. L. Schwartzberg. 2011. Functional and epigenetic studies reveal multistep differentiation and plasticity of in vitro-generated and in vivo-derived follicular T helper cells. Immunity. 35: 622-632. 33. Crotty, S. 2011. Follicular helper CD4 T cells (TFH). Annu. Rev. Immunol. 29: 621-663. 34. Deenick, E. K., and C. S. Ma. 2011. The regulation and role of T follicular helper cells in immunity. Immunology 134: 361-367. 35. Mastroeni, P., A. Vazquez-Torres, F. C. Fang, Y. Xu, S. Khan, C. E. Hormaeche, and G. Dougan. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. II. Effects on microbial proliferation and host survival in vivo. J. Exp. Med. 192: 237-248. 36. Vazquez-Torres, A., J. Jones-Carson, P. Mastroeni, H. Ischiropoulos, and F. C. Fang. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. I. Effects on microbial killing by activated peritoneal macrophages in vitro. J. Exp. Med. 192: 227-236. 37. Kagaya, K., K. Watanabe, and Y. Fukazawa. 1989. Capacity of recombinant gamma interferon to activate macrophages for Salmonella-killing activity. Infect. Immun. 57: 609-615. 38. Nairz, M., G. Fritsche, M. L. Crouch, H. C. Barton, F. C. Fang, and G. Weiss. 2009. Slc11a1 limits intracellular growth of Salmonella enterica sv. Typhimurium by promoting macrophage immune effector functions and impairing bacterial iron acquisition. Cell Microbiol. 11: 1365-1381.

178 Summarizing discussion

39. Nairz, M., G. Fritsche, P. Brunner, H. Talasz, K. Hantke, and G. Weiss. 2008. Interferon-gamma limits the availability of iron for intramacrophage Salmonella typhimurium. Eur. J. Immunol. 38: 1923-1936. 40. Bryant, V. L., C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, M. R. de Waal, and S. G. Tangye. 2007. Cytokine-mediated regulation of human B cell differentiation into Ig-secreting cells: predominant role of IL-21 produced by CXCR5+ T follicular helper cells. J. Immunol. 179: 8180-8190. 41. Avery, D. T., V. L. Bryant, C. S. Ma, M. R. de Waal, and S. G. Tangye. 2008. IL-21-induced isotype switching to IgG and IgA by human naive B cells is differentially regulated by IL-4. J. Immunol. 181: 1767-1779. 42. Kindler, V., and R. H. Zubler. 1997. Memory, but not naive, peripheral blood B lymphocytes differentiate into Ig-secreting cells after CD40 ligation and costimulation with IL-4 and the differentiation factors IL-2, IL-10, and IL-3. J. Immunol. 159: 2085-2090. 43. Tangye, S. G., D. T. Avery, E. K. Deenick, and P. D. Hodgkin. 2003. Intrinsic differences in the proliferation of naive and memory human B cells as a mechanism for enhanced secondary immune responses. J. Immunol. 170: 686-694. 44. Arpin, C., J. Dechanet, K. C. Van, P. Merville, G. Grouard, F. Briere, J. Banchereau, and Y. J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268: 720-722. 45. Ettinger, R., G. P. Sims, A. M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky. 2005. IL-21 induces differentiation of human naive and memory B cells into antibody-secreting plasma cells. J. Immunol. 175: 7867-7879. 46. Crotty, S. 2011. Follicular helper CD4 T cells (TFH). Annu. Rev. Immunol. 29: 621-663. 47. Zhu, J., H. Yamane, and W. E. Paul. 2010. Differentiation of effector CD4 T cell populations. Annu. Rev. Immunol. 28: 445-489. 48. Crotty, S., R. J. Johnston, and S. P. Schoenberger. 2010. Effectors and memories: Bcl-6 and Blimp-1 in T and B lymphocyte differentiation. Nat. Immunol. 11: 114-120. 49. Haynes, N. M., C. D. Allen, R. Lesley, K. M. Ansel, N. Killeen, and J. G. Cyster. 2007. Role of CXCR5 and CCR7 in follicular Th cell positioning and appearance of a programmed cell death gene-1high germinal center- associated subpopulation. J. Immunol. 179: 5099-5108. 50. Johnston, R. J., A. C. Poholek, D. DiToro, I. Yusuf, D. Eto, B. Barnett, A. L. Dent, J. Craft, and S. Crotty. 2009. Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science 325: 1006-1010. 51. Zaretsky, A. G., J. J. Taylor, I. L. King, F. A. Marshall, M. Mohrs, and E. J. Pearce. 2009. T follicular helper cells differentiate from Th2 cells in response to helminth antigens. J. Exp. Med. 206: 991-999. 52. Choi, Y. S., R. Kageyama, D. Eto, T. C. Escobar, R. J. Johnston, L. Monticelli, C. Lao, and S. Crotty. 2011. ICOS receptor instructs T follicular helper cell versus effector cell differentiation via induction ofthe transcriptional repressor Bcl6. Immunity. 34: 932-946. 53. Nurieva, R. I., Y. Chung, D. Hwang, X. O. Yang, H. S. Kang, L. Ma, Y. H. Wang, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2008. Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages. Immunity. 29: 138-149.

54. Nurieva, R. I., Y. Chung, G. J. Martinez, X. O. Yang, S. Tanaka, T. D. Matskevitch, Y. H. Wang, and C. Dong. 8 r e t p a h C 2009. Bcl6 mediates the development of T follicular helper cells. Science 325: 1001-1005. 55. Poholek, A. C., K. Hansen, S. G. Hernandez, D. Eto, A. Chandele, J. S. Weinstein, X. Dong, J. M. Odegard, S. M. Kaech, A. L. Dent, S. Crotty, and J. Craft. 2010. In vivo regulation of Bcl6 and T follicular helper cell development. J. Immunol. 185: 313-326. 56. Zotos, D., J. M. Coquet, Y. Zhang, A. Light, K. D’Costa, A. Kallies, L. M. Corcoran, D. I. Godfrey, K. M. Toellner, M. J. Smyth, S. L. Nutt, and D. M. Tarlinton. 2010. IL-21 regulates germinal center B cell differentiation and proliferation through a B cell-intrinsic mechanism. J. Exp. Med. 207: 365-378. 57. Linterman, M. A., L. Beaton, D. Yu, R. R. Ramiscal, M. Srivastava, J. J. Hogan, N. K. Verma, M. J. Smyth, R.

179 Chapter 8

J. Rigby, and C. G. Vinuesa. 2010. IL-21 acts directly on B cells to regulate Bcl-6 expression and germinal center responses. J. Exp. Med. 207: 353-363. 58. Ma, C. S., S. Suryani, D. T. Avery, A. Chan, R. Nanan, B. Santner-Nanan, E. K. Deenick, and S. G. Tangye. 2009. Early commitment of naive human CD4(+) T cells to the T follicular helper (T(FH)) cell lineage is induced by IL-12. Immunol. Cell Biol. 87: 590-600. 59. Horn, F., C. Henze, and K. Heidrich. 2000. Interleukin-6 signal transduction and lymphocyte function. Immunobiology 202: 151-167. 60. King, C., S. G. Tangye, and C. R. Mackay. 2008. T follicular helper (TFH) cells in normal and dysregulated immune responses. Annu. Rev. Immunol. 26: 741-766. 61. Linterman, M. A., R. J. Rigby, R. Wong, D. Silva, D. Withers, G. Anderson, N. K. Verma, R. Brink, A. Hutloff, C. C. Goodnow, and C. G. Vinuesa. 2009. Roquin differentiates the specialized functions of duplicated T cell costimulatory receptor genes CD28 and ICOS. Immunity. 30: 228-241. 62. Dooms, H., E. Kahn, B. Knoechel, and A. K. Abbas. 2004. IL-2 induces a competitive survival advantage in T lymphocytes. J. Immunol. 172: 5973-5979. 63. Broome, H. E., C. M. Dargan, S. Krajewski, and J. C. Reed. 1995. Expression of Bcl-2, Bcl-x, and Bax after T cell activation and IL-2 withdrawal. J. Immunol. 155: 2311-2317. 64. Plaetinck, G., M. C. Combe, P. Corthesy, P. Sperisen, H. Kanamori, T. Honjo, and M. Nabholz. 1990. Control of IL-2 receptor-alpha expression by IL-1, tumor necrosis factor, and IL-2. Complex regulation via elements in the 5’ flanking region. J. Immunol. 145: 3340-3347. 65. Sadlack, B., H. Merz, H. Schorle, A. Schimpl, A. C. Feller, and I. Horak. 1993. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75: 253-261. 66. Schorle, H., T. Holtschke, T. Hunig, A. Schimpl, and I. Horak. 1991. Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting. Nature 352: 621-624. 67. Willerford, D. M., J. Chen, J. A. Ferry, L. Davidson, A. Ma, and F. W. Alt. 1995. Interleukin-2 receptor alpha chain regulates the size and content of the peripheral lymphoid compartment. Immunity. 3: 521-530. 68. Suzuki, H., T. M. Kundig, C. Furlonger, A. Wakeham, E. Timms, T. Matsuyama, R. Schmits, J. J. Simard, P. S. Ohashi, H. Griesser, and . 1995. Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science 268: 1472-1476. 69. Fontenot, J. D., J. P. Rasmussen, M. A. Gavin, and A. Y. Rudensky. 2005. A function for interleukin 2 in Foxp3-expressing regulatory T cells. Nat. Immunol. 6: 1142-1151. 70. Hori, S., T. Nomura, and S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. 71. Malek, T. R., and I. Castro. 2010. Interleukin-2 receptor signaling: at the interface between tolerance and immunity. Immunity. 33: 153-165. 72. Knoechel, B., J. Lohr, E. Kahn, J. A. Bluestone, and A. K. Abbas. 2005. Sequential development of interleukin 2-dependent effector and regulatory T cells in response to endogenous systemic antigen. J. Exp. Med. 202: 1375-1386. 73. Van, P. L., A. Biuckians, A. Ibragimov, F. W. Alt, D. M. Willerford, and A. K. Abbas. 1997. Functional responses and apoptosis of CD25 (IL-2R alpha)-deficient T cells expressing a transgenic antigen receptor. J. Immunol. 158: 3738-3745. 74. Jelley-Gibbs, D. M., N. M. Lepak, M. Yen, and S. L. Swain. 2000. Two distinct stages in the transition from naive CD4 T cells to effectors, early antigen-dependent and late cytokine-driven expansion and differentiation. J. Immunol. 165: 5017-5026. 75. Cote-Sierra, J., G. Foucras, L. Guo, L. Chiodetti, H. A. Young, J. Hu-Li, J. Zhu, and W. E. Paul. 2004. Interleukin 2 plays a central role in Th2 differentiation. Proc. Natl. Acad. Sci. U. S. A 101: 3880-3885. 76. Dooms, H., K. Wolslegel, P. Lin, and A. K. Abbas. 2007. Interleukin-2 enhances CD4+ T cell memory by

180 Summarizing discussion

promoting the generation of IL-7R alpha-expressing cells. J. Exp. Med. 204: 547-557. 77. Seddon, B., P. Tomlinson, and R. Zamoyska. 2003. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat. Immunol. 4: 680-686. 78. Li, J., G. Huston, and S. L. Swain. 2003. IL-7 promotes the transition of CD4 effectors to persistent memory cells. J. Exp. Med. 198: 1807-1815. 79. Kondrack, R. M., J. Harbertson, J. T. Tan, M. E. McBreen, C. D. Surh, and L. M. Bradley. 2003. Interleukin 7 regulates the survival and generation of memory CD4 cells. J. Exp. Med. 198: 1797-1806. 80. Liao, W., J. X. Lin, L. Wang, P. Li, and W. J. Leonard. 2011. Modulation of cytokine receptors by IL-2 broadly regulates differentiation into helper T cell lineages. Nat. Immunol. 12: 551-559. 81. Pepper, M., A. J. Pagan, B. Z. Igyarto, J. J. Taylor, and M. K. Jenkins. 2011. Opposing signals from the Bcl6 transcription factor and the interleukin-2 receptor generate T helper 1 central and effector memory cells. Immunity. 35: 583-595. 82. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77: 297-306. 83. Fazilleau, N., L. Mark, L. J. McHeyzer-Williams, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells: lineage and location. Immunity. 30: 324-335. 84. Yu, D., S. Rao, L. M. Tsai, S. K. Lee, Y. He, E. L. Sutcliffe, M. Srivastava, M. Linterman, L. Zheng, N. Simpson, J. I. Ellyard, I. A. Parish, C. S. Ma, Q. J. Li, C. R. Parish, C. R. Mackay, and C. G. Vinuesa. 2009. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity. 31: 457- 468. 85. Fazilleau, N., L. Mark, L. J. McHeyzer-Williams, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells: lineage and location. Immunity. 30: 324-335. 86. McHeyzer-Williams, L. J., N. Pelletier, L. Mark, N. Fazilleau, and M. G. McHeyzer-Williams. 2009. Follicular helper T cells as cognate regulators of B cell immunity. Curr. Opin. Immunol. 21: 266-273. 87. Linterman, M. A., and C. G. Vinuesa. 2010. Signals that influence T follicular helper cell differentiation and function. Semin. Immunopathol. 32: 183-196. 88. Manel, N., D. Unutmaz, and D. R. Littman. 2008. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat. Immunol. 9: 641-649. 89. Volpe, E., N. Servant, R. Zollinger, S. I. Bogiatzi, P. Hupe, E. Barillot, and V. Soumelis. 2008. A critical function for transforming growth factor-beta, interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses. Nat. Immunol. 9: 650-657. 90. Chen, K., W. Xu, M. Wilson, B. He, N. W. Miller, E. Bengten, E. S. Edholm, P. A. Santini, P. Rath, A. Chiu, M. Cattalini, J. Litzman, B. Bussel, B. Huang, A. Meini, K. Riesbeck, C. Cunningham-Rundles, A. Plebani, and A. Cerutti. 2009. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils. Nat. Immunol. 10: 889-898. 91. Yang, L., D. E. Anderson, C. Baecher-Allan, W. D. Hastings, E. Bettelli, M. Oukka, V. K. Kuchroo, and D. A.

Hafler. 2008. IL-21 and TGF-beta are required for differentiation of human T(H)17 cells.Nature 454: 350- 8 r e t p a h C 352. 92. Bouguermouh, S., G. Fortin, N. Baba, M. Rubio, and M. Sarfati. 2009. CD28 co-stimulation down regulates Th17 development. PLoS. One. 4: e5087. 93. McGeachy, M. J., Y. Chen, C. M. Tato, A. Laurence, B. Joyce-Shaikh, W. M. Blumenschein, T. K. McClanahan, J. J. O’Shea, and D. J. Cua. 2009. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells in vivo. Nat. Immunol. 10: 314-324. 94. Axtell, R. C., L. Xu, S. R. Barnum, and C. Raman. 2006. CD5-CK2 binding/activation-deficient mice are resistant to experimental autoimmune encephalomyelitis: protection is associated with diminished

181 Chapter 8

populations of IL-17-expressing T cells in the central nervous system. J. Immunol. 177: 8542-8549. 95. Acuto, O., and F. Michel. 2003. CD28-mediated co-stimulation: a quantitative support for TCR signalling. Nat. Rev. Immunol. 3: 939-951. 96. Monteleone, I., A. M. Platt, E. Jaensson, W. W. Agace, and A. M. Mowat. 2008. IL-10-dependent partial refractoriness to Toll-like receptor stimulation modulates gut mucosal dendritic cell function. Eur. J. Immunol. 38: 1533-1547. 97. Brown, M. H., and E. Lacey. 2010. A ligand for CD5 is CD5. J. Immunol. 185: 6068-6074. 98. Puel, A., C. Picard, S. Cypowyj, D. Lilic, L. Abel, and J. L. Casanova. 2010. Inborn errors of mucocutaneous immunity to Candida albicans in humans: a role for IL-17 cytokines? Curr. Opin. Immunol. 22: 467-474. 99. Sarrias, M. R., M. Farnos, R. Mota, F. Sanchez-Barbero, A. Ibanez, I. Gimferrer, J. Vera, R. Fenutria, C. Casals, J. Yelamos, and F. Lozano. 2007. CD6 binds to pathogen-associated molecular patterns and protects from LPS-induced septic shock. Proc. Natl. Acad. Sci. U. S. A 104: 11724-11729. 100. Ivanov, I. I., R. L. Frutos, N. Manel, K. Yoshinaga, D. B. Rifkin, R. B. Sartor, B. B. Finlay, and D. R. Littman. 2008. Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host. Microbe 4: 337-349. 101. Fierer, J. 2001. Polymorphonuclear leukocytes and innate immunity to Salmonella infections in mice. Microbes. Infect. 3: 1233-1237. 102. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. KewalRamani, D. R. Littman, C. G. Figdor, and K. Y. van. 2000. DC-SIGN, a dendritic cell- specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100: 587-597. 103. Miller, L. H., D. I. Baruch, K. Marsh, and O. K. Doumbo. 2002. The pathogenic basis of malaria. Nature 415: 673-679. 104. de Wit J., Y. Souwer, T. Jorritsma, B. H. Klaasse, B. A. ten, J. Neefjes, and S. M. van Ham. 2010. Antigen- specific B cells reactivate an effective cytotoxic T cell response against phagocytosed Salmonella through cross-presentation. PLoS. One. 5: e13016. 105. Salerno-Goncalves, R., and M. B. Sztein. 2009. Priming of Salmonella enterica serovar typhi-specific CD8(+) T cells by suicide dendritic cell cross-presentation in humans. PLoS. One. 4: e5879. 106. Rosales-Reyes, R., C. Alpuche-Aranda, M. L. Ramirez-Aguilar, A. D. Castro-Eguiluz, and V. Ortiz- Navarrete. 2005. Survival of Salmonella enterica serovar Typhimurium within late endosomal-lysosomal compartments of B lymphocytes is associated with the inability to use the vacuolar alternative major histocompatibility complex class I antigen-processing pathway. Infect. Immun. 73: 3937-3944. 107. Galan, J. E., and H. Wolf-Watz. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444: 567-573. 108. Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P. Kraehenbuhl, and P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat. Immunol. 2: 361-367. 109. Niess, J. H., S. Brand, X. Gu, L. Landsman, S. Jung, B. A. McCormick, J. M. Vyas, M. Boes, H. L. Ploegh, J. G. Fox, D. R. Littman, and H. C. Reinecker. 2005. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science 307: 254-258. 110. Marriott, I., T. G. Hammond, E. K. Thomas, and K. L. Bost. 1999. Salmonella efficiently enter and survive within cultured CD11c+ dendritic cells initiating cytokine expression. Eur. J. Immunol. 29: 1107-1115. 111. Niedergang, F., J. C. Sirard, C. T. Blanc, and J. P. Kraehenbuhl. 2000. Entry and survival of Salmonella typhimurium in dendritic cells and presentation of recombinant antigens do not require macrophage- specific virulence factors. Proc. Natl. Acad. Sci. U. S. A 97: 14650-14655. 112. Pepper, M., and M. K. Jenkins. 2011. Origins of CD4(+) effector and central memory T cells.Nat. Immunol. 12: 467-471.

182 Nederlandse samenvatting Samenvatting voor niet-ingewijden Curriculum Vitae Dankwoord Chapter 8

184 Nederlandse samenvatting

Nederlandse samenvatting

Om ons te beschermen tegen schadelijke ziekteverwekkende organismen (pathogenen) heeft ons lichaam een immuunsysteem ontwikkeld, dat bestaat uit twee takken, namelijk het “aangeboren immuunsysteem” en het “verkregen immuunsysteem”. Ons aangeboren immuunsysteem is in staat om de eerste golf van infectie op te ruimen. In tweede instantie wordt het verkregen immuunsysteem geactiveerd. In het geval van een infectie met de bacterie Salmonella typhimurium zijn T-cellen onontbeerlijk. CD8+ cytotoxische T-cellen (CTLs) kunnen geïnfecteerde cellen opruimen, terwijl CD4+ T-helpercellen andere immuunreacties kunnen activeren of ondersteunen. Zo helpen T-helpercellen B-cellen in het maken van antistoffen tegen de specifieke pathogeen. Naast het maken van antistoffen zijn B-cellen ook belangrijk omdat zij op hun beurt ook T-cellen activeren.

Fagocytose van bacteriën door B-cellen Binding van specifieke antigen aan de B-cel receptor (BCR) zorgt voor activering van de B-cel. In hoofdstuk 2 laten we zien dat zowel de Ramos B-cellijn als primaire B-cellen uit menselijk bloed bolletjes geheel kunnen opnemen (fagocyteren) wanneer de bolletjes beladen zijn met antistoffen tegen de BCR (anti-IgM). Wanneer bolletjes zonder antistoffen worden gebruikt, of bolletjes beladen met een antistof dat niet gericht is tegen de BCR, dan vindt er geen fagocytose plaats. Om dit fenomeen op een meer fysiologische manier te bekijken, hebben we de interactie tussen bacteriën en B-cellen onderzocht. We laten zien dat totale Salmonella bacteriën eveneens gefagocyteerd worden door zowel naïeve als memory B-cellen. Deze internalisatie is BCR afhankelijk. Als gevolg hiervan produceert de B-cel antistoffen die specifiek gericht zijn tegenSalmonella . Daarnaast presenteert de B-cel Salmonella-antigen via MHC klasse II aan CD4+ T-helper (Th) cellen. Dit resulteert in activering van T-helper cellen, die op hun beurt antistof productie door de B-cellen stimuleren die vervolgens de B-cel ondesteunen bij de antistof productie. Herkenning en fagocytose van Salmonella door B-cellen leidt dus tot een wederzijdse communicatie tussen B- en T-cellen. 8 r e t p a h C T-cel activering en differentiatie Het stimuleren van antistof productie vindt gedeeltelijk plaats door cel-cel interacties tussen de B- en Th-cellen, zoals CD40-CD40L. Daarnaast spelen cytokines die geproduceerd worden door de Th cellen ook een belangrijke rol. IL-21 is beschreven als de meest potente cytokine in het versterken van antistof productie en B-cel activering. In hoofdstuk 3 tonen we aan dat B-cellen die een Salmonella bacterie hebben opgenomen Th cel differentiatie sturen naar IFN-γ producerende Th1 en IL-21 producerende folliculaire T-helper (Tfh)

185 Chapter 8

cellen. IL-4 productie daarentegen wordt in mindere mate geïnduceerd. Er ontstaan niet alleen cellen die alleen IFN-γ of IL-21 maken, maar er is ook een significante IFN-γ+/ IL-21+ dubbel-positieve populatie. Verdere karakterisering laat zien dat deze populatie eigenschappen van zowel Th als Tfh bezit en zowel de Th1 transcriptie factor T-bet als de Tfh transcriptie factor Bcl-6 tot expressie brengt. Het blijft de vraag of deze dubbel- positieve populatie ontstaat uit een oorspronkelijke Th1 dan wel Tfh populatie. Daarnaast laten we zien dat de effector cytokines IL-4 en IL-21 elkaar wederzijds beïnvloeden. IL-4 verlaagt de differentiatie naar IL-21+ cellen, terwijl IL-21 de vorming van IL-4+ cellen onderdrukt. Het feit dat Salmonella-geïnfecteerde B-cellen een sterke IL- 21+ Tfh response induceren, kan daarom de lage IL-4+ Th2 inductie verklaren. Als gevolg hiervan kan IL-21 overheersen en zijn effecten op antistofproductie versterken. De manier waarop B-cellen Tfh differentiatie sturen is niet bekend. Eerste experimenten duiden erop dat IL-6 bijdraagt aan het induceren van Tfh differentiatie, maar verdere studies zijn noodzakelijk om dit verder te begrijpen.

IL -2 en IL-21 in T-cel differentiatie IL-2 is voornamelijk beschreven als een factor die deling van T-cellen bevordert en immuunreacties stimuleert. IL-2 lijkt ook effecten te tonen op differentiatie van specifieke Th populaties. In hoofdstuk 4 hebben we de rol van IL-2 en IL-21 in Th differentiatie bestudeerd. Het toevoegen van IL-21 aan onze celkweken laat in eerste instantie een stimulerend effect op T-cel proliferatie zien. Na een aantal dagen heeft IL-21 juist een negatief effect en T-cel proliferatie en cytokine productie zijn drastisch verminderd. We laten zien dat IL-21 de transcriptie van autoloog IL-2 onderdrukt. De lagere IL-2 productie resulteert vervolgens ook in verlaagde transcriptie van de hoog affiene IL-2Rα. Toevoeging van extra IL-2 helpt brengt deze transcriptie weer op normaal niveau. Tevens herstelt extra IL-2 de productie van IFN-γ en IL-21 tot niveaus die vergelijkbaar zijn aan condities waaraan geen IL-21 is toegevoegd. In aanwezigheid van extern toegevoegd IL-2 heeft IL-21 dus geen negatieve effecten meer op T-helper cellen. Met name de aanwezigheid van IL-2 in de tweede fase van T-cel activering lijkt cruciaal, aangezien het toevoegen van IL-2 op latere tijdstippen voldoende is om T-cel proliferatie en cytokine productie te herstellen. B-cellen zetten T-cellen aan tot het maken van IL-21. De balans tussen lokaal aanwezig IL-2 en IL-21 lijkt te bepalen of een immuunrespons doorgaat of juist tot stilstand wordt gebracht. Mogelijk is IL-21 dus een belangrijke factor om het immuunsysteem na activering weer tot rust te brengen.

186 Nederlandse samenvatting

Th17 differentiatie Naast differentiatie naar Th1 en Tfh populaties kunnen B-cellen dieSalmonella hebben opgenomen ook memory Th17 cellen reactiveren. De initiële activering en differentiatie van naïeve IL-17 producerende populatie Th cellen in de mens blijft een onderwerp van discussie. Van de cytokines IL-23, IL-1 β, IL-6 en TFG-β is beschreven dat ze een bijdrage leveren aan de ontwikkeling van Th17 cellen. In hoofdstuk 5 hebben wij de rol van co- stimulatie bestudeerd. Ten opzichte van klassieke CD28 co-stimulatie, laat stimulatie via CD5 of CD6 een aanmerkelijk betere Th17 differentiatie uit naïeve Th cellen zien in aanwezigheid van genoemde cytokines. Deze superieure inductie van Th17 ontwikkeling is te verklaren door verhoogde expressie van de IL-23 receptor (IL-23R). IL-23R speelt een belangrijke rol bij het stabiliseren van het Th17 fenotype. Stimulatie via CD5 resulteert in langdurige activatie van STAT3, een cruciale regulator van Th17 differentiatie. Stimulatie van CD28 naast CD5 laat een sterk verminderde Th17 ontwikkeling zien. Dit impliceert dat voor optimale Th17 ontwikkeling naïeve T-cellen geactiveerd moeten worden via CD5, zonder sterke co-stimulatie van CD28.

B-cellen als transportmiddel voor verspreiding van Salmonella Bacteriën, zoals Salmonella, kunnen het darmepitheel passeren via zogenaamde microfold cellen, of M cellen. Vervolgens komen zij in Peyerse Platen terecht. In deze georganiseerde lymfe organen bevinden zich veel B- en T-cellen. In hoofdstuk 2 hebben we laten zien dat B-cellen Salmonella’s kunnen fagocyteren. In hoofdstuk 6 beschrijven we dat Salmonella overleeft in primaire, humane B-cellen, maar dat replicatie van Salmonella actief wordt onderdrukt door de B-cel. Na verloop van tijd wordt Salmonella uit de B-cel geworpen, waarna de bacterie andere cellen kan infecteren en weer tot deling kan overgaan. In een muismodel laten we zien dat Salmonella zich via B-cellen kan verspreiden naar bloed en milt. Deze data suggereren dat B-cellen als transport middel kunnen worden misbruikt door Salmonella en zo systemische verspreiding van infectie mogelijk maken. Een effectieve cytotoxische T-cel respons is noodzakelijk om deze geïnfecteerde cellen te verwijderen. 8 r e t p a h C Activatie van CTL response Om een effectieve CTLs respons te induceren moeten antigen via MHC klasse II moleculen worden gepresenteerd aan CD8+ T-cellen. In hoofdstuk 8 laten we zien dat primaire B-cellen uitstekend in staat zijn om antigenen van gefagocyteerde Salmonella te presenteren aan CD8+ CTLs. Salmonella maakt gebruik van zogenaamde SPI-1 en SPI-2 Type 3 Secretiesystemen, waarmee specifieke eiwitten in het cytosol van de geïnfecteerde cel worden gebracht die onder andere bijdragen aan de intracellulaire overleving van de

187 Chapter 8

bacterie. Door gebruikt te maken van Salmonella-stammen met een mutatie in SPI-1 of SPI-2 laten we zien dat beide secretiesystemen bijdragen aan presentatie vanSalmonella - antigenen aan CTLs. Activering van deze CTLs resulteert in proliferatie en differentiatie naar voornamelijk effector memory cellen. We laten zien dat deze cellen vervolgens specifiek Salmonella-geïnfecteerde cellen doden.

Samenvattend, laat dit proefschrift zien dat B-cellen Salmonella kunnen fagocyteren via hun specifieke B-cel receptor. Hierdoor ontstaat een niche waarinSalmonella intracellulair kan overleven en zich verspreiden naar andere organen. B-cellen induceren echter tegelijkertijd een veelzijdige immuunreactie wanneer zij Salmonella opnemen. Naast het produceren van antistoffen en het induceren van een effectieve T-helpercel respons, induceren B-cellen tevens een specifieke, cytotoxisch respons om eenSalmonella -infectie op meerdere vlakken te kunnen bestrijden. Ons modelsysteem van B–T-cel interacties laat tevens zien dat B-cellen in staat zijn de CD4+ T-cel respons te reguleren. B-cellen induceren differentiatie van Tfh cellen, die optimaal zijn om de humorale immuunrespons te bevorderen en tevens mogelijk een belangrijke rol uitoefenen bij het weer tot rust brengen van het immuunsysteem.

188 8 r e t p a h C

189 Chapter 8

190 Samenvatting voor niet-ingewijden

Samenvatting voor niet-ingewijden

Ons lichaam wordt dagelijks blootgesteld aan vele micro-organismen, zoals bacteriën en virussen, die schadelijk kunnen zijn. Om ons hiertegen te beschermen beschikt het lichaam over een afweersysteem, of immuunsysteem, om schadelijke bacteriën en virussen uit te schakelen. Het immuunsysteem kan grofweg in twee delen worden gesplitst, het “aangeboren immuunsysteem” en het “verkregen immuunsysteem”. Het aangeboren immuunsysteem treedt als eerste op bij een infectie en is niet specifiek gericht tegen één type infectie. Als het aangeboren immuunsysteem de infectie niet volledig kan vernietigen, wordt het verkregen immuunsysteem geactiveerd. Dit type respons bestaat uit professionele cellen die bepaalde micro-organismen specifiek kunnen herkennen. Hierdoor wordt een immuunrespons in werking gesteld, die specifiek gericht is tegen een bepaald micro-organisme. Een ander voordeel is dat de cellen die in deze respons geactiveerd worden, een zogenaamd geheugen opbouwen. Hierdoor wordt bij een latere infectie veel sneller gereageerd en worden de micro-organismen sneller vernietigd. Twee typen immuuncellen spelen een cruciale rol in het verkregen immuunsysteem: B-cellen en T-cellen. B-cellen, ontstaan in het beenmerg, hebben een tweezijdige rol in de immuunrespons. Allereerst door het produceren van specifieke antistoffen. Deze antistoffen zijn gericht tegen het schadelijke micro-organisme, zoals een bacterie, en binden zich daar vervolgens aan. Hierdoor kunnen functies van deze bacterie worden uitgeschakeld en wordt het verwijderen door andere gespecialiseerde cellen bevorderd. Daarnaast kunnen B-cellen ook T-cellen activeren. T-cellen ontstaan in de thymus en worden weer verder onderverdeeld in twee subtypen: T-helpercellen en Killer-T- cellen. Activatie van T-helpercellen induceert secretie van verschillende signaalstofjes, cytokines, wat weer leidt tot activatie van andere cellen. Verschillende cytokines leiden tot verschillende activatie van cellen, waardoor de secretie van een bepaald type cytokine het verloop van een immuunrespons beïnvloedt. Killer-T-cellen zijn in staat om geïnfecteerde cellen te vernietigen. De rol van B-cellen in het activeren van T-cellen, en de manier waarop dat gebeurt, is nog niet volledig bekend. 8 r e t p a h C In dit proefschrift heb ik gekeken naar de manier van activatie van T-cellen door B-cellen. Om deze interactie te bestuderen heb ik gebruik gemaakt vanSalmonella bacteriën als fysiologisch model. De precieze manier waarop B-cellen Salmonella-antigenen presenteren aan T-cellen is tot op heden onduidelijk. Ik laat voor het eerst zien dat humane B-cellen als een soort Pac-Man een Salmonella bacterie in zijn geheel kunnen opnemen of fagocyteren. Door opname van de bacterie wordt de B-cel geactiveerd en presenteert de B-cel stukjes Salmonella aan T-helpercellen. De T-helper- cellen die precies dit

191 Chapter 8

specifieke stukjeSalmonella herkennen worden vervolgens geactiveerd en gaan cytokines produceren. In dit proefschrift laat ik verder zien dat de interactie tussen B- en T-cellen een optimale respons geeft voor de B-cellen zelf. B-cellen sturen de cytokineproductie van T-cellen zodanig, dat deze optimaal zijn voor de productie van antistoffen. In tegenstelling tot andere antigeenpresenterende cellen, zoals dendritische cellen, induceren B-cellen productie van het signaalstofje interleukine 21 (IL-21) door de T-cellen. Ik laat zien dat de productie van IL-21 de B-cellen enorm helpt in antistof productie. Daarnaast induceert de B-cel productie van een ander signaalstofje, interferon-γ (IFN-γ). IFN-γ helpt macrofagen en killer-T-cellen bij het opruimen van de Salmonella infectie. Ook behandel ik de ontwikkeling van T-helpercellen naar een IL-17 producerende subset, Th17. Over het ontstaan van deze Th17 subset is veel onduidelijk. T-cel activatie en ontwikkeling wordt gestuurd door drie signalen: 1) T-cel-receptor activatie, zorgt voor specifieke responsen; 2) co-stimulatie, geeft de T-cel een overlevingssignaal; 3) cytokines, bepalen welk type T-cel zich uiteindelijk ontwikkelt. Ik laat zien dat niet alleen cytokines belangrijk zijn bij het sturen van deze ontwikkeling, maar dat co-stimulatie ook een belangrijke, sturende rol speelt. Ik laat zien dat alternatieve co-stimulatie via een CD5 eiwit een veel betere IL-17-productie geeft. Daarnaast laat ik zien dat een Salmonella die door een B-cel is gefagocyteerd, kan overleven binnenin de B-cel. Na enige tijd wordt deSalmonella uit de B-cel verwijderd, en kan de Salmonella vervolgens andere cellen infecteren, wat leidt tot verspreiding van de infectie door het hele lichaam. We concluderen dan ook dat B-cellen een niche vormen voor Salmonella, om daarmee vroegtijdige herkenning door het immuunsysteem te voorkomen. Aangezien Salmonella binnenin een cel kan verblijven, is een killer-T-cellen respons van groot belang. In dit proefschrift beschrijf ik dat B-cellen uitstekend killer- T-cellen kunnen activeren. Deze kunnen vervolgens specifiek Salmonella-geïnfecteerde cellen vernietigen en daarmee mogelijk verdere verspreiding voorkomen. Samenvattend: In dit proefschrift laat ik zien dat B-cellen een grote rol spelen inde bestrijding van bacteriële infecties zoals Salmonella. Na het fagocyteren van hele Salmonella’s activeren B-cellen T-helpercellen zodanig, dat deze optimaal cytokines produceren die nodig zijn bij de bestrijding van de infectie. Deze cytokines helpen de B-cel in antistofproductie, wat bijdraagt aan het verwijderen van de bacteriën. Daarnaast kunnen B-cellen een killer-T-cel respons opwekken, wat geïnfecteerde cellen kan vernietigen. Dit is van cruciaal belang, aangezien Salmonella intracellulair kan overleven in de B cel. De inductie van Salmonella-specifieke, killer-T-cellen voorkomt mogelijke verdere verspreiding van de bacteriële infectie. Dus B-cellen bestrijden een bacteriële infectie op meerdere vlakken: door activatie van de juiste T-helpercellen, productie van antistoffen en activatie van een killer-T-cel respons.

192 8 r e t p a h C

193 Chapter 8

194 Curriculum Vitae

Curriculum Vitae

De auteur van dit proefschrift, Jelle de Wit, werd geboren op 11 februari 1983te Heemskerk. In 2001 haalde hij zijn VWO-Gymnasiumdiploma aan het Bonhoeffer College in Castricum om vervolgens te beginnen aan de studie Biomedische Wetenschappen aan de Vrije Universiteit te Amsterdam. Hij behaalde zijn bachelor-diploma in 2004 en heeft in deze tijd een korte stage gelopen bij de afdeling Medische Microbiologie en Infectiepreventie van het VU medisch centrum (VUmc). In 2006 voltooide hijde masteropleiding Biomedische Wetenschapen. Gedurende zijn master liep hij stage bij de afdeling Fysiology van het VUmc, onder begeleiding van drs. C.M.L. Beckers en dr. G.P. van Nieuw Amerongen. Hier bestudeerde hij de activatie van RhoA door middel van FRET (fluorescence resonance energy transfer) microscopie. Tijdens zijn tweede stage op de afdeling Immunopathologie van Sanquin Bloedvoorziening, onder begeleiding van A. M. Wolbink-Kamp en Prof. dr. S.M van Ham, onderzocht hij de subcellulaire effecten van granzyme A. In 2006 startte hij zijn promotieonderzoek , beschreven in dit proefschrift, naar de interactie tussen Salmonella-geïnfecteerde B-cellen en T-cellen, onder leiding van Prof. dr. S.M. van Ham. Vanaf juni 2012 is hij werkzaam als post-doc op dezelfde afdeling waar hij dit onderzoek voortzet. 8 r e t p a h C

195 Chapter 8

196 Dankwoord

Dankwoord

En dan, na al die pagina’s met Salmonella’s, B-cellen en T-cellen, het laatste stukje (maar zeker niet onbelangrijk!). De afgelopen jaren waren nooit zo leuk geweest zonder alle mensen om mijn heen, bedankt daarvoor. Een aantal wil ik er in het bijzonder uitlichten.

Allereerst natuurlijk Marieke. Wat ben ik blij dat je mij na mijn stage hebt binnengehaald als AIO. Jouw positieve instelling werkt enorm aanstekelijk en je gave om uit een mislukte proef toch weer iets bruikbaars te halen waardeer ik nog steeds. Niet alleen wetenschappelijk heb ik veel van je geleerd, maar ook op sociaal gebied ben je ijzersterk. Je maakt altijd tijd voor iedereen en ook onze tripjes naar het buitenland of borrels na het werk waren reuzegezellig. Heel erg bedankt voor alles wat je mij de afgelopen jaren hebt meegegeven en voor alle steun bij het zetten van de volgende stap in Engeland. Beste Sjaak, als andere promotor hebben wij voornamelijk de laatste maanden intensiever contact gehad bij het afronden van dit proefschrift. Onze eerste echte ontmoeting in het vliegtuig vanaf Sardinië zal ik echter nooit vergeten. Bedankt voor je ideeën en nuttige toevoegingen, maar ook voor het supersnel corrigeren van alle manuscripten en de tips die je mij hebt meegegeven. Tineke, bedankt voor het leren van de fijne kneepjes van proeven doen. Jouw onvermoeibare inzet, als een proef weer eens uitliep of tijdens het inzetten nog helemaal werd veranderd, heb ik altijd enorm gewaardeerd. Ik vind het heel leuk dat je mijn paranifm bent! Hanny, schouders eronder en gaan! Je gretigheid en werklust die je toonde toen je halverwege mijn promotie bij de B-celgroep kwam, weet ik nog als de dag van gisteren. Altijd bereid om te helpen en je gaat er helemaal voor. Ook nu weer. Ik vind het heel fijn dat je erbij bent als mijn andere paranimf. Yuri, als eerste begeleider heb ik ontzettend veel van je geleerd. Met je nuchterheid weet je alles precies goed te relativeren. Ik heb altijd heel leuk met je samengewerkt en mis regelmatig nog de ‘goede’ muziek op het kweeklab. Dan natuurlijk de rest van de afdeling Immunopathologie; laat ik bij het begin beginnen: 8 r e t p a h C de ‘moeders’ van het kippenhok. Angela (mam), mijn laatste masterstage bij jou was mijn redding; door jou was proeven doen weer leuk. Maar ook de draaideur zal ik nooit vergeten! Dorina, Mieke en Miranda, ik denk nog regelmatig terug aan het knusse kippenhok. Als er weer onder tafel gedoken moet worden, hoor ik het wel. Daarna naar de grote kamer aan de overkant: Miriam (SET!), Judith, Theresa, Marja en Gijs. De snoeppot was altijd goed gevuld. Een beetje extra suiker of een ouderwetse fireball houdt je scherp. Naast werken konden we ook lol hebben; Gijs, altijd in voor een goede (of slechte) grap,

197 Chapter 8

maar dat Brafandt os vlinf typen wpordt nooitr meer wat (war!). En natuurlijk de AIO-tuin beneden. Femke, Martine, Mateusz, Mieke, Sonja, Mischa, Iwan, Lotte, Laura en Gerben. Heerlijk om alle frustraties kwijt te kunnen en op de goede momenten een slechte grap te horen. Bedankt voor alle gezelligheid tussen de meest lelijke souvenirs en naast een stralende kerst-/paas-/oranjeboom. Uiteraard ook de rest van de afdeling (en nu maar hopen dat ik niemand vergeet): Anja, Diana, Dörte, Ellen, Els, Flavia, Gerard, Gertjan, Gwen, Henk, Ineke, Irma, Jilian, Judith, Jolanda, Josine, Margreet, Maria, Ninotska, Piet, Pleuni, Remco, Rishi, Rob, Ruchira, Sacha, Simone, Shabnam, Steven, Susanne, Suzanne, Theo en Wouter. Bedankt voor alle hulp en gezelligheid op het lab en tijdens borrels, labuitjes en –weekenden. Ik heb het hier reuze naar mijn zin gehad. Lucien, bedankt voor je input en leuke discussie over het B-celwerk. Ingrid, nooit meer vergeten: 1-2-3-rust! Anneke, dankzij jouw scherpe blik op het einde is alles nóg mooier geworden. Bouke bedankt voor het op peil houden van de voorraad. Kaoutar en met name Fatima, bedankt voor het regelen van alle rompslomp tijdens mijn promotie. De studenten die de afgelopen jaren bij ons in de groep zijn geweest: Ilona, Gerben, Yotam en Sanne. Ilona, als mijn eerste student vond ik het best spannend, maar het feit dat je nu zelf promotieonderzoek doet, zegt genoeg. Gerben, een frisse wind in de groep (chill!). Gezellig dat je nog steeds op de afdeling rondloopt. Yotam en Sanne, sorry voor alle stress die jullie de afgelopen maanden van mij hebben moeten verduren. Gelukkig zijn jullie beiden slim en heel snel zelfstandig, dat komt helemaal goed met jullie. Ook wil ik graag de mannen van de centrale faciliteit heel erg bedanken. Erik (‘ej popje’), de energie en enthousiasme die je iedere dag uitstraalt blijft ongelooflijk. Floris, jouw engelengeduld en vrolijkheid zullen we hard missen. Beiden waren jullie altijd bereid te helpen, ook als we weer eens bagger wilden sorten en toch weer iets meer hadden dan gepland. Dank jullie wel voor de ontelbare keren sorten en alle hulp met FACS en confocaal. Martien, Esther, Astrid, Femke en Rosa. De drie maanden knallen werd uiteindelijk drie jaar, maar het heeft zich wel mooi uitbetaald. Bedankt voor de leuke samenwerking en borrels. Martien, ik vind het ontzettend leuk dat je in mijn commissie wilt zitten.

Dan de mensen die misschien minder wetenschappelijk, maar zeker heel sociaal hebben bijgedragen om mijn promotie te voltooien. Allereerst de VU-groep: Femke, Jolle Mijs, Imke, Natalee en Richard. Jullie zorgden altijd voor heerlijke ontspanning naast het werk. Ik ben blij dat we de fameuze ER-avondjes nog zo lang hebben kunnen rekken. Femke, na 15 jaar elkaar bijna dagelijks gezien te hebben, lijkt het er toch op dat we allebei een andere kant op gaan. Dat zal even wennen worden. Dank je wel voor het delen van

198 Dankwoord frustraties en goede verhalen. Mijn achteroppie blijft nog wel gewoon beschikbaar hoor! De andere VU-ers: Ruben (Rubber), Emilie (Emmeleh), Ron (Lonnie), Viola (Violet Vi) en Vicky (MiVi). Nu kunnen jullie eindelijk eens lezen wat ik nou eigenlijk echt gedaan heb. Bedankt voor de hilarische avondjes discobowlen, Wii-en en heerlijke cocktails. Copa! Marco, ja het is zover: het is nu echt af! Ik kan me nu totaal focussen op het squashen en je eindelijk eens een keer van de baan vegen. De oude gang: Bas, Martijn, Bart-Jan, Sanne en Laura. De Pac-Man en IL-17 verhalen zitten er nog steeds goed ingeramd volgens mij. Sanne, nu iets verder maar nog steeds even gezellig! Limoncello? Laura, nog verder weg geweest, maar altijd intersse getoond. Snel weer bijpraten! Martijn, als out-sider heb je goed staande gehouden tussen al het promotiegeweld. Nu kunnen we echt gaan beginnen aan de “checklist”. Bart-Jan, een jaar later begonnen, maar toch bijna tegelijk klaar. Succes met de laatste lootjes! Baz, ben je me toch nog voor geweest! Onze “culturele avondjes” en slap geouwehoer (ahjoh, maakt niet uit) waren altijd een heerlijke afleiding. Binnenkort weer een zonnige hamburger om 7 uur?

Kees, het is toch nog een paar maanden later geworden, maar nu toch echt klaar. Dank je wel voor al je interesse de afgelopen jaren.

Lieve zusjes, Maartje, Karlijn en Lonneke, jullie hebben het ook flink moeten ontgelden, maar wat ongelooflijk fijn dat het nog steeds even gezellig is. Maartje, de ‘twee jaar later’ heeft even op zich laten wachten en Nature heeft er (nog) niet ingezeten. Misschien kan jij weer een poging doen? Linde, ondanks alle drukte toch nog ruimte voor een biertje en een ontspannend spelletje op zijn tijd. Staat doctor ook nog ergens in het Dalmuti-rijtje? Lonneke, zijn we dan toch echt oud aan het worden? Ik nu klaar en jij zwanger, het lijkt er wel op... Gelukkig altijd nog in voor een geintje, dat zal nooit veranderen. Sander, Dave en Sébastien, bedankt voor jullie interesse en het aanhoren van alle (onbegrijpelijke) verhalen. Lieve papa en mama. Wat een fantastische ouders zijn jullie toch. Dank jullie wel voor alle liefde en gewoon voor het feit dat jullie er altijd voor mij zijn. Betere ouders dan jullie 8 r e t p a h C bestaan niet!

Lieve Pauline, jij betekent zoveel voor mij. ‘Die dikke stress overkomt mij niet’, en toch was het er ineens. Met jouw rust en doelgerichtheid als ik het niet meer zag zitten, je lieve grapjes om me weer op te vrolijken en je hulp wanneer ik niks meer kon onthouden, heb je er voor gezorgd dat het toch nog gelukt is dit jaar. Ik vind het echt leuk met jou en we zijn een goed team zo samen!

199