APPL1 Endocytic Adaptor As a Fine Tuner of Dvl2-Induced Transcription

CORE Metadata, citation and similar papers at core.ac.uk

Provided by Elsevier - Publisher Connector

FEBS Letters 589 (2015) 532–539

journal homepage: www.FEBSLetters.org

APPL1 endocytic adaptor as a ﬁne tuner of Dvl2-induced transcription ⇑ Magdalena Banach-Orlowska ,1, Ewelina Szymanska, Marta Miaczynska

Laboratory of Cell Biology, International Institute of Molecular and Cell Biology, Warsaw, Poland

article info abstract

Article history: APPL1 is a multifunctional endocytic adaptor which acts at different steps of various signaling path- Received 26 October 2014 ways. Here we report that APPL1 interacts with Dvl2, a protein known to activate the canonical and Revised 15 January 2015 non-canonical Wnt pathways. APPL1 synergizes with Dvl2 and potentiates transcription driven by Accepted 15 January 2015 AP-1 transcription factors, speciﬁcally by c-Jun, in non-canonical Wnt signaling. This function of Available online 23 January 2015 APPL1 requires its endosomal recruitment. Overproduction of APPL1 increases Dvl2-mediated Edited by Lukas Huber expression of AP-1 target gene encoding metalloproteinase 1 (MMP1) in a JNK-dependent manner. Collectively, we propose a novel role of APPL1 as a positive regulator of Dvl2-dependent transcriptional activity of AP-1. Keywords: APPL endocytic proteins Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Dishevelled Activating protein 1 Wnt signaling

1. Introduction accumulation of RelA leading to expression of NF-jB target genes [10]. We also showed that APPL1 and APPL2 modulate transcrip- It is commonly accepted that endocytic proteins can regulate tion of b-catenin/TCF target genes in canonical Wnt signaling via cellular signaling at different levels, including transcription by interactions with histone deacetylases and reptin [11]. modulating the activity of nuclear factors [1,2]. APPL1 (adaptor Dishevelled (Dvl) adaptor proteins act at early stages of Wnt protein containing pleckstrin homology domain, phosphotyrosine signaling thanks to interactions with multiple partners [12]. Both binding domain, and leucine zipper motif 1) and its less studied the canonical (b-catenin-dependent) and non-canonical Wnt path- homolog APPL2 are examples of endocytic proteins able to regulate ways are activated by overexpression of Dvl. These primarily cyto- intracellular signaling. APPL1 localizes to a subpopulation of early plasmic proteins can also translocate to the nucleus [13,14]. Upon endosomes (termed APPL endosomes) due to interactions with overexpression they form cytosolic puncta of unclear nature, pos- Rab5 and Rab21 GTPases [3,4]. However, this protein resides also tulated to represent either protein assemblies [15] or endocytic in the cytoplasm and shuttles to the nucleus partially due to inter- structures in agreement with the proposed crucial role of Dvl in actions with the NuRD complex [3,5]. APPL1 binds several trans- Frizzled receptor internalization [16,17]. membrane receptors and kinases involved in signal transduction Dvl proteins regulate the canonical Wnt pathway at, at least, [6–9]. Recently, we discovered that APPL1 can induce nuclear two steps: (i) ligand-induced phosphorylation of LRP5/6 receptors and (ii) phosphorylation-dependent degradation of b-catenin. Ini-

Abbreviations: AP-1, activating protein 1; APPL, adaptor protein containing tially, Dvl-mediated recruitment of Axin-bound GSK3b and/or CKI pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper kinases stimulates phosphorylation of LRP by these kinases at the motif; CKI, casein kinase I; Dvl, Dishevelled; GST, glutathione S-transferase; JNK, c- plasma membrane [18,19]. Consequentially, Dvl-mediated titra- Jun N-terminal kinase; LRP, low-density lipoprotein receptor-related protein; MMP, tion of Axin away from the b-catenin destruction complex compro- matrix metalloproteinase; NF-jB, nuclear factor jB; NuRD, nucleosome remodeling mises phosphorylation of b-catenin, thus preventing its deacetylase; PCP, planar cell polarity; PDZ, post synaptic density protein (PSD95), Drosophila disc large tumor suppressor (Dlg1), and zonula occludens-1 protein (zo- subsequent degradation [20]. 1); PH, pleckstrin homology; PTB, phosphotyrosine binding; TCF, T-cell factor Planar cell polarity (PCP) signaling, one of the non-canonical ⇑ Corresponding author at: International Institute of Molecular and Cell Biology, Wnt pathways, is also regulated by Dvl proteins. Dvl2 activates a Ks. Trojdena 4, 02-109 Warsaw, Poland. Fax: +48 22 597 07 26. small GTPase Rac which in turn stimulates the c-Jun N-terminal E-mail address: [email protected] (M. Banach-Orlowska). kinase (JNK), a potent regulator of the PCP pathway [21,22]. 1 Present address: Department of Histology and Embryology, Center of Biostructure Research, Medical University of Warsaw, Banacha 1b, 02-097 Warsaw, Poland. This mechanism operates during dendrite growth [13] and cell

http://dx.doi.org/10.1016/j.febslet.2015.01.022 0014-5793/Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539 533 movements in embryogenesis [23]. Moreover, Dvl proteins bind to 2.3. Antibodies and activate Daam1 [24] which induces ROCK kinase responsible for cytoskeleton remodeling [25]. Rabbit polyclonal anti-APPL2 (Ab5002) and anti-APPL2 The JNK substrate c-Jun belongs to the family of activating pro- (Ab4567) antibodies were previously described [11]. Anti-Dvl2 tein 1 (AP-1) transcription factors. They act as dimers of basic leu- (sc-8026), anti-phospho-c-Jun Ser63/73 (sc-16312), anti-c-Jun cine zipper (bZIP) domain containing mainly proteins which (sc-45), anti-GAPDH (sc-25778), anti-lamin A/C (sc-7292) and belong to the subfamilies of Jun (c-Jun, JunB, JunD) and Fos (c- anti-b-catenin (sc7199) were from Santa Cruz Biotechnology; Fos, FosB, Fra1 and Fra2) (reviewed by [26]). AP-1 homo- and het- anti-Myc tag (05-419) and anti-Axin1 (2087) from Cell Signaling; erodimers bind DNA at the heptamer consensus sequence known anti-b-catenin (610154) from BD Transduction Laboratories and as the TPA-responsive element (TRE) [27]. A large number of AP- anti-GSK3b (44-610) from Invitrogen. 1 proteins provide broad combinatorial possibilities of dimers with The following secondary antibodies were used: horseradish different binding specificities to tightly regulate expression of peroxidase-conjugated (Jackson ImmunoResearch), fluorophore- numerous genes [28]. It was demonstrated that c-Jun exhibits tran- conjugated (IRDye 680 and IRDye 800CW; LI-COR Biosciences), scriptional activity when phosphorylated at Ser63 and Ser73 by the AlexaFluorÒ488-conjugated anti-mouse and AlexaFluorÒ568-con- JNK kinase [29]. Moreover, one of the c-Jun transcriptional targets jugated anti-rabbit antibodies (Invitrogen). is c-Jun itself since its promoter region contains a consensus sequence for AP-1 binding [30]. Probably, this positive autoregula- 2.4. Western blotting tion loop constitutes a mechanism for prolonging the signals from extracellular stimuli. HEK293T cells were lysed in RIPA buffer containing 1% Triton X- Here, we report that APPL1 interacts and synergizes with Dvl2 100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris (pH 7.4), to regulate AP-1-dependent transcription in non-canonical Wnt 150 mM NaCl, 0.5 mM EDTA, protease inhibitor cocktail (6 lg/ml signaling. chymostatin, 0.5 lg/ml leupeptin, 10 lg/ml antipain, 2 lg/ml aprotinin, 0.7 lg/ml pepstatin A and 10 lg/ml 4-amid- inophenylmethanesulfonyl fluoride hydrochloride; Sigma–Aldrich) 2. Materials and methods and phosphatase inhibitor cocktails (Sigma–Aldrich, cat# P0044, P5726). Protein concentration was measured with BCA Protein 2.1. Cell lines and transfections Assay Kit (Thermo Scientific). Samples of 10–50 lg total protein were subjected to SDS–PAGE. Resolved proteins were transferred HEK293T, Hela, Wnt3a-expressing mouse L cells (ATCC; CRL- to nitrocellulose membrane (Whatman), probed with specific anti- 2647) and parental L cells (CRL-2648) were maintained in DMEM bodies, and detected with enhanced chemiluminescence or Odys- with 10% fetal bovine serum, 2 mM L-glutamine. The conditioned sey infrared imaging system (LI-COR Biosciences). Quantitative media from L cells were obtained as recommended by the supplier. analysis of bands detected on LI-COR Odyssey platform was per- siRNA (30 nM) was delivered to HEK293T cells using HiPerFect formed with Image Studio Software (LI-COR Biotechnology). reagent (Qiagen), plasmids were delivered with Lipofectamine 2000 (Invitrogen) according to manufacturers’ instructions. For 2.5. Immunoprecipitation and GST pull-down immunoprecipitation assay HEK293T cells were transfected in 6- well plate with 2 lg of each plasmid and harvested 24 or 48 h after Immunoprecipitation assay was performed as described previ- transfection. For RT-PCR experiments HEK293T cells were transfec- ously [5]. ted in 12-well plate with 1.5 lg of each plasmid and harvested 24 h GST, GST–APPL1-N (comprising 428 amino acids from the N- after transfection. For luciferase assay HEK293T cells were trans- terminus) and GST–APPL1-C (comprising amino acids 429–709), fected for 24 h in 96-well plate with 50 ng of reporter (pAP-1- GST–APPL2-N (comprising 377 amino acids from the N-terminus) luc) plus 25 ng of normalization construct (pRL-TK) along with dif- and GST–APPL2-C (comprising amino acids 378–664) fusion pro- ferent amounts of APPL1- or Dvl2-encoding plasmids, or with siR- teins used in pull-down assays as baits were expressed and puri- NA for 48 h and then with plasmid DNA for the next 24 h. For fied according to the manufacturer’s instructions (GE Healthcare). microscopic analysis Hela cells were transfected in 24-well plates Isopropyl b-D-thiogalactoside (Sigma–Aldrich) at a concentration with 0.5 lg of Dvl2-encoding plasmid using FuGene (Roche) of 0.5 mM was used to induce the expression. The lysates of Dvl2 reagent and fixed 24 h after transfection. overexpressing cells were incubated overnight at 4 °C with constant rotation with equal amounts of glutathione–Sepharose beads 2.2. siRNA, plasmids (GE Healthcare) complexed with GST, GST–APPL1-N, GST–APPL1-C, GST–APPL2-N or GST–APPL2-C fusion proteins. Beads were washed ON-TARGETplus SMARTpool siRNA targeting human APPL1 5 times with the wash buffer used for immunoprecipitation. GST- (Dharmacon, cat # L-005138-00-0005) and non-targeting control fusion proteins together with bound proteins were eluted with SMARTpool (cat# D-001810-10-20) were employed at 30 nM 10 mM glutathione in 50 mM Tris/HCl, pH 8.0, for 15 min at room concentration. temperature with shaking. Eluates were resuspended in Laemmli The following plasmids were used: pCMV-Dvl2 (kind gift from buffer, subjected to 10% SDS–PAGE and immunoblotted for the Prof. Jacek Otlewski, University of Wroclaw); pcDNA3-based con- proteins of interest. structs of untagged and N-terminally myc-tagged APPL1 and APPL2, pEYFP-C3-APPL1DC4, pcDNA3-MycHisB-APPL1DC4, pcDNA3- 2.6. Luciferase assays MycHisB-APPL1 K280E/Y283C/G319R, pcDNA3-MycHisB-APPL1- A318D, pcDNA3-MycHisB-APPL1-G320A [3,4]; pRL-TK (kind gift HEK293T cells at 50–60% confluence were transiently transfec- from Dr. Vladimir Korinek, Institute of Molecular Genetics, Prague), ted with the appropriate plasmids and/or siRNA, and lysed with pAP-1-luc (Stratagene), A-Fos construct was provided by Dr. Charles passive lysis buffer (Promega). The following amounts of transfec- Vinson (Addgene plasmid #33353) [31]. pGEX-6P-3/APPL1-N ted plasmids were used in Fig. 2A and B: Dvl2 – 12.5 ng/well, (amino acids 1–428), pGEX-6P-3/APPL1-C (amino acids 429–709), APPL1 – 12.5 ng/well, A-Fos – 25 ng/well; in Fig. 2C: Dvl2 – 6 ng/ pGEX-6P-3/APPL2-N (amino acids 1–377), pGEX-6P-3/APPL2-C well, APPL1 – 10 ng/well, APPL1mut1 – 37.5 ng/well, APPL1mut2 (amino acids 378–664) were previously described [3,11]. – 37.5 ng/well, APPL1mut3 – 75 ng/well (to obtain comparable 534 M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539

Table 1 treated with medium containing 40 lM SP600125 or control List of primers used for RT-PCR. (DMSO) and cultured for further 19 h. Reporter gene activity was

Gene Forward primer Reverse primer measured 24 h after transfection. ACTB CAGGTCATCACCATTGGCAAT TCTTTGCGGATGTCCACGT APPL1 GAGGACAGCCCGCAGACA TCCGATGCATAGCTTGATACAACT 2.7. Cell fractionation and DNA-binding ELISA assay B2M GGAGGCTATCCAGCGTACTC GAAACCCAGACACATAGCAATTC DVL2 GCGCATCACCCTCGGCGATT ACACCAGCCAGGATACCACCCT HEK293T cells were transfected in 10 cm dishes with appropri- FOS CCTCGCCCGGCTTTGCCTAA AGAAGTCCTGCGCGTTGACAGG ate plasmids for 24 h or with siRNA for 48 h and then with plasmid JUN GCCAGGTCGGCAGTATAGTC TCTGGACACTCCCGAAACAC DNA for the next 24 h, harvested and fractionated as described pre- JUNB GCACTAAAATGGAACAGCCCTT GGCTCGGTTTCAGGAGTTTG JUND CCCCTTTCCTCGATCTCGC GAAAACAGAAAACCGGGCGAA viously [5]. 10–20 lg of the obtained nuclear fractions were Ò MMP1 CCCTCGCTGGGAGCAAACACA TTGTCCCGATGATCTCCCCTGAC assayed using the TransAM AP-1 Family kit according to the man- MMP2 CACCCATTTACACCTACACCAAGAAC TGCCAAGGTCAATGTCAGGAGAG ufacturer’s instructions (Active Motif, Inc.). MMP13 GACTTCACGATGGCATTGCT GAAGTCGCCATGCTCCTTAATT TEK CCAGGCTGATAGTCCGGAGAT AGCAGTACAGAGATGGTTGCATTC 2.8. Quantitative RT-PCR protein levels of wt and mutated forms of APPL1). In all assays, the The total RNA was isolated with High Pure Isolation Kit (Roche). amount of DNA transfected was kept constant by co-transfection For cDNA synthesis random nonamers, oligo(dT)23 and M-MLV with empty pcDNA3 vector. The obtained cell lysates were assayed reverse transcriptase (Sigma–Aldrich) were used according to using the Firefly Buffer [50 mM Tris pH 7.8, 12 mM MgCl2,10mM manufacturer’s instructions. DTT, 0.2 mM ATP (Sigma–Aldrich), 0.5 mM D-luciferin (Lux Bio- The PCR reaction was performed with the Kapa Sybr Fast ABI technology #20052), 0.25 mM coenzyme A (Sigma–Aldrich)] or Prism qPCR Kit (KapaBiosystems) using a 7900HT Fast Real-Time Renilla Buffer [50 mM Tris pH 7.8, 100 mM NaCl, 2.5 nM coelenter- PCR thermocycler (Applied Biosystems). The DataAssist™Software azine (Lux Biotechnology #20001)]. Signals were measured in a v3.0 was used to estimate fold change of gene expression versus microplate luminometer (BMG Lumistar Galaxy or Berthold Tech- controls, employing housekeeping genes ACTB and B2M (encoding nologies Centro XS3 LB 960). The firefly luciferase activity derived actin B and beta-2-microglobulin, respectively) for normalization. from the AP-1-responsive reporter (pAP-1-luc; 50 ng/well) was The expression values were obtained at least in duplicate. Oligonu- normalized to its respective Renilla luciferase activity driven by cleotides for PCR reaction listed in Table 1 were custom-synthe- TK promoter (pRL-TK; 10 ng/well). For experiments with JNK1/2 sized by the Institute of Biochemistry and Biophysics (Warsaw, inhibitor (SP600125, Calbiochem), 5 h post-transfection cells were Poland).

Fig. 1. APPL1 interacts with Dvl2. (A) and (B) Extracts of HEK293T cells transfected for 24 h with Dvl2 and different APPL1 or APPL2 constructs were subjected to immunoprecipitation (IP) using anti-Dvl2 or anti-Myc antibody; non-speciﬁc antibodies (IgG) were used as controls. Input indicates 10% of total cell extracts used for immunoprecipitation. Transfection with the Myc-APPL2 construct leads to overproduction of two forms of APPL2 protein (Myc-tagged indicated with an asterisk and untagged; see also Supplementary Fig. 1). Band indicated with ** represents unspeciﬁc binding of highly overexpressed Myc-APPL2 to control antibodies (IgG). (C) Extract of HEK293T cells transfected for 24 h with Dvl2 was subjected to GST pull-down assay using GST alone or GST fused to the N- or C-terminal parts of APPL1 and APPL2 (APPL1-N or APPL1-C, APPL2-N or APPL2-C, respectively). As a control, lysis buffer was used instead of cell lysate (Àcell lysate, +cell lysate, respectively). Input indicates 20% of cell lysate. M – molecular weight marker. The amounts of GST and GST-APPL1/2 fragments are shown by Ponceau staining (lower panel). (A)–(C) Bound proteins and input extracts were analyzed by Western blotting using the indicated antibodies. M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539 535

2.9. Statistical analysis 3. Results and discussion

The data presented in Fig. 2A of six independent experiments 3.1. APPL1 interacts with Dvl2 were subjected to the two tailed t-test, Dvl2 + APPL1 versus Dvl2, ⁄⁄P-value <0.01. Mass spectrometry analysis of protein complexes formed by APPL1 and APPL2 revealed the presence of Dvl2, among many oth- 2.10. Immunofluorescence ers constituents [32]. To confirm binding between Dvl2 and APPL proteins, we performed reciprocal co-immunoprecipitations from Cells grown on coverslips were fixed with 3% paraformaldehyde lysates of HEK293T cells co-transfected with APPL1 or APPL2 and (15 min). Staining was performed as described previously [10]. Dvl2, as no endogenous Dvl2 was detected in HEK293T cells. We Images were acquired on a laser-scanning confocal microscope found APPL1 and APPL2 in immunoprecipitates of Dvl2 (Fig. 1A; Leica TCS SP2 AOBS using a Â63/1.4 numerical aperture oil immer- Supplementary Figs. 1 and 2), and vice versa (Fig. 1B) demonstrat- sion objective. The presented images were arranged in Adobe ing an association between these proteins. Photoshop CS 5.1 with linear adjustment.

Fig. 2. APPL1 enhances the activation of the non-canonical Wnt pathway induced by Dvl2. (A)–(C) Luciferase reporter assays were performed in HEK293T cells transiently transfected with the different combinations of plasmids, as indicated. Values are mean ± S.E.M. from three independent transfections performed in parallel and are representative of at least three experiments. Data are normalized to the luciferase activity in pcDNA3-transfected cells, which was arbitrarily set to 1 unit of relative activity. APPL1 and Dvl2 overexpression were tested by Western blotting with GAPDH as a loading control (lower panels). (A) APPL1 potentiates Dvl2-dependent AP-1 reporter activity. Statistical signiﬁcance is marked according to the two tailed t-test, ⁄⁄P < 0.01. (B) A-Fos expression abolishes effects of Dvl2 and APPL1 on the reporter activity. (C) Mutants of APPL1 [APPL1mut1 (320A); APPL1mut2 (A318D) and APPL1mut3 (K280E/Y283C/G319R)] unable to localize to endosomes cannot potentiate Dvl2-driven reporter activity. (D) Dvl2 partially co-localizes with APPL1 in Hela cells. Arrows in magniﬁed inset indicate co-localization of overexpressed Dvl2 (green channel) and endogenous APPL1 (red channel). Scale bar, 20 lm. 536 M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539

Fig. 3. APPL1 does not affect activity of AP-1 transcription factors. (A) Expression of AP-1 transcription factors in HEK293T cells upon Dvl2 overproduction measured by RT- PCR in the absence or presence of JNK inhibitor SP600125. (B) Dvl2 increases c-Jun activation. Nuclear extracts of HEK293T cells (10 lg total protein) transfected as indicated were assayed using the TransAMÒ AP-1 Family kit for the activity of c-Jun. Nuclear extract of K-562 cells stimulated with TPA (5 lg) served as positive control (PC). To control for speciﬁcity of the observed effects the nuclear extracts of Dvl2-transfected cells were incubated with the competing wild type (wt) and mutated (mut) oligonucleotides. Values are mean ± S.E.M. from two experiments. (C) and (D) APPL1 does not affect Dvl2-dependent phosphorylation of c-Jun. The levels of total and active (phosphorylated at Ser63, Ser73; P-cJun) c-Jun were analyzed by Western blotting in nuclear (NUC) fractions of HEK293T cells transfected with the indicated plasmids (C) and/ or siRNA (D; non- targeting siRNA marked as CON). Lamin A/C was used as a loading control for nuclear fractions. The efﬁciency of APPL1 and Dvl2 overexpression and of APPL1 knockdown was tested in total cell lysates (TCL) by Western blotting (with Ponceau staining in C or GAPDH immunoblot in D as loading controls).

We verified that Dvl2 binding involved the C-terminal part of 3.2. APPL1 enhances the activation of non-canonical Wnt signaling APPL proteins containing the PH and PTB domains, as the bacteri- induced by Dvl2 ally expressed fragments comprising amino acids 429–709 of APPL1 and 378–664 of APPL2 fused to GST were able to pull down Since we did not detect any clear impact of APPL1-Dvl2 interac- Dvl2 from HEK293T cell lysate, whereas the N-terminal parts of tions on canonical Wnt signaling (Supplementary Fig. 2A and B), APPL were not (Fig. 1C). Since the efficiency of GST pull-down we verified whether APPL1 may regulate the Dvl2 function in the was low, one cannot exclude that also other parts of APPL proteins b-catenin-independent PCP pathway. To measure the activity of might be important for interaction with Dvl2 and/or proper folding non-canonical Wnt signaling in HEK293T cells we employed an of APPL1/2. The differences in Dvl2 binding between the C-termi- AP-1-driven luciferase reporter assay, a sensitive and reliable tool nal parts of APPL1 and APPL2 most probably reflect their different to monitor activation of the JNK pathway [34–36]. In agreement stability (GST-APPL1-C is more prone to degradation, as shown by with previous reports, Dvl2 strongly (>10-fold) stimulated reporter Ponceau staining in Fig. 1C). In further studies we focused on activity (Fig. 2A). APPL1 had no effect when overexpressed alone, APPL1 for several reasons: (i) APPL1 is more abundant in HEK293T but in the presence of exogenously expressed Dvl2 it increased cells than APPL2; (ii) the silencing efficiency of APPL1 is better than the reporter activity. These results suggest that APPL1 can potenti- for APPL2; (iii) there are biochemically well characterized mutants ate the action of Dvl2 on AP-1 transcription in non-canonical Wnt of APPL1 useful for functional assays. signaling. PDZ domains, such as the one present in Dvl2, preferentially To verify the assay specificity, we employed the DNA-binding bind C-terminal peptides of interacting partners [33]. Therefore, mutant of Fos transcription factor (A-Fos) which heterodimerizes we tested binding between Dvl2 and APPL1 truncated at the with c-Jun sequestering it and compromising AP-1-driven tran- C-terminus by four amino acids (APPL1DC4), verifying that both scription [31]. The data presented in Fig. 2B shows that A-Fos proteins still interacted (Fig. 1A). These data indicate that regions expression: (i) reduced basal AP-1 reporter activity, (ii) abolished other than the last four residues within the C-terminal part of Dvl2-dependent stimulation of luciferase activity, (iii) eliminated APPL1 enable association with Dvl2. the stimulatory effect of APPL1 on Dvl2-dependent reporter activity. M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539 537

Collectively, these results indicate that both Dvl2 and APPL1 However, the abundance of this active c-Jun form remained affect AP-1 driven transcription operating in non-canonical Wnt unchanged upon additional overexpression (Fig. 3C) or silencing signaling. (Fig. 3D) of APPL1, excluding any direct impact of APPL1 on c-Jun activation. Nevertheless, it should be noted that other active forms 3.3. Endosomal recruitment of APPL1 is necessary for its function in the of c-Jun exist [39] which were not assayed in our study and could non-canonical Wnt pathway be potentially affected by APPL1. Moreover, c-Jun is one of numerous substrates of the JNK kinase [40] and it remains possible that Since APPL1 localizes mainly to endosomes, we examined the APPL1 could, via Dvl2, act on transcription factors others than relationship between its role in non-canonical Wnt signaling and the examined AP-1 members. its cellular localization. We tested three previously described mutants of APPL1 which cannot associate with Rab5 (APPL1- 3.5. APPL1 modulates expression of the MMP1 gene K280E/Y283C/G319R and APPL1-A318D) or Rab21 (APPL1- G320A) [3,4] and are therefore deﬁcient in binding to endosomal Since APPL1 was able to increase Dvl2-dependent AP-1 reporter membranes. When tested in the reporter assay, none of the activity, we tested whether APPL1 could modulate expression of mutants was able to potentiate Dvl2-mediated AP-1 activity, in non-canonical Wnt target genes. First, we employed HEK293T cells contrast to the wild-type protein (Fig. 2C). While it cannot be overproducing APPL1 or Dvl2 proteins and measured expression excluded that APPL1 mutants fail to affect the AP-1 pathway levels of four AP-1 target genes (MMP1, MMP2, MMP13 encoding because of reduced interactions with Dvl2, we consider it unlikely, metalloproteinases and TEK encoding angiotensin receptor Tie2), since the N-terminal part of APPL1 (where the mutations are known to be upregulated by non-canonical Wnt5a ligand [41,42] located) seems to be dispensable for Dvl2 binding. These results may therefore suggest that endosomal fraction of APPL1 is responsible for its function in Dvl2-dependent non-canonical Wnt signaling. Since, by microscopy, we could observe residual co- localization of APPL1 and Dvl2 on endosomes (Fig. 2D) recruitment of Dvl2 to these organelles may be transient. APPL1 endosomal localization was shown to be crucial for activation of the NF-jB pathway [10], possibly due to its posttranslational modiﬁcations or the presence of interacting proteins on endosomes. One might speculate that endosomal APPL1 could be a part of a bigger platform for dynamic assembly/disassembly of complexes involved in non-canonical Wnt signaling. There are known examples of interactions between endocytic proteins and Dvl which regulate the non-canonical Wnt pathway. Binding of Dvl2 by AP-2, a clathrin adaptor complex, was shown to be crucial for Frizzled/PCP signaling [37].InXenopus development, PCP signaling depends on the interaction between Dvl homolog (Dsh) and an endocytic protein b-arrestin 1 [38]. APPL1 may thus represent another link between endocytosis and the non-canonical Wnt pathway.

3.4. Dvl2-dependent activation of c-Jun is not affected by APPL1

To understand the mechanism of Dvl2-APPL1 cooperation in AP-1-dependent gene regulation, we started with profiling the members of AP-1 family in HEK293T cells. First, we measured the mRNA level of: c-Jun, JunB, JunD and cFos in HEK293T cells overexpressing Dvl2. As shown in Fig. 3A, c-Jun, JunB and cFos, but not JunD, were upregulated upon Dvl2 overexpression. In the presence of JNK inhibitor SP600125 the effects of Dvl2 were eliminated which confirmed the involvement of JNK in this process. Next, we estimated activity of individual AP-1 transcription factors in nuclear extracts of HEK293T cells transfected with Dvl2 by DNA-binding ELISA assay. We found that among six analyzed transcription factors five of them: JunB, JunD, cFos, FosB, and Fra-1 were not activated by Dvl2 (data not shown), indicating that the observed increase in transcript levels of cFos and JunB did not cor- relate with activities of these proteins. Consistently with transcriptional analysis, overexpression of Dvl2 led to about 2-fold Fig. 4. APPL1 affects expression of the MMP1 target gene in Dvl2-dependent activation of c-Jun (measured as binding of Ser73-phosphorylated manner. RT-PCR was performed to measure transcription of the indicated non- c-Jun to oligonucleotides representing AP-1 binding sites) canonical Wnt target genes in HEK293T cells transiently transfected with Dvl2 and APPL1. Data represent mRNA levels as fold change versus control (pcDNA3- (Fig. 3B). This effect was specific since addition of competing wild transfected cells). ACTB and B2M were used as reference genes. (A) Dvl2 overex- type oligonucleotides abolished Dvl2-driven activation, while pression stimulates MMP1 transcription. (B) Dvl2- and APPL1-regulated transcrip- addition of mutated oligonucleotides did not affect it. These tion of MMP1 depends on the JNK activity. Before lysis, cells were treated with observations show that in HEK293T cells Dvl2 acts via the c-Jun DMSO or the JNK inhibitor SP600125. The effects of Dvl2 on MMP1 transcription are represented as fold change versus pcDNA3-transfected, DMSO-treated control cells transcription factor. Consistently, immunoblotting of nuclear or versus pcDNA3-transfected, SP600125-treated cells. Values are mean ± S.E.M. extracts for c-Jun phosphorylated at Ser63 and Ser73 confirmed from three experiments. The efficiency of APPL1 and Dvl2 overexpression was its increased levels in cells overexpressing Dvl2 (Fig. 3C and D). tested by Western blotting with GAPDH as a loading control. 538 M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539 or by Dvl2 overexpression in distinct cell lines [43]. As depicted in References Fig. 4A, Dvl2 overexpression induced transcription only of the MMP1 gene, whereas APPL1 overexpression alone had no effect. [1] Borlido, J., Zecchini, V. and Mills, I.G. (2009) Nuclear trafficking and functions of endocytic proteins implicated in oncogenesis. Traffic 10, 1209–1220. However, in cells transfected with Dvl2, APPL1 overproduction fur- [2] Pyrzynska, B., Pilecka, I. and Miaczynska, M. (2009) Endocytic proteins in the ther increased the level of MMP1 transcript (Fig. 4B), in full agree- regulation of nuclear signaling, transcription and tumorigenesis. Mol. Oncol. 3, ment with the reporter data (Fig. 2A). 321–338. To examine if the observed effects were dependent on the JNK [3] Miaczynska, M. et al. (2004) APPL proteins link Rab5 to nuclear signal transduction via an endosomal compartment. Cell 116, 445–456. pathway, as reported for the role of Dvl2 in non-canonical Wnt sig- [4] Zhu, G. et al. (2007) Structure of the APPL1 BAR-PH domain and naling [21,22], we employed JNK inhibitor SP600125 in HEK293T characterization of its interaction with Rab5. EMBO J. 26, 3484–3493. cells overexpressing Dvl2 alone or with APPL1. Data presented in [5] Banach-Orlowska, M., Pilecka, I., Torun, A., Pyrzynska, B. and Miaczynska, M. (2009) Functional characterization of the interactions between endosomal Fig. 4B shows that JNK inhibition severely reduced the stimulatory adaptor protein APPL1 and the NuRD co-repressor complex. Biochem. J. 423, effect of Dvl2 on MMP1 transcription. The remaining stimulatory 389–400. effect of Dvl2 can be explained by incomplete inhibition of JNK [6] Deepa, S.S. and Dong, L.Q. (2009) APPL1: role in adiponectin signaling and beyond. Am. J. Physiol. Endocrinol. Metab. 296, E22–E36. or by an additional JNK-independent pathway involving Dvl2 in [7] Erdmann, K.S. et al. (2007) A role of the Lowe syndrome protein OCRL in early the regulation of MMP1 expression. In the presence of SP600125, steps of the endocytic pathway. Dev. Cell 13, 377–390. APPL1 was no more able to increase transcription of MMP1 [8] Mitsuuchi, Y., Johnson, S.W., Sonoda, G., Tanno, S., Golemis, E.A. and Testa, J.R. (1999) Identification of a chromosome 3p14.3-21.1 gene, APPL, encoding an (Fig. 4B). These results indicate that in HEK293T cells APPL1 mod- adaptor molecule that interacts with the oncoprotein-serine/threonine kinase ulates Dvl2-driven expression of MMP1 via a mechanism involving AKT2. Oncogene 18, 4891–4898. the JNK kinase. [9] Zhou, L. et al. (2009) Adiponectin activates AMP-activated protein kinase in muscle cells via APPL1/LKB1-dependent and phospholipase C/Ca2+/Ca2+/ The exact mechanism of APPL1 action in Dvl2-mediated gene calmodulin-dependent protein kinase kinase-dependent pathways. J. Biol. expression will require further investigation. Since APPL1 mutants Chem. 284, 22426–22435. deficient in endosome localization failed to potentiate Dvl2 func- [10] Hupalowska, A., Pyrzynska, B. and Miaczynska, M. (2012) APPL1 regulates tion in regulation of AP-1 dependent transcription, one may spec- basal NF-kappaB activity by stabilizing NIK. J. Cell Sci. 125, 4090–4102. [11] Rashid, S., Pilecka, I., Torun, A., Olchowik, M., Bielinska, B. and Miaczynska, M. ulate that APPL1 residing on endosomes provides a proper context (2009) Endosomal adaptor proteins APPL1 and APPL2 are novel activators of for Dvl2 activity. Taking into account the role of APPL1 in canonical beta-catenin/TCF-mediated transcription. J. Biol. Chem. 284, 18115–18128. Wnt signaling, it is plausible that APPL1 can act as a switch [12] Gao, C. and Chen, Y.G. (2010) Dishevelled: the hub of Wnt signaling. Cell Signal. 22, 717–727. between canonical and non-canonical Wnt signaling. APPL1 seems [13] Gan, X.Q., Wang, J.Y., Xi, Y., Wu, Z.L., Li, Y.P. and Li, L. (2008) Nuclear Dvl, c-Jun, to affect these two branches of Wnt signaling at different stages: beta-catenin, and TCF form a complex leading to stabilization of beta-catenin– the non-canonical pathway at an early stage involving Dvl2 and TCF interaction. J. Cell Biol. 180, 1087–1100. [14] Habas, R. and Dawid, I.B. (2005) Dishevelled and Wnt signaling: is the nucleus the canonical one at a late stage by attenuating reptin-dependent the final frontier? J. Biol. 4, 2. transcriptional repression in the nucleus [11]. Being an adaptor [15] Schwarz-Romond, T., Merrifield, C., Nichols, B.J. and Bienz, M. (2005) The Wnt protein capable of multiple interactions in various cellular loca- signalling effector Dishevelled forms dynamic protein assemblies rather than stable associations with cytoplasmic vesicles. J. Cell Sci. 118, 5269–5277. tions, APPL1 can function in many signaling pathways and is a [16] Chen, W. et al. (2003) Dishevelled 2 recruits beta-arrestin 2 to mediate good candidate for a fine tuner of cellular signaling. We postulate Wnt5A-stimulated endocytosis of Frizzled 4. Science 301, 1391–1394. that APPL1 may act as such modulator also in Dvl-induced non- [17] Seto, E.S. and Bellen, H.J. (2006) Internalization is required for proper Wingless signaling in Drosophila melanogaster. J. Cell Biol. 173, 95–106. canonical Wnt signaling network. [18] Bilic, J., Huang, Y.L., Davidson, G., Zimmermann, T., Cruciat, C.M., Bienz, M. and Niehrs, C. (2007) Wnt induces LRP6 signalosomes and promotes dishevelled- Author contribution dependent LRP6 phosphorylation. Science 316, 1619–1622. [19] Zeng, X. et al. (2008) Initiation of Wnt signaling: control of Wnt coreceptor Lrp6 phosphorylation/activation via frizzled, dishevelled and axin functions. MBO and ES designed and performed experiments, and ana- Development 135, 367–375. lyzed the data with the help of MM; MBO conceived and directed [20] Schwarz-Romond, T., Metcalfe, C. and Bienz, M. (2007) Dynamic recruitment of axin by Dishevelled protein assemblies. J. Cell Sci. 120, 2402–2412. the project; MBO and MM wrote the manuscript. [21] Boutros, M., Paricio, N., Strutt, D.I. and Mlodzik, M. (1998) Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and Acknowledgments wingless signaling. Cell 94, 109–118. [22] Yamanaka, H., Moriguchi, T., Masuyama, N., Kusakabe, M., Hanafusa, H., Takada, R., Takada, S. and Nishida, E. (2002) JNK functions in the non- We are grateful to Prof. J. Otlewski for the gift of pCMV-Dvl2 canonical Wnt pathway to regulate convergent extension movements in plasmid, and Dr. Vladimir Korinek for the gift of pRL-TK plasmid. vertebrates. EMBO Rep. 3, 69–75. This work was carried out within the Parent-Bridge programme [23] Habas, R., Dawid, I.B. and He, X. (2003) Coactivation of Rac and Rho by Wnt/ Frizzled signaling is required for vertebrate gastrulation. Genes Dev. 17, 295– of the Foundation for Polish Science, co-financed from the Euro- 309. pean Union under the European Regional Development Fund [24] Liu, W., Sato, A., Khadka, D., Bharti, R., Diaz, H., Runnels, L.W. and Habas, R. [Grant No.: Pomost/2010-1/1] to MBO. ES was supported by the (2008) Mechanism of activation of the Formin protein Daam1. Proc. Natl. Acad. Sci. U.S.A. 105, 210–215. Parent-Bridge grant Pomost/2011-3/11. Research in the MM lab [25] Habas, R., Kato, Y. and He, X. (2001) Wnt/Frizzled activation of Rho regulates was supported by the funding from the European Community’s vertebrate gastrulation and requires a novel Formin homology protein Daam1. Seventh Framework Programme (FP7/2007-2013) under grant Cell 107, 843–854. [26] Wagner, E.F. (2001) AP-1–introductory remarks. Oncogene 20, 2334–2335. agreement number TRANSPOL – 264399 and by the matching [27] Chinenov, Y. and Kerppola, T.K. (2001) Close encounters of many kinds: Fos– funds from the Ministry of Science and Higher Education under Jun interactions that mediate transcription regulatory specificity. Oncogene agreement number 2024/7.PR/2011/2 in years 2012-2014. 20, 2438–2452. [28] Hess, J., Angel, P. and Schorpp-Kistner, M. (2004) AP-1 subunits: quarrel and harmony among siblings. J. Cell Sci. 117, 5965–5973. Appendix A. Supplementary data [29] Minden, A., Lin, A., Smeal, T., Derijard, B., Cobb, M., Davis, R. and Karin, M. (1994) C-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated protein kinases. Mol. Supplementary data associated with this article can be found, in Cell. Biol. 14, 6683–6688. the online version, at http://dx.doi.org/10.1016/j.febslet.2015.01. [30] Angel, P., Hattori, K., Smeal, T. and Karin, M. (1988) The jun proto-oncogene is 022. positively autoregulated by its product, Jun/AP-1. Cell 55, 875–885. M. Banach-Orlowska et al. / FEBS Letters 589 (2015) 532–539 539

[31] Ahn, S., Olive, M., Aggarwal, S., Krylov, D., Ginty, D.D. and Vinson, C. (1998) A [38] Kim, G.H., Park, E.C., Lee, H., Na, H.J., Choi, S.C. and Han, J.K. (2013) Beta- dominant-negative inhibitor of CREB reveals that it is a general mediator of Arrestin 1 mediates non-canonical Wnt pathway to regulate convergent stimulus-dependent transcription of c-fos. Mol. Cell. Biol. 18, 967–977. extension movements. Biochem. Biophys. Res. Commun. 435, 182–187. [32] Urbanska, A., Sadowski, L., Kalaidzidis, Y. and Miaczynska, M. (2011) [39] Reddy, C.E., Albanito, L., De Marco, P., Aiello, D., Maggiolini, M., Napoli, A. and Biochemical characterization of APPL endosomes: the role of annexin A2 in Musti, A.M. (2013) Multisite phosphorylation of c-Jun at threonine 91/93/95 APPL membrane recruitment. Trafﬁc 12, 1227–1241. triggers the onset of c-Jun pro-apoptotic activity in cerebellar granule [33] Jelen, F., Oleksy, A., Smietana, K. and Otlewski, J. (2003) PDZ domains – neurons. Cell Death Dis. 4, e852. common players in the cell signaling. Acta Biochim. Pol. 50, 985–1017. [40] Bogoyevitch, M.A. and Kobe, B. (2006) Uses for JNK: the many and varied [34] Endo, M., Nishita, M. and Minami, Y. (2012) Analysis of Wnt/planar cell substrates of the c-Jun N-terminal kinases. Microbiol. Mol. Biol. Rev. 70, 1061– polarity pathway in cultured cells. Methods Mol. Biol. 839, 201–214. 1095. [35] Cheyette, B.N. et al. (2002) Dapper, a Dishevelled-associated antagonist of [41] Masckauchan, T.N. et al. (2006) Wnt5a signaling induces proliferation and beta-catenin and JNK signaling, is required for notochord formation. Dev. Cell survival of endothelial cells in vitro and expression of MMP-1 and Tie-2. Mol. 2, 449–461. Biol. Cell 17, 5163–5172. [36] Pukrop, T., Klemm, F., Hagemann, T., Gradl, D., Schulz, M., Siemes, S., Trumper, [42] Kamino, M. et al. (2011) Wnt-5a signaling is correlated with inﬁltrative L. and Binder, C. (2006) Wnt 5a signaling is critical for macrophage-induced activity in human glioma by inducing cellular migration and MMP-2. Cancer invasion of breast cancer cell lines. Proc. Natl. Acad. Sci. U.S.A. 103, 5454– Sci. 102, 540–548. 5459. [43] Yamagata, K., Li, X., Ikegaki, S., Oneyama, C., Okada, M., Nishita, M. and [37] Yu, A., Rual, J.F., Tamai, K., Harada, Y., Vidal, M., He, X. and Kirchhausen, T. Minami, Y. (2012) Dissection of Wnt5a-Ror2 signaling leading to matrix (2007) Association of Dishevelled with the clathrin AP-2 adaptor is required metalloproteinase (MMP-13) expression. J. Biol. Chem. 287, 1588–1599. for Frizzled endocytosis and planar cell polarity signaling. Dev. Cell 12, 129– 141.