DOCSLIB.ORG

ABL TYROSINE KINASES MEDIATE INTERCELLULAR ADHESION By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

ABL TYROSINE KINASES MEDIATE INTERCELLULAR ADHESION by Nicole L. Zandy Department of Pharmacology and Cancer Biology Duke University Date:_______________________ Approved: ___________________________ Ann Marie Pendergast, Supervisor ___________________________ Christopher Counter ___________________________ Mark Dewhirst ___________________________ Christopher Kontos ___________________________ Xiao‐Fan Wang Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Pharmacology and Cancer Biology in the Graduate School of Duke University 2008 ABSTRACT ABL TYROSINE KINASES MEDIATE INTERCELLULAR ADHESION by Nicole L. Zandy Department of Pharmacology and Cancer Biology Duke University Date:_______________________ Approved: ___________________________ Ann Marie Pendergast, Supervisor ___________________________ Christopher Counter ___________________________ Mark Dewhirst ___________________________ Christopher Kontos ___________________________ Xiao‐Fan Wang An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor in the Department of Pharmacology and Cancer Biology in the Graduate School of Duke University 2008 Copyright by Nicole Lynn Zandy 2008 Abstract Adherens junctions are calcium‐dependent cell‐cell contacts formed during epithelial morphogenesis that link neighboring cells via cadherin receptors. Coordinated regulation of the actin cytoskeleton by the Rho GTPases is required for the formation and dissolution of adherens junctions, however the pathways that link cadherin signaling to cytoskeletal regulation remain poorly defined. The Abl tyrosine kinases been shown to modulate cytoskeletal reorganization downstream of various extracellular signals including growth factor receptors and integrins. Here we use pharmacological inhibition, genetic inactivation, and RNA interference to identify the Abl family kinases as critical mediators of cadherin‐mediated adhesion. Endogenous Abl family kinases, Abl and Arg, are activated and are required for Rac activation following cadherin engagement, and regulate the formation and maintenance of adherens junctions in mammalian cells. Significantly, we show that Abl‐ dependent regulation of the Rho‐ROCK‐myosin signaling pathway is critical for the maintenance of adherens junctions. Inhibition of the Abl kinases in epithelial sheets results in activation of Rho and its downstream target ROCK, leading to enhanced phosphorylation of the myosin regulatory light chain. These signaling events result in enhanced stress fiber formation and increased acto‐myosin contractility, thereby disrupting adherens junctions. Conversely, Arg gain‐of‐function promotes adherens iv junction formation through a Crk‐dependent pathway in cells with weak junctions. These data identify the Abl kinases as a novel regulatory link between the cadherin/catenin adhesion complex and the actin cytoskeleton through regulation of Rac and Rho during adherens junction formation. Unexpectedly, we identified a requirement for Abl and Crk downstream of Rac in the regulation of adherens junctions. Therefore, Abl functions both upstream and downstream of Rac in regulating adherens junctions, which suggests the possibility of a positive feedback loop consisting of Abl‐Crk‐Rac. Finally, we identified the Abl kinases as critical mediators of epithelial cell response to HGF. Pharmacological inhibition of Abl kinase activity resulted in impaired dissolution of adherens junctions downstream of HGF stimulation of the Met receptor. Additionally, we observed decreased phosphorylation of the Met receptor itself, along with Gab1 and Crk, downstream effectors of Met signaling. Taken together, these data suggest a requirement for Abl kinases in both adherens junctions formation and turnover. v Dedication It is with a sense of profound loss and utter desolation that I dedicate this dissertation in loving memory of my father, Leonard Marino Zandy (Sunday, August 6, 1944‐Friday, November 23, 2007). Exactly five months have passed since I lost my first valentine, my career role model, my sports buddy and “athletic” trainer, my TV gossip companion, my “project manager,” my verbal sparring partner, my first styling “client,” my inspiration to achieve without costing others and to give until it hurts, the foundation of my moral and ethical beliefs, the sun in my solar system, the center of my family, and the platinum standard I use to gauge the value of husband and father. Just two days and five months ago, I was exhausted, in part due to our trip to South Bend, but happily submitting my dissertation in plenty of time to finish dinner before watching Duke win the Maui Invitational and looking forward to seeing Santa Claus in the Macy’s Thanksgiving Day Parade the next day. On Thanksgiving Day, my dad, mom, Kim, Pam, and I sat at the table eating turkey, roast “beast,” and mashed potatoes, while Kurbain ate a cornucopia of food “donations.” It was a perfect meal. On Friday, I woke up with a headache, but insisted I would not miss our family tradition of me & mommy & daddy cutting down our Christmas tree‐I had to get it decorated before I left to return to Durham to prepare for my thesis defense the vi following week. We all got ready, went to our usual local tree farm, and almost too easily found the “perfect tree,” our first Fraser Fir from PA in years, and brought it home. The events that followed are too private to be shared: and just like that…he was gone… And in that instant, I learned infinitely more than the words that follow on these hundred‐odd pages describing five years’ work convey. It is the wisdom from that moment that I will continue to build on and share in his name. I miss you, Daddy. xoxo Love, Nicole vii Contents Abstract .........................................................................................................................................iv Dedication .....................................................................................................................................vi List of Figures ..............................................................................................................................xii 1. Introduction ...............................................................................................................................1 1.1 Adherens junctions...........................................................................................................1 1.1.1 Adherens junctions during development ................................................................1 1.1.2 Adherens junctions in cancer.....................................................................................5 1.1.3 Adherens junction components.................................................................................8 1.1.3.1 Cadherin family proteins....................................................................................8 1.1.3.2 Catenin family proteins.......................................................................................9 1.1.3.3 Actin cytoskeleton..............................................................................................11 1.1.4 Regulation of adherens junctions............................................................................13 1.1.4.1 Adherens junction component binding ..........................................................14 1.1.4.2 Phosphorylation.................................................................................................15 1.1.4.3 Rho GTPases .......................................................................................................18 1.2 Cross‐talk between Adherens junctions and Receptor Tyrosine Kinases ..............23 1.2.1 Interactions between adherens junctions and RTKs ............................................25 1.2.2 Met receptor tyrosine kinase....................................................................................29 1.2.2.1 Cancer relevance ................................................................................................29 1.2.2.2 Biological effects of Met activation..................................................................30 viii 1.2.2.3 Met signaling ......................................................................................................32 1.3 Abl family of non‐receptor Tyrosine Kinases.............................................................36 1.3.1 Abl and Arg................................................................................................................37 1.3.2 Regulation of Abl/Arg ..............................................................................................42 1.3.2.1 Physical................................................................................................................42 1.3.2.2 Protein modification ..........................................................................................44 1.3.2.3 Upstream signals regulating Abl tyrosine kinase activity ...........................45 1.3.3 Biological function of Abl/Arg ................................................................................48 1.3.3.1 In vivo roles of Abl and Arg.............................................................................48 1.3.3.2 Abl kinases regulate response to growth factors and cell migration .........50 1.3.3.3 Abl family kinases in intercellular conversations .........................................52 2. Abl Tyrosine Kinases regulate cell‐cell adhesion
Recommended publications
  • Profiling Data

    Profiling Data

    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia

    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia

    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
  • Inhibition of Src Family Kinases and Receptor Tyrosine Kinases by Dasatinib: Possible Combinations in Solid Tumors

    Inhibition of Src Family Kinases and Receptor Tyrosine Kinases by Dasatinib: Possible Combinations in Solid Tumors

    Published OnlineFirst June 13, 2011; DOI: 10.1158/1078-0432.CCR-10-2616 Clinical Cancer Molecular Pathways Research Inhibition of Src Family Kinases and Receptor Tyrosine Kinases by Dasatinib: Possible Combinations in Solid Tumors Juan Carlos Montero1, Samuel Seoane1, Alberto Ocaña2,3, and Atanasio Pandiella1 Abstract Dasatinib is a small molecule tyrosine kinase inhibitor that targets a wide variety of tyrosine kinases implicated in the pathophysiology of several neoplasias. Among the most sensitive dasatinib targets are ABL, the SRC family kinases (SRC, LCK, HCK, FYN, YES, FGR, BLK, LYN, and FRK), and the receptor tyrosine kinases c-KIT, platelet-derived growth factor receptor (PDGFR) a and b, discoidin domain receptor 1 (DDR1), c-FMS, and ephrin receptors. Dasatinib inhibits cell duplication, migration, and invasion, and it triggers apoptosis of tumoral cells. As a consequence, dasatinib reduces tumoral mass and decreases the metastatic dissemination of tumoral cells. Dasatinib also acts on the tumoral microenvironment, which is particularly important in the bone, where dasatinib inhibits osteoclastic activity and favors osteogenesis, exerting a bone-protecting effect. Several preclinical studies have shown that dasatinib potentiates the antitumoral action of various drugs used in the oncology clinic, paving the way for the initiation of clinical trials of dasatinib in combination with standard-of-care treatments for the therapy of various neoplasias. Trials using combinations of dasatinib with ErbB/HER receptor antagonists are being explored in breast, head and neck, and colorectal cancers. In hormone receptor–positive breast cancer, trials using combina- tions of dasatinib with antihormonal therapies are ongoing. Dasatinib combinations with chemother- apeutic agents are also under development in prostate cancer (dasatinib plus docetaxel), melanoma (dasatinib plus dacarbazine), and colorectal cancer (dasatinib plus oxaliplatin plus capecitabine).
  • PRKACA Mediates Resistance to HER2-Targeted Therapy in Breast Cancer Cells and Restores Anti-Apoptotic Signaling

    PRKACA Mediates Resistance to HER2-Targeted Therapy in Breast Cancer Cells and Restores Anti-Apoptotic Signaling

    Oncogene (2015) 34, 2061–2071 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE PRKACA mediates resistance to HER2-targeted therapy in breast cancer cells and restores anti-apoptotic signaling SE Moody1,2,3, AC Schinzel1, S Singh1, F Izzo1, MR Strickland1, L Luo1,2, SR Thomas3, JS Boehm3, SY Kim4, ZC Wang5,6 and WC Hahn1,2,3 Targeting HER2 with antibodies or small molecule inhibitors in HER2-positive breast cancer leads to improved survival, but resistance is a common clinical problem. To uncover novel mechanisms of resistance to anti-HER2 therapy in breast cancer, we performed a kinase open reading frame screen to identify genes that rescue HER2-amplified breast cancer cells from HER2 inhibition or suppression. In addition to multiple members of the MAPK (mitogen-activated protein kinase) and PI3K (phosphoinositide 3-kinase) signaling pathways, we discovered that expression of the survival kinases PRKACA and PIM1 rescued cells from anti-HER2 therapy. Furthermore, we observed elevated PRKACA expression in trastuzumab-resistant breast cancer samples, indicating that this pathway is activated in breast cancers that are clinically resistant to trastuzumab-containing therapy. We found that neither PRKACA nor PIM1 restored MAPK or PI3K activation after lapatinib or trastuzumab treatment, but rather inactivated the pro-apoptotic protein BAD, the BCl-2-associated death promoter, thereby permitting survival signaling through BCL- XL. Pharmacological blockade of BCL-XL/BCL-2 partially abrogated the rescue effects conferred by PRKACA and PIM1, and sensitized cells to lapatinib treatment. These observations suggest that combined targeting of HER2 and the BCL-XL/BCL-2 anti-apoptotic pathway may increase responses to anti-HER2 therapy in breast cancer and decrease the emergence of resistant disease.
  • The Role of C-Abl Kinase in HCC Development

    The Role of C-Abl Kinase in HCC Development

    Loyola University Chicago Loyola eCommons Master's Theses Theses and Dissertations 2016 The Role of c-Abl Kinase in HCC Development Lennox Chitsike Loyola University Chicago Follow this and additional works at: https://ecommons.luc.edu/luc_theses Part of the Molecular Biology Commons Recommended Citation Chitsike, Lennox, "The Role of c-Abl Kinase in HCC Development" (2016). Master's Theses. 3259. https://ecommons.luc.edu/luc_theses/3259 This Thesis is brought to you for free and open access by the Theses and Dissertations at Loyola eCommons. It has been accepted for inclusion in Master's Theses by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. Copyright © 2016 Lennox Chitsike LOYOLA UNIVERSITY CHICAGO THE ROLE OF C-ABL KINASE IN HCC DEVELOPMENT A THESIS SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL IN CANDIDACY FOR THE DEGREE OF MASTER OF SCIENCE PROGRAM IN BIOCHEMISTRY AND MOLECULAR BIOLOGY BY LENNOX CHITSIKE CHICAGO, ILLINOIS AUGUST, 2016 I dedicate this thesis to my mother ACKNOWLEDGEMENTS Firstly, I would like to express my sincere gratitude to my Ph.D advisor and mentor, Dr. Qiu for his tutelage, guidance, and support for the past year I have been in his lab. I could not have achieved half without the assistance. Secondly, I would like to express my sincere gratitude to the members of my thesis committee: Dr. Mitchell Denning and Dr. Zeleznik-Le for their insightful advice and suggestions that gave my study better perspective and new directions.
  • Low Doses of Imatinib Induce Myelopoiesis and Enhance Host Anti-Microbial Immunity

    Low Doses of Imatinib Induce Myelopoiesis and Enhance Host Anti-Microbial Immunity

    RESEARCH ARTICLE Low Doses of Imatinib Induce Myelopoiesis and Enhance Host Anti-microbial Immunity Ruth J. Napier1☯, Brian A. Norris2☯, Alyson Swimm3, Cynthia R. Giver4, Wayne A. C. Harris4, Julie Laval5,6,7, Brooke A. Napier1, Gopi Patel3, Ryan Crump8, Zhenghong Peng9, William Bornmann9, Bali Pulendran3,10,11, R. Mark Buller8, David S. Weiss10,11,12, Rabindra Tirouvanziam5,6, Edmund K. Waller4, Daniel Kalman3* 1 Microbiology and Molecular Genetics Graduate Program, Emory University School of Medicine, Atlanta, Georgia, United States of America, 2 Immunology and Molecular Pathogenesis Graduate Program, Emory University School of Medicine, Atlanta, Georgia, United States of America, 3 Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia, United States of America, a11111 4 Department of Hematology and Medical Oncology, Winship Cancer Institute, Emory University, Atlanta, Georgia, United States of America, 5 Department of Pediatrics, Emory University School of Medicine, Atlanta, Georgia, United States of America, 6 Center for Cystic Fibrosis Research, Children’s Healthcare of Atlanta, Atlanta, Georgia, United States of America, 7 Institut de Génétique Moléculaire de Montpellier (IGMM), CNRS UMR5535, Université Montpellier, Montpellier, France, 8 Department of Molecular Microbiology and Immunology, Saint Louis University, St. Louis, Missouri, United States of America, 9 MD Anderson Cancer Center, University of Texas, Houston, Texas, United States of America, 10 Emory Vaccine Center, Emory University, Atlanta, Georgia, United States of America, 11 Yerkes National Primate Research OPEN ACCESS Center, Atlanta, Georgia, United States of America, 12 Division of Infectious Diseases, Department of Medicine, Emory University School of Medicine, Atlanta, Georgia, United States of America Citation: Napier RJ, Norris BA, Swimm A, Giver CR, Harris WAC, Laval J, et al.
  • Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its

    Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its

    Supplementary data ASXL2 regulates hematopoiesis in mice and its deficiency promotes myeloid expansion Supplementary Methods Genomic DNA extraction Genomic DNA was extracted from BM mononuclear cells using a DNA extraction kit (Puregene Gentra System, Minneapolis, MN, USA) according to the manufacturer’s instructions. Genomic DNA was quantified using Qubit Fluorometer (Life Technologies) and DNA integrity was assessed by agarose gel electrophoresis. For samples with low quantity, DNA was amplified using REPLI-g Ultrafast mini kit (Qiagen). Peripheral blood analysis Complete peripheral blood counts were analysed using Abbott Cell-Dyn 3700 hematology analyzer (Abbott Laboratories). Expression analysis of Asxl2 and Asxl1 Transcript levels of Asxl2 and Asxl1 were estimated using quantitative RT-PCR with following primers: Asxl2 primer set 1, ATTCGACAAGAGATTGAGAAGGAG (forward) and TTTCTGTGAATCTTCAAGGCTTAG (reverse); Asxl2 primer set 2, GCCCTTAACAATGAGTTCTTCACT (forward) and TCCACAGCTCTACTTTCTTCTCCT (reverse); Asxl1 primers, GGTGGAACAATGGAAGGAAA (forward) and CTGGCCGAGAACGTTTCTTA (reverse). Asxl2 protein was detected in immunoblot using anti-ASXL2 antibody (Bethyl). In vitro differentiation of bone marrow cells Bone marrow (BM) cells were cultured in IMDM containing 20% FBS and 10 ng/ml IL3, 10 ng/ml IL6, 20 ng/ml SCF and 20 ng/ml GMCSF for two weeks. For FACS analysis, cells were washed, stained with fluorochrome-conjugated antibodies and analysed on FACS LSR II flow cytometer (BD Biosciences) using FACSDIVA software (BD Biosciences). Colony re-plating assay Bone marrow cells were plated in methylcellulose medium containing mouse stem cell factor (SCF), mouse interleukin 3 (IL-3), human interleukin 6 (IL-6) and human erythropoietin (MethoCult GF M3434; StemCell Technologies). Colonies were enumerated after 9-12 days and cells were harvested for re-plating.
  • Structure, Regulation, Signaling, and Targeting of Abl Kinases in Cancer

    Structure, Regulation, Signaling, and Targeting of Abl Kinases in Cancer

    436 M MONOGRAPHS Genes & Cancer 3(5-6) 436 –446 © The Author(s) 2012 Reprints and permission: Structure, Regulation, Signaling, and sagepub.com/journalsPermissions.nav DOI: 10.1177/1947601912458584 Targeting of Abl Kinases in Cancer http://ganc.sagepub.com Oliver Hantschel Abstract Abl kinases are prototypic cytoplasmic tyrosine kinases and are involved in a variety of chromosomal aberrations in different cancers. This causes the expression of Abl fusion proteins, such as Bcr-Abl, that are constitutively activated and drivers of tumorigenesis. Over the past decades, biochemical and functional studies on the molecular mechanisms of Abl regulation have gone hand in hand with progression of our structural understanding of autoinhibited and active Abl conformations. In parallel, Abl oncoproteins have become prime molecular targets for cancer therapy, using adenosine triphosphate (ATP)–competitive kinase inhibitors, such as imatinib. Abl-targeting drugs serve as a paradigm for our understanding of kinase inhibitor action, specificity, and resistance development. In this review article, I will review the molecular mechanisms that are responsible for the regulation of Abl kinase activity and how oncogenic Abl fusions signal. Furthermore, past and ongoing efforts to target Abl oncoproteins using ATP-competitive and allosteric inhibitors, as well as future possibilities using combination therapy, will be discussed. Keywords: tyrosine kinase, Bcr-Abl, kinase inhibitor, kinase structure Structure and Regulation of Abl of Abl play key roles in mediating
  • ABBOTT MOLECULAR ONCOLOGY and GENETICS 2015-2016 Product Catalog

    ABBOTT MOLECULAR ONCOLOGY and GENETICS 2015-2016 Product Catalog

    DESCRIPTOR, 9/12, ALL CAPS ABBOTT MOLECULAR ONCOLOGY AND GENETICS 2015-2016 Product Catalog Area for placed imagery Only use imagery that is relevant to the communication CHOOSE TRANSFORMATION See where it will take you at AbbottMolecular.com 2 Please note some products may not be for sale in all markets. Contact your local representative for availability. ASR (Analyte Specific Reagent) Analytical and performance characteristics are not established CE (CE Marked) Conformité Européenne GPR (General Purpose Reagent) For Laboratory use RUO (Research Use Only) Not for use in diagnostic procedures All products manufactured and/or distributed by Abbott Molecular should be used in accordance with the products’ labeled intended use. Products labeled “Research Use Only” should be used for research applications, and are not for use in diagnostic procedures. CEP, LSI, AneuVysion, MultiVysion, PathVysion and Vysis are registered trademarks of Vysis, Inc., AutoVysion, ProbeChek, SpectrumAqua, SpectrumBlue, SpectrumGreen, SpectrumGold, SpectrumOrange, SpectrumRed, TelVysion, ToTelVysion, UroVysion and VP 2000 are trademarks of Abbott Molecular in various jurisdictions. All other trademarks are the property of their respective owners. Please note some products may not be for sale in all markets. Contact your local representative for availability. 3 Abbott Molecular is Transforming Laboratory Partnerships and Productivity—Today and into the Future As a leader in molecular Our commitment to exploring new clinical frontiers is evident in the development and delivery of innovative diagnostics, Abbott is committed systems and assay solutions that aid physicians in the diagnosis of disease, selection of therapies and monitoring to providing solution-oriented of disease. offerings built on FISH and PCR.
  • Amplification of the Human Epidermal Growth Factor Receptor 2 (HER2) Gene Is Associated with a Microsatellite Stable Status in Chinese Gastric Cancer Patients

    Amplification of the Human Epidermal Growth Factor Receptor 2 (HER2) Gene Is Associated with a Microsatellite Stable Status in Chinese Gastric Cancer Patients

    387 Original Article Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with a microsatellite stable status in Chinese gastric cancer patients He Huang1#, Zhengkun Wang2#, Yi Li2, Qun Zhao3, Zhaojian Niu2 1Department of Gastrointestinal Surgery, The First Hospital of Shanxi Medical University, Shanxi, China; 2Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, Qingdao, China; 3Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: I) Conception and design: Z Niu, Q Zhao, H Huang; (II) Administrative support: Z Niu, H Huang, Z Wang; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: Z Wang, Q Zhao; (V) Data analysis and interpretation: Z Niu, H Huang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhaojian Niu. Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, No. 16, Jiangsu Road, Shinan District, Qingdao 260003, China. Email: [email protected]; Qun Zhao. Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, No. 12 Jiankang Road, Shijiazhuang 050011, China. Email: [email protected]. Background: Gastric cancer (GC) is one of the most common cancers worldwide. However, little is known about the combination of HER2 amplification and microsatellite instability (MSI) status in GC. This study aimed to analyze the correlation of HER2 amplification with microsatellite instability (MSI) status, clinical characteristics, and the tumor mutational burden (TMB) of patients. Methods: A total of 192 gastric cancer (GC) patients were enrolled in this cohort. To analyze genomic alterations (GAs), deep sequencing was performed on 450 target cancer genes.
  • The ABL2 Kinase Regulates an HSF1-Dependent Transcriptional Program Required for Lung Adenocarcinoma Brain Metastasis

    The ABL2 Kinase Regulates an HSF1-Dependent Transcriptional Program Required for Lung Adenocarcinoma Brain Metastasis

    The ABL2 kinase regulates an HSF1-dependent transcriptional program required for lung adenocarcinoma brain metastasis Jacob P. Hoja,1, Benjamin Mayroa,1, and Ann Marie Pendergasta,2 aDepartment of Pharmacology and Cancer Biology, Duke University School of Medicine, Durham, NC 27710 Edited by Joan S. Brugge, Harvard Medical School, Boston, MA, and approved November 6, 2020 (received for review April 24, 2020) Brain metastases are the most common intracranial tumors in independent of the canonical heat shock response (18–25). adults and are associated with increased patient morbidity and Previous work identified a divergent cancer-specific transcrip- mortality. Limited therapeutic options are currently available for tional program driven by HSF1 in highly malignant mammary the treatment of brain metastasis. Here, we report on the discov- epithelial cells and tumor cell lines from the lung, breast, and ery of an actionable signaling pathway utilized by metastatic colon (18). Central to this work was the discovery that genome tumor cells whereby the transcriptional regulator Heat Shock occupancy of HSF1 in the context of tumor malignancy is distinct Factor 1 (HSF1) drives a transcriptional program, divergent from from that of heat shock and drives expression of target genes its canonical role as the master regulator of the heat shock implicated in cell cycle, translation, and DNA repair. More re- response, leading to enhanced expression of a subset of E2F cently, HSF1 expression was also identified in T cell acute lym- transcription factor family gene targets. We find that HSF1 is phoblastic leukemia as critical for tumor cell survival by required for survival and outgrowth by metastatic lung cancer regulating NOTCH1 transcriptional activity (19).
  • (-)-Oleocanthal As a Dual C-MET-COX2 Inhibitor for The

    (-)-Oleocanthal As a Dual C-MET-COX2 Inhibitor for The

    nutrients Article (−)-Oleocanthal as a Dual c-MET-COX2 Inhibitor for the Control of Lung Cancer Abu Bakar Siddique 1 , Phillip C.S.R. Kilgore 2, Afsana Tajmim 1 , Sitanshu S. Singh 1 , Sharon A. Meyer 1, Seetharama D. Jois 1, Urska Cvek 2, Marjan Trutschl 2 and Khalid A. El Sayed 1,* 1 School of Basic Pharmaceutical and Toxicological Sciences, College of Pharmacy, University of Louisiana at Monroe, 1800 Bienville Drive, Monroe, LA 71201, USA; [email protected] (A.B.S.); [email protected] (A.T.); [email protected] (S.S.S.); [email protected] (S.A.M.); [email protected] (S.D.J.) 2 Department of Computer Science, Louisiana State University Shreveport, Shreveport, LA 71115, USA; [email protected] (P.C.S.R.K.); [email protected] (U.C.); [email protected] (M.T.) * Correspondence: [email protected]; Tel.: +1-318-342-1725 Received: 14 May 2020; Accepted: 9 June 2020; Published: 11 June 2020 Abstract: Lung cancer (LC) represents the topmost mortality-causing cancer in the U.S. LC patients have overall poor survival rate with limited available treatment options. Dysregulation of the mesenchymal epithelial transition factor (c-MET) and cyclooxygenase 2 (COX2) initiates aggressive LC profile in a subset of patients. The Mediterranean extra-virgin olive oil (EVOO)-rich diet already documented to reduce multiple malignancies incidence. (-)-Oleocanthal (OC) is a naturally occurring phenolic secoiridoid exclusively occurring in EVOO and showed documented anti-breast and other cancer activities via targeting c-MET. This study shows the novel ability of OC to suppress LC progression and metastasis through dual targeting of c-MET and COX-2.