DOCSLIB.ORG

Abstract Booklet

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Abstract Booklet 33rd EUROPEAN CONFERENCE ON PHILOSOPHY OF MEDICINE AND HEALTH CARE 7 – 10 August 2019 VENUE: UNIVERSITY OF OSLO GEORG SVERDRUPS HUS – UNIVERSITY LIBRARY MOLTKE MOES VEI 39, OSLO PHILOSOPHY AT THE EDGE OF MEDICINE Organised by: The European Society for Philosophy of Medicine and Healthcare (ESPMH) and the Centre for Medical Ethics, University of Oslo (Norway) ABSTRACTS ThE casE for psychophysical dualism Ahlzén, Rolf [email protected] The scientific revolution of the 17th century resulted in a pressing enigma: If man belongs to nature and nature follows natural laws which work fully deterministically – how may freedom of will exist, and how can there be an inner world of thoughts and emotions? Descartes wanted to solve this challenge by postulating that there is an immaterial substance, res cogitans, the thinking soul, that connects with the physical body, res extensa, in the pineal gland. Descartes has been much ridiculed for this attempt, and almost all evils of our time have been projected onto what is commonly called “dualism”. With the rapidly expanding neurosciences, there has appeared a monistic materialism, declaring that the mind is plainly an epiphenomenon of the workings of the brain and that our subjective experience of an inner world and of some degree of free choices and resulting responsibility is just an illusion. This ontological position has gained strength to the extent that any dualistic position is looked upon as blatantly naïve. In this paper, I want to challenge this position. I will draw inspiration from Karl Popper´s and John Eccle´s by now around thirty years old book The Self and its Brain, as well as Swedish philosopher Helge Malmgren, who defends a moderately dualistic position. It will be shown that dualism in a better way pays respect to the absolutely fundamental sense among most people that they have an inner world and that they have some degree of freedom of choice in their lives. Interactive dualism, however, has to accept that there is a fundamental enigma involved in the mind-body problem: How can mind work on matter (i.e. certain structures in the brain), so that not only the brain creates the mind, but also that the mind changes the state of the brain? The position that will be defended in this paper is that science needs to accept that this is inexplicable with the present state of science, but that it, as many scientific enigmas, may be explained with time. It will also be argued that no religiously or metaphysically based theories need to be involved in this. The workings of evolution and the idea of emergent properties offer promising roads towards this richer understanding of the relation between mind and matter. PErsonal rEsponsibility for hEalth” is a futilE project Ahola-Launonen, Johanna [email protected] Healthcare costs are increasing, and chronic diseases have a significant role in these costs. Furthermore, there seems to be a strong correlation between certain lifestyles and the chronic diseases. Boosted by the political trend of the responsibilization of the individual currently taking place elsewhere in politics, the health discussion has come to debate whether individuals should be held accountable for their lifestyle’s choices. Due to these premises, both the theoretical and applied discussion on health, justice, and prioritization currently navigate in the complex jungle of both holding individuals accountable and taking account the social determinants of health affecting health behaviour. This is mostly done by operating within the family of luck egalitarian theories. In this paper, I argue that this discussion should be taken into another direction. The project of finding accurate models of holding individuals responsible for their health is theoretically interesting. However, the applications end up being moralistic, simplistic or ineffective in the non-ideal real life. The consequences of the proposed applications are doomed to be unfair and ineffective. Even though luck egalitarian theories per se can survive criticisms of unfairness (because they can be formulated in pluralistic and holistic exceptions and nuanced excusing conditions), I argue that taking the theories into applied discussions end up merely contributing to the political trend of the responsibilization of the individual. The finely nuanced accounts of responsibility are too complex for popular understanding and the (usually) preferred end-states of public insurance and strong redistributive institutions are buried deep under layers of theory. “Responsible” behaviour in general is not without problems. The literature discusses certain specific risky behaviours related to health standards. It might be a good thing that people acted, at least remotely, according to those standards. However, this usually requires resources of several kinds, namely, the social determinants of health. Therefore, if the goal is to pursue these certain healthy behaviours, the reasonable (fair and efficient) approach should be to enhance the abilities of persons to act “responsibly”, that is, response-ability. In other words, this means enhancing people’s ability to make their own “best” decisions, not “decisions” made under extensively restricted autonomy under circumstances of scarcity. Digital hEalth: Implications for thE doctor-patiEnt rElationship Amann, Julia; Vayena, Effy; Blasimme, Alessandro [email protected] Patient-centered care has become widely recognized as the golden standard in healthcare. In its essence, patient-centered care refers to care that respects and responds to individual patients’ needs and preferences. It seeks to foster patient autonomy by equalizing knowledge and power asymmetries that have long characterized the doctor-patient relationship. A key component of patient-centered care is shared decision-making, which is deeply rooted in the principles of good clinical practice that emphasize the patient’s right to know. Shared decision-making thus presupposes a collaborative exchange between clinician and patient to ensure that all available and relevant information is taken into consideration and that the potential risks and benefits of a particular course of action are made evident to the patient. This, in turn, implies that information is provided to patients in a transparent and accessible manner. To date, research in the field of precision medicine and digital health has predominantly focused on ethical issues related to the collection, storage, and sharing of different types of data for analytical purposes. Only little is known about the clinical impact of introducing data-driven models into practice. In which cases does it make sense to rely on predictive models generated by data analytics? What effects will these new decision support systems have on the doctor- patient relationship and on the provision of care more generally? How can we ensure that patients retain the right to informed choice and control over medical decision-making rather than being subjected to algorithmic classificatory practices? The present contribution centers around the notion of shared decision-making in digital healthcare to generate a better understanding of how the inherent values of patient-centered care, in general, and shared decision-making, in particular, can be aligned with the emerging opportunities offered by real-time data analytics. It seeks to illustrate some of the key challenges associated with this process and makes recommendations on how to address them. Traditional ChinEsE MEdicinE and thE nEw “PErsonalizEd MEdicinE” / P4 Barilan, Y Michael [email protected] The Human Genome Project heralded a new vision of medicine, according to which, genetic and other “personal” markers would guide treatment as to render it more “precise”. A broader vision, inspired by “system biology” speaks of the mobilization of IT in the processing of large amount of “personal data”, from genomics to life-style as to “predict, prevent and personalize by means of participation”. This new vision embodies a turn to some metaphysical and regulative structures that were common in pre-modern Europe and most prominently in Traditional Chinese Medicine. Attention to these points may help us understand “personalized medicine” and some philosophical and moral problems it involves. In the past (and still today), the poor availed themselves of “one drug fit all”, buying remedies for problems from cheap providers. The rich consulted physicians who would write prescriptions for personalized mixtures of generic medicines. The very complex art of creating personalized concoctions renders it difficult to conduct clinical trials evaluating the effects of traditional Chinese herbology. It took a different paradigm of health and pharmacology to facilitate the development of “drugs that fit diseases” (rather than clinicians treat persons), and then test them in clinical trials. The establishment of the Royal College of Physicians in 1518 England, marked the beginning of separation of physicians from apothecaries. During the centuries, it became illegal for physicians to sell drugs, especially medicine they personally develop and concoct. With the advent of P4, the problem of conflict of interest and of physicians’ economic stakes in “personalized” care rears its head back. Modern medicine relies on “big pharma” to develop drugs for the people. The economy of P4 is more dispersed, where numerous small “startup” companies vie for investment. The “Big Pharma” develop many drugs in parallel, while the new “startup”
Load more

Recommended publications
  • Numerical and Structural Chromosome Aberrations in Cauliflower (Brassica Oleracea Var
    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana Xianwen Ji Thesis committee Promotor Prof. Dr J.H.S.G.M. de Jong Personal chair at the Laboratory of Genetics Wageningen University Co-promotor Dr E. Wijnker Researcher at the University of Hamburg, Germany Other members Prof. Dr G.C. Angenent, Wageningen University Dr G.F. Sanchez Perez, Wageningen University Dr A.B. Bonnema, Wageningen University Dr K. van Dun, Rijk Zwaan Breeding Company, Fijnaart, the Netherlands This research was conducted under the auspices of the Graduate School of Experimental Plant Sciences Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana Xianwen Ji Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 5 December 2014 at 1.30 p.m. in the Aula Xianwen Ji Numerical and structural chromosome aberrations in cauliflower Brassica( oleracea var. botrytis) and Arabidopsis thaliana 137 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in English, Dutch and Chinese ISBN 978-94-6257-160-0 Contents Chapter 1 General Introduction 7 Chapter 2 FISH painting with repetitive DNA sequences for chromosome identification in aneuploid cauliflower (Brassica oleracea L. var. botrytis) 29 Chapter 3 Cross-species chromosome painting with Arabidopsis BACs on cauliflower (Brassica oleracea L. var. botrytis for karyotype analysis and chromosome identification 47 Chapter 4 Meiotic aberrations leading to aneuploidy in Cauliflower (Brassica oleracea L.
    [Show full text]
  • Genome-Wide Detection of Chromosomal Rearrangements, Indels, and Mutations in Circular Chromosomes by Short Read Sequencing
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Method Genome-wide detection of chromosomal rearrangements, indels, and mutations in circular chromosomes by short read sequencing Ole Skovgaard,1,3 Mads Bak,2 Anders Løbner-Olesen,1 and Niels Tommerup2 1Department of Science, Systems and Models, Roskilde University, DK-4000 Roskilde, Denmark; 2Wilhelm Johannsen Centre for Functional Genome Research, Department of Cellular and Molecular Medicine, University of Copenhagen, DK-2200 Copenhagen, Denmark Whole-genome sequencing (WGS) with new short-read sequencing technologies has recently been applied for genome- wide identification of mutations. Genomic rearrangements have, however, often remained undetected by WGS, and additional analyses are required for their detection. Here, we have applied a combination of WGS and genome copy number analysis, for the identification of mutations that suppress the growth deficiency imposed by excessive initiations from the Escherichia coli origin of replication, oriC. The E. coli chromosome, like the majority of bacterial chromosomes, is circular, and DNA replication is initiated by assembling two replication complexes at the origin, oriC. These complexes then replicate the chromosome bidirectionally toward the terminus, ter. In a population of growing cells, this results in a copy number gradient, so that origin-proximal sequences are more frequent than origin-distal sequences. Major rearrangements in the chromosome are, therefore, readily identified by changes in copy number, i.e., certain sequences become over- or under-represented. Of the eight mutations analyzed in detail here, six were found to affect a single gene only, one was a large chromosomal inversion, and one was a large chromosomal duplication.
    [Show full text]
  • Chromosome Structure & Recombination
    Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy • Genetic variation refers to differences between members of the same species or those of different species – Allelic variations are due to mutations in particular genes – Chromosomal aberrations are substantial changes in chromosome structure • These typically affect more than one gene • They are also called chromosomal mutations 1 • The banding pattern is useful in several ways: – 1. It distinguishes Individual chromosomes from each other – 2. It detects changes in chromosome structure – 3. It reveals evolutionary relationships among the chromosomes of closely-related species Structural Mutations of Chromosomes • Deficiency (or deletion) – The loss of a chromosomal segment • Duplication – The repetition of a chromosomal segment compared to the normal parent chromosome • Inversion – A change in the direction of the genetic material along a single chromosome • Translocation – A segment of one chromosome becomes attached to a different chromosome – Simple translocations • One way transfer – Reciprocal translocations • Two way transfer 2 Deficiencies • A chromosomal deficiency occurs when a chromosome breaks and a fragment is lost Figure 8.3 • Chromosomal deletions can be detected by a variety of experimental techniques – Cytological, Molecular (probes) & Genetic analysis Genetic • Deletions can be revealed by a phenomenon known as pseudodominance – One copy of a gene is deleted – So the recessive allele on the other chromosome is now
    [Show full text]
  • Why Should Mitochondria Define Species?
    HUMAN EVOLUTION Vol. 33 - n. 1-2 (1-30) - 2018 Stoeckle M.Y. Why should mitochondria define species? Program for the Human Environment The Rockefeller University 1230 York AVE More than a decade of DNA barcoding encompassing New York, NY 10065 about five million specimens covering 100,000 animal USA species supports the generalization that mitochondrial Email: [email protected] DNA clusters largely overlap with species as defined by domain experts. Most barcode clustering reflects synony- Thaler D.S. mous substitutions. What evolutionary mechanisms ac- Biozentrum, University of Basel count for synonymous clusters being largely coincident Klingelbergstrasse 50/70 with species? The answer depends on whether variants CH - 4056 Basel Switzerland are phenotypically neutral. To the degree that variants are Email: [email protected] selectable, purifying selection limits variation within spe- [email protected] cies and neighboring species may have distinct adaptive peaks. Phenotypically neutral variants are only subject to demographic processes—drift, lineage sorting, genetic DOI: 10.14673/HE2018121037 hitchhiking, and bottlenecks. The evolution of modern humans has been studied from several disciplines with detail unique among animal species. Mitochondrial bar- codes provide a commensurable way to compare modern humans to other animal species. Barcode variation in the modern human population is quantitatively similar to that within other animal species. Several convergent lines of evidence show that mitochondrial diversity in modern humans follows from sequence uniformity followed by the accumulation of largely neutral diversity during a population expansion that began approximately 100,000 years ago. A straightforward hypothesis is that the extant populations of almost all animal species have arrived at KEY WORDS: Species evolution, a similar result consequent to a similar process of expan- mitocondrial evolution, speciation, sion from mitochondrial uniformity within the last one to human evolution.
    [Show full text]
  • Dghtm Imaging Products
    dGH TM Imaging Products TRANSFORMATIONAL CHROMOSOME IMAGING TOOLS KromaTiD Directional Genomic Hybridization™ (dGH™) imaging technology forms the platform for a wide range of reagents, kits and services that enable the discovery, detection and diagnosis of genetic mutations and diagnostic targets. The KromaTiD dGH platform is the only technology capable of detecting cryptic inversions - an important class of disease causing mutations. Unlike other chromosome imaging technologies and whole genome approaches, dGH generates gene sequence, Internal Control Inversion location and orientation data in a single rapid assay. dGH Inversion Detection FLEXIBLE, HIGH-PERFORMANCE CHROMOSOME ASSAYS The foundation of the dGH platform is a library of proprietary short, synthetic, single- stranded DNA probes. Together with unique and optimized assay methods, the dGH platform provides researchers with: 10 kb Targets The Broadest Assay Range: In a single assay, KromaTiD products detect the broadest possible spectrum of chromosome rearrangements, including those assayable by standard FISH technologies (e.g. translocations between chromosomes) as well as intra-chromosomal rearrangements such as cryptic inversions. The KromaTiD platform enables orders of magnitude higher-resolution inversion detection than any competing technique. Chromosome and Chromatid Assay Formats: Using the same probes in different test Pinpoint FISH using dGH Probes conditions, KromaTiD assays are capable of targeting entire chromosomes (double- stranded applications like FISH) or individual chromatids (single-stranded applications) in interphase or metaphase cells. Visual Orientation Data: When used on metaphase chromosomes, dGH is the only imaging technology capable of providing sequence, location and orientation information in a single assay. Unique Specificity:Probes are designed to target unique genomic sequences, so KromaTiD assays require no blocking DNA (COT), exhibit no non-specific background, and demonstrate improved hybridization performance.
    [Show full text]
  • 737155V1.Full.Pdf
    bioRxiv preprint doi: https://doi.org/10.1101/737155; this version posted August 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Ancestral reconstruction of sunflower karyotypes reveals dramatic chromosomal evolution Kate L. Ostevik1,2, Kieran Samuk1, and Loren H. Rieseberg2 1. Department of Biology, Duke University, Durham, NC, 27701 2. Department of Botany, University of British Columbia, Vancouver, BC, Canada, V6T 1Z4 Correspondence to: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/737155; this version posted August 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Abstract 2 3 Mapping the chromosomal rearrangements between species can inform our understanding of genome 4 evolution, reproductive isolation, and speciation. Here we present a systematic survey of chromosomal 5 rearrangements in the annual sunflowers, which is a group known for extreme karyotypic diversity. We 6 build high-density genetic maps for two subspecies of the prairie sunflower, Helianthus petiolaris ssp. 7 petiolaris and H. petiolaris ssp. fallax. Using a novel algorithm implemented in the accompanying R 8 package syntR, we identify blocks of synteny between these two subspecies and previously published 9 high-density genetic maps. We reconstruct ancestral karyotypes for annual sunflowers using those 10 synteny blocks and conservatively estimate that there have been 9.7 chromosomal rearrangements 11 per million years – a high rate of chromosomal evolution.
    [Show full text]
  • Chromosomal Inversion Patterning and Population Differentiation in A
    Proc. Nati. Acad. Sci. USA Vol. 86, pp. 4798-4802, June 1989 Population Biology Chromosomal inversion patterning and population differentiation in a young insular species, Drosophila silvestris (genetic polymorphism/hierarchical F statistics/Hawaiian Drosophila evolution/microgeographic variation) ELYSSE M. CRADDOCK* AND HAMPTON L. CARSONt *Division of Natural Sciences, State University of New York, Purchase, NY 10577; and tDepartment of Genetics, University of Hawaii, Honolulu, HI 96822 Contributed by Hampton L. Carson, March 31, 1989 ABSTRACT The recently evolved Hawaiian species Dro- genes into balanced coadapted complexes via such chromo- sophila silvestris has a subdivided population structure and somal arrangements may permit the evolution of genetic shows great spatial heterogeneity in chromosome inversion interaction systems and an enhancement of overall fitness. distributions and frequencies within its extremely limited geo- Such a process can be presumed to have taken place in D. graphic range. Pattern analysis of the 11 chromosomal poly- silvestris as each successive new inversion arose and became morphisms in the context of the recently discovered morpho- incorporated into a local population. logical and behavioral divergence within the species has eluci- Within the island, D. silvestris has been subdivided into dated the history of the chromosomal differentiation. We two regionally disjunct sets of populations that show behav- identify four chronological groups of inversions and their ioral and morphological differences (8). To the west and probable sites of origin. Spread of the derived "3-row" bristle south ("Kona side"), the populations give evidence of being morphotype on the Hilo side of the Island of Hawaii has been phylogenetically older than those of the "Hilo side" to the accompanied by the acquisition of six new inversion polymor- north and east (7, 9).
    [Show full text]
  • 2La Paracentric Chromosomal Inversion and Overexpressed
    biology Article 2La Paracentric Chromosomal Inversion and Overexpressed Metabolic Genes Enhance Thermotolerance and Pyrethroid Resistance in the Major Malaria Vector Anopheles gambiae Sulaiman S. Ibrahim 1,2,* , Muhammad M. Mukhtar 2 , Abdullahi Muhammad 1 and Charles S. Wondji 1 1 Vector Biology Department, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK; [email protected] (A.M.); [email protected] (C.S.W.) 2 Department of Biochemistry, Bayero University, PMB 3011, Kano 700241, Nigeria; [email protected] * Correspondence: [email protected]; Tel.: +44-74-4044-3871 Simple Summary: While shifts in temperature may promote the spread of insects, exacerbating the intensity of vector-borne diseases like malaria, very high temperatures exert deleterious effects in insect vectors, forcing them to evolve/adapt genetically. These genetic adaptations may facilitate insecticide resistance through common genes involved in both processes. Here, the impact of thermal tolerance on pyrethroid resistance in the major malaria vector Anopheles gambiae s.l. from four locali- ties spanning the savanna and sub-Sahel of northern Nigeria was investigated. In all four localities, An. coluzzii and An. gambiae s.s. were the only malaria vectors found. The populations were highly thermotolerant, with ~50% of mosquitoes in two sites surviving 44 ◦C. Thermotolerant larvae and Citation: Ibrahim, S.S.; Mukhtar, adult mosquitoes (survivors of 44 ◦C) were significantly more resistant to permethrin, suggesting M.M.; Muhammad, A.; Wondji, C.S. that prior heat-hardening facilitates insecticide resistance. Thermal tolerance and permethrin resis- 2La Paracentric Chromosomal tance were found to be associated with the 2La rearrangement (a form of chromosomal inversion).
    [Show full text]
  • Comparative Linkage Maps Suggest That Fission, Not Polyploidy
    Heredity (2014) 112, 562–568 & 2014 Macmillan Publishers Limited All rights reserved 0018-067X/14 www.nature.com/hdy ORIGINAL ARTICLE Comparative linkage maps suggest that fission, not polyploidy, underlies near-doubling of chromosome number within monkeyflowers (Mimulus; Phrymaceae) L Fishman1, JH Willis2,CAWu2,3 and Y-W Lee2,4 Changes in chromosome number and structure are important contributors to adaptation, speciation and macroevolution. In flowering plants, polyploidy and subsequent reductions in chromosome number by fusion are major sources of chromosomal evolution, but chromosome number increase by fission has been relatively unexplored. Here, we use comparative linkage mapping with gene-based markers to reconstruct chromosomal synteny within the model flowering plant genus Mimulus (monkeyflowers). Two sections of the genus with haploid numbers X14 have been inferred to be relatively recent polyploids because they are phylogenetically nested within numerous taxa with low base numbers (n ¼ 8–10). We combined multiple data sets to build integrated genetic maps of the M. guttatus species complex (section Simiolus, n ¼ 14) and the M. lewisii group (section Erythranthe; n ¼ 8), and then aligned the two integrated maps using 4100 shared markers. We observed strong segmental synteny between M. lewisii and M. guttatus maps, with essentially 1-to-1 correspondence across each of 16 chromosomal blocks. Assuming that the M. lewisii (and widespread) base number of 8 is ancestral, reconstruction of 14 M. guttatus chromosomes requires at least eight fission events (likely shared by Simiolus and sister section Paradanthus (n ¼ 16)), plus two fusion events. This apparent burst of fission in the yellow monkeyflower lineages raises new questions about mechanisms and consequences of chromosomal fission in plants.
    [Show full text]
  • Spontaneous Inversion Heterozygote in Haworthia Limifolia
    © 2015 The Japan Mendel Society Cytologia 80(4): 415–418 Spontaneous Inversion Heterozygote in Haworthia limifolia Ramesh Ahirwar*, Pratibha Shrivastava and Rakesh Chandra Verma School of Studies in Botany, Vikram University, Ujjain (M.P.) 456010, India Received December 28, 2014; accepted June 25, 2015 Summary A population of cultivated Haworthia limifolia displayed various types of chromosomal configurations at anaphase/telophase-I and -II due to inversion heterozygosity. It was characterized by the presence of bridge and fragment because of various numbers and positions of crossovers in the inversion loop. The heterozygous condition led to reduced pollen fertility. Key words Haworthia limifolia, Inversion heterozygote, Chromosomal configuration, Pollen fertility. Haworthia is a genus of the tribe Aloineae in the family Liliaceae (Brandham 1974). There are about 60 species native to Southern Africa (Bayer and Manning 2012). Haworthia limifolia is one of the most important ornament plant species. It is a xerophytic, succulent, perennial herb with fleshy leaves arising in a rosette from a short stem. The chromosome number is (2n=28) and 16 chromosomes are long and 12 small. There have been very few studies on spontaneous mutants in Aloineae (Brandham 1975, 1977a, b). In the present investigation an inversion heterozygote was found from a cultivated population which was confirmed on the basis of the presence of bridge and fragment at anaphase-I/-II. Materials and methods Twenty clones of Haworthia limifolia were collected from Malwa Nursery, Ujjain and planted in pots. For meiotic studies, young flower buds of appropriate size were collected and fixed in Carnoy’s fluid. Anthers were separated, teased in a drop of 2% iron acetocarmine on a clean slide and squashed under a cover glass.
    [Show full text]
  • REVIEW OPMENT Vol
    ISSN: 0972-7566 Vol. 23 | No. 1 | March 2021 BIOTECHNOLOGY ASIAN AND DEVELOPMENT REVIEW Special Issue on CRISPR and Genome Editing: Impacts and Implications Editorial Introduction Human Heritable Genome Editing – Potential and Current Status for Clinical Use Navneesh Yadav and B. K. Thelma Model Legislation and the Transnational Governance of Human Heritable Gene Editing Andrea Boggio Gene Editing –Ethical Pathways to Connect Science & Society Roli Mathur From Genome Editing to Battling a Pandemic: The Rise of CRISPR Poorti Kathpalia and Debojyoti Chakraborty Perspective Asian Biotechnology and Development Review Editorial Board Editor Sachin Chaturvedi Director General, RIS Managing Editor K. Ravi Srinivas Consultant, RIS Assistant Editor Amit Kumar Assistant Professor, RIS International Editorial Advisory Board Aggrey Ambali Head of Science, Technology and Innovation Hub (NSTIH), NEPAD Nares Damrogchai Chief Executive Officer, Genepeutic Bio, Bangkok Vibha Dhawan Director General, TERI, New Delhi Reynaldo V. Ebora Executive Director, Philippine Council for Advanced Science and Technology Research and Development (PCASTRD), The Philippines Jikun Huang Professor and Director, Centre for Chinese Agricultural Policy (CCAP), China Dongsoon Lim Dong-EUI University, College of Commerce and Economics, South Korea William G. Padolina President, National Academy of Science and Technology, Philippines Balakrishna Pisupati United Nations Environment Programme (UNEP), Nairobi, Kenya Bambang Purwantara Director, Southeast Asian Regional Centre for
    [Show full text]
  • Eighteenth Edition Rams - March 2021
    AATCGCCCAAGACAACATGGGGTTGCAGGTGTAAATCGATAAAAGAAG GGTAGGTATCGTTCACGGGGCACACTACTAGCGGGGCTTAGATAGCAA CTAGGGGTTCTTCACGCAEIGHTEENTHGCGCAAGA EDITIONCACATG -C MARCHGCTA T2021AAATGCTAGAT AACTGACATTATACTTATCAATGGGGAATAGGTCAGATAGATGGCACCA CATCGCACACTTATAGGCACGTCACCTGAGCCGACTCGAAATCCGCTTA TACTGCGACAAAATCATCCGCTCGGTTGATCTAGGATCGGGACTATATC CAGCGCRISPRCCCTAGCTCATTCTCAGAGGGAGCGACGAATGCTCAGC GAGGAGTTGTTCTGACCCGTGACGGAGTACTCTTTACTATCAAGTATAG CCAGTCTTGCCCCGATCGCTATACATTATTTGATGCCCCCCRISPRATAGC CGCAGTCATTCGACAGATTAGGCCCACCACCACCTCCCCTTGAGATTGG TATCRISPRCGCAACTGTAAGCAACATTACGGAAGGGCTACTCTAGATTG AACTCGCGTACAAGGTTTACCAAAGTGCATAAATCGACGGCCCCTCACG GCGGCCGTTAGCGCTCTAGAACCGAAACTAAGHACTACRISPRAACGCC GAAGACCCACGCCAATACAGTTCCGCGCCACGGAGGTAACTTACATGC CGCTCCCCGCRISPRGTTTACGGGTCATGCCTACCCCTCGGCATTCATGG GACTCAAACCTATCCCCGCAGCCGGAGCTTAAGAAAGAGCTAACACTTA GTTCGCATTCAAAATCGGTAAATTAATTAACATGCCGCAACGCGTCTATA AATGCCRISPRGTTCACCAACGTCCCGAGTTTTAACCTAGAAGCATATGTG CTGACCGTTAGCATGGAACTGCGTAACCTGACGGTCRISPRGTTCATCAC CTCGCGATCTCGTCAACTTGGCCATCGCCATCTGGTGGACCCCGGAATC AAAGCTGCTGACTAGAGGCGTTGAATCGCCCAAGACAACATGGCRISPR TTGCAGGTGTAAATCGATAAAAGAAGGGGTAGGTATCGTTCACGGGGC CATAGCCRISPRGGGGCTTAGATAGCAAACTAGGGGTTCTTCACGCAGC Interview: facing sex bias in biomedical research CAAGACACATGCGCTATAAATGCTAGATCAACTGACATTATACTTATCAA GGGGAZebrasATA ofG Medicine:GTCAG whenATA GthrombocytesATGGCA areCC scarceACCATCGCACACTTATAGGCAC TCACCOurTG futureAGC CwithGA CRISPR:CTCG a AbraveAAT newCC world?GCTTAGTACTGCGACAAAATCATCCG TCGGTCRISPR/Cas9TGATCTA geneGG editingATCG asG aG cancerACT therapyATATCGCAGCGCCCTAGCTCATTCTC
    [Show full text]