Interactions between bioenergetics and cytochrome c oxidase levels in

striated muscles

Scot C. Leary

A thesis subrnitted to the Department of Biology in conforrnity with the requirements for

the degree ofDoctor of Philosophy

Queen's University

Kingston, Ontario, Canada

September, 200 1

Copyright O Scot C. Leary, 2001 National Libiary Bibliothégue nationale 1*1 oi Canada du Canada Acquisitions and Acquisitions et Bibliographie Services seivices bibliographiques 395 Wellington Street 395, rue Wellington CMwa ON KIA ON4 ôttawa ON KIA ON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive pennettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, disûiiute or seil reproduire, prêter, distri'buer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la fome de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be priuted or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission, autorisation. Abstract

Physiologicai stimuli that cause chronic bioenergetic deficits fiequently lead to aitered rnitochondriai content. Although the primary effector that regulates changes in mitochondriai content remains equivocal, an increasing body of evidence suggests that bioenergeticaily-driven alterations in mitochondrial reactive oxygen species (ROS) production contribute to the modulation of such adaptive processes. This thesis examined the potential interactions between bioenergetics and changes in cytochrome c oxidase

(COX) content in striated muscle models.

The importance of altered energy demand in regulating changes in COX content was initially considered as a hnction of myogenesis. Although there was a pronounced shift in the relative importance of aerobic and glycolytic metabolism, metabolic rate did not increase rnarkedly during rnyogenesis. Related experiments were designed to chronically inhibit a small fraction of total COX activity in fiilly differentiated myocytes.

Cells were treated with sodium aïide at levels that would be expected to acutely inhibit only 2-5% of COX activity. Surprisingly, this treatment caused profound, irreversible

losses in COX activity by a previously unknown mechanism. Subsequent studies reveaied

that aide effects were not dependent upon changes in bulk phase ROS production,

copper chelation, reduced rates ofmitochondrial protein synthesis or a decline in the

steady-state mRNA or protein levels of individual COX subunits (COX 1, II, IV). in

contrast, the decline in cataiytic activity was accompmied by a Iesser reduction in heme

a% and holoenzyme contents. This suggested that &de exerts its effects on COX by

promoting either holoenzyme dissociation or degradation. The potential pathophysioIogica1 mechanïsmsof COX losses were subsequently addressed in spontaneously hypertensive rats (SHR) as a function of hypertension and aggressive anti-hypertensive treatment (ie. dmg + low salt). Specific activities of two mitochondrial enzymes, COX and citrate synthase (CS), were highly preserved, not ody throughout the age-dependent development of hypertension, but also in response to enaiapril-mediated ventricular regression. Although deciines in mitochondrial enzyme content paralleied the reductions in ventricular rnass, total ventricular mtDNA content was unaffected by enalapril treatrnent. Altered enzymic content occurred without significant changes in mRNA and protein levels of relevant gene products. Enaiapril-

mediated ventricular and mitochondrial remodeiling was accompanied by 2-fold

increases in the specific activity of catalase, a sensitive indicator of oxidative stress. This

suggests that rapid phases of cardiac adaptation are accompanied not only by the tight

regulation of mitochondri ai enzyme activities but also by increased ROS production,

Collectively, these studies contribute to our general understanding of mechanisms

by which COX content of striated muscles is aftered in response to bioenergetic

perturbation. Characterization of the azide-induced model of COX deficiency also has

profound implications for diagnostic approaches to assessing the moiecular bais of

COX-specific lesions in cardiovascular and neurodegenerative diseases. With the exception of the General Discussion, all chapters are CO-authoredwith

Dr. C.D. Moyes. "Interactions between bioenergetics and mitochondrial biogenesis during mogenesis" (Chapter 2) is CO-authoredwith B.J. Battersby [mtDNA measurements] and Dr. R.G. Hansford [CDM post-doctoral supervisor, NM, Bethesda,

MD]. "Chronic treatrnent with aide in sitri leads to an irreversible loss of cytochrome c oxidase activity via holoenzyme dissociation" (Chapter 3) is a collaborative study that is

CO-authoredby several individuals from four labs; C.N. Lyons [fluorescence microscopy] and C. Kraft [protein synthesis studies] (SV.Dr. C.D. Moyes), C.G. Carlson [RP-HPLC]

(SV.Dr. D.M. Glenim), and Drs. B.C. Hill [spectroscopy] and K. Ko [SDS-PAGE irnmunoblotting]. "Bioenergetic remodelling during treatment of spontaneously hypertensive rats with the ACE-inhibitor enalaprilo' (Chapter 4) is also a collaborative study between our lab (C.N. Lyons, D. Michaud [mtDNA and RNA analyses]) and that of

Dr. M.A. Adams (T.M.Hale, T.L BusMeid [treatment of animals, tissue harvesting]). Acknowledgements

In the midst of a conversation with a peer one day, the journey through a doctoral thesis was described as a rite of passage. 1 feel that this highly appropriate moniker best descnies the sum total of my experience.

I am indebted to past (B.]. Battersby, M. Sharma) and present (C.N. Lyons. C.

Kr&) graduate students and lab technicians @. Michaud, N. Fragoso). From them I have received countless hours of technical, intellectual and emotional support. I am particularly gratefiil to B.J. Battersby, whose technical advice has remained constant despite his departure fiiom the lab. I would also like to acknowledge Drs. W. Bendena and

W. Snedden for their willingness to consistently impart technical expertise that ultimately facilitated the progression olmy studies. My committee mernbers have also been very helpful, particularly Drs. K. Ko and B.C. Hill who patiently taught me the basic

principles of irnmunoblotting and spectroscopy respectively.

I am most grateful in an academic sense, however, to my mentors Drs. J.F.

Leatherland, J.S. Ballantyne and CD.Moyes (in chronological order). Special thanks to

John and Jim for faciiitating my introduction to the empirical and technical elements of

science, and valuing my input despite my junior stage of development. An additional,

even larger debt of gratitude is owed to Chris who is largely responsible for mouIding a

Young, impulsive scientist into a more thorough, broadminded investigator. While we

have occasionaüy engaged in intense exchange of rhetoric, we have never strayed very

far from a common set of goals.

Last but certainiy not least are those individuals who have supported me either

before or throughout my doctoral studies in both academic and non-academic ways. Without Mom, Dad and Tara I probably would never have developed the drive, cunosity and passion that are integral to scientific investigation. Thanks also go out to my peers

(B. Wu, J. Bedard, J. Dawson) for listening to my fnistrations and helping me through them.

Perhaps the greatest joy of al1 during rny journey has been meeting my partner,

Kate Thompson. Lf 1 had to waik away from science today, 1 would still have sornething from the past five years to be incredibIy thruikfiil for. Table of Contents .. Ab stract ...... ii Co-authorship ...... ~...... iv Acknowledgements ...... ~.~.~...~~...... ~...... ~.~.~..~.....~..~...... ~.....~~...~~~.~v...... Table of Contents ...... vli List of Tables ...... x List of Figures ...... xi.. List of Abbreviations ...... XII Chapter 1. Ceneml Introduction ...... 1 INTERPLAY BETWEEN MITOCHONûW STRUCTüRE AND FIiNCTtON..... I MITOCHONDRIAL BIOGENESIS REQUiRES COORDlNATEû GENE EXPRESSION...... ,7 WHAT IS THE TRIGGER FOR MITOCHONDRIAL BIOGENESIS DüRiNG PHYSIOLOGlCAL ADAPTATION?...... 3 tNTERACTIONS BETWEEN ENERGY METABOLISM AND MITOCHONDRIAL BEOGENESIS ...... 5 Oxygen ...... 5 Nucleotides and phosphate...... 7 Calcium ...... 11 Reducing quivalents ...... ~...... 12 Carbon substrates...... 13 GENERAL EFFECTORS OF METABOLIC RATE ...... 15 REDOX-MEDIATED CHANGES CN MIT0CHOM)RIAL BIOGENESIS ...... 16 Intracellular redox balance ...... 18 REDOX REGULATION OF GENE EXPRESSION...... 21 NF-@ and AP- 1...... 22 NRFs and other respiratory Qenetranscription factors ...... 25 COX AS A MODEL OF MITOCHONDRIAL CONTENT ...... 26 THESIS OVERVIEW ...... 27 REFERENCES ...... 28 Chapter 2. Interactions between bioenergetics and mitochondrial biogenesis ...... 65 ABSTRACT ...... 65 .... INTRODUCTION ...... ,...... 66 MATERIALS AND METHODS ...... 68 Ceil culture ...... 68 Enzyme assays ...... 68 Metabolic rate determinations ...... 69 Metabolite assays ...... 70 Mitochondrial mRNA and mtDNA ...... 70 Statistical analysis ...... 71 RESULTS ...... 71 Changes in metabolic rate with difkntiation ...... 71 Changes in pyruvate dehydrogenase ...... ~...~...~...... ~~~...... ~...~....72 Azide effects on rnitochondrial parameters and bioenergetics ...... 72 DISCUSSION ...... 73 Mitochondrial energetics in proliferating cells ...... 73 Mitochondrial energetics dunng myogenesis ...... 74 Azide effects on mitochondrial energetics and gene expression...... 76 ACKNOWLEDGEMENTS ...... 78 LITERATURE CITED ...... 78 Chapter 3. Chronic treatment with azide in situ leads to an irreversible loss of cytochrome c oxidase activity via holoenzyme dissociation ...... 93 SUMMARY ...... ,...... -93 INTRODUCTION...... 94 EXPERIMENTAL PROCEDURES ...... 96 CeIl culture ...... 96 Enzyme assays, metabolite analyses and respiration measurements...... 96 Fluorescence microscopy ...... 98 Electrophoresis and immunoblotting ...... 99 Spectral and heme analyses...... ,...... 100 RNA isolation and northem analysis ...... 101 Pulse-chase labelling experiments ...... ,.....,...... 102 Statistical analyses ...... 102 RESüLTS ...... 102 Chronic aide treatment results in an irreversible loss oîCOX activity, a concomitant decline in whole cell respiration, and a resultant bioenergetic stress . 102 Chronic azide effects on mitochondrial enzymes are specific to COX and do not require a hnctionally intact respiratory chah ...... 104 Chronic azide effects on COX activity are independent of changes in butk phase ROS production ...... 104 Chronic aide treatment does not affect the levels of mitochondnaily- and nuclear- encoded COX rnRNAs and proteins ...... ,...... ,...... 106 Azide-rnediated loss of COX activity is accompanied by a lesser decline in heme aa3 levels that is reflective of reduced hoioenzyme content ...... 107 Chronic aide effects on COX do not involve copper chelation...... 108 DlSCUSSION ...... IO8 ACKNOWLEDGEMENTS ...... 112 REFERENCES ...... 112 Chapter 4 .Bioenergetic remodelling during treatment of spontaneously hypertensive rats with the ACE-inhibitor enalapril ...... 132 AB STRACT ...... 132 INTRODUCTION ...... 133 MATERIALS AND METHODS ...... 136 Animais ...... 136 Dmg Treatment...... 136 Tissue Excision ...... 137 Enzyme assays and metabolite analyses ...... 137 Quantitative-competitive poiymerase chain reaction (QC-PCR) ...... 138 Immunoblotting and protein analyses...... 139 RNA isolation, northern analysis and CDNAconstructs ...... 140 Statisticai analyses ...... 141 RESULTS ...... 14 1 Chronic treatment with enalapril results in a significant temporal regression in left ventricular (LV)mass ...... 141 Enalapril treatment mediates. . pardel changes in LV mass and the levels of bioenergetic and antioxidant enzymes ...... 142 Enalapd treatment mediates significant uicreases in mtDNA copy number without affecting either the steady-state RNA or protein levels of relevant gene products . 143 Enalapril-mediated mitochondrial regression occurs without changes in the steady- state levels of gene products involved in mtDNA expression, reticulum maintenance, and mitochondriai protein degradation ...... t44 DISCUSSION ...... 145 Mitochondrial changes during hypertrophy and regression ...... 145 ROS and respiratory gene expression and cardiac hypertrophy ...... 146 Mitochondrial losses during ventricular regression ...... 147 MtDNA and mitochondrial gene expression ...... 148 SUMMARY AM) PERSPECTIVES...... ,,, ...... 149 LITERATURE CITED ...... 150 Chapter 5. General Discussion ...... 176 SUMMARY AND PERSPECTTVES ...... 180 REFERENCES ...... 182 CURRICULUM VITAE ...... ,., ...... 187 List of Tables

Table 1.1: A summary of redox-regulated transcription factors, target genes, sequence recognition sites and stimuli known to modulate theu expression and/or activation...... 57 Table 1.2: Metabolic intermediates and components of the ETC that are found within the mitochondria both as oxidized and reduced forms...... 58 Table 3.1: Azide and cyanide effects on enzyme activity. C2C 12 and Sol 8 ceils were differentiated for 6 days under serum-starved conditions, prior to a 24h treatment with the agents listed below. Enzymes were assayed at 37°C as outlined in LI Experimental Procedures"...... 1 18 Table 3.2: Ande and oligomycin effkts on enzyme açtivity. C2C 12 cells were differentiated for 6 days under senim-starved conditions, prior to a 24h treatment with the agents listed below. Enzymes were assayed at 37'C as outlined in CL Experimental Procedures"...... 119 Table 4.1 : Primer sequence, annealing temperature and RT-template source designed for ampliQing nuclear DNA gene products...... 162 TabIe 4.2: Enzyme activity ratios fiom the endo- and epicardium of the septum and left ventride of control and enalapril-treated SHR [n=5; 5p<~.05)...... 163 List of Figures

Figure 1.1: Organization of Complexes 1-V within the inner mitochondrial membrane. -59 Figure 1.2: Cellular pathways for the generation and interconversion of fiee radicals. ... 61 Figure 1.3 : Interactions between endogenous antioxidants, ...... 63 Figure 2.1 : Changes in energy metabolism during differentiation of C2C12 cells...... 8 1 Figure 2.2: Effects of acute and chronic azide treatments on C2C12 myoblasts and myotubes...... -...~...-...... -...... -....-....-....-...-..-83 Figure 2.3: Effects of &de concentration on C2C12 enzymes and bioenergetic parameters...... -.-....-..-...... -.. ...-. ...-...... -...-.. 85 Figure 2.4: Changes in mtDNA and mRNA in relation to azide treatrnent ...... 87 Figure 2.5: Representative autoradiographs of mRNA levels in C2C12 cells treated 3 days with azide...... -...... -...... -...... -....*....--~..--....--.-89 Figure 2.6: Levels of mRNA in C2C12 cells treated with azide. .,...... ~...... - -...... 91 Figure 3.1: Chronic treatment of cultured cells with mide results in loss of COX activity, bioenergetic deficit and altered cellular capacity for ROS metabolism...... 120 Figure 3 -2: Azide effects on COX activity are not dependent on dtered bulk phase ROS production...... 122 Figure 3.3 : Azide effects on catalytic activity do not involve reduced steady-state mRNA or protein levels of individual COX subunits, ...... -..--..-.-....-.-...... 124 Figure 3.4: Azide effects on COX content are not mediated by inhibition of mitochondriai protein synthesis...... 126 Figure 3.5: Loss of catalytic activity is accompanied by a lesser decline in heme aa.~ content...... ,.,....--.....-..-.-..-.--...... -..-...... -.-..--.-.---..-.-+.-~.-~.-.-+.--~.----..-.~-~.--...-...... 128 Figure 3.6: Chronic mide treatment mediates the decline in catalytic activity through a loss of holoenzyme content that is independent of copper chelation, ...... -...... *. 130 Figure 4.1: Treatment profile of SHR rats...... - -.-...... -.... - ....-~.~~...... 164 Figure 4.2: Temporal changes in LV mass [g(LV+S)/BW] in control(4) and endapril- treated (If) SHR ...... 166 Figure 4.3 : Temporal changes in the activity per g LV of COX (A), CS (B) and LDH (C) in control (a) and enalapril-treated (a)SHR (inset panel: total LV enzyme activity). ..-~.-~~--...... -...-..~--.--~~~-.---..--.--~....~.~~.-...... 168 Figure 4.4: Temporal changes in the activity per g LV of catalase (A) and total cellular SOD (B) in control (+) and enalapril-treated (Ci) SHR (inset panel: total LV enzyme *. activity)...... - --... ---. -.. . ---. .. .- .- +. -.... ------..-- - ....-+. -..- .. -...... - ...... -- - - - .. - 170 Figure 4.5: Endapril-mediated changes in mtDNA copy number, RNA levels and content of mitochondrial proteins...... ,....~.~.~..~~------~~---~...... ~172 Figure 4.6: Enalapril-mediated changes in the levels of gene products involved in oxidant metaboiism, reticulum maintenance, mtDNA expression and mitochondrial protein degradation...... -...... ------....------.---.--.-.------.------.---.. - ~.-----....-~...... 174 List of Abbreviations

ACE - angiotensin-converting enzyme ADNT1 - adenine nucleotide translocase 1 ADP - adenosine 5'-diphosphate ALAS - 5-arninolevulinate synthase ANG LI - angiotensin U AP-1 - activator protein 1 ASMC - aortic smooth muscle cells ATP - adenosine 5'-diphosphate ATPB - ATP synthase subunit B BCS - bathocuproine disuifonic acid BHP - tert-butyl hydroperoxide BISTRIS - bis[Zhydroxyethyl]imino-tris[hydroxymethyl]rnethane CAMP - cyclic adenosine monophosphate cGMP - cyclic guanosine monophosphate COX - cytochrorne c oxidase CPK - creatine phosphokinase CPT 1 - carnitine palmitoyl transferase 1 Cr - creatine CRE - cyclic Aiiresponsive element CS - citrate synthase DCF-DA EDTA - ethylenediaminetetraaceticacid EPO - erythropoeitin ETC - electron transport chah FBS - feta1 bovine senim FCCP - carbonyl cyanide p-trifluoromethoxyphenyl-hydrazone FeS - iron-sulphur G6PDH - glucose-6-phosphate dehydrogenase GDP - guanosine 5'-diphospate GLUT l - glucose transporter 1 GPX - glutathione peroxidase GTP - guanosine 5-triphosphate Ha- hydrogen peroxide HIF-1 - hypoxia inducible factor 1 HRE - hypoxia responsive elernent HRP - horseradish peroxidase HS - home senirn Id3 - inhibitory subunit kappa beta P3- inositoi triphosphate KCN - potassium cyanide KPB - potassium phosphate buffer LDH - lactate dehydrogenase LM - lauryi mdtoside L-NAME - No-nitro-L-arginine methyl ester hydrochloride mRNA - messenger RNA MRP RNA - mitochondrial RNA processing RNA mtDNA - mitochondrial DNA mtRNA - mitochondcial RNA mtSSB - mitochondnal single-stranded binding protein mtTFA - mitochondrial transcription factor A NB-PAGE - native blue polyacrylamide electrophoresis nDNA - nuclear DNA NF-KB - nuclear factor kappa beta NO - nitric oxide NOS - nitnc oxide synthase NRFs - nuclear respiratory factors NTP - nucleotide triphosphate O-- - superoxide anion OH' - hydroxyi radical ONOO- - peroxynitrite OXPHOS - oxidative phosphorylation PBS - phosphate-buffered saline PCG- 1 - PPAR-y-coactivator 1 PCr - phosphocreatine PDH - pynivate dehydrogenase PEP - phosphoenolpyruvate PK - pyruvate kinase PKC - protein kinase C PPAR - peroxisome proliferator-activated receptors PPP - pentose phosphate pathway RNOS - reactive nitnc oxide species ROS - reactive oxygen species RP-HPLC - reverse-phase high performance liquid chromatography rRNA - ribosomal RNA SCFA - short-chah fatty acid SDS-PAGE - sodium dodecyl sulphate polyacrylamide electrophoresis SIN-1 - 3-morpholinosydnonimine SNAP - S-nitroso-N-acetylpenacillamine SOD - superoxide disrnutase TM - thiamphenicol TNFa - tumour necrosis factora TRX - thioredoxin USF2 - upstream stimulatory factor 2 VEGF - vascuiar endothehi growth factor XO - xanthine oxidase Chapter 1. General introduction'

CNTERPLAY BETWEEN MITOCBONDRIAL, STRUCTLJRE AND FUNCTION

Most of the ATP required by celis under aerobic conditions is generated via

oxidative phosphorylation (OXPHOS). The proteins of OXPHOS are embedded within

the inner mitochondrial membrane and are otiented to allow for eiectron transfer between

complexes and proton expulsion across the inner membrane (Fig. 1.1). The inner

mitochondrial membrane protein content approaches 80% due to the high concentrations

of OXPHOS complexes, as well as other transport proteins (e.g. adenine nudeotide

translocase). With limited ultrastructural space to augment protein density, increases in

maximal capacity for aerobic ATP production over both physiological and evolutionary

time generally require increases in cellular levets of total cristae surface area. In most

species, this is enhanced by increases in mitochondd volume density (cm3/cm3),with

surface area to volume ratios relatively constant at 20-40 m'/cm3 (Schwemann et ai.,

1986). However, cristae surface area per unit mitochondrial volume can approach 60-75

m'/cm3 in some high performance species (hummingbird: Suarez et al., 199 1; skipjack

tuna: Moyes et al., 1992; pronghorn antelope: Lindstedt et al., 199 1), suggesting that

intracellular space is ais0 occasionally Iimiting (Hochachka, 1987).

AIthough the mitochondrial population of a ceil is fiequentiy thought of as a

collection of separate organelles, electron micrographie reconstnictions, confocai and

fluorescent microscopy have shown mitochondria Eom many tissues, especially muscle,

to exist as a dynamic syncytium (Bakeeva et aL, 1978; Bereiter-Hahn et a[., L990). The

With the exception of the "COX as a marker of mitochondnal content" and Thesis overvierv' sections. the Generai huoduction nas taken hmS.C. Leaq and C.D. Mo- (2000) The effects of bioenergetic "mitochondrial content" of a tissue cannot, therefore, be considered to be the sum of the number of discrete, identical organelles. Mitochondrial content could arguably be expressed fiom an ultrastntctural (volume density, cristae surface density), biochemical

(enzyme levels or activity) or genetic (mtDNA copy nurnber) perspective.

MITOCüONDRiAL BIOGENESIS REQUIRES COORDLNATED GENE

EXPRESSION

Ultrastructural changes associated with physiological or evolutionary adaptations requin the combined contributions oPDNA replicatian, membrane and protein biosynthesis. Although relatively Meis known about the factors regdating mitochondriaI membrane synthesis, control of mitochondrial protein synthesis bas received considerable attention (see Attardi and Schatz, 1988; Hood et al., 1994; Poyton and McEwen, 1996). Synthesis of new mitochondna requires de novo synthesis of proteins with the appropriate stoichiometries. This is complicated by the fact that genes cnticaI to OXPHOS are Iocated in both the nuctear and mitochondrial genomes, whereas

Krebs cycle proteins, including succinate dehydrogenase, are entirely nuclear-encoded.

In addition to being located in two subcellular compartments, nuclear and mitochondrial genes are present at drasticaIly direrent copy numbers. For exampie, a cardiornyocyte may possess one pair of alleies encoding cytochrome c oxidase (COX)subunit i.V but

10,000 copies of the mtDNA-encoded COX subunit üi (see Van den Bogert et ai., 1993).

Mitochondrial biogenesis and mtDNA replication are thought to be under nudear controi (see Attardi and Schau, 1988; Poyton and McEwen, 1996)- Recent studies

addressing the mechanisrns responsible for coordinating the expression of respiratory

stress and redox balance on the e.upression oPgenes critical to mitochondrial fiinction. VoI. 1, Envininmenlai Stressars and Gene Responses (Eds. K.B. and S. Storey), Elsevier Science. p209-229.

2 genes and maintaining the stoichiornetnes of enzymes within rnitochondrial pathways have focused on specific families of transcription factors (see Scarpulla, 1997), and how these factors could give rise to evolutionary differences in mitochondrial content (Moyes et ai., 1998). However, the expanding role of a growing number of unrelated transcription factors (e.g. Sp 1, Connor et ai., 200 1: USF2, Breen and Jordan, 2000: ESF,

Luciakova et ai., 2000) in modulating respiratory gene expression rnakes it difficult to reconcile a rnechanism by which adaptive changes in mitochondrial content rnay rely upon shared sensitivity of respiratory genes to a small group of transcription factors.

Uncertainties about the overall regulation of respiratory gene expression are funher compounded by the fact that, with the exception of the wclear ~spiratoryfictors Ws)

(Wu et ai., 1999, Andersson and Scarpulla, 2001), rnechanisms that coordinate the activity of specific families of transcription factors remain equivocal. Moreover, the physiological trigger that activates any of these factors has yet to be established.

WHAT IS TEE TRiGGER FOR MIT0CBONDRiA.L BIOGENESIS DURiNG

PBYSIOLOGICAL ADAPTATION?

Mitochondnal proliferation accompanies a wide spectrum of physioiogicai chailenges (reviewed by Hood et al. 1994). Increases in skeletal muscle rnitochondriai content accompany chronic increases in contractile activity such as endurance exercise training (Freyssenet et al., 1996), shivering thermogenesis (Bourhim et al., 1990) and chronic electricai stimulation (Williams et al., 1987). A number of non-contractile challenges aiso alter mitochondriai content, including hyperthyroidism (Scarpulla et al.,

1986; Craig et al., 1998), hypoxia (Kwast and Hand, 1996) and ischemia/repe&sion

(Meno et ai,, 1984), cold exposure in horneotherms (Klingenspor et al., 1996) and cold acclimation in poikilotherms (see Guderley, 1990). Most of these conditions are accompanied by direct or indirect changes in metabolic rate (see Hood et al. 1994). [In the case of the mitochondrial biogenesis that accompanies myogenesis, there is no increase in metabolic rate although there is a shiîl in the relative importance of glycolytic and mitochondrial ATP production (Leary et al. 1998)]. in none of these examples, is the primary effector in the pathway established, but an attractive hypothesis is that bioenergetic disturbances themselves alter gene expression (Aprille 1988; Pette and

Dusterhofi, 1992; Poyton and McEwen 1996). Transcription factors such as NRFs help unite expression of respiratory genes. However, relatively Iittle is known about how the metabolic disturbance Ieads to either induction or activation of these transcription factors.

Exercise physioiogists typically characterize energeric changes in terms of carbon substrates, phosphagens and reducing equivalents. There is some evidence that each of these factors is capable of altering respiratory gene expression in some manner. The effects may be exerted on global events, such as protein synthesis, or on regulation of specific genes via the metabohtes acting as rnessengers in signal transduction pathways. in some cases, the regdators Iead to quantitative changes in mitochondrial content, with stoichiometric changes in al1 mitochondriai proteins. In other cases, regulation of specific genes may alter qualitative properties such as fhel preference or enzyme protile. In the following sections we consider how substrates, products and modulators of OXPHOS impact upon expression of genes involved in mitochondrïai biogenesis. INTERACTIONS BETWEEN ENERGY METABOLISM AND

MITOCHONDlUAL BIOGENESIS

Owen

Oxygen is the temùnal electron acceptor in OXPHOS, being reduced to water at

Complex IV. Changes in oxygen levels have the potentiai to alter flow through OXPHOS and may require compensatory changes in glycolysis. Oxygen-sensitive gene expression is therefore an important element of adaptive changes in response to chronic oxygen limitations. These changes are mediated by activation of the transcription factor HF-1. which increases expression of genes involved in erythropoiesis (Firth et al., 1994), glucose transport (Eben et al., 1995) and glycolysis (Semenza et al., 1994; Firth et al.,

1995; Semenza et al., 1996), thereby afXecting both oxygen deIivery and glycolytic ATP

production (see Table 1.1).

HE- 1 is a heterodimeric protein composed of a novei a subunit and a B subunit

that is also part of the aryl hydrocarbon receptor complex (see Hoffman et al., 1991).

While HIF-1P expression is constituitive (Wang et al., 1995), KiF-la protein levels

increase exponentially with declining oxygen tensions (Jiang et al., 1996) as a result ofits

reduced rate of ubiquitination (Sutter et al., 2000). Stabilization of KIF-la is dependent

upon the presence of an intact, redox-sensitive signalling pathway (see Huang et al.,

1996). It has been postulated that an upstream heme protein mediates HIF-1 activation by

interacting directly with oxygen and altering intracellular peroxide levels (see Goldberg

et al., 1988; Cross et al., 1990. AIthough Schumacker and colleagues had previousiy

shown a rote for rnitochondrial ROS production in the redox-dependent stabilization of

HIF-1 (Chandel et al., 1998; Chandel et al., 2000), more recent studies in p0 ceiis provide compelling evidence against the invotvement of mitochondrial fiee radical generation in stabiiiing HF-1 during the hypoxic response (Srinivas et al., 200 1; Vaux et al., 200 1).

Related studies suggest instead that a cGMP-dependent signalling pathway is involved in

HIF-1 activation (Liu et al., 1998; Sogawa et al., 1998), and that activation is redox regulated directly at the iron centre of HIF-la (Srinivas et al., 1998). However, the mechanism(s) by which changes in intracellular oxygen tension are sensed remain equivocal,

HIF-L regulates the expression of at least I 1 of 13 proteins involved in the conversion of extracellular glucose to intracellular lactate, and appears to be a rnaster regulator of cellular and developrnental homeostasis (lyer et al., 1998). Shared sensitivity of glycolytic genes to HIF-1 facilitates coordinated adaptive responses to decreased oxygen tensions. Hypoxic exposure of rnyoblasts results in reciprocal changes in mitochondrial and glycolytic gene expression (Webster et al., 1990), and in differential expression of isoforms for a subset of nuclear-encoded COX subunits in yeast (Burke et al., 1996). While the lack of boxia gsponsive glements (HREs) within the promoters of respiratory genes makes it is unlikeiy that such reciprocai effects are mediated by HIF- 1,

AP-1 activity has recently been shown to be involved in both HIF-1 (Hoffmann et ai.,

200 1) and NRF (Xia et al., 1997; Xia et al., 1998)mediated changes in gene expression.

However, the potential role of AP- 1 in facilitating cross talk between these two distinct

programmes of gene expression in relation to oqgen tension has yet to be investigated.

Aithough oxygen per se has little potential to directly affect transcription factors

that regulate respiratory gene expression, oxygen sensitivity may be achieved indirectly

through its effects as a substrate of OXPHOS. in vitro, oxygen tension must deciine to very low levels before inhibition of oxygen consumption is obsewed (see Korzeniewski and Mazat, 1996). htracelluiar oxygen gradients exacerbate oxygen limitations, and lead to an apparent decrease in oxygen afinity in vivo. Conflicting studies searching for

intracellular oxygen gradients in vivo have not resolved the issue (Wittenberg and

Wittenberg, 1985; Connett et al., 1986; Jones, 1986; Vanderkooi et al., 1991). A roie for

myogiobin in minirnizing such gradients (Wittenberg and Wittenberg, 1985) is supported

by recent studies that demonstrate that the lack of a defect in tissue oxygen supply in

myoglobin knockouts (Gany et al., 1998) is the result of multiple compensatory

responses that enhance haemodynarnics (Godecke et al., 1999) via the upregulated

expression of HIF and yascular gndothelial growth factor (VEGF) genes (Meeson et al.,

200 1).

Respiration may also be altered by nitric oxide (NO), which is produced

intramitochondrially and competes with oxygen by binding reversibly to COX (see

Bomtaite and Brown, 1996). Tissue-specific effects of NO on respiration may be

mechanistically attributable to differences in inner nritochondrial membrane 1ipid:protein

ratios (Shiva et al., 200 l), NOS (French et al., 200 1) or myoglobin (Flogel et ai., 200 1)

contents.

Nucleotides and phosphate

A deryliztes

Mitochondrid adenine nucleotides and phosphate exert control over OXPHOS

through effects on the cataIytic rate of the FtF&TPase. Adenylates also auence

glycolytk ATP production through mass action, ailosteric and codent regulation.

OXPHOS and glycolysis collectively provide the energy for the spectmm of cytosolic ATPases, including rnyofibrillar and ion-pumping ATPases. Communication between the cytosoIic and mitochondriai adenylate pools is through the action of the phosphate/ûK exchanger and the adenine nucleotide translocase, which exchanges ADP with ATP (see

Apritle, 1993; Hagen et ai., 1993). While the mitochondriai adenylate pool is protected during transient hypoxia by converting ATP and ADP to AMP,prolonged hypoxia results in a net efflux of adenylates to the cytosol (see Dransfield and Aprille, 1994). However, changes in the relative composition of rnitochondrial and cytosolic adenylate pools are rapidly reversed upon reoxygenation. Thus, adenylates affect energy rnetabolism in cornplex ways, leading to a number of indices of cellular energy status, including

[ATP]/(ADP], RAn, phosphorylation potential or energy charge (see Schulte et al..

1992).

AprilIe and co-workers (Austin and Aprille, 1984; AprilIe and Nosek, 1987) have found that increases in matrix adenine nucleotide content parallel the post-partum proliferation of mitochondria. This has led to the proposal that changes in the size and relative composition of the matrix adenylate pool may be involved in the regdation of mitochondrial biogenesis (see Aprille, 1988). While changes in adenylate status have since been shown to aiter mitochondriai gene expression (Joyal et ai., 1995; Enriquez et al. 1996), there is considerably more experimental evidence to support a role for increased rates of ATP turnover in the absence of altered adenylate status in mediating changes in mitochondrial content (see Hood, 200 1). lnorgrnlic Phosphate

Exercise can cause muscle phosphate levels to Ïncrease many fold fiom sub- miiliolar to 20 millimolar, largely due to phosphocreatine breakdown. Phosphate IeveIs return to resting concentrations in recovery through ATP synthesis and trans- phosphorytation to creatine. In many systems, changes in phosphate may be cntical in regulation of the rate of OXPHOS (see Balaban, 1990). In animds, phosphate changes reflect bioenergetic regulation, but in some systems phosphate levels Vary as a hnction of its availability in the extemal environment. Both plants and yeast respond to phosphate starvation conditions by inducing expression of genes whose products either control growtWcell cycle events (Measday et al., 1994) or lead to synthesis of metabolic enzymes with altered phosphate dependencies @uff et al., 1989; Plaxton, 1996). The factor(s) that initiates phosphate-dependent signal transduction pathways has yet to be identified. It is intnguing to consider the possibility that phosphate dependent gene regulation might contribute to the response of animais to bioenergetic stress. However, while low phosphate levels in plants may be indicative of bioenergetic stress, they generally coincide with high energy status in animals (e.g. Alen et al., 1997).

Guanine mrc1eotidt.s

Wnlike the adenine nucleotide pool, which provides energy for a wide variety of biologicaf processes, energy fiom the guanine nucleotide pool is used pnmarily in anabolic processes. It is produced in substrate level phosphorylation by succinate dehydrogenase and is therefore a plausible surrogate for ECrebs cycle activity or even metabolic rate. GTP is directly involved in al1 regdatory aspects of protein synthesis, including initiation, eiongation and termination within the cytosol and mitochondna (see

Hucul et al., 1985; Pall, 1985). Protein synthesis requires GTP as a substrate for the addition of the 7-methylguanosine cap to mEWA, a structure that significantly increases translational efficiency (Shatkin, 1976). Initiation of protein synthesis is much more sensitive to GTP/GDP than is elongation, and it has been suggested that altering the ratio of GWGDP may control the rate of protein synthesis (Swedes et al., 1979). Adequate levels of GTP are dso required for complete translocation of newly synthesized nuclear pre-proteins across the inner mitochondrial membrane into the matrix (Sepuri et ai.,

1998a; Sepuri et aL, 1998b).

Evaluation of the impact of changes in guanidine nucleotides must reconciie in

vitro sensitivities and kinetics with in vivo changes. For instance, when Arfemiri emerges

fiom dormancy, there is a rapid increase in protein synthesis. While the relative

concentrations of guanidine nucleotides change rapidly under these conditions (Kwast

and Hand, 1996a), Kwast and Hand (1996b) concluded that these changes are likely to

have little impact upon protein synthesis compared with alterations in redox state.

However, GTP has also been shown to regulate transcription, with intracellular GTP

levels being directly correiated with rRNA accumulation in vivo (Ehrlich et al.. 1975). It

is believed that GTP acts on transcription by shifting the pre-existing intracellular

equilibrium between two forms of RNA polymerase towards the enzyme that has the

greater ability to transcnie rRNA (see Travers et al., 1980). The transcriptionai effects

oFGTP appear to be mediated primarily by CAMP-sensitive signalling pathways (see

Pd, 1988; Pal1 and Robertson 1988). Although CAMP is important in many signailing

pathways, OXPHOS genes generally lack consensus CAMP-responseelements (CREs)

with sorne exceptions (e.g- COX TV, Gopaiakrishan and ScarpulIa t 994; ALAS, Giono

et al., 200 1). Thus, guanine nucleotides have the potentiai to aiter many aspects of mRNA

and protein synthesis in a global sense. but there is relatively littIe evidence that such

changes couid alter the expression of mÏtochondriai genes specifically. Calcium

Calcium (ca2-) is known to exert its effects on 0;YPHOS through changes in the regulation of 3 mitochondrial dehydrogenases. tt covaiently activates pynivate dehydrogenase (PDH) by stimuIating PDH phosphatase. It activates isocitrate dehydrogenase and 2-oxoglutarate dehydrogenase by increasing affinity for their substrates. This regulatory pattern is an eiegant way to couple ATP demand to ATP synthesis in contractile tissues that reiy upon ~a'-transients to increase metabolic work

(see McCormack and Denton, 1993).

ca2' aiso exerts effects on signa1 transduction through activation of a family of

ca2--sensitive protein kinases (PKC), which phosphorylate a wide range of proteins

including hormone receptors, transcription factors and other enzymes, including protein

kinases (e.g. Steffan et ai., 1995; McCarthy et a[., 1998). Differences in intracellular

calcium transients between muscle fibre types have recently been show to differentially

modulate the expression of fibre-type specific genes via calcineurin-dependent signalling

(Chin et al., 1998; Rothermel et al., 2000). While it is not known if calcineurin is also

able to regulate the expression of respiratory genes, the involvement of other calcium-

sensitive signalling pathways in such genetic responses has been clearly demonstrated.

Treatment with the ca2&ionophore A-23 187 leads to increased cytochrome c expression

via a caZL-sensitive,PKC-dependent signalling pathway (Freyssenet et ai., 1999). rUtered

cdAhomeostasis in response to both mtDNA depletion and metabolic stress also triggers

changes in the gene expression of a number of respiratory proteins and transcription

factors (Biswas et al., 1999). caz'-mediated activation of NF-& occurs via PKC phosphorylation of the inhibitory protein IKB (Steffan et al., 1995), while increases in AP-1 (dimers of fodjun family) (Angel and Karin, 1991; Cogswell et al., I994) activity resuIt fiom enhanced transcription of c-fos and c-jun genes (Lambert et al., 1993; Passegue et al., 1995).

Collaborative interactions between AP-1 and Wsin the replation of cytochrome c expression in response to chronic contractile activity suggest that some of the ca2-- mediated changes in respiratory gene expression may be transduced through this redox- sensitive signalling pathway. However, recent studies by Hood and colleagues suggest that, independent of the mechanisms by which its signais are transduced, cal- alone is not able to coordinateiy regulate changes in mitochondriai content (see Hood. 200 1).

Reducing equivalents

NADH

Activity of the Krebs cycle leads to production of reductant in the forrn of NADH and FADH2. Reducing equivalent availability has been shown to regulate OXPHOS in some tissues and species (e.g. Duboc et al., 1988; Duboc et al., 1990). However, in other tissues severaf fold increases in metabolic rate can be sustained without significant changes in NADEüNAD' ratios (see Balaban, 1990). Thus. NADWNAD- changes are

not ubiquitous, unequivocal indicators of bioenergetic state. Early studies attempting to

show links between bioenergetic state and gene expression explored the impact of NADH

on gene expression. Although NADH was found to increase the expression of adenine

nucleotide translocase and ATP synthase fl subunit (Chung et al., t992), the levels

required to obtain an efect were supra-physiological. NADPH

While NADH is a rnetabolic intermediate consumed in both catabolic and anabolic reactions, NADPH provides energy primarily for biosynthetic pathways (e.g. fatty acid biosynthesis). Changes in NADPH levels are also important to redox balance, particularly during oxidative stress when it is oxidized either via a specific pathway in conjunction with GSH and ascorbate to reduce partially oxidized a-tocopherol (see

Moller, 2001) (Fig. 1.3) or directly as an antioxidant within the mitochondrial

cornpartment (Kirsch and De Groot, 200 1). Oxidation of intramitochondnal stores of

NADPH is also believed to sustain NO production (see Giuiivi, 1998). Although it is

clear that NADPH participates in oxidant metabolism, the regulatory significance of in

vivo changes in NADPWNADP' in relation to either anti-oxidant defenses or oxidant-

mediated signailing pathways remains unknown.

Carbon substrates

Fatîy acids

Lipids are important fuels in oxidative metabolism of vertebrate muscle. Fatty

acid oxidation may account for the majority of ATP production in working mammalian

heart (Neely and Morgan, 1974) and skeletal muscle (Roberts et al., 1996). Increases in

oxidative capacity are typically paralleled by elevation of fatty acid oxidizing enzymes

but there are many circumstances where these enzymes are preferentially increased,

suggesting an increased reliance upon lipid fùels. Thus, fatty acids as substrates can have

effects both on mitochondrial fùel preferences as welI as mitochondrial proiiferation per

se. Fatty acids in diet or culture medium have been show to lead to mitochondrial proliferation in a number of mode1 systems (see Madsen et al., 1998). Addition of acetyt-

L-carnitine to the diets of aged rats partially restored mitochondrial tùnction (Hagen et al., 1998) while fùlly restoring mitochondrial mRNA levels relative to adult rats

(Gadaleta et al., 1990). Treatment of human colonic carcinoma cell lines with unbranched, short-chain fatty acids (SCFAs) potentiates differentiation (Heerdt et al.,

1994; Augenlicht et al., 1995) and results in increased expression of mitochondrial COX genes without concomitant increases in mtDNA copy number (Heerdt and Augenlicht,

199 1). This suggests that fatty acids somehow regulate mitochondrial gene expression at the level of transcription. However, the signalling pathway has not been identified and it remains possible that this proliferation is a compensatory response to increased reliance upon fùels that yield less ATP per molecule of oxygen used.

Apart from these global effects on rnitochondrial biogenesis, there are a nurnber of examples of fatty acid-rnediated regdation of specific respiratory genes. Treatment of a pancreatic ceil line (Assimacopoulos-Jeannet et al., 1997) and fetal rat hepatocytes

(Chatelain et al., 1996) with either saturated or unsaturated fatty acids induces a rapid transcriptional up-regulation of the camitine palrnitoyl transferase 1 (CPT I) gene, resulting in a significant increase in CPT 1 enzyme activity. Changes in CPT I gene expression induced by fatty acids in heart and skeletal muscle are transduced by a famiiy of ligand-activated receptors, coiiectively referred to as peroxisome proliferator-activated receptors (PPARs) (Brandt et al., L998; Mascaro et al., 1998). Induction of genes invoIved in fatty acid oxidation has recently been shown to involve collaborative interactions between PPARa and EPAR-y~oactivator1 [PGC-1 J (Vega et al., 7000). hterestingly, PGC-1 aiso promotes mitochondrial biogenesis by moduiating the activity of NRF-1 (Wu et ai., 1999; Lehman et ai., 2000). This finding provides a plausible mechanistic link for the aforementioned modulatory effects of fatty acids on mitochondrial gene expression.

GENERAL EFFECTORS OF METABOLIC RATE

Studies of metabolic regulation by substrates and products of OXPHOS have traditionally focused on the relative importance of redox vs. phosphagen control through effects on rnass action ratios. The eariiest studies of isolated mitochondria identified adenylates as the primary regulators of oxidative metabolism characterizing the transition

Rom "resting" to "m~~imal"rates as a shift from respiratory "state 4" to "state 3" (Chance and Williams, 1956). Debates around regulatory models of metabolic control then focused on regulation through substrate:product ratios acting under near-equilibrium

(Erecinska and Wilson, 1982) vs. non-equilibrium (LaNoue et al., 1986) conditions.

However, these models are generally unable to account for the range of metabolic rates seen in rest-to-work transitions (see Hochachka and McLelland, 1997). Alternate approaches used control theory to assess control strengths to various enzytnatic steps of processes (e-g. Brown, 1992). Such an approach recognizes the pleiotropic regulatory patterns apparent in control of OXPHOS, and accommodates the growing awareness of potential for metabolic regulation through ligand interactions with proteins of OXPHOS.

Of ail potential interactions, the effects of ligand binding with COX have been studied most extensively. Di-iodo-thyronine, a degradation product ofthyroid hormones. has been shown to alter flux through COX (Arnoid et ai., 1998; Lombardi et ai., 1998).

Adenylate binding sites have been identified for cytochrome c (Corthésy and Wallace, 1988), and COX subunits IV (Arnold and Kadenbach, 1997) and VIa (Huther and

Kadenbach, 1988; Taanman et al., 1993). The Kd for ATP on cytochrome c falls within the physiological range, thus providing a potential mechanism through which electron flow may be aitered when the relative concentration of ADP is high (Craig and Wallace,

1993). Flux through OXPHOS may aiso be rnodulated by binding of ATP and ADP to either COX IV (Arnold and Kadenbach, 1997) or COX V[a (Anthony et al., 1993;

Kadenbach et al., 1997). However, effects of adenylates on COX activity appear to be both species and tissue-specific (see Grossman and Lomax, 1997). ATP effects on COX activity via COX IV are only observed in eukaryotes (Follmann et al., 1998), and binding of either adenylate to COX Via is specific to tissues that express the heart isofotm

(Arnold et al., 1997).

Flux through COX may also be artered by physical interactions between COX VI,

and the regulatory subunit of PKA (Yang et al.. 1998), or by phosphorylation of COX IV

(Bender and Kadenbach, 2000). Phosphorylation-dephosphorylation events also modulate

flux through Complex V via ca2--dependentphosphorylation of subunit c (Azarishvily et

al,, 2000), and through Complex 1 via CAMP-dependent protein kinase A-dependent

phosphorylation of subunit 1 (Papa et al., 2000). While an expanding role for allosteric

and phosphorylation-dependent regdation of OXPHOS is apparent, it is unclear whether

such interactions impact upon mitochundrial biogenesis.

REDOX-MEDIATED CEIANGES IN MITOCB0M)RIA.L BIOGENESIS

in most cases, there is Little evidence for any of the bioenergetic regdators (e.g.

adenylates, reducing equivalents) to act as a primary, universal iink between

bioenergetics and gene expression. However, they aii share the ability to alter flux through OXPHOS. While proton motive force and ATP are nonnally considered to be the products of OXPHOS, the process of electron transport aiso leads to secondary production of reactive oxygen species (ROS). Thus, any ligand, substrate or product that has the capacity to alter OXPHOS flux can affect production of ROS and impact upon

ROS-sensitive signalling pathways. The rate of production of ROS is a£Fected by the respiratory state (Le, the state 3-4 continuum). Changes in metabolic rate can alter production of superoxide anion (Oz'-), particularly at Complexes 1 and III of the ETC (see

Lucas and Szweda, 1998). Papa and Skulachev (1997) have suggested that mild uncoupling of mitochondria may occur in vivo when ADP levels are low, preventing the complete inhibition of respiration and accumulation of one electron reductants in "state

4".

There is abundant evidence that interventions and conditions that inhibit

OXPHOS alter ROS and ROS-sensitive signalling pathways. Hypoxic inhibition of

OXPHOS is particularly intriguing because oxygen is a substrate for both Complex CV

and ROS production. Inhibition of OXPHOS and stimulation of mitochondrial oxidant

production has been shown to alter nuclear gene expression in yeast (e-g. Zhao et al..

1996) and manmals (e-g. Behrooz and Ismail-Beigi, 1997). Antimycin A, an inhibitor of

Complex ttI, causes an elevation in mitochondrial H20r production in human fibroblast

ceus and results in increased expression of cytochromes cl and b (Suniki et al., 1998).

Kristai and co-workers have aiso shown that mitochondriai transcription is ROS-sensitive

and that transcription is partiaily restored upon the exogenous addition of antioxidants

(fista1 et ai., 2994; Kristal et al., 1997). These and related observations coliectively Ied

to the proposal that mitochondrial ROS production acts as a retrograde signal allowing for nucleo-rnitochondnal communication (Poyton and McEwen, 1996). In the following section we discuss the potentiai role of ROS in coupling bioenergetic changes to respiratory gene expression. lntracellular redox balance

ROS and niîric oxide production

The ability to maintain and finely adjust intracellular redox balance represents a deiicate interplay between the rates of oxidant production and scavenging. Basal Ievels of mitochondrial ROS and NO production are important in signal transduction pathways in a number of tissues (see Schulze-Osthoffet ai., 1995; Sen and Packer, 1996; Bolanos et al.,

1996). However, their increased production during physiological challenges such as hypoxia (ûawson et al., 1993), ischemialreperfusion (Schild et al., 1997) and exercise

(Supinski, 1998) often results in extensive damage to proteins, lipids and DNA. While it has been proposed that accmed oxidative damage Ieads to accelerated rates of cellular and organismal senescence (see Wallace, 1992; Shigenaga et al., 1994; Papa and

Skulachev, 1997), mitochondnal involvement in the fiee radical theory of aging has been chaiienged by several groups (see Forman and hi, 1997; Rustin et al., 2000).

NO production occurs within mitochondna of endotheliai cells (see Feron et ai.,

1998), cells of the immune system (see Stuehr and Nathan, 1989), and microglial celis of

the central nervous system (see Bolaiïos et al., 1996; Youdim and Riederer, 1997). ROS

are produced in al1 cells as a normal by-product of aerobic metaboiism, when electrons

escape fiom the electron transport chin and are transferred to molecular oxygen to form

02'-. Aithough 02" is a weak oxidant with a rather short diision radius, it cm give rise

to other more potent radicals. Its dismutation to hydrogen peroxide &O2) cm lead to the production of the extremely toxic hydroxyl radical (OH') via the Fenton reaction (see

Femandez-Checa et al., 1997). 02'-may also react with NO to yield the highly damaging

07300-(see Sharpe and Cooper, 1998), The levels and effects of these free radicais are highly dependent upon tissue rate of production, levels of metals, activities of inter- converting enzymes, and presence of scavenging pathways (see Fig. 1.2).

Free radical scmengirg and metabolism

Protection fiom the oxidizing power of NO and ROS is afforded by scavenging activities of endogenous antioxidants and antioxidant enzymes. At the celluiar level, the thiol antioxidants, giutathione (GSH), glutaredoxin, and thioredoxin (TRX) are the major reducing agents (Thomas et al., 1995). However, non-thiol intracellular reducing agents, which are comprised of both hydrophilic (mainly ascorbate) and hydrophobic (a- tocopherol and ubiquinol) scavengers, also protect against oxidative damage (Burton et al., 1983; Frei et al., 1990). While most of these antioxidants are targeted for degradation upon oxidation, some oxidized forms may be regenerated via specific enzymes. For example, the oxidized intermediate of a-tocopherol can be reduced via an NADPH- specific pathway (see Fig. 1.3). Similarly, the relative proportions of oxidized and reduced GSH are controlled by the action of giutathione peroxidase (GPx) (see Stio et al.,

1994).

Changes in the redox state of endogenous antioxidants (see Table 1.2) also appear to depend on the nature of the oxidative stress and the tissue in which the stress occurs.

While ischernialreperfùsion of intact hearts leads to the preferential and rapid oxidation of GSH and ascorbate, lipophilic antioxidants such as ubiquinoI and a-tocopherot remain unchanged (Haramaki et al., 1998). In contrast, ischernialrepefision causes a global depletion of reduced endogenous antioxidants in brain tissue (Katz et al., 1998), and of a- tocopherol in response to treatment with micromolar concentrations of peroxynitnte (e-g.

Vatassery et al., 1998). Variability in the relative importance of the individual antioxidants may be explained at least in part by recently reported inter-tissue differences in mitochondrial antioxidant capacity and site of oxidant production (see Kwong and

Sohal, 1998). It is intriguing to consider the possibility that such inherent differences in redox balance and its regdation across tissues could provide a redox-based mechanisrn for observed, tissue-specific changes in the expression of respiratory genes (see Preiss and Lightowlers, 1993; Preiss et al., 1995).

In addition to antioxidants, the enzymes superoxide dismutase (SOD), GPx and catalase are critical in fiee radical metabolism (Fig 1.2). Efficient scavenging of ROS requires that the appropriate stoichiometry be maintained between the activity of SOD and the combined activities of GPx and catalase (see Orr and Sohal, 1994; Kim et ai.,

1996; Peled-Karnar et al., 1997). In the absence of the appropriate stoichiometry, Hz02

accumulates and 'OH is produced, leading to cellular damage and cytotoxicity.

Mitochondrial ROS metabolism is cornplicated by the fact that rnitochondria are

unable to synthesize most antioxidants. Mitochondria rely upon GSH uptake via a

specific transporter. Glthough mitochondria possess approximately 15% of total

intracellular GSH stores (Fernandez-Checa et al., 1997), the kinetics of the transporter

and rates of ROS generation resuit in rapid GSH depletion during oxidative stress (see

Garcia-Ruiz et al., 1995). This is particularly evident du~gphysiological challenges that

increase mitochondrial NO production (Lizasoain et aI., 1996; Nishikawa et al., 1997).

Ascorbate and a-tocopherol, while found at much lower intramitochondriai concentrations, are thus also important in protecting mitochondriaI constituents fiom oxidative darnage (see Leist et al., 1996). The presence ofa-tocopherol in both the inner and outer mitochondrial membranes (Ham and Liebler, 1985) is particularly significant because it allows for the quenching of f?ee radicals generated in different rnitochondrial cornpartments. Consideration of enzyrnatic protection from oxidants is complicated by compartmentation issues and the existence of isoforms with distinct sub-cellular distributions. Mitochondria and cytosol possess unique isofonns of SOD (MnSOD vs

CdZnSOD) and GPx (mtGPx vs. cGPx). Although catalase is generally thought to distribute to peroxisornes, it has been reported to be present in rnarnmalian heart mitochondria (Radi et al., 199 1) and to protect against lipid peroxidation (Radi et al.,

1993). However, efficient lipid peroxide scavenging in heart appears to be more dependent on rnaintaining the appropriate stoichiornetry between cytosolic and mitochondrial isoforms of GPx rather than between total GPx and cataiase (Molina and

Garcia, 1997).

REDOX REGULATION OF GENE EXPRESSION

A number of signal transduction pathways are sensitive to intracelMar redox bdance (see Sen and Packer, 1996). Such signailing pathways are rnost comrnonly activated by physiolo@caI chaitenges that cause changes in the rate of oxidant production relative to antioxidant scavenging observed during physiologicai challenges. However. redox effects on transcription can be mediated indirectly through other signalling pathways. hcreased levels of NO and ROS act as secondary rnessengers, both by pemirbing ca2*homeostasis and altering the phosphorylation state of protein kinases and phosphatases, ultimately activating a spectmm of transcription factors (see Tmmp and

Berezesky, 1992; Suniici et al., 1997).

ROS-sensitive transcriptionai regulation can also be exerted directly through redox-sensitive transcription factors. A number of mechanisms have been characterized that impart redox-sensitivity to transcription factor activity. In prokaryotes, oxidation of iron-sulphur (FeS) ciusters generally leads to the activation of redox-sensitive regulons

(e.g. Gaudu et al., 1997; Hidalgo et al., 1997). in contrast, DNA-binding of most redox- sensitive eukaryotic transcription factors is modulated by shifts in the redox state of cysteine residues (see Sen and Packer, 1996). TU date, four redox-sensitive transcription factors have been identified in eukaryotes that may either directly or indirectly affect bioenergetic gene expression: nuclear respiratory factor 2 (NRF-2) (Martin et al., I996), hypoxia inducible factor 1 (HF-1) (Wang et al., 1995; Huang et al., 1996), NF-& (Jin et al., 1997; Lin et al., 1997), and AP-1 (Nose et al., 1991; Stauble et al., 1994) (see Table

1).

NF-KBand AP-1

Studies of redox regulation of transcription factors in mammalian systems have focused on NF-& and M-1 because of their invoivement in numerous signalling pathways. Shifts in inti-acellular redox balance alter the DNA-binding activity ofboth factors, thereby regulating the expression of gens whose protein products affect signal transduction and intracellular redox balance. Whiie NF-& and M-1 directly and indirectly modulate the expression of a considerable number of genes, there is Little evidence that either factor represents the dominant regulatory signal for controiiing expression of respiratory genes under bioenergetic stress. NF-KB activation Ieads to the induction of a substantiai number of genes involved largely in the immune response and cell proliferation (see Storz and Pola, 1996;

Goldstone and Hunt, 1997). Production of low to moderate levels of ROS directly affects

NF-KB activity in two ways. H202activates a phospholipase C-mediated pathway, promoting the release of ca2* fiom IP3-sensitive charnels (see Suzuki et d., 1997). It

may also lead to the release of ~e~'from ferritin (Lin et al., 1997). ~a'*and ~e"are

believed to activate serinehhreonine and tyrosine kinases, which phosphorylate specific

residues on IicB thereby promoting the dissociation of NF-KB (see Primiano et al., 1997).

Free NF43 is translocated to the nucleus, transcriptionally up-regulating specific genes

(Table 1). There is growing evidence that redox state of cysteine residues in NF-KB

aiters its DNA-binding activity. GSH was the first physiologically relevant modulator of

redox state of cysteine residues within NF-KB to be described (see Schulze-Osthoff et al.,

L995). However, recent studies have shown that TRX also facilitates the DNA-binding

and activation of NF-KB by donating electrons fiom its dithiol center to reduce cys6'

(Hirota et ai., 1997; Jin et al., 1997).

Binding of AP-1 to DNA results in changes in the expression of genes important

in signal transduction (Angel and Karin, 199 1) (Table 1). Studies of redox control of AP-

1 DNA-binding activity have yielded confiicting results (see Sen and Packer, 1996;

Primiano et ai. 1997). AP-1 is a dimer that may be composed of a number of proteins

(e.g. JunB, JunD, c-jun, c-fos, Fra-1, Fra-2), but it is most commonIy found as homo- or

heterodimers of dosand c-jun While oxidiing conditions frequently induce expression

of c-fos and c-jun (Lambert et al., 1993; Passegue et aI., 1995), increases in their

intracellular levels do not always lead to enhanced AP-t DNA-binding activity (see Nose et al., 199 1). Variable activation of AP-1 may, however, be attributable to the nature of the oxidative stress, since reduction of cysteine residues within the AP-I DNA-binding domain requires a shifi in redox balance that promotes the association of TRX with a nuclear protein, Ref-1 (Hirota et al., 1997). A recent study has also shown that TRX promotes AP-2 DNA-binding activity (Huang and Domann, 1998), and suggests that the activity of several members of the AP family of transcription factors may be rnodulated by similar redox pathways.

It is well established that redox activation of AP-1 and NF-KB induces the expression of cytokines and antioxidant enzymes (see Angel and Karin, 199 1; Cogswell et al., 1994; Wong et al., 1996). While binding sites for members of the AP family of transcription factors are found in the promoters of several nuclear-encoded bioenergetic genes (e.g. Pierce et al., 1992; Vifials et al., 19971, a general role for either transcription factor in regulating their expression remains equivocal. Recent stiidies have shown that

several members of the AP-1 family of transcription factors modulate the expression of

cytochrome c in electrically stimulated cardiac myocytes (Xia et al., 1997; Xia et al.,

1998). However, activation of cytochrome c expression is mediated by binding of c-jun

dimers to CREs and not to AP-1 sequence recognition sites (Xia et al., 1998). Binding of

AP-1 to highiy homologous ATF sequence recagnition sites in the promoter of COX IV

has also been proposed (Evans and Scarpuiia, 1989), but potentiai cross-reactivity of AP-

1 with binding motifs of established modulators of bioenergetic gene expression has yet

to be substantiated experimentally. Recent observations that the pro-oxidant gossypol

acetic acid induces coordinate increases in c-fos, COX I, and COX CI mRNAs

(Hutchùison et ai., 1998) suggest that the AP-1 famiiy of transcription factors may also influence mitochondrial gene expression. However, it is difficultto imagine a widespread role for either NF-KB or the AP-1 family in controlling changes in gene expression that occur during mitochondrial biogenesis.

NRFs and other respiratory gene transcription factors

Unlike NF-KB and AP-1, NRFs regulate the expression of many genes whose protein products are critical to mitochondrial fùnction (see Scarpulla, 1997). In addition to respiratory proteins, these inciude enzymes involved in heme synthesis (e.g. ALAS:

Braidotti et al., 1993) and factors that influence mtDNA replication and transcription (e.g.

MRP-RNA: Evans and Scarpulla, 1990; mtTFA: Virbasius and Scarpulla, 1994; mtSSB:

Gupta and Van Tuyle, 1998).

Lirnited studies to date suggest that redox state affects at least the activation of

NRF-2. Martin et al. (1996) found that NRF-2 DNA-binding activity was reduced in nuclear extracts of NiH-3T3 cells upon depletion of GSH in vivo, and restored by the addition of TRX. Recent evidence tûrther suggests that regdation oFNRF-2 may be achieved by altering the redox state of cysteine residues that are critical to its ability to

either heterodimerize or bind DNA (Chinenov et al., 1998). While functional analyses of

NRF-1 have shown that its DNA-binding activity is regulated by phosphoryiation of

multiple senne residues (Gugneja and Scarpulla, 1997), the potentiai significance of

cysteine residues within its DNA-binding domain in facilitating tùnctional interactions

with PGC-I (see Wu et al., 1999) has yet to be considered. The redox sensitivity of other

transcription factors known to regulate the expression of nuclear-encoded OXPHOS

proteins (reviewed by Moyes et ai., 1998) also remains equivocai. COX AS A MODEL OF MlTOCHONDRIAL CONTENT

Mitochondria are cornplex organelles, the product of expressing an estimated 340 genes (Grive11 et al., 1999). This complexity complicates studies designed to address the mechanistic basis of mitochondrial changes observed under physiological and pathophysiological conditions. Furthemore, it is fair to consider mitochondrial content i5om an ultrastructural (e.g. volume density, cristae surface density), biochemical

(enzyme activity or content) or genetic (rntDNA copy number) perspective (see

"Interplay between mitochondrial structure and fhction" section). Consequently, studies of mitochondrial biogenesis typically rely upon critically important enzymes as rnodels of organelar changes.

Several of the genetic and biochemicai characteristics of COX make it a more suitable marker of mitochondrial content than other OXPHOS complexes. Unlike

Complex LI, which is entirely nuclear-encoded, three of the 13 COX subunits are encoded in mitochondrial DNA Aithough subunits of CompIex I are also mitochondrially- and nuciear-encoded, the holoprotein consists of at Ieast 4 1 subunits (Fearnley and WaIker.

1992). Thus, rneasuring changes in the Ieveis of a subset of COX subunits not onIy accommodates the need to address mechanisms by which the expression of genes lioused in different cellular compartments is coordinated but also provides a more physiologicalIy meanin&[ result than that obtained From a similarly sized subset of

CompIex C subunits.

COX is also the terminal oxidase of the ETC, catdyzing the transfer of electrons fiom reduced cytociuome c to molecular oxygen and the expulsion of 4 protons across the hermembrane. Metaboiic control analyses have show that while the overaI1 cuntrol of electron flux through the ETC is shared between complexes, maximal capacity for flux thmugh COX is frequentiy achieved, thereby resulting inhibition of aerobic respiration under a range of physiologicai and cIinical conditions (see Villani and Attardi,

2000). Ets activity is also rnarkediy inttibited in response to hypoxia, making the potential link between COX activity and changes in rnitochondrial content that are driven by bioenergetics and redox balance intnguing.

COX content declines markedly with age, and is the most comrnonly observed of al1 bioenergetic Iesions that accompany early-onset rnitochondrial diseases (Caruso et al.,

1996). However, malecular meçhanisms that account for its greater wlnerability to

deficiency relative to other OXPHOS complexes remain equivocal.

TEIIESIS OVERVIEW

This thesis examines the potentiai interactions between bioenergetics and changes

in COX content in striated muscle models. In Chapter 2, I tested the hypothesis that

mitochondnal biogenesis during myogenesis arose in response to increases in energy

demand associated with differentiation. 1 found that rnetaboiic rate did not increase

markedly during myogenesis, but there was a pronounced shifi in the relative importance

of aerobic and glycolytic metabolism. One subset of experiments was designed to impose

a minor degree of bioenergetic stress by using low levels of sodium azide to fractionally

inhibit COX. Although the applied dose was expected to acutely inhibit approximately 2-

5% of COX activity, 1 observed that chronic azide treatment caused profound,

irreversible losses in catalytic activity. In Chapter 3, [ addressed several hypotheses that

could explain how azide induced COX losses. My studies aIso considered the potentiai

reievance of this mode[ in addressing the nature of the general and specitic losses in COX seen in many cardiovascular and neurodegenerative diseases. In Chapter 4,1 continued to explore the potential pathophysiological mechanisms of COX losses. Hypertension typically induces ventricular hypertrophy in response to increased cardiac work, requiring bioenergetic compensation. I used the spontaneously hypertensive rat mode1 to study the pattern of change in bioenergetic and oxidative parameters that result fiom age-dependent ventricular hypertrophy and anti-hypertensive drug treatment with the ACE-inhibitor enaiapril. Collectively, these studies contribute to our understanding of mechanisms by which COX content of striated muscles is altered in response to bioenergetic challenges. REFERENCES

Abate, C., Patel, L., Rauscher, F.J., & Curran, T. (1990). Redox reguiation of Fos and Jun

DNA-binding activity iu vitro. Science. 249, 1 157-1 161.

Allen, P.S.,Matheson, G.O.,Zhu, G., Gheorgiu, D., Dunlop, R.S., Falconer, T., Stanley,

C., & Hochachka, P.W.(1997). Simultaneous "P MRS ofthe soleus and

gastrocnemius in Sherpas during graded calf muscle exercise. Am. J. Physiol. 273,

R999-R1007.

Andersson, U., & Scarpulla, R.C. (200 1). PGC-1-related coactivator, a novel, semm-

inducible coactivator of nuclear respiratory factor 1-dependent transcription in

mammalian cells. Mol. Cell. Biol. 21, 3738-3749.

Angel, P., & Karin, M. (1991). The role of Jun, Fos and the AP-1 cornplex in ceil-

proliferation and transformation- Biochim. Biophys. Acta. 1072, 129-157.

Anthony, G., Reimann, A., & Kadenbach, B. (1993). Tissue-specitic regdation of bovine

hart cytochrome-c oxidase activity by ADP via interaction with subunit Via. Proc.

Natl. Acad. Sci. USA 90, 1652-1656. Apriiie, J.R (1988). Regulation of the mitochondrial adenine nucleotide pool size in

liver: mechanism and metabolic role. FASEB. J. 2,3547-2556.

Apdle, J.R (1993). Mechanism and regdation of the mitochondrial ATP-Mg/P(i)

carrier. J. Bioenerg. Biornembr. 25,473-48 1.

Aprille, J.R., & Nosek, M.T. (1987). Neonatal hypoxia or materna1 diabetes delays

postnatal developrnent of liver mitochondria. Pediatr. Res. 21, 266-269.

Arnold, S., & Kadenbach, B. (1997). Cell respiration is controlled by ATP, an allosteric

inhibitor of cytochrome-c oxidase. Eur. J. Biochern. 249, 350-354.

Arnold, S., Lee, I., Kim, M., Song, E., Linder, D., Lottspeich, F., & Kadenbach, B.

(L997). The subunit structure of cytochrome-c oxidase fiom tuna heart and liver.

Eur. J. Biochem. 248,99-103.

Arnold, S., Goglia, F., & Kadenbach, B. (1998). 3,s-diiodothyronine binds to subunit Va

of cytochrome-c oxidase and abolishes allosteric inhibition of respiration by ATP.

Eur. J. Biochem., 252, 325-330.

Assimacopoulos-Jeannet, F., Thumelin, S., Roche, E., Esser, V., McGarry, J.D.,&

Prentki, M. (1997). Fatty acids rapidly induce the carnitine palmitoyltransferase 1

gene in the pancreatic P-cell Iine Dis-L. J. Biol. Chern. 272, 16594664.

Attardi, G., & Schatz, G. (1988). Biogenesis of mitochondria. Annu. Rev. CeIl. Biol., 4,

289-333.

Augedicht, L, Velcich, A., & Heerdt, B.G. (1995). Short-chah fatty acids and molecular

and ce1lular mechanisms of colonic cell differentiation and transformation. Adv.

Exp. Med. Biol. 375, 137-148. Austin, J., & Aprille, J.R. (1984). Carboxyatractyloside-insensitive influx and efflux of

adenine nucleotides in rat Iiver mitochondria. J. Biol. Chem. 259, 154-160.

Azarashvily, T.S., Tyynela, J., Baumann, M., Evtodienko, Y.V., & Saris, N.L. (2000).

ca2'-modulated phosphorylation of a low-molecular-mass polypeptide in rat Iiver

mitochondria: evidence that it is identical with subunit c of FoFr-ATPase. Biochem.

Biophys. Res. Commun. 270,741-744.

Bakeeva, L.E., Chentsov, YS, & Skulachev, V.P. (1978). Mitochondrid fiamework

(reticulurn mitochondriale) in rat diaphragm muscle- Biochirn Biophys Acta. 50 1,

349-369.

Balaban, R.S. (1990). Regdation of oxidative phosphorylation in the mammalian cell.

Am. J. Physiol. 258,377-389.

Behrooz, A., & Ismail-Beigi, F. (1997). Dual control of glut 1 glucose transporter gene

expression by hypoxia and by inhibition of oxidative phosphorylation. J. Bioi.

Chern. 272, 5555-5562.

Bender, E., & Kadenbach, B. (2000). The allosterk ATP-inhibition of cytochrome c

oxidase activity is reversibly switched on by CAMP-dependent phosphorylation.

FEBS. Lett. 466, 130-134.

Bereiter-Hahn, J. (1990). Behavior of mitochondria in the living cell. [nt. Rev. Cytol.

122, 1-63.

Biswas, G., Adebanjo, O. A., Freedrnan, B.D., Anandatheenhavarada, H.K.,

Vijayasarathy, C., Zaidi, M., Kotlikoff, M., & Avadhani, N.G. (1 999). Retrograde

ca2' signalling in C2C 12 skeletal myocytes in response to rnitochondrial genetic and metabolic stress: a novel mode of inter-organelle cross talk. EMBO. J. 18, 522-

533.

Bolafios, J.P., Heales, S.J.R., Peuchen, S., Barker, J.E., Land, J.M., & Clark, J.B. (1996).

Nitric oxide-mediated rnitochondrial damage: a potential neuroprotective role for

glutathione. Free. Radic. Biol. Med, 2 1,995-100 1.

Borutaite, V., & Brown, G.C. (1996). Rapid reduction of nitnc oxide by mitochondria,

and reversible inhibition of mitochondrial respiration by nitnc oxide. Biochem. I.

3 15,295-399.

Bourhim, M., Barre, H., Oufara, S., Minaire, Y., Chatonnet, J., Cohen-Adad, F., &

Rouanet, J.L. (1990). Increase in cytochrorne oxidase capacity of BAT and other

tissues in cold-acclimated gerbils. Am. J. Physiol. 258, R1291-R1398.

Braidotti, G., Borthwick, I.A., & May, B.K. (1993). Identification of regulatory

sequences in the gene for 5-arninolevulinate synthase fiom rat. J. Biol. Chem. 268,

1109-1117.

Brandt, J.M., Djouadi, F., & Kelly, D.P. (1998). Fatty acids activate transcription of the

muscle carnitine paImitoyItransferase 1 gene in cardiac myocytes via the

peroxisome proliferator-activated receptor a. J. Biol. Chem. 273,23756-23792.

Breen, G.A.M., & Jordan, E.M. (2000). Upstream stimulatory factor 2 stimulates

transcription through an initiator element in the mouse cytochrome c oxidase

subunit Vb promoter. Biochim. Biophys. Acta. 1517, 119-127.

Brown, G.C. (1992). ControI of respiration and ATP synthesis in mammalian

mitochondria and cells. Biochem. J. 284, 1- 13. Bmnori, M. (2001). Nitric oxide moves rnyoglobin centre stage. Trends. Biochem. Sci.

26,209-2 10.

Burke, P.V.,Raitt, D.C., Allen, L.A., Kellogg, E.A., & Poyton, R.O. (1997). Effects of

oxygen concentration on the expression of cytochrome c and cytochrome c oxidase

genes in yeast. J. Biol. Chem. 272, 14705- 147 12.

Burton, G.W., Joyce, A., & Ingold, K.U. (1983). Is vitamin E the only lipid-soluble,

chain-breaking antioxidant in human blood plasma and erythrocyte membranes?

Arch. Biochern. Biophys. 221,28 1-290.

Caruso, U., Adami, A., Bertini, E., Burlina, AB., Carnevale, F., Cerone, R., Dionisi-Vici,

C., Giordano, G., Leuzzi, E.. Parenti, G., Savasta, S., Uziel, G., & Zeviani, M.

(1996). Respiratory-chain and pymvate rnetabolisrn defects: Italian collaborative

survey on 72 patients. J. Inherit. Metab, Dis. 19. 143-148.

Chance, B. & Williams, G.R. (1956). The respiratory chain and oxidative

phosphorylation. Adv. Enzymol. 17, 65-134.

Chandel, N.S., Maltepe, E., Goldwasser, E., Mathieu, C.E.,Simon, M.C., & Schumacker,

P.T. (1998). Mitochondrial reactive oxygen species trigger hypoxia-induced

transcription. Proc. Natl. Acad. Sci. USA 95, 1 17 15-1 1720.

Chandel, N.S., McClintock, D.S., Feliciano, C.E., Wood, T.M., Melendez, J.A.,

Rodrigue? A.M., & Schumacker, P.T. (2000). Reactive oxygen species generated

at rnitochondrial complex üI stabilie hypoxia-inducible factor-la during hypoxia.

A mechanism of 02 sensing. I. Biol. Chem. 375,25 130-25 138. Chateiain, F., Kohl, C., Esser, V., McGany, I.D., Girard, J., & Pegorier, J.P. (I996).

CycIic AMP and fatty acids increase carnitine palmitoyltransferasa 1 gene

transcription in cultured fetal rat hepatocytes. Eur. J. Biochem. 235,789-798.

Chin, E.R., Olson, E.N., Richardson, J.A, Yang, Q., Humphries, C., Shelton, J.M-, Wu,

H., Zhu, W., Bassel-Duby, R & Williams, R.S. ( 1998). A calcineurin-dependent

transcriptional pathway controls skeletal muscle fiber type. Genes. Dev. 12, 2499-

3509.

Chinenov, Y., Schmidt, T., Yang, Y.-Y.,& Martin, M.E, (1998). Identification of redox-

sensitive cysteines in GA-binding proteinir that regulate DNA binding and

heterodimerization. J. Biol. Chem. 273,6203-6209.

Chung, M.,Stepien, G., Haraguchi, Y., Li, K., & Wallace, D.C. (1992). Transcriptional

control of nuclear genes for the mitochondrial muscle AûPiATP translocator and

the ATP synthase P subunit. Multiple factors interact with the OXBOXlREBOX

promoter sequences. 1. Biol. C hem. 267,2 11 54-2 1 16 1.

Cogswell?J.P., Godlevski, M.M., Wisley, G.B., Clay, W.C.,Leesnitzer, L.M.,Ways, J .P.,

& Gray, J.G. (1994). NF-& regulates IL- 1 P transcription through a consensus NF-

KB bindinç site and a nonconsensus CRE-like site. J. hnunol. 153, 722-723.

Connett, RJ.,Gayeski, T.E.J.,& Honig, C.R. (1986). Lactate efflux is unrelated to

intracellular p02in a working red muscle in situ. J. AppI. Physiol. 61,402408.

Cornor, M.K.,Irrcher, L, & Kood, D.A (2001). Contractile activity-induced

transcriptional activation of cytochrome c involves Sp 1 and is proportionai to

rnitochondrial ATP synthesis in CX12 muscte ceiis. .i.Biol. Chem. 276. 15898-

159O4. Corthésy, B.E.,& Wallace, C.J.A (1988). The oxidation-state-dependent ATP-binding

site of cytochrome c. Implication of an essentiaI arginine residue and the effect of

occupancy on the oxidation-reduction potentiai. Biochem. J. 252,349-3 55.

Craig, D.B.,& Wallace, C.J.A. (1993). ATP binding to cytochrome c diminishes electron

flow in the mitachondriai respiratory pathway. Protein. Sci. 2, 966-976.

Craig, E.E., Chesley, A., & Hood, D.A. (1998). Thyroid hormone modifies mitochondrial

phenotype by increasing protein import without altering degradation. Am. J.

Physioi. 275, C 1508-C 15 15.

Cross, A.R., Henderson, L., Jones, O.T.G., Delpiano, M.A., Hentschel, J., & Acker, H.

(1990). ?nvolvement of an NAD(P)H oxidase as a p01 sensor protein in the rat

carotid body. Biochem. J. 272,743-747.

Dawson T.L.,Gores, G.J.,Nieminen, A.-L., Herman, B., & Lemasters, J.J. (1993).

Mitochondria as a source of reactive oxygen species during reductive stress in rat

hepatocytes. Am. J. Physiol. 264, C96 1-C967.

Demple, B., & habile-Cuevas, C.1. (199 1). Redox redux: the control of oxidative stress

responses. Cell. 67, 837-839.

Dransfield, D.T.,& Apdle, J.R. (1994). The influence of hypoxia and anoxia on

distribution of adenine nucleotides in isolated hepatocytes. Arch. Biochem.

Biophys. 3 13, 156-165.

Duboc, D., Muffat Joly, M., Renault, G., Degeorges, M., Toussaint, M., & Pocidalo, J.J.

(1988). In situ NADH laser fluonrnetry of rat fast- and slow-twitch muscles dunng

tetanus. J. Appi. PhysioI. 64, 2692-2695. Duboc, D., Abastado, P., Muffat Joly, M., Perier, P., Toussaint, M., Marsac, C.,

Francois, D., Lavergne, T. Pocidalo, J.J., & Guerin, F. (1990). Evidence of

mitochondriai impairment during cardiac ailograft rejection. Transplantation. 50,

75 1-755.

Due S.M.G., Moorhead, G.B.G.,Lefebvre, D.D.,& Plaxton, W.C.(1989). Phosphate

starvation induces bypasses of adenylate and phosphate-dependent glycolytic

enzymes in Brassica rrigra suspension cells. Plant. Physiol. 90, 1275-1280.

Ebert, B.L., Firth, J.D., & Ratcliffe, P.J. (1995). Hypoxia and mitochondrial inhibitors

regulate expression of glucose transporter- l via distinct Cis-acting sequences. J.

Biol. Chem. 270, 29083-29089.

Ehrlich, H., GaIlant, J., & Lazzarini, R.A. (1975). Synthesis and turnover of ribosomal

ribonucleic acid in guanine-starved cells of Eschecheria coli. J. Biol. Chem. 250,

3057-3061.

Enriquez, J. A., Fernandez-Silva, P., Pérez-Martos, A., Lopez-Pérez, M.J., & Montoya,

J. (1996). The synthesis of mRNA in isolated mitochondria can be mrtintained for

several hours and is inhibited by high levels of ATP. Eur. J. Biochem. 237, 60 1-

610.

Erecinska, M., & WiIson,D.F. (1982). Regulation of celIular energy metabolism. J.

Membr. Biol. 70, 1-14.

Evans, M.J., & Scarpulla, RC. (1990). NRF-1: a trans-activator of nuclear-encoded

respiratory genes in animal ceIls. Genes. Dev. 4, 1023-1034. Feamiey, LM.,& Wdker, J.E. Conservation of sequences of subunits of mitochondrial

complex 1 and their relationships with other proteins. Biochim. Biophys. Acta.

1140, 105-134.

Fernandez-Checa, J.C., Kaplowitz, N., Garcia-Ruiz, C., Colell, A., Miranda, M.,

Montserrat, M., Ardite, E., & Mordes, A. (1997). GSH transport in mitochondria:

defense against TNF-induced oxidative stress and alcohol-induced defect. Am. J.

Physiol. 273, G7-G17.

Feron, O., Dessy, C., Opel, D.J., Arstall, M.A., Kelly, KA-, & Michel, T. (1998).

Modulation of the endothelial nitric-oxide synthase-caveolin interaction in cardiac

myocytes. Implications for the autonomie regulation ofheart rate. J. Biol. Chem.

273,249-254.

Firth, J.D., Ebert, B.L., Pugh, C.W., & Ratcliffe, P.J. (1994). Oxygen-regulated control

elernents in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes:

similarities with the erythropoietin 3' enhancer. Proc. Natl. Acad. Sci. USA. 9 1,

6496-6500.

Firth, I.D., Ebert, B.L., & Ratcliffe, P.J. (1995). Hypoxic regulation of lactate

dehydrogenase A. Interaction between hypoxia-inducible factor 1 and CAMP

response elements. J. Biol. Chem. 270, 2 1021-2 1027.

Flogel, U., Mem, MW.,Godecke, A, Decking, UKM., & Schrader, J. (2001).

Myoglobin: a scavenger of bioactive NO. Proc. Natl. Acad. Sci. USA 98, 735-740.

Folmann, K., Arnold, S.. Ferguson-Miller, S., & Kadenbach, B. (1998). Cytochrome c

oxidase fiom eucaryotes but not fiom procaryotes is allostencalIy inhibited by

ATP- Biochem. Mol. Biol. Int. 45, 1047-1055. Forman, H.J., & Azzi, A (1997). On the virtual existence of superoxide anions in

mitochondria: thoughts regarding its role in pathophysiology. FASEB. J. 1 1,374-

375.

Frei, F., Kim, MC, & Ames, B.N. (1990). übiquinol-10 is an effective lipid soluble

antioxidant at physiological concentrations. Proc. Natl. Acad. Sci. USA 84,4879-

4883.

French, S., Giulivi, C., & Balaban, R.S. (200 1). Nitric oxide synthase in porcine heart

mitochondria: evidence for low physiological activity. Am. I. Physiol. 280, W863-

H2867.

Freyssenet, D., Berthon, P., & Denis, C. (1996). Mitochondrial biogenesis in skeletal

muscle in response to endurance exercises. Arch. Physiol. Biochem. 104, 129-t 3 1.

Freyssenet, D., Di Carlo, M., & Hood, D.A. (1999). Calcium-dependent regdation of

cytochrome c gene expression in skeletal muscle cells: identification of a protein

kinase c-dependent pathway. J. Biol. Chem. 274,9305-93 1 1.

Gadaleta, MN, Petruzzeila, V., Renis, M., Fracasso, F., & Cantatore, P. (1990). Reduced

transcription of rnitochondrial DNA in the senescent rat. Tissue dependence and

effect of L-carnitine. Eur. 1. Biochem. 187, 50 1-506.

Garcia-Ruiz, C., Colell, A., Morales, A, Kaplowitz, N., & Fernandez-Checa, J.C.

(1995). Role of oxidative stress generated tiom the mitochondrial electron transport

chah and mitochondrial glutathione status in loss of mitochondrial fùnction and

activation of transcription factor nuclear factor-icB: studies with isolated

mitochondria and rat hepatocytes. Mol. Pharmacol. 48, 825-834. Garry, D.J., Ordway, G.A., Lorenz, J.N., Radford, N.B., Chin, ER-, Grange, RW.,

Bassel-Duby, R., & WiUiarns, RS. (1998). Mice without myoglobin. Nature. 395,

905-908.

Gaudu, P., Moon, N., & Weiss, B. (1997). Regulation of the soxRS oxidative stress

regulon, Reversible oxidation of the Fe-S centers of SoxR in vivo. J. Biol. Chem.

272, 5082-5086.

Giono, L.E., Varone, C.L., & Canepa, E.T. (200 1). 5-aminolaevulinate synthase gene

promoter contains two CAMP-responsiveelement (CEE)-like sites that confer

positive and negative responsiveness to CE-binding protein (CREB). Biochem. J.

353, 307-3 16.

Godecke, A., Flogel, U., Zanger, K., Ding, Z., Hirchenhain, I., Decking, U.K.M..&

Schrader, J. (1999). Disruption of myoglobin in mice induces multiple

compensatory mechanisms. Proc. Natl. Acad. Sci. USA 96, 104%- 10500.

Goldberg, M.A., Dunning, S.P., & Bunn, H.F.(1988). Regulation of the erythropoietin

gene: evidence that the oxygen sensor is a heme protein. Science. 242, 14 12-141 5.

Goldstone, S.D., & Hunt, NH. (1997). Redox regulation of the rnitogen-activated protein

kinase pathway during lymphocyte activation. Biochim. Biophys. Acta 1335,353-

360.

Gopalakrishnan, L., & Scarpulla, R.C.(1994)- Differential regulation of respiratory chin

subunits by a CREB-dependent signal transduction pathway. Role of cyclic AMP in

cytochrome c and COXrV gene expression. J. Biol. Chem. 269, 105-1 13. Grivell, L.A., Artal-Sang M., Hakkaart, G., de Jong, L., Nijtmans, L.G.J., van Oosterum,

K., Siep, M., & van der Spek, H. (1999). Mitochondrial assembly in yeast. FEBS

Lett. 452, 57-60.

Grossman, L.I., & Lomax, M.I. (1997). Nuclear genes for cytochrome c oxidase.

Biochim. Biophys. Acta. 1352, 174-192.

Guderley, H. (1990). Functional significance of metabolic responses to thermal

acclimation in fish muscle. Am. J. Physiol. 259, R245-R252.

Gugneja, S., & Scarpulla, R.C. (1997). Serine phosphorylation within a concise amino-

terminal domain in nuclear respiratory factor 1 enhances DNA binding. J. Biol.

Chem. 272, 18732-18739.

Gupta, S., & Van Tuyle, G.C. (1998). The gene and pseudogenes of the rat mitochondrial

single-stranded DNA-binding protein: structure and promoter strength analyses.

Gene. 2 12,269-278.

Guilivi, C. (1998). Functional implications of nitric oxide produced by mitochondria in

mitochondrial metabolism. Biochem. J. 332, 673-679.

Hagen, T., Joyal, J.L., Henke, W., & Aprille, J.R. (1993). Net adenine nucIeotide

transport in rat kidney mitochondria. Arch. Biochem. Biophys. 303, 195-307.

Hagen, T.M.,Ingersoll, RT.,Wehr, C.M., Lykkesfeldt, J., Vinarsky, V., Bartholornew,

J-C., Song, M.H., & Ames, B.H. (1998). Acetyl-L-camitine fed to old rats partially

restores mitochondrial hnction and ambulatory activity. Proc. Natl. Acad. Sci.

USA 4,9562-9566.

Ham, A.-JL., & Liebier, D.C. (1995). Vitamin E oxidation in rat iiver mitochondria.

Biochemistry. 34, 5754-576 1. Haramaki, N., Stewart, D.B.,Agarwal, S., Ikeda, H.,Reznick, A.Z., & Packer, L. (1998)-

Networking antioxidants in the isolated rat heart are selectively depleted by

ischemia-reperfusion. Free. Rad. Biol. Med. 25, 329-339.

Heerdt, B.G., & Augenlicht, L.H. (1991). Effects of fatty acids on expression of genes

encoding subunits of cytochrome c oxidase and cytochrome c oxidase activity in

HT29 human colonic adenocarcinorna cells, J. Biol. Chem. 266, 19 120-1 9 126.

Heerdt, B.G., Houston, M. A., & Augenlicht, L.H. ( 1994). Potentiation by specific short-

chah fatty acids of differentiation and apoptosis in human colonic carcinoma cell

lines. Cancer. Res. 54, 3288-3293.

Hentze, M.W.,& Kühn, L.C. (1996). Molecular control of vertebrate iron metabolism:

mRNA-based regdatory circuits operated by iron, nitric oxide, and oxidative stress.

Proc. Natl. Acad. Sci. USA. 93, 8 175-8 182.

Hidalgo, E., Ding, H., & Dernple, B. (1997). Redox signal transduction: mutations

shifting [2Fe-2S] centers of the SoxR sensor-regulator to the oxidized form. CeII.

88, 121-129.

Eiirota, K., Matsui, M., Iwata, S., Nishiyama, A., Mon, K., & Yodoi, J. (1997). AP-1

transcriptional activity is regulated by a direct association between thioredoxin and

Ref-1. Proc. Natl. Acad. Sci. USA. 94,3633-3638.

Hochachka, P-W.(1987). Limits: how fast and how slow muscle metabolism can go. In:

Advances in myochernistry. (Benzi, G., Ed.), pp. 3- 12. John Libbey Eurotext Ltd,

New York.

Hochachka, P.W.,& McClelland, GB. (1997). Cellular metabolic homeostasis during

large-scale change in ATP turnover rates in muscles. J. Exp. Biol. 200, 38 1-386. Hohan, A, Gloe, T., & Pohl, U. (200 1). Hypoxia-induced upregulation of eNOS gene

expression is redox-sensitive: a cornparison between hypoxia and inhibitors of ceIl

metabolism. J. Cell. Physiol. 188,3344-

Hohan, E.C.,Reyes, H., Chu, F.F., Sander, F.,Conley, L.H., Brooks, B.A.,&

Hankinson, 0. (199 1). Cloning of a factor required for activity of the Ah (dioxin)

receptor. Science. 252,954-958.

Hood, D.A. (200 1). lnvited review: contractile activity-induced rnitochondrial biogenesis

in skeletal muscle. 1. Appl. Physiol. 90, 1137-1 157.

Hood, D.A., Baiaban, A., Cornor, M.K., Craig, E.E., Nishio, M.L., Rezvani, M., &

Takahashi, M. (1994). Mitochondriai biogenesis in striated muscle. Can. J. Appl.

Physiol. 19, 12-48.

Huang, Y., & Dornann, F.E. (1998). Redox modulation of AP- DNA binding activity iri

vitro. Biochem. Biophys. Res. Commun. 249,307-3 12.

Huang, L.E., Arany, S., Livingston, D.M., & Bunn, H.F. (1996). Activation of hypoxia-

inducible transcription factor depends primwily upon redox-sensitive stabilization

of its a subunit. J. Biol. Chem. 271, 32253-32259.

Hucul, J-A, Henshaw, E.C., & Young, D.A (1985). NucIeoside diphosphate regulation

of overail rates of protein biosynthesis acting at the level of initiation. S. Biol.

Chem. 260, 15585-1 559 1.

Hutchson, RW., Ing, H., & Burghardt, RC. (1998). Induction of c-fos, and cytochrome

c oxidase subunits 1and II by gossypol acetic acid in rat liver cells. Ceii. Biol.

Toxicol. 14,39 1-399. Huther, FJ., & Kadenbacb B. (1988). Intraiiposomal nucleotides change the kinetics of

reconstituted cytochrome c oxidase fi-om bovine heart but not corn Paracoccus

denitrificans. Biochem. Biophys. Res. Commun. 153,525-534.

Iyer, N.V., Kotche, L.E., Agani, F., Leung, S.W.,Laugher, E., Wenger, RR.H.,Gassman,

M., Gearhart, J.D.. Lawler, A.M., Yu, A.Y., & Semenza, G.L. (1998). Cellular and

deveiopmental control of Othomeostasis by hypoxia-inducible factor I a.Genes.

Dev. 12, 149- 163.

Jiang, B.-H., Semenza, G.L.,Bauer, C., & Marti, H.H. (1996). Hypoxia-inducible factor

1 levels Vary exponentially over a physiologically relevant range of O2tension.

Am. J. Physiol. 27 1, C 1 172-C 1180.

Jin, D.-Y., Chae, HZ., Rhee, S.G., & Jeang, K.-T.(1997). Regdatory role for a novel

human thioredoxin peroxidase in NF-KB activation. J. Biol. Chem. 272, 30952-

3096 1.

Jones, D.P. (1986). Intracellular difision gradients of O2and ATP. Am. J. Physiol. 250,

C663- C675.

Joyal, J.L., Hagen, T., & Aprille, J.R. (1995). Intramitochondrial protein synthesis is

regulated by matrix adenine nucleotide content and requires calcium. Arcfi.

Biochem. Biophys. 3 19,322-330.

Kadenbach, B., Frank, V., Rieger, T., & Napiwotzki, J. (1997). Regulation of respiration

and energy transduction in cytochrome c oxidase isozymes by dlosteric effectors.

Mol. Cell. Biochem. 174, 13 1-135. Katz, L.M.,Callaway, C.W., Kagan, V.E., & Kochanek, P.M. (1998). Electron spin

resonance measure of brain antioxidant activity during ischemidreperfusion.

Neuroreport. 11, 1587-1593.

Kim, J.D.,Yu, B.P., McCarter, R.J., Lee, S.Y., & Herlihy, J.T. (1996). Exercise and diet

modulate cardiac lipid peroxidation and antioxidant defenses. Free. Rad. Biol. Med.

20,83-88.

Kirsch, M., & De Groot, H. (200 1). NAD(P)H, a directly operating antioxidant? FASEB.

J. 15, 156% 1574.

Klingenspor, M., Ivemeyer, M., Wiesinger, H., Haas, K., Heldmaier, G., & Wiesner, RI.

(1996). Biogenesis of thermogenic mitochondria in brown adipose tissue of

Djungarian hamsters during cold adaptation. Biochem. J. 3 16.607-6 13.

Korzeniewski, B., & Mazat, J.-P. (1996). Theoretical studies on the control of oxidative

phosphorylation in muscle mitochondria: application to mitochondrial deficiencies,

Biochem. J. 3 19, 143- 148.

Kristal, B.S., Park, B.J., & Yu, B.P. ( 1994). Antioxidmts reduce peroxyl-mediated

inhibition ofmitochondrial transcription. Free. Rad. Biol. Med. 16, 653-660.

Kristal, B.S., Koopmans, S.J., Jackson, C.T., Ikeno, Y., Park, B.J., & Yu, B.P. (1997).

Oxidant-mediated repression of mitochondrial transcription in diabetic rats. Free.

Rad. Biol. Med. 22, 8 13-823.

Kwast, K.E., & Hand, S.C. (1996a). Oxyçen and pH replation of protein synthesis in

mitoc hondria from Artemiafimciscunn embryos. Biochem. J. 3 13,207-2 13. Kwast, KE., & Hand, S.C. (1996b). Acute depression of mitochondrial protein synthesis

during anoxia. Contributions of oxygen sensing, matrix acidification, and redox

state. J. Biol. Chem. 271,73 13-73 19.

Kwong, L.K., & Sohal, R.S. (1998). Substrate and site specificity of hydrogen peroxide

generation in mouse mitochondria. Arch. Biochem. Biophys. 350, 118-126.

Lambert, C.A., Lefebvre, P.Y.,Nusgens, B.V., & Lapiere, C.M. (1993). Modulation of

expression of endogenous collagenase and collagen genes by electroporation:

possible involvement of cas and protein kinase C. Biochem. J. 290, 135-1 38.

LaNoue, K.F., Jefies, F.M.H.,& RaddqG.K. (1986). Kinetic control of mitochondrial

ATP synthesis. Biochemistry. 25, 7667-7675.

Leary, S.C., Battersby, B.J., Hansford, R.G.,& Moyes, C.D. (1998). Interactions between

bioenergetics and rnitochondrial biogenesis. Biochim. Biophys. Acta. 1365, 522-

530.

Lehman, J.J., Barger, P.M., Kovacs, A., Saffitz, J., Medeiros, D.M., & Kelly, D.P.

(2000). Peroxisome proliferator-activated receptor y coactivator-1 promotes cardiac

mitochondrial biogenesis. J. Clin. Invest. 106, 847-856.

Leist, M*, Raab, B., Maurer, S., Rosick, U., & Brigelius-Flohé, R, (1996). Conventional

cell culture media do not adequately supply cells with antioxidants and thus

facilitate peroxide-induced genotoxicity. Free. Radic. Biol. Med. 21,297-306.

Lin, M., Rippe, R.A., Niemela, O., Brittenham, G., & Tsukamoto. H. (1997). Role of

iron in NF-KB activation and cytokine gene expression by rat hepatic macrophages.

Am. J. Physiol. 272, G1355-G1364. Lindstedt, S.L., Hokanson, J.F., Wells, D.J., Swain, S.D.,Hoppeler, H.,& Navarro, V.

(1991). Running energetics in the pronghorn antelope. Nature. 353, 748-750.

Liu, Y., Christou, H., Monta, T., Laughner, E., Semenza, G.L., & Kourernbanas, S.

(1998). Carbon rnonoxide and nitric oxide suppress the hypoxic induction of

vascular endothelial growth factor gene via the 5' enhancer. J. Biol. Chern. 273,

15257-15262.

Lizasoain, I., Moro, M.A., Knowles, R.G., Darley-Usmar, V., & Moncada, S. (1996).

Nitnc oxide and peroxynitrite exert distinct effects on rnitochondrial respiration

which are differentially blocked by glutathione or glucose. Biochern, 1. 3 14, 877-

880.

Lornbardi, A., Lanni, A, Moreno, M., Brand, M.D., & Goglia, F. (1998). Effect of 3.5-

di-iodo-L-thyronine on the mitochondnal energy-transduction apparatus. Biochern.

5. 330, 521-526.

Lucas, D.T., & Szweda, L.I. (1998). Cardiac reperfùsion injury: aging, Iipid peroxidation,

and rnitochondrial dysfùnction. Proc. Natl. Acad. Sci. USA. 95, 510-5 14.

Luciakova, K., Barath, P., Li, R., Zaid, A, & Nelson, B.D. (2000). Activity of the human

cytochrome c 1 prornoter is rnodulated by E2F. Biochem. J. 3 5 1,25 1-256.

Madsen, L., Froyland, L., Dyroy, E., Helland, K., & Berge, RK. (1998).

Docosahexaenoic and eicosapentaenoic acids are differently metaboIized in rat Iiver

during mitochondna and peroxisorne proliferation. J. Lipid. Res. 39, 583-593.

Mascaro. C., Acosta, E., Ortiz, J.A., Marrero, P.F., Hegardt, F.G., & Haro, D. (1998).

Control of human muscle-type carnitine paimitoyl transferase 1 gene transcription

by peroxisorne prouerator-activated receptor. 5. Biol. Chem. 273, 8560-8563. Martin, M.E., Chinenov, Y., Yu, M., Schmidt, T.K.,& Yang, X.-Y.(1996). Redox

regulation of GA-binding protein-alpha DNA binding activity. J. Biol. Chem- 271,

25617-25623.

McCarthy, G.M., Augustine, J.A., Baldwin, A.S., Christopherson, P.A., Cheung, H.S.,

Westfall, P.R., & Scheinmann, R.I. (1998). Molecular mechanism of basic calcium

phosphate crystal-induced activation of human fibroblasts. Role of nuclear factor

kappab, activator protein 1, and protein kinase C. J. Biol. Chem. 273,35 16 1-35 169.

McCorrnack, J.G., & Denton, R.M. (1993). The role of intramitochondrial ca2-in the

regulation of oxidative phosphorylation in mammalian tissues. Biochem. Soc.

Trans. 21,793-799.

Measday, V., Moore, L., Ogas, J., Tyers, M., & Andrews, B. (1994). The PCL2 (0RFD)-

PH085 cyclin-dependent kinase complex: a ceil cycle regulator in yeast. Science*

266, 1391-1395.

Meeson, A.P., Radford, N., Shelton, S.M., Mammen, P.P., DiMaio, J.M., Hutcheson, K.,

Kong, Y., Elterman, J., Williams, R.S., & Gany, D.J.(200 1). Adaptive mechanisms

that preserve cardiac function in mice without myoglobin. Circ. Res. 88, 7 13-720.

Meno, H., Kanaide, H., Okada, M., & Nakamura, M. (1984). Total adenine nucleotide

stores and sarcoplasmic reticular CG* transport in ischemic rat heart. Am. J.

P hysiol. 247, H3 80-H3 86.

Meyer, M., Schreck, R, & Baeuerle, P.A. (1993). Hz02 and antioxidants have the

opposite effects on activation of NF-KB and AP-1 in intact cells: AP-1 as secondary

antioxidant-responsive factor. EMBO. J. 12, 2005-2015. Molina, H,,& Garcia, M. (1997). Enzymatic defenses of the rat heart against tipid

peroxidation. Mech. Ageing. Dev. 97, 1-7.

Moller, LM.(2001). Plant mitochondria and oxidative stress: electron transport, NADPH

turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant. Physiol.

Plant. Mol. Biol. 52, 56 1-59 1.

Moyes, C.D., Mathieu-Costello, O.A., Brill, R.W.,& Hochachka, P.W.(1992).

Mitochondrial metabolism of cardiac and skeletal muscles fiom a fast (Katsimonts

pelamis) and a slow (Cyprintrs carpio) fish. Can. J. 2001. 70, 1246- 1253.

Moyes, C.D., Battersby, B.J., & Leary, S.C. (1998). Regdation of muscle rnitochondrial

design. J. Exp. Biol. 201,299-307.

Neely, J.R., & Morga4H.E. (1974). Relationship between carbohydrate and lipid

rnetabolism and the energy balance of heart muscle. Ann. Rev. Physiol. 36,413-

459.

Nishikawa, M., Sato, E.F., Kuroki, T., & [noue, M. (1997). Role of giutathione and nitric

oxide in the enerky metabolism of rat liver mitochondria. FEBS Lett. 415,341-345.

Nose, K., Shibanuma, M., Kikuchi, K., Kageyama H., Sakiyarna, S., & Kuroki, T.

(199 1). transcriptional activation of early-response genes by hydrogen peroxide in a

mouse osteoblastic ce11 line. Eur. J. Biochem. 20 1, 99- 106.

Orr, WC, & Sohal, R.S. (1994). Extension of Me-span by overexpression of superoxide

dismutase and catalase in Drosophila melanogaster. Science. 263, 1 128- 1 130.

Pd, ML. (1985). GP:a central regulator of cellular anabolism. Curr. Top. Cell. ReguI.

25, 1-20. Pall, M.L. (1988). Cyclic AMP control of GïT pools in Saccharomyces cerevisiae.

Biochem. Biophys. Res. Commun. 150, 1 144-1 148.

Pall, M.L., & Robertson, C.K. (1988). Growth regulation by GTP. Reguiation of

nucleotide pools in Neztrosporu by nitrogen and suffir control systems. J. Biol.

Chem. 263, 11 168-1 1 174.

Papa, S., & Skulachev, V.P. (1997). Reactive oxygen species, mitochondria, apoptosis

and aging. Mol. Cell. Biochem. 174,305-3 19.

Papa, S., Sardaneili. A.M., Scacco, S., & Technikova-Dombrova, 2. (1999). CAMP-

dependent protein kinase and phosphoproteins in mammaiian mitochondria. An

extension of the CAMP-mediated intracellular signa1 transduction. FEBS Lett. 444,

245-249.

Passegue, E., Richard, J.L., Boulla, G., & Gourdji, D. (1995). Multiple intracellular

signailings are involved in thyrotropin-releasing hormone (TRH)-induced c-fos and

jun B mRNA Ievets in clonal prolactin cells. Mol. Cell. Endocrinol. 107, 29-40.

Peled-Kamar, M., Lotem, J., Wirguin, 1.. Weiner, L., Hemalin, A., & Groner, Y. (1997).

Oxidative stress rnediates impairment of muscle tunction in transgenic mice with

elevated levei of wild-type CulZn superoxide dismutase. Proc. Natl. Acad. Sci.

USA. 94,3883-3887.

Pette, D., & Dusterhoft, S. (1992). Altered gene expression in fast-twitch muscle induced

by chronic low-frequency stimulation. Am. J- Physiol. 262, R3334338.

Plaxton, W.C. (1996). The organization and regulation of plant glycolysis. Annu. Rev.

Plant. Physiol. Plant. Mol. Biol. 47, 185-2 14. Poyton, RO., & McEwen, J.E. (1996). Cross taik between nuclear and mitochondrial

genomes. Annu. Rev. Biochem. 65,563-607.

Preiss, T., & Lightowlers, R.N. (1993). Post-transcriptionai regulation of tissue-specific

isoforms. A bovine cytosolic RNA-binding protein, COLBP, associates with

messenger RNA encoding the liver-form isopeptides of cytochrome c oxidase. J.

Biol. Chem. 268, 10659-10667.

Preiss, T., Sang, A.E., Chrzanowska-Lightowjers, Z.M., & Lightowlers, R.N. (1995). The

rnRNA-binding protein COLBP is glutamate dehydrogenase. FEBS Lett. 367,291-

296.

Primiano, T., Suter, T.R., & Kensler, T.W.(1997). Redox regulation of genes that protect

against carcinogens. Comp. Biochem. Physiol. 1 1 8B. 487-497.

Radi, R,, Turrens, J.F., Chang, L.Y., Bush, KM., Crapo, J.D., & Freeman, B.A. (199 1).

Detection of catalase in rat heart mitochondria. 1. Biol. Chem. 266, 22028-22034.

Radi, R., Sims, S., Cassina, A., & Turrens, J.F. (1993). Roles of cataiase and cytochrome

c in hydroperoxide-dependent lipid peroxidation and chemiluminescence in rat

heart and kidney mitochondria. Free. Rad. Biol. Med. 15,653-659.

Roberts, T.J., Weber, J.M., Hoppeler, H., Weibel, E.R., & Taylor, C.R. (1996). Design of

the oxygen and substrate pathways. II. Defining the upper limits of carbohydrate

and fat oxidation. 1. Exp. Biol. 199, 1651-1658.

Rothermel, B., Vega, R.B., Yang, J., Wu, H., Bassel-Duby, R, & Williams, R.S. (2000).

A protein encoded within the Dom syndrome criticai region is enriched in striated

muscles and inhibits calcineurin signallig. I. Biol. Chem. 275, 8719-8725. Rustin, P., von Kleist-Retzow, J.C., Vajo, Z., Rotig, A, & Munnich, A. (2000). For

debate: defective mitochondria, Free radicals, cell death, aging-reality or myth-

ocondria? Mech. Ageing. Dev. 1 14,20 1-206.

Scarpulla, R.C., Kilar, M.C.,& Scarpulla, K.M. (1986). Coordinate induction of multiple

cytochrome c rnRNAs in response to thyroid hormone. J. Bioi. Chem. 26 1,4660-

4662.

Scarpulla, R.C. (1997). Nuclear respiratory factors and the pathways of nuciear-

mitochondrial interactions. Trends- Cardiovasc. Med- 6, 39-45.

Schild, L., Reinheckel, T., Wiswedel, 1.. & Augustin, W. (1997). Short-term impairment

of energy production in isolated rat liver mitochondria by hypoxidreoxygenation:

involvement of oxidative protein modification. Biochem. J. 528, 205-210.

Schulte, P.M., Moyes, CD.,& Hochachka, P.W. (1992). [ntegrating metaboiic pathways

in post-exercise recovery of white muscie. J. Exp. Biol. 166, 18 1- 195.

Schuize-Osthoff,K., Los, M., & Baeuerle, P.A. (1995). Redox signalhg by transcription

factors NF-KB and AP- 1 in lymphocytes. Biochem. Pharmacol. 50, 73 5-74 1.

Schwerzmann, K., Cruz-Onve, L.M., Eg-man, R, Sanger, A., & Weibel, E-R (1986).

Moiecular architecture of the i~ermembrane of mitochondria fiom rat Iiver: a

combined biochemical and stereological study. J. Cell. Biol. 102,97-103.

Sernenza, GL,Roth, P.H.,Fang, H.-M.,& Wang, G.L. (1 994). Transcnptional

regdation of genes encoding giycoIytic enzymes by hypoxia-inducible factor 1. J.

BioI. Chem. 269,23757-23763.

Semenza, G.L., Jiang, B.-H., Leung, S.W., Passantino, R, Concordet, J.-C, Maire, P., &

GialIongo, k (1996). Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for

hypoxia-inducible factor I. J. Biol. Chem. 271,32529-32537.

Sen, CX., & Packer, L. (1996). Antioxidant and redox regulation of gene transcription.

FASEB J. 10,709-720.

Sepuri, N.B.V., Schülke, N., & Pain. D. (1998). GTP hydrolysis is essential for protein

import into the mitochondria1 matrix. J. Biol. Chem. 273, L420-1424.

Sepuri, N.B.V., Gordon, D.M.,& Pain, D.(1998). A GTP-dependent "push" is generally

required for efficient protein translocation across the mitochondrial inner

membrane into the matrix. J. BioI. Chem. 273,2094 1-20950.

Sharpe, M.A., & Cooper, C.E. (1998). Reactions of nitric oxide with mitochondriai

cytochrome c: a novel mechanism for the formation of nitroxyl anion and

peroxynitrite. Biochem. J. 332,9-19.

Shatkin, A.J. (1976). Capping of eucaryotic mRNAs. Cell. 9, 645-653.

Shigenaga, M.K., Hagen, T.M.,& Arnes, B.N. (1494). Oxidative damage and

mitochondriai decay in aging. Proc. Natl. Acad. Sci. USA. 9 1, 10771-10778.

Shiva, S., Brookes, P.S., Patel, R.P., Anderson, P.G., & Darley-Usmar, V.M. (2001).

Nitric oxide partitioning into rnitochondrial membranes and the control of

respiration at cytochrome c oxidase. Proc. Natl. Acad. Sci. USA 98, 7312-7217.

Sogawa, K., Numayama-Tsumta, K., Ema, M., Abe, M., Abe, H., & Fujii-Kunyama, Y.

(1998). Inhibition of hypoxia-inducible factor 1 activity by nitnc oxide donors in

hypoxia. Proc. Natl. Acad. Sci. LJSA 95,7368-7373. Srinivas, V., Zhu, X., Salceda, S., Nakamura, R., & Caro, J. (1998). Hypoxia-inducible

factor (HIF-1) is a non-heme iron protein. Implications for oxygen sensing. J. Biol.

Chem. 273, 180 19-18022.

Srinivas, V., Leshchinsky, 1, Sang, N., King, M.P., Minchenko, A., & Caro, J. (2001).

Oxygen sensing and HIF-1 activation does not require an active mitochondnal

respiratory chah eiectron transport pathway. J. Biol. Chern. 276,2 1995-2 1998.

Stauble, B., Boscoboinik, D., Tasinato, A, & Azzi, A. (1994). Modulation of activator

protein-l (AP-1) transcription factor and protein kinase C by hydrogen peroxide

and D-alpha-tocopherol in vascular smooth muscle cells. Eur. J. Biochem. 226,

393402.

Steffan, N.M., Bren, G.D.,Frantz, B., Tocci, M.J., O'Neill, E.A., & Paya, C.V. (1995).

Regdation of IKB~phosphorylation by PKC- and ~a('f)-dependent signal

transduction pathways. J. Immunol. 155,4685-469 1.

Stio, M., Iantomasi, T., Favilli, F., Marraccini, P., Lunghi, B., Vincenzini, M.T., &

Treves, C. (1 994). Glutathione metabolism in heart and liver of the aging rat.

Biochem. Cell. Biol. 72, 58-61.

Storz, G., & Polla, B.S. (1996). Transcriptional regulators of oxidative stress-inducible

genes in prokaryotes and eukaryotes. In: Stress-inducible cellular responses. (Feige,

U., Morimoto, RI,Yahara, I., &. Polla, B.S., Eds), pp. 239-254. Birkhauser

Verlag, Basel.

Stuehr, D.J., & Nathan, C.F. (1989). Nitric oxide. A macrophage product responsible for

cytostasis and respiratory inhibition in tumor target cells. 1. Exp- Med. 169, 1543-

1555. Suarez, R.K., Lighton, J.R.B., Brown, G.S., & Mathieu-Costello, O.A. (1991).

Mitochondriai respiration in humrningbird flight muscles. Proc. Natl. Acad. Sci.

USA. 88,4870-4873.

Supinski, G. (1998). Free radical induced respiratory muscle dysfunction. MOI. Celt.

Biochem. 179,99-110.

Sutter, C.H., Laughner, E., & Semenza, G.L. (2000). Hypoxia-inducible factor la protein

expression is controlled by oxygen-regulated ubiquitination that is disrupted by

deletions and missense mutations. Proc. Natl. Acad. Sci. USA 97,4748-4753.

Suuki, H., Kumagai, T., Goto, A., & Sugiura, T. (1998). Increase in intracellular

hydrogen peroxide and upregulation of a nuclear respiratory gene evoked by

impairment of mitochondrial electron transfer in human cells. Biochem. Biophys.

Res. Commun. 249, 542-545.

Suniki, Y.J., Forman, H.J., & Sevanian, A. (1997). Oxidants as stimulators ofsignal

transduction. Free. Radic. Biol. Med. 22, 269-85.

Swedes, J.S., Dial, M.E., & McLaughlin, C.S. (1979). Regulation of protein synthesis

during early limitation of Saccharomyces cerevisiae. 1. Bacteriol. 13 8, 162- 170.

Taanman, J.W., Turina, P., & Capaldi, R.A. (1994). Regulation of cytochrorne c oxidase

by interaction of AT' at two binding sites, one on subunit Wa. Biochemistry. 33,

11833-1 1841.

Thomas, ].A, Poland, B., & Honzatko, R. (1995). Protein suühydryls and their role in the

antioxidant fiinction of protein S-thiolation. Arch. Biochem. Biophys. 3 19, 1-9. Travers, GA, Debenham, P.G., & Pongs, 0. (1980). Translation initiation factor 2 alters

transcriptional selectivity of Escherichia Coli ribonucleic acid polymerase.

Biochemistry. 19, 165 1-1656.

Trump, B.F., & Berezesky, [K. (1992). The role of cytosolic ca2*in ce11 injuiy, necrosis

and apoptosis. Curr. Opin. Cell. Biol. 4, 227-232.

Van den Bogert, C., De Vries, H., Holtrop, M., Muus, P., Dekker, H.L., Van Galen, M.J.,

Bolhuis, P.A., & Taanrnan, J.W. (1993). Regulation of the expression of

mitochondrial proteins: relationship between mtDNA copy number and

cytochrome-c oxidase activity in human cells and tissues. Biochim. Biophys. Acta.

1144, 177-183.

Vanderkooi, J.M., Erecinska, M., & Silver, I.A. (1991). Oxygen in Mammalian Tissue:

Methods of Measurement and ;Vtinities of Various Reactions. Am. J. Physiol. 260,

Cl 131-C1150.

Vatassery, G.T., Smith, W.E., & Quach, H.T. (1998). a-tocopherol in rat brain

subcellular fractions is oxidized rapidly during incubations with low concentrations

of peroxynitrite. J. Nutr. 128, 153- 157.

Vaux, E.C., Metzen, E., Yeates, K.M., & Ratcliffe, P.J. (200 1). Regulation of hypoxia-

inducible factor is preserved in the absence of a functioning mitochondrial

respiratory chain. Blood. 98, 296-302.

Vega, RB., Huss, J.M., & Kelly, D.P. (2000). The coactivator PGC-1 cooperates with

peroxisome proliferator-activated receptor alpha in transcriptional control of

nuclear genes encoding mitochondrial fatty acid oxidation enzymes. Mol. Cell.

Biol. 20, 1868-1876- ViUani, G., & Attardi, G. (2000). In vivo control of respiration by cytochrome c oxidase

in human cells. Free. Rad. Bioi. Med. 29,200-210.

Virbasius, J.V., & Scarpulla, R.C. (1994). Activation of the human mitochondrial

transcription factor A gene by nuclear respiratory factors: a potential regdatory link

between nuclear and mitochondrial gene expression in organelle biogenesis. Proc.

Natl. Acad. Sci. USA. 9 1, 1309- 13 13.

Wallace, D.C. (1992). Diseases of the mitochondrial DNA. Annu. Rev. Biochem. 61,

1175-12L2.

Wang, G.L, Jiang, B.-H., & Semenza, G.L. (1995). Effect of altered redox States on

expression and DNA-binding activity of hypoxia-inducible factor 1. Biochem.

Biophys. Res. Commun. 2 12, 550-556.

Webster, K.A., Gunning, P., Hardeman, E., Wallace, D.C., & Kedes, L. (1990).

Coordinate reciprocal trends in glycolytic and mitochondrial transcript

accumulation during the in vitro differentiation of human myoblasts. J. Cell.

Physiol. 142, 566-573.

Wdliams, R.S., Garcia-Moll, M., Mellor, J., Salmons, S., & Harlan, W+(1987).

Adaptation of skeletal muscle to increased contractile activity. Expression nuclear

genes encoding mitochondrial proteins. J. Biol. Chem. 262,2764-2767.

Wittenberg, B.A, & Wittenberg, J.B. (1985). Oxygen pressure gradients in isolated

cardiac myocytes. J. Biol. Chem. 260,6548-6554.

Wong, G.H.W., Kaspar, R.L., & Vehar, G. (1996). Tumor necrosis factor and

[ymphotoxin: protection against oxidative stress through induction of MnSOD. In: Stress-inducible cellular responses. (Feige, U., Morimoto, R.I., Yahara, I., &.Polla,

B.S., Eds), pp. 321-333. Birkhauser Verlag, Basel.

Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A.,

Cinti, S.. Lowell, B., Scarpulla, R.C., & Spiegelman, B-M. (1999). Cell. 98, 115-

124.

Xia, Y., Buja, L.M.,Scarpulla, R.C., & McMillin, J.B. ( 1997). Electrical stimulation of

neonatal cardiomyocytes results in the sequentiai activation of nuclear genes

governing mitochondrial proliferation and differentiation. Proc. Natl. Acad. Sci.

USA. 94, 11399-1 1404.

Xia, Y.,Buja, L.M., & McMiilin, J.B. (1998). Activation of the cytochrome c gene by

electrical stimulation in neonatal rat cardiac myocytes. Role of NRF-1 and cdun. I.

Biol. Chem. 273, 12593-12598,

Yang, W.-L., lacono, L.. Tang, W-M. & Chin, K.-V. (1998). NoveI Gnction of the

regdatory subunit of protein kinase A: regulation of cytochrome c oxidase activity

and cytochrome c release. Biochemistry. 37, 14 175- 14 180.

Youdim, M.B.H., & Riederer, P. (1997). Understanding Parkinson's disease. Sci. Am.

276, 52-59.

Zhao, X.J., Raitt, D-V-,Burke, P., CleweU, AS., Kwast, K.E., & Poyton, RO. (1996).

Function and expression of flavohcmoglobin in Saccharomyces wrevisiar.

Evidence for a role in the oxidative stress rssponse. J. Bioi. Chem. 271, 25 13 1-

25138. Table 1,l:A suminary of redox-regulated transcription factors, target genes, sequence recognition sites and stimuli known to modulate tlieir expression and/or activation.

------

Factor Cellular Targets Sequence recognition sites (5'+3') StimuludStress

catalase, hydroperoxidase Unknown Oxidative (H202)

MnSOD, G6PDH, SOXS' Oxidative (O2", 'NO) Endonuclease IV, fbmarase

NF-KB TNFa,MnSOD, cytokines Oxidative (H202)

AP- 1 kinases (e.g. PKC), Oxidative Cytochrome c

COX IV, COX Vb, COX Vlc Development, COX Vlla, nitTFA Chronic exercise Hyperthyroidism

WIF- 1 aldolase, LDH A, PK, Hypoxia GLUT 1, EPO, type II NOS iNOS

'~ern~leand Amabile-Cuevas 199 1 ; '~e~eret al., 1993; 3~bateet al, 1990; "irbasius and Scarpulla, 199 1; 'Semenza et al., 1996 Table 1.2: Metabolic intermediates and components of the ETC that are found within the mitochondria both as oxidized and reduced forms.

Oxidized form Reduced form

ETC ubiquinone (Q) ubiquinol (QHz) cytochrome bi33 cytochrome b ('3 cytochrome c (33 cytochrome c (?3

Nw-v+ NAD(P)H

Prosthetic pups w23 w23 Zn(")

Anîioxidants dehydroascorbate ascorbate a-tocopherol (R-O) a-tocopherol (R-OH) glutathione (GSSG) glutathione (GSH)

Amino acids thioI group (-S? thiol group (-SH) Figure 1.1: Organization of Complexes 1-V within the inner mitochondrial membrane.

Reducing equivaients (NADH, FADH*) donate electrons at Complex 1 and il, which are transferred down the electron transport chah and coupled with the proton motive force

(H-) to generate ATP. The adenine nucleotide translocase (ADNT) tùnctions as a transporter, exchanging ATP for ADP across the i~ermembrane,

Figure 1.2: Cellular pathways for the generation and interconversion of fiee radicals.

Superoxide anion (02'3 is fonned fiom oxygen via single electron transfer. 02'- rnay be dismutated by superoxide dismutase (SOD) to hydrogen peroxide (H202). H202is in turn reduced to water by either catalase or glutathione peroxidase (GPx), or yields the hydroxyl radical (.OH)via the Fenton reaction. 02'- may also react with nitric oxide (NO), which is synthesized by nitric oxide synthase INOS), to generate peroxynitrite (ONOO?.

Figure 1.3 : Interactions between endogenous antioxidants.

A. The stmcture of a-tocopherol. The phytyl tail allows for its insertion into the inner and outer mitochondrial membranes, while the tocol ring of the chroman "head works as an antioxidant. The structure of the tocol ring is such that upon oxidation of the -OH group to -0,it remains stable and allows for either its reduction or tiirther oxidation. B.

NADPH-dependent metabolic pathway for the reduction of partially oxidized a-

tocopherol. NADPH, glutathione (GSH)and ascorbate act in concert to reduce panially

oxidiied a-tocopherol, with NADPH being supplied via the pentose phosphate pathway

m'ph

Chapter 2. Interactions between bioenergetics and mitochondrial

biogenesis2

ABSTRACT

We studied the interaction between energy metabolism and mitochondrial biogenesis during myogenesis in C2C12 myoblasts. Metabolic rate was nearly constant throughout differentiation, although there was a shift in the relative importance of glycolytic and oxidative rnetabolism, accompanied by increases in ppvate dehydrogenase activation state and total activity. These changes in mitochondrial bioenergetic parameters observed during differentiation occurred in the absence of a hypermetaboiic stress. A chronic (3 day) energetic stress was imposed on differentiated myotubes using sodium aide to inhibit oxidative metabolism. When used at low concentrations, azide inhibited more than 70% of cytochrome oxidase activity without changes in bioenergetics (either lactate production or creatine phosphorylation) or mRNA for mitochondrial enzymes. Higher azide concentrations resulted in changes in bioenergetic parameters and increases in steady state COX ti mRNA levels. hide did not affect mtDNA copy number or rnRNA levels for other mitochondrial transcripts,

suggesting aide affects stability, rather than synthesis, of COX U mRNA. These resuIts

indicate that changes in bioenergetics can alter mitochondrial genetic regulation, but that

mitochondrial biogenesis accompanying differentiation occurs in the absence of

hypennetabolic challenge.

'Lean;. SC, Banersby, BI. Hansford, RG. and Moyes. CD. (1998). Interactions behveen bioenergetics and mitochondriai biogenesis during rnyogenesis. Biochirn. Biophys. Acta. 1365: 522-530. INTRODUCTiON

Genetic control of mitochondrial biogenesis requires the coordinated expression of genes in both the nucleus and mitochondria. Mitochondria DNA (mtDNA) copy number is a primary regulator of mitochondrial gene expression (1) whereas expression of nuclear DNA is increased through both transcriptional (2) and post-transcriptional mechanisms (3). Coordination of nuclear gene transcription is thought to be achieved by shared activators including the nuclear respiratory factor family (4), OXBOX (9,

REBOX (6), YYI (7) and MT1, -3. and -4 (8.9). Apart fiorn coordinating nDNA expression, there is evidence that several of these factors also influence mtDNA replication, transcription and mRNA processing (9- 12). While an increasing number of respiratory genes are found to possess these regdatory elements, the reguiatory links between physiological stressors (i.e. hypermetabolic stress) and controi of respiratory gene expression remain eiusive (13).

Mitochondrial prohferation occurs in muscle in response to chronic hypermetabolic conditions, such as endurance training, electrical stimulation and hyperthyroidism (L3.14). A number of studies have demonstrated that factors which decrease metabolic rate or mitochondrial efficacy alter the expression of genes for respiratory proteins, supporting the hypothesis that prolonged elevations in metabolic rate directly or indirectly induce mitochondrial enzyme synthesis. Tetrodotoxin treatment of neurons leads to a decrease in mRNA for COX proteins (15). Hypoxia exens a reciprocai control on giycolytic (increase) and mitochondrial (decrease) enzymes in myotubes (16).

ParaIysis of myoblasts, however, does not Iead to changes in the activities of oxidative enzymes (17). There is littte evidence for direct links between regdators of metabolic rate (e.g. phosphorylation potentiai, 18) and induction of mitochondrial biogenesis under hypermetabolic conditions. Cytoplasmic translation is regulated by GTP:GDP ratios (tg), although it is not clear if the changes which occur in vivo are great enough to have physiological relevance (20). High IeveIs of ATP have been shown to both inhibit mitochondrial RNA poiyrnerase activity (21) and stimulate mitochondriai translation

(22).

Differentiation of myoblasts into myocytes is also accornpanied by mitochondrial biogenesis, as indicated by increases in mtDNA, marker enzyme activities and mRNA levels (16, 23-25). Mitochondrïa-deficient myobiasts fail to form into myotubes (26), but the connections between mitochondrial biogenesis, myogenesis and bioenergetics have not been established. At present, it is not known if the regulatory control of mitochondrial biogenesis in hypermetabolic adaptation is tùndamentally similar to that in celIuiar differentiation. In contrast to the apparent coordinated expression during hypermetaboiic challenges (14), the expression of respiratory genes during cellular differentiation can be asynchronous (25). It is also unknown if the differentiation-induced mitochondrial biogenesis is accompanied by changes in either metabolic rate or bioenergetic regdation.

Although cultured myoblasts are widely used in studies of rnitochondrial biogenesis and myogenesis, relatively Little is known about their rnetabolic properties. [n

the present study, we use an irnmortaiized rnouse skeletal muscle ce11 line (C2C 12) to

investigate the relationship between energy metaboIisrn and mitochondrial biogenesis.

We initially consider how bioenergetics change in response to differentiation. We then

examine the influence of ai5de on respiratory gene transcript levels in differentiated rnyocytes, since the responsiveness of myocytes to energetic stress is superimposed upon the intrinsic relationships between respiratory genes and myogenesis.

MATERlALS AND METHODS

Cell culture

C2C12 cells were grown in Dulbeco's minimum essential medium (DMEM),

containing high glucose, glutamine and pyruvate, supplemented with 20% fetal bovine

serum. At 70% cotifluency, the medium was changed to DMEM supplemented with 2%

horse serum. Penicillin, streptomycin and neomycin were included in ail media. Al1

media, sera and antibiotics were suppiied by Gibco-BRL.

Enzyme assays

Cultured cells were extracted in I ml of enzyme solubilization medium (20mM

Hepes, pH 7.2, 0.1% Triton X-100, 1 mM EDTA). Citrate synthase (CS), cytochrorne

oxidase (COX) and Complex t activities were assayed spectrophotometrically from

whole ce11 extracts using previously described protocols (25). Dichlorophenol-

indophenol was used as the acceptor for Complex 1 assays.

A radiometric assay for ppvate dehydrogenase (PDH) was employed to assay

both total PDH and the proportion present in the active, dephospho form. Cells were

extracted in a medium that prevents changes in phosphorylation (2mM EDTA, 5mM

dichloroacetate, 2mM dithiothreitol, 0.2% Triton X-100 in 50 mM Hepes, pH 7.7).

Conversion of PDH into its dephospho form was accomplished by incubation of the cells

with uncoupler (10pM FCCP) for IO min prior to extraction. This concentration (in the

presence of DMEM+2% horse serum) gave maximal rates of oxygen consumption in trypsinized suspensions of myoblasts (data not shown). Higher FCCP concentrations or longer incubations did not increase measurable PDH activity. Incubations were conducted in flasks sealed with rubber caps which contained a center well holding a glas fiber circle (934 AH). Enzyme was added to the assay medium (2 mM NAD', 0.6mM coenzyme A, 0SmM cocarboxylase, 1mM dithiothreitol, ImM MgClz, 0.1% Triton X-

100, 20 mM Tris-HC1 pH 8.0) for a 4 min pre-incubation in a 37°C water bath. The assay

was started by addition of pyruvate (100pM final concentration) with approximately

200,000 DPM ''~-l-~yruvate. Incubations were stopped with 0.1 volume of 70%

perchloric acid. Hyarnine hydroxide (150ul) was injected into the center well and CO^

collected for 90 min. Filters were removed and counted in scintillant containing 0.1%

acetic acid to reduce chemiluminescence. These reaction conditions gave a Iinear rate of

iJCO2 production for 20 min, although assays were routinely camed out for only IO min.

Metabolic rate determinations

Oxygen consumption was measured in C2C12 cells at O, 1, 3, 6, 9 and 12 days of

serum starvation. Culture flasks were filled with a solution of DMEhU1% horse serum

buffered with 6 mM HEPES and equilibrated to 10% CO?,and oxygen consumption was

monitored polarographically at 37°C using a Clark-type electrode interfaced with Vernier

Instruments Data Logger software. The rate of oxidative ATP production per milligram

protein was calculated by multiplying the rate of oxygen consumption by a conversion

factor that accounted for the volume of solution in the flask, the maximal saturation of

oxygen in water at 37"C, and the production of 5 moles of ATP per mole of consumed

02. The rate of glycolytic ATP production was also calculated at O, 1, 3, 6, 9 and 12 days of semm starvation by rneasuring lactate concentrations in the supernatant. Culture media was replaced with LOml fiesh DMEM/2% HS on each sarnphg day, and an aliquot of the supernatant rernoved immediately. Plates were incubated for 4hr, and a second aliquot of the supernatant was taken. Plates were washed twice with phosphate buffered saline, and cells extracted in 1 ml of solubilization medium (20rnM Hepes, pH

7.2, 0.1% Triton X-100, 1 rnM EDTA).

Metabolite assays

Lactate, phosphocreatine (Kr) and creatine (Cr) were analyzed using conventional spectrophotornetric techniques modified for use on microtitre plates. Lactate was assayed using lactate dehydrogenase (LDH') and the "hydrazine sink" method.

Lactate oxidation by LDH leads to equimolar NADH production, detectable at 340nrn.

Inclusion of hydrazine and use of high pH ensures the reaction goes to cornpletion. PCr was assayed using the enzymes creatine phosphokinase (CPK), hexokinase and glucose-

6-phosphate dehydrogenase. Cr was assayed using the enzymes CPK, pymvate kinase and LDH. The ratio of PCrICr is an index of energy status, through interactions of the adenylate pool with creatine pool mediated by endogenous CPK, which is assurned to be near-equilibriurn [By day 6, the onset of azide treatrnents, CPK activity has risen to near maximum activities (25)].

Mitochondrial mRNA and mtDNA

Total RNA was purified fiom guanidinium thiocyanate extracts using the acid phenol method. RNA was glyoxylated and electrophoresed on 1.2% agarose gels. Probes for mtDNA-encoded COX II and ATPase VI were obtained as previously described

(Moyes et al. 1997). Probes for COX 1, COX LU, COX IV, PK and ADNTl were constructed as outlined in Table 2.1. COX III, COX IV, and ADNTl were amplified tom first strand cDNA prepared fiom total RNA of rat gastrocnernius, and the nucleotide sequence confirmed by MOBIX (McMaster University, Canada). COX 1 and PK cDNAs were amplified fiom a plasmid containing the entire mouse mitochondrial genome and a

pure PK fragment respectively (both generousiy supplied by R.G. Hansford, National

Institute of Health). Blots were corrected for loading differences using a probe for a-

tubulin mRNA (generously supplied by W. Bendena, Queen's University). The probes

for mtDNA and mRNA were radiolabelled using random primers and 12p-dc~P.Blots

were exposed to a phosphorimager screen, and quantified using a phosphorimager

(Molecular Dynamics) dnven by lmagequant software,

Statistical analysis

Significant differences in steady state mRNA levels between treatment groups

were detected using one-way ANOVAs, and identified using Student-Newman-Keuls

Test. A repeated measures one-way ANOVA was used to test for significant differences

in the rate of ATP production as a function of time following serum starvation. RESULTS

Changes in metabolic rate with differentiation

Metabolic rate was highest in proliferating cells with approximately 30% of the ATP

being contributed by OXPHOS (Fig. 2. Ib). Once proliferation ceased, the metabolic rate

decreased slightIy and then remained constant throughout the differentiation perïod. Although the total metabolic rate was constant, there was a steady shifi toward a greater reliance on mitochondrial pathways (Fig* 2.lqb). By day 12, mitochondrial pathways contributed 61% of the total ATP used by the cens. This shifl was due to an increase in mitochondrial respiration coupled with a decrease in glycolytic rate.

Changes in pyruvate dehydrogenase

PDHt increased approximately 6-fold (Fig. 2.2~)during differentiation. As well as an increase in total enzyme, there was an increase in the proportion present in its active, dephospho fom (PDHa). In myoblasts the ratio of PDHaIt was approximately

50%, but as myotubes fonned, PDH became increasingly active to the point of being almost completely activated.

Azide effects on mitochondrial parameters and bioenergetics

Acute azide treatment inhibited respiration by myoblast suspensions with an 150 of approximately 1mM (Fig. 2.2a). Chronic Iow level aide treatment led to pronounced changes in the activity of COX. The degree of inhibition increased with time until reaching a maximum effect by 3 days (Fig. 2.2b). The activities of CS and Complex 1 were not affected by azide.

As much as 70% of COX activity could be inhibited without aEecting lactate production (Fig. 2.3a), creatine phosphorylation (Fig, 2.3b) or steady state levels of COX

U mR.NA (Fig. 2.4a). Greater degrees of inhibition stimulated glycolysis (Fig. 2.3a), decreased creatine phosphorylation (Fig. 2.3b) and increased COX Ii rnRNA approximately 4-fold (n=3) (Figs. 2.4b, 5). While mitochondrial DNA copy number was unafliected by the degree of COX inhibition (Fig 2.4a), COX II mRNA levels were highest following three days of azide treatment Fig. 2.6a). Steady state levels of other mitochondrial and nuclear mRNAs were unchanged using identical azide treatment protocols (Fig. 2.6b). DISCUSSION

Mitochondrial energetics in proliferating cells

Undifferentiated CX12 myoblasts appear similar to tumor cells in their dependence upon glycoiysis (27). Despite the availability of oxidizable hels (glucose, pyiuvate, arnino acids) much of the energy required for proliferation is derived ftom glycolysis. In the earjiest stages of differentiation, approximately 60% of the energy demands of the ceIl are met by lactate production fiom glucose (Fig. 2. la). However, several lines of evidence suggest this reliance upon anaerobic gIycolysis is not due to mitochondrial inadequacy. Addition of an uncoupler of OXPHOS (FCCP) more than doubles the respiration rate of suspended myoblasts (data not shown), suggesting mitochondria are capable of greater flux under the appropriate regdatory influences. The activity of PDHa (3.6 nmoledmirdmg protein, Fig. 2.lc), the first step in oxidation of mitochondrial pyruvate, suggests a capacity to yield 54 nmoles ATP/min/mg protein (3.6 x 15 AWpyruvate oxidized), compared to an observed rate of oxidative ATP production of 25 nmoledrnidmg protein (Fig 2.1b). Fwthermore, only 50% of PDH in myoblasts is present in its active, dephospho form. In many oxidative tissues, changes in PDHaft accompany changes in energetic demands (28). These observations suggest that oxidative rnetaboiism couid meet the bioenergetic demands of proliferating cells under the appropriate regulatory conditions- Mitochondrial energetics during myogenesis

In marnrnaiian skeletal muscle, hypennetabolic treatments such as exercise training and chronic electricai stimulation lead to mitochondriai proliferation (13,14). It is not clear if rnitochondrial biogenesis is induced directly by neural/hormonal factors or indirectly fiom persistent disturbances in energy metabolism arising through the recruitment pattern. In mitochondrial myopathies, the resulting bioenergetic disturbance may induce expression of the nuclear-encoded respiratory genes ADNTl and ATPP (29).

It is unlikely that, during myogenesis, metabolic demand per se is the ultimate cause of mitochondrial biogenesis, given that the metabolic rate during differentiation (Fig. 2. lab, sum of oxidative and glycolytic rates) is relatively constant at 55-85 nmoles ATPfmidrng protein.

Manifold changes in the activity of PDH (Fig. 7.lc,d) and other mitochondrial enzymes (25) coincided with a shiti in energy metabolism from primarily glycolytic

(66%) to predominantly oxidative (60%). A fiindamental change in the relationship between glycolysis and respiration is also predicted in previous studies which showed a shifi in adenine nucleotide translocase (ADNT) isoform expression. ADNT2 is an isoform expressed in glycolytic tissues whereas ADNT1 predominates in oxidative tissues such as skeletal and cardiac muscles. In C2C12 myoblasts. Ievels of mRNA deciine for ADNT2 but increase for ADNT1 with the onset of differentiation and myotube formation (30). Although there is no direct evidence for tûnctional differences in the isoforms, the tissue distribution suggests ADNT2 may have a role in transferring giycolytic ATP into mitochondria (see 30). The elevated oxidative capacity accompanying C2C12 differentiation is perhaps best illustrated by the changes in the capacity for flux through PDH (Fig. 2. lc). The calculated maximal flux through myoblast PDHa is 54 nrnoles ATPImidmg (PDHa= 3.6 moUmidmg x 15 mol ATPfnrnol pynivate). This capacity approaches that predicted fiom respiration studies (25 nmoleslmidmg) (Fig. 2.lb). During myogenesis there was a pronounced increase in both PDHt (Fig. 2. ic) and PDH activation state (Fig. 2.ld), leading to an increase in capacity to 480 moles ATPImidmg (15 nmol ATPInrnol pynivate x 32 nmollmidmg PDHa, Fig. Ic), 12.5-fold greater than that which would account for oxidative AIT requirements (37.5 nmollmidmg, Fis. 3. lb). The increased capacity and high PDH activation state do not reflect a cellular response to an increased metabolic demand, as metabolic rate did not increase dunng differentiation (Fig. 2. la). It

can fiirther be argued that the differentiating ceil was not in an energetic deficit as

glycolytic flux actually declined during myogenesis (Fig. 2. la). This disparity suggests

that regulatory conditions within the mitochondria (acetyl CoAKoA, NADHINAD',

ca23 were highly favourable for PDH interconversion towards PDHa, but were not

necessarily indicative of energetic demand. There is some potential for these same

regulatory factors to influence myogenesis and mitochondrial biogenesis. REBOX factor

binds to the element in an NADH-dependent manner (6), although the conditions

required (0-15mM NADH) are not physiologically realistic. caZ* is an important

regulator of both myogenesis and bioenergetics. Myogenesis is stnctly dependent on the

extracellular ca2* concentration (3 1). The ca2- ionophore A25 187 leads to an increase Ïn

expression of mitochondrial enzymes in prirnary cultures of rat muscle cells (17). Thus, it

has not been established if any of these bioenergetic regdators directly or indirectly influence rnitochondnal gene expression. More information exists, at present, on the presence of cis-elements of nuclear-encoded rnitochondnal genes than controi of expression of trms-factors bindmg to these elements.

Azide effects on mitochondrial energetics and gene expression

Azide is a welI known non-cornpetitive inhibitor of COX, in this study demonstrating an Iso of approximately 1 rnM (Fig. 2.2a). However, chronic treatment of

C2C12 cells with azide in the pM range also reversibly decreases COX activity (Fig.

2.2b). Bennett et al. (32) treated rats with low levels of azide via osmotic pumps and

created Alzheimer-like syrnptoms, inciuding a depression of measurable COX activity.

Chandel et al. (33) found that chronic hypoxia reduced the COX catalytic activity,

aithough the mechanism by which this occurs is unclear. Similarly, the molecular

mechanism by which low levels of azide inhibits COX activity is unknown. It did allow

us to introduce small, measurable degrees of metabolic inhibition to examine the

relationship between metabolic stress, mitochondnal energetics and gene expression. The

azide effects were specific to COX, as neither CS nor Complex 1 activity was affected

(Fig. 2.2b). Aide did not cause changes in lactate production (Fig. 2.3a) or creatine

phosphorylation (Fig. 2.3b) until more than 70% of the COX activity was inhibited.

Effécts on COX Il mRNA Ievels coincided with the point in the azide titration

where effects on bioenergetic parameters were apparent (70% inhibition of COX).

However, the changes in COX U mRNA with azide treatment are likely due to post-

transcriptionai regulation (e-g. mRNA stability) rather than an increased rate of

transcription. Mitochondrial transcription is generally thought to be primady regulated

by gene amplification and a5de did not affect mtDNA copy number (Fig. 2.4a). Also, because of the polycistronic transcript, mRNA for COX II is synthesized stoichiornetricaüy with COX 1, COX III, and ATPase W mRNA, the levels of which did not change with azide treatment (Fig. 2.5).

Although these resuIts argue for an azide-induced increase in COX II mRNA stability, the mechanism by which this occurs is not clear. There is evidence for the presence of cytoplasrnic proteins which bind the 3' untranslated region of mRNA of liver isofoms of COX ma, VtIt (34) and Via (35). However, there is no evidence for COX rnRNA binding proteins within mitochondria. Changes in rnitochondrial mRNA stability have been reported in developing rat liver (36) but the effect is not selective as al1 mRNA species are more stable. If the increase in COX ii mRNA is due to stability, the nature of the azide sensitivity of the process is unknown. Yeast possess an NTP dependent exonuclease which controls mtRNA turnover (37). A nurnber of pathways have been shown to be sensitive to either hypoxia or azide. Hypoxia exerts a reciprocal control on transcription of glycolytic (increase) and mitochondrial (decrease) enzymes (16). It has since been shown that the effects on glycolytic enzymes may be rnediated by the oxygen sensitive transcription factor KIF (hypoxia-inducible factor). Some genes have been shown to be similarly sensitive to both hypoxia and azide, suggesting an oxygen independent regulatory pathway (see 38). To Our knowledge there is no evidence for a similar pathway regulating activity of mRNA binding proteins, particularly for mRNA species Iocated within mitochondna,

in sumrnary, pronounced changes in mitochondna and bioenergetics occurred during rnyogenesis in the absence of a hypennetabolic challenge. When metabolic conditions were perturbed directly by azide, at le& one species of rnitochondrial mRNA increases, likely due to an increase in mRNA stability.

This research was supported by operating grants fiom NSERC-Canada (CDM),

Queen's University Advisory Research Council (CDM), Nationai Institutes of Aging

Intramural Research hnds (RGH). SCL was supported by an NSERC Canada post- graduate fellowship.

LITERATURE CI'ITED

1. Williams, RS. (1986) 1. Biol. Chem. 26 1, 12390-12394.

2. Williams, R.S., Garcia-Md, M., Meilor, J., Salmons, S. and Harlan, W. (1987) S.

Biol. Chem. 262,2764-2767.

3. izquierdo. J.M., Ricart, J., Ostronoff, L.K., Egea, G. and Cuezva, J.M.. ( 19%) J. Biol.

Chem. 270, 10342-10350.

4. Scarpulla, R.C. ( 1996) Trends Cardiovasc. Med. 6.3 9-45.

5. Li, K., Hodge, S.A. and Wallace, D.C. (1990) J. Biol. Chem. 265, 20585-20588.

6. Chung, AB., Stepien, G., Haraguchi, Y., Li. K. and Wallace, D.C. (1992) J. Biol.

Chem. 267,2lL%-Zi 161.

7. Basu, A., Park, K., Atchinson, M.L.,Carter, RS. and Avadhani, N.G. (1993) J. Biol.

Chem. 268, 4188-4196.

8. Suzuki, H., Hosokawa, Y., Hishikimi, M. and Ozawa, T. (1989) J. Biol. Chem. 264,

1368-1374.

9. Suzuki,H., Hosokawa, Y., Hishikimi, M. and Ozawa, T. (1991) J. Biol. Chem. 266,

2333-2338, 10, Evans, M.J. and Scarpulla, R.C.. (1989) J. Biol. Chem. 264, 14361-14368.

11. Haraguchi, Y., Chung, AB., Neill, S. and Wallace, D.C. (1994) J. Biol. Chem. 269,

9330-9334.

12. Virbasius, J.V. and Scarpulla, R.C. (1994) Proc. Natl. Acad. Sci. USA 91, 1309-13 13.

13. Wiesner R.J. (1997) Adaptation of mitochondrial gene expression to changing

cellular energy demands. NIPS 13,178- 184.

14. Hood, D.A., Balaban, A., Connor, M.K.,Craig, E.E.,Nishio, M.L., Rezvani, M. and

Takahashi, M. (1994). Can, J. Appl. Physiol. 19, 12-48.

15- Hevner, RF., and Wong-Riley, M.T.T.(1993) J. Neurosci. 13, 1805-18 19.

16. Webster, K.A., Gunning, P., Hardeman, E., WaIlace, D.C. and Kedes, L. (1 990) J.

Ce11 Physiol. 142, 566-573.

17. Lawrence, J-C. and SaIsgiver, W.J.(1983) Am. J- Physiol. 244, C348-C355.

18. Pette, D. and Dusterhofi, S. (1992) Am. J. Physiol. 262, R333-338.

19. Hucul, J.A., Henshaw, E.C. and Young, D.A.(1985) J. Biol. Chem. 260, 15585-1 559 1

20. Kwast, KI. and Hand, S.C. (1996) J. Biol. Chem. 271, 73 13-73 19.

21. Enriquez, J.A.. Fernandez-Silva, P.. Perer-Martos, A., Lopez-Perez, M.J. and

Montoya, J. (1996) Eur. J. Biochem. 237, 60 1-6 10.

22. Joyal J.L., Hagen T. and Aprille J.R. (1995) Arch. Biochem. Biophys. 3 19,322-330

23. Brunk, CF. (1981) Exp. Cell. Res. 136, 305-309.

24. Lomax, ML, Coucouvainis, E., Schon, E-A. and Barald, K.F. (1990) Muscle. Nerve.

13,330-337.

25. Moyes, C.D., Mathieu-Costeiio, O.A, Tsuchiya, N., Fiburn, C. and Hansford, RG.

(1997) Am. J. Physiol. 272 (Cell PhysioI. 4i), Cl345-Cl351. 26. Board, M., Humm, S. and Newsholme, E.A (1990) Biochem. J. 265,503-509.

27. Herzberg, N.H., Zwart, R., Wolteman, RA., Ruiter, J.P.N., Wanders, RJ.A.,

Bolhius, P.A. and van den Bogert, C. (1993) Biochim. Biophys. Acta 1181,63-67.

28. Behal, RH., Buxton, D.B., Robertson, J.G. and Olson, M.S. (1993) Am. Rev.

Nutr. 13,497-520.

29. Heddi, A., Lestienne, P., Wallace, D.C. and Stepien, G. (1993) J. Biol. Chern. 268,

12156-12163.

30. Stepien, G., Torroni, A., Chung, A.B., Hodge, S.A. and Wallace, D.C. (1993) J. BioI.

Chem.267, 14592- 14597.

3 1. Cox, PG. and Gunter, M. (1973) Exp. Cell. Res. 79, 169- 178.

32. Bennett, M.C., Mlady, G.W.,Kwon, Y.H.and Rose, G.M.(1996) J.Neurochem. 66,

2606-26 1 1.

33. Chandel, N., Budinger, G.R.S., Kemp, R.A. and Schumacker, P.T. (1995) Am. J.

Physiol. 268 (Lung Cell. Mol. Physiol. 12), L918-L925.

34. Preiss, T. and Lightowlers, R.N. (1993) J. Biol*Chern. 268. 10659-10667.

35. Schillace, R., Preiss, T., Lightowlers, R.N. and Capaldi, RA. (1994) Biochim.

Biophys. Acta 1188,391-397.

36.Ostronoff,L.K., izquierdo,J.M., and Cuezv&J.M (1995) Biochem. Biophys. Res.

Commun. 2 17, 1094-1098.

37. Min, J. and Zassenhaus, HP. (1993) J. Bacteriol. 175,62456253.

38. Ebert, BL., Firth, J.D. and Ratclie, P.J. (1995) J. Biol. Chem. 270, 29083-20089. Figure 2.1: Changes in energy rnetabolism dunng differentiation of C2C12 cells.

See Methods for complete description of techniques. Figure 3.1 a; Glycolytic (e) and oxidative (m) rates. Figure 2. Ib; Relative importance ofoxidative metabolism in ATP generation. Figure 2. Lc; Changes in pymvate dehydrogenase activity, expressed as total activity (PDHT, a) and that present in the active. dephospho form (FDHA, m). Figure

3. Id; PDm activity expressed as % of total activity. Ai1 data are presented as mean (+- sem).

Figure 2.2: Effects of acute and chronic azide treatments on C2C 12 myoblasts and

myotubes.

Figure 2.2a; Respiration was measured on cells coilected 1 day after serum starvation.

Rates are expressed relative to the untreated suspension. Figure 2.2b; Chronic effects of

low azide concentrations. Myotubes (day 6) were treated with azide (10 CiM) and

sampled over 6 subsequent days for cytochrome oxidase (a), citrate synthase (I)and

cornplex I (a)activities. Azide (mM)

O 2 4 6 Azide treatment (days) Figure 2.3: Effects ofazide concentration on C2C 12 enzymes and bioenergetic

parameters.

Myotubes (day 6) were treated with various azide concentrations (0-500CLM) for 3 days.

Figure 23a; Lactate production over 34h was measured in the culture medium. Plates were washed and extracted for cytochrome oxidase activity and protein determinations.

Data are expressed relative to the activity in untreated control. Paired data were ranked by degree of inhibition of COX. Each data point represents 10 separate determinations.

Figure 2.3b; Creatine (Cr) and phosphocreatine @Cr) were measured afler 3 days azïde treatment. The degree of COX inhibition was deterrnined on parallel plates. Cells were given fiesh medium 4 h before sarnpling. Plates were quickly rinsed in ice-cold phosphate buffered saline then extractcd imrnediately in 7% perchioric acid. COX inhibition Figure 2.4: Changes in mtDNA and mRNA in reIation to aide treatment.

Cells were treated with various azide concentrations for 3 days beginning at 6 days of serum starvation. Two series of plates were harvested for enzyme analysis, then subsequently extracted for DNA. A third senes was extracted for total RNA. 32~-d~~~

IabelIed COX U was used as a probe for both the mtDNA dot blot and the northern blot

(IOpg RNA~lane).Data for mtDNA copy nurnber are presented as mean of two separate azide titrations (each point in triplicate). Degree of COX inhibition is expressed relative to untreated control. COX inhibition

Li ;.. .-

COX-U mRNA Figure 2.5: Representative autoradiographs of mRNA LeveIs in CX12 cells treated 3

days with aide.

Each panel is a autoradiograph of blot of a L 2% agarose gel using 5pg (panels a and d) or 20 pg (panels b and c) glyoxylated total RNA per lane. Panel A, ATPase VI; B,

ADNT1; C, a-tubulin; D, COX U. In each panel, the le€t lane is O aide, center 50uM, right 500pM. Azide treatment increased lactate production 2-fold at 50pM and 5-fold at

SOOpM.

Figure 2.6: Levels of mRNA in C2C 12 cells treated with azide.

All data were obtained by probing total RNA blots (5pg for mitochondrial signals, 25pg for nuclear signals) with "P-~cTPlabelied cDNA probes, normalized with a-tubulin, and expressed relative to control. Figure 2.6a; Changes in COX II mRNA levels in controi (a) and azide-treated (I)(500CLM) C2C12 cells over 6 days relative to day O control. Figure 2.6b; düVA levels relative to controI for rnitochondnai and nuclear transcnpts in C2C 12 ceils treated with 50pM (open bar) and 500pM (closed bar) aide for 3 days (* denotes significant difference; pc0.05). Azide treatment (days) Chapter 3. Chronic treatment with azide in situ leads to an irreversible loss

of cytochrome c oxidase activity via hoioenzyme dissociation3

SUMMARY

Chranic treatment of cultured cells with very Iow Ievels of aide (IS0

COX activity (85%) was more pronounced than the loss of content (65%). Collectively, these data suggest that chronic &de treatment enhanced the rate of holoenzyme dissociation or degradation, possibly through interactions with the structure or coordiiation of heme m, and provide a potential mechanistic explanation for dserential

3 Leary. SC. Lyons. CN. CarIson CG, Kr& C. HilI. BC. Ko. K. Gtenim DM and Moyes. CD. (2001). Chmnic mtment with aPde in situ leads ta an irreversibie loss of cytochrome c o.uic&se activicy via holoenzyme dissociation. J. Biot. Chem In preparation. losses of catalytic activity and holoenzyme content observed in some models of COX deficiency.

INTRODUCTlON

Most ATP required by eukaryotic cells under resting conditions is generated aerobically by mitochondrial oxidative phosphorylation (OXPHOS)'. Maintenance of appropriate stoichiometries of OXPHOS complexes is critical, not only to ensure efficient flux of electrons through the ETC, but also to minirnize the potentially cytotoxic impact of mitochondnally-derived ROS (L,2).Declines in the content of individuai OXPHOS complexes frequently accompany cardiovascular and neurological diseases, as well as

(3,4).

The origins and consequences of the loss of a given OXPHOS complex are eequently studied in ceIl lines established fi-om patients with metabolic deficiency (5-7).

However, the pathophysiological consequences of complex deficiencies have aiso been studied using specific inhibitors to chronicaily impair cataiytic activity (2,8). Sodium azide is commonly used hi vitro as a rapid and reversible inhibitor of COX, the terminal enzyme of the ETC that catalyzes the transfer of electrons fiom reduced cytochrome c to molecular oxygen (9-1 1). The ability of azide to rapidly form a bndging ligand at the binuclear center, thereby inhibiting COX activity, has led to its fiequent use in acute

JThe abbreviations used are: ASMC. aortic smooth muscle ceUs :BCS, bathocuproine disulfonic acid: BHP, tert-butylhydroperoxide;COX qwhrome c oxidase: CS. citrate -hase: DCF-DA 2.7- dichiorofhorescin diacetate; ETC. electron transport chah: OXPHOS, osidativc phosphorylation: ROS. reactive O-ygenspecies; Hahydrogen peroside: SOD, superoside dismutase: DMEM, DuIbecco's Modified EagIes Medium; FBS, fetal bovine senun: GPK glutathione perosidase: GR glutathione reductase: GSR gfutathione; HRP, horseradish peroxidase: HS. horse serum: KPB, potassium phosphate baer, LDR lactate dehydrogenase; LM. laurylmaltoside: L-NAME. No-nitro-L-arginine methyl ester hydrochioride; NB-PAGE,native blue polyacrylamide gel electrophoresis: superoxide anion: :ON00 , peroxynitrïte: PBS, phosphate buOfered saline: PEP, phosphoenolpyuvate: PK ppvate kinase-. RNOS. reactive nitric oxide species; RP-HPLC: reverse phase high performance tiquid chrornatography SIN-1-3- studies, including those designed to address the roIe of rnitochondrial oxygen sensing in signal transduction (l2,13). Azide has also been used chronically to mode1 selective losses of COX activity observed in neurodegenerative diseases (14,lS). We previously reported that chronic treatment of cultured myocytes with rnicromolar levels of aide results in the irreversible inhibition of COX activity (14). This mode of inhibition ciearly diiers from the classic mechanism of azide-mediated COX inhibition in that it is of higher affinity (0.0 1-0.1 mM vs 1- l OmM) and irreversible in nature. The mechanism(s) and signalling pathways by which azide rnediates these effects were unknown. Moreover, their potential relevance to COX deficiency observed in a more physiologically relevant context had not been evaluated despite previous reports of selective COX losses leading to Alzheimer's disease-like symptoms in rats that had been chronically infused with sodium aide (1 5,16).

Several plausible mechanisms exist that could account for the azide-mediated, irreversible inhibition of COX activity. Firg the capacity of azide to act as a chelator of first order transition series metals could affect COX activity by either terminal binding to or stripping of one or both copper centers fiom highly conserved domains within rnitochondrially-encoded subunits I and II (Cu,, on COX II, Cus on COX 1; 1 1,17).

Second, since copper metabolism is criticai to the maturation and assembly of individual

COX subunits into a hnctional haloenzyme complex (18-20), &de may impair either its delivery or insertion into the complex. Third, azide may act as a suicide metabolite to inhibit COX activity during enzyme turnover in a rnanner analogous to aicide-mediated loss of catalase activity (21). AccordingIy, it has recently been show that the COX-

morphilinosydnonimuie: SNAP. S-nimso-N-acetyIpenadIamine; TAP. thiamphenicol; XO. xanthine oxidase. rnediated conversion of azide to the azidyl radical leads to its irreversible inactivation in vitro, aithough this mechanism requires very high concentrations of both aide and Hz02

(22). Fourth, chronic azide effects on COX activity rnay arise indirectly fiorn elevated bulk phase production of ROS since it is also a potent inhibitor of SOD (23) and catalase

(2 lJ4) activities.

In the present study, we systernatically addressed these possibilities to dari@ the mechanisms by which azide irreversibly inhibits COX activity. Collectively, our studies suggest that aide accelerates the rate of dissociation ancilor degradation of COX, possibly through interactions with the structure or coordination of heme moieties.

EXPERMENTAL PROCEDURES

Cell culture

Al1 culture media, sera and antibiotics were purchased fiorn Gibco-BRL. C2C 12 cells were grown in proliferation medium consisting of DMEM supplernented with 10%

FBS. At 70% confiuency, myoblasts were switched to differentiation medium consisting of DMEM supplernented with 2% HS. Penicillin, streptornycin, and neornycin were inciuded in ail media. Media was changed every 2 to 3 days in serurn-starved cells.

HEK293 and ASMC were cultured in DMEM supplemented with IO% FBS, while PC 12 and Sol8 cells were maintained in DMEM containing 20% FBS.

Enzyme assays, metabolite analyses and respiration measurements

Plates were rinsed once with PBS and extracted in lm1 of enzyme solubiiiiation buffer (20mM Hepes [pH 7-21, ImM EDTA and 0.1% Triton). Assays were perfonned on a Molecular Devices SpectraMAX PIus spectrophotorneter thermostated to 37°C. The activities of Complex 1 (EC 1.6.5.3), COX (EC 1.9.3. l), CS (EC 4.1.3.7) and LDH (EC

1.1.1.27) were measured from whole cell extracts using previously described protocols

(25). The activities of individual ETC enzymes were also assayed using isolated mitochondria according to Bindoff et al. (26). Assays for al1 other enzymes described in detail below were optirnized to ensure that neither substrates nor co-factors were limiting.

Complex V (EC 3.6.1.34). The Anase assay contained (in mM) 5 MgCl*. 100

KCl, 1 phosphoenolpymvate, 5 ATP, 0.15 NADH, and 1U each LDH and pyruvate kinase in 50 HEPES (pH 7.4) in the presence and absence of saturating amounts of

oligomycin (0.24-0.72~~).No NADH oxidation was observed in the absence of

mitochondria.

Stiperoxide dismzitase (SOD)(EC l.Ij.I.1). Total cellular SOD was assayed at

550nm using the aerobic xanthinelxanthine oxidase (XO) system (27,28). The assay

contained (in rnM) 0.1 EDTA, O. 1 xanthine, 0.04 oxidized cytochrome c, and 20 U/ml

XO in 50 KFB (pH 7.8). In the absence of homogenate, XO reduced cytochrome c at a

rate of 80-120 ODfmin. 1 unit of total cellular SOD activity corresponds to the arnount of

homogenate required to inhibit the rate of cytochrome c reduction by 50%. No reduction

ofcytochrome c in the absence of XO andor enzyme was observed.

Relative contributions of CdZn and MnSOD isozymes to total celIular SOD

activity couId not be reliably quantified using whole cell extracts. As a result, MnSOD

activity was measured fiom mitochondrial extracts in the presence of 5mM KCN to

inhibit any contaminating CdZn SOD. Giutathiorie peroxide (GPx) (f.fl.f.9).The assay contained (in mM) 1 GSH, 0.15

NADPH, 1.2 BHP and 0.6Ufd GR in 50 KPB (pH 7.0). Activity was detected as the disappearance of NADPH at 340nm.

Cataiase (I.fI.f.6).Samples were sonicated with one 5s burst (Virsonic 60,

Virtis). Activity was detected as the rate of disappearance of 20mM H202at 240nm in

50mM KPB (pH 7.0) (29). Rates of Hz02 IOSS were linear for 60s. Specific activity of catalase was calculated based on a mM extinction coefficient 0189.3.

Protocols for measuring celiular protein content, lactate concentration in the culture media, and whole cell respiration were as previously described (14).

Fluorescence microscopy

Subconfluent myobIasts were grown in DMEM (10% FBS) on poly-l-lysine treated glass coverslips and treated with O or IOONazide for 24 h. Coverslips were fitted to a 260 pl pertùsion chamber thermostated to 37°C (Wamer Instruments) on a

Zeiss fluorescent microscope stage, supertùsed for 35min with PBS suppiemented with

(in mM) 35 ducose, 4 giutamine, 1 pyruvate, 1.8 CaClt, 0.8 MgSOj and 1% PSN containing 5pM DCF-DA (Molecular Probes). Fluorescence was measured (20X magnification, 100 rns exposure, 4x4 binning) using a CCD camera (Cooke Sensicam) and optical filters appropnate for DCF fluorescence (excitation pe&, 490nm; emission

peak, 526nm). The same cells were subsequently pertùsed for 5 min with 5mM H202to

obtain maximai fluorescence (30). The mean pixel intensities of cells and background

were determined using Slidebook (Intelligent imaging Innovations). Due to excitation-

dependent orcidation of DCFH, only one field of view was analyzed on each coversiip. Electrophoresis and immunoblotting

Plates were rinsed and harvested in ice-cold PBS. Pelleted cels were flash fiozen in liquid nitrogen, and stored at -80°C for at least 24h. Thawed cells pellets were resuspended in ice-cold isolation buffer (250mM sucrose, 2OmM HEPES [pH 7.41 and

ImM EDTA) supplemented with a protease inhibitor cocktail (Sigma), and homogenized with 10 passes through a pre-chilled, zero clearance homogenizer (Kontes Glass Co.).

Cell debris and nuclei were pelleted with two, 5 minute spins at 650 xg(4°C). The resultant supernatant (S 1) was spun at 4°C for 15 minutes at 14,000 xgto collect the mitochondriai fraction.

SDS-PAGE of rnitochondrial and S 1 fiactions was essentially as described by

(3 1). Denatured samples were resolved using a 12% SDS-PAGE gel, and electroblotted

(Biorad, Mini-protean systern) ont0 nitrocellulose membrane (Zymotech Inc.). Polyclonal antibodies directed against CdZn and MnSOD (StressGen Biotechnologies Corp.), COX

II (Dr. E.A. Shoubridge, Montreal Neurological Institute), and cytochrome c (Santa Cruz

Biotechnologies) and monoclonal antibodies for anti-COX 1, COX IV and ND 1

(MoIecular Probes) were diluted to 1: 1,000. A human monoclonal antibody for anti-porin

(Calbiochem) and a rabbit polyclonal antibody for anti-actin (Sigma) were diluted to

1:5,000. A rabbit polyclonal antibody for anti-catalase (Rockland) was diluted to

1:25,000. COX 1 and IV antibodies were resuspended in PBS containing 1% BSA and

0.1% Tween 20. AI1 other antibodies were reconstituted in 50mM Tris-HCl (pH 8.0), l5OmM NaCl and 0.05% Tween 20 (TBS-T)supplemented with 2% low fat skim milk powder. Membranes were blocked for lh at room temperature in TBS-T supplemented with 5% low fat skim milk, and incubated ovemight at 4°C in the primary antibody of interest. FoUowing a lh incubation at room temperature with either secondary anti- mouse or anti-rabbit HRP antibodies (Promega 12,500; Pierce 1: 10,000), immunoreactive proteins were detected by luminol-enhanced chemiluminescence

(Pierce)-

Native blue eiectrophoresis (NB-PAGE) was performed essentially as desaibed by Schagger and colleagues (32,33). Mitoplasts were isolated using a 0.5: 1 digitonin to protein ratio (34) and 75pg were solubilized on ice for 30min in 50p1 of 7SOmM 6- aminocaproic acid, 50 mM BISTRE (pH 7.0), 0.25rnM EDTA and 1% w/v lauryl maltoside (LM) (Anatrace). SampIes were centrîtùged for 20 minutes at 14,000 w g, and the relative distribution of Complex I activity between the pellet and the extract measured as an index of solubilization (extract typically contained 8590% of the total activity).

Loading dye was added to each sarnple at a 4: 1 ratio of Coomassie:LM and equal units of

CS were loaded in each Iane of a 5-18% continuous gradient gel. Samples were electrophoresed at 30V for 1 h to aIIow for protein entry into the stacking gel, and then at

90-1OOV for the remainder of the run. One third of the way through the run, the cathode buffer was switched fiom 0.02% Cuomassie to colourless. Gels were .en until the dye fi-ont rnigrated to the end of the gel, and either electroblotted or electrophoresed in the second dimension (3 5).

Spectral and heme analyses

Mitochondria ( IOmglml) were solubiiiied on ice for 1h in 750mM 6- aminocaproic acid, 50mM BISTRE (pH 7.0) containhg 1% w/v Triton X-100. Samples were centrifùged for 10 minutes at 14,000 xgto rernove debris, and the resultant pellets assayed for Complex 1 activity to ensure cornplete solubilization. W-visible spectra were

LOO recorded on an OLIS-refùrbished Arninco DW-2 WMS spectrophotometer at room temperature, and are presented as reduced-oxidized differences. The oxidiied state is taken as the form of the sample in air and is unchanged upon addition of femcyanide.

The reduced state is generated by addition of a few grains of solid sodium dithionite to the air-oxidized sample. Total heme A content fiom 3mg of mitochondrial protein was extracted and measured by RP-HFLC as previously described (36).

RNA isolation and northem analysis

Total RNA was purified Fiom guanidium thiocyanate extracts using a standard

acid phenol protocol(37). RNA was quantified in triplicate spectrophotometrically,

denatured and fiactionated using a standard 1% agarose-formaldehyde gel system. A

cDNA for the muscle-specific isoform of COX Vla was amplified fiom rat soleus

reverse-transcriptase template at 60°C with 5'-ctgacctttgtgctggctct-3' and 5'-

gattgacgtggggattgtg-3 ' using standard PCR conditions. The PCR product was cloned into

pCR 2.1 (Invitrogen) and its sequence confirmed. Ail other probes for mtDNA- and

nuclear-encoded rnRNA species were obtained as previously described (14,25).

Membranes were prehybridized (3h) and hybridized (12-18h) respectively at 65°C

in modified Church's buffer (0.5M sodium phosphate [pH 7.01, 7% SDS and lOrnM

EDTA). Membranes were washed twice at room temperature for 15 minutes with 2X

SSC/O.I% SDS, and twice at 50°C for 15 minutes with O. IX SSC/O.l% SDS. Blots were

phosphotimaged and relative signai strength quantified using imagequant software

(Molecular Dynamics). DEerences in loadig across lanes were normalized using a

probe for a-tubulin mRNA Pulse-chase labelling experiments

Pulse labelling of mitochondrid translation products was performed essentially as described by (38). Briefly, myotubes grown in 60mm plates were washed twice with sterile PBS and incubated for 30 min in pre-warmed, methionine-tiee DMEM supplemented with 2% dialyzed HS. Following an additional 5 min incubation in the presence of 100pg/ml emetine, cells were incubated with 400pCi EXPRE35 S35 S protein labeling mix (NEN)for 1h. Excess labe1 was chased by the addition of regular

DMEM/2% HS for 10 min. Cells were washed 3 times with PBS and harvested by trypsinization. Samples (10pg) were sonicated on ice and fractionated on a 1220% gradient gel at 7mA for 15h. The gel was then fixed for 1 h and dried for autoradiography.

Statistical analyses

Sigificant differences (p

measured parameters were detected using one-way ANOVAs, and identified post hoc

using the Tukey-Kramer HSD. RESULTS

Chronic azide treatment results in an irreversible loss of COX activity, a

concomitant decline in whoie cell respiration, and a resultant bioenergetic stress

Chronic treatment of C2C 13 cells with micromolar amounts of &de caused an

irreversible, the-dependent loss of COX activity (data not shown; I4), a paraiieI decline

in whoIe ceIl respiration and a concomitant increase in the rate of intraceiiular lactate

accumulation (Fig. 3.1A). The azide effect on COX activity was also observed in three

other ce11 backgrounds (HEK293,PC 12 and ASMC), with a 24h treatment with LOOW mide resulting in the inhibition of approximately 80% of total activity (20.6*5.8 % of control; Fig. 3.1B).

To detennine whether azide required access to the binuclear center in order to irreversibly inhibit COX activity in situ, C2C 12 and Sol8 myotubes were co-incubated with equimolar arnounts of azide and cyanide. Despite cyanide's much higher relative affinity (1pM vs 64CLM) (10,39) and its ability to competitively displace bound azide fiom the binuclear center in vitro (40), it neither attenuated nor abrogated azide-mediated

COX inhibition (Table tII.1). tn contrast, cyanide added at a 100-fold molar excess was able to attenuate but not abrogate the azide effect (Table 111.1). These results collectively suggest that while elevated cyanide concentrations were able to impair azide interactions with the holoenzyrne via a trans effect (see IO), chronic azide effects on COX activity were not contingent upon binding to the binuclear center.

A mutually exclusive, but equally plausible interpretation of these results is that aide may oxidatively damage the holoenzyme through transient interactions with thiol groups or other charged residues with a consequent loss offùnction. However, several experirnental manipulations argue that the deciine in COX activity is not simply expiained by direct azide interactions with the holoenzyme that result in genenc oxidative damage. First, diaiysis of azide-treated C2C 12 ce11 extracts in the presence or absence of reductant (P-mercaptoethanol, dithiothreitol) for 24h at 4OC was not able to restore catalytic activity (24.7 vs 23.3% of control; data not shown). Second, the irreversible Ioss of catalytic activity could not be mirnicked by chronic in vitro dialysis of previously untreated C2C 12 extracts, rat skeietal muscle homogenates or purified bovine COX with

0-100p.M azide at 4°C (data not shown). Third, loss of cataiytic activity was not recovered in siltr, 24h afler the rernovai of &de fiorn the culture media (100@f for 6h

+/- washout; 32.5 vs 48.6% of control).

Chronic azide effects on mitochondrial enzymes are specific to COX and do not require a functionally intact respiratory chain

Because azide-induced COX losses only occurred in siltr, we investigated the potential requirement of an intact ETC to the observed aide effects (see 4 1). Previous reports that azide is a potent inhibitor of the ATPase activity of Cornplex V (42,43) also prompted us to evaluate its effects on the activity of a spectrum of other mitochondrial enzymes. AIthough azide treatrnent resulted in a significant loss of COX activity, it had no efea on a Krebs cycle enzyme (CS), individual complexes of the ETC, and the

ATPase component of Complex V (Fig. 3. IC). Incubation of CXl? cells for 24h with specific inhibitors of Complexes I (O-20nM rotenone) and ILI (2pg/ml antirnycin A, O. I-

IOph4 myxothiazol) in the presence or absence of azide neither caused a specific COX loss nor abrogated &de-rnediated COX losses (data not shown). While 24h incubations with oligomycin (0-2.4pg/rnl), a Complex V inhibitor, enhanced the specific loss of COX activity mediated by azide (Table III-LI), rnarked inhibition of 35~-incorportaioninto mitochondrial translation products (36.2% of control; data not shown) suggested that the oligomycin effect was attributable to reduced rates of COX assernbly.

Chronic azide effects on COX activity are independent of changes in bulk phase

ROS production

Although other bioenergetic enzymes were unatFected by azide treatment, marked

ùihibition of CulZn SOD (12.&3.6% of control) and catalase (30.8*1.3% of control) was observed (Fig. 3. ID). This presented the possibility that aitered cellular capacity to metabolize ROS may contribute to the loss of COX activity. However, myoblasts treated for 24h with LOOpM azide showed no increase in DCF fluorescence, an indicator of Hz02 production, despite 70% losses in COX activity (Figs. 3.24B).

To tiirther confirm that azide effects on COX were not mediated by altered ROS production, C2C 12 myotubes were treated for 24h with a spectrum of pro-oxidants.

Treatment with the 02'- generator paraquat (44) and the catalase inhibitor aminotnazole

(45) alone and in combination did not result in a loss of COX activity despite having significant effects on cellular capacity to metabolize ROS (Figs. 3.2C,D). A cornplementary approach, in which myotubes were incubated with a series of antioxidants, also failed to prevent azide-induced COX losses. Treatments included supplementation with sodium selenite (46), which induced a 4-fold increase in GPx content (Fig. 3.2C), and chernical antioxidants NAC (H202),Tiron (07.-),carnosine (02J and mannitol (hydroxyl radical) (each O. 1-lmM) (n=3, data not shown).

NO is a well known, reversible inhibitor of COX (47,48). One of its metabolic by- products, ONOO-, may also be catabolized by COX, a process that leads to its catalytic inactivation (49). We therefore considered the potential contribution ofaltered NO and

RNOS metabolism to the azide effects. No effects comparable to &de-dependent Iosses in COX were seen with the NO and ONOO-generators SNAP and SIN-L (0.01-3mM), the NOS inhibitor L-NAM. (O. l-lmM) or the soluble guanylyl cyclase inhibitor 8- bromo-cGMP (5-500nM) (data not shown). Chronic aide treatment does not affect the levels of mitochondrially- and nuclear-enwded COX mRNAs and proteins

Northem and western analyses were conducted to evaluate whether the loss in catalytic activity was accompanied by changes in steady-state mRNA andor protein levels of individual COX subunits. Steady-state mRNA levels of two mitochondriaily- encoded (COX I, II) and two nuclear-encoded subunits (COX IV, VIa) were unchanged following 1, 3 or 6 days of treatment with 50pM aiide (Fig. 3.3A; n=j). Lack of a generai protection of COX 11 mRNA in response to azide-mediated COX inhibition (see

14) was fùrther confirmed by measuring COX IVCOX 1 mRNA ratios fiom aide titrations of ASMC, HEK 293, PC 12 cells (data not shown). Steady-state protein levels of

COX 1, II and IV subunits were also comparable in azide-treated and control celis following either 1 or 3 days treatment with lOOpM aide (Fig. 3.3B). Similarly, leveis of the ND1 subunit of Complex I and of cytochrome c, the electron donor to Complex IV, were unaffected by &de treatment.

To address whether azide inhibited the synthesis of individual subunits required for complex assembly without altering the levels of pre-existing ETC enzymes, the rate of mitochondrial protein synthesis was measured in control and aiide-treated ceils. kide had no effect on the rate of mitochondnai protein synthesis, either acutely (added with label) or chronicaily (added 24hr prier to pulse-chase) (data not shown). Parallel treatment of myocytes with aide and TM, a rnitochondrial-specific inhibitor of translation (50) reveaied that both agents caused significant iosses of COX activity without affecting the activities of Complex 1 and CS (Fig. 3.4A). However, despite a 65% depression in the rate of rnitochondrial protein synthesis relative to controls, the TAP- induced loss of COX activity was significantly slower than that observed with azide (Fig.

3.4B).

Aride-mediated loss of COX activity is accompanied by a lesser decline in heme aa~levels that is refiective of reduced holoenzyme content

Irreversible losses of COX activity could conceivably arise as a result of damage to either its metal centers or surrounding protein moieties without a decline in holoenzyme protein content per se. To darifi the molecular buis of the defect in catalytic activity, difference spectra were generated hmsolubilized rnitochondria.

Although the Ieveis of cytochromes b (243 vs 27 1 nM) and c (225 vs 295 nM) were comparable in control and azide-treated samples, cells exposcd to 100pM aïide for 24h displayed approxirnately a 65% reduction in aa3 content (22 vs 7nM; Fig. 5A). CO- derived difference spectra revealed that whiIe sas content was markedly reduced in azide- treated cells, the integrity of the binudear center of residual COX was preserved (data not shown). Subsequent analyses of total heme A content by W-HPLC confirmed the loss of herne aa3 in &de-treated cells (heme Nprotoheme 0.54 vs 0.20; Figs. j .5B,C).

To determine whether COX content declined in parallel with catalytic activity and heme aa3, holoenzyme levels were detected imrnunologicalIy following native electrophoresis of sohbilized rnitochondrial proteins hmC2C 12 cells treated with O or

100phd azide for 24h. When normalized to Complex 1 Ieveis, COX content was reduced by approximately 65% in azide-treated cells (35915.2% of control, Fig. 3.6A).

Overexposure of aii ECL-detected COX subunits from first and second dimension gels

did not reveai additiond bands suggestive of either a partially assembled or degraded

holoenzyme in azide-treated celis. Chronic azide effects on COX do not involve copper chelation

Azide's ability to act as a monodentate chelator of first transition series metals by binding to open coordination sites raised the possibility that it also exerted its effects on

COX content by either chelation or stripping of its copper centers. To evaluate the

potential importance of ligand interactions with the copper centers in contributing to

azide-induced COX losses, C2C 12 celis were incubated with LOpM azide in the presence

or absence of CuCI2 and the copper chelators neocuproine and BCS (Fig. 3.6B). Azide

effects on COX activity were unperturbed when it was added in combination with a 10-

fold molar excess of CuC12. Treatrnent with either neocuproine or BCS failed to mirnic

the effects of azide on COX, although marginal losses in COX activity (-35% of total

activity in 24h) were observed. Moreover, the effects of azide and copper chelators on

catalytic activity were additive, suggesting different modes of action.

DISCUSSION

The present study characterized the mechanism by which chronic azide treatment

mediates irreversible COX losses. While aide has traditionally been used irr vitro as a

rapid and reversible inhibitor of COX açtivity (9, IO), it bas been shown that chronic

exposure results in "selective" and irreversible COX losses, both iri sittr (14) and irt vivo

(15,16). However, the mechanistic basis of these two distinct effects on COX had not

been previousIy investigated. Since selective COX losses and Alzheimer's disease-like

symptoms have been observed in rats chronicaILy infùsed with azide (15,51), this rnodel

may be clinicaüy relevant to the pathophysiology of COX deficiency.

The primary hding of the present study is that chronic azide treatment causes the

irreversible loss of COX activity by reducing holoenzyme content. Interestingly, the Ioss of COX activity was pater than the decline in COX content, assessed by the three independent indices (spectroscupy [ai3],RP-HPLC [total heme A] and NB-PAGE

[holoenzyme levels]). This suggests that damage induced by aide rnay be sustained at the level of the hoIoenzyme that differentially affects its catatytic activity and total content. This observation may provide a mechanistic explanation for differential losses of

COX activity and heme a% content that accompany COX deficiency in a number of disease modeis (Aizheimer's disease, 52; Menkes' syndrome, 53). The ability of aïide to induce COX deficiency in the absence ofany apparent defecrs in the expression of rnitochondrially-encoded and nuclear-encoded COX subunits represents another important tinding that bas profound implications for diagnostic approaches to assessing the molecular basis of COX deficiency, and extends the findings ofa recent study in which some COX-deficient patients had normal subunit profiles (54).

Results from in situ and iri vitro manipulations strongly suggest that chnic azide effects are not mediated by classic, high affinity interactions with the binuclear center

(IO). Although the Ki for this site is within the range of doses used in the present study

(64p.M vs 0- 100CLM), binding of azide to the binuclear center is readily reversible Ïft vitro. In contrast, extensive in vitro dialysis and iri vivo washout of azide-treated cells failed to reverse in silu losses in COX activity. Co-incubation with cyanide was also unable to abrogate the observed aide effects despite its higher afinity for the binuclear center (39) and its ability to rapidly displace bound azide (40).

Our in vitro findings with purüied COX, tissue homogenates and ce11 cuIture extracts fùrther extend the argument that aïide-induced COX losses oniy occur in silit.

The inhibition of COX activity in both muscle (C2C12, Sol 8, ASMC) and non-muscie (HEK293,PC 12) cell backgrounds elirninates the possibk requirement of either a muscle-specific factor or the expression of rnuscle-specific COX isofoms in order for azide to exert its effects. Although one possible ir~vivo influence common to al1 tissues is

redox cycling of COX, inhibition of other OXPHOS complexes to alter the rate of

electron fiow to COX had no effects on the efficacy ofazide. The minor losses in COX

activity seen with oligomycin treatment in both control and aide-treated ceils appear to

be due to indirect inhibition of mitochondriai protein synthesis as opposed to direct

effects on COX.

COX has previously been shown to catalyze the one electron oxidation of aide to

the aidyl radical, a reaction that results in its irreversible inactivation in vitro (55). The

anaiogous reaction wîth cyanide leads to loss of COX activity by cyanyl radical attack of

the non-metai protein matnx intrinsic to the holoenzyme (56). Aithough azidyl radical

attack could, in principle, lead to COX damage and dissociation in our mode], this seems

improbable for at least two reasons. First, iti vimcatalysis of azide to the azidyt radical

requires very high levels of exogenous H202(1 mM) and azide ( IOrnM). In contrast,

manipulation of cellular capacity either to produce (ie. ATA-mediated catalase inhibition,

ETC inhibitors) or scavenge (ie. NAC, sodium selenite-induced increases in GPx content)

Hz02 did not alter azide effects on COX.Second, uniike cyanytinhibited COX, wkch

showed no aiteration in difference spectra (56), spectroscopicaIly detectable heme aa3

content was reduced as a result of aide treatment.

Severai Iines of evidence also argue against the invohement of bulk phase ROS

production in azide-mediated COX Iosses despite the additionai inhibition of catalase and

CdZn SOD activities. Fust, extensive experimental manipulations that resdted in signihnt changes in the abiiity to either produce or quench a suite of fiee radicals

(H202,hydroxyl radical, NO, ONOO-?027 had no eEect on COX activity. Second, inhibition of Complexes 1 and III, the two major intrarnitochondrial sites of 02'- production (57), neither contributed to nor abrogated azide-mediated Iosses of COX activity. And third, the activity of aconitase, a mitochondrial hemoprotein that is highly sensitive to oxidative stress (58,59), was the same in control and &de-treated cells (data not shown).

Reduced COX content does not appear to be due to its impaired synthesis since aide had no effect on steady-state IeveIs of COX mRNA transcripts (1, II, W.Via). COX subunits (1, II, IV), mtDNA copy number (14) or the rate of mitochondrial protein synthesis. While potential azide effects on the expression of the 10 remaining subunits were not considered, the azide phenotype differs dramatically ftom those observed in mode1 systems in which either the proteolytic or chaperone function of mitochondrial proteases has been modified (60.6 l), or in which the function of nucIear-encoded proteins critical to cornplex assembly has been lost (62,631.It therefore seems unlikely that defects in COX biogenesis contributed to the loss of hoIoenzyme content as a result of chronic azide treatrnent. Lack of an equivalent temporal Ioss of COX activity in TM- treated cells provides hrther support that aide-mediated COX losses occur at a much greater rate than can be accounted for simply by the kinetic inhibition of processes relhng to cornpiex biogenesis.

The inability of either copper to abrogate or copper chelators to mirnic the azide

effects fiirther suggests that the loss of catalytic activity was independent of aide

interactions with the copper centers within COX.Although previous in vitro studies have described alterations in the kinetic and spectroscopic properties of COX in response to incubation with BCS, substantially higher doses were required to obtain an effect (0.05- lM, 64,65). In contrast, comprehensive spectroscopic, HPLC and native electrophoretic analyses al1 argue that structural darnage either at or near the heme groups caused an initiai loss of catalytic activity that ultimately ied to a reduction in COX content through holoenzyme dissociation or degradation. The ability of azide to mediate the differential loss of catalytic activity and holoenzyme content, and to induce COX deficiency without altering the expression of mitochondriaily-encoded and nuclear-encoded COX subunits has important implications for diagnostic tools used to assess the molecular basis of COX deficiency ,

ACKNOWLEDCEMENTS

The authors would like to thank Denise Michaud for expert technical assistance.

S.C.L would also like to recognize the continued technical support received €rom

members of the lab of Dr. E.A. Shoubridge (Montreal Neurological Institute, Canada).

This study was supported by a Grants-in-Aid of research fiom the Heart and Stroke

Foundation of Canada (C.D.M.), and Canadian Institutes of Heaith Research (Cm)

@.M.G). D.M.G. is an Alberta Heritage Foundation for Medicai Research Scholar and a

CiHR New Investigator. S.C.L. and C.G.C. are respectively supported by an HSFC

Research Traineeship and a Naturai Sciences and Engineering Research Council

Fellowship.

REFERENCES

1. Richter, C., Gogvadze, V., Lafianchi, R, Schlapbach, R, Schweizer, M., Suter, M.,

Walter, P., and YaEee, M. (1995) Biochim. Biophys. Acta. l271,67-74 2. Bamentos, A, and Moraes, C.T. (1 999) J. Biol. Chern. 274, 16188-26 197

3. Wallace, D.C.(1992) Science 256, 628-632

4. Ishii, N., Fujii, M., Hartman, P.S., Tsuda, M., Yasuda, K., Senoo-Matsuda, N.,

Yanase, S., Ayusawa, D., and Suzuki, K. (1998) Nature 394,694-697

5. Zhu, Z., Yao, J., Johns, T., Fu, K.. De Bk, I., Macmillan, C., Cuthbert, A.P.,

Newbold, R.F., Wang, J.-c., Chevrette, M., Brown. G.K., Brown, RM.and

Shoubridge, E.A (1998) Nat. Genet. 20,337-343

6. Jaksch, M., Ogilvie, I., Yao, J., Kortenhaus, G., Bresser, H.-G.,Gerbitz, K.-D., and

Shoubridge, E.A. (2000) Hzïm. Moi. Genet. 9,795-80 I

7. Valnot, 1,. von Kleist-Retzow, J.-C., Batrientos, A., Gorbatyuk, M., Taanman, I.-W.,

Mehaye, B., Rustin, P., TzagoIoK A., Munnich, A., and Rotig, A. (2000) Hm.Md.

Genef. 9, 1245-1 249

8. Betarbet, R., Sherer, T.B.. MacKenzie, G., Garcia-Osuna, M., Panov. A.V., and

Greenamyre, J.T.(2000) Nol. Newosci. 3, 130 L - 1306

9. Yoshikawa, S., and Caughey, W. (1992) J. Biol. Chem. 267,9757-9766

10. Li, W., and Palmer, G. (1993) Biochemisty 32, 1833-18436

II. Yoshikawa, S., Shinzawa-Itoh, K.. Nakashima, R.. Yaono, R., Yarnashita, E., [noue,

N., Yao, M., Fei, M.J., Libeu, C.P., Mimshima, T., Yamaguchi, H., Tomizaki, T., and

Tsukihara, T. (1998) Science 280, 17% 1729

12. Budinger, G-RS., Duranteau, J., Chandel, N.S., and Schumacker, P.T.(1998) J. BioL

Chem. 273,3320-3326

13. ChandeI, N.S., Maltepe, E., Goldwasser, E., Mathieu, C.E., Simon, MC., and

Scbumacker, P.T. (1 999) Proç, NatL Acad Sci. USA 95, 1 17 15- 1 1720 14. Leary, S.C., Battersby, B.I., Hansford, RG., and Moyes, C.D.(1998) Biochim.

Biophys. Acta. 1365,522-53 0

15. Bennett, M.C., Mlady, G.W.,Kwon, Y.-H., and Rose, G.M. (1996) J. Newochem. 66,

2606-26 1 1

16. Bemdt, J.D., Callaway, N.L.,and Gonzalez-Lima, F. (200 1) J. Toxicol. Env. Health.

63,67-77

17. Capaldi, R.A. (1990) Arimi. Rev. Biochem. 59,569-596

18. Glerum, D.M., Shtanka, A., and Tzasolofî, A. (1996) J. Biol. Chem. 27 1, 14504-

14509

19. Glerum, D.M., Shtanko, A., and Tzagoloff, A. (1996) A Biol. Chem. 271,2053 1-

20535

20. Hiser, L., Di Valentin, M., Hamer. AG., and Hosler, J.P. (2000) J. Biol. Chem- 275,

6 19-623

2 1. Lardinois, O.M.,and Rouxhet, P.G. (1996) Biochim. Biophys. Acta. 1298, 180-1 90

22. Chen, Y.-R., Sturgeon, B.E., Gunther, M.R., and Mason, R.P. (1999) J. Biol. Chem.

274,246 1 1-246 16

23. Misra, H.P., and Fridovich, 1. (1978) Arch Biochem. Biophys. 189,3 17-32',

24. Ghadermani, M., and Moosavi-Movahedi, AA. (1 999) BÏochim. Biophys. Acta.

1431,30-36

25. Moyes, C.D., Mathieu-Costello, O.A, Tsuchiya, N., Filburn, C., and Hansford, R.G_

(1997) Am. J. Physiol. 272, C 1345-C 135 1

26. Bindoff, L-A,Birch-Machin, M.A, Cartlidge, NE, Parker Jr., W.D., and TunibuIl,

D.M. (1991) J. Netcrol. Sci 104,203-208 27. Misra, HP.,and Fridovich, 1. (1977) Anal. Biochem. 79, 553-560

28. Crapo, J.D., McCord, J.M., and Fridovich, 1. (1978) hiethods. Enzymol. 53,382-393

29. Aebi, H. ( 1974) in Methods of Enqymatic nnc~&sis(Bergmeyer, H.U., ed) pp. 673 -

678, Academic Press, New York

30. Narayan, P., Mentzer Jr., RM., and Lasley, R.D. (200 1) ./. Mol. Celf.Cardiol. 33,

121-129

3 1. Laemmli, U.K. (1970) Natzrre 227,680-685

32. Schagger, H., and von Jagow, G. (1991) Anal. Biochem. 199,223-23 1

33. Schagger, H., Bentlage, H., Ruitenbeck, W., Pfeiffer, K., Rother, C., Bottcher-Purkl,

A., and Lodemann, E. (1995) Elecrrophor'esis 16,763-770

34. Klement, P., Nijtrnans, L.G.J.,Van den Bogert, C., and Houstek, J. (1995) Arral.

Biochem. 231, 2 18-224

35. Dekker, P.J.T., Martin, F., Maarse, A.C., Borner, U. Müller, H. Guiard, B. Meijer, M.,

Rassow, J., and Pfanner, N. (1997) EMBO. .L 16, 5408-54 19

36. Barros, M.H., C.G. Carlson, D.M. Glerum, and A. Tzagoloff. (200 1) FBS Lett. 192,

133-138

37. Chomczynski, P., and Sacchi, N. ( 1987) AnaL Biochem. 162, 156-159

38. Chomyn, A. (1996) Merhods. Enzymol. 264, 197-2 11

39. Van Buuren, K.JH., Nicholls, P., and Van Gelder, B.F. ( 1972) Biochim. Biophys.

Acta. 256, 258-276

40. Tsubaki, M., and Yoshikawa, S. (1993). Biochemistry. 32, 174-182

41. Partridge, RS., Monroe, SM., Parks, J.K., Johnson, K., Parker Jr., W.D., Eaton,

GR., and Eaton, S.S. (1994) Arch. Biochem. Biophys. 3310.2 10-217 42. Kobayashi, fi., Maeda, M., and Anraku, Y. (1977) J. Biochem. 81, 1071-1077

43. Harris, D.A (1989). Biochim. Biophys. Acta. 974, 156-162

44. Krall, J., Bagley, A.C., Mullenbach, G.T., Hallewell, RA., and Lynch, R.E. (1988) J.

Biol. Chem. 263, 1910-1914

45. Margoliash, E., Novogrodsky, A., and Schetjer, A, (1960) J. Biol. Chem. 74,339-348

46. Leist, M., Raab, B., Maurer, S., Rosick, U., and Brigelius-Flohe, R. (1996) Fret. Rad.

Biol. Med 21,297-306

47. Giufie, A., Sad, P., D'hi, E., Buse, G., Soulimane, T., and Brunori, M. (1996) J.

Biol. Chem, 271,33404-33407

48. Torres, J., Cooper, C.E., and Wilson, M.T. (1998) J. Biol. Chem. 273, 8756-8766

49. Sharpe, M.A., and Cooper, C.E. (1998) J. Biol. Chem. 273,3096140973

50. Chrzanowska-Lightowlers, Z.M.A.. Preiss, T., and Lightowlers, R.N. (1994) J. BioL

Cheni. 269,27322-27328

51. Bennett, M.C., Diamond, D.M., Stryker, S,L., and Parker Sr.., W.D. (1992)J. Geriatr.

Psychiatry Neirrol. 5.93 - 1O 1

52. Parker Jr., W.D.,Parks, J., Filley, CM., and Kleinschmidt-DeMasters, B.K. (1994)

Nertrology 44, 1090- 1096

53. Kuznetsov, AV., Clark, J.F., Winkler, K., and Kunz, W.S. (1996) J. Biol. Chem. 271,

283-288

54. Hanson, B.J., Carroao, R., Piemonte, F., Tessa, A, Robinson, B.H.,and Capaldi,

RA (2001) J. Bid Chem. 276, 16396-1630 1

55. Chen, Y.-R.,Sturgeon, B.E., Gunther, M-R, and Mason, R.P. (1999) J. BioL Chem.

274,246 11 -246 16 56. Chen, Y.-R., Deterding, L.J-, Tomer, K.B., and Mason, R.P. (2000) Biochernist7y 39,

44 15-4422

57. Lucas, D.T., and Szweda, L.I. (1998). Proc. Nat/. Acad Sci. USA 95, 5 10-5 14

58. Cabiscol, E., Piulats, E., Echave, P., Herrero, E., and Ros, J. (2000) J. Biol. Chem.

275,27393-27398.

59. Yan, L.J., Levine, R.L., and Sohal, R.S. (1997). Proc. Natl Acad. Sci. 94, 11 168-

11 172.

60. Rep, M, van Dijl, J.M., Suda, K., Schatz, G., Grivell, L.A., Suzuki, C.K. (1996)

Science 274, 103-1 O6

6 1. Van Dyck, L., Neupert, W., and Langer, T. (1998) Gmes Dev. 12, 15 15-1524

62. Zhu, Z., Yao, J., John, T., Fu, K., De Bie, I., Macmillan, C., Cuthbert, A.P., Newbold,

RI., Wang, J.-c., Chevrette, M., Brown, G.K., Brown. R.M., and Shoubndge, E.A.

(1998). Nat. Genet. 20, 33 7-343

63. Valnot, I.,Osmond, S., Gigarel, N., Mehaye, B., Amiel, J., Cormier-Daire. V.,

Munnich, A., Bonnefont, J.-P., Rustin, P., and Rotig, A. (2000) Am. J. Hum. Genet.

67, 1104-1 109

64. Weintraub, S.T., and Wharton, D.C. (1981) J. Biol. Chem. 256, 1669-1676

65. Weictraub, S.T., Muhoberac, B.B., and Wharton, D.C. (1982) J. Biol. Chem. 257,

4940-4946 Table 3.1 : Azide and cyanide effects on enzynie activity. C2C 12 and Sol S cells were differentiated for 6 days under serum-siarved conditions, prior to a 24h treatnient with the agents listed below. Enzymes were assayed at 37°C as outlined in "Experimental

Procedures".

COX activity (% of Control)

C2C12 Sol8 Treatment COX Coniplex I COX Complex I l OpM Azide 1 OpM KCN I OpM Azidet- I OpM KCN 10pM Azide+ l niM KCN

NM, not measured; KCN, potassiuiii cyanide Tabte 3.2: Azide and oligomycin effects an enzyme activity. C2C12 cells were differentiated for 6 days under serum-starved conditions, prior to a 24h treatmeni with the agents listed below. Enzymes were assayed at 37OC as outlined in "Experiniental

Procedures".

Enzyme activity (% Control)

Treatment COX Coinplex I Catalase Total SOD

I OpM azide 2.4pdrnl oligoniy cin l OpM azidei 2.4pdml oligoniycin Figure 3.1: Chronic treatment of cultured cells with aide resuIts in loss of COX activity,

bioenergetic deficit and altered cellular capacity for ROS metabolism.

A, Whole cell respiration (a)and lactate production (U)in serum-starved C2C 12 myocytes treated with 50p.M for 6 days (mea*SEM, n=6). 6,Titration of COX activity in HEK293, ASMC, PC 12 and C2C 12 cells treated with increasing concentrations of m-de (0-500p.M) for 24h. C, Activities of bioenergetic enzymes assayed fiom isolated mitochondria and D, antiondant enzymes measured either fiom whole cell extracts or mitochondria of C2C 12 myocytes treated with IOOEM azide for

24h (mean*SEM, n=3). All rates are expressed relative to controls. denotes a significant difference (p<0.05) between control and azide-treated cells. 0 ASMC HEK293 v C2C12 PC12

0123456 O 100 200 300 400 500 Treatment (Days) Azide (PM) Figure 3.2: Azide effects on COX activity are not dependent on altered bulk phase ROS

production.

A, DCF fluorescence in control and azide-treated (100pM, 24h) myoblasts, and B, expressed as a relative percentage of Hz@-stimulated maximal fluorescence (n=S). C,

Activities of GPx, total cellular SOD, catalase and D, COX in C2C 12 myocytes grown either in minimal or sodium selenite (5OnM)-supplemented media, and treated with aide

(IOOCLM), arninotriazole (ATG 20mM), paraquat (PQ, SOM), or ATA+PQ for 24h

(meeSEM, n=3). Al1 rates are expressed relative to sodium selenite-supplemented controls * denotes a significant difference (pC0.05)between cells grown in minimal versus sodium selenite-supplemented media. denotes a sipificant difference (~~0.05) between &de-treated and control celis. :denotes a significant difference @

100pM Ar 20mM ATA 50pM PQ 20mM ATA +50pM PQ Figure 3.3: Aide effects on catalytic activity do not involve reduced steady-state rnRNA

or protein levels of individuai COX subunits.

A, Representative autoradiograms of COX 1, LI, IV and Wa steady-state mRNA levels as a tùnction of azide treatrnent (50mover a 6 day penod (n=5). B, Representative immunoblots of steady-state levels of bioenergetic (COX 1, II and iV;NDI; cytochrorne c) and ROS scavenging (cataiase, CdZn and MnSOD) proteins nonnalized for loading to porin and actin respectively as a hnction of treatrnent with azide (O, 10, 100pM) for 3 days. COX II

O O---- 50 O 50 O 50 O 50 pMAzide O 1 2 3 6 Days treatment

Catalase

Cytochrome c d Figure 3.4: Aade effects on COX content are not mediated by inhibition of mitochondrial

protein synthesis.

A, COX, NDH and CS activities were measured after 1 (dl) & 3 days (d3) treatment of semm-starved myotubes with 50pM azide (T) or 50pg/mI T.4P (5).Rates are expressed relative to controls (rneanISEM, n=3). ' denotes a significant difference (pcO.05) between treated and control cells. 'denotes a significant dfirence (p<0.05) between azide- and TAP-treated cells. B. 'Ispulse-labeling of mitochondrial translation products in control (C), azide (Az) & TAP (T)-treated myotubes fier 1 (d 1) and 3 (d3) days of treatment. d 1 d3 d 1 COX NDH

dl d3 C Az TAP C Az TAP Figure 3.5: Loss of catalytic activity is accornpanied by a lesser decline in heme aa3

content.

A, Difference spectra (air oxidized minus dithionite-reduced) generated fiom solubilized mitochondria fiom semm-starved C2C12 myotubes treated with O or lOO@f aïide for

24h (n=2). B&C, RP-HPLC profiles of protoheme (first peak) and heme A (third peak) content in control and aide-treated (100p.M for 24h) cells respectively (n=2). Integrated area under the curve is shown in brackets. iv Wavelength (nm)

1-020 30 40 50 60 O 10 20 30 40 50 60 Time (min) Time (min) Figure 3.6: Chronic aide treatment mediates the decline in cataiytic activity through a

loss of holoenzyme content that is independent of copper chelation.

A, Myoblasts were treated with or without IOOpM azide for 24h. Mitoplasts were isolated

tiom digitonin-permeabilized cells, sohbilized and electrophoresed under native

conditions as described in 'Experimentd Procedures'. COX and NDH leveis were then

detected immunologically using ami-Cox2p and anti-ND1 antibodies respectively (n=3).

B, COX activity in serum-starved myotubes treated for 24h with aide (1OpM)in the

presence or absence of LOOpiM CuC12 and the copper chelators neocuproine and BCS.

Rates are expressed relative to controls (mean*SEM, n=3). * denotes a significant

dEerence (pC0.05) between control and treated cells. :denotes a significant difFerence

(pC0.05) between cells treated with azide alone and aide -t- neocuproine. NDH Chapter 4. Bioenergetic remodelling during treatment of spontaneously

hypertensive rats with the ACE-inhibitor enalaprï16

ABSTRACT

The present study used a spontaneously hypertensive rat (Sm)mode1 to address

changes in bioenergetic and oxidative parameters that result tiom the age-dependent

development of hypertension and its treatment with the angiotensin [I-converting enzyme

(ACE) inhibitor enalapril. Specific activities of bioenergetic (COX, CS, LDH) and ROS

(total cellular SOD) enzymes were actively maintained within relatively narrow ranges

regardless of the treatment duration, organismal age or transmural region. Aithough

declines in mitochondrial enzyme content paralleled the reductions in ventncular mas,

total ventncular mtDNA content was unaffected by enalapril treatment. Altered enzymic

content occurred without significant changes in relevant mRNA and protein IeveIs.

Transcript levels of gene products involved in mtDNA maintenance (mtTFA),

mitochondrial protein degradation (LON protease), hsion (fùzzy onion) and tission

(synaptojanin-2a) were also unchanged. In contrast, enalapril-mediated ventricular and

mitochondrial remodelling was accompanied by a 2-fold increase in the specific activity

of catalase, a sensitive indicator of oxidative stress. This suggests that rapid phases of

cardiac adaptation are accompanied not only by the tight regulation of mitochondriai

enzyme activities, but aiso by increased ROS production.

Lem, SC, Michaud. D. Lyons. CN. Haïe. TM Bushfield TL. Adams. MG and Moyes, CD. (200 1). Bioenergetic remodeling during munent of spontaneous hypenensive tais with the ACE-inhi'bitor enalapril. Hypenension. In prepantion. LNTRODUCTION

Mitochondrial changes, both structural and functional, accompany a spectmm of diseases with cardiovascular implications including hypertension,'" coronary artery disease, ather~sclerosis,~.'diabetes,'*'' agingH-l6and ischemidhypo~ia.'"~'In general, it is difficult to assess either the origins or consequences of changes in mitochondrial properties that accompany many cardiovascular disorders. In relatively infiequent cases, specific mutations in respiratory genes have been identified."" More often, cardiovascular diseases are accompanied by either a limited array of identifiable mitochondrial lesions (e.g. COX deficienciesr or global changes in mitochondrial content."

In a variety of models of cardiac hypertrophy, increases in left ventricuiar mass are paralleled by global increases in mitochondrial content. Mitochondrial enzymes,

DNA and accessory proteins increase in parallei, maintaining stoichiometries between rnitochondrial structural (e.g. cristae surface area to volume ratios) and tbnctional (e.g. respiratory chain enzyme stoichiometries) elements. Specific activities are rigidly preserved, even when the hypertrophic response is induced rapidly by acute hypertension

(e-g. aortic banding)."' However, the connections between the signalling pathways for genes for contractile proteins and those involved in mitochondrial biogenesis are poorly understood. The compensatory response of the contractile machinery is induced primarily by angiotensin iI (ANG changes in cardiac gene expression can be reversed by treatrnent with either angiotensin 1 receptor (ATl) blockers or angiotensin-converting enzyme (ACE) inhibitors. Activation of AT1, a G-protein-linked receptor, triggers a signaliing cascade involving phospholipase C and protein kinase c,~~but may also lead to activation of other protein kinases including c-Jun arnino-terminal kinase (JNKs)." In the case of mitochondrial biogenesis, the transcription factors NRF-1 and NRF-2 are thought to coordinate expression of a suite of mitochondnal genes.28The signalling pathways that activate NRF-1 and NRF-2 largely remain elusive? although recent studies suggest AP-1 may be involved. 'OJ' Since JNK also irnpinges directly upon AP-1 signalling, this pathway represents a potential link between the hypertrophie responses of contractile and bioenergetic genes.

Since mitochondrial changes are an element of many developmental and physiological conditions, it has been suggested that intrinsic changes in relation to bioenergetic demand mediate the respiratory gene response. Reactive oxygen species are a normal by-product of mitochondrial respiration and, along with stress-mediated calcium efflux, have been implicated as retrograde signais that allow for nucleo-mitochondrial cr~sstalk.~~~"In the context of rnitochondrial biogenesis during cardiac hypenrophy, respiratory genes may be responding to such proies for cardiac work.

Treatment of hypertension with ACE-inhibitors leads to relatively rapid reductions in cardiac work and results in remodelling of cardiomyocyte architecture and contractile properties.3637As cardiomyocytes decrease in size, the cells must also reduce

mitochondrial content in parallel to preserve bioenergetic regdatory relationships and

meet constraints on intracellular space. Although significant changes in antioxidant

defenses3' and mitochondrial properties3g*40are also observed, it is unclear whether ACE-

inhibitors modulate parailel reductions in mitochondrial content via redox-sensitive

signaiiing pathways. In principle, decreases in mitochondnal content du~gventricular

regression could be achieved through combinations of reduced synthesis and increased degradation. If mitochondrial proliferation during hypertensive hypertrophy is mediated through .JNK and AP-1 sensitive pathways, ACE-inhibitors could regulate both ventricuiar regression and rnitochondriai reductions via the same pathway. Mitochondrial degradation is rnediated by intra-rnitochondrial proteases (AAA,'"; LO~')and organellar degradation via autophagy involving lysosomaUendosomaI pathways.J3.JJ

Autophagy has an important role in clearing the cell of darnaged, depolarked mitochondria but in the case of ventricular regression, it is unlikely that the mitochondna targeted for degradation exhibit any damage. In cardiac tissue, rnitochondna exist as a continuous reticuiurn and rnitochondrial regression may therefore require mitochondriai fission prior to autophagy. Several proteins have been identified that play criticai roles in control of reticulum fusion (e.g. fuuy ~nion)'~~'and fission (e.g. dynamin-like protein).J8"9 However, connections between pathways that regutate reticulum fùsion and organellar degradation in the context of mitochondriai adaptation remain Iargeiy unexplored.

In the present study, we used the SHR mode1 to examine changes in bioenergetic

parameters in response to the age-dependent development of hypertension and its

treatrnent with the ACE-inhibitor enalapnl. Our results argue that the specific activity of

bioenergetic enzymes is tightly regulated during rapid phases of cardiac adaptation.

Increased specific activity of cataiase in enalapril-treated SHR tiirther suggests that

ventricular regession is accornpanied by increased H202 production. MATERLUS AND METHODS

Animals

Male spontaneously hypertensive rats (SHR) (Charles River Laboratones,

Montreal, Quebec, Canada) were housed in pairs in a temperature-controlled room (22-

2492) with a 12h light: 1% dark cycle. himals had access to food and water ad libitum and al1 procedures were in accordance with the guidelines set out by the Canadian

Council on Animal Care.

Drug Treatment

Anti-hypertensive dnig treatment began at either 15 or 40 weeks of age.

Treatment involved administration of the angiotensin-convening enzyme (ACE) inhibitor endapril(30 mg/kg per day) in the drinking water, and a diet consisting of low sodium chow (0.04%), for 14 days. In addition, fiom treatment day 6-14, rats were allowed access to standard chow (0.4% Na-) for four hours per day in order to control blood pressures at values approximately 50% below pre-treatment levels (T.M.Hale, T.L.

Bushfleld and M.A. Adams, unpublished observation). The 14-day treatment period was followed by a 14-day drug-free period. This cycle was repeated three times in the 15 week old animals. Separate groups of age-rnatched SHR receiving standard chow and tap water served as time controts for the 19,27, and 44 week old animais.

Treated SHR fiom 15 weeks of age were sacrificed at 3 on-treatment time points

(day 10; cycles 1,2&3) and 2 off-treatment tirne points (day 14; cycles 1&3) (Fig- 1).

Control SHR were sacrificed at the start of the study (time=O), and at 2 off-treatment the points (day 14; cycles 1&3). SHR that started treatment at 40 weeks of age and corresponding age-rnatched controls were sactificed at 1 off-treatment time point only

(day 14; cycle 1).

Tissue Excision

Hearts were excised from anaesthetized rats (pentobarbitai Img/kg body weight, i.p.) and blotted dry. The extraneous tissue and atria were removed and the right and Iefi ventricle and septum were separated and weighed. For some hearts, core samples (2mrn diameter) were made from the lefi ventricle and septum. These cores were then cut in haifto separate the endocardium from the epicardium. Samples were snap fiozen in

Iiquid nitrogen and stored at -80°C for further analysis.

Enzyme assays and metabolite analyses

Powdered le& ventricles were homogenized in 9 vol of homogenization buffer

(20m.M Hepes [pH 7-31, ImM EDTA and 0.1% Triton). Assays were performed on a

Moiecular Devices SpectraMAX Plus spectrophotorneter thermostated to 37°C. The activities of cytochrorne c oxidase (COX),citrate synthase (CS), and lactate

dehydrogenase (LDH)were measured using previously described protocols."8 Assays for

al1 other enzymes were optimized as described in detail below to ensure that neither

substrates nor CO-factorswere Iimiting.

Superoxide dismutase (Sm). Total ceilular SOD was assayed at 550nm using the

aerobic xanthinelxanthine oxidase (XO) stem."^^ The assay contained (in mM) 0.1

EDTA, 0.1 xanthine, 0.04 oxidized cytochrorne c, and 20 Ulm1 XO in 50 potassium

phosphate (pH 7.8). In the absence of homogenate, XO reduced cytochrome c at a rate of

80-120 ODImin. 1 unit of total cellular SOD activity corresponds to the amount of hornogenate required to inhibit the rate of cytochrome c reduction by 50%. No auto- reduction of cytochrome c in the absence of XO and/or enzyme was observed.

Glutathione peroxide (GP!).The assay contained (in mM) 1 GSH, 0.15 NADPH, 1.2

BHP and 0.6Ufml GR in 50 potassium phosphate (pH 7.0). Activity was detected as the disappearance of NADPH at 340nrn.

Catalnre. Samples were sonicated with one 5s burst (Virsonic 60, Virtis). Activity was detected as the rate of disappearance of 20mM hydrogen peroxide at 240nm in 50rnM potassium phosphate (pH 7.0)" Specific activity of catalase was calculated from the equation: specific activity (unitsmg protein-'.min-') = AA2~onm(lmin) X 1000f89.2 X mg protein.

Protocols for measuring cellular protein content were as previously described."

Quantitative-competitive polymerase chain reaction (QC-PCR)

A QC-PCR was established based upon previous method~~'*~~to measure left

ventricular rnitochondrial DNA content. Briefly, a 767 bp fi-agment of rat COX 1 was

amplified at 58°C hma rat heart reverse-transcriptase template using primers s'-CAC

AAA GAT ATC GGA ACC CTC-3' and 5'-GTA ACT ACA TGT GAA ATA ATT CCA

AA-3' as follows; lOmM Tris-HCI (pH 9.0), 1.5mM MgC12, 50mM KCI, 2OOu.M dNTPs,

200ng/pl primers, and 2SU Taq poiyrnerase (Qiagen). The resultant PCR product was

cloned into pCR 2.1 (invitrogen), and the plasmid linearized by digestion at a unique

HincII site within the insert. Ligation of a 188bp blunt-end fiagrnent allowed for the

generation of a pIasmid containing a 955bp cornpetitor ternplate. The identity of the

competitor construct was confimeci by sequencing. An optimal range of ratios of left ventricular homogenate to cornpetitor template was initially determined to avoid unequal cornpetition during the QC-PCR reaction. This concentration was established by varying the amount of homogenate per reaction in the presence of a constant amount of cornpetitor template. The corresponding titration curve

(log homogenate vs log hornogenate/competitor) revealed that a homogenate/competitor ratio anywhere frorn 0.4 to 13 was within the Iinear range of the PCR reaction. The PCR reaction contained 5OmU CS, lOmM Tris-HCI (pH 9.0), 2.5mM MgCIz, 50mM KCL,

0.2mM dNTPs, 9.7 ng/jd forward primer, 14.44 ng/pI reverse primer, and 1 .SU Taq polyrnerase. PCR conditions were as follows; 2 min at 40°C, initial denaturation Srnin at

95"C, subsequent denaturations 15s at 9SoC, annealing for lmin at 62"C, extension for

lmin at 72°C. final extension at 7% for 10 min. The PCR was run for 30 cycles, with a-

~CTP~'added for the last five cycles. PCR products were resolved on 6% polyacrylamide

gels, dried, and the signal strength quantified using a phosphorimager (Biorad).

lmmunoblotting and protein analyses

Protein fiom roughly 5mg of powdered lefi ventricle was extracted for ISrnin on

ice in RIPA b~ffer.~~Equal amounts of total protein were denatured, Ioaded ont0 a 12%

SDS-polyacrylamide gel, and electrophoresed at 120V for 1.5h. Gels were then

electroblotted (Biorad, Mini-protean system) for 2h at 50V ont0 nitrocelluIose membrane

(Zymotech Inc.), and blocked in 50mM Tris-HC1 (pH 7.4), 150mM NaCI containing

0.05% Tween 20 (TBS-T) supplemented with 5% low-fat skim milk powder. Membranes

were incubated ovemight at 4°C in TBS-T containing 2% Iow-fat skim milk powder and

the primary antibody of interest. Polyclonal antibodies directed against CdZn and

MnSOD (StressGen Biotechnologies Corp., Victoria, BC, Canada), COX II (Dr. E.A Shoubridge, Montreal Neurological Institute), cytochrome c (Santa Cruz

Biotechnologies, Santa Cruz, CA) and actin (Sigma), and mouse monoclonal antibodies for anti-COX I, COX IV and ND L (Molecutar Probes) were ail used at 1 :1,000 dilutions.

A polyclonal rabbit anti-catalase antibody (Rockland Inc., NJ) and a monoclonal human anti-porin antibody (Calbiochem) were used at L:25,000 and 1 :2,000 dilutions respectively. Following a 1h incubation at room temperature with either secondary anti- mouse (1 :10,000; Pierce) or anti-rabbit (1:2,500; Promega) horseradish peroxidase antibodies, immunoreactive proteins were visualized with luminol-enhanced cherniluminescence (Amersham Pharmacia Biotech).

RNA isolation, northern analysis and cDNA constructs

Total RNA was purified from guanidium thiocyanate extracts usinç a standard acid phenol protacol." RNA was quantified in triplicate spectrophotmetrically. denatured and fiactionated using a standard 1% agarose-forrnaldehyde gel system. cDNAs for catalase, MnSOD, CuiZnSOD, LON protease, rntTFq fiizzy onion and synaptojanin-2a were arnplified fiorn an appropriate reverse-transcriptase template in lOmM Tris-HCI

(pH 9.0), 1.5mM MgCI2, 50mM KCI, 200uM 200ngIpl primers, and 2SU Taq polymerase (Qiagen) (Table 1)- PCR conditions were as follows; initial denaturation at

95°C for 60s, subsequent denaturations at 95°C for 30s, annealing for 90s, extension at

72°C for 90s. and a final extension at 72'2°C for IOmin. All other probes for mtDNA- and

nuclear-encoded mRNA species were obtained as previously de~criied."~~'Blots were

corrected for loading diîerences using a probe for a-tubulin mRNA.

Membranes were prehybridiied and hybridiied at 65°C in a Hybaid mini-hybridization

oven (Interscience) in modified Church's buffer (034 sodium phosphate [pH 7.21, 10mM EDTA and 7%SDS). Membranes were washed twice at room temperature for 15 minutes with 2X SSCIO. 1% SDS, and twice at 50" for 15 minutes with O. IX SSCIO. 1%

SDS. Blots were phosphorirnaged and relative signal strength quantified using imagequant software (Molecular Dynamics).

Statistical analyses

For a11 parameters, significant differences (pC0.05) between control and enalapril- treated Smwere detected using one-way ANOVAs and identified post hoc using the

Tukey-Kramer HSD.Two-way ANOVAs were also used to test for significant differences (p<0.05) between enalapril-treated SHR and specific, age-rnatched controls as a fiinction of treatment and tirne. RESULTS

Chronic treatment with enalapril results in a significant temporal regression in left ventricular (LV) mass

SHR treated with enalapril exhibited a rapid and significant reduction in LV rnass when expressed per kg body weight (Fig, 2). In contrast, LV mass rernained a fixed

proportion ofbody weight over the entire experimental time period in control SHR.

While the extent of LV regression in enalapnl-treated SHR was significantlygreater

during the first treatment cycle, LV rnass per kg body weight returned to that of age-

matched controls afler 14 days of off-treatment. However, additional treatment cycles

were not only efectual at reducing LV mass per kg body weight but also led to the

achievement of a signiticantly lower steady-state LV mass than that of age-matched

controls following removal of the dmg fiom their diet. This suggests that chronic treatment with enalapril effects permanent changes in LV mass by targeting both hed and malleable parameters critical to its remodel~in~.~~

Enalapril treatment mediates parallel changes in LV mass and the levels of bioenergetic and antioxidant enzymes

The activities of five enzymes representative of either energy (COX, CS, LDH) or

ROS (total cellular SOD, catalase) metabolism were measured to address the temporal nature of changes in cardiac bioenergetics and oxidant metabolism associated with enalapril-mediated LV remodelling. To ensure that the interpretation of such results was

not confounded by significant transmural differences in enzymic distributi~n,~~.~~

activities were initially measured in the endo- and epicardium of septum and LV.No

significant differences were observed between the endo- and epicardiurn in either the

septum or lefi ventricle of enalapril-treated and time control SHR for bioenergetic

enzymes (Table 2). Although each of the antioxidant enzymes displayed one significant

cornpartmental difference in LV activity, no obvious transmural patterning of antioxidant

enzyme content was evident in either enalapril-treated or control SHR. Intact LVs were

therefore used as starting material for al1 tùrther analyses.

The activities of COX, CS, LDH and total cellular SOD per g LV were preserved

over a fairly narrow range regardless of treatment duration or organismai age (Figs. 3.4).

No significant effects of enalapril treatment were observed for either LDH or totaI

cellular SOD.Enalapril effects on COX and CS were subtly different, with CS activity

essentialiy remaining a tixed activity per g LV while prolonged enalaprii treatment

resulted in modest but signXcant increases in COX activity (Figs. 3A,B). In contrast to its rather modest effects on the activity of other enzymes per g LV, enalapril treatment led to rapid and significant increases in the specific activity of cataiase (Fig. 4A). Conversion of specific activity to total ventricular content (ie U activitylg LV X total g LV) resulted in multiple treatment and time-dependent effects for all enzymes (inset panels; Figs. 3,4). This suggests that the moles of most enzymes is constant in relation to ventricular mass and that changes in totai enzymic content in response to enalapril treatment are explained almost exclusiveiy by alterations in ventricular mass.

Enalapril treatment mediates significant increases in mtDNA copy number without affecting either the steady-state RNA or protein levels of relevant gene

products

Cn anaiysing mitochondrial parameters, hvo situations were observed; constant

content or constant specific activity. Throughout the treatment protocol, rntDNA content

(copies per LV) was constant (Fig, SA), such that its 'specific activity' (mtDNA copy

number/g LV) varied approxirnately Mold with LV mass (Fig. SA, inset). Off-treatment

and control SHR had comparable mtDNA contents and 'specific activities', with the totd

number of copies of mtDNA increasing significantly in control SHR as a fùnction of age

(-25%lwk tiom 15 to 27 weeks; Fig. SA).

Uniilce the situation with mtDNA. RNA and protein levels of mitochondnally-

(COX 1, II) and nuclear-encoded (COX IV) COX subunits were unchanged with either

age or drug treatment (Figs. SB$). Similady, the Ievels of two other bioenergetic

proteins, the ND1 subunit of Complex 1 and cytochrome c, the mobile electron carrier

between Complexes iü and N,were unaffected (Fig. SC) Despite rapid changes in ventricular mass, there was no effect of age or treatment on antioxidant enzyme RNA levels, or the protein leveIs of Mn and CdZn SOD (Figs.

64B). In contrat, cataiase protein content increased as a fiinction of enalapril treatment

(Fig. 6B).

Enalapril-mediated mitachondrial regression occurs withaut changes in the

steady-state levels of gene praducts involved in mtDNA expression, reticulum

maintenance, and mitochondrial protein degradation

Discordant changes in mitochondrial enzymes and mtDNA copy number

prompted us to measure the mRNA Ievels of several factors known to collaborate in the

regulation of mtDNA expression. Transcript levels of rntTFA, a nuclear-encoded

transcription factor that is essential to mtDNA maintenance and e~~ression,6~were

unafEected by enalapril treatment (Figs. 6C,D). Similarty, no changes were observed in

the rnRNA levels of LON protease, a matriv protease with a known involvement in

degradation of unasseinbled cornplex subunitsJ2and a proposed role in the regulation of

mtDNA expression6' (Figs. 6C,D).

We aiso investigated possibIe changes in the mRNA levels of proteins implicated

in the maintenance of the mitochondrial reticul~rn."~~'No evidence of changes in the

levels of rat hypertensive protein, a putative homologue of hzzy onion, a GTPase

involved in reticulum fi~ssion,'~~'were observed (Figs. 6C,D). The transcript levels of

synaptojanin-2a, an inositol5'-phosphatase involved in syncytium fission, 63-* were

similarly unaffected by drug treatment (Figs. 6C,D). DISCUSSION

Mitochondrial changes during hypertrophy and regression

Mitochondna play a critical role in maintainhg normal heart function by producing most

of the ATP needed in energy metabolism and by generating ROS at levels that modulate

signal transduction. While low levels of mitochondrial ROS production exert a regulatory

role within the cell, hypertensive animais exhibit a broad range of dysfunction that could

enhance their rate of generation and, as a result, their cytotoxic as opposed to regulatory

effects. Mitochondnal abnomalities inciude defects in ~a'*handling, phosphate

transport, ATP synthesis and export.s-6'4' Thus, maintenance of mitochondnal structure

and fiinction is an important element of cardiac adaptation.

We used the SHR mode1 to address the nature of bioenergetic remodelling during

cardiac adaptation that accompanies both hypertension and anti-hypertensive treatment

with the ACE-inhibitor enalapril. EnalapriI treatment resulted in a rapid reversai of age-

dependent hypertrophy (-30% by 10 days). Enalapril-rnediated changes in ventricular

mass were reversible, aIthough repeated treatment cycles led to sustained improvements

in both mean artenal blood pressure and LV mas. Despite the changes in ventncular

mass in response to this complex treatment protocol, the specific activity of

mitochondriai (COX, CS) and glycoIytic (LDH)enzymes was highly preserved.

Preservation of the specific activity of bioenergetic enzymes was seen across heart

compartments, transmural regions and throughout the age-dependent development of

hypertension Collectively, these observations suggest that bioenergetic changes are well

integrated into both rapid (ie. enaIapri1-i-low salt) and siow age-dependent hypertrophy)

phases of cardiac adaptation. The relative importance of control of synthesis and degradation in achieving these mitochondrial changes is largely unknown, although our data provide some insight into the possibilities.

During off-treatment penods, mitochondrial enzyme content increased rapidly to preserve specific activities as ventricular hypertrophy occurred. In differentiating C2C 12 myocytes, another mode1 of mitochondrial proliferation, a 3-fold increase in COX activity over a 14 day period was accompanied by a 2-fold increase in mitochondrially- encoded COX mRNA ~evels.'~If this relationship between enzyme activity and RNA levels held in cardiomyocytes, an increase in total COX activity over roughly the same time period (-60% in 14 days) could be achieved with relatively modest increases in

COX mRNA levels (-40%). Thus, our relatively broad time course may have precluded detection ofperiods of elevated mRNA for mitochondnal enzymes. Recent studies have shown that ANG II signalling leads to activation of protein synthesis through dephosphorylation of eEF2, an elongation factor involved in trans~ation.~'As a resuit, the

'recovery' of ANG LI signalling as off-treatment SHR re-hypertrophy need not be restricted to effects on transcription, and in fact, both enhanced rates of protein synthesis and reduced rates of protein degradation are known to contribute to the coordinated increase in mitochondnal content that accompanies cardiac hypertrophy in response to

aortic banding6'

ROS and respiratory gene expression and cardiac hypertrophy

ROS have fiequentty been impiicated as participants in regdatory pathways associated with both the hypenrophic re~~onse'~-~Anti-oxidants and anti-oxidant

enzymes inhibit the regdatory effects of ANG II on ~asl~af7ERK~and AP-1'"

signailing pathways. Enhanced rnitochondrial Hz02 production has also been shown to alter cellular metabolism by increasing JNK a~tivit~.'~JM( is a downstream target of

AT1-dependent signalùig27and regulates AP-1 activity via c-Jm. Atered mitochondrial

ROS production is thought to modulate the activity of ROS-sensitive transcription factors and kinases, thereby allowing for changes in nuclear gene expression.32J5While there are many examples of stressors that lead to enhanced ROS production and increased expression of respiratory genes,76'n it is not clear if ROS are a plausible effector of changes in mitochondrial enzyme synthesis during ANG LI-dependent hypertensive hypertrop hy.

Since AP-1 interacts with NRF- 1 to transcriptionally regulate cytochrome c

e~~ression,~~.~'JNK may facilitate coordinated changes in the contractile apparatus and

mitochondrial content in response to hypertensive stimuli. However, our data argue

against a regulatory role for ROS in the observed increases in mitochondrial enzymes.

The activity of catalase, a sensitive indicator of Hz02 production. has previously been

shown ta increase in SHR following a 30 min infusion with 25p.M H&." In the present

study, the highest specific activity of catalase was observed during periods of

mitochondrial regression (ie. enalapril treatment) as opposed to proliferation. EnaIapril-

mediated increases in catalase are consistent with other observations that suggest

enalapril treatment leads to enhanced antioxidant capacity as a result of experiencing

some degree of oxidative

Mitochondrial losses during ventricular regression

Unlike control of protein turnover during hypertrophy, the relative importance of

protein synthesis vs degradation in mediating mitochondrial regression is less understood.

Durhg enalapril treatment, LV regression was accompanïedby parailel losses in mitochondrial enzyme content (ü/LV), but mtDNA content (copies1 LV) was unaffected.

Discordant changes in the levels of mitochondrial parameters suggest that while reduced protein synthesis could play a role, enhanced degradation is likely the dominant mechanism of mitochondrial regression. Whether degradation is mediated by intra-

mitochondrial proteases or organellar degradation via autophagy is unclear. While both

pathways are typically considered to be involved in organellar maintenance, it is unlikeiy

that the coordinate activity of intra-mitochondnal proteases could account for the

relatively rapid (-30% in 10 days) and largely stoichiometric reductions in bioenergetic

enzymes. Organellar degradation via autophagy relies on the activity of several proteins

involved in reticulum maintenance, and their ability to interact with outer mitochondrial

membrane proteins in order to promote either fission or fusion. A recently identified

outer membrane protein, Mmmlp, has roles both in reticulum maintenance and

organization of mtDNA aggregation." Thus, a plausible mechanistic basis exists by

which autophagy could mediate organellar degradation that results in discordant changes

in mtDNA copy number and the mitochondrial enzyme content. Although enalapril

treatment did not affect steady-state mRNA levels of proteins implicated in reticulum

fùsion (i.e. rat homologue of fii73y onion) and fission (dynamin-like protein), it is not

known if their activity is regulated transcriptionally or post-transcnptionally, or even

dependent upon changes in their levels.

MtDNA and mitochondrial gene expression

[ncreased "specific activity" of mtDNA was not accompanied by paralle1

increases in the steady-state levels of mitochondrially-encoded gene products. This

suggests that enalapril mediated a reduction in factors that reguiate mtDNA expression, thereby limiting its rate of transcription andor replication, However, steady-state mRNA levels of mtTFA, a factor involved in mtDNA maintenance by virtue of its role in transcription,60were unaKected by enalapd treatment. Transcript levels of LON protease, which has been postulated to degrade regulatory factors bound to mtDNA, thereby moduiating its expression,6' were simiiarly unchanged. While the identification ofthese and other factors has geatly contributed to our understanding of mechanisms by which mtDNA expression is controlled, how changes in mtDNA copy number impinge upon the levels of the regulatory factors themselves remains unc~ear.~'

SUMMARY AND PERSPECMS

Previous studies of alterations in mitochondrial properties as a result of hypertension have typically cornpared either the content or activity of relevant parameters in SHR and normotensive WKY rats. AIthough changes in bioenergetic, 1.65.66 antioxidant8' and glycolytic enzymes6"' have been reported. the potential confaunding effects of using two distinct genetic backgrounds make it difficult to conclusively assess the nature of the relationship between hypertension, cardiac bioenergetics, ROS

metaboiism and mitochondrial content." The present study avoided such concems by

exarnining these relationships in the progression of hypertension as SHR age and in SHR treated with the ACE-inhibitor enaiapril. We demonstrated that despite pronounced lefi

ventncular regression, the specific activities of bioenergetic (COX, CS, LDEi) and

superoxide-scavenging (Cu/Zn SOD and MnSOD) enzymes were largely preserved

irrespective of treatment duration, organismd age or transmural region. The significant

changes in catalase and mtDNA copy number per g LV argue that active mitochondna1

remodehg resulted not oniy in the removai of selected rnitochondriai eiements but also in enhanced H202production. The relative contributions of synthetic and degradative pathways, and the associated signal transduction pathways that can account for the observed affects of enalapril treatment are currently being investigated.

LITERATüW CITED

Chen, L, Tian, X, Song L. Biochemical and biophysical characteristics of

rnitochondria in the hypertrophie hearts hmhypertensive rats. Chiri. hfed J.

1995; 1 O8:36 1-366.

Nishio, ML, Omatsky, 01 Craig, EE, Hood, DA. Mitochondrial bioçenesis during

pressure overioad induced cardiac hypertrophy in adult rats. Can. J. Physioi.

Pharmacol. l995aJ3 $30-63 7.

Nishio, ML, Ornatsky, 01, Hood, DA. Effects of hypothyroidism and aortic

constriction on mitochondria during cardiac hypenrophy. Med. Sci. Sports. EYWL

1995b;27:1500-1 508.

Tokoro, T, ho, Fi, Sumki. T. Aiterations in mitochondriai DNA and enzyme activities

in hypertrophied rnyocardium of stroke-prone SHRS.Clin. Erp Hypertens.

1996; 181595-606.

Seccia, TM, Atlante, A, VuIpis, V, Marra, E, PassarelIa S, Pirrelli, A. Mitochondrial

energy metabolism in the lefi vent~iculartissue of spantaneously hypertensive rats:

abnomalities in both adenine nucleotide and phosphate transtocators and enzyme

adenylate-kinase and creatine-phosphokinase activities. Clin. Exp. Hyperterrsion.

1998;20:345-358. Corrai-Debrinski, M, Shoftner, JM, Lott, MT, Wallace, DC. Association of

mitochondriai DNA damage with aging and coronary atherosclerotic heart disease.

Mzrtat. Res. 1992;275:169- 180.

Maurer, 1, Zierz, S. Myocardial respiratory chain enzyme activities in idiopathic

dilated cardiomyopathy, and comparison with those in atherosclerotic coronary artery

disease and valvular aortic stenosis. Am. J. Curdiol. l993;72:428-433.

Rodrigues, B, McNeill, JH. The diabetic heart: metabolic causes for the development

of a cardiomyopathy. Cardiovasc. Res. 1992;26:9 13-922.

Antonetti, DA, Reynet, C, Kahn, CR. Increased expression of mitochondrial-encoded

genes in skeletal muscle of humans with diabetes mellitus. J. Clhi. Invest.

199S;gS: 1383-1388.

10. Shiotani, H, Ueno, H, houe, S, Yokota, Y, Yokoyama M. Diabetes mellitus and

cardiomyopathy-association with mutation in the mitochondriai tRNA (Leu)(UUR)

gene. Jpri. Circ. J. 1998;62:309-3 10.

11. Fernando-Silva, P, Petruzzella, V, Fracasso, F, Gadaleta, MN, Cantatore, P. Reduced

synthesis of mtRNA in isolated rnitochondria of senescent rat brain. Biochem.

Biophys. Res. Cotnm. 199 1; 176:645-653.

12. Castelluccio, C, Baracca, A, Fato, R, Pallotti, F, Maranesi, M, Barzanti, V. Gorini, A,

Villa, RF, Parenti Castelli, G,Marcheai, M, Lenaz, G. Mitochondrial activities of rat

heart during ageing. Mech. Agccing Dev. 1994;76:73-88.

13. Ames, BN, Shigenaga MK, Hagen, TM. MitochondriaI decay Ïn aging. Biochim.

Biophys. Acta. 1995; 1271: 165-170- 14. Boffoli, D, Scacco, SC, Vergari, R, Persio, MT, Solarino, G, Larforgia, Et, Papa, S.

Ageing is associated in females with a decline in the content and activity of the bc 1

compiex in skeletal muscle mitochondria. Biochim. Biophys. Acta. 1996; 13 15:66-72.

15. Filbuni, CR, Edris, W, Tamatani, M, Hogue, B, Kudryashova, 1, Hansford, RG.

Mitochondrial electron transport chain activities and DNA deletions in regions of the

rat brain. Mech, Ageing. Dev. l996;87:3 5-46.

16. Nicoletti, VG, Tendi, EA, Consoie, A, Pnvitera, A, Villa, RF, Ragusa, N, GiuEida-

Stella, AM. Regulation of cytochrome c oxidase and FoFI-ATPasesubunits

expression in rat brain during aging. Netirochem. Res. l998;Z :55-6 1.

17. Toleikis, A. Cytochrome oxidase activity of mitochondria Rom ischemic and

repertised myocardium. Ah. Mjmcardiol. 1983 ;4:409-4 18.

18. LaManna, JC, Kutina-Nelson, EU, Hritz, MA, Huang, 2, Wong-Riley, MT.

Decreased rat brain cytochrome oxidase activity after prolonged hypoxia. Brait~.Res.

IW6;73O: 1-6.

19. de la Torre, JC. Cada, 4 Nelson, N, Davis* G, Sutherland, Ri, Gonzalez-Lima, F.

Reduced cytochrome oxidase and memory dysfùnction after chronic brain ischemia in

aged rats. Nezirosci. Lett. 1997;223: 165- 168.

30. Lesnefsky, EJ, Tandler, 0, Ye, J, Slabe, TJ, Turkaly, J, Hoppel, CL. Myocardial

ischemia decreases oxidative phosphorylation through cytochrome oxidase in

subsarcolernma1 mitochondria. Am. J. Physiol. I997;273 :H1 WI-HlSS4.

21- Budinger, GR, Duranteau, J, Chandel, NS, Schumacker, PT. Hibernation during

hypoxia in cardiomyocytes- Role of rnitochondria as the O2sensor. J. Biol. Chem.

1998;273:3320-3326. 22. Graham, BH, Wayinire, KG, Cottrell, B, Trounce, IA, MacGregor, GR. Wdace, DC.

A mouse mode1 for rnitochondrial myopathy and cardiomyopathy resulting from a

deficiency in the heart/muscle isoform of the adenine nucleotide translocator. Nat-

Genet- 1997;16:226-234

23. Benit, P, Chretien, D, Kadhom, N, de Lonlay-Debeney, P, Cormier-Daire, V,

Peudenier, S, Rustin, P, Munnich, A, Rotig, A Large-scale deletion and point

mutations of the nuclear NDUFV1 and NDüFS 1 genes in mitochondrial complex 1

deficiency. Am, J. Hm.Genet. 200 1;68:1344- 13 52

24. Jaksch, M, Ogilvie, 1, Yao, J, Kortenhaus, G, Bresser, H-G, Gerbitz, K-D,

Shoubridge, EA. Mutations in SC02 are associated with a distinct fonn of

hypertrophic cardiomyopatliy and COX deficiency. Httm. Mol. Genet, 2000:9:795-

801.

25. Williams, R.S. Cardiac involvement in mitochondrial diseases and vice versa.

Circrhtiori, 1995;9 1 :1266- 1268.

26. Kim, S, Iwao, K. Molecular and cellular mechanisms of angiotensin II-mediated

cardiovascular and renal diseases. Pham. Rev. 2001;52:1 1-34.

27. Kudoh, S, Komura, 1, Minino, T, Yamazaki, T, Zou. Y, Shiojima, 1, Takekoshi, N,

Yazaki, Y. Angiotensin II stimulates cdun NH2-terminal kinase in cuitured myocytes

of neonatal rats. Circ. Res. 1997;82:244-250.

28. Scarpulla, RC. Nuclear control of respiratory chah expression in marnmalian cells. J.

Bioenerg Biomembr. 1997;29:109- 1 19.

29. WIJ, Z, Puigserver, P, Andersson, U, Zhang C, Adelmant, G, Mootha V, Troy, A,

Cinti, S, Lowell, B, Scarpulla, RC, Spiegelman, BM. Mechanisms controhg

mitochondrial bio~genesisand respiration through the thermogenic coactivator PGC-1 .

Cell. l999;98:1 15-124.

30. Xia, Y, Buja, LM, Scarpulla, RC, McMillin, JB. Electrical stimulation of neonatal

cardiomyocytes resuits in the sequential activation of nuclear genes governing

mitochondrial proliferation and differentiation. Proc. Nutl. Acud Sci. USA

1997;94:11399-11404.

3 1. Xia, Y, Buja, LM, McMillin, JB. Activation of the cytochrome c gene by electrical

stimulation in neonatal rat cardiac myocytes. Role of NRF-1 and c-Jun. J. Biol. Chem.

1998;273: 12593- 12598.

32. Liao, X, Butow, RA. RTGI and RTG2: two yeast genes required for a novel path of communication from mitochondria to the nucleus. CeIl. 1993;72:6J. 1-7 1.

33. Poyton, RO, McEwen, JE. Cross talk between nuclear and mitochondnal çenomes.

Anmi. Rev. Biochem. 1996;65:563-607.

34. Biswas, G, Adebanjo, OA, Freedman. BD, Anandatheerthavarada, HK,

Vijayasarathy, C, Zaidi, M, Kotlikoff M, Avadhani, NG. Retrograde ~a"signalling

in C2C12 skeletal myocytes in response to mitochondrial genetic and metabolic

stress: a novel mode of inter-organelle cross talk. EMBO. 1999;l8:522-533.

35. Osiewacz, HD, Stumpferl, SW. Metabolism and aging in the filamentous fungus

Podospora anserina. Arch. Gerontol. Geriatr. 200 1 ;23 :1 85- 197.

36. Makino, N, Sugano, M, Hata, Tl Taguchi, S, Yanaga, T. Chronic low-dose treatment

with enalapril induced cardiac regession of lefi ventricular hypertrophy. Mol Cd.

Biochem. 1996;1631 164:239-245. 37. Nunez, E, Hosoya, K, Susic, D, Frohlich ED. Enalapril and losartan reduced cardiac

mass and improved coronary haemodynamics in SHR. Hypertension. 1997;29: 5 19-

524.

38. De Cavanagh, EM, Inserra, F, Ferder, L, Fraga, CG. Enalapril and captopril enhance

glutathione-dependent antioxidant defenses in mouse tissues. Am. J. Physiol.

2000;278:R572-R577.

39. Sanbe, A, Tanonaka, K, Kobayashi, R, Takeo, S. Effects of long-term therapy with

ACE inhibitors, captopril, enalapril and trandolapril, on myocardial energy

metabolism in rats with heart failure following myocardial infarction, J. Mol. Cd.

Cardiol. 1995;27:2209-2222,

40. Ferder, L, Romano, LA, Ercole, LB, StelIa, 1, Inserra, F. Biomolecular changes in the

ageing myocardium: the effect of enaIapriI. Am. J. Hypertrris. 1998; 1 1: 1297-1304.

4 1. Leonard, K, Henmann, JM. Stuart, FM, Mannhaupt, G, Neupert, W, Langer, T. AM

proteases with catalytic sites on opposite membrane surfaces comprise a proteolytic

system for the ATP-dependent degradation of inner membrane proteins in

mitochondria. LMBO. 3. 1996;15 :42 18-4229.

42. Wang, N, Gottesman, S, Willingham, MC, Gottesman, MM., Maurizi, MR. A human

mitochondrial ATP-dependent protease that is highly homologous to bacterial Lon

protease. Proc. NatL Acad Sci. USA. 1993$0: 1 1247- 1 125 1.

43. Lemasters, JJ, Nieminen, A-L, Qian, T, Trost, LC, Elmore, SP, Nishimura, Y, Crowe,

Rq Cascio, WE, Bradham, C4Brenner, DA, Herman, B. The mitochondrial

permeabitity transition to cell death: a common meçhanism in necrosis, apoptosis and

autophagy. Biochim. Biophys.Acta. 1998;1366: 177- 196 44. Luzikov, VN. Quality control: fiom molecule to organelles. FEBS Lett.

1999;448:20 1-205.

45. Hales, K, Fuller-M. Developmentaily regulated mitochondriai îùsion mediated by a

conserved, novel, predicted GTPase. Ce11 1997;90: 12 1- 129.

46. Hermann, G, Thatcher, J, Mills, J, Hales, K, Fuller, M, Numari, J, Shaw, J.

Mitochondrial fiision in yeast requires the transmembrane GTPase Fzo lp. J. Cell.

Biol. 1998;143:359-373.

47. Rapaport, D, Brunner, M, Neupert, W, Westermann, B. Fzo Ip is a mitochondrial

outer membrane protein essential for the biogenesis of îùnctional mitochondria in

Saccharomyces cerevisiae. J. Biol. Chem. 1998;273:20 150-20 155.

48. Moyes, CD, Mathieu-Costello, 04 Tsuchiya, N, Filburn, C, Hansford, RG.

Mitochondrial biogenesis during cellular differentiation. Am. J. Physiol.

l997;272:C 1345-C 135 1.

49. Misra, HP, Fridovich, 1. Superoxide dismutase: "positive" spectrophotometric assays.

Allal. Biochem. 1977;79:553-560.

50. Crapo, iD,McCord, JM, Fridovich, 1. Preparation and assay of superoxide

dismutases. Methods En,ymoL 1978;53 :382-393.

5 1. Aebi, H. Cataiase. In: Bergmeyer, HU Ed. Methodi of E~yaticana@sis. New

York, Academic; 1974: p673-p678.

53- Leary, SC, Battersby, BJ, Hansford, RG, Moyes, CD. Interactions between

bioenergetics and rnitochondrial biogenesis. Biochim. Biophys. Acta, 1998; 1365:522-

530. 53. Piatak, M, Luk, KC, Williams, B, Lifson, JD. Quantitative competitive polymerase

chah reaction for accurate quantitation of HIV DNA and RNA species.

Biotechniqies 1993;L4:70-8 1.

54. Zimmermann, K, Mannhalter, JW. Technical aspects of quantitative competitive

PCR Biotechtiiqtres 1996;21:268-279.

55. Hemg, RP, Scacco, S, Scarpulfa, RC. Sequential serum-dependent activation of

CREB and NRF-1 leads to enhanced mitochondrial respiration through the induction

of cytochrome c. J. Biol. Chern. 2000;275: 13 134- 13 14 1.

56. Chomczynski, P, Sacchi,.N. Single-step rnethod of RNA isolation by acid guanidium

thiocyanate-phenol-chlorofonnextraction. Ami. Biochem. 1987;62: 156-1 59.

57. Childs, TJ, Adams, Mq Mak, AS. Regression of cardiac hypertrophy in

spontaneously hypertensive rats by enaiapri! and the expression of contractile

proteins. Hypertension. 1990;t 6: 662-668.

58. Pauletto, P, Nascimben, L, Piccolo, D, Scannapieco, G, Vescovo, G, Pessina, AC, Dal

Palu, C. Changes in ventricular creatine-kinase with progression and regession of

cardiac hypertrophy in hypertensive rats. J Hypertension. 1989;7:S94-S95.

59. Lapema, D, Mezzetti, A, de Gioia, S, Consoli, A, Festi, D, Di Ilio, C, Cuccu~llo,F.

Transmural distribution of antioxidant defences and Iipid peroxidation in the rabbit

left ventricular myocardium. Pflt'lrgrs. Arch. 1994;427:432-436,

60. Larsson, N-G, Wang, 1, WilheIrnsson, H, Oldfors, 4 Rustin, P, Lewandoski, M,

Barsh, GS, Clayton, DA Mitochondrial transcription factor A is necessary for

mtDNA maintenance and embryogenesis in mice. Nat- Genet. 1998;l8:Z 1-236 6 1. Fu, GK, Markovitz, DM. The human LON protease binds to mitochcndrial promoters

in a singIe-stranded, site-specific, strand-specific marner. Biochemistry.

1998;37: 1905-1999-

62. Yaffe MP. The machinery of mitochondrial inheritance and behaviour. Science

1993;283:1493-1496.

63. Nemoto, Y, hibas, M., Hafier, C, De CarniIli, P. Synaptojanin 2, a novel

synaptojanin isoform with a distinct targeting domain and expression pattern. J. Biol,

Chem- 1997;372:30817-3082 1.

64. Nemoto, Y, De Carnilli, P. Recruitment of an alternatively spliced form of

synaptojanin 2 to mitochondria by the interaction with the PDZ domain of a

mitochondrial outer membrane protein. MBO. J. 1999;l8:299 1-3006.

65. Nicholls, DG, Budd, SL. Mitochondria and neuronal survival. Physiol. Rev.

2000;80:315-360.

66. Seccia, TM, Atlante, 4 Vulpis, V, Marra, E, Passarella, S, Pirrelli, A Abnormal

transport of inorganic phosphate in le€t ventricuiar mitochondria from spontaneously

hypertensive rats. Ccrrdiologin. 1999;44:719-775.

67. Atlante, A, Seccia, TM. Pierro, P. Vulpis, V, Marra, E, Pirrelli, A, Passarella. S. ATP

synthesis and export in hem lefi ventrîcle mitochondria fiom spontaneously

hypertensive rat. Im. J. Mol. Med L998; I :709-716.

68. Everett, AD, Stoops, TI), Nairn, AC, Brautigan, D. Angiotensin ïi regulates

phosphorylation of translation elongation tàctor-2 in cardiac myoqes. Am. 1.

Physioi. 200 L;28 1 S161-H167. 69. Zak, R, Martin, AF, Reddy, MK, Rabinowiz, M. Control of protein balance in

hypertrophied cardiac muscle. Circ. Res. 1976;38:Il45-C150.

70. Purcell, NH, Tang, G., Yu, ClMercurio, F, DiDonato, JA, Lin, A. Activation of

NFKB is required for hypertrophic growth of pituitary rat neonatal ventricular

cardiomyocytes. Proc. Nd. Acad. Sci. USA. 200 1;98:6668-6673.

71. Wolfe, G. Free radical production and angiotensin. Cm-.Hyperfens. Rep.

2000;2: 167- 173.

72. Dhalla, NS, Temsah, RM,Netticada, T. Role of oxidative stress in cardiovascular

diseases. J. Hyperfem 2000; 18:655-673.

73. Shih, NL, Cheng, TH, Loh, SH, Cheng, PY, Wang, DL, Chen, YS, Liu, SH, Liew,

CC, Chen, JJ. Reactive oxygen species moduIate angiotensin II-induced B-myosin

heavy chah gene expression via Ra~extraceIlularsignal-regulated kinase

pathway in neonatal rat cardiomyocytes. Biocheni. Biophys. Rcs. Comm.

2001;283: 143-148.

74. Puri, PL, Avantaggiati, ML, Burgio, VL, Chirillo, P, Collepardo, D, Natoli. G,

Balsano, C, Levrero, M. Reactive oxygen intemediates rnediate angiotensin U-

induced chn-cFos heterodimer DNA binding activity and proliferative hypertrophic

responses in myogenic cells. J. Biol. Chem. 1995;270:22 129-22134.

75. Nemoto, S, Takeda, K, Yu, ZX, Ferrans, VJ, Finkel, T. Role of rnitochondrial

oxidants as regulators of cellular metabolism. Mol. Cell. Biol. 2000;20:73 11-73 18.

76. Suzuki, H, Kumagai, T, Goto, A, Sugiura, T. Cncrease in intracellular hydrogen

peroxide and upregdation of a nuclear respiratory gene evoked by impairment of rnitochondrial electron transfer in human ceUs. Biochem. Biophys. Res- Commrin-

1998;249:542-545.

77. Zhao, W,Raitt, DV, Burke, P, Clewell, AS, Kwast, KE, Poyton, RO. Function and

expression of flavohemogiobin in Saccharomyces cerevisiae. Evidence for a role in

the oxidative stress response. J. Biol. Chem. I996;27 1:25 13 1-25 138.

78. Csonka, C, Pataki, T, Kovacs, P, Muller, SL, Schroeter, ML, Tosaki, A, Blasig, iE.

Effects of oxidative stress on the expression of antioxidant defense enzymes in

spontaneously hypertensive rat hearts. Free. Rad. Biol. Meci 2000;29:612-6 19.

79. De Cavanagh, EM, Ferder, L, Carrasquedo, F, Scrivo, D, Wassermann, A, Fraga, CG,

Inserra, F. Higher levels of anti-oxidant defences in enalapril-treated versus no-

enalapril-treated hemodialysis patients. Am. J. Kidney Dis. 1999;34:445455.

80. Hobbs, KA, Srinivasan, M, McCaffery, hl, Jensen, RE. Mmmlp, a mitochondrial

outer membrane protein, is connected to mitochondrial DNA (mtDNA) nucleoids and

required for mtDNA stability. J. CeIl. Biol. 200 1; 152:40 1-410.

8 1. Moraes, CT. What regulates mitochondrial DNA copy number in animal cells?

Trends, Genet. 200 1; 17: 199-205.

82. ho, H, Torii, M, Suzuki, T. Decreased superoxide dismutase activity and increased

superoxide anion production in cardiac hypertrophy of spontaneousiy hypertensive

rats. Clin. Ky. Hypertens. 1995;17:803-8 16.

83. Atlante, A, Abruzzese, F, Seccia, TM, Vuipis, V, Doonan, S, Pirreiii, A, Marra, E.

Changes in enzyme levels in hypertensive hem tissue. Biochem. Mol BioL Int.

1995;37:983-990. 84. Binda, D, Nicod, L, VioUon-Abadie, C, Rodnguez, S, Berthelot, A., Coassoio, P,

Richert, L. Strain diirences (WKY, SPRD) in the hepatic antioxidant status in rat

and effect of hypertension (SHR, DOCA). Ex vivo and in vitro data. Mol. Cell.

Biochem. 2001;218:139-146. Table 4,l:Primer sequence, annealing temperature and RT-teinplate source designed for amplifying nuclear DNA yene products.

- -. - -

GENE Forward Prinier (5'-3') Reverse Primer (5'-3') T (OC) RT-Template Size (bp) dynamin ccttagaatctgttgatccac ttcagctgtatcacgagacaa skeletal muscle' mtTFA cttgtctgtattccgaagtg tgctcagagatgtctccg skeletal muscle'

Mn SOD acclgccttacgactatgg ccagttgattacattccaaat skeletal muscle' catalase atgtcctgaccaccgg cctcctcattcaacacctt skeletal muscle'

Cu/Zn SOD act t cgagcagaaggca cagcatttcca&qctttgtac skeletal muscle'

RH' accgtgaaccagctagccccatg tcgatccaccacgcctayctcatc skeletal muscle'

LON protease t tggttgagctgcigagaagg gaggagtggttgtccagcag f-€EK 293 synaptojanin-2a cttagcggatgagtttggtca tctacggg1glcaglctctgg skeletal muscle' .. RHP: rat hypenensive protein; mtTFA: iniicichandrial transcription factor A; SOD: superoxide dismutase;'total RNA from Sprague-

Dawley rat skeletal muscle: bp; base pair

Figure 4.1 : Treatment profile of SHR rats.

Schedule of enalapril cycles and sarnpling, overlaid on a representative trace of enalapril- rnediated changes in rnean artenal blood pressure (T.M.Hale, T.L. Bushfield and M.A.

Adams; unpublished observations).

Figure 4.2: Temporal changes in LV mass [g(LV+S)/BW] in controi (e) and enalapril-

treated (C) SHR.

Ali data are presented as meanISEM (n=6 for al1 groups except d IOT'c 1 (9),2 011.12off

TC (9,d lOTx3 (4), 44 wk 2 od2 ofTC (5) and 44 wk 2 od2 off T (4)). " significantly diferent (pC0.05) fiom 15 wk time control; significantly different (pc0.05) from age- matched tirne control; ' significantly different (p

in control (+) and enalapril-treated (5)SHR (inset panel: total LV enzyme activity).

Al1 data are presented as mean*SEM (n=6 for al1 groups except 2 od2 off TC (1 I), 2 od2 off T (1 l), 44 wk 2 od2 off TC (5), 44 wk 2 od2 off (4)). " significantly different

(~4.05)from 15 wk time control; significantly different (pC0.05) from age-matched time control; ': significantly different (pC0.05) hmother treatment groups;

significantly different (p

SOD (B) in controi (+) and enalapril-treated (C)SHR (inset panel: total LV enzyme

activity).

Al1 data are presented as meankSEM (n=6 for al1 groups except 2 on12 off TC (1 l), 2 od2 off T (1 l), 44 wk 20d20ff TC (5),44 wk 2 od2 off (4)). " significantly different

(p<0.05) from 15 wk time control; significantly different (pC0.05) fiorn age-matched time control; 'significantly different (p

significantly different (p<0.05) tiom al1 other the points. Time (weeks) Figure 4.5: Enalapd-mediated changes in mtDNA copy number, RNA levels and content

of mitochondrial proteins.

A Total lefl ventricular mtDNA copy number in control (+) and enalapnl-treated (3)

SHR. (n=6) significantly different (pC0.05) from 15 wk time control; 'significantly

different (p<0.05) from other treatment groups). B. Representative autoradiograms of

COX 1, COX II, and COX IV RNA levels in response to enalapril treatment. C. RNA

levels of each transcnpt normalized to a-tubulin and expressed reIative to 1 S wk tirne

controIs (n=3). D Representative ECL exposures of COX II, COX [V, ND 1, cytochrome

c, porin and actin fiom multiple biots of the same protein fractions (n=4). COX IV

Tfam ab------porin Figure 4.6: Enalapril-mediated changes in the levels of gene products involved in oxidant

metabolism, reticulurn maintenance, mtDNA expression and mitochondrial protein

degradation.

A. Representative autoradiograms of Mn SOD, CdZn SOD, catalase, rat hypertensive protein (RHP), synaptojanin-2a (syn-îa), mtTFA and LON protease (Ion) RNA Ievels in response to enalapril treatrnent. B. RNA levels of each transcript norrnalized to a-tubulin and expressed relative to 15 wk time controls (n=3), C. Representative ECL exposures of

catalase, Mn SOD, CdZn SOD and actin fiom multiple blots of the same protein

fractions. D. Steady-state levels of each protein nomalized to actin and expressed

relative to 15 wk tirne controls (n=4). a Mn SOO iCual SOD n catalase

rntTFA nhn

Transuipt levels (% 15 wk TC)

CulZn SOD Mn SOD

350 a CulZn S00 rn Mn SOD Ci catalase Chapter 5. General Discussion

Eukaryotic cells ffequently alter their mitochondrial content when exposed to chronic physiological stimuli in order to more appropriately meet energetic demands.

Bioenergetic shortfalls that aise as a result of both chronic and acute physiological challenges are accompanied by fluctuations in the cellular levels of many bioenergetic parameters known to impinge upon mitochondrial tùnction. However, the ability of either altered redox state (e.g. NAD(P)+/NAD(P)H), metabolite ratios (e.g. ADPIATP) or ROS production to modulate the observed changes in gene expression and, ultimately mitochondrial content, has received relativeiy little attention. This thesis addressed the potential involvement of such perturbations in cellular energetics in contributing to changes in COX content in stnated muscles.

Three complementary approaches were used to evaluate the relationship between chronic bioenergetic stress and the synthesis and degradation of COX. In the first model, several bioenergetic indices were measured in differentiating myocytes to evaluate whether hypennetabolic stress preceded the mitochondrial biogenesis that accompanies myogenesis, While there was a profound change in the relative reliance upon glycolytic and oxidative metabolism, dgerentiating myocytes retained excess metabolic capacity with which to meet energetic demands. Thus, it is unlikely that hypermetabolic stress either directly or indirectly acts as a physioIogical trïgger to induce increases in mitochondrial content dunng myogenesis. However, other observations provide insight into potential mediators of the metabolic shift during myogenesis. The increased activation state of the pymvate dehydrogenase complex throughout myogenesis couid be explaïned by elevated intramitochondrial calcium concentrations (see Robb-Gaspers et ai., 1998). Since calcium can modulate both mitochondrial metabolism (see McCormack and Denton, 1993) and respiratory gene expression (Biswas et al., 1999; Freyssenet et al.,

1999), its role in mediating mitochondrial changes is worthy of fùture study. The possibility that other metabolically-driven signalling pathways independent of bioenergetic stress par se (e.g ROS) are involved in the mitochondrial biogenesis that accompanies myogenesis represents another potential avenue for hrther investigation.

In a related effort to mimic energetic shortfalls that may be experienced by striated muscle dunng physiological stimuli, we attempted tu fractionally inhibit COX activity in cultured myocytes using sodium azide. Surprisingly, application of azide concentrations that should have acutely inhibited between 2-5% oftotal COX activity resulted in a profound and irreversible Ioss of catalytic activity. While an azide-induced model of COX loss represented a pharmacological manipulation, several considerations resulted in the tùrther characterization of the molecular basis of the observed effects.

First, aide-mediated COX inhibition was specific with respect to bioenergetic enzymes.

Since COX deficiency is the most comrnon metabolic lesion seen in childhood mitochondrial diseases (Csmso et al., 1996), our model fortuitously provided an alternative ce11 culture approach with which to study the mechanistic basis of COX losses. Second, &de treatment mediated the additional losses of CdZn SOD and cataiase activities and, as a resuIt, represented a convenient opportunity to fùrther consider the role of ROS production in mediating mitochondriai dysfùnction in the pathophysiology of many disease States (Esposito et ai., 1999; Di Giovanni et al., 200 1; Kokoszka et d.,

200 1). Third, the mechanism(s) by which aide mediated irreversible COX losses had not been previousIy descnied, despite earlier reports that chronic in vivo administration of aide with osmotic pumps mimicked the symptoms of Alzheimer's disease (Bennett et al., 1996). in addition, the widespread application of aide as a "specific" inhibitor occurs routineiy even though it has been broadly used to alter a number of ceiiular processes, including calcium homeostasis (Misler et ai., 1992; Biswas et al., 1999; Hedin et al.,

2000), ROS (singlet oxygen scavenger, Menon et al., 1998) and RNOS metabolism (NO scavenger, VanUffelen et al., 1998; Nz03 scavenger, Zhou et al., 2000; cGMP-dependent signalling, Sano et al., 1997).

Subsequent characterization of the mechanistic basis of azide-mediated COX losses revealed that the decline in catalytic activity occurred in the absence of changes in the rates of mitochondrial protein synthesis, and in the levels and stoichiometries of

mitochondrially- and nuclear-encoded COX subunits. This observation has profound

impiications for diagnostic approaches to assessing the molecular basis of COX

deficiency, and extends a recent report of normal subunit profiles in COX-deficient

patient ce11 lines (Hanson et al., 200 1). The greater loss of catalytic activity relative to

either aa3 or holoenzyme levels fùrther suggested that azide exened its effects on

catalytic activity by damaging the holoenzyme in a way that promoted its dissociation

andfor degradation. This finding provides a mechanistic basis for differential effects on

cataiytic activity and aa content that have been observed in some disease States (Menkes'

syndrome, Kuznetsov et al., 1996: Alzheimer's disease, Parker et ai., 1994). Because

COX assays are kquently problematic (e-g. differential solubilization, detergent effects,

hem),it is also possible that some reports of COX defects are actually attributable to

incongruities related to the assay conditions. The pleiotropic effects of aide on COX, cataiase and CulZn SOD also compiicate concIusions based upon its use as a 'specific' inhibitor to study discrete aspects of cellular function.

The final experimental approach continued to examine the pathophysiological mechanisms of COX losses in the lefi ventncles of spontaneously hypertensive rat (SHR) hearts as a hnction of treatment with the anti-hypertensive drug enalapril. This mode1 was related to the first two approaches in that the experimental manipulation is known to induce bioenergetic alterations (Sanbe et al., 1995) and cause changes in some mitochondrial enzymes (Chen et al., 1995; Ferder et al., 1998). However, it differed fundamentally fiom my other studies in that it also addressed the role of hypometabolic conditions in mediating mitochondnal regression.

Despite significant enalapril-mediated regression of ventricular mass, the specific activity of COX (Ufg LV) was maintained over a fairly narrow range independent of treatment duration or organismai age. As with reduced COX activity observed in response to azide treatment, parallei reductions in its total content and ventricular mass mediated by enalapril occurred without significant changes in the mRNA or protein

Ievels of mitochondrially- and nuclear-encoded COX subunits. While this suggested that

the reduced COX content that accompanies ventricular regression could be

accommodated by rather modes changes in the relative rates of synthesis and degradation, we cannot exclude the possibility that our on-treatment sampling protocol

was too broad to detect significant changes in the ievels of relevant mRNAs and proteins

that may have occurred earlier in the enalapril treatment cycle,

In contrast to the observed reductions in ventricular mass and mitochondriai

enzyme activities (-30%) in response to enaiapril treatment, total ventricular mtDNA content (copy nurnber1LV) remained unchanged. Two muhially exclusive mechanisms can account for the discordant changes in mitochondrial parameters during the mitochondrial remodelling that accompanies ventricular regression. Mitochondriai regression may involve the regulated degradation of specific mitochondriai elements via inner membrane and matrix proteases (see Suzuki et al., 1997)- Altematively, mtDNA- deficient regions of the mitochondrial syncytium may be preferentially degraded by autophagy (see Lemasters et ai., 1998). While these results collectively suggest that mitochondriai enzymes are tightly regulated during rapid phases of cardiac adaptation,

mechanisms by which changes in bioenergetic and contractile pararneters are

coordinateiy regulated remain equivocal. Future studies are planned that will directiy

address these and related issues in order to clariG the relative involvement of synthesis

and degradation, the mitochondrial syncytiurn and ROS-sensitive signalling in enalapril-

rnediated mitochondrial regression.

SUMMARY AND PERSPECTIVES

It is extraordinarily dificult to make NI vivo measurements of redox changes in

either bioenergetic or oxidative parameters that directly address their ability to trigger a

physiological signal that uitimately modulates changes in mitochondrial content. The

associated difficulties are perhaps best illustrated by the on-going debate conceming the

physiological relevance of mitochondrial ROS production.

Mitochondrial energy metabolism and ROS production are intimately linked in

that superoxide is a normal by-product of respiration, and its rate of production, dong

with that of other mitochondrially-derived fiee radicals, changes in response to numerous

physiological stimuli (see Boveris, 1977). These observations coiiectively led to the proposa[ that altered rates of mitochondriai ROS production allow for nucleo- mitochondnal communication (see Poyton and McEwen, 1996). However, despite the attractive links between mitochondrial energetics and ROS production, there is iittle

direct experimental evidence to support release of mitochondrially-derived ROS into the

cytosol under normal, physiological conditions (see Forman and Aza', 1997). This has

led several groups to openly question the proposed role of mitochondrial ROS production

in modulating cellular events.

Clarifying uncertainties surrounding mitochondrial ROS generation and

subsequent release into the cytosol are compounded by two unrelated limitations. First,

ROS-specific fluorophores, which were onginally intended to measure many fold

changes in ROS production, are not able to reliably detect small. localized yet

physiologically significant changes in production. Thus, a probe that allows for real-time

measurements of physiologically localized changes in ROS production is not currently

available. Second, ROS-sensitive dyes are also cornpetitors for ROS, such that changes in

ROS 'production' may reflect altered eficiency of endogenous scavengers rather than

dtered rates of production. Third, although gene knockout approaches may provide

insight into the involvement of an individual redox-sensitive signalling pathway in a

&en cellular event, the large amount ofredundancy and cross talk that exists between

pathways makes it is difficult to eliminate the possibility of compensatory responses that

may not othemise be operative.

Some of these concerns were obviated in the chronic azide studies by using

rnuhipk, complementary approaches to evaiuate the importance of ROS production on

the observed effect(s). Simiiar approaches could be used to address the role of ROS in modulating the observed changes in COX content during myogenesis and as a result of enalapril treatment. Although uncertainties remain with respect to the regdatory potential of altered redox balance, the present studies greatly contribute to our understanding of the relative contributions of bioenergetic perturbation in modulating changes in COX content in striated muscles. Future studies in this area need to incorporate and integrate appropriate molecular genetic. biochemical and physiological approaches to investigate the role of ROS in mediating mitochondrial changes. REFERENCES

Bennett, M.C. Mlady, G.W., Kwon, Y .-FI., & Rose, G.M. Chronic in vivo sodium aide

infiision induces serective and stable inhibition of cytochrorne c oxidase. J.

Neurochem. 66,2606-26 1 1.

Biswas, G., Adebanjo, O.A., Freedman, B.D., Anandatheeerthavarada, H.K.,

Vijayasarathy, C., Zaidi, M., KotlikotE M.. & Avadhani, N.G. (1999). Retrograde

ca2+signalling in C2C 12 skeletal myocytes in response to rnitochondrial genetic

and metabolic stress: a novel mode of inter-organelle cross talk. EMBO.J. 18,522-

533.

Boveris, A. (1977). Mitochondrial production of superoxide radical and hydrogen

peroxide. Adv. Exp. Med. Biol. 78, 67-82-

Caruso, U., Adami, A., Bertini, E., Burlina, AB., Carnevale, F., Cerone, R., Dionisi-Vici,

C., Giordano, G., Leuzzi, E., Parenti, G., Savasta, S., Zlzïel, G., & Zeviani, M.

(1996). Respiratory-chah and pywate metabolism defects: Italian coilaborative

survey on 72 patients. J- Mierît. Meth Dis. 19, 143-148. Chen, L., Tian, X., & Song, L. (1995). Biochemical and biophysical charactaristics of

rnitochondria in the hypertrophie hearts fiom hypertensive rats. Chin. Med. J. 108,

361-366.

Di Giovanni, S., Mirabella, M., Papacci, M., Odoardi, F., Silvestn, G., & Se~dei,S.

(200 1 ). Apo ptosis and ROS detoxification enzymes corrdate with cytochrome c

oxidase deficiency in mitochondriai encephalomyopathies. Mol. Cell, Neurosci. 17,

646-705.

Esposito, L.A., Mebv, S., Panov, A., Cottrell, B.A., & Wallace, D.C. (1999).

MitochondriaI diseass in mouse results in increased oxidative strass. Proc. Natl.

Acad. Sci. USA 96,48204825,

Ferder, L., Romano, L.A., Ercoie, L.B., Stella, E., & Insena, F. ( 1998). BiomoIecular

changes in the aging myocardium: the effect of enalapril. Am. J. Hypertens. 12,

1297- 1304.

Forman, H.J..& Ani, A. (1997). On the virtual existence ofsuperoxide anions in

mitochondna: thoughts regarding its role in pathophysiology. FASEB. J. I 1, 374-

375-

Freyssenet, D., DiCarlo, Me, & Hood, DAj 1999). Calcium-dependent regdation of

cytochrome c gene expression in skeletal muscle cells. Identification of a protein

kinase C-dependent pathway. J. Biol. Chem. 274,9305-93 1 1.

Hanson, B.J., Carrozzo, R., Piemonte, F., Tessa, A, Robinson, B.H.,& Capaldi, RA.

(200 1). Cytochrorne c oxidase-deficient patients have distinct subunit assembly

profiles. J. Biol. Chem. 276, 16296-1630 1. Hedin, H.L.M., Eriksson, S., & Fowler, C.J. (2000). Rapid inhibition by sodium aide of

the phosphoinositide-mediated caIcium response to serotonin stimulation in human

platelets: preservation in Alzheimer's disease. Biochem. Biophys. Res. Comm. 274,

472-476.

Kokoszka, J.E., Coskun, P., Esposito, LA., & Wallace, D.C. (2001). Increased

mitochondrial oxidative stress in the sod-" mouse results in the age-related decline

in mitochondrial fùnction culminating in increased apoptosis. Proc. Natl. Acad. Sci.

USA 98,2278-2283.

Kuznetsov, A, Clark, J.F., Winkler. K., & Kunz, W.S. (1996). [ncrease of flux control of

cytochrome c oxidase in copper-deficient mottled brindled mice. J. Biol. Chem.

271, 283-288.

Lemasters, J.J., Nieminen, A,-L., Qian, T., Trost, L.C., Elmore. S.P., Nishimura, Y.,

Crowe, R.A., Cascio, W.E., Bradham, C.A., Brenner, D.A, & Herman, B. (1998).

The mitochondrial permeability transition in cet1 death: a common mechanism in

necrosis, apoptosis and autophagy. Biochim. Biophys. Acta. 1366, 177- 196.

McCormack, J.G., & Denton, KM.(1993). The role of intramitochondrial ~a'~in the

regdation of oxidative phospharylation in marnmalian tissues, Biochem. Soc.

Trans. 21, 793-799.

Menon, M., Maramag, C., Malhotra, R.K. & Seethalakshrni, L. (1998). Effect of vitamin

C on androgen independent prostate cancer cells (PC3 and Mat-Ly-Lu) in vitro:

involvement of reactive oxygen species-effect on ceIl number, viability and DNA

synthesis. Cancer. Biochem. Biophys. 16, 17-30. Misler, S*, Barnett, D.W., & Falke, L.C. (1992). Effects of metabolic inhibition by

sodium azide on stimulus-secretion coupling in B cells of human islets of

Langerhans. Pflugers Arch. 42 1,289-29 1.

Parker Jr., W.D.,Parks, J., Filley, C.M., & Kleinschmidt-DeMasters, B.K. (1 994).

Electron transport chah defects in Alzheimer's disease brain. Neurology. 44, 1090-

1096.

Poyton, RO., & McEwen, J.E. (1996). Cross talk between nuclear and mitochondriai

genomes. Annu. Rev. Biochem. 65,563-607.

Robb-Gaspers, L.D., Bumett, P., Rutter, G.A., Denton, R.M.. Riuuto, R, & Thomas,

A.P. (1998). [ntegrating cytosolic calcium signals into mitochondrial rnetabolic

responses. EMBO.J. 17,4987-5000.

Sanbe, A., Tanonaka, K., Kobayasi, R., & Takeo, S. (1995). Effects of long-term therapy

with ACE inhibitors, captopril, enalapril and trandolapril, on myocardial energy

metabolism in rats with heart failure following myocardial infarction. J. Mol. Cell.

Cardiol. 27, 3203-2222.

Sano, I., Minimoto, A,, Sakai, T., Tamura, T., & ttoh, 2. (1997). Sodium aide induces

relaxation of the canine gastric body by activating a guanylate cyclase-dependent

pathway. Neurogastroenterol, Motil. 9, 193-20 1.

Seccia, T.M.,Atlante, A., Vulpis, V., Marra, E. Passarella, S., & Pirrelli, A. (1999).

Abnormal transport of inorganic phosphate in left ventricuiar mitochondria tiom

spontaneously hypertensive rats. Cardiologia. 44,719-725. Suzuki, C.K., Rep, M., van Dijl, J.M., Suda, K., GriveU, L.A., & Schatz, G. (1997). ATP-

dependent proteases that also chaperone protein biogenesis. Trends. Biochem. Sci.

22, 118-123.

Zhou, X., Espey, M.G., Chen, J.X., Hofseth, L.J., Miranda, K.M.,Hussain, S.P., Wink,

D.A., & Harris, C.C.(2000). lnhibitory effects of nitric oxide and nitrosative stress

on dopamine-B-hydroxylase. J. Biol. Chem. 275,2 124 1-2 1246.