Oncogenic Properties of NEAT1 in Prostate Cancer Cells Depend on the CDC5L–AGRN Transcriptional Regulation Circuit

Published OnlineFirst June 5, 2018; DOI: 10.1158/0008-5472.CAN-18-0688

Cancer Genome and Epigenome Research

Oncogenic Properties of NEAT1 in Prostate Cancer Cells Depend on the CDC5L–AGRN Transcriptional Regulation Circuit Xin Li1,2,3, Xianteng Wang1,2,3, Wanlu Song1,2,3,4,HuiXu1,2,3,4, Rongyao Huang1,2,3, Yuting Wang1,2,3,5, Wenwei Zhao1,2,3, Zhengtao Xiao1,2,3,4, and Xuerui Yang1,2,3

Abstract

The long noncoding RNA nuclear-enriched abundant tran- and ChIP-seq analyses further revealed a handful of potential script 1 (NEAT1) has been shown to regulate multiple cancer- targets of CDC5L regulated by NEAT1 expression. One target related cellular activities including cell proliferation, apopto- of CDC5L, ARGN, mediated the strong phenotypic conse- sis, and migration. In this study, we confirm that repression of quences of NEAT1 reduction, including DNA damage, cell- NEAT1 induces DNA damage, disturbs the cell cycle, and cycle dysregulation, and proliferation arrest. In summary, arrests the proliferation of prostate cancer cells. By taking we have established the requirement of the CDC5L–AGRN advantage of the prostate cancer tumor transcriptome profiles circuit for the essential oncogenic role of NEAT1 in prostate from The Cancer Genome Atlas, our data-mining pipeline cancer cells. identified a series of transcription factors (TF) whose regulatory activities on target genes depended on the level of Significance: An integrative methodology uncovers NEAT1. Among them was putative TF CDC5L, which bound CDC5L–AGRN signaling as critical to the tumor-promoting directly to NEAT1. Silencing NEAT1 in prostate cancer cells function of long noncoding RNA NEAT1 in prostate cancer repressed the transcriptional activity of CDC5L, and RNA-seq cells. Cancer Res; 78(15); 4138–49. 2018 AACR.

Introduction vious high-throughput profiling studies also revealed more proteins that interact directly with NEAT1 but are not essential for the Nuclear enriched abundant transcript 1 (NEAT1), which is a architecture of the paraspeckle (9, 14). The functions of these long noncoding RNA (lncRNA), has been shown to play key roles interactions remain largely unknown. in a variety of cancer-related cellular activities, including cell Although substantial abnormalities of NEAT1 have been proliferation, apoptosis, DNA damage, invasion, and migration observed frequently in various cancer-related contexts (1–3, (1–4). However, the detailed mechanisms have not been fully 15–18), the exact role of NEAT1 in tumorigenesis is still debated, elucidated. NEAT1 is an essential component of the paraspeckle and the potential underlying machineries remain largely unclear. (5, 6), which is a nuclear speckle near the cell nucleolus. Specif- For example, NEAT1 has been identified as a direct transcriptional ically, NEAT1 binds directly to the core proteins in the para- target of p53 in multiple studies; however, those studies derived speckle, such as SFPQ (7) and NONO/p54 (8), and the major seemingly contradictory functions of NEAT1 (4, 19). Being pro- function of this RNA-protein complex is believed to be the posed as an oncogenic lncRNA, NEAT1 was shown to serve as a regulation of gene expression at the transcriptional (7, 9, 10) and negative feedback signal that attenuates p53 activity by preventing post-transcriptional (11–13) levels. For example, NEAT1 and the DNA damage accumulation (4). In contrast, NEAT1 was also paraspeckle were shown to be enriched around gene transcription characterized as a major component of the p53-mediated sup- start and termination sites in breast cancer cells (9), although their pression of transformation and cancer development (19). In the involvement in transcription remains unclear. In addition, pre- present study, we confirmed that NEAT1 is essential for the proliferation and tumorigenesis of the castration-resistant prostate cancer (CRPC) cell lines, including PC3, which bears a 1MOE Key Laboratory of Bioinformatics, Tsinghua University, Beijing, China. hemizygous p53 deletion and mutation, and DU145, which 2School of Life Sciences, Tsinghua University, Beijing, China. 3Center for Syn- carries two nonsynonymous mutations of p53. We showed that thetic and Systems Biology, Tsinghua University, Beijing, China. 4Tsinghua- knocking down NEAT1 resulted in significant DNA damage and 5 Peking Joint Center for Life Sciences, Beijing, China. Joint Graduate Program of suppression of cell proliferation and tumor growth. Peking-Tsinghua-National Institute of Biological Science, Tsinghua University, Mechanistic investigations for many lncRNAs has been chal- Beijing, China. lenging and the studies remain limited, partly due to lack of prior Note: Supplementary data for this article are available at Cancer Research knowledge and difficulties in generating plausible hypotheses to Online (http://cancerres.aacrjournals.org/). start with. Regulation of gene transcription has been one of the Corresponding Author: Xuerui Yang, Medical Science Building, Tsinghua Uni- major known functions of multiple lncRNAs (20, 21). To eluci- versity, Beijing 100084, China. Phone/Fax: 86-10-62783943; E-mail: date the machinery responsible for the essential function of [email protected] NEAT1 in prostate cancer cells, we applied an integrative data- doi: 10.1158/0008-5472.CAN-18-0688 mining strategy to identify potential transcription factors (TF) 2018 American Association for Cancer Research. whose transcriptional activity depends on the level of NEAT1. This

4138 Cancer Res; 78(15) August 1, 2018

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

analysis based on transcriptome profiling data from about 500 ATGCCCAAACTAGACCTGCC, CDC5L: TCCGTTTAGGGTTGT- prostate tumors in The Cancer Genome Atlas yielded a series of TGGGC and TCTCGTATGGCCTGCTTTCG, AGRN: ACAC- known TFs and other DNA-binding proteins, including CDC5L, a CGTCCTCAACCTGAAG and CCAGGTTGTAGCTCAGTTGC, putative TF shown to bind directly to NEAT1 by the CHART-MS LMNA: ATGAGGACCAGGTGGAGCAGTA and ACCAGGTTG- assay (9). CDC5L, cell division cycle 5-like protein, is a critical CTGTTCCTCTCAG, B2M: AGTATGCCTGCCGTGTGAA and element for mitotic progression. Inhibition of CDC5L resulted in AGCAAGCAAGCAGAATTTGGA. arrest of the mitotic and activated spindle assembly checkpoint (22). Moreover, CDC5L was involved in the regulation of ATR- Cell proliferation assay associated cell-cycle progression, and silencing CDC5L affected The cells transfected with control or gene knockdown siRNAs not only the mitotic checkpoint but also the S phase checkpoint by were cultured in appropriate plates. The IncuCyte live-cell imag- interacting with ATR (23). Guided by our data-mining results, our ing and analysis system (ESSEN Bioscience) was used to monitor experimental studies confirmed the regulation of CDC5L by long-term cell growth and morphology changes. Cell prolifera- NEAT1 and identified the target gene of CDC5L, AGRN, which tion was quantified by measuring the occupied area (% conflu- was modulated by NEAT1. We finally proved that this transcrip- ence) in the cell images over time. tional regulatory circuit, NEAT1–CDC5L–AGRN, is essential for proper tumor cell growth, and repression of the pathway causes Western blotting and antibodies DNA damage and potent arrest of the cell cycle and proliferation. The cells were lysed with RIPA lysis buffer (Solarbio) supple- Therefore, we are proposing a novel transcription regulation mented with proteinase inhibitor (Solarbio). Protein concentra- machinery that mediates the oncogenic role of NEAT1 in prostate tions were quantified using the BCA protein assay (Pierce). The cancer cells. cell lysate containing 20 to 30 mg proteins was heat denatured and subjected to SDS-PAGE, followed by transfer to a negative control Materials and Methods membrane. The membrane was incubated with the primary and Cell culture secondary antibodies and visualized with the SuperSignal West PC3 and DU145 cells were purchased from the ATCC. The Pico Chemiluminescent HRP substrate (Thermo). The primary ATCC has performed authentications for both cell lines by short CDC5L antibody and secondary antibodies Alexa Fluor 488 tandem repeat DNA profiling, morphology, and karyotyping. PC3 (Donkey anti-Mouse), Alexa Fluor 594 (Donkey anti-sheep), and cells were cultured in RPMI-1640, and DU145 cells were cultured Alexa Fluor 594 (Goat anti-Rabbit) were purchased from Abcam. in Eagle's Minimum Essential Medium, which were both supple- The ACTB antibody and secondary antibodies Goat to Rabbit and mented with 10% FBS (HyClone). The cells were maintained in a Goat to Mouse were from Bioss. The Phos-H2AX (Ser139) antibody was from Ruiying Biological, AGRN (D2) antibody from humidified incubator with 5% CO2 at 37 C. Cells after the second passage and before the 10th passage were used for the experi- Santa Cruz Biotechnology, secondary antibody Alexa Fluor 488 ments. All cells were routinely tested as Mycoplasma-free with the (Donkey anti-Rabbit) from Life Technology, and PSPC1 and Mycoplasma Detection Kit (Bimake, B39032). SFPQ antibodies from Sigma.

Transfection and quantitative PCR DNA damage quantification All siRNAs in this study were purchased from GenePharma Cells transfected with siRNA were cultured with 5% CO2 at (Shanghai, China). The antisense and sense sequences of the 37C for 24 hours. Genomic DNA was isolated with the AxyPre siRNAs are the following. siNEAT1_2: UUAAGAUUGAGAU- Multisource Genomic DNA Miniprep Kit (AxyGEN). A total of UUACCCag and GGGUAAAUCUCAAUCUUAAtt, siNEAT1: 0.1 mg/mL of purified genomic DNA was mixed with 5 mLof GGAAAGUUUCUAAGCAACUUCUCACUU and GUGAGAA- ARP solution and incubated at 37C for 1 hour to tag the DNA GUUGCUUAGAAACUUUdCdC, siCDC5L-1: UCAGACAAAA- AP site. The AP-labeled DNA was isolated and measured accord- GUGUACUGGaa and CCAGUACACUUUUGUCUGAtt, siCD- ing to the manufacturers' instructions (Biovision). C5L-2: AAACUUGACUGUAGCAUUCtt and GAAUGCUACAGU- CAAGUUUtt, siAGRN-1: UCAGUUCAAAGUGGUUGCUct and TUNEL analysis AGCAACCACUUUGAACUGAtt, siAGRN-2: AUAAAUCGCAC- The siRNA-transfected cells were washed twice with 1 PBS GUGCUCCUGC and GCAGGAGCACGUGCGAUUUAT, siB2M: solution, fixed with 4% paraformaldehyde for 30 minutes, and UACAAGAGAUAGAAAGACCAG and CUGGUCUUUCUAUCU- then washed twice with 1 PBS. The fixed cells were perme- CUUGUA, siLMNA: AUCUCAUCCUGAAGUUGCUUC and abilized with 0.3% Triton X-100 in PBS solution for 5 minutes GAAGCAACUUCAGGAUGAGAU, siNC: ACGUGACACGUUCG- and then rinsed with PBS solution. After preparing the TUNEL GAGAA and UUCUCCGAACGUGUCACGU. A total of 10 nmol/L measurement solution (Beyotime), the fixed cells were incubated siRNA was transfected with the Lipofectamine RNAiMAX with the appropriate TUNEL measurement solution at 37C for Reagent (Invitrogen) according to the manufacturer's instruc- 30 minutes and then photographed with a microscope. tions. For plasmid transfection, plasmids were transfected with Lipofectamine 2000. Flow cytometry assay Total RNA was isolated using the RaPure Total RNA Micro Kit Cells transfected with siRNAs were harvested and centrifuged at (MaGen). Then, 1 mg of total RNA was reverse transcribed using a 1,200 rpm, 4C for 5 minutes. The supernatant was removed, and High-Capacity cDNA Reverse Transcription Kit (Invitrogen). the cells were re-suspended in 1 PBS solution. The cells were Quantitative PCR was carried out with SYBR Green Master then re-centrifuged at 12,000 rpm and 4C for 5 minutes and then Mix (Invitrogen). The forward and reverse primers are the fol- re-suspended in 0.3 mL of 1 PBS solution. Then, the cell lowing. NEAT1_2: TTCACCTGCTCTGGCTCTTG and GCCAGG- suspension was gently mixed with 0.7 mL of 100% ethanol and CACCGTGTTATACT, NEAT1: GACCTCTCACCTACCCACCT and stored at 20C overnight. On day 2, the cells were washed

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4139

Li et al.

once with 1x PBS solution and then centrifuged. Then, the cell TACTTCAC, Scramble sgRNA-2: GCGCCTTAAGAGTACTCATC. pellet was re-suspended in 0.25 mL of 1 PBS solution, and Both vectors were individually mixed with the packaging plasmid added 5 mL of 10 mg/mL RNAse A (the final concentration was psPAX2 and VSVG. The plasmids were transfected into HEK293T 0.2–0.5 mg/mL) for incubation at 37C for 30 minutes. After cells with the Lipofectamine 2000 reagent (Invitrogen). The 30 minutes, 62.5 mLofa50mg/mL propidium iodide (PI) solution media with virus was collected 72 hours after transfection and was added; the cells were then kept in the dark at 4C until the time passed through a 0.45 mm filter. The cells were infected in media of analysis. containing 8 mg/mL of polybrene and spin-fected by centrifuga- Assessment of apoptosis was done by flow cytometry as well, tion at 2,200 rpm for 2 hours. After 24 hours of infection, the virus with the Alexa Fluor 488 Annexin V/Dead Cell Apoptosis was removed, and the cells were cultured using media with Kit (Invitrogen). Specifically, cells transfected with siRNA for appropriate antibiotics. 48 hours were washed with 1 PBS solution. Cells were harvested and re-suspended with 1 Annexin-binding buffer (Invitrogen) Xenograft assay to make final cell concentration of 1 106 cells per ml. 100 mLof The animal model was carried out in male BALB/c nude mice cell suspension was transferred to a new tube, and 5 mL of Annexin (6–8-weeks-old) First, 5 million cells with inducible gene knock- V solution and 5 mL of PI solution were added to the cell down were gently mixed into 150 mL of PBS and used to infect suspension. Cells were incubated at room temperature for the mice subcutaneously. The tumor volume was recorded after 15 minutes with protection from light, followed by addition 7 days of treatment. The drinking water of the mice contained of 400 mL1 Annexin-binding buffer for a flow-cytometry assay. 2 mg/mL of doxycycline and 5% sucrose. The tumor volume was measured every 5 days. Tumor weight was measured at the end Dual-luciferase reporter assay of experiment. All the studies with mice have been approved The CDC5L- or CMV-motif-luciferase plasmid was constructed by the Institutional Animal Care and Use Committee at Tsinghua as described previously (24). The two plasmids, 50 ng of CMV- or University. CDC5L-motif-Luc (firefly) and 1 ng of pRL-TK (Renilla) were co- transfected into cells with 10 nmol/L of siRNA negative control RNA sequencing (siNC) or siNEAT1_2 at 96-well format. After 24 hours of trans- Total RNA was isolated from cells transfected with siNC and fection, the cells were washed with 1 PBS solution and analyzed siNEAT1_2. Before library construction, ribosomal RNA was with a dual-luciferase reporter assay kit (Promega: E1910) as the removed using a Ribozero Kit (Epicentre). The RNA-seq library manufacturer's instruction. The luciferase activity was measured was generated using a NEB Next Ultra Directional RNA Library using ELISA and normalized to Renilla luciferase. Prep Kit (NEB). RNA-seq was carried out with Illumina HiSeq X Ten. RNA fluorescence in situ hybridization and immunofluorescence staining Differential expression analysis and gene set function A 0.5 kb fragment of NEAT1_2 was amplified using the relevant annotation primer sets (GCCTTCATTTATCCTCAGATCAGGTGAG and Truseq library 2 125 reads from total RNA sequencing GTGTCTTTCATTTCATGCCCGCACTGCAC). The amplified DNA (RNA-seq) were first pre-processed using Cutadapt to remove clone was generated with pGEM-T (Promega). The NEAT1_2 adaptors and trim low-quality bases from the 50 and/or 30 ends. probe was synthesized with DIG RNA labeling Mix (Roche) and After discarding reads shorter than 20 bp, paired-end reads were SP6 polymerase (Thermo), according to the manufacturers' mapped to the hg38 genome using the splice-aware algorithm instructions. The RNA–FISH assay was performed as described RSEM (v1.2.15), with GENCODE v23 reference annotation and previously (25). the following parameters: "—bowtie2—paired-end." Differential For immunofluorescence staining, cells were fixed with 4% gene-expression analyses were performed with the R package formaldehyde solution for 15 minutes and then washed thrice DEseq and marked on a volcano plot. Significantly up- and with 1 PBS solution at room temperature for 15 minutes. downregulated (|log2-fold change| >1 and P value < 0.05. Subsequently, the slides were permeabilized with PBT (0.1% siNEAT1_2 vs. siNC) genes were used for gene set function Triton X-100 in 1 PBS solution) and then washed with 1 PBS annotation analysis with Metascope (http://metascape.org/gp/ solution at room temperature for 15 minutes. The slides were index.html#/main/step1) and illustrated on a heat map. incubated with blocking solution (1% BSA in PBT) at room temperature for 1 hour and then incubated with antibody diluted Modulator inference using the network dynamics algorithm in blocking solution at 4C overnight. On day 2, the slides were TheModulatorinferenceusingthenetworkdynamics washed thrice with 1 PBS and then incubated with Alexa Fluor (MINDy) algorithm was used to infer the TFs whose activities 488/594 2nd antibody diluted in blocking solution at room on the target gene expressions depend on the level of NEAT1 temperature for 1 hour. The slides were imaged with a Zeiss (26). The transcriptome profiles obtained with RNA-seq (level LSM710 confocal microscope. 2) for 499 prostate cancer tumor samples were downloaded fromTCGAandusedfortheMINDyalgorithm.TheP value Tet-on CRISPR/Cas9-mediated knockdown cutoffofMINDywassetat1E8. The results of MINDy were The lentiviral expression vector for Tet-on Cas9 was purchased then subjected to two levels of filtering. First, for the target from Addgene (Addgene ID: 50661). The lentiviral expression genes of each TF inferred by MINDy, the ones that are weakly vector for single guide RNA (sgRNA) was obtained from Dr. Wang correlated with the TF (correlation coefficient below 0.4) were Dong's laboratory. The sgRNA sequences are the following. discarded. Next, the TFs with no more than 20 target genes that sgNEAT1-1: GGTTACCATGCTCTCCTACA, sgNEAT1-2: GGTAG- were inferred by MINDy to be modulated by NEAT1 were GAGGTGAGCCTGGGA, Scramble sgRNA-1: GAACGTTGGCAC- discarded. Finally, the analysis and filtering pipeline yielded

4140 Cancer Res; 78(15) August 1, 2018 Cancer Research

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

111 TFs, which has more than 20 target genes that are highly Results correlated with the TFs and inferred by MINDy to be dependent NEAT1 knockdown arrested the proliferation and on NEAT1. tumorigenesis of PC3 and DU145 prostate cancer cells RNA-binding protein immunoprecipitation In androgen-independent prostate cancer cells, NEAT1 was PC3 cells were harvested into a fresh 1.5 mL tube, lysed with shown to be upregulated by ERa signaling and to act as a native lysis buffer (Solarbio, Lot: R0030) with proteinase inhib- transcriptional regulator for tumor-promoting ER-signature itor cocktail (Roche) and RNAsin (TianGen) for 30 minutes by genes (1). The goal of the current study is to further elucidate shaking every 4 minutes, and then centrifuged at 14,000 g for the essential physiological role of NEAT1 in CRPC cells in 10 minutes. The antibodies (IgG and CDC5L) were incubated absence of the ERa signaling activity. The NEAT1 gene has two with Dynabeads Protein-G at 4C by rotating for 6 to 8 hours. transcripts: the short isoform NEAT1_1 and the long isoform Then, the antibody-bead slurry was washed five times with NT-2 NEAT1_2. NEAT1_2, but not NEAT1_1, has been recognized as buffer (50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, the predominant isoform for the function of NEAT1 in the paraspeckle (28). Our qPCR assay also suggested that NEAT1_2 1 mmol/L MgCl2, and 0.05% NP-40). The antibody-bead slurry was resuspended with 900 mL of NET-2 buffer (NT-2 buffer, is the main transcript of NEAT1 in PC3 and DU145 cells 20 mmol/L EDTA (pH 8.0), 1 mmol/L DTT, and 200 U/mL (Supplementary Fig. S1A). The following studies therefore RNasin). The supernatants of the cell lysate were mixed overnight focused on NEAT1_2. with the antibody-bead slurry at 4C by rotating. Afterwards, the Silencing of NEAT1 via an siRNA targeting both NEAT1_1 and antibody-bead slurry was washed five times with NT-2 buffer. The NEAT1_2 or an siRNA targeting NEAT1_2 only (Supplementary antibody-bead slurry was resuspended with proteinase k buffer Fig. S1B) resulted in nearly identical arrest of PC3 cell prolifer- (117 mL of NT-2 buffer, 15 mL of 10% SDS, and 18 mL of proteinase ation (Fig. 1A). Another type of CRPC cell, DU145, showed K; 10 mg/mL). Then, RNA was isolated using TRizol. For cross- similar growth inhibitory responses to silencing of NEAT1 (Fig. linking IP, the cells were exposed to 150 mj/cm2 UV light 1B; Supplementary Fig. S1C). The sgRNA-mediated inducible (254 nmol/L), as described previously (25). knockdown of NEAT1 by CRISPR (Supplementary Fig. S1D– S1F) also resulted in a significant arrest of PC3 cell proliferation Chromatin immunoprecipitation sequencing (Fig. 1C) and the growth of xenograft tumors derived from PC3 The PC3 cells were fixed with formaldehyde at a 1% final cells (Fig. 1D; Supplementary Fig. S1G). Taken together, these fi concentration by incubation at 37C for 10 minutes. Then, glycine results con rmed the essential role of NEAT1 in maintaining the was added to a final concentration of 0.14 mol/L, and the cells regular cell proliferation and tumor growth of CRPC cells. How- were incubated at room temperature for 30 minutes. The cells ever, the cellular response to NEAT1 loss that led to proliferation were harvested into a fresh tube and lysed with 400 mL of lysis arrest and the underlying pathway for the essential function of buffer with 8 mL of protease inhibitor, with ice vortexing every 2 NEAT1 in CRPC cells remain largely unknown. minutes. The cell lysate was sonicated to shear cross-linked DNA and was then mixed with Dynal beads and washed 3 times with Silencing NEAT1 resulted in DNA damage in PC3 and PBS/BSA. The beads were resuspended with 1 mL of PBS/BSA with DU145 cells the tube against a magnet. Then, 5 mg of antibody were added to To elucidate the role of NEAT1 in the prostate cancer cells, we the bead slurry, for a total volume of 1 mL. This mixture was then measured the transcriptome profile shift that occurs upon the loss incubated for 6 hours on a rotating platform at 4 C. The antibody- of NEAT1 via RNA-seq experiments in PC3 cells. Silencing NEAT1 bead slurry was washed 3 times with PBS/BSA. Sheared chromatin caused more downregulation than upregulation of genes (Fig. 2A; was added to the antibody-bead slurry and incubated at 4 C Supplementary Fig. S2, and detailed data in Supplementary Table overnight on a rotating platform. Then, 30 mL of chromatin were S1). Strikingly, out of 333 downregulated genes, 26 genes were saved for input. The antibody-bead slurry was washed 5 times annotated as being involved in chromatin assembly (Fig. 2B), with RIPA buffer (50 mmol/L Hepes pH 8.0, 1% NP-40, 0.7% which was the top enriched function repressed upon NEAT1 DOC, 0.5 M LiCl, and 1 proteinase inhibitor cocktail), re- knockdown. The other significantly enriched processes included suspended with 100 mL of elution buffer (10 mmol/L Tris pH nucleosome assembly and epigenetic gene-expression regulation. 8.0, 1 mmol/L EDTA, and 1% SDS), and incubated at 65 C for 10 There were far fewer upregulated genes (Fig. 2A), and those genes minutes. Reverse crosslinking was performed at 65 C overnight. did not show any functional enrichment with P value smaller Then, a 0.4 mg/mL final concentration of proteinase k was added than 1E4. to the elution, and the sample was incubated at 55 C for 1 hour. In fact, many of the downregulated genes that composed the Genomic DNA was isolated using a Tiangen DNA purification kit repressed processes, such as chromatin and nucleosome assem- and then incubated with 1 mL of RNAse (20 mg/mL) at 37 C for 1 bly, were histone genes (Supplementary Table S2). Previous hour. Finally, the DNA was re-isolated using AMpure XP beads. studies have shown that DNA damage induced downregulations The chromatin immunoprecipitation sequencing (ChIP-seq) of histones at both the mRNA and protein levels (29, 30). library was generated with a TD503 kit (Vazyme). Sequencing Therefore, we investigated DNA damage in response to NEAT1 was carried out using Illumina HiSeq X Ten. ChIP-seq peak repression; indeed, silencing NEAT1 caused a dramatic DNA finding was performed with the MACS algorithm (27). damage response in PC3 and DU145 cells, as shown by the phosphorylation of histone 2A.X (Fig. 2C), which is a marker of Data availability the DNA damage response. The TUNEL assay confirmed break- The gene expression datasets generated in this study are avail- down of the DNA upon silencing of NEAT1 (Fig. 2D), and able in the GEO database repository (https://www.ncbi.nlm.nih. quantification of apurinic/apyrimidinic sites also supported the gov/geo/, GEO accession ID: GSE114959). significant DNA damage upon silencing of NEAT1 (Fig. 2E). Taken

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4141

Li et al.

Figure 1. Repression of NEAT1 inhibited the cell proliferation and tumorigenesis of prostate cancer cells. A and B, Growth curves of the PC3 (A) and DU145 (B) cells upon gene silencing with siRNAs. C, Growth curves of the Tet-on CRISPR-Cas9-PC3 cells. The expression of Cas9 was induced with 20 mg/mL of doxycycline (Dox) after sgRNA transfection. D, Images, volumes, and weights of the xenograft tumor models in male BALB/c-null mice established from PC3 cells with stable Tet-on CRISPR/Cas9 gene silencing. Error bars, mean SD. Student t test was performed to calculate the statistical signiﬁcance (P values) of the difference between the volumes or weights of the two groups of tumors.

together, these results indicated the essential role of NEAT1 in NEAT1 regulates the transcriptional activity of CDC5L maintaining the genomic DNA integrity of PC3 and DU145 Previous studies have proposed that NEAT1 functions as a cancer cells. Finally, it is worth noting that our flow cytometry transcriptional regulator by modulating the epigenetic landscape assays did not detect significant changes in the apoptosis rate in of tumor-promoting genes (1). NEAT1 was also shown to bind to response to NEAT1 silencing in PC3 and DU145 cells (Supple- transcriptional start and termination sites (9). These findings mentary Fig. S3A). Consistently, the caspase-3 activity and the indicated that NEAT1 may be deeply involved in the process of expression levels of BCL2 and BAX all remained unaltered upon transcriptional regulation, but it is unclear whether NEAT1 targets NEAT1 silencing (Supplementary Fig. S3B and S3C). Indeed, as any specific TF during the process of transcriptional regulation. both PC3 and DU145 bear loss of p53 function, which is the Here, we sought to identify specific TF(s) whose activity on target major mediator of apoptosis induction upon DNA damage, it is genes depends on the level of NEAT1. not surprising that NEAT1 silencing induced strong DNA damage We took advantage of transcriptomic profiling data from about without triggering apoptosis. 500 prostate tumors in the TCGA consortium and used the One of the major downstream effects of the DNA damage MINDy algorithm (26, 34) to screen for TFs that appear to be response is the arrest of cell-cycle progression at the G1–S, dependent on NEAT1 expression. Approximately 1,400 genes that intra-S and G2–M checkpoints (31). Indeed, silencing of NEAT1 were annotated as TFs or putative TFs were tested, and 111 TFs induced cell-cycle arrest at the G1 and G2–M phase and reduced passed the filters, showing strong signatures of dependency on the number of cells in the S phase in both PC3 and DU145 cells NEAT1 expression (top 14 shown in Fig. 3A, and more details in (Fig. 2F; Supplementary Fig. S4A and S4B; Supplementary Fig. Supplementary Table S3). Previously, a CHART-MS assay had S5A). Such senescence of DNA synthesis has been shown to profiled the proteins pulled down by RNA probes targeting repress the tumorigenesis and malignancy of cancer cells (32). NEAT1 via mass spectrometry (9), generating a list of 30 Furthermore, NEAT1 silencing reduced the phosphorylation of RB NEAT1-interacting proteins. Interestingly, among the top 14 TFs at Thr821 (Supplementary Fig. S5B), indicating CDK2 activity that were inferred to be dependent on NEAT1, only CDC5L was inhibition and RB-E2F1 dissociation (33), which could contribute among this list of 30 proteins that bind directly to NEAT1, as to the cell-cycle arrest that we observed. revealed by the CHART-MS data (9). Furthermore, our RIP-qPCR

4142 Cancer Res; 78(15) August 1, 2018 Cancer Research

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

Figure 2. Repression of NEAT1 induced the DNA damage response and cell-cycle arrest. A, Heat map showing relative expressions (Z-scores) of the signiﬁcantly

up- and downregulated genes in PC3 cells after NEAT1 knockdown with siRNA. The genes were selected on the basis of the criteria of log2-fold change >1or< 1andadjustedP < 0.05 (See Supplementary Fig. S2A for reference). B, Enrichment of the gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes functional annotations in the downregulatedgenesetsuponNEAT1knockdowninPC3cells.TheP values (log10)ofthe enrichments are provided on the y-axis. C, Western blotting assay of g-H2AX, a marker of DNA damage, upon NEAT1 knockdown in PC3 and DU145 cells. D, DetectionofDNAdamagewithaTUNELassayuponsilencingofNEAT1inPC3cellswithsiRNA.E, Quantiﬁcation of DNA damage with apurinic/apyrinidinic sites. Error bars, SD. Student t test was performed to calculate the statistical signiﬁcance (P value). F, Assessment of cell-cycle stages via FACS after PI staining of the cells.

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4143

Li et al.

assay, with or without UV cross-linking, confirmed the direct CDC5L was found to be generally colocalized with PSPC1, which interaction between CDC5L and NEAT1 (Fig. 3B). In addition, is a core component and marker of paraspeckles, the repression of an RNA-FISH assay also demonstrated the partial colocalization NEAT1 broke up the integrity of the paraspeckle and its associ- of NEAT1 and CDC5L in the cell nucleus (Fig. 3C). ation with CDC5L (Fig. 3E). Collectively, these results established Next, we constructed a dual-luciferase reporter system that the physical interaction between NEAT1 and CDC5L, and more contains CDC5L-specific–binding motifs (24) upstream of a importantly, both the data-mining and the experimental tests firefly luciferase gene. The luciferase reporter assay showed that showed that the activity of CDC5L depends on NEAT1 expression. silencing NEAT1 indeed repressed the transcriptional effect of Furthermore, the silencing of CDC5L in PC3 and DU145 cells CDC5L on firefly luciferase expression (Fig. 3D). Finally, although (Supplementary Fig. S6A) also resulted in the arrest of cell

Figure 3. NEAT1 regulates the transcriptional activity of CDC5L. A, Top 14 TFs whose transcriptional effects on target genes were predicted to depend on the level of NEAT1. The numbers of target genes that supported this conclusion are provided. B, Quantification of NEAT1 and U1 pulled down via UV cross-linking immunoprecipitation (IP) with an antibody specific for CDC5L. The negative controls include the pull-down with IgG and the pull-down without UV cross-linking. Error bars, mean SD. C, Colocalization of CDC5L or SFPQ with NEAT1 in the nucleus of PC3 cells as a positive control. The staining of NEAT1 was reduced by RNA-FISH and CDC5L or SFPQ, as detected by immunofluorescence with the antibody. D, Quantification of the transcriptional activity of CDC5L with a dual luciferase reporter system upon knockdown of NEAT1. pRL-TK was used as a negative control for the detection of the dual-luciferase reporter. A CMV-motif constructed luciferase expression plasmid was used as a positive control for experiments. Error bars, mean SD. Student t test was performed to calculate the statistical significance (P value). E, Colocalization of CDC5L and the paraspeckle marker PSPC1 in the nucleus. The proteins were visualized via immunofluorescence staining. n.s., nonsignificant.

4144 Cancer Res; 78(15) August 1, 2018 Cancer Research

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

Figure 4. Silencing of CDC5L repressed cell growth and induced DNA damage in prostate cancer cells. A, Growth curves of PC3 (left) and DU145 (right) cells upon silencing of CDC5L with siRNAs. Error bars, means SD. The P values from Student t tests for the differences between siNC and siCDC5L are all below 0.0001. B, Western blotting assay of g-H2AX, a marker of DNA damage, upon the silencing of CDC5L in PC3 and DU145 cells. C, Quantiﬁcation of DNA damage with apurinic/apyrinidinic sites. Error bars, means SD. Student t test was performed to calculate the statistical signiﬁcance (P value). D, Growth curves of PC3 cells upon inducible knockout of NEAT1 with and without overexpression of CDC5L. The expression of Cas9 was induced with 20 mg/mL of doxycycline. E, Western blots showing the level of g-H2AX, a marker of DNA damage, upon inducible knockout of NEAT1 with or without overexpression of CDC5L.

proliferation (Fig. 4A) and DNA damage (Fig. 4B and C), similar target gene set exhibited a strong enrichment in a gene set to the phenotypic responses of the cells to NEAT1 repression (Figs. enrichment analysis using the differential mRNA expression data 1 and 2). Importantly, overexpressing CDC5L completely rescued upon NEAT1 silencing (Fig. 5A). This result again supports our the proliferation arrest caused by silencing NEAT1 and restored finding that CDC5L activity depends on NEAT1 expression. normal tumor cell growth (Fig. 4D). The DNA damage resulted Among the putative CDC5L targets revealed by the ChIP-seq from loss of NEAT1 was also reversed by overexpressing CDC5L in data, 10 genes were subjected to differential expression upon PC3 cells (Fig. 4E). Taken together, the above results suggest that silencing of NEAT1 (adjusted P < 0.05 and fold change >1or the physiological indispensable function of NEAT1 in CRPC cells < 1). These genes include FAM43A, RECQL4, ACAP3, TIGD5, is mediated, at least in part, by its regulatory function on the AGRN, EPS8L2, KLHL17, TONSL, CDC42BPA, and PLEKHB2, activity of the putative TF CDC5L. and some of them indeed showed up- or downregulation by CDC5L knockdown (Fig. 5B). Among these 10 genes, AGRN was AGRN, a target of CDC5L, mediated the effect of NEAT1 in CRPC the most sensitive gene in response to repression of CDC5L cells (Fig. 5B). Furthermore, the suppressed AGRN expression caused Although recognized as a putative TF, CDC5L has not been by NEAT1 knockdown was rescued by overexpressing CDC5L in assessed in a ChIP-seq experiment. In the present study, we the PC3 cells (Fig. 5C). Collectively, these results confirmed the performed ChIP-seq profiling for CDC5L, and the CDC5L-bind- CDC5L–AGRN circuit that was modulated by NEAT1. ing regions were identified with the peak-calling program MACS Importantly, compared with repression of CDC5L or NEAT1, (Supplementary Table S4), which also identified the CDC5L silencing of AGRN (Supplementary Fig. S6B) caused nearly iden- target genes harboring the peak regions in their approximate tical phenotypic responses in the CRPC cells PC3 and DU145, promoters (Supplementary Table S5). Interestingly, this CDC5L including proliferation arrest, DNA damage responses, and the

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4145

Li et al.

Figure 5. Identification of AGRN as a target of CDC5L and its dependency on NEAT1. A, Gene set enrichment analysis showing statistically significant enrichment of differentially expressed genes upon NEAT1 silencing in the gene set of CDC5L target genes identified by ChIP-seq. B, qPCR analysis for expressions of 10 genes upon silencing of CDC5L in PC3 and DU145 cells. These 10 genes were selected as they were identified as CDC5L targets by ChIP-seq and shown to be subjected to differential expression upon NEAT1 silencing. C, qPCR analysis showing that AGRN was repressed upon knockout of NEAT1 (KO), which was rescued by the overexpression of CDC5L. Error bars, means SD.

reduction of S-phase cells (Fig. 6A–D; Supplementary Fig. S7A and experiment (9), suggesting both previously known and unchar- S7B). Finally, similar to CDC5L, overexpressing AGRN in PC3 acterized functions of NEAT1. Inspired by these findings related to cells rescued the suppressed proliferation rate observed after NEAT1, we sought to further elucidate the involvement of NEAT1 NEAT1 knockdown (Fig. 6E). Therefore, we propose that the in the transcriptional regulation that underlies the physiological tumor-promoting function of NEAT1 in the prostate cancer cells functions of NEAT1 in tumor cells. was mediated by the CDC5L–AGRN transcriptional activation We applied a high-throughput computational screen strategy to circuit. Loss of NEAT1 attenuated the CDC5L activity on its target search for transcription factors that may depend on NEAT1 AGRN, resulting in DNA damage and cell-cycle arrest that hin- expression. Specifically, the MINDy algorithm quantifies how dered cell proliferation (working model summarized in Fig. 7). much TF-target association depends on a candidate regulator or TF activity (26). Using prostate cancer tumor transcriptome profiling data from TCGA, our analysis identified a group of TFs Discussion whose activities appeared to depend on NEAT1 expression. This The regulation of gene transcription has been recognized as one insight was then integrated with previous NEAT1-protein inter- of the major functions of lncRNAs (20, 21). Various lncRNAs have action data, leading to the hypothesis that CDC5L is a regulatory been shown to interact directly with histone modifying proteins, target of NEAT1. Although CDC5L has been recognized as a RNA polymerase II, and many other DNA binding proteins, putative TF (24, 35), this factor has been better studied as an including transcription factors (20). As an essential component RNA binding protein involved in the regulation of RNA splicing of the paraspeckle, NEAT1 was shown to activate the expression of (24, 35–38). Here, we focused on the activity of CDC5L as a TF IL8 by titrating away the transcriptional repressor SFPQ from the and showed that its TF activity was reduced upon NEAT1 repres- IL8 promoter DNA (7). A systematic lncRNA–chromatin interac- sion. Furthermore, we found that AGRN, as a target of CDC5L, was tion profiling assay (CHART-seq) showed NEAT1 binding to responsible, at least in part, for the indispensable function of active chromatin regions, especially around transcriptional start NEAT1 in tumor cell growth. sites and transcriptional termination sites, suggesting a strong ApreviousstudyhasreportedthatAGRNwasinvolvedin association between transcription and NEAT1 (9). Furthermore, a the proliferation, migration, and invasion of liver cancer set of NEAT1-interacting proteins was identified in a CHART-MS cells by regulating focal adhesion integrity (39). Here, we have

4146 Cancer Res; 78(15) August 1, 2018 Cancer Research

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

Figure 6. AGRN mediated the oncogenic role of NEAT1 in prostate cancer cells. A, Growth curves of PC3 (left) and DU145 (right) cells upon silencing of AGRN with siRNAs. Error bars, means SD. B, Western blotting assay of g-H2AX, a marker of DNA damage, upon silencing of AGRN in PC3 and DU145 cells. C, Immunoﬂuorescence staining of g-H2AX in the nucleus upon silencing of AGRN in PC3. D, Assessment of cell-cycle stages via FACS after PI staining of the cells. E, Growth curves of PC3 cells upon inducible silencing of NEAT1 with or without rescue of the expression of rat AGRN in PC3 cells. The expression of Cas9 was induced with 20 mg/mLof doxycycline. Error bars, means SD.

conﬁrmed the tumor-promoting function of AGRN in prostate bind to extracellular BMP2, BMP4, and TGFb1(40).Speciﬁ- cancer. The knockdown of AGRN via RNAi repressed the cally, AGRN binding was shown to promote the activity of proliferation of prostate cancer cells and induced DNA damage TGFb (40), which is necessary for maintaining genomic stabil- in both PC3 and DU145 cells. Although AGRN has not been ity and facilitating DNA damage repair (41–43). Although DNA reported to be associated with DNA integrity, it was shown to damage has been acknowledged as a hallmark of cancer and a

Figure 7. Proposed working model of the NEAT1–CDC5L–AGRN circuit in prostate cancer cells. On the basis of our results, we propose that the tumor-promoting function of NEAT1 in the prostate cancer cells PC3 and DU145 was mediated by the interaction between NEAT1 and CDC5L, a transcription factor targeting on AGRN. NEAT1 repression attenuated the CDC5L–AGRN transcriptional activation circuit, resulting in DNA damage and cell-cycle arrest that hindered cell proliferation.

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4147

Li et al.

driver of tumorigenesis, cancer cells also need a certain level of Administrative, technical, or material support (i.e., reporting or organizing genome stability to ensure their viability and proliferation data, constructing databases): X. Wang, W. Zhao potential (44). Therefore, a proper level of TGFb signaling Study supervision: X. Yang activity could be advantageous for tumor development (41). On the basis of our findings, we suspect that AGRN helps Acknowledgments maintaining DNA integrity and promotes DNA repair by acti- The authors wish to thank Mathew P. Daniels and Michael Ferns for vating the TGFb signaling activity. generously providing the AGRN overexpression plasmids. The authors wish to acknowledge the supports from the Platforms of Genome Sequencing, High- In conclusion, we propose that NEAT1 plays an essential role in Performance Computing, shRNA Library, and Cell Imaging & Function of the maintaining tumor cell growth and preventing DNA damage via National Protein Science Facility (Beijing), the Laboratory Animal Center at direct binding with CDC5L. The repression of NEAT1 reduced the Tsinghua University, and the Flow Cytometry Core Facility of Center of expression of AGRN, which is a target of CDC5L and a binding Biomedical Analysis at Tsinghua University. This work was supported by the partner of TGFb1, resulting in the accumulation of DNA damage National Key Research and Development Program, Precision Medicine Project and cell-cycle arrest and hindering the growth and tumorigenesis (2016YFC0906001 to X. Yang), the National Natural Science Foundation of China (91540109 and 81472855 to X. Yang), the Tsinghua University Initiative of PC3 and DU145 prostate cancer cells. Scientific Research Program (2014z21046 to X. Yang), the Tsinghua–Peking Joint Center for Life Sciences, and the 1000 talent program (Youth Category; to Disclosure of Potential Conflicts of Interest X. Yang). No potential conflicts of interest were disclosed. The costs of publication of this article were defrayed in part by the Authors' Contributions payment of page charges. This article must therefore be hereby marked Conception and design: X. Li, X. Yang advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Development of methodology: X. Li, X. Yang this fact. Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): X. Li, W. Song, H. Xu, R. Huang, Y. Wang, Z. Xiao Received March 4, 2018; revised April 23, 2018; accepted May 31, 2018; Writing, review, and/or revision of the manuscript: X. Li, X. Yang published first June 5, 2018.

References 1. Chakravarty D, Sboner A, Nair SS, Giannopoulou E, Li R, Hennig S, et al. protein component 1 and analysis of its role in subnuclear body formation. The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical mod- Proc Natl Acad Sci U S A 2012;109:4846–50. ulator of prostate cancer. Nat Commun 2014;5:5383. 14. Naganuma T, Nakagawa S, Tanigawa A, Sasaki YF, Goshima N, Hirose T. 2. Fu JW, Kong Y, Sun X. Long noncoding RNA NEAT1 is an unfavorable Alternative 30-end processing of long noncoding RNA initiates construc- prognostic factor and regulates migration and invasion in gastric cancer. tion of nuclear paraspeckles. EMBO J 2012;31:4020–34. J Cancer Res Clin Oncol 2016;142:1571–9. 15. Ma Y, Liu L, Yan F, Wei W, Deng J, Sun J. Enhanced expression of long non- 3. Peng W, Wang Z, Fan H. LncRNA NEAT1 impacts cell proliferation and coding RNA NEAT1 is associated with the progression of gastric adeno- apoptosis of colorectal cancer via regulation of Akt signaling. Pathol Oncol carcinomas. World J Surg Oncol 2016;14:41. Res 2017;23:651–6. 16. Chai Y, Liu J, Zhang Z, Liu L. HuR-regulated lncRNA NEAT1 stability in 4. Adriaens C, Standaert L, Barra J, Latil M, Verfaillie A, Kalev P, et al. p53 tumorigenesis and progression of ovarian cancer. Cancer Med 2016;5: induces formation of NEAT1 lncRNA-containing paraspeckles that mod- 1588–98. ulate replication stress response and chemosensitivity. Nat Med 2016; 17. Chen ZJ, Zhang Z, Xie BB, Zhang HY. Clinical significance of up-regulated 22:861–8. lncRNA NEAT1 in prognosis of ovarian cancer. Eur Rev Med Pharmacol Sci 5. Shen W, Liang XH, Crooke ST. Phosphorothioate oligonucleotides can 2016;20:3373–7. displace NEAT1 RNA and form nuclear paraspeckle-like structures. Nucleic 18. He C, Jiang B, Ma J, Li Q. Aberrant NEAT1 expression is associated with Acids Res 2014;42:8648–62. clinical outcome in high grade glioma patients. APMIS 2016;124:169–74. 6. Clemson CM, Hutchinson JN, Sara SA, Ensminger AW, Fox AH, Chess 19. Mello SS, Sinow C, Raj N, Mazur PK, Bieging-Rolett K, Broz DK, et al. Neat1 A, et al. An architectural role for a nuclear noncoding RNA: NEAT1 is a p53-inducible lincRNA essential for transformation suppression. RNA is essential for the structure of paraspeckles. Mol Cell Genes Dev 2017;31:1095–108. 2009;33:717–26. 20. Long Y, Wang X, Youmans DT, Cech TR. How do lncRNAs regulate 7. Imamura K, Imamachi N, Akizuki G, Kumakura M, Kawaguchi A, Nagata K, transcription? Sci Adv 2017;3:eaao2110. et al. Long noncoding RNA NEAT1-dependent SFPQ relocation from 21. Dykes IM, Emanueli C. Transcriptional and post-transcriptional gene promoter region to paraspeckle mediates IL8 expression upon immune regulation by long non-coding RNA. Genomics Proteomics Bioinformatics stimuli. Mol Cell 2014;53:393–406. 2017;15:177–86. 8. Naganuma T, Hirose T. Paraspeckle formation during the biogenesis of 22. Mu R, Wang YB, Wu M, Yang Y, Song W, Li T, et al. Depletion of pre-mRNA long non-coding RNAs. RNA Biol 2013;10:456–61. splicing factor Cdc5L inhibits mitotic progression and triggers mitotic 9. West JA, Davis CP, Sunwoo H, Simon MD, Sadreyev RI, Wang PI, et al. The catastrophe. Cell Death Dis 2014;5:e1151. long noncoding RNAs NEAT1 and MALAT1 bind active chromatin sites. 23. Zhang N, Kaur R, Akhter S, Legerski RJ. Cdc5L interacts with ATR and is Mol Cell 2014;55:791–802. required for the S-phase cell-cycle checkpoint. EMBO Rep 2009;10: 10. Hirose T, Virnicchi G, Tanigawa A, Naganuma T, Li R, Kimura H, et al. 1029–35. NEAT1 long noncoding RNA regulates transcription via protein seques- 24. Lei XH, Shen X, Xu XQ, Bernstein HS. Human Cdc5, a regulator of mitotic tration within subnuclear bodies. Mol Biol Cell 2014;25:169–83. entry, can act as a site-specific DNA binding protein. J Cell Sci 2000;113Pt 11. Cooper DR, Carter G, Li P, Patel R, Watson JE, Patel NA. Long non-coding 24:4523–31. RNA NEAT1 associates with SRp40 to temporally regulate PPARgamma2 25. Kawaguchi T, Tanigawa A, Naganuma T, Ohkawa Y, Souquere S, Pierron G, splicing during adipogenesis in 3T3-L1 cells. Genes 2014;5:1050–63. et al. SWI/SNF chromatin-remodeling complexes function in noncoding 12. Chen LL, Carmichael GG. Altered nuclear retention of mRNAs containing RNA-dependent assembly of nuclear bodies. Proc Natl Acad Sci U S A inverted repeats in human embryonic stem cells: functional role of a 2015;112:4304–9. nuclear noncoding RNA. Mol Cell 2009;35:467–78. 26. Wang K, Saito M, Bisikirska BC, Alvarez MJ, Lim WK, Rajbhandari P, et al. 13. Passon DM, Lee M, Rackham O, Stanley WA, Sadowska A, Filipovska A, Genome-wide identification of post-translational modulators of transcrip- et al. Structure of the heterodimer of human NONO and paraspeckle tion factor activity in human B cells. Nat Biotechnol 2009;27:829–39.

4148 Cancer Res; 78(15) August 1, 2018 Cancer Research

Tumor-Promoting Function of NEAT1 via the CDC5L–AGRN Circuit

27. Liu T. Use model-based analysis of ChIP-Seq (MACS) to analyze short reads 36. Liu L, Graub R, Hlaing M, Epting CL, Turck CW, Xu XQ, et al. Distinct generated by sequencing protein-DNA interactions in embryonic stem domains of human CDC5 direct its nuclear import and association with the cells. Methods Mol Biol 2014;1150:81–95. spliceosome. Cell Biochem Biophys 2003;39:119–32. 28. Souquere S, Beauclair G, Harper F, Fox A, Pierron G. Highly 37. Graub R, Lancero H, Pedersen A, Chu M, Padmanabhan K, Xu XQ, et al. Cell ordered spatial organization of the structural long noncoding cycle-dependent phosphorylation of human CDC5 regulates RNA proces- NEAT1 RNAs within paraspeckle nuclear bodies. Mol Biol Cell 2010; sing. Cell Cycle 2008;7:1795–803. 21:4020–7. 38. Boudrez A, Beullens M, Groenen P, Van Eynde A, Vulsteke V, Jagiello I, 29. Su C, Gao G, Schneider S, Helt C, Weiss C, O'Reilly MA, et al. DNA damage et al. NIPP1-mediated interaction of protein phosphatase-1 with CDC5L, a induces downregulation of histone gene expression through the G1 check- regulator of pre-mRNA splicing and mitotic entry. J Biol Chem 2000;275: point pathway. EMBO J 2004;23:1133–43. 25411–7. 30. Hauer MH, Seeber A, Singh V, Thierry R, Sack R, Amitai A, et al. 39. Chakraborty S, Lakshmanan M, Swa HL, Chen J, Zhang X, Ong YS, et al. An Histone degradation in response to DNA damage enhances chromatin oncogenic role of Agrin in regulating focal adhesion integrity in hepato- dynamics and recombination rates. Nat Struct Mol Biol 2017;24: cellular carcinoma. Nat Commun 2015;6:6184. 99–107. 40. Banyai L, Sonderegger P, Patthy L. Agrin binds BMP2, BMP4 and TGFbeta1. 31. Jackson SP, Bartek J. The DNA-damage response in human biology and PLoS ONE 2010;5:e10758. disease. Nature 2009;461:1071–8. 41. Barcellos-Hoff MH, Cucinotta FA. New tricks for an old fox: impact of 32. Bartkova J, Horejsi Z, Koed K, Kramer A, Tort F, Zieger K, et al. DNA damage TGFbeta on the DNA damage response and genomic stability. Sci Signal response as a candidate anti-cancer barrier in early human tumorigenesis. 2014;7:re5. Nature 2005;434:864–70. 42. Kanamoto T, Hellman U, Heldin CH, Souchelnytskyi S. Functional pro- 33. Inoue Y, Kitagawa M, Taya Y. Phosphorylation of pRB at Ser612 by Chk1/2 teomics of transforming growth factor-beta1-stimulated Mv1Lu epithelial leads to a complex between pRB and E2F-1 after DNA damage. EMBO J cells: Rad51 as a target of TGFbeta1-dependent regulation of DNA repair. 2007;26:2083–93. EMBO J 2002;21:1219–30. 34. Bansal M, Califano A. Genome-wide dissection of posttranscription- 43. Ewan KB, Henshall-Powell RL, Ravani SA, Pajares MJ, Arteaga C, Warters R, al and posttranslational interactions. Methods Mol Biol 2012;786: et al. Transforming growth factor-beta1 mediates cellular response to DNA 131–49. damage in situ. Cancer Res 2002;62:5627–31. 35. Bernstein HS, Coughlin SR. Pombe Cdc5-related protein. A putative 44. Chin K, de Solorzano CO, Knowles D, Jones A, Chou W, Rodriguez EG, human transcription factor implicated in mitogen-activated signaling. J et al. In situ analyses of genome instability in breast cancer. Nat Genet Biol Chem 1997;272:5833–7. 2004;36:984–8.

www.aacrjournals.org Cancer Res; 78(15) August 1, 2018 4149

Oncogenic Properties of NEAT1 in Prostate Cancer Cells Depend on the CDC5L−AGRN Transcriptional Regulation Circuit

Xin Li, Xianteng Wang, Wanlu Song, et al.

Cancer Res 2018;78:4138-4149. Published OnlineFirst June 5, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-0688

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/06/05/0008-5472.CAN-18-0688.DC1

Cited articles This article cites 44 articles, 16 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/15/4138.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/78/15/4138.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/15/4138. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.