Purdue University Purdue e-Pubs

Open Access Dissertations Theses and Dissertations

Fall 2013 Genes with Physiological Roles in Callipyge Muscle Hypertrophy Hui Yu Purdue University

Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Part of the Agriculture Commons, and the Animal Sciences Commons

Recommended Citation Yu, Hui, "Genes with Physiological Roles in Callipyge Muscle Hypertrophy" (2013). Open Access Dissertations. 10. https://docs.lib.purdue.edu/open_access_dissertations/10

This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School ETD Form 9 (Revised 12/07) PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance

This is to certify that the thesis/dissertation prepared

By Hui Yu

Entitled Genes with Physiological Roles in Callipyge Muscle Hypertrophy

Doctor of Philosophy For the degree of

Is approved by the final examining committee:

Christopher A. Bidwell Chair Shihuan Kuang

Kolapo Ajuwon

Ourania M. Andrisani

To the best of my knowledge and as understood by the student in the Research Integrity and Copyright Disclaimer (Graduate School Form 20), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy on Integrity in Research” and the use of copyrighted material.

Approved by Major Professor(s): ______Christopher A. Bidwell ______

Approved by: Todd J. Applegate 11/15/2013 Head of the Graduate Program Date

i

GENES WITH PHYSIOLOGICAL ROLES IN CALLIPYGE MUSCLE HYPERTROPHY

A Dissertation

Submitted to the Faculty

of

Purdue University

by

Hui Yu

In Partial Fulfillment of the

Requirements for the Degree

of

Doctor of Philosophy

December 2013

Purdue University

West Lafayette, Indiana

ii

ACKNOWLEDGEMENTS

I would like to express my deepest gratitude to my advisor, Dr. Christopher Bidwell, for his excellent guidance, caring, patience, and hand­on teaching of the experimental techniques. During these four years, he plays a role more than an advisor, but like my father, encouraging and supporting me to overcome many crisis situations and finish this dissertation. His passion and attitude on science deeply impressed me, and I hope that one day I would become as good an advisor to my students as Dr.Bidwell has been to me.

I would also like to thank Dr. Kuang for allowing me to work and learn in his lab, helping me with the data presenting and analyzing, and inviting me to join his lab meeting. To

Dr.Ajuwon for his encouragement and practical advice on my experimental design. To Dr.

Andrisani for her insightful comments and constructive criticisms at different stages of my research. Appreciation goes to Dr. Waddell, who is always willing to help and give her best suggestions both in work and life.

I am grateful to Jun Wu for managing the mice colony, Gerald Kelly for his management of the sheep flocks, and Weiyi Liu for his input in experimental techniques.

Thanks goes to Marion Welsh for her generous help with me and my family. To undergraduates, Kimberly Lutz and Jingyuan Zhang, for assisting my experiments. To all the other faculty and staff for supporting and giving me career advice during my graduate

iii study. To my friends, Min Wang, Yanfang Li, Qianyi Yang, Qiaojing Wang, Yefei Wen,

Yaqin Liu, Chunhui Jiang, Xin Yang, Xinrong Liang, Pengpeng Bi, and Tizhong Shan for their cheerfulness and fun, and I will always remember the wonderful time we ha together.

Finally, I would like to thank my family, to whom this dissertation is dedicated to, for their continuous support and encouragement through all of my education. To my parents, who give my life and endless love. To my husband, Mou Wang, who has been with me all these years and has faith in me and in every decision I made. To my son, Alexander

Wang, who always cheer me up and give me hope and strength in my life.

iv

TABLE OF CONTENTS

Page LIST OF TABLES vii LIST OF FIGURES viii ABSTRACT x CHAPTER 1. INTRODUCTION ...... 1 1.1 Objective ...... 1 1.2 Callipyge Phenotype ...... 2 1.3 Genetics in Callipyge Sheep ...... 5 1.4 Primary inducers in callipyge sheep...... 8 1.4.1 Delta-like Homolog 1 ...... 8 1.4.2 Retrotranposon-like 1 ...... 11 1.5 Parkinson Disease 7 ...... 13 1.5.1 Genetics and Structure Biology of Park7 ...... 13 1.5.2 Park7 and Male fertility ...... 17 1.5.3 Park7 and Its RNA Binding Capacity ...... 18 1.5.4 Park7 and Parkinson ’s Disease ...... 19 1.5.5 Park7 and Cancer ...... 29 1.6 Muscle Hypertrophy Pathways ...... 33 1.6.1 PI3K/AKT Pathway ...... 33 1.6.2 Myostatin­Smad2/3 Pathway ...... 37 1.7 Conclusion ...... 39 CHAPTER 2. ASSAY VALIDATION ...... 40 2.1 Introduction ...... 40 2.2 Material and Methods...... 41 2.2.1 PARK7 Plasmid Construct ...... 41 2.2.2 C2C12 Cell Culture and Cell Transfection ...... 41 2.2.3 Optimizing Electroporation Condition ...... 42 2.2.4 Primary Myoblast Isolation and Culture ...... 42 2.2.5 Luciferase Assay ...... 43 2.2.6 Immunocytochemistry and Microscopy ...... 44 2.3 Results and Discussion ...... 44 2.3.1 Validation of the pPARK7­pcDNA3.2 Construct ...... 44 2.3.2 Optimization of Electroporation Conditions ...... 46 2.3.3 Titration of IGF1 Concentrations ...... 47

v

Page CHAPTER 3 IDENTIFICATION OF GENES DIRECTLY RESPOND TO DLK1 SIGNALING IN CALLIPYGE SHEEP ...... 55 3.1 Abstract ...... 55 3.2 Introduction ...... 57 3.3 Materials and Methods ...... 61 3.3.1 Sample Collection ...... 61 3.3.2 Primary Myoblast Isolation and Culture ...... 61 3.3.3 Quantitative PCR Analysis...... 62 3.3.4 Plasmid Construction ...... 64 3.3.5 Luciferase Reporter Assay ...... 64 3.4 Results ...... 66 3.4.1 Phenotypic Data Analysis ...... 66 3.4.2 Muscle Specific Gene Expression ...... 66 3.4.3 Effects of Candidate Target Genes on Myh4 and Myh7 Promote Activity ...... 69 3.4.4 Effects of DLK1 on DNTTIP1 and PARK7 Expression ...... 71 3.5 Discussion ...... 72 3.6 Authors’ Contributions ...... 79 3.7 Acknowledgements ...... 80 CHAPTER 4. PARK7 EXPRESSION INFLUENCES MYOTUBE SIZE AND MYOSIN EXPRESSION IN MUSCLE ...... 90 4.1 Summary ...... 90 4.2 Background ...... 92 4.3 Materials and Methods ...... 96 4.3.1 Mice and Animal Care ...... 96 4.3.2 RNA Isolation and Quantitative PCR Analysis ...... 96 4.3.3 Primary Myoblast Isolation and Culture ...... 97 4.3.4 Protein Extraction and Western Blots Analysis ...... 98 4.3.5 Analysis of Myotube Differentiation and Size ...... 99 4.3.6 In situ ELISA Quantification of Myosin Expression ...... 99 4.3.7 AKT Phosphorylation in Primary Myotubes ...... 100 4.4 Results ...... 101 4.4.1 Up­regulation of PARK7 in Hypertrophied Muscle of Callipyge Lambs ...... 101 4.4.2 Effects of Park7 Genotype on Myosin Heavy Chain Gene Expression ...... 102 4.4.3 Effect of Park7 Genotype on Phosphorylation Level of AKT (S473) ...... 104 4.5 Discussion ...... 105 4.6 Conclusions ...... 109 4.7 Authors’ Contributions ...... 109 4.8 Acknowledgements ...... 110 CHAPTER 5. IMPLICATION AND FUTURE DIRECTIONS ...... 118 5.1 Possible Physiological Roles of Effector Genes in Callipyge Sheep .... 119

vi

Page 5.2 PARK7 as a Muscle Growth Regulator ...... 121 5.3 Conclusions ...... 123 LIST OF REFERENCES...... 125 APPENDICES Appendix A Gene Expression Data for 7­muscle Experiment ...... 152 Appendix B Park7 (­/­) mice Phenotypic Analysis ...... 164 Appendix C Lab Protocols...... 167 VITA...... 180

vii

LIST OF TABLES

Table ...... Page Table 1.1 Genetic Variation of PARK7 ...... 16 Table 2.1 Summary of the Transfection Efficiency...... 53 Appendix Table Table A. 1 Quantitative PCR Primer Sequences and Amplification Conditions ...... 152 Table A. 2 Quantitative Analysis of Gene Expression ...... 156 Table A. 3 Analysis of Variance of Genotype Effects in qPCR Analysis ...... 159 Table A. 4 Plasmids Compositions of Effector Luciferase Assay ...... 160 Table B. 1 Analysis on Carcass Weights and Internal Organs Weights by Live Body Weight in Park7 (+/+), (+/­) and (­/­) Mice...... 165 Table B. 2 Quantitative PCR Primers...... 166

viii

LIST OF FIGURES

Figure ...... Page Figure 1.1 The DLK1-DIO3 Imprinted Gene Cluster...... 8 Figure 1.2 Structure of PARK7 Protein ...... 15 Figure 1.3 Cysteine Oxidation and Activation of PARK7...... 17 Figure 1.4 Effects of PARK7 in PI3K/AKT Pathway...... 36 Figure 2.1 Illustration of pPARK7­pcDNA3.2 Construct...... 49 Figure 2.2 Validation of the Expression of pPARK7­pcDNA3.2 Construct...... 50 Figure 2.3 Optimizing Transfection Conditions Using 10 µL tips in NeonTM system. .... 51 Figure 2.4 Optimizing Transfection Conditions Using 100 µL tips in NeonTM system. .. 52 Figure 2.5 Validation of Long®R3 IGF1...... 54 Figure 2.6 Titration of IGF1 Concentrations...... 54 Figure 3.1 Muscle Hypertrophy in Callipyge Lambs...... 81 Figure 3.2 Transcript Abundance of RPLP0 in 7 Muscles ...... 82 Figure 3.3 mRNA Abundance of Genes From the DLK1-DIO3 Locus...... 83 Figure 3.4 mRNA Abundance of Myosin Heavy Chain Genes...... 84 Figure 3.5 Hierarchal Clustering of Candidate Gene Expression Pattern in 7 Muscles ... 85 Figure 3.6 Transcript Abundance of the Candidate Target Genes in 7 Muscles...... 86 Figure 3.7 Effects of DLK1, DNTTIP1 and METTL21E on Myosin Promoter Activity. 87 Figure 3.8 Effect of Park7 on Myosin Promoter Activity...... 88 Figure 3.9 Transcript Abundance of DNTTIP 1, Myh4 and Park7 in DLK1 Treated Myoblast and Myotubes...... 89 Figure 4.1 PARK7 Protein Expression Level in Sheep Skeletal Muscles...... 111 Figure 4.2 PARK7 Protein Expression in Vastus Lateralis...... 111 Figure 4.3 Comparison of Myotube Size Between Park7 (+/+) and Park7 (­/­) Genotypes...... 112 Figure 4.4 Detection of Total Sarcomere Myosin Expression in Myotubes by ELISA. 113 Figure 4.5 Detection of Myosin Heavy Chain Isoform mRNA Levels in Myotubes by Quantitative PCR...... 114 Figure 4.6 Phosphorylation of AKT (S473) Protein in Park7 (+/+) and Park7 (­/­) Myotubes...... 115 Figure 4.7 PARK7 Inhibits PTEN Function, But Not PTEN Expression...... 116 Figure 4.8 Sustained Activity of AKT Phosphorylation (S473) in Park7 (+/+) and Park7 (­/­) Myotubes After IGF1 Stimulation...... 117

ix

Appendix Figure ...... Page Figure A. 1 Cellular Localization of DNTTIP1...... 161 Figure A. 2 Cellular Localization of PARK7...... 162 Figure A. 3 Cellular Localization of METTL21E and GW­CAT...... 163 Figure B. 1 Analysis on Live Body Weight by Age in Park7 (+/+), (+/­) and (­/­) Mice ...... 164

x

ABSTRACT

Yu, Hui. Ph.D., Purdue University, December 2013. Genes with Physiological Roles in Callipyge Muscle Hypertrophy. Major Professor: Christopher A.Bidwell.

Callipyge sheep is an excellent model to study genes regulation in muscle growth since the up­regulation of DLK1 and/or RTL1 results in extreme postnatal muscle hypertrophy in loin and hindquarters. DLK1 and/or RTL1 are the primary inducers of muscle hypertrophy due to the inheritance model for the callipyge phenotype. The overall aim of this dissertation is to study the physiological pathways responding to the up­ regulation of DLK1 and / or RTL1 in the hypertrophied muscles. Microarray analysis of gene expression identified 375 genes that were differentially expressed in callipyge semimembranosus. Twenty­five transcripts were further verified by quantitative PCR in two hypertrophied muscles (semimembranosus and longissimus dorsi) and one non­ hypertrophied muscle (supraspinatus). In order to identify the genes that are consistently co­expressed with DLK1/RTL1, the current study extends the gene expression analysis on these 25 genes in 4 hypertrophied muscles (longissimus dorsi, semimembranosus, semitendinosus and triceps brachii ) and 3 non­hypertrophied muscles (supraspinatus, infraspinatus and heart). The quantitative PCR results showed that DLK1 expression was significantly increased in the 4 hypertrophied muscles but not in the 3 non­hypertrophied muscles. However, RTL1 was up­regulated in both hypertrophied and non­hypertrophied

xi muscles, which confirmed that RTL1 is not sufficient to induce muscle hypertrophy but it may act in concert with DLK1 to increase muscle mass in callipyge lambs. Five other genes, including PARK7, DNTTIP1, SLC22A3, METTL21E and PDE4D, were consistently co­expressed with DLK1, herein they were the potential transcriptional target genes responding to DLK1 signaling. Since the hypertrophied muscles have a fiber type shift to a more fast­twitch, glycolytic muscle fibers and less oxidative fibers, DNTTIP1,

METTL21E and PARK7 were examined for their effects on MYH promoter activity using luciferase assays. The results showed that both PARK7 and DNTTIP1 had an effect to increase MYH4 and decrease MYH7 luciferase activity, similar to the effects of DLK1. In contrast, METTL21E increase MYH7 and decreased MYH4 luciferase activity. In DLK1­ treated myotubes, the mRNA expression of Myh4 and DNTTIP1 were both increased, suggesting DLK1 may regulate Myh4 expression through elevated DNTTIP1 expression.

Though PARK7 was not up­regulated in DLK1­treated cells, its increased levels in hypertrophied muscles still indicated its important role in callipyge muscle hypertrophy.

PARK7 has been shown to positively regulate PI3K/AKT pathway by suppressing the phosphatase activity of PTEN in mouse fibroblasts. The aim of the second study is to determine whether the elevation of PARK7 was part of the physiological mechanism for muscle hypertrophy in callipyge lambs. Primary myoblasts isolated from Park7 (+/+) and

Park7 (­/­) mice were used to examine the effect of differential expression of Park7. The

Park7 (+/+) myotubes had significantly larger diameters and more total sacomeric myosin expression than Park7 (­/­) myotubes. IGF1 treatment increased the mRNA abundance of Myh4, Myh7 and Myh8 between 20­40% in Park7 (+/+) myotubes relative to Park7 (-/-). The activity of PI3K/AKT pathway was determined by examination the

xii level of phosphorylation of AKT. The basal level of AKT phosphorylation (S473) was increased in Park7 (+/+) myotubes and this increase was substantially elevated in Park7

(+/+) myotubes at all levels of IGF1 supplementation. The differential levels of AKT phosphorylation were eliminated by the addition of a PTEN inhibitor, suggesting PARK7 inhibited PTEN activity in myotubes. After removal of IGF1, the Park7 (+/+) myotubes could still maintain about 20% higher signal intensity through 12 hours. These combined results suggested PARK7 can positively regulate the PI3K/AKT pathway by inhibition of

PTEN phosphatase activity. The elevated expression of PARK7 in the muscles of callipyge lambs would be expected to lead to increased muscle growth in response to the normal IGF1 signaling present in young growing lambs. The results presented in this thesis unveiled the genes consistently co­expressing with DLK1 in callipyge lambs and identified DNTTIP1 as a secondary transcriptional effector gene responding to DLK1 signaling. Furthermore, this thesis suggested a positive role of PARK7 in callipyge muscle hypertrophy.

1

CHAPTER 1. INTRODUCTION

1.1 Objective

In food animal industry, there is always a need to identify genes that can increase meat production. Callipyge sheep is an excellent model for this study since the up­ regulation of DLK1 and / or RTL1 results in the increased muscle mass. The overall aim of this dissertation is to study the physiological pathways responding to the up­regulation of DLK1 and / or RTL1 in the hypertrophied muscles. The current study is based on the results from the previous study, in which twenty­five transcripts were discovered and validated with differential expression in hypertrophied muscles. Two projects were included in this study. The objective of the first project was to identify the secondary transcriptional targets for DLK1 and / or RTL1 signaling (primary effectors) from the 25 transcripts. The consistent up­regulation of Parkinson Protein 7 (PARK7) expression in hypertrophied muscles but not in non­hypertrophied muscles makes it a potential secondary target. Therefore, the objective of the second project was to explore the functional role of PARK7 in muscle growth and protein accretion. Based on the objectives of the two projects, callipyge sheep, DLK1, RTL1, PARK7 and muscle hypertrophy pathways will be reviewed in this section to provide a better understanding in the follow­up experiments.

2

1.2 Callipyge Phenotype

The first callipyge sheep was identified in a commercial Dorset flock in Oklahoma in

1983 when it was referred to as “Solid Gold”. The unexpected superior muscling in the hindquarters makes it a unique model for researchers to study muscle development. Some of the offspring from the “Solid Gold” inherited the same extreme­muscling phenotype and thus were termed callipyge from the Greek –calli for beautiful, and –pyge for buttocks (Cockett et al. 1994).

The callipyge lambs are born normal and carry the same live weights as the normal lambs throughout their entire life (Jackson et al. 1997a; Freking et al. 1998b; Duckett et al. 2000; Lorenzen et al. 2000). However, depending on location, different degrees of increased muscle mass are found when slaughtering (Koohmaraie et al. 1995; Jackson et al. 1997b, c; Freking et al. 1998b; Duckett et al. 2000). Specifically, the increase of muscle mass in the pelvic limb (42%) and the torso (50%) is much greater than in the thoracic limbs (14%) (Jackson et al. 1997c), which is consistent with the visual perception that callipyge sheep appear to be more muscular in the hind legs and also appear to be wider and deeper through the rack and loin (Jackson et al. 1997c). Notably, the supraspinatus and infraspinatus muscles located in thoracic limbs do not undergo muscle hypertrophy (Koohmaraie et al. 1995; Jackson et al. 1997c; Lorenzen et al. 2000).

The “rostro–caudal gradient” is given to describe this special characteristic (Georges et al.

2003). Furthermore, the selective muscular hypertrophy of callipyge lambs develops during the postnatal growth period between birth and weaning (Jackson et al. 1997a;

Carpenter & Cockett 2000; Duckett et al. 2000; Lorenzen et al. 2000), therefore the 30­

3 day old lambs are utilized in the present study when the increase of muscle mass is statistically detectable.

As different from the “double­muscling” cattle (Kambadur et al. 1997), whose increased muscle mass is a results of the increase in the fiber number (hyperplasia), the muscle hypertrophy in callipyge sheep is due to the increased diameter of muscle fibers

(hypertrophy). (Koohmaraie et al. 1995; Carpenter et al. 1996; Carpenter & Cockett 2000;

Lorenzen et al. 2000). In a study of the histology and composition of muscles from callipyge lambs, a 34% increase in fiber size was determined in the longissimus, which was sufficient to account for the observed 31% increase in the loin eye area (Carpenter et al. 1996). A striking muscle fiber change is observed in the hypertrophy­responsive muscles with an increase in the proportion and size of type IIB fast­twitch, glycolytic muscle fibers (Carpenter et al. 1996; Carpenter & Cockett 2000). These fast­twitch fibers increase in diameter by 35% to 75% depending on the age and muscle affected

(Carpenter et al. 1996; Carpenter & Cockett 2000; Kerth et al. 2003). The muscle fiber switch reflects the metabolic change in callipyge muscles, and identifying of the regulators in the muscle fiber switch will enrich our knowledge concerning the muscle growth in callipyge sheep. The current study investigates the potential genes modulating muscle fiber switch using a cell culture model.

A reduction in the rate of protein degradation, rather than increased protein synthetic capacity, was first proposed to account for the higher protein accretion in callipyge sheep

(Koohmaraie et al. 1995; Lorenzen et al. 2000). Calpains are calcium­dependent proteases that degrade myofibers, whereas calpastatin inhibits calpain activity maintaining the integrity of myofibers. Increased calpastatin activity was described in

4 callipyge muscles suggesting a reduced protein degradation and increased protein accretion (Koohmaraie et al. 1995; Lorenzen et al. 2000). Recently, a higher level of

PARK7, a positive regulator of the PI3K/AKT pathway (see section 1.5.5), has been identified in hypertrophied muscles (Fleming­Waddell et al. 2009). The up­regulation of

PARK7 is assumed to enhance the downstream targets of AKT, such as p70S6 kinase

(p70S6K), to increase protein synthesis (see section 1.6.1)(Fleming­Waddell et al. 2009).

One goal of the current study is to address whether the elevation of PARK7 is part of the physiological mechanism for the induced muscle hypertrophy in callipyge lambs.

Other advantages of callipyge over normal sheep are the superior feed efficiency for both male and female animals and the higher dressing percentage (Koohmaraie et al.

1995; Jackson et al. 1997a; Jackson et al. 1997b). Lambs with the callipyge mutation have average daily gains which are similar to that of their half­siblings with a normal muscle phenotype but less feed per day (Jackson et al. 1997a). Dressing percentage is influenced by the amount of muscle, fat, gut­fill, and wool on the lamb (Jackson et al.

1997b). A total of 6 to 7% decrease in fat depot is constantly described in callipyge animals, and this reduction is not limited to subcutaneous fat, but also is reported in internal fat and intramuscular fat. (Koohmaraie et al. 1995; Jackson et al. 1997b; Freking et al. 1998b; Goodson et al. 2001). The results of the comparison of internal organs vary.

The lighter lungs, liver, and kidneys were first demonstrated in callipyge animals,

(Koohmaraie et al. 1995) but a later comprehensive study showed no statistically significant difference in the mean weights for liver, lungs, kidneys, rumen, reticulum, omasum, abomasum, small intestine, spleen, and testicles (Jackson et al. 1997b). At the same time, a lighter large intestine was indicated in this study. Two other studies

5 confirmed the lighter liver weights in more animals (Freking et al. 1998b; Lorenzen et al.

2000). Furthermore, the carcasses of callipyge lambs are more compact with a significantly shorter length and greater width at the shoulder and rump (Freking et al.

1998b). In addition, a reduction in fleece weight and staple length is observed for ewes with the callipyge phenotype (Freking et al. 1998a). These unique characteristics together contribute to the higher dressing percentage in callipyge sheep.

Despite the advantageous characteristics described above, the meat quality in callipyge muscle is not as good as in normal muscle. The higher levels of calpastatin activity are detrimental to meat tenderness. Several studies showed the increased Warner­

Bratzler shear force value from callipyge loin chops (Duckett et al. 2000) as a result of the reduced rate of calpain­mediated postmortem proteolysis. One study indicated that the postmortem proteolysis is delayed by as much as 20 days in callipyge lambs

(Koohmaraie et al. 1995). Notably, no difference in the tenderness of the SS (non­ hypertrophied muscle) between callipyge and normal lambs was reported (Koohmaraie et al. 1995; Shackelford et al. 1997; Duckett et al. 2000). Moreover, the lower marbling score also affects the quality, making them less juicy and flavorful (Jackson et al. 1997b;

Freking et al. 1999; Abdulkhaliq et al. 2002).

Despite the low meat quality in callipyge lambs, the better feed efficiencies and higher muscle yields allow researchers to use them as a model to study muscle growth. In addition, the unique inheritance model also attracts attention from the Genetics experts.

1.3 Genetics in Callipyge Sheep

The mutation causing muscle hypertrophy in callipyge lambs was first mapped to the distal end of ovine chromosome 18 (Cockett et al. 1994). Later, a non­Mendelian mode

6 of inheritance called polar overdominance was described based on the offspring production from multiple mating combinations (Cockett et al. 1996). The Callipyge sheep is the only animal model that demonstrates the polar overdominance phenomena.

Only the lambs inherit a paternal mutant allele and a normal maternal allele (+/C) exhibit the callipyge phenotype, whereas the lambs inheriting a maternal mutant allele (C/+) or both mutant alleles (C/C) possess the same phenotypes as the normal lamb (+/+) (Cockett et al. 1996; Freking et al. 1998a). Although the underlying mechanism for polar overdominance is complex (Georges et al. 2003) and is still under investigation, studies suggests that it relates to the altered genes expression around the callipyge mutation.

The callipyge mutation was identified in 2002 as a single base change of an A (wild­ type allele) to a G (callipyge allele) between the DLK1 (Delta-Like homolog 1) and

MEG3 (Maternal Expressed Gene 3) genes in the DLK1­DIO3 (Deiodinase,

Iodothyronine, type III) imprinted gene cluster (Freking et al. 2002; Smit et al. 2003). No evidence showed that the callipyge mutation disrupted protein coding. However, several studies have suggested that it acts as a long­range control element to alter the transcription of the nearby imprinted genes in cis (Freking et al. 1998a; Bidwell et al.

2001; Charlier et al. 2001a; Bidwell et al. 2004; Murphy et al. 2006; Takeda et al. 2006;

Fleming­Waddell et al. 2007; Vuocolo et al. 2007; Fleming­Waddell et al. 2009). These imprinted genes include the paternally expressed genes: DLK1 and Retrotransposon-like

1 (RTL1), and the Maternal Expressed Gene 3 (MEG3), Maternal Expressed Gene 8

(MEG8) and RTL1 antisense (RTL1AS) (Fahrenkrug et al. 2000; Schmidt et al. 2000;

Charlier et al. 2001b; Shay et al. 2001; Bidwell et al. 2004). Telomeric to MEG8 is the largest known cluster of mammalian miRNA, which are present in the introns of an

7 ncRNA transcript, called MicroRNA-containing Gene (MIRG) (Seitz et al. 2003a; Seitz et al. 2004). The existence of these maternally expressed MIRG has been confirmed in the skeletal muscle of sheep (Caiment et al. 2010)(see Figure 1.1). The imprinted status of

DIO3 in sheep has not been determined. Increased expressions of the paternally expressed genes (DLK1 and RTL1) are detected in the lambs which inherited the mutation from the sire (+/C), and up­regulated levels of maternally expressed genes (MEG3,

MEG8 and RTL1AS) are identified in the animals which inherited the mutation from the dam (C/+) (Bidwell et al. 2001; Charlier et al. 2001a; Bidwell et al. 2004; Perkins et al.

2006; Takeda et al. 2006; Fleming­Waddell et al. 2007; Fleming­Waddell et al. 2009).

Notably, only the paternally expressed genes are protein­coded (DLK1 and RTL1), whereas all the maternally expressed genes are non­coding RNA. Unlike RTL1, whose increased transcript abundance has been detected in all the muscles in callipyge animals, the up­regulation of DLK1 has been shown exclusively in the hypertrophy­responsive muscles, suggesting DLK1 is the primary effector of muscle hypertrophy but a synergistic effect of RTL1 cannot be ruled out (Bidwell et al. 2004). The following section will demonstrate the function of DLK1 and RTL1 respectively.

8

Figure 1.1 The DLK1-DIO3 Imprinted Gene Cluster. The relative positions of these imprinted genes are shown above. The protein coding genes (DLK1 and RTL1; blue) are expressed from the paternal allele (Pat) and the non­ coding RNA (MEG3, RTL1AS, MEG8 and MIRG; pink) are expressed from the maternal allele (Mat). The genes are shaded with blue or pink on the parent­of­origin chromosome to indicate their allele­specific expression. The causative mutation (A to G; CLPG) for the callipyge phenotype lies in the intergenic region between DLK1 and MEG3.

1.4 Primary inducers in callipyge sheep

1.4.1 Delta-like Homolog 1

DLK1, also known as FA1 (fetal antigen 1), Pref1 (preadipocyte factor 1), SCP1

(stromal cell­derived protein 1) and ZOG (zone glomerulosa specific factor) for its multiple functions and different discoveries [for review see (Laborda 2000)], encodes a protein that contains six extracellular epidermal growth factor (EGF)­like sequences, a proteolytic cleavage reorganization site, and a short intracellular tail (Laborda et al. 1993;

Laborda 2000). The cleavage of the EGF­like extracellular domain releases the soluble form of DLK1 called FA­1, widely existing in the serum of pregnant females and in amniotic fluid (Jensen et al. 1994b; Bachmann et al. 1996). ADAM17 (tumor necrosis factor alpha converting enzyme, TACE) is identified as an enzyme to catalyze the production of FA­1 (Wang & Sul 2006). An alternative splicing form of DLK1 without the proteolytic cleavage site is found to remain constitutively membrane­bound and this

9 form of DLK1 predominates during later fetal and adult life (Davis et al. 2004; White et al. 2008).

The function of DLK1 has been extensively explored in the context of adipogenesis.

DLK1 is proposed as a marker for pre­adipocytes where it strongly expressed, and its expression level is immediately decreased during adipocyte differentiation. Constitutive

Dlk1 expression inhibits adipose differentiation (Smas & Sul 1993; Smas et al. 1997).

This result is further confirmed in Dlk1 knockout mice, whose fat deposition is highly increased and serum lipid metabolites are altered (Moon et al. 2002). Thus, Dlk1 is considered as a negative regulator of adipogenesis, and this anti­adipogenic function of

Dlk1 could be an explanation for the lean muscle phenotype characteristic of callipyge sheep.

Several studies have illustrated a role of Dlk1 in muscle growth. Transgenic mice over­expressing Dlk1 results in a 10 to 15% increase in quadriceps femoris muscle mass and a 9 to 10% increase in myofiber diameter (Davis et al. 2004). Conversely, muscle­ specific gene ablation of Dlk1 in the mouse results in reduced body weight and skeletal muscle mass due to reductions in myofiber numbers (Waddell et al. 2010). A polymorphism in the DLK1 gene in pigs is associated with increased lean muscle mass and decreased adiposity similar to callipyge sheep (Kim et al. 2004). Moreover, a marked reduction in mRNA levels of myosin heavy chain 4 as well as compromised regenerative capacity and elevated inflammatory response to injury are also detected in the Dlk1 knockout mice (Waddell et al. 2010). These combined transgenic models suggest the important role of Dlk1 during postnatal muscle development and regeneration.

10

The expression of Dlk1 is greater during embryonic development and gradually decreases after birth. However, increased expression of Dlk1 is discovered in human myopathies including Duchenne and Becker muscular dystrophies (Andersen et al. 2009).

The relationship between Dlk1 and muscle disorders could be explained by the involvement of satellite cells. Muscle satellite cells have been characterized as a population of muscle­specific committed progenitors that are responsible for the postnatal maintenance, growth, repair and regeneration of skeletal muscle [for review, see (Kuang

& Rudnicki 2008)]. The expression of transcriptional factor Pax7 has been defined as a maker of muscle satellite cells (Kuang et al. 2006). A subpopulation of PAX7 positive cells is found to be DLK1 positive in muscles of newborn sheep (White et al. 2008).

Substantial numbers of Dlk1 positive satellite cells were observed in Duchenne muscles.

Furthermore, myogenic Dlk1 positive cells were identified during muscle regeneration in animal models in which the peak expression of Dlk1 mRNA and protein coincided with that of myoblast differentiation (Andersen et al. 2009). These combined evidences suggest that Dlk1 functions to regulate myogenic progenitor cells to modulate muscle growth.

The mechanism on how Dlk1 regulates muscle growth has been explored and studies have shown that Dlk1 acts as an inhibitor for Notch signaling. The structure of DLK1 has high homology to the drosophila protein Delta except that DLK1 lacks the critical

Delta/Serrate/Lag­2 (DSL) domain at its N­terminus (Artavanis­Tsakonas et al. 1999;

Laborda 2000). However, DLK1 can still interact with Notch­1 and down­regulate its activity in mammalian cell lines (Baladron et al. 2005; Bray et al. 2008). The Notch signaling is a conserved cell fate regulator and is known to inhibit myogenic regulatory

11 transcription factor MyoD expression and myogenic differentiation, but enhances satellite cell proliferation and self­renewal (Nofziger et al. 1999; Wen et al. 2012). Ablation of

Dlk1 inhibits the expression of MyoD, and facilitates the self­renewal of activated satellite cells. Conversely, over­expression of Dlk1 inhibits the proliferation and enhanced differentiation of cultured myoblasts. This suggests a model in which Dlk1 facilitates muscle differentiation through dampening of Notch signaling (Waddell et al.

2010).

Extensive studies have shown that Dlk1 is involved in tumorgenesis. Dlk1 is proposed as a marker for hepatoblastomas (Dezso et al. 2008) and adrenal gland tumors (Turanyi et al. 2009). It is also detected frequently in colon adenocarcinomas, pancreatic islet carcinoma, and small cell lung carcinoma (Yanai et al. 2010). The mechanism on how

Dlk1 regulates oncogenesis is complicated but studies have shown that Dlk1­positive fetal liver cells have higher proliferative potential compared to the Dlk1­negative cell population. The Dlk1­positive fetal liver cells are able to differentiate into both the hepatocyte and cholangiocyte lineages, which implies that Dlk1­positive liver cells are still hepatoblasts (Tanimizu et al. 2003; Xu et al. 2012). Interestingly, PARK7, the target gene in the present study, is also associated with development of multiple cancers (see section 1.5.5), indicating it may function together with Dlk1 to modulate cell fate determination.

1.4.2 Retrotranposon-like 1

Retrotranposon-like 1 (RTL1), is the other up­regulated gene in callipyge sheep.

RTL1 belongs to the Ty3­Gypsy retrotransposons gene family and contains a gag­pol­like structure common to retroviruses (Charlier et al. 2001b). This highly conserved gene only

12 has one single exon open reading frame and encodes a full length 151 kD protein in skeletal muscles (Byrne et al. 2010).

RTL1 is highly expressed at the late­fetal stage in both the fetus and placenta.

Paternally knockout RTL1 in mice showed pre­ and postnatal growth retardation in the F1 and F2 generations, and after the F3 generation, most showed late­fetal or neonatal lethality (Sekita et al. 2008). A 40% decrease in passive permeability in placenta is also reported in RTL1 deficient mice, indicating that the loss of RTL1 may damage the placental physical barrier (Sekita et al. 2008). A 2.5 to 3 times over­expression of RTL1 leads to 15% retardation in growth after weaning in early generations, and predominant neonatal lethality was found after the F6 generation (Sekita et al. 2008). The expansion of the inner spaces of the fetal capillaries has also reported in this model. These combined evidences indicate an essential function of RTL1 for the development of embryo and growth of fetus and adult animals. Recently, RTL1 has been identified as a novel driver of hepatocarcinogenesis (Riordan et al. 2013). Mutations resulting in the over­expression of

RTL1 are found in the mouse model of hepatocarcinogenesis. Over­expression of RTL1 results in highly penetrant (86%) tumor formation in vivo and the increased growth ability of hepatocytes in vitro (Riordan et al. 2013).

A maternally expressed non­coding RNA transcribed from the opposite direction

(RTL1-antisense, RTL1AS), containing at least four microRNA, was identified for the

RISC­mediated degradation of RTL1 transcripts (Seitz et al. 2003b; Bidwell et al. 2004;

Davis et al. 2005). The identification of RTL1AS provides a new insight into the polar overdominance of the callipyge phenotype, in which only the paternal heterozygous (+/C) have the increased level of RTL1. The miRNA­mediated degradation of RTL1 transcripts

13 in homozygous animals (C/C) reduces the mRNA abundance of RTL1 (Bidwell et al.

2004; Davis et al. 2005). However, the role of RTL1 in the callipyge muscle hypertrophy is still unclear and needs further investigation.

1.5 Parkinson Disease 7

Parkinson Protein 7 (PARK7 / DJ-1) was first identified in 1997 as an oncogene that transformed NTH3T3 cells in cooperation with activated Ras (Nagakubo et al. 1997).

PARK7 encodes a 20­kDa protein comprising 189 amino acid residues ubiquitously expressed in various human tissues (Nagakubo et al. 1997). Later, a mutation is found to be responsible for a recessive early­onset form of Parkinson’s disease (Bonifati et al.

2003). Substantial studies implicated that PARK7 plays important roles in male fertility, cellular management of oxidative stress, mitochondrial homeostasis, and tumor progression.

1.5.1 Genetics and Structure Biology of Park7

The PARK7 gene was located in human chromosome 1p36.2­p36.3, in mouse chromosome 4 and in sheep chromosome 12. PARK7 genomic DNA comprises seven exons, in which the 2­7 exons encode for PARK7 protein. Human PARK7 homomers comprise a structure with a six­strand parallel β­sheet sandwiched by α­helical arrangements (flavodoxin fold) (Honbou et al. 2003a; Honbou et al. 2003b). The PARK7 protein is homologous to a number of bacterial enzyme families such as ThiJ, a protein involved in thiamine biosynthesis, the Pfp1 protease (Bonifati et al. 2003) as well as the

YajL redox­sensitive chaperone (Martinat et al. 2004). The three­dimensional structure is given below (Figure 1.2.) [for review, see (Trempe & Fon 2013)]. Though the crystal structure of PARK7 is similar to the Pfp1 protease, PARK7 does not exhibit protease

14 activity due to the distorted catalytical triad that is essential for protease activity, and the occupation of additional C­terminal helix at putative active site of PARK7 (Wilson et al.

2003; Martinat et al. 2004). PARK7 contains three cysteine residues, C46, C56, and

C106. Of the three cysteine residues, C106 is highly susceptible to oxidative stress and is oxidized as SOH, SO2H, and SO3H. PARK7 at C106 with SO3H is thought to be an inactive form of PARK7 (Figure 1.3.) and the mutation of C106 results in loss of PARK7 functions (Mitsumoto et al. 2001; Kinumi et al. 2004; Meulener et al. 2006; Hulleman et al. 2007; Blackinton et al. 2009). So far, about 28 mutations are found in this gene

(Table1.1). The effects of most of these sequence alterations in PARK7 are not clear but the L166P seems to be a dramatic point mutation, which affects PARK7 function

(Bonifati et al. 2003). L166 is located in the middle of α­helix 8 (α8) and the mutation from leucine to proline seems to cause a break in the α­helix, which results in abrogation of the dimer formation, unstable and degradation of the protein (Miller et al. 2003; Moore et al. 2003; Gorner et al. 2004; Olzmann et al. 2004).

15

Figure 1.2 Structure of PARK7 Protein The crystal structure of human PARK7 (PDB 1P5F) was used to generate this dimer, which represents the biologically active unit. The two subunits are colored in cyan and magenta. Residues of the active site catalytic triad (Glu18, Cys106, His126) are shown as sticks. The location of the PD mutation that disrupts dimerization (L166P) is indicated by arrow (Trempe & Fon 2013).

16

Table 1.1 Genetic Variation of PARK7 Mutation Population Effects Reference

Ex1­5del Dutch Loss of protein (Bonifati et al. 2003)

Ex1­5dup Dutch Unknown (Macedo et al. 2009)

Ex2del Chinese Unknown (Guo et al. 2010)

Ex5del Serbian Unknown (Djarmati et al. 2004)

Ex5­7del Northern Italian Altered transcript (Hedrich et al. 2004)

c.­122_­107del South African Promoter activity (Keyser et al. 2009)

Leu10Pro Chinese Unknown (Guo et al. 2010)

Met26Ile Ashkenazi Jewish Decreased stability (Abou­Sleiman et al. 2003)

Ala39Ser Chinese Destabilized PINK1 (Tang et al. 2006)

Glu64Asp Turkish Unknown (Hering et al. 2004)

IVS4+8_9insA Southern Italy polymorphism (Tarantino et al. 2009)

Arg98Gln Global Polymorphism (Hedrich et al. 2004)

Ala104Thr Latino Unknown (Hague et al. 2003)

IVS5+2_12del Russian Altered transcript (Hague et al. 2003)

Asp149Ala Afro Caribbean Unknown (Abou­Sleiman et al. 2003)

Pro158del Dutch Unknown (Macedo et al. 2009) Thr160 American Unknown (Pankratz et al. 2006) (g.33808C>A) Glu163Lys Italian Altered activity (Annesi et al. 2005)

Leu166Pro Italian Protein instability (Bonifati et al. 2003)

Ala171Ser Global Unknown (Clark et al. 2004)

Ala179Thr Dutch Unknown (Macedo et al. 2009)

17

Figure 1.3 Cysteine Oxidation and Activation of PARK7. PARK7 contains three cysteine residues at amino acid numbers 46, 54, and 106 (C46, C54, and C106). C106 is sequentially oxidized with SOH, SO2H, and SO3H, and then C46 and C54 are oxidized. Graph modified from (Ariga et al. 2013).

1.5.2 Park7 and Male fertility

In rats, the contraceptive associated protein 1 (CAP1) is found in sperm­extracts from fertile rats and epididymal fluid of ornidazole treated infertile rats. CAP1 is highly expressed in rat testis, indicating its function in male fertility (Wagenfeld et al. 1998).

The further characterization of CAP1 showed that it shared high homology at the nucleotide and amino acid level of human and mouse PARK7 (Wagenfeld et al. 1998). In human and mouse, CAP1 is referred to DJ-1 or PARK7. Ornidazole treatment reduces the level of CAP1 expression in sperm, which leading to low fertilization both in rat and mice

(Wagenfeld et al. 1998; Okada et al. 2002). This decreased level of CAP1 is also observed and quantified in rat serum extract treated with haloacids, which disrupts spermiogenesis in rat (Kaydos et al. 2004; Klinefelter et al. 2004). Furthermore, the binding of sperm to the eggs is abrogated when treated with anti­PARK7 antiserum in mice indicating PARK7 directly participates in the fertilization reaction (Okada et al.

2002). These results were further confirmed by another group using rats. In their study,

18 the inhibition effect of anti­PARK7 antiserum is decreased when using zona­free eggs, which suggests that PARK7 works to enable binding of sperm to the egg surface and penetrating of the egg surface (Klinefelter et al. 2002). Since its sensitivity and correlation with fertility, PARK7 is proposed as a sperm fertility biomarker (Klinefelter

2008). In addition, a recent study unveils the expression and localization of PARK7 in efferent ducts, which conduct sperm from the rete testis to the epididymis. The epididymis is the place where the sperm acquire the mobility and ability to fertilize an egg (Trepos­Pouplard et al. 2010). In their study, they also found the promoter region of

PARK7 contains estrogen response elements, which together implicate its role in sperm maturation and sex hormones regulation (Trepos­Pouplard et al. 2010).

1.5.3 Park7 and Its RNA Binding Capacity

RNA­binding proteins play an important role in the post­transcriptional control of gene expression. The activity of this family of proteins is mediated through specific recognition of sequences and structural elements within the mRNA transcripts. In 1993, a

RNA binding complex includes a RNA­binding subunit (s), and a regulatory subunit(s)

(RS) were identified in FTO­2B rat hepatoma cells (Nachaliel et al. 1993). Later, this RS was cloned and characterized identical to human PARK7 gene (Hod et al. 1999). This study also showed that the purified recombinant RS had the capacity to inhibit RNA binding complex activity (Hod et al. 1999). However, the RNA binding capacity of

PARK7 has not been stated until recently (van der Brug et al. 2008). Though lacking of classical RNA binding motifs, PARK7 can bind to GG/CC­rich sequences and dissociate under conditions of oxidative stress (van der Brug et al. 2008). The mRNA binding partners of PARK7 were involved in but not limited to cell metabolism, mitochondrial

19 transcripts and cell survival components both in vitro and in vivo (van der Brug et al.

2008). The RNA binding capacity provides an explanation of the multifunction of

PARK7.

1.5.4 Park7 and Parkinson ’s disease

Parkinson's disease (PD) is a progressive neurodegenerative disease affecting more than 1 million individuals in the United States. Approximately 0.3% of the general population and 3% of the population above 65 years have PD (Shaikh & Verma 2011).

Oxidative stress and mitochondrial dysfunction are implicated in the pathogenesis of PD.

Park7 had been investigated to exhibit the functions in maintaining mitochondrial homeostasis and protecting neurons from oxidative stress.

1.5.4.1 Role of Park7 in Mitochondrial Homeostasis

PARK7 is located both in the cytoplasm and nucleus (Nagakubo et al. 1997) and a portion of PARK7 has been shown to be located in the mitochondria (Canet­Aviles et al.

2004; Shendelman et al. 2004; Zhang et al. 2005; Hayashi et al. 2009). It has been reported that some parts of PARK7 are translocated into mitochondria after cells has been subjected to oxidative stress, to protect cells from oxidative stress­induced cell death (Li et al. 2005; Junn et al. 2009). The oxidation of C106 with SO2H and the N­terminal 12 amino acids are necessary for the mitochondrial translocation of PARK7 (Canet­Aviles et al. 2004; Maita et al. 2013). The localization of PARK7 in mitochondria is controversial.

Zhang et al. reported that PARK7 is located in the mitochondrial matrix and inner membrane space (Zhang et al. 2005), while Canet­Aviles et al. reported that PARK7 is located in the outer membrane but not inside of mitochondrial outer membrane (Canet­

20

Aviles et al. 2004). Recently, the localization of PARK7 in outer mitochondrial membrane is supported by the identification of a PARK7 binding partner Bcl­XL, a typical Bcl­2 family protein that primarily localized in the outer mitochondrial membrane

(Ren et al. 2011). The Bcl­2 family proteins are involved in PD pathogenesis and the Bcl­

XL is required for mouse substantial nigra development. The Bcl­XL inhibits dopaminergic neuronal death induced by MPTP in the substantia nigra pars compacta

(Savitt et al. 2005; Dietz et al. 2008), thus it has a protective role in PD. In response to ultraviolet B irradiation (an oxidative agent), the mitochondrial distribution of Park7 increases, which leads to the more binding capacity to Bcl­XL and further to prevent Bcl­

XL degradation (Ren et al. 2011).

Moreover, loss function of Park7 results in several mitochondrial abnormalities.

Significantly more fragmented mitochondria are reported in Park7 knockout mice and cells (Irrcher et al. 2010). Loss of Park7 causes decreased mitochondrial transmembrane potential and increased mitochondrial permeability transition pore opening, which can be restored by treatment of antioxidant molecules (Giaime et al. 2012). Reduced activity level and reduced amount of mitochondrial complex I have been reported in PD patients.

PARK7 is colocalized with mitochondrial complex I and directly bounded to NDUFA4

[NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4] and ND1 (NADH dehydrogenase subunit 1), which are nuclear and mitochondrial DNA­encoding subunits of mitochondrial complex I respectively (Hayashi et al. 2009). Knockdown of Park7 in vitro causes reduced activity of mitochondrial complex I and delivery of Park7 partially restored its activity (Hayashi et al. 2009). Since the pathogenic Park7 mutants such as

21

L166P and M26I are localized in mitochondria as monomers, the dimer formation is necessary for PARK7 to elicit its function in mitochondrial (Maita et al. 2013).

Since Park7 sequence contains no consensus mitochondrial targeting signals, the precise mechanism by which Park7 is translocated into mitochondria is still not known. However, the mitochondrial Hsp70 has the capacity to direct the import of nuclear­encoded proteins into mitochondria (Li et al. 2005; De Mena et al. 2009), therefore it has been proposed that the binding of PARK7 to chaperones such as the Hsp70, CHIP, and mitochondrial

Hsp70 / Grp 75 may contribute to the translocation of PARK7 to mitochondria.

Regulation of autophagy and especially the autophagic degradation of mitochondria is an essential tool to maintain mitochondrial function and cellular homeostasis. Autophagy is a process that is involved in cell degradation of unnecessary or dysfunctional cellular components to provide sufficient ATP to ensure the functionality of vital cellular processes such as transcription and protein synthesis during periods of energy limitation

(Vasseur et al. 2009; Macintosh & Ryan 2013). Recent studies provide evidence for a potential role of Park7 in regulation of autophagy. The association of Park7 with autophagy varies. Park7 silencing results in both up­regulation (Irrcher et al. 2010;

Thomas et al. 2011) and down­regulation of autophagy (Gonzalez­Polo et al. 2009;

Vasseur et al. 2009; Krebiehl et al. 2010). It has been reported that Park7 acts in parallel to the Pink1 / Parkin to control mitochondrial function and autophagy (Thomas et al.

2011). Future studies on the precise mechanism of autophagy induction by Park7 will be needed to better understand the function of PARK7 in regulation of mitochondrial homeostasis.

22

1.5.4.2 Role of PARK7 in Anti­oxidative Stress

Park7 plays an important role in protecting neurons and somatic cells from oxidative stress. Park7 has several isoforms with different isoelectric points (pI). It quenches reactive oxygen species (ROS) by converting from pI 6.2 to the more acidic form pI 5.8 in mammalian cell lines. This pI shift is caused by the oxidation of cysteine residues in

PARK7 (Figure 1.3.) (Mitsumoto & Nakagawa 2001; Mitsumoto et al. 2001). Post­ mortem studies of brain samples taken from sporadic Parkinson’s disease patients found that the acidic isoforms of PARK7 are more abundant in PD brains as compared to controls.

The anti­oxidative stress function of Park7 is confirmed both in vitro and in vivo. In the presence of H2O2, the cell viability of Park7 knockout primary cortical neurons is increased when transfected with wild­type Park7 and further improves upon over­ expression of Park7, suggesting a gene dosage effect (Kim et al. 2005b). Transient knockout Park7 in SH­SY5Y neuroblastoma cells results in less resistant to 1­methyl­4­ phenyl­1,2,3,6­tetrahydropyrindine (MPTP), a neurotoxin leading to the pathology most similar to PD, and H2O2 treatment (Taira et al. 2004). Conversely, stable over­expression of Park7 in H9C2 cardiomyocytes effectively attenuates ROS generation, enhances the cellular antioxidant capacity and prevents ischemia/reperfusion­induced oxidative stress

(Yu et al. 2013). In addition to the in vitro studies, several Park7 knockout mice lines were established to study the consequences of Park7 deficiency in vivo. Under basal conditions, Park7 knockout mice are viable, fertile, and show no gross anatomical or neuronal abnormalities (Kim et al. 2005b; Yamaguchi & Shen 2007). However, when exposing to MPTP, Park7 deficient mice show increased striatal denervation and

23 dopaminergic neuron loss. Adenoviral vector delivery of Park7 restores all these phenotypes (Kim et al. 2005b) and over­expression of Park7 resists the MPTP induced striatal damage. Similar to Park7 knockout mice, Park7 knockdown zebrafish and

Drosophila melanogaster flies are specifically sensitized to lethal oxidative stress

(Menzies et al. 2005; Bretaud et al. 2007). Taken together, all these evidences suggested the anti­oxidative stress and cell protective function of Park7.

The mechanism on how Park7 exerts its cell protective function has been extensively studied. In addition to maintaining mitochondrial homeostasis and oxidizing itself to a more acidic form, Park7 has chaperone activities and it can also regulate anti­oxidative gene induction, and signaling pathways against oxidative stress.

1.5.4.3 Chaperone Activity of PARK7

Structural similarities to Hsp31 (heat shock proteins 31) suggests that PARK7 may function as a chaperone, and the presence of a hydrophobic patch, which is a characteristic of chaperone proteins, in the PARK7 dimer complex supports to this notion

(Lee et al. 2003). Subsequent evidence of its chaperone activity has been demonstrated by quantification of the suppression of heat­induced aggregation of citrate synthase (CS) and glutathione S­transferase (GST), two well characterized protein chaperone assays in vitro (Shendelman et al. 2004). The chaperone activity of PARK7 is in a redox­ dependent manner (Shendelman et al. 2004) and the oxidation of C106 to SO2H form is required for this activity (Zhou et al. 2006). A recent study also showed that the abrogation of chaperone activity of PARK7 by L166P mutation could be restored by

BAG1 (Bcl­2 associated athanogene1), an anti­apoptotic foldase stimulating co­

24 chaperone (Deeg et al. 2010). The aggregation of α­synuclein, a 140 residue presynaptic protein, is believed to be a critical factor in the development of Parkinson’s disease and it has been suggested that oligomeric forms of α­synuclein might be toxic (Zhou et al.

2006). Under an oxidative condition, the chaperone activity of PARK7 inhibits the aggregation of α­synuclein, (Shendelman et al. 2004), suggesting an alternative mechanism on how PARK7 is involved in PD pathogenesis.

1.5.4.4 Role of Park7 in Transcriptional Regulation

Park7 acts as a coactivator or a corepressor through binding to proteins to regulate transcriptional activities. Several studies have reported the regulation of Park7 on androgen receptor (AR) function. The androgen receptor is a member of the nuclear receptor superfamily and plays a role as a ligand­dependent transcription factor. After a ligand binds to the AR, the AR translocates into the nucleus and binds to the androgen­ responsive element (ARE) and the androgen­activating genes. These AR binding partners affect development, growth, and regulation of male reproductive functions (Heinlein &

Chang 2002). Park7 modulates androgen receptor activities in a highly cell­type­specific manner. The first identified PARK7 interacting protein is PIASxα (protein inhibitor of activated STAT), also known as androgen receptor­interacting protein (Takahashi et al.

2001). PARK7 bounds to the AR­binding region of PIASxα to abolish the suppression of

AR transcription activity by PIASxα in CV1 monkey kidney cells and the TM4 mouse testis sertoli cell line but not in human HepG2 hepatoma cells. In mouse Cos1 cells,

PARK7 is found to bind to DJBP (DJ­1 binding protein) to reverse the suppression of

DJBP on AR transactivation activity in a testosterone­dependent manner (Niki et al.

25

2003). Surprisingly, in human neuroblastoma SK­N­BE(2)C, Park7 is reported to inhibit

AR­dependent gene activation by approximately 50% (Jeong et al. 2006). In 2007, a direct interaction between PARK7 and AR was reported in prostate cancer cells (LNCaP and LAPC4 cell lines) and this study also showed PARK7 functions as a positive regulator of AR signaling (Tillman et al. 2007).

The regulation of the transcriptional activity of the tyrosine hydroxylase (TH) gene by androgen receptor leads to the studies on the modulation of Park7 on TH activity (Jeong et al. 2006). The characteristics of Parkinson disease are the selective loss of dopaminergic neurons and the decrease of striatal dopamine levels. Dopamine is synthesized from tyrosine by two enzymes; tyrosine hydroxylase (TH) and L­DOPA decarboxylase (DDC). After synthesis, dopamine is transported into synaptic vesicles by vesicular monoamine transporter 2 (VMAT2). Tyrosine hydroxylase catalyzes the first and rate­limiting step of dopamine synthesis. Park7 positively regulates human TH gene expression by sequestering the transcriptional repressor PSF (polypyrimidine tract­ binding protein­associated splicing factor) from the human TH gene promoter (Zhong et al. 2006). Park7 suppresses PSF activity by inhibiting the sumoylation of PSF and preventing its sumoylation­dependent recruitment of histone deacetylase 1(Zhong et al.

2006). However, this up­regulation of TH is only observed in human, the Park7 knockout mice do not exhibit reduced TH expression or decreased dopamine production due to the lacking of PSF­recognition sequence in the mouse TH gene (Ishikawa et al. 2010).

Recently, the nuclear receptor related protein 1 (NURR1) is reported to mediate Park7 induced TH activation via the ERK1 pathway (Lu et al. 2012). The TH up­regulation by

Park7 can be abolished when NURR1 is silenced. Conversely, the up­regulation of

26

NURR1 as a result of over­expression of Park7 increases TH activity (Lu et al. 2012). In addition, a recent study reported that Park7 regulates dopamine synthesis by stimulating

VMAT2 activity in the synapse through directly binding to VMAT2 and modulating the transactivation of the VMAT2 gene. The cysteine 106 is necessary for the stimulating activity of Park7 toward VMAT2 (Ishikawa et al. 2012).

Park7 is an important regulator of anti­oxidative gene induction. Park7 is reported to stabilize Nrf2 (nuclear factor erythroid 2­related factor) by preventing its association with the inhibitor protein, Keap1 and further preventing the subsequent ubiquitination of Nrf2

(Clements et al. 2006). Upon exposure to oxidative stress, Nrf2 translocates to the nucleus, which allows transcriptional activation of various antioxidant enzymes, such as

NQO1 [NAD(P)H quinone oxidoreductase 1], Hmox-1, and enzymes that generate antioxidant molecules, such as glutathione. Therefore, Park7 acts as a positive regulator of Nrf2­driven antioxidant protection (Clements et al. 2006). Furthermore, Park7 protects rat dopaminergic cells upon oxidative damage by mediating the induction of glutamate cysteine ligase, the rate­limiting enzyme of glutathione biosynthesis (Zhou & Freed

2005). In addition, knockdown or L166P mutant of Park7 in NIH3T3 cells reduces the expression of the extracellular superoxide dismutase (SOD3), leading to the increase of

ROS in cells (Nishinaga et al. 2005)

1.5.4.5 Role of Park7 on Signal Transduction

As introduced above (see section 1.5.4.2), Park7 quenches reactive oxygen species

(ROS) by converting itself to a more acidic form to protect cells from oxidative stress.

Notably, the ROS are not only cytotoxic molecules; they are produced in cells in minute

27 amounts to facilitate signal transduction pathways (Hattori et al. 2009). The ASK1 signaling pathway is one of the pathways that can be activated by ROS (Hattori et al.

2009). Apoptosis signal­regulating kinase 1 (ASK1) is mitogen­activated protein kinase­ kinase­kinase 5 (MAP3 K5) and it can activate c­Jun N­terminal kinase (JNK) and p38 mitogen­activated protein kinases (Hattori et al. 2009). Activation of these pathways induces cellular responses such as apoptosis, differentiation, cell survival, and also produces inflammatory cytokines (Hayakawa et al. 2012). PARK7 co­ immunoprecipitates with ASK1 upon H2O2 exposure and this binding occurs after ASK1 dissociation with Trx1 (thioredoxin 1), an ASK1 inhibitor. Herein it has been proposed that Park7 replaces Trx1 under acute oxidative stress, providing a second safeguard suppressing ASK1­mediated apoptosis (Gorner et al. 2007). This result is further confirmed by another group, which demonstrated that after H2O2 treatment, Park7 is incorporated into the ASK1 complexes and forms mixed disulfide bonds to suppress

ASK1 function (Waak et al. 2009). Furthermore, PARK7 has been identified to bind to

Daxx, a death domain­associated protein. Through this binding, PARK7 sequesters Daxx in the nucleus, which prevents Daxx from binding to and activating its effector kinase

ASK1 (Junn et al. 2005). This process is reversed by the MPTP mediated down­ regulation of Park7 (Karunakaran et al. 2007), which induces the translocation of Daxx from nucleus to cytoplasm and results in the death of dopaminergic neurons. Through suppression of ASK1 activity, Park7 negatively regulates the stress­activated p38 MAPK and JNK pathways. In addition, Park7 has been shown to physically interacts with

MAPK/extracellular signal­regulated kinase kinase kinase 1 (MEKK1) and inhibits

MEKK1 activation, resulting in the suppression of MEKK1­mediated cell death (Mo et al.

28

2008). Considering that MEKK1 is an MAP3K that participates in the JNK signaling cascade, the inhibition of MEKK1 activation by Park7 may also be an important mechanism in the progression of PD (Mo et al. 2008). Pathogenic mutants of PARK7 do not have this activity.

Park7 has been identified to be involved in ERK pathway since 1997 when it was first defined as a Ras­pathway interactor during oncogenic transformation (Nagakubo et al. 1997). The ERK pathway is the main cell­progression pathway starting from Ras, followed by Raf, Mek, and ERK. A recent study showed that dopamine­exposure led to the up­regulation of Park7, which in turn to protect cells from dopamine toxicity and reduce intracellular ROS (Lev et al. 2009). Inhibition of ERK 1, 2 phosphorylation abolishes dopamine induced up­regulation of Park7, suggesting the up­regulation of

Park7 is mediated by the MAP kinases pathway through the activation of ERK 1, 2 (Lev et al. 2009). Moreover, combined deletion of ERK and Park7 in Drosophila enhances the developmental defects during eye and wing development caused by ERK deletion, providing evidence for an important role for the interaction between Park7 and ERK related signaling during evolution (Aron et al. 2010). In addition, it has been shown that

Park7 protects dopaminergic neurons against rotenone­induced apoptosis by enhancing

ERK­dependent mitophagy (Gao et al. 2012).

Since reactive oxygen species (ROS) has also been implicated to induce programmed cell death or necrosis (Hancock et al. 2001), the involvement of JNK and ERK pathway makes Park7 an important regulator in cancer development.

29

1.5.5 Park7 and Cancer

Park7 has been shown to regulate a variety of cancers’ development. Both breast cancer and pancreatic cancer patients have elevated levels of circulating Park7, and thus

Park7 is proposed as the biomarker for these two cancers (Pucci­Minafra et al. 2008; He et al. 2011). Park7 stabilizes Nrf2 (nuclear factor erythroid­drived 2­like2) to up­regulate the expression of antioxidant / protective enzymes, which confers a consequent survival benefit to the lung carcinomas (Clements et al. 2006). PARK7 is associated with prostate cancer by directly binding to androgen receptor to promote the progression of prostate cancer to androgen independence (Tillman et al. 2007). In addition, elevated levels of

Park7 have been detected in astrocytomas (Miyajima et al. 2010), leukemias (Liu et al.

2008), and renal cell carcinomas (Eltoweissy et al. 2011). In addition to the involvement of Park7 in JNK and ERK pathways, Park7 can also modulate cell survival through regulation of p53, NF­κB and the PI3K/AKT pathway.

p53 is a tumor suppressor and plays roles in induction of senescence and apoptosis of cells (Smith et al. 2003). Park7 regulates p53 transcriptional activity in many ways.

Topors is a ring finger protein binding to both topoisomerase I and p53 in vitro and in vivo. Transcription activity of p53 is found to be abrogated by Topors concomitant with sumoylation of p53 in a dose­dependent manner, and PARK7 restores the repressed activity of p53 by releasing the sumoylated form of p53 (Shinbo et al. 2005).

Sumoylation of PARK7 itself is necessary for PARK7 to localize from the cytoplasm to the nucleus (Shinbo et al. 2006), and PARK7 is a negative regulator for sumoylation (Fan et al. 2008a). Interestingly, increased levels of p53 and Bax (a transcriptional target of p53 and an inducer for apoptosis) are found in Park7 knockout zebrafish, suggesting

30

Park7 may act as a negative regulator of p53 (Bretaud et al. 2007). This result is supported by another group which demonstrated Park7 decreases Bax expression by repressing p53 transcriptional activity (Fan et al. 2008b). A recent study showed that

PARK7 bounds to the DNA­binding region of p53 in a manner dependent on the oxidation of C106. PARK7 suppresses the expression of p53 target genes through preventing promoter recognition of p53 in a DNA­binding affinity dependent manner

(Kato et al. 2013).

The identification of Cezanne, a known deubiquitination enzyme that inhibits NF­κB activity, as a PARK7 binding partner leads to the investigation of Park7 in NF­κB signaling (McNally et al. 2011). The amino terminus of PARK7 is sufficient to mediate this interaction, and this interaction between Cezanne and PARK7 is enhanced by oxidation of the C106 residue of PARK7. (McNally et al. 2011). Park7 and Cezanne shRNA are found to reciprocally regulate interleukin 8 (IL-8) and intercellular adhesion molecule 1 (ICAM-1), whose transcription are mediated by NF­κB, and both of them are shown to be positively associated in human cancer (Dong et al. 2005; Rubie et al. 2007;

Chavey et al. 2008; Singh & Lokeshwar 2009). This result indicated the roles of Park7 and Cezanne in NF­κB mediated transcription (McNally et al. 2011). The link between

Park7 and NF­κB is confirmed with the discovery of decreased nuclear p65 expression in the presence of Park7 shRNA, suggesting Park7 acts as a positive regulator of NF­κB signaling (McNally et al. 2011).

Park7 is shown to suppress the phosphatase activity of PTEN (Phosphatase with tensin homology), one of the most frequently mutated tumor suppressor genes in human cancers (Guldberg et al. 1997). PTEN is a negative regulator of the phosphatidylinositol

31

3' kinase (PI3K)/AKT pathway (Kim et al. 2005a), which is an important pathway regulating the signaling of multiple biological processes such as apoptosis, metabolism, cell proliferation and cell growth (Morgensztern & McLeod 2005). The activation of

PI3K is initiated by the binding of the transmembrane tyrosine kinase linked receptors

(Hennessy et al. 2005). The activated PI3K phosphorylates phospholipid phosphatidylinositol­4, 5­bisphosphate (PIP2) to phosphatidylinositol­3, 4, 5­ trisphosphate (PIP3), which creates a lipid­binding site on the cell membrane for the recruitment of serine/threonine kinase AKT (protein kinase B). AKT is phosphorylated and activated by 3’­Phoshphoinositide­dependent protein kinase 1(PDK1). PTEN phosphatase activity catalyzes the reverse reaction of PIP3 back to PIP2, resulting in less activated AKT (Maehama & Dixon 1998) (see Figure 1.4 in section 1.6.1).

The suppression of Pten phosphatase activity by Park7 is supported by several gain­ of­function experiments. In Drosophila, Park7 rescues the reduced eye size caused by the over­expression of Pten (Kim et al. 2005a). This result is further confirmed in mammalian cells by observation of the increased cell survival in Park7 transfected Pten

(+/­) cells, but not in Pten (­/­) cells. In NIH­3T3 cells line, over­expression of Park7 reduces by 40 to 50% apoptosis in response to treatment with UV irradiation, sorbitol, or

TNF­α. A decrease in phosphorylation of AKT is seen in Park7 siRNA treated Pten (+/−) immortalized mouse embryonic fibroblasts, but not in Pten (­/­) cells, suggesting the function of Park7 requires the presence of Pten (Kim et al. 2005a). In primary breast cancer samples, Park7 expression correlates negatively with PTEN immunoreactivity and positively with AKT hyper­phosphorylation (Kim et al. 2005a). Since the phosphorylation levels of PTEN at Ser380, Thr382, Thr383 and Ser385 are equal in

32

Park7 transfected NIH3T3 cells (Kim et al. 2009), the inhibition of PTEN phosphatase activity by Park7 is not affected by phosphorylation of PTEN. The detailed mechanism on how PARK7 inhibits PTEN phosphatase activity is still remaining unclear. But studies have proposed that PARK7 can directly bind to PTEN to change its conformation to form a disulfide bond between C71 and C124 of PTEN upon oxidative stress and this form of

PTEN was considered to be inactive (Lee et al. 2002; Kwon et al. 2004; Kim et al. 2009).

It also has proposed that the interaction of PARK7 to PTEN may accelerate the oxidation of PTEN, thus rendering the PTEN function inactive (Kim et al. 2009).

The inhibition of PTEN function by Park7 makes it as a positive regulator in the

PI3K/AKT pathway. AKT signaling inactivates several proapoptotic factors including the proapoptotic protein (BAD) (Gu et al. 2004) , procaspase­9 (Cheng et al. 2006) and

Forkhead (FKHR) transcription factors (Abid et al. 2004), and it also activates transcription factors that up­regulate anti­apoptotic genes, including the cyclic­AMP response element binding protein (CREB) (Perkinton et al. 2002) and IκB kinase (IKK)

(Gustin et al. 2004). AKT­mediated activation of mTOR (the mammalian target of rapamycin, also known as FRAP1) is important in stimulating cell proliferation (Wendel et al. 2004). mTOR is a serine/threonine kinase that serves as a molecular sensor regulating protein synthesis on the basis of the availability of nutrients. It also has been shown as an important mediator in regulating skeletal muscle hypertrophy (Glass 2003b)

(see section 1.6.1).

33

1.6 Muscle Hypertrophy Pathways

The skeletal muscle growth during postnatal development reflects the balance between overall rates of protein synthesis and rates of protein degradation. Two major signaling pathways control the protein accretion: the PI3K/AKT pathway, acting as a positive regulator; and the myostatin­Smad2/3 pathway, acting as a negative regulator.

These two pathways are described in this section to provide the detailed mechanism on how Park7 induced myotube hypertrophy.

1.6.1 PI3K/AKT Pathway

The PI3K/AKT pathway has been extensively studied and well characterized due to its positive regulation on muscle growth (Bodine et al. 2001; Rommel et al. 2001; Glass

2003a; Stitt et al. 2004; Latres et al. 2005; Wilson & Rotwein 2007; Glass 2010;

Schiaffino et al. 2013). In live animals, the increases in muscle load stimulate the expression of insulin­like growth factor 1(IGF1) (DeVol et al. 1990). The role of IGF1 on muscle growth has been supported by a variety of evidences. Addition of the IGF1 into culture medium induces hypertrophy in C2C12 myotubes through enhanced activation of

AKT (Rommel et al. 2001). Muscle­specific over­expression of IGF1 causes muscle hypertrophy (Musaro et al. 2001), and conversely, muscle­specific inactivation of the

IGF1 receptors impair muscle growth due to the reduced muscle fiber number and size

(Mavalli et al. 2010). In mammals, IGF1 induces phosphorylation of the IGF1 receptor, a tyrosine kinase that directly activates the insulin receptor substrate (IRS) (Bohni et al.

1999) and PI3K (Leevers et al. 1996). The detailed description on how PI3K activates

AKT was described in section 1.5.5. It has also been well demonstrated that the activation of AKT is sufficient to induce hypertrophy. Over­expression of activated AKT

34 in muscle fibers results in significantly larger fiber size (Bodine et al. 2001; Pallafacchina et al. 2002). Transgenic mice expressing a constitutively active form of Akt in muscle exhibits rapid skeletal muscle hypertrophy (Lai et al. 2004). Conversely, genetic depletion of Akt in mice leads to smaller body size and shorter life span (Chen et al.

2001). AKT stimulates protein synthesis by activating mammalian target of rapamycin

(mTOR) and the downstream effectors of mTOR. The essential role of mTOR in muscle growth has been well established. Loss of mTOR in skeletal muscle leads to premature death and severe myopathy (Risson et al. 2009). Inhibition of mTOR by rapamycin blocks the adaptive hypertrophy in adult animals (Bodine et al. 2001) and suppresses muscle growth during postnatal development (Bodine 2006) and muscle regeneration

(Pallafacchina et al. 2002).

The activated mTOR further phosphorylates and activates p70S6 kinase (p70S6K) as well as releases the inhibitory effects of phosphorylated, heat and acid stable (PHAS)­

1⁄eukaryotic translation initiation factor 4E­binding (eIF4E­binding) protein 1 (4E­BP1) to promote protein synthesis. The activated p70S6K up­regulates the translational rates of mRNA in the ribosome and thus increases the total protein synthesis rates (Hornberger et al. 2007). The 4E­BP1, on the other hand, is a negative regulator of the protein initiation factor eIF4E. The activation of mTOR leads to hyperphosphorylation of 4E­BPs, resulting in dissociation of the 4E­BPs from eIF4E (Le Bacquer et al. 2007). Increased phosphorylation of eIF4E as well as its over­expression is associated with the stimulation of translation of mRNAs with highly structured 5’­untranslated regions (Kimball et al.

1999).

35

In addition to the mTOR pathway, the glycogen synthase kinase 3 beta (GSK3β) is a distinct substrate of AKT that can also modulate hypertrophy [for reviews see (Glass

2005)]. GSK3β is a ubiquitously expressed constitutively active serine/threonine kinase that phosphorylates cellular substrates, and thereby regulates a wide variety of cellular functions, including development, metabolism, gene transcription, and protein translation

(Hardt & Sadoshima 2002). GSK3β is a negative regulator in myotube hypertrophy.

Phosphorylation of AKT inhibits GSK3β activity (Cross et al. 1995). Profound myotube hypertrophy is observed in the dominant negative form of GSK3β expressed myotubes

(Rommel et al. 2001). GSK3β inhibits cardiac hypertrophy both in vivo and in vitro through blockage of protein translation initiated by the eIF2B protein (Hardt &

Sadoshima 2002). Furthermore, deficiency of GSK3β protein results in enhanced myotube formation and muscle­specific gene expression in both mouse embryonic fibroblasts and C2C12 myoblasts depending on the transcriptional regulator nuclear factor of activated T­cells c3 (NFATc3) (van der Velden et al. 2008).

PTEN negatively regulates AKT activity (see section 1.5.5). Thus the inhibition of

PTEN phosphatase activity by PARK7 positively regulates PI3K/AKT pathway, and in turn to modulate the activities of the downstream targets of AKT to enhance protein synthesis (Figure 1.4.).

36

Figure 1.4 Effects of PARK7 in PI3K/AKT Pathway. Factors that are inhibitory of protein synthesis are indicated in red and stimulatory factors are in blue. The activation of PI3K is initiated by the binding of IGF1 to its receptors. The activated PI3K phosphorylates phospholipid phosphatidylinositol­4, 5­bisphosphate (PIP2) to phosphatidylinositol­3, 4, 5­trisphosphate (PIP3), which creates a lipid­binding site on the cell membrane for the recruitment of serine/threonine kinase AKT (protein kinase B). AKT is phosphorylated and activated by 3’­Phoshphoinositide­dependent protein kinase 1(PDK1). PTEN catalyzes the reverse reaction of PIP3 back to PIP2, resulting in less activated AKT. PARK7 inhibits PTEN phosphatase activity and positively regulates AKT activity. Activated AKT phosphorylates mTOR and GSK3β to increase protein synthesis and thus leads to hypertrophy. Graph modified from (Glass 2005; Fleming­Waddell et al. 2009; Russell 2010)

37

1.6.2 Myostatin­Smad2/3 pathway

The myostatin­Smad2/3 pathway is described here since the callipyge sheep share several similar characteristics with myostatin mutant animals and the myostatin­Smad2/3 pathway interferes with the Akt­mTOR pathway (Trendelenburg et al. 2009).

Understanding the myostatin pathway helps to build the whole picture on the regulation of muscle growth.

Myostatin, also known as growth/differentiation factor 8 (GDF­8), is a member of the transforming growth factor β (TGFβ) super family. Myostatin is produced by skeletal muscle and acts as a negative regulator of muscle growth (McPherron & Lee 1997b).

Several animal models, including mice, cattle, dogs and sheep, demonstrate the increased muscle mass as a result of a variety of mutations in the myostatin gene (McPherron &

Lee 1997a; Girgenrath et al. 2005; McCroskery et al. 2005; Clop et al. 2006; Mosher et al. 2007). Muscle growth due to a myostatin mutation results in both hyperplasia and hypertrophy with 40% more fibers in each muscle as well as a 20 to 40% increase in fiber diameters in cattle (Kambadur et al. 1997; McPherron & Lee 1997a; Lee 2004). In addition to the hypertrophy, the myostatin knockout mice exhibit a larger proportion of fast, glycolytic fibers as well as a decrease in adiposity. These characteristics are similar to the callipyge phenotype (Pankratz et al. 2006). Purified myostatin inhibits protein synthesis and reduces myotube size when added to differentiated myotubes in culture further proves its negative effects in muscle growth (Taylor et al. 2001).

The myostatin signal initiates from the interaction and activation of a heterodimeric receptor complex with serine­threonine kinase activity. These receptor complexes are composed of a type II receptor, ACVR2 or ACVR2B, and a type I receptor, ALK4 or

38

ALK5 (Rebbapragada et al. 2003). The binding of myostatin to these receptor complexes results in the phosphorylation and the activation of the transcriptional factors, Smad2 and

Smad3, which translocate to the nucleus upon phosphorylation to form heterodimers with

Smad4 [for reviews see (Lee 2004)]. The detailed mechanism on how these complexes inhibit muscle growth is still unclear but many studies show that it interacts with the

AKT/mTOR pathway [for reviews see (Welle 2009)]. Myostatin reduces Akt phosphorylation both in human and mouse C2C12 myotubes (Trendelenburg et al. 2009).

Blockage of mTOR increases myostatin­induced phosphorylation of Smad2 and facilitates myostatin’s inhibition of muscle differentiation (Trendelenburg et al. 2009).

The muscle fiber atrophy induced by Smad2/3 activation is prevented by the presence of constitutively active Akt. Conversely, constitutively active Smad3 is also found to suppress mTOR activation (Sartori et al. 2009). The addition of IGF1 does not block

Smad2/3 transcriptional activity but nevertheless it can promote myotube hypertrophy when myostatin levels are high (Sartori et al. 2009). The precise cross­talk between these two pathways is still under study.

In addition, transcriptomic and proteomic analyses in quadriceps muscles in myostatin­null mice show elevated levels of PARK7 and phosphorylation of AKT (Chelh et al. 2009). This result is further proved by the same group in double­muscled cattle showing higher PARK7 expression in double­muscled fetuses compared to normal controls (Chelh et al. 2011). Since up­regulated PARK7 was reported in callipyge sheep as well (Fleming­Waddell et al. 2009), the combined results here suggest that PARK7 may be involved in the intersection of myostatin and PI3K/AKT pathway, and thus deserves further investigation.

39

1.7 Conclusion

Callipyge sheep is a unique model to study muscle growth since a small nucleotide mutation leads to the profound muscle hypertrophy in live animals. Understanding the genes network in callipyge muscle hypertrophy will enrich the notions on muscle metabolism, muscle fiber type switch, and muscular protein synthesis. Since DLK1 and / or RTL1 are examined as the primary causative genes, the identification of the secondary transcriptional responses genes becomes the research goals in several studies including the present one. In addition to the demonstration of callipyge phenotype and callipyge genes regulation, this literature review detailed described the function of PARK7, which is identified in previous study as a potential secondary response to DLK1 signaling , that may stimulate protein synthesis in muscles. PARK7 is a multi­functional protein and is involved in diverse biological processes. PARK7 occupies a pivotal position in cellular biology with the loss of function leads to the Parkinson’s disease and the gain of function results in the unregulated cell survival in human cancers. PARK7 acts through interaction with RNA and partner proteins to modulate the transcriptional activities and signaling pathways. The regulation of Park7 in muscle is explored in the present dissertation to elucidate the molecular mechanisms behind muscle hypertrophy in callipyge sheep.

40

CHAPTER 2. ASSAY VALIDATION

2.1 Introduction

Callipyge sheep have extreme muscling in their loin and hindquarters as a result of a genetic mutation located in the DLK1-DIO3 imprinted gene cluster (Freking et al. 2002;

Smit et al. 2003) This mutation up­regulates the expression of nearby genes through cis and these genes in turn to further alter the gene network in hypertrophied muscles

(Charlier et al. 2001a; Bidwell et al. 2004; Murphy et al. 2006; Perkins et al. 2006;

Fleming­Waddell et al. 2007). Several recent studies have been conducted to profile gene expression in callipyge sheep in order to understand the signals and pathways leading to the increased muscle mass (Fleming­Waddell et al. 2007; Vuocolo et al. 2007; Fleming­

Waddell et al. 2009). The overall aim of this dissertation is to identify the downstream genes that respond to DLK1 and / or RTL1 signaling and characterize their function in muscle growth. In order to achieve this aim, several experiments including quantitative

PCR, western blots, ELISA, in situ ELISA, gene clone, gene transfection, and luciferase assays have been conducted. This chapter covers the validation of assays used in this thesis to provide reliable experimental methods as well as lab protocols to perform the complete experiments.

41

2.2 Material and Methods

2.2.1 PARK7 Plasmid Construct

Full length PARK7 cDNA was first synthesized by reverse transcriptional PCR from total sheep RNA extraction using the following primers: F: 5’

CACCATGGCTTCAAAAAGAGCTCTAGT 3’ and R: 5’

ATCTTTAAGAACCAGCGG 3’. (CACC sequence was added into 5’ end of forward primer to construct directional TOPO cloning vector). Primers were designed based on the sequence from Bos taurus (GenBank accession number, NM_001015572). The PCR product was cloned into pENTR/SD/D­TOPO vector as instructed by manufacturer (Life

Technologies, Grand Island, NY USA). NotI and AscI enzymes were used to cut out the whole vector in order to identify the insertion. The insertion was confirmed by sequencing using T7_ZL primer (5’ GTAAAACGACGGCCAG 3’). To create an expression clone construct, the LR Recombination Reaction (Life Technologies) was performed to recombine pENTR­PARK7/SD/D­TOPO construct with pcDNA3.2/V5­

DEST vector (Life Technologies). The pcDNA3.2/V5­DEST vector contains V5 epitope tag allowing detection of the recombination fusion protein by recognizing the V5 tag. To confirm the insertion of PARK7, the expression construct was sequenced from both directions using the following primers; T7_ZL F: 5’ GTAAAACGACGGCCAG 3’ and

V5 reverse: 5’ ACCGAGGAGAGGGTTAGGGAT 3’.

2.2.2 C2C12 Cell Culture and Cell Transfection

C2C12 cells were cultured in Dulbecco’s modified Eagle’s medium (Life Technology) containing 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA USA), 100 units of penicillin, 100 µg of streptomycin, and 0. 292 mg/ml of L­glutamine. To valid

42 the expression of pPARK7­pcDNA3.2 /V5 construct, C2C12 cells were transfected using

FuGene 6 reagent (Roche Applied Science, Indianapolis, IN USA) according to the manufacturer’s instructions. pPARK7­pcDNA3.2 / V5 plasmids were transfected at a rate of 1 μg of plasmid DNA in 3×105 cells and seeded in 24­well plates with cover slides.

The transfected cells were cultured in growth medium without antibiotics on the first day of transfection and the regular growth medium was changed to the culture afterwards.

2.2.3 Optimizing Electroporation Condition

In order to optimize the electroporation conditions, C2C12 cells were transfected using Neon TM Transfection System (Life Technologies) according to the manufacturer’s recommended protocol. C2C12 cells (2 × 105 for 10 µL tips and 2 × 106 for 100 µL tips) were electroporated with green fluorescence protein (pGFP) (3 µg for 10 µL tips and 30

µg for 100 µL tips) construct at the indicated transfection condition (see Figure 2.3). The transfected cells were plated in one well of 6­well plate in the growth medium without antibiotics and normal medium was changed into culture afterwards. Cells were suspended in 2 days and count on BD Accuri™ C6 Flow Cytometry (BD Biosciences,

San Jose, CA USA). For each individual transfection, the total number of the cells transfected was same. The gated cells reflect the population of cells in the restricted gating area in the scatter plot. The same gating area was applied to every treatment. The transfection efficiency was calculated by the percentage of GFP positive cells to total gated cells.

2.2.4 Primary Myoblast Isolation and Culture

Primary myoblasts were isolated from hind limb skeletal muscles at 3­5 weeks of age.

Muscles were washed with Dulbecco’s Phosphate­Buffered Saline (DPBS), minced and

43 digested in type I collagenase and dispase B mixture (Roche Applied Science,

Indianapolis, IN USA). The digested muscle pulp was then filtered through a 100 µm filter (CellTrics®, Partec Inc., Swedesboro, NJ USA) to remove large muscle fiber debris and then plated on culture dishes. In 3 days, the cells together with the small debris were collected and digested with 0.025% trypsin for 10 minutes with agitation. Cells were seeded in growth media (F­10 Ham’s medium supplemented with 20 % fetal bovine serum, 100 units of penicillin, 100 µg of streptomycin,0. 292 mg/ml of L­glutamine, , and

4 ng/mL basic fibroblast growth factor) on rat­tail collagen (Roche Applied Science)­ coated dishes with preplating on non­coated plates for 45 minutes to deplete fibroblasts as previous described (Waddell et al. 2010; Liu et al. 2012).

2.2.5 Luciferase Assay

Primary myoblast from Park7 (+/+) and Park7 (­/­) mice were transfected using Neon

TM Transfection System (Life Technologies) according to the manufacturer’s recommended protocol. Myoblasts (2 × 105 cells) were electroporated with 3 µg of plasmid DNA consisting of 2.7 µg of pGL3IIB2.6 and 0.3 µg of pRL­SV40 (control) at three pulses of 1500 V for 10 ms. The transfected cells were plated into 96­ well plate in growth medium overnight and then fused into myotubes for 3 days with the indicated concentration (50 ng/mL, 100 ng/mL and 200 ng/mL) of long®R3 IGF1. The reporter assays were performed with Dual­Luciferase Reporter Assay System (Promega, Madison,

WI USA), according to the manufacturer’s recommendations. The samples were read at

Tecan Genios Pro (Tecan Group Ltd.) plate reader. Luciferase activity was adjusted for transfection efficiency by multiplying the firefly luciferase activity of a given well by the ratio of mean renilla luciferase activity for all wells divided by renilla luciferase activity

44 of the given well to produce units of adjusted luciferase activity. The results were analyzed for the genotype and IGF1 as the main effects by ANOVA using SAS 9.2 software.

2.2.6 Immunocytochemistry and Microscopy

C2C12 cells were transfected as described method and cultured in a 24­well plate with cover slides for 48 hours. Cells were fixed in 4 % formaldehyde and permeabilized in 0.5 % Triton X­100. Cells were blocked in 1 % bovine serum albumin (BSA) in PBS for 1 hour at room temperature and stained with primary antibody with a dilution of

1:200 for 2 hours. The primary antibodies used in this experiment were goat anti­PARK7 antibody (Santa Cruz Biotechnology) and mouse anti­V5 antibody (Life Technology).

Cells were then washed with PBS, and incubated with secondary antibodies with a dilution of 1:1000 for 1 hour. The secondary antibodies used in the experiments were

Alexa Fluor 488­conjugated donkey anti­Goat IgG secondary antibody (Life Technology) and Alexa Fluor 594­conjugated donkey anti­mouse IgG secondary antibody (Life

Technologies). Finally, cells were mounted with Prolong Gold antifade reagent with

DAPI (Life Technologies). The IP Lab software (Scanalytics Inc., Madison, WI USA) and Leica DM6000 microscope were used to acquire pictures.

2.3 Results and Discussion

2.3.1 Validation of the pPARK7­pcDNA3.2 Construct

Full length PARK7 cDNA was synthesis from total sheep RNA extraction using primers designed from Bos taurus sequence (GenBank accession number,

NM_001015572) due to the unavailability of sheep PARK7 gene sequence. The forward

PCR primer contained the sequence, CACC, at the 5’end of the primer, matching the

45 overhang sequence GTGG in pENTR™ TOPO® vector allowing directly cloning the entire gene to the entry clone vector. The full length of PARK7 open reading frame is

570bp. In order to fuse PARK7 protein in frame with a C­terminal tag, the reverse PCR primer was designed without the stop codon. The PARK7 cDNA was cloned into entry vector first (pENTR™ TOPO®) and then subcloned into pcDNA3.2/V5­DEST vector for expression in mammalian cells. The illustration of PARK7 expression construct

(pPARK7­pcDNA3.2 /V5) was shown in Figure 2.1. The human cytomegalovirus immediate­early (CMV) promoter drove the high­level expression of PARK7 and the fusion of the V5 epitope tag allows the detection using anti­V5 antibodies. The detailed description of this vector can be found on the website

(http://www.lifetechnologies.com/us/en/home.html).

In order to examine the ectopic expression of PARK7 gene in mammalian cells,

C2C12 cells were transfected with pPARK7­pcDNA3.2 /V5 construct and detected using anti­PARK7 and anti­V5 antibodies (Figure 2.2). The cells stained with anti­PARK7 antibody (green) can also be detected with anti­V5 antibody (red), suggesting the effectiveness of pPARK7­pcDNA3.2 /V5 construct. PARK7 was mostly localized in cytoplasm, however, the nucleus localization was also detected (Figure 2.2). This result was in consistent with previous studies which also demonstrated the nucleus, cytoplasm and mitochondrial localization of Park7 (Nagakubo et al. 1997; Junn et al. 2009). The subcellular compartmentalization of Park7 is important to its cytoprotective activity. A study reported that the oxidative stress drives the translocation of Park7 from cytoplasm to mitochondrial and nucleus whereas under basal conditions Park7 is present mostly in the cytoplasm and to a lesser extent in mitochondria and nucleus (Junn et al. 2009).

46

2.3.2 Optimization of Electroporation Conditions

To accurately optimize the transfection conditions, the green fluorescence protein

(GFP) construct was transfected into cells and counted through the flow­cytometry. The start condition was based on the manufacture’s instruction. A combined consideration of transfection efficiency and cell viability was taken to determine the best transfection condition. The NeonTM transfection system provides two sizes of tips that fits two volumes of cells, 10 µL for 2×105 (Figure 2.3) and 100 uL for 2×106 (Figure 2.4). The non­transfected cells were used as controls to define the gated cells area and the non­ fluorescence cells graphic area (Figure 2.3 A, B and Figure 2.4 A, B). The same gating areas were applied to each treatment. The condition for the 10 µL tip was first examined.

The input pulse width and pulse number were maintained the same, however, an increase of voltage results in higher transfection efficiency. There are 63.6 % of GFP positive cells at the condition of 1800V, 10ms and 3 pulses (Figure 2.3 E and F); however, the cell population that counted in this treatment and the observed cell viability is much lower than at the condition of 1650V, 10ms and 3 pulses with 60.2 % GFP positive cells (Figure

2.3 C and D). Therefore, the optimized condition for transfection of 2×105 cells using 10

µL tips was at 1650 V, 10ms and 3 pulses. The conditions titrated in this study was given in Table 2.1A. Based on the optimized condition for 10 µL tips, the starting voltage for testing conditions using 100 µL tips was determined at 1500V and 1650V. Different input pulse width and pulse number were examined in this assay. Interestingly, the optimal transfection condition was still at 1650V, 10ms and 3 pulses, where 81.2 % cells were GFP positive (Figure 2.4 C and D). The condition of 1650V, 20ms and 2 pulses gave the worst transfection efficiency of 22.2% (Figure 2.4 E and F). The entire condition

47 titrated in this study was given in Table 2.1B. These results suggested that over 50 % of the cells can be transfected by NeonTM transfection system and the high transfection efficiency supported the feasibility of luciferase assay.

2.3.3 Titration of IGF1 concentrations

One objective of current study was to investigate the effects of PARK7 in muscle growth and protein accretion in response to IGF1 (see Chapter 4). Herein, the Long®R3

IGF1, whose effects was determined to induce myotube hypertrophy (Rommel et al.

2001), was introduced to this study. The effectiveness of IGF1 was also examined in the current study by observation of the myotube size. C2C12 cells were fused into myotubes for 6 days with the additional of indicated concentration of IGF1 for the last 4 days.

Additional of IGF1 led to observed more and larger sizes of myotubes (Figure 2.5B and

C) compared to no addition of IGF1 (Figure 2.5A). Here, we concluded that the

Long®R3 IGF1 enhanced myoblast differentiation.

PARK7 was identified as a secondary effector gene in DLK1 and RTL1 (primary inducers) induced muscle hypertrophy in the current study (see Chapter 3). Since the hypertrophied muscles in callipyge sheep have a greater proportion of fast­twitch, glycolytic muscle fibers and a marked reduction in mRNA levels of Myh4 was detected in the Dlk1knockout mice (Waddell et al. 2010), the effects of PARK7 on regulation of myosin heavy chain 4 (Myh4) promoter luciferase activity was examined to determine whether it is a component of DLK1 regulation of muscle fiber type switch. Different concentrations of IGF1 were titrated here to determine the optimal treatment that can induce significant differences between Park7 wildtype (+/+) and knockout (­/­) cells

48

(Figure 2.6). The statistical analysis suggested that in the presence of PARK7, Myh4 luciferase activity was significantly elevated by 7% (P<0.0001). IGF1 treatments also increased Myh4 luciferase activity by 30 % (P<0.0001). A significant interaction effects was also detected (P=0.0122). Specifically, a 36 % increase was detected in the Park7

(+/+) myotubes at IGF1 concentration of 100 ng/mL and further increase of IGF1 concentration to 200 ng/mL does not change this magnitude. No significant differences were observed in other lower IGF1 concentrations (12.5, 25 and 50 ng/mL). Therefore, a higher concentration of IGF1 (100 ng/mL or 200 ng / mL) was used in the future luciferase assays to explore the effects of over­expression of Park7 on the Myh4 luciferase activity (see chapter 3).

49

Figure 2.1 Illustration of pPARK7­pcDNA3.2 Construct. Full length PARK7 cDNA was amplified by reverse transcriptional PCR from total sheep RNA extraction, first cloned to pENTR/SD/D­TOPO vector and subcloned to pcDNA3.2 /V5­DEST vector. The CMV promoter drives the expression of PARK7 gene. The V5 epitope tag was fused with PARK7 and co­expressed with PARK7.

50

Figure 2.2 Validation of the Expression of pPARK7-pcDNA3.2 Construct. C2C12 cells were transfected with pPARK7-pcDNA3.2 /V5 construct and stained with anti-PARK7 (green), anti-V5 epitope tag (red) and DAPI (nuclei, blue). The merged cells (orange) showed the detection of the same cells by anti-PARK7 and anti-V5 antibodies. PARK7 localized both in the cytoplasm and nucleus in C2C12 cells.

51

Figure 2.3 Optimizing Transfection Conditions Using 10 µL tips in NeonTM system. C2C12 cells were transfected with GFP and counted through BD Accuri™ C6 Flow Cytometry. The total number of the cells transfected was same. Forward-scattered light (FSC) is proportional to cell-surface area or size aand side-scattered light (SSC) is proportional to cell granularity or internal complexity. The FL1 reflect the fluorochromes detected. A: Non-transfected cells (control). The population of cells in the restricted circle area (67.2%) is the gated cells and it reflected the graphical boundary that can be used to define the characteristics of particles to include for further analysis. The same gating area was applied to each treatment. B: None of the cells has fluorescence labeled. The circled area indicated the cells without fluorescence and the rest lined open area indicated the population of cells labeled with fluorescence. C and D: At the condition of 1650V, 10ms and 3 pulses, 48.8% of the total cells were used to calculate a 60.2% of transfected cells. E and F: At the condition of 1950V, 10ms and 3 pulses, only 14.3% of the total cells were used to calculate a 52.9% of trransfected cells.

52

Figure 2.4 Optimizing Transfection Conditions Using 100 µL tips in NeonTM systemm. C2C12 cells were transfected with GFP and counted through BD Accuri™ C6 Flow Cytometry. The total number of the cells transfected was same. Forward-scattered light (FSC) is proportional to cell-surface area or size aand side-scattered light (SSC) is proportional to cell granularity or internal complexity. The FL1 reflect the fluorochromes detected. A: Non-transfected cells (control). The population of cells in the restricted circle area (72.3%) is the gated cells and it reflected the graphical boundary that can be used to define the characteristics of particles to include for further analysis. The same gating area was applied to each treatment. B: None of the cells has fluorescence labeled. The circled area indicated the cells without fluorescence and the rest lined open area indicated the population of cells labeled with fluorescence. C and D: At the condition of 1650V, 10ms and 3 pulses, 69.2% of the total cells were used to calculate an 81.2% of transfected cells. E and F: At the condition of 1650V, 20ms and 2 pulses, only 17.8% of the total cells were used to calculate a 22.2% of trransfected cells.

53

A

Condition Transfection Efficiency Gated Cells

Non-Transfection 0 % 67.2%

1500V 10ms 3 pulse 49.5% 64.4%

1650V 10ms 3 pulse 60.2 % 48.8%

1800V 10ms 3pulse 63.6% 15.9%

1950V 10ms 3pulse 52.9% 14.3%

B

Condition Transfection Efficiency Gated Cells

Non-Transfection 0 % 72.3%

1500V 10ms 3pulse 66.3% 67.7%

1500V 30ms 1 pulse 62.3% 69.0%

1500V 20ms 2pulse 69.4% 42.4%

1650V 10ms 3pulse 81.2% 69.2%

1650V 30ms 1 pulse 65.9% 42.2%

1650V 20ms 2pulse 22.1% 17.8%

Table 2.1 Summary of the Transfection Efficiency. C2C12 cells were transfected with GFP and counted through BD Accuri™ C6 Flow Cytometry. The total number of the cells transfected was same. The gated cells reflect the population of cells in the restricted gating area in the scatter plot. The same gating area was applied to every treatment. The transfection efficiency was calculated by the percentage of GFP positive cells to total gated cells. A: C2C12 cells were transfected with 10 µL Neon tips with 3 µg plasmids in 2 × 105 cells per tip and B: C2C12 cells were transfected with 100 µL Neon tips with 30 µg plasmids in 2 × 106 cells per tip.

54

Figure 2.5 Validation of Long®R3 IGF1. C2C12 cells were seeded on 24-well plate and fuused into myotubes. Long®R3 IGF1 was added to the fusion medium 2 days after differentiation. Myotubes were stained with an antibody for total myosin heavy chain (green: MF20) and DNA (blue: DAPI). Different concentrations of IGF1 were tested with A: no IGF1 treatment; B: 10 ng/mL; and C: 40 ng/mL. Additional of IGF1 enhanced myoblast differentiation.

12000 -/- ** ** Effect P-Value 10000 +/+ Genotype <0.0001 IIGF1 0.0002 8000 IIGF1*Genotype 0.0122

6000

4000

2000 Adjusted Luciferase Activity Luciferase Adjusted

0 0.0 12.5 25.0 50.0 100.0 200.0 IGF1 Concentration (ng / mL)

Figure 2.6 Titration of IGF1 Concentrations. The Park7 (+/+) myotubes had a significantly higher Myh4 luciferase activity than Park7 (-/-) myotubes at IGF1 concentration of 100 ng/mL and 200 ng/mL. Adjusted luciferase activity was calculated by multiplying the renilla luciferase activity for all wells by the ratio between firefly and renilla luciferase activity of a given well. **P < 0.01, values significantly different from Park7 (+/+) myotubes and Park7 (-/-) myotuubbes with each IGF1 treatment.

55

CHAPTER 3. IDENTIFICATION OF GENES DIRECTLY RESPOND TO DLK1 SIGNALING IN CALLIPYGE SHEEP

3.1 Abstract

Callipyge sheep are an excellent model to study genes regulation in muscle growth since the up-regulation of DLK1 and RTL1 results in extreme postnatal muscle hypertrophy. Gene expression analysis was conducted in four hypertrophied and three non-hypertrophied muscles to distinguish the genes that directly respond to DLK1 signaling from the muscle specific effects of hypertrophy. The quantitative PCR results suggested that DLK1 expression was significantly increased in the 4 hypertrophied muscles but not in the 3 non-hypertrophied muscles. However, RTL1 was up-regulated in both hypertrophied and non-hypertrophied muscles, which reinforced DLK1 as the primary inducer for callipyge phenotype and also indicated that RTL1 alone is not sufficient to induce muscle hypertrophy. Five genes, including PARK7, DNTTIP1,

SLC22A3, METTL21E and PDE4D, were consistently co-expressed with DLK1, and therefore have the potential to be the transcriptional target genes responding to DLK1 signaling. The expression of DNTTIP1, METTL21E and PARK7 were examined for their effects on Myosin Heavy Chain (MYH) promoter activity using luciferase assays. The results showed that both PARK7 and DNTTIP1 increased MYH4 and decreased MYH7 promoter activity, similar to the effects of DLK1. In contrast, expression of METTL21E increased MYH7 and decreased MYH4 luciferase activity. Treatment of myoblast and

56 myotubes with DLK1 induced a 1.6-fold and a 2-fold increase in DNTTIP1 expression.

The expression of MYH4 also increased in DLK1-treated myotubes, however, no significant difference was found in PARK7 expression. This suggests that DNTTIP1 was a secondary effector gene responding to DLK1 signaling.

Keywords: DLK1, RTL1, skeletal muscle, hypertrophy, callipyge sheep

57

3.2 Introduction

Callipyge sheep are well known for their postnatal muscle hypertrophy that is prominent in loin and hind quarters (Koohmaraie et al. 1995; Jackson et al. 1997c;

Duckett et al. 2000). The muscle mass in callipyge sheep is increased 35-40 % and carcass fat is decreased 6-7 % but the live weights were the same relative to normal lambs (Jackson et al. 1997a; Jackson et al. 1997b, c; Freking et al. 1998b). Callipyge lambs are born with normal muscling and hypertrophy becomes detectable at 4-6 weeks of age (Jackson et al. 1997a; Carpenter & Cockett 2000; Duckett et al. 2000; Lorenzen et al. 2000). After 5 weeks of age, an increased proportion and larger size of fast-twitch, glycolytic muscle fibers were found in callipyge muscles (Carpenter et al. 1996;

Carpenter & Cockett 2000). Not all the skeletal muscles in callipyge sheep develop hypertrophy, the supraspinatus and infraspinatus muscles in thoracic limb are two muscles that do not undergo hypertrophy (Koohmaraie et al. 1995; Jackson et al. 1997b;

Freking et al. 1998b).

The callipyge mutation is a single base change of an A (wild-type allele) to a G

(callipyge allele) between DLK1 (Delta-Like homolog 1) and MEG3 (Maternal Expressed

Gene 3) genes in the DLK1-DIO3 (Deiodinase, Iodothyronine, type III) imprinted gene cluster (Freking et al. 2002; Smit et al. 2003). The callipyge mutation did not disrupt any protein coding sequence. However, several studies have shown that the highly conserved

12 bp sequence including the mutation acts as a long-range control element to alter the transcription of the surrounding imprinted genes in cis. Specifically, the inheritance of a callipyge allele from the sire up-regulates the transcription of paternal protein-coding genes DLK1 and RTL1 (Retrotransposon-like 1), while the inheritance of a maternal

58 callipyge allele enhances the expression of maternal non-coding RNA including MEG3,

MEG8 (Maternal Expressed Gene 8) and RTL1AS (RTL1 antisense)(Bidwell et al. 2001;

Charlier et al. 2001a; Bidwell et al. 2004; Perkins et al. 2006).

Dlk1 encodes a transmembrane protein belonging to the epidermal growth factor

(EGF)-like repeat containing family. This family includes proteins such as the Notch receptors and their ligands including Delta-like (Dll1, Dll3 and Dll4) and Serrate

(Jagged)-like (Jagged1 and Jagged2) ligands (Laborda et al. 1993; Smas 1993; Jensen et al. 1994a; Okamoto et al. 1998). Unlike Delta and Serrate, Dlk1 lacks the critical

Delta/Serrate/Lag-2 (DSL) domain at its N-terminus. Therefore, Dlk1 is thought to interact with the Notch receptors through its EGF repeats as an antagonist and down- regulates Notch signaling (Baladron et al. 2005; Bray et al. 2008). The Notch signaling is a conserved cell fate regulator and is known to inhibit myogenic regulatory transcription factor MyoD expression and myogenic differentiation, but enhances satellite cell proliferation and self-renewal (Nofziger et al. 1999; Wen et al. 2012). Several studies indicate that DLK1 expression can influence postnatal muscle growth. Transgenic mice over-expressing Dlk1 caused increased muscle mass and myofiber diameter (Davis et al.

2004). Muscle-specific gene ablation of Dlk1 in the mouse resulted in reduced body weight and skeletal muscle mass due to reductions in myofiber numbers (Waddell et al.

2010). Conversely, over-expression of Dlk1 in cell culture was shown to inhibit myoblast proliferation and enhanced differentiation (Waddell et al. 2010). DLK1 mRNA was up- regulated in longissimus dorsi, gluteus medius and semimembranosus, the hypertrophied muscles in callipyge lambs but not up-regulated in supraspinatus, the non-hypertrophied muscle (Bidwell et al. 2004; Perkins et al. 2006; Fleming-Waddell et al. 2007; Fleming-

59

Waddell et al. 2009). The DLK1 protein was expressed at high levels observed in the myofibers of callipyge longissimus dorsi and semimembranosus but was not detected in normal muscles (White et al. 2008).

Similar to DLK1, the mRNA abundance of RTL1 is also increased in the calipyge muscles. RTL1 belongs to Ty3-Gypsy retrotransposons gene family and contains gag-pol- like structure common to retroviruses (Charlier et al. 2001b). This highly conserved gene only has one single exon and encodes a full length 151 kDa protein in skeletal muscles

(Byrne et al. 2010). In the mouse, Rtl1 is highly expressed at the late-fetal stage in both the fetus and placenta and the loss or over-expression of Rtl1 cause late-fetal and / or neonatal lethality (Sekita et al. 2008). In callipyge sheep, the up-regulation of RTL1 is not specific to hypertrophied muscles, a lower magnitude of induction of RTL1 in the non- hypertrophied muscle (supraspinatus) was detected (Bidwell et al. 2004), suggesting

RTL1 alone is not sufficient to induce muscle hypertrophy. These combined studies suggest that elevated DLK1 expression is the primary cause of callipyge muscle hypertrophy. Since the biological activity of RTL1 in muscles is not well understood, a synergistic effect with DLK1 has not been ruled out.

MEG3, MEG8, and RTL1AS are all non-coding RNA that are transcribed from the maternal chromosome. MEG3 was recently proposed to possess tumor suppressor properties (Zhou et al. 2012; Balik et al. 2013). MEG8 was located in embryonic brain and muscles (Gu et al. 2012) but the function of MEG8 is still unclear. RTL1AS contains at least four microRNA that was identified for RISC-mediated degradation of RTL1 transcripts (Seitz et al. 2003b; Davis et al. 2005).

60

Several studies were conducted to identify the downstream target genes responding to the over-expression of DLK1 and RTL1 in callipyge animals (Fleming-Waddell et al.

2007; Vuocolo et al. 2007; Fleming-Waddell et al. 2009). Microarray analysis of gene expression in the semimembranosus identified 375 genes that were differentially expressed in callipyge versus normal lambs (Fleming-Waddell et al. 2009). Twenty-five transcripts were further verified by quantitative PCR in 2 hypertrophied muscles

(semimembranosus and longissimus dorsi) and one non-hypertrophied muscle

(supraspinatus). It has been assumed that among these 25 transcripts, there are direct targets of DLK1 signalings and tertiary responses to hypertrophy. Therefore, gene expression analysis using 4 hypertrophied muscles longissimus dorsi, semimembranosus, semitendinosus and triceps brachii and 3 non-hypertrophied muscles supraspinatus, infraspinatus and heart was conducted in the current study to distinguish the genes that directly respond to DLK1 signaling from tertiary effects of hypertrophy. These direct targets are defined as the physiological directly respond to DLK1 signaling rather than a direct binding partner of DLK1, and these genes would expect to have a similar mRNA expression pattern as DLK1 in all the muscles examined. Whereas the tertiary response genes are assumed as the genes that indirectly respond to DLK1 signaling and thus could have different expression levels in one or several muscles. These tertiary response genes could be associated with many bioactivities such as protein accretion, myofiber type and metabolic changes. Since the hypertrophied muscles have a fiber type proportions shift to a greater number of fast-twitch, glycolytic muscle fibers expressing MYH4, the MYH4 is an appropriate indicator of the tertiary responses. Therefore, the MYH4 luciferase reporter

61 assay was conducted to explore the potential components on DLK1 regulation of MYH4 expression.

3.3 Materials and Methods

3.3.1 Sample Collection

Matings between a ram that was heterozygous for the callipyge allele and a group of normal ewes were used to generate a cohort of callipyge and normal lambs. The lambs were genotyped to detect the callipyge SNP and sampled at 30-35 days of age following protocols approved by Purdue University Animal Care and Use Committee. Seven muscles including (longissimus dorsi, semimembranosus, semitendinosus, triceps brachi, supraspinatus, infraspinatus, and heart) were weighed and sampled as described

(Fleming-Waddell et al. 2007; Fleming-Waddell et al. 2009) . Muscle RNA was isolated according to the methods described previously (Fleming-Waddell et al. 2007).

3.3.2 Primary Myoblast Isolation and Culture

Primary myoblasts were isolated from hind limb skeletal muscles of mice at 3-5 weeks of age. Muscles were washed with Dulbecco’s Phosphate-Buffered Saline (DPBS), minced and digested in type I collagenase and dispase B mixture (Roche Applied Science,

Indianapolis, IN USA). The digested muscle pulp was then filtered through a 100 µm filter (CellTrics®, Partec Inc., Swedesboro, NJ USA) to remove large muscle fiber debris and then plated on collagen-coated dishes. After 3 days, the cells together with the small debris were collected and digested with 0.025% trypsin for 10 mins with agitation. Cells were seeded in growth media (F-10 Ham’s medium supplemented with 20 % fetal bovine serum, 100 units/mL of penicillin, 100 µg/mL of streptomycin,0. 292 mg/ml of L- glutamine, and 4 ng/mL basic fibroblast growth factor) on non-coated plates for 45 mins

62 to deplete fibroblasts as previous described (Waddell et al. 2010; Liu et al. 2012) and then transferred to collagen (Roche Applied Science)-coated dishes. Myoblasts were differentiated into myotubes after plating cells at approximately 80% confluency on

Matrigel (BD Biosciences, San Jose, CA USA) coated plates and the addition of fusion media consisting of DMEM supplemented with 5 % horse serum, 100 units/mL of penicillin, 100 µg/mL of streptomycin, and 0. 292 mg/ml of L-glutamine. Myoblast cultures testing the effects of DLK1 ligand were plated on a bed of 1 mg/mL BD Matrigel containing 500 ng/mL of recombinant DLK1 protein [DLK1 (mouse): Fc(human),

Adipogen International Inc., San Diego CA USA]. Cells were induced to differentiate the next day and fused for 2 days before mRNA isolation.

3.3.3 Quantitative PCR Analysis

Complimentary DNA (cDNA) synthesis for measuring RTL1 transcript abundance used gene-specific priming of 5 µg total RNA and Superscript III reverse transcriptase at

50 ℃ (Life Technology). The cDNA synthesis for other transcripts used random hexamer priming from 5 µg RNA and MMLV reverse transcriptase. The first strand cDNA synthesis reaction was diluted 25-fold so that there was an equivalent of 20 ng of input

RNA per microliter. Quantitative PCR assays were carried out in 15-µL reaction volumes of iQ SYBR Green Supermix with cDNA equivalent to 100 ng of input RNA. All cDNA samples were assayed in duplicate. Absolute quantification was used to measure gene expression in sheep muscle RNA. The quantitative PCR primers and the plasmid standards were designed and tested according to the methods described previously

(Fleming-Waddell et al. 2009). Primer sequences were listed in Supplement Table 1.

Cloned amplicons were used as standards to calculate a regression of threshold cycle on

63 molecule copy number to determine a log value of starting abundance for each of the cDNA samples based on their threshold cycle (Bidwell et al. 2004). All plasmid standards were diluted from either 108 to 102 or 107 to 101 molecules. Quantitative PCR reactions for standards were performed in triplicate. The variance analysis was performed using SAS 9.2 software and the MIXED procedure was used to analyze the log value of gene expression. Genotype was the main effect in the model and each muscle was analyzed individually. The random effect was defined as animal nested within genotype.

The least squares means; standard error and difference between least squares means were calculated for the variance analysis.

Relative quantification was used to measure gene expression in DLK-treated myoblast experiments. RNA from cultured myotubes was extracted and purified using

Nucleo Spin RNA II columns (Machery-Nagel Inc., Easton, PA USA) with DNase I treatment. First strand cDNA was synthesized from RNA using random hexamer and oligo dT priming and MMLV (Life Technologies). Quantitative PCR measurements were performed using the SA Bioscience SYBR Green Supermix (QIAGEN, Valencia, CA

USA) reagents on an iCycler Real-Time PCR Detection System (Bio-Rad Inc.). Each reaction was carried out in 15 µl reaction volumes of SA Bioscience SYBR Green

Supermix with 5 pM of each primer and diluted first-strand cDNA. Primer sequences were listed in Supplement Table S1. Ribosomal protein large protein 38 (Rplp38) was used as the housekeeping gene control for ΔCT calculation [ΔCT = (CT of the target gene)

- – (average CT of housekeeping genes)]. Fold expression values were calculated using 2

ΔΔCT methods (Livak & Schmittgen 2001), where ΔΔCT = (ΔCT of the treatment sample)

– (ΔCT of control treatment samples) with no added DLK1 as control treatment and

64 normalized to 1. Statistical significance was determined by Analysis of Variance

(ANOVA) method.

3.3.4 Plasmid Construction

Full length DNTTIP1, METTL21E and PARK7 cDNA were amplified by reverse transcription PCR from total sheep RNA and directionally cloned into pENTR/SD/D-

TOPO vector (Life Technologies, Grand Island, NY USA) and then subcloned by recombination into the pcDNA3.2/V5-DEST expression vector (Life Technologies) according to the manufacturer’s recommendations. The mouse pDLK1-pCMV-SPORT

6.1 plasmid was commercial available (cat#: MMM1013-9201636, Thermo Fisher

Scientific Inc., PA USA). To confirm the insertion of the target genes with an intact open reading frame, all plasmids were sequenced from both directions. The pGWCAT- pcDNA3.2 /V5 control plasmid was obtained from Life Technologies.

The mouse Myh4 luciferase construct (pGL3IIB2.6) containing 2.56 kb of the promoter region of Myh4 was kindly provided by Dr. Swoap (Swoap 1998). The rat Myh7 luciferase construct (p-3542β-MHCluc), containing 3.5 kb of the promoter of Myh7, was obtained from Dr.Hasegawa (Hasegawa et al. 1997). The pRL-SV40 plasmid expressing renilla luciferase was commercial available at Promega Corporation. Plasmids for electroporation were purified using EndoFree Plasmid Maxi Kit (QIAGEN) and quantified by Nanodrop spectrophotometry (Thermo Fisher Scientific Inc, Rockford, IL

USA).

3.3.5 Luciferase Reporter Assay

Neon TM Transfection System (Life Technologies) was used according to the manufacturer’s recommended protocol. Myoblasts (2 × 105 cells) were electroporated

65 with 3 µg of plasmid DNA with three pulses 10 msec pulses of 1500V. To determine if these target genes could have effects on myosin gene expression, the effector experiments were done by co-transfection of protein coding sequence of the target genes along with the myosin luciferase reporter construct. The myosin luciferase reporter construct and the transfection control (renilla) were kept constant first, and the two different amounts of effector cDNA were titrated. In order to keep a constant amount of the total plasmid

DNA, the GW-CAT was added and also used as the null control vector. A detailed description of the plasmid combinations were given in Supplementary Table A4. The electroporated cells were put into 96-well plates in growth media overnight and subsequently fused into myotubes for 3 days. In PARK7 luciferase experiments, the indicated concentrations of IGF1 (50, 100, and 200 ng / mL) (long®R3 IGF1, Sigma-

Aldrich Co, St Louis, MO USA) were added to the fusion medium 24 hours after differentiation and cultured for another 48 hours. The reporter assays were performed with Dual-Luciferase Reporter Assay System (Promega, Madison, WI USA), according to the manufacturer’s recommendations. The samples were read with a Tecan Genios Pro

(Tecan Group Ltd.) plate reader. Luciferase activity was adjusted for transfection efficiency by multiplying the firefly luciferase activity of a given well by the ratio of mean renilla luciferase activity for all wells divided by renilla luciferase activity of the given well to produce units of adjusted luciferase activity. The results were analyzed for the addition of target construct as the main effect by ANOVA using SAS 9.2 software.

The IGF1 treatment was also considered as a main effect when analyzing PARK7 luciferase assay.

66

3.4 Results

3.4.1 Phenotypic Data Analysis

Animal birth weights and live weights were collected and statistical analysis (Figure

3.1) showed that there were no significant differences in birth weight and live weight between callipyge (+/C) and normal lambs (+/+). The callipyge lambs have significantly heavier longissimus dorsi, semimembranosus, semitendinosus and triceps brachi, ranging from 23 % to 17 % more relative to normal muscles (Figure 3.1), thus these 4 muscles are referred to “hypertrophied muscles” in this study. No significant differences were detected in supraspinatus, infraspinatus, and heart; herein these are “non-hypertrophied muscles”. These results verified the muscle specific hypertrophy in the experimental samples.

3.4.2 Muscle Specific Gene Expression

The mRNA abundance of the 25 differentially expressed transcripts from the previous study (Fleming-Waddell et al. 2009) were assayed by quantitative PCR. To investigate the shift of myosin heavy chain isoforms in callipyge animals, the four myosin heavy chain genes [MYOSIN HEAVY CHAIN 4 (MYH4), MYOSIN HEAVY CHAIN 7 (MYH7),

MYOSIN HEAVY CHAIN 2 (MYH2) and MYOSIN HEAVY CHAIN 1 (MYH1)] were also examined in this study. The complete set of primers for all genes analyzed by quantitative

PCR and PCR conditions was given in supplementary Table A1 and the least square mean with standard errors was given in supplementary Table A2. The differential expression of these genes with corresponding p-values was given in supplementary Table

A3.

67

The expression of Ribosomal protein, large P0 (RPLP0) was used as a control gene.

RPLP0 expression was not significantly different in the two genotypes in all the 7 muscles (Figure 3.2), which is an indication that equivalent amounts of RNA were used for cDNA synthesis and for quantitative PCR. The callipyge mutation affected the genes expression at DLK1-DIO3 locus (Figure 3.3). Compared to normal lambs, the expression of DLK1 was significantly elevated in hypertrophied muscles with semimembranosus having the largest magnitude of increase; and triceps brachi had the smallest increase.

There were no significant differences in supraspinatus, infraspinatus and heart (Figure

3.3A). The expression pattern of RTL1 was different from DLK1. Normal lambs had extremely low RTL1 expression in longissimus dorsi , semitendinosus, triceps brachi and supraspinatus with average log value is 1.14, and its expression level was barely detectable in semimembranosus, infraspinatus and heart with average log value is less than 1 (Figure 3.3B). The expression of RTL1 was significantly increased in callipyge lambs in all the assayed muscles with an average log value for RTL1 was 4.6. The expression patterns of MEG3 and MEG8 were quite similar. Both of their expression levels were significantly elevated in the hypertrophied muscles (Figure 3.3D). The callipyge lambs also had a significantly elevated MEG3 expression (4-fold, P=0.0323) in supraspinatus. There was a trend (P=0.0678) for MEG8 to express differentially in supraspinatus (Figure 3.3C). The expression patterns of these imprinted genes in DLK1-

DIO3 locus were consistent with the previous reports (Bidwell et al. 2004; Perkins et al.

2006).

The expression of several myosin isoforms were examined as markers of the muscle hypertrophy response. The differential expression of myosin isoforms show the

68 established fiber type changes in callipyge muscle. Previous studies reported significant and strong up-regulation of muscle genes characteristic of type IIb (MYH4) and down- regulation of genes characteristic of type IIa fibers (fast oxidative/glycolytic) (MYH2) and type 1 fibers (slow oxidative) (MYH7) in hypertrophied muscles (Vuocolo et al.

2007). The present study confirmed this phenotype by examination of a 60-fold increase in MYH4 expression in the hypertrophied muscles (Figure 3.4A). MYH1 is the most abundant myosin isoform measured in the skeletal muscles and its mRNA abundance was significantly elevated in semimembranosus by 2.5-fold (Figure 3.4B). MYH2, which is characteristic of an intermediate fiber type between fast and slow fibers, was relatively unchanged in triceps brachi (2.5-fold) but down-regulated in other hypertrophied muscles with longissimus dorsi has the largest magnitude at 0.125-fold (Figure 3.4C).

The mRNA abundance of MYH7 was only down-regulated in semimembranosus with

0.27-fold, which is different from the previous report indicating a decreased level of

MYH7 in longissimus dorsi (Figure 3.4D). The myosin heavy chain gene expression results confirmed the reported callipyge phenotype with increased fast-glycolytic and decreased slow-oxidative myofibers (Carpenter et al. 1996; Vuocolo et al. 2007).

The gene expression pattern of these 25 transcripts was given in Figure 3.5. The variable gene expression pattern reflected the differences in response to the DLK1 signaling. Five genes including Parkinson Protein 7 (PARK7, also known as DJ-1)

(Figure 3.6A), Deoxynucleotidyltransferase, terminal, interacting protin 1 (DNTTIP1)

(Figure 3.6B), Solute carrier family 22 member 3 (SLC22A3) (Figure 3.6C), protein- lysine methyltransferase METTL21E (METTL21E) (Figure 3.6D), and cAMP specific phophodiesterase 4D (PDE4D) (Figure 3.6E) were specifically up-regulated in the

69 hypertrophied muscles, but not in the non-hypertrophied muscles, resembling the DLK1 expression pattern. The change in gene expression of PARK7 in hypertrophied muscles is small relative to other four genes, but significantly different from normal muscles with semimembranosus having the biggest magnitude of 6.1-fold (Figure 3.6A). DNTTIP1 had the biggest magnitude of increase in longissimus dorsi with 6.8-fold and smallest increase in semimembranosus with 5.6-fold (Figure 3.6B). There was a substantial up-regulation of SLC22A3 in hypertrophied muscles with the magnitude ranging from 6.5-fold to 17.8- fold (Figure 3.6C). The average mRNA abundance for METTL21E (Figure 3.6D) and

PDE4D (Figure 3.6E) in hypertrophied muscles were 8.4-fold and 5-fold greater relative to normal lambs. In addition to these 5 transcripts, there is a muscle specific expression pattern for all the other assayed genes. Since these transcripts were identified from the microarray and quantitative PCR using longissimus dorsi and semimembranosus, the majority of these genes were differentially expressed in both of these two muscles. Many of these genes are metabolic in nature; for example, PFKM was up-regulated in 3 of the 4 hypertrophied muscles and LPL was down-regulated in 2 of the 4 hypertrophied muscles, therefore they were likely to be involved in the response to the changes of MYH isoforms and metabolic demands in callipyge lambs.

3.4.3 Effects of Candidate Target Genes on Myh4 and Myh7

Promoter Activity

The muscle specific gene expression analysis identified 5 genes, DNTTIP1, PARK7,

METTL21E, SLC22A3 and PDE4D, whose muscle specific expression pattern is the same as DLK1. In order to determine if PARK7, DNTTIP1, and METTL21E could influence myosin isoform expression similar to what occurs in callipyge muscle, a series of

70 luciferase assays were conducted to test the effects of these candidate genes on MYH4 and MYH7 promoter activity. The luciferase assays were conducted by co-transfection of the candidate gene cDNA constructs as effector plasmids together with Myh4

(pGL3IIB2.6) or Myh7 (p-3542β-MHCluc) luciferase reporter plasmids in primary myoblasts. The amount of effector plasmid that was co-transfected was titrated for each plasmid with the addition of the null vector (pGWCAT) to maintain equal amounts of input DNA. After tranfection, the myoblasts were differentiated into myotubes for 3 days.

To validate the expression of the effector protein in cells, the cells were stained with corresponding antibodies after transfection (DNTTIP1 in Supplementary Figure A1,

PARK7 in Supplementary Figure A2 and METTL21E in Supplementary Figure A3).

These results validated the expression of these constructs and also illustrated the nuclear localization of DNTTIP1, and the nuclear and cytoplasmic localizations of PARK7,

METTL21E and GWCAT.

There was a dose effect for DLK1 induced MYH4 luciferase activity. Adding DLK1 significantly increased Myh4 luciferase activity at the high concentration (48%) (P=

0.0012) (Figure 3.7A). The same effect was also observed in DNTTIP1 treatment with the high concentration (24%) of DNTTIP1 resulting in significantly elevation of MYH4 luciferase activity (P< 0.0001) (Figure 3.7C). In this experiment, less DNA was used for

DNTTIP1 because it was a nuclear factor. Conversely, adding METTL21E (60%) significantly decreased MYH4 luciferase activity (P=0.0126) by 16.5 % (Figure 3.7E). An opposite dose response was observed in MYH7 luciferase assay for DLK1 and DNTTIP1 treatments. A 35 % decrease in MYH7 luciferase activity was examined by adding a high concentration of either DLK1 (48%) (Figure 3.7B) or DNTTIP1 (24%) (Figure 3.7C)

71 treatment. Adding METTL21E, on the other hand, significantly increased MYH7 luciferase activity even at a low concentration (30%, P=0.0135 relative to control)

(Figure 3.7F).

Since PARK7 was assumed as a positive regulator in PI3K/AKT pathway which was initiated by the binding of IGF1 to its receptor (Kim et al. 2005a; Fleming-Waddell et al.

2009), different concentrations of IGF1 were applied to the myotubes in order to induce a differential response in PARK7 treatment. Statistical analysis indicated the overall effect of PARK7 was significant in both MYH4 (P=0.0004) (Figure 3.8A) and MYH7 (P<0.0001)

(Figure 3.8B) luciferase assays (P=0.0471). Specifically, with a higher concentration of

IGF1 (100 ng/mL) treatment, adding PARK7 even at a low concentration (30%) significantly increased MYH4 luciferase activity (P=0.0007). There is a similar trend at

IGF1 concentration of 200 ng/mL with 30% input of PARK7 significantly increasing

MYH4 luciferase activity by 20% (Figure 3.8A). No significant difference was found at low IGF1 concentration (50 ng / mL) and no added IGF1 treatment. There is a dose effect for IGF1 treatment in MYH4 luciferase assay, however, the MYH7 luciferase activity was not affected by IGF1 treatment. A dose response for PARK7 was observed in PARK7 induced MYH7 luciferase activity. Adding PARK7 (60%) significantly reduced MYH7 luciferase activity regardless of IGF1 concentrations (Figure 3.8B).

3.4.4 Effects of DLK1 on DNTTIP1 and PARK7 Expression

The luciferase assay indicated both DNTTIP1 and PARK7 are capable of altering

MYH4 and MYH7 gene expression, similar to DLK1. Therefore treatment of myoblast and myotube with DLK1 was tested to determine its effects on DNTTIP1 and PARK7 expression. Since it had been reported that C2C12 cells over-expressing DLK1 failed to

72 proliferate (Waddell et al. 2010), the primary myoblasts were plated onto Matrigel containing recombinant DLK1 protein to enable DLK1 to act as a ligand for cell surface receptors. The mRNA abundance of DNTTIP1 was significantly increased by DLK1 treatment in both myoblast and myotubes (Figure 3.9A). Specifically, the DLK1-treated myoblasts had 1.6-fold increase in DNTTIP1 expression and the DLK1-treated myotubes had 2-fold increase. The expression of Myh4 was very low in myoblasts and there were no significant differences between the control and DLK1 treatments (Figure 3.9B).

However, the mRNA abundance of Myh4 was significantly elevated after differentiation with the DLK1 treated myotubes having 1.8-fold (P<0.0001) higher expression compared to the control myotubes. The mRNA abundance of Park7 was not significantly changed in the presence of DLK1 (Figure 3.9C).

3.5 Discussion

In food animal agriculture, there is a need to identify the mechanisms that can improve the efficiency of muscle growth and protein accretion. Callipyge sheep have improved feed efficiency with greater than 35% more muscle mass, which proves that much higher production efficiency is biologically possible. Therefore callipyge muscle hypertrophy provides a unique model for investigating the genes that are potentially rate limiting for muscle growth. The 25 transcripts examined in the current study were initially identified and validated from previous study by which their expressions were explored at extensive postnatal developmental series (10, 20, 30 days and 80 days)

(Fleming-Waddell et al. 2009). Changes in gene expression during muscle hypertrophy can be categorized as the primary causative genes, DLK1 and RTL1, which were known due to the co-localization with the causative mutation and up-regulation with the

73 inheritance of the mutation in cis. The secondary effector genes have a directly physiological response to DLK1 and RTL1 activities, and the tertiary response genes that indirectly respond to DLK1 signaling or hypertrophy. This study extended the investigation to several muscles (longissimus dorsi, semimembranosus, semitendinosus, triceps brachi, supraspinatus, infraspinatus and heart). The muscle specific patterns of gene expression provide a comprehensive analysis to discern the secondary effectors response to DLK1 and RTL1 from the tertiary changes in expression due to the muscle hypertrophy.

The phenotypic data analysis supported the reported callipyge phenotype that the callipyge lambs share the same body weight as normal lambs (Jackson et al. 1997a;

Freking et al. 1998b), and also confirmed the well-recognized pattern of muscle hypertrophy that the increase of muscle mass in the pelvic limb and the torso is much greater than in the thoracic limbs (Jackson et al. 1997c). The gene expression analysis in

DLK1-DIO3 locus showed the established pattern for induction of muscle hypertrophy in callipyge lambs. There was high level of expression of DLK1 and RTL1 in the callipyge lambs. DLK1 was only up-regulated in hypertrophied muscles but the up-regulation of

RTL1 was also detected in the 3 non-hypertrophied muscles. The expression levels of

MEG3 and MEG8 were increased in supraspinatus. These combined evidence together suggested that RTL1 alone is insufficient to induce muscle hypertrophy and reinforce that

DLK1 is the primary inducer of muscle hypertrophy. However, since the biological activity of RTL1 is not well understood, it is still possible that RTL1 acts in concert with

DLK1 to co-regulate the callipyge phenotype.

74

Analysis of several myosin isoforms showed the up-regulation of the fast twitch glycolytic myosin isoform (MYH4) in all hypertrophied muscles and the down-regulation of the fast twitch mixed oxidative and glycolytic myosin isoform (MYH2) in hypertrophied musclses except triceps brachi. The changes in muscle fiber type are indicative for metabolism, which have been directly associated with elevated postnatal expression of the DLK1 protein in muscle fibers (White et al. 2008). A decrease in slow twitch oxidative MYH7 was only detected in the semimembranosus but not in other hypertrophied muscles, which is inconsistent with previous observation of decreases in

MYH7 expression and smaller oxidative myofibers in longissimus dorsi (bCarpenter et al.

1996; Carpenter & Cockett 2000; Vuocolo et al. 2007; White et al. 2008). The discrepancy is possibly due to the younger animals used in the current study. The decreased level of MYH7 may not be evident in these animals.

Among the 25 examined transcripts, five genes, DNTTIP1, PARK7, PDE4D,

SLC22A3, and METTL21E, were up-regulated specifically in hypertrophied muscles, resembling DLK1 expression pattern in 7 assayed muscles and thus these genes were considered as the secondary targets in response to DLK1 and RTL1 signaling. Further luciferase experiments demonstrated Park7 and DNTTIP1 positively regulate MYH4 and negatively influence MYH7 luciferase activity similar to the effects of DLK1. However, only the expression of DNTTIP1 was increased in DLK1 treated cells. These combined results indicated that DNTTIP1 is a direct transcriptional response to DLK1 signaling.

DNTTIP1 (deoxynucleotidyl transferase interacting protein 1), is a transcriptional factor that negatively regulates the activity of terminal deoxynucleotidyltransferase (TdT), which is a DNA polymerase that synthesized the N-region of B and T-cell receptor genes,

75 independent of a DNA template. (Yamashita et al. 2001). DNTTIP1 is ubiquitously expressed and exclusively localized in the nucleus and it has a helix-turn-helix and AT- hook-like motif and preferentially binds to AT-rich regions of double-stranded DNA

(Yamashita et al. 2001; Kubota et al. 2007). Notably, the promoter region of Myh4 gene contains two AT-rich motifs (Takeda et al. 1992) which suggested that DNTTIP1 may bind to Myh4 promoter region to active its transcription. Moreover, DNTTIP1 is reported to interact with HDAC1 and HDAC2 during M phase (Bantscheff et al. 2011). The

HDACs usually down-regulate transcriptional activity by deacetylating histones (Segre &

Chiocca 2011). The interaction with HDACs may facilitate DNTTIP1 to regulate gene expression in muscles. The function of DNTTIP1 in muscle growth is unclear. But the up- regulation of DNTTIP1 was reported in longissimus dorsi and semimembranosus in callipyge lamb from two previous studies (Fleming-Waddell et al. 2007; Fleming-

Waddell et al. 2009). The current study confirmed its up-regulation in longissimus dorsi and semimembranosus, and also revealed its increased levels in semitendinosus and triceps brachi, along with the regulation of myosin gene expression and the response to the DLK1 treatment. Taken together, DNTTIP1 could be a seconday effector in response to DLK1 and it may involve in the differential expression of MYH genes and regulation of other genes in callipyge lambs.

Since PARK7 was not up-regulated in DLK1-treated cells, it may not act as a direct transcriptional response to DLK1 signaling. However, due to its increased expression in hypertrophied muscles and the regulation of MYH4 and MYH7 luciferase activity, it may have a physiological role in response to the DLK1-induced muscle hypertrophy. PARK7 encodes a ubiquitously expressed, highly conserved protein that was originally identified

76 as an oncogene that transforms NIH3T3 cells in cooperation with the activated ras gene

(Nagakubo et al. 1997). PARK7 has been associated with diverse biological processes including oxidative stress response, transcriptional regulation and cell survival

(Takahashi et al. 2001; Tillman et al. 2007; McNally et al. 2011). The PI3K/AKT pathway is known for its positive regulation on muscle growth, and the binding of IGF1 to its receptor initiates this pathway. PARK7 was identified to positively regulate

PI3K/AKT pathway by suppressing the phosphatase activity of PTEN in mouse fibroblasts (Kim et al. 2005a). Thus the up-regulation of PARK7 may lead to the enhanced activity and prolonged sustained activity of PI3K/AKT pathway and in turn to elevate the response of the downstream elements in PI3K/AKT pathway to increase protein synthesis and muscle mass. Moreover, a recent study demonstrated that over- expression of constitutively active AKT resulted in the hypertrophy of glycolytic myofibers not oxidative myobfiers (Izumiya et al. 2008). This study was supported by identification a regulatory cascade that regulate AKT activation to drive the metabolic and contractile specification of fast-twitch muscle fibers (Meng et al. 2013). Therefore, the significantly higher Myh4 luciferase activity induced by adding PARK7 could be expected as enhanced activation of AKT. Interestingly, in addition to callipyge animals, double muscle cattle, in which the expression of Park7 gene was also elevated, had an increased proportion of white fast-twitch glycolytic fibers as well (Chelh et al. 2011).

Although different from DLK1, METTL21E up-regulated MYH7 and down- regulated MYH4 luciferase activity, it may still have a physiological role in callipyge muscle hypertrophy since it consistently up-regulated in hypertrophied muscles similar to

DLK1. METTL21E has nuclear localization, but it mostly accumulated in perinuclear

77 cytoplasm (Supplementary Figure S3). Herein, it may not act as a direct transcriptional response to DLK1. The results from luciferase assay suggested METTL21E may not regulate the myosin heavy chain gene expression, but it may be involved in other biological activities since its multiple function. The METTL21E, known as protein-lysine methyltransferase METTL21E in Bos taurus, encodes a methyltransferase domain similar to members of the S-adenosylmethionine (SAM) -dependent methyltransferase family

(Marchler-Bauer et al. 2007). This family of methyltransferases catalyzes the transfer of a methyl group (CH3) from a donor, generally S-adenosyl-L-methionine (AdoMet), to various acceptor molecules (Martin & McMillan 2002; Schubert et al. 2003). In human, there is no METTL21E, but the bovine METTL21E gene shares 51 % similarity to human

METTL21C. Due to the species specificity, the function of METTL21E is not well defined. However, thousands substrates of SAM-dependent methyltransferases has been identified. These substrates included nucleic acids for regulation of gene expression,

DNA repair or protection against restriction enzymes, proteins for repair or control of signal transduction pathways, hormones and neurotransmitters, and biosynthetic intermediates to produce secondary metabolites (Schubert et al. 2003). These bioactivities of the substrates may indicate the diverse functional role of METTL21E in the metabolic changes during the callipyge muscle development.

Both PDE4D and SLC22A3 have increased expression only in hypertrophied muscles, which implied they may play roles in DLK1-induced muscle hypertrophy. The luciferase analysis was not done for PDE4D in this study due to the expression of numerous alternatively spliced transcripts that dictate subcellular localization and the specific cAMP pools that are affected (Richter et al. 2005). PDE4D is a member of

78

Phosphodiesterases (PDEs), which catalyze the hydrolysis of cyclic nucleotides cAMP into the inactive substrate 5’-AMP. The cAMP signaling is important for muscle hypertrophy and metabolism (Berdeaux & Stewart 2012). The β2-adrenergic receptors

(β2-ARs) as cAMP inducers in skeletal muscle draw the majority of attention since its main target are β-agonists. The phenotype observed in callipyge hypertrophy is very similar to muscle growth induced by the β-agonists agent, which includes increased muscle mass and decreased adiposity (Kretchmar et al. 1990; Pringle et al. 1993). It has shown that the activation of PDE4D is an important feedback regulation contributing to the transient nature of the β2-ARs response and represents a major adaptive mechanism required for physiological β2-ARs signaling (Liu et al. 2000). Though the callipyge lambs do not respond to β-agonist supplementation with additional muscle hypertrophy

(Koohmaraie et al. 1996), the up-regulation of PDE4D in hypertrophied muscles may be associated with a stronger response to the physiological levels of adrenaline in young growing lambs. The nature of SLC22A3 is an organic cation transporter and SLC22A3 knockout mice did not show overt phenotypic abnormalities indicating it was not essential for physiological functions (Zwart et al. 2001). Therefore, it is unlikely a direct transcriptional response to DLK1. Herein, it was also excluded from the luciferase study.

SLC22A3 / OCT3 (Solute carrier 22A3 / Organic cation transporter 3) mediates the uptake of many important endogenous amines and basic drugs in a variety of tissues

(Chen et al. 2013). Studies have shown that in excretory organs, such as kidney and liver,

SLC22A3 facilitated the uptake of organic cations across the basolateral membrane into the cell (Ahmadimoghaddam et al. 2012; Ahmadimoghaddam et al. 2013). Though it had been already reported that SLC22A3 expressed in skeletal muscle (Lee et al. 2009), the

79 up-regulation of SLC22A3 in hypertrophied muscles was firstly discovered in our lab. It is assumed that the high-levels of SLC22A3 may enhance the up-take of amines including amino acids and biogenic amines to stimulate muscle growth in callipyge lambs. Further studies will be needed to explore its function in muscle development.

In summary, the present study extended the knowledge on the genes regulation in callipyge lamb. This study provided additional support that RTL1 alone was not sufficient to induce muscle hypertrophy, examined the up-regulation of DNTTIP1, PARK7,

SLC22A3, PDE4D and METTL21E in hypertrophied muscles, proposed the regulation of

DNTTIP1 and PARK7 on myosin gene expression and identified DNTTIP1 as a secondary effector gene responding to DLK1 signaling. The present study also assumed the possible mechanisms on how these genes influence muscle mass in callipyge lambs.

The callipyge sheep is a valuable model in livestock since its increased muscle growth and higher feed efficiency. Identification of the genes and the signaling that cause the callipyge phenotype will enrich the understanding of the postnatal muscle growth in all meat animal species, and will help to solve the world’s poverty problem by producing higher protein accretion.

3.6 Authors’ Contributions

HY designed, performed the experiments and wrote the paper. JNW sampled lamb muscles and helped with data analysis. SK participated in the experimental design, data analysis, and manuscript preparation. CB was responsible for designing the entire project and helping with writing paper.

80

3.7 Acknowledgements

We want to thank Jun Wu for managing the mice colony and Gerald Kelly for his management of the sheep flocks.

81

300 ** 250

200 +/C +/+ ** 150 *

Weight (g / Kg) 100

* 50

0 g) g) D M T B S IS T (K (K L S S T S H BW LW

Figure 3.1 Muscle Hypertrophy in Callipyge Lambs. There were no differences in the birth weights (BW) and live weights (LW) between callipyge (+/C) and normal lambs (+/+). Callipyge lambs had significantly heavier longissimus dorsi (LD), semimembranosus (SM), semitendinosus (ST) and triceps brachii (TB) muscles. There were no differences in muscle weights for the supraspinatus (SS), infraspinatus (IS) and heart (HT). Significant differences are indicated by (*; P < 0.05, or **; P < 0.01) between callipyge and normal lambs within each muscle.

82

+/C 8 +/+ e c n a d

n 6 u b A

t

p 4 i r c s n a

r 2 T

g o L 0 T T LD SM S TB SS IS H

Figure 3.2 Transcript Abundance of RPLP0 in 7 Muscles. Least square means and standard errors for log transcript abundance in 100 ng of total RNA are shown for each muscle and genotype. Callipyge animals indicated by +/C, and normal animals are represented by +/+. LD, SM, ST, and TB are hypertrophied muscles, SS, IS and HT are non-hypertrophied muscles. RPLP0 was used as a control to confirm equivalent RNA input into cDNA synthesis and qPCR assays, and no significant difference was detected between the two genotypes in all the muscles analyzed.

83

A B 6 6 e e ** ** ** c c n n ** ** a

** a * 5 **

d ** d n 5 n u u b * b 4 A A

t t p 4 p 3 ** i i r r c c s s

n 2 n a a r

3 r T T

1 g g o o L 2 L 0 D T B S S T T T L SM S T S I H LD SM S TB SS IS H

C D 5 8 e e ** c c ** ** n n a ** a 7 * d ** * d n 4 n * u u b b 6 A ** A

t t p 3 p 5 i i r r c c s s

n 4 n a a r 2 r T T

3 g g o o L 1 L 2 D T B S S T T T L SM S T S I H LD SM S TB SS IS H +/C +/+

Figure 3.3 mRNA Abundance of Genes From the DLK1-DIO3 Locus. Least square means and standard errors for log transcript abundance in 100 ng of total RNA are shown for each muscle and genotype. Callipyge animals indicated by +/C, and normal animals are represented by +/+. LD, SM, ST, and TB are hypertrophied muscles, SS, IS and HT are non-hypertrophied muscles. Samples are from 30 – 35 days of age lamb. DLK1 shown in (A), RTL1 in (B), MEG8 in (C) and MEG3 in (D). Significant differences are indicated by (*; P < 0.05, or **; P < 0.01) between callipyge and normal lambs within each muscle.

84

A B 7 9 ** e e

c *

c 6

n 8 n

** a a d d n

n 5 ** 7 u u ** b b A A

4 6 t t p p i i r r

c * 3 c 5 s s n n a a r 2 r 4 T

T

g o 1 g 3 L o L 0 2 T B S S T LD SM S T S I H LD SM ST TB SS IS HT C D 8 8 e

e ** ** ** c c 7 n n a a

d * d 7 n n u u 6 b b A A

t t p 5 p i

i 6 r r c c s s n

4 n a r a r T

5 T g

o

3 g L o L 2 4 LD M ST TB S IS HT S S LD SM ST TB SS IS HT +/C +/+

Figure 3.4 mRNA Abundance of Myosin Heavy Chain Genes. Least square means and standard errors for log transcript abundance in 100 ng of total RNA are shown for each muscle and genotype. Callipyge animals indicated by +/C, and normal animals are represented by +/+. LD, SM, ST, and TB are hypertrophied muscles, SS, IS and HT are non-hypertrophied muscles. Samples are from 30 – 35 days of age lamb. MYH4 shown in (A), MYH1 in (B), MYH2 in (C) and MYH7 in (D). Significant differences are indicated by (*; P < 0.05, or **; P < 0.01) between callipyge and normal lambs within each muscle.

85

Figure 3.5 Hierarchal Clustering of Candidate Gene Expression Pattern in 7 Muscles. Columns for the seven muscles were fixed and rows representing gene expression were subject to clustering. The fold change of transcript abundance for the ratio of callipyge to normal was transformed to log2 . The magnitude of the fold change is represented by red if gene expression was higher in callipyge than normal or blue if expression was lower in callipyge than normal muscle. Significant differences are indicated by (*; P < 0.05, or **; P < 0.01) between callipyge and normal lambs within each muscle.

86

A B 7.0 e ** 6.0 e c * c n ** ** ** n ** a 6.5

a ** d d n 5.5 * n u u

b 6.0 b A

A t

t p

i 5.5

p 5.0 r i r c c s s n 5.0 n a r a

r 4.5 T

T

4.5 g g o o L 4.0 L 4.0 D M T B S IS T T T L S S T S H LD SM S TB SS IS H C D 4.5 6.5 e e c c

** ** n n 4.0 ** a a ** 6.0 ** * d ** d n

n **

3.5 u u b b

A 5.5 A 3.0

t t p p i i r r

2.5 c

c 5.0 s s n n

2.0 a a r r

T 4.5 T

1.5 g g o o L L 1.0 4.0 T T T T LD SM S TB SS IS H LD SM S TB SS IS H E 6.5 e

c * n ** ** a 6.0 ** d +/C n u +/+ b 5.5 A

t p i r

c 5.0 s n a r

T 4.5

g o

L 4.0 T T LD SM S TB SS IS H

Figure 3.6 Transcript Abundance of the Candidate Target Genes in 7 Muscles. Least square means and standard errors for log transcript abundance in 100 ng of total RNA are shown for each muscle and genotype. Callipyge animals indicated by +/C, and normal animals are represented by +/+. LD, SM, ST, and TB are hypertrophied muscles, SS, IS and HT are non-hypertrophied muscles. PAKR7 (A), DNTTIP1 (B), SLC22A3 (C), METTL21E (D), and PDE4D in (E) are up-regulated in hypertrophied muscles but not in non-hypertrophied muscles. Significant differences are indicated by (*; P < 0.05, or **; P < 0.01) between callipyge and normal lambs within each muscle.

87

A B 1400 10000 1200 b b 8000 1000 6000 a 800 a a 600 a 4000 400 2000 200 Adj Luciferase Activity Adj Luciferase Activity 0 0 0% 24% 48% 0% 24% 48% C DLK1 INPUT D DLK1 INPUT

3000 30000 a 2500 b a 25000 a 2000 a 20000 b 1500 15000 1000 10000 500 5000 Adj Luciferase Activity Adj Luciferase Activity 0 0 0% 12% 24% 0% 12% 24% DNTTIP1 INPUT E DNTTIP1 INPUT F

9000 a 60000 b b 8000 a b 55000 a 7000 50000 6000 45000 5000 40000 4000 35000 Adj Luciferase Activity

Adj Luciferase Activity 3000 30000 0% 30% 60% 0% 30% 60% METTL21E INPUT METTL21E INPUT

Figure 3.7 Effects of DLK1, DNTTIP1 and METTL21E on Myosin Promoter Activity. Increased Myh4 and decreased Myh7 luciferase activity was examined in DLK1 (A: Myh4; B: Myh7) and DNTTIP1 (C: Myh4; D:Myh7) over-expressed myotubes. Over- expression of METTL21E decreased Myh4 (E) and increased Myh7 (F) luciferase activity. Primary myoblasts were transfected with different compositions (indicated by percentage in graph) of effector constructs together with Myh4 or Myh7 luciferase plasmids. The pRL-SV40 plasmid was constantly transfected into cells as a transfection efficiency control. The transfected cells were put into 96-well plates in growth media overnight and fused into myotubes for 3 days. Luciferase activity was adjusted for transfection efficiency by multiplying the firefly luciferase activity of a given well by the ratio of mean renilla luciferase activity for all wells divided by renilla luciferase activity of the given well to produce units of adjusted luciferase activity. Differing lower case letters indicate significance (P < 0.05) within each test.

88

A 35000 0% 60% a a 30000 30% b 25000 a a

20000 b 15000

10000

Adj Luciferase Activity 5000

0 0 50 100 200 IGF1 Concentration (ng / mL) B 8x106 a 0% a 30% a a 6x106 60% b b 6 4x10 b b b c c b 2x106 Adj Luciferase Activity

0 0 50 100 200 IGF1 Concentration (ng / mL) Figure 3.8 Effect of Park7 on Myosin Promoter Activity. (A) Increased PARK7 input (30 % and 60 %) significantly elevated Myh4 luciferase activity at high concentrations of IGF1 (100 ng / mL and 200 ng / mL). (B) Adding PARK7 (30% and 60%) significantly decreased Myh7 luciferase activity regardless of IGF1 concentration. Primary myoblasts were transfected with different compositions of effector constructs pPARK7-pcDNA3.2 and pGWCAT- pcDNA3.2 (control) plasmids together with Myh4 or Myh7 luciferase plasmids.The pRL-SV40 plasmid was constantly transfected into cells as a transfection efficiency control. The transfected cells were put into 96-well plates in growth media overnight and fused into myotubes for 3 days. IGF1 was added to the culture 24h after differentiation at the indicated concentration. Different composition of the effector gene in the transfected plasmid complex was indicated as percentage. Luciferase activity was adjusted for transfection efficiency by multiplying the firefly luciferase activity of a given well by the ratio of mean renilla luciferase activity for all wells divided by renilla luciferase activity of the given well to produce units of adjusted luciferase activity. Differing lower case letters indicate significance (P < 0.05) within each IGF1 treatment.

89

A Control 2.5 DLK1 b 2.0 b

1.5 a a 1.0

0.5 Mean Fold Change Mean

0.0 Myoblast Myotube B 2.5 Control DLK1 2.0 b

1.5 a 1.0

0.5 Mean Fold Change

0.0 Myoblast Myotube C 2.0 Control DLK1 1.5

1.0

0.5 Mean FoldMean Change

0.0 Myoblast Myotube

Figure 3.9 Transcript Abundance of DNTTIP 1, Myh4 and Park7 in DLK1 Treated Myoblast and Myotubes. Primary myoblasts cultured on Matrigel (Control) or Matrigel plus recombinant DLK1 protein (Dlk1) for 24 hours and induced to differentiation for 48 hours. (A) DNTTIP 1 expression was increased in DLK1 treatment in both myoblast and myotubes. (B) The mRNA abundance of Myh4 was highly elevated in DLK1-treated myotubes but not in myoblast. (C) No significant difference was observed in the expression of Park7. Differing lower case letters indicate significance (P<0.05) between control and Dlk1 treatment within myoblast or myotubes.

90

CHAPTER 4. PARK7 EXPRESSION INFLUENCES MYOTUBE SIZE AND MYOSIN EXPRESSION IN MUSCLE

4.1 Summary

Callipyge sheep exhibit postnatal muscle hypertrophy due to the up-regulation of

DLK1 and/or RTL1. The up-regulation of PARK7 was identified in hypertrophied muscles by microarray analysis and further validated by quantitative PCR. The expression of

PARK7 in hypertrophied muscle of callipyge lambs was confirmed to be up-regulated at the protein level. PARK7 was identified to positively regulate PI3K/AKT pathway by suppressing the phosphatase activity of PTEN in mouse fibroblasts. The purpose of this study was to investigate the effects of PARK7 in muscle growth and protein accretion in response to IGF1. Primary myoblasts isolated from Park7 (+/+) and Park7 (-/-) mice were used to examine the effect of differential expression of Park7. The Park7 (+/+) myotubes had significantly larger diameters and more total sacomeric myosin expression than Park7 (-/-) myotubes. IGF1 treatment increased the mRNA abundance of Myh4,

Myh7 and Myh8 between 20-40% in Park7 (+/+) myotubes relative to Park7 (-/-). The level of AKT phosphorylation was increased in Park7 (+/+) myotubes and this increase was substantially elevated in Park7 (+/+) myotubes at all levels of IGF1 supplementation.

After removal of IGF1, the Park7 (+/+) myotubes maintained about higher signal intensity through 3 hours. PARK7 positively regulates the PI3K/AKT pathway by inhibition of PTEN phosphatase activity in skeletal muscle. The activity of PARK7 in

91 muscle can increase protein synthesis and result in myotube hypertrophy. These results support the hypothesis that elevated expression of PARK7 in callipyge muscle would increase levels of AKT activity to cause hypertrophy in response to the normal IGF1 signaling in rapidly growing lambs and PARK7 could be a key regulator in protein accretion and muscle growth.

Keywords

PARK7, skeletal muscle AKT, hypertrophy, callipyge sheep

92

4.2 Background

Callipyge sheep exhibit postnatal muscle hypertrophy, with higher rates of protein accretion and lower rates of fat deposition compared to wild type sheep (Jackson et al.

1997b; Freking et al. 1998a). The muscle hypertrophy phenotype is most prominent in the loin and hind-quarters at 4-6 weeks of age due to increased muscle fiber diameter, while the muscle fiber number remains unchanged (Carpenter et al. 1996; Jackson et al.

1997c; Duckett et al. 2000).After 5 weeks of age, fiber type proportions shift to a greater number of fast-twitch, glycolytic muscle fibers at the expense of oxidative fibers in callipyge muscles (Carpenter et al. 1996; Carpenter & Cockett 2000). The callipyge mutation is a single nucleotide polymorphism in the DLK1-DIO3 imprinted gene cluster

(Freking et al. 2002; Smit et al. 2003) that causes up-regulation of Delta-like 1 (DLK1) and Retrotransposon-like 1 (RTL1) in hypertrophied muscles (Charlier et al. 2001a;

Bidwell et al. 2004; Murphy et al. 2006; Perkins et al. 2006; Fleming-Waddell et al.

2007). Transgenic mice over-expressing Dlk1 exhibited increased muscle mass and myofiber diameter (Davis et al. 2004). Muscle-specific gene ablation of Dlk1 in the mouse resulted in reduced body weight and skeletal muscle mass due to reductions in myofiber numbers (Waddell et al. 2010). Conversely, over-expression of Dlk1 in culture was shown to inhibit myoblast proliferation and enhance myotube differentiation

(Waddell et al. 2010). The expression of DLK1 has a clear role for inducing muscle hypertrophy although the biological activity of RTL1 is not well understood and a synergistic effect with DLK1 has not been ruled out in the callipyge phenotype.

Microarray analysis of gene expression identified 199 genes that were differentially expressed in semimembranosus muscle of callipyge and normal lambs (Fleming-Waddell

93 et al. 2009). Twenty-five transcripts were further verified by quantitative PCR in two hypertrophied muscles (semimembranosus and longissimus dorsi) and one non- hypertrophied muscle (supraspinatus). Parkinson Protein 7 (PARK7; also known as DJ-1) expression was consistently up-regulated in hypertrophied muscles.

PARK7 encodes a ubiquitously expressed, highly conserved protein that has been shown to be involved in diverse biological processes including oxidative stress response, transcriptional regulation and cell survival modulation. A mutation causing a loss of function of PARK7 was found to be responsible for a recessive early-onset form of

Parkinson’s disease (Bonifati et al. 2003). PARK7 protects neurons and somatic cells from oxidative stress by oxidizing itself to a more acidic form (Mitsumoto & Nakagawa

2001). PARK7 could modulate transcription through interaction with proteins. PARK7 enhances the NF-κB pathway by binding to Cezanne (McNally et al. 2011), restores androgen receptor transcription activity by bound to PIAS1 (protein inhibitor of activated

STAT,1) (Takahashi et al. 2001), and up-regulates human tyrosine hydroxylase gene expression by interaction and inhibition of PSF (Splicing factor proline/glutamine-rich; also known as Polypyrimidine tract-binding protein-associated splicing factor) (Zhong et al. 2006). In addition, PARK7 could mediate cell survival signaling pathways. Park7 was originally identified as an oncogene that transforms NIH3T3 cells in cooperation with the activated Ras gene (Nagakubo et al. 1997). Later, substantial studies have shown that

PARK7 is involved in the progression of many cancers including lung cancer (Clements et al. 2006), breast cancer (Pucci-Minafra et al. 2008), pancreatic cancer (He et al. 2011), astrocytomas (Miyajima et al. 2010), leukemias (Liu et al. 2008), and renal cell carcinomas (Eltoweissy et al. 2011). The mechanism of how PARK7 is involved in

94 cancer development is complex and studies have shown that PARK7 could bind to

Topors/p53BP3, p53 (Shinbo et al. 2005; Fan et al. 2008b), DAXX (death domain- associated protein), ASK1 (Apoptosis signal-regulating kinase 1) (Junn et al. 2005;

Karunakaran et al. 2007) and PTEN (Phosphatase with tensin homology) (Kim et al.

2005a) to regulate cell cycle progression.

PARK7 was shown to suppress the phosphatase activity of PTEN which is a negative regulator of the phosphatidylinositol 3' kinase (PI3K)/AKT pathway (Kim et al. 2005a).

The activated PI3K phosphorylates phospholipid phosphatidylinositol-4, 5-bisphosphate

(PIP2) to phosphatidylinositol-3, 4, 5-trisphosphate (PIP3), which creates a lipid-binding site on the cell membrane for the serine/threonine kinase AKT (v-akt murine thymoma viral oncogene homolog 1 /protein kinase B). AKT is activated by phosphorylation of 3’-

Phoshphoinositide-dependent protein kinase 1(PDK1) (Latres et al. 2005). PTEN phosphatase activity catalyzes the reverse reaction of PIP3 back to PIP2 resulting in less activated AKT (Maehama & Dixon 1998). PARK7 acts to suppress PTEN phosphatase activity and, therefore, can modulate levels of AKT activity (Kim et al. 2005a). The phosphorylation of AKT activates several pathways to regulate cell proliferation

(Sandirasegarane & Kester 2001), cell survival (Lawlor & Rotwein 2000) and protein synthesis (Rommel et al. 1999).

The PI3K/AKT pathway is known for its positive regulation on muscle growth

(Bodine et al. 2001; Rommel et al. 2001). The binding of insulin-like growth factor 1

(IGF1) to its receptor initiates this pathway and activates AKT. The role of IGF1 for stimulating muscle growth had been well established. Addition of IGF1 into culture medium induced hypertrophy in C2C12 myotubes through enhanced activation of AKT

95

(Rommel et al. 2001). Muscle-specific over-expression of Igf1caused muscle hypertrophy in mice (Musaro et al. 2001) and conversely muscle-specific inactivation of the Igf1 receptor impaired muscle growth due to reduced muscle fiber number and size

(Mavalli et al. 2010). It also had been well demonstrated that the activation of AKT is sufficient to induce hypertrophy. Over-expression of activated Akt in muscle fibers results in significantly larger fiber size (Bodine et al. 2001; Pallafacchina et al. 2002).

Transgenic mice expressing a constitutively active form of Akt in muscle exhibit rapid skeletal muscle hypertrophy (Lai et al. 2004). Conversely, genetic depletion of Akt in mice leads to a smaller body size and shorter life span (Chen et al. 2001).

Though extensively studied, the role of PARK7 in muscle growth had not been reported until recently. Transcriptomic and proteomic analyses in quadriceps muscles in myostatin-null mice, which exhibit a muscle hyperplasia phenotype, found elevated levels of PARK7 and phosphorylation of AKT (Chelh et al. 2009). Further work by the same group in double-muscled cattle also showed higher PARK7 expression in double- muscled fetuses compared to normal controls (Chelh et al. 2011). In food animal agriculture, there is a need to identify genes that can increase muscle growth and protein accretion. The identification of elevated expression of PARK7 in hypermuscular animals suggests PARK7 could play a functional role in muscle growth and could be a rate- limiting gene in protein accretion. Differential expression of PARK7 was examined in this study using Park7 (+/+) and Park7 (-/-) mouse models to investigate the effects of

Park7 in muscle growth and protein accretion in response to IGF1. Here the elevation of

PARK7 was proposed as part of the physiological mechanism for the induced muscle hypertrophy in callipyge lambs.

96

4.3 Materials and Methods

4.3.1 Mice and Animal Care

Mice with the Park7 locus inactivated by gene targeting [Park (-/-)] are available from JAX mice® (Strain 006577, Jackson Laboratories, Bar Harbor, ME). The initial

Park7 (-/-) mouse was back crossed with C57BL6 to produce Park7 (+/+) (+/-) and (-/-) mice. Twenty females with 4 Park7 (+/+), 12 (+/-) and 4 (-/-) animals and twenty-five males with 4 Park7 (+/+), 11 (+/-) and 10 (-/-) were examined to analyze the live animal growth. The carcass and internal organ weights were measured on a total of 18 males (4

Park7 (+/+), 6 (+/-) and 8 (-/-) animals) and 16 females (4 Park7 (+/+), 8 (+/-) and 4 (-/-) animals). Mice maintenance and experimental use were performed according to protocols approved by the Purdue Animal Care and Use Committee.

4.3.2 RNA Isolation and Quantitative PCR Analysis

RNA from cultured cells was extracted and purified using Nucleo Spin RNA II columns (Machery-Nagel Inc., Easton, PA USA). First strand cDNA was synthesized from RNA using random hexamer and oligo dT priming and moloney murine leukemia virus reverse transcriptase (MMLV, Life Technologies) were used to produce random primed cDNA. Quantitative PCR measurements were performed using the SA Bioscience

SYBR Green Supermix (QIAGEN, Valencia, CA USA) reagents on an iCycler Real-

Time PCR Detection System (Bio-Rad Inc., Hercules, CA USA). Each reaction was carried out in 15 µl reaction volumes of SA Bioscience SYBR Green Supermix with 5 pM of each primer and diluted first-strand cDNA. All cDNA samples were measured in duplicate. Ribosomal protein large protein 38 (Rplp38) was used as the housekeeping gene control for ΔCT calculation [ΔCT = (CT of the target gene) – (average CT of

97 housekeeping genes)]. Primer sequences were listed in Additional file 3. Fold expression

-ΔΔCT values were calculated using 2 methods(Livak & Schmittgen 2001), where ΔΔCT =

(ΔCT of the treatment sample) – (ΔCT of control treatment samples) with no added IGF1 as control treatment and normalized to 1. Statistical significance was determined by

ANOVA.

4.3.3 Primary Myoblast Isolation and Culture

Primary myoblasts were isolated from hind limb skeletal muscles at 3-5 weeks of age.

Muscles were washed with Dulbecco’s Phosphate-Buffered Saline (DPBS), minced and digested in type I collagenase and dispase B mixture (Roche Applied Science,

Indianapolis, IN USA). The digested muscle pulp was then filtered through a 100 µm filter (CellTrics®, Partec Inc., Swedesboro, NJ USA) to remove large muscle fiber debris and then plated on culture dishes. In 3 days, the cells together with the small debris were collected and digested with 0.025% trypsin for 10 minutes with agitation. Cells were seeded in growth media (F-10 Ham’s medium supplemented with 20 % fetal bovine serum, 100 units of penicillin, 100 µg of streptomycin,0. 292 mg/ml of L-glutamine, , and

4 ng/mL basic fibroblast growth factor) on rat-tail collagen (Roche Applied Science)- coated dishes with preplating on non-coated plates for 45 minutes to deplete fibroblasts as previous described (Waddell et al. 2010; Liu et al. 2012). Myoblasts were differentiated into myotubes after plating cells at approximately 80% confluency on

Matrigel (BD Biosciences, San Jose, CA USA) coated plates and the addition of fusion media consisting of DMEM supplemented with 5 % horse serum, 100 units of penicillin,

100 µg of streptomycin, and 0. 292 mg/ml of L-glutamine. Long®R3 IGF1 (Sigma-

98

Aldrich Co, St Louis, MO USA) was added to the fusion medium for 15 minutes at 3 days after differentiation. Cells were collected for analysis of protein expression.

4.3.4 Protein Extraction and Western Blots Analysis

Semimembranosus and supraspinatus muscles were extracted from 4 callipyge and 4 normal lambs at 30-35 days. Samples were frozen immediately after dissection and homogenized in RIPA buffer [50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 10 %

TritonX100, 0.5 % Deoxycholate, 0.1 % SDS and 1 × complete protease inhibitor (Roche

Applied Science)]. Samples were centrifuged at 10,000 × g for 10 minutes at 4 ℃. The supernatant was transferred into ultracentrifuge tubes and centrifuged at 50,000 × g for 15 minutes at 4 ℃.

Proteins were quantified by BCA assay (Thermo Fisher Scientific Inc, Rockford, IL

USA) per manufacturer’s recommendation. A total of 60 µg of protein from each muscle sample was diluted in SDS loading buffer, denatured by heating for 5 minutes in boiling water and loaded in the 6 %-18 % gradient SDS-PAGE gel. The gel was transferred to

PVDF membrane by semi-dry transfer using 20 % methanol, 40 mM glycine, 0.15 % ethanolamine, 0.2% SDS at 180 mA for 1h 45 min. PVDF membrane was blocked overnight with agitation in 5% sodium caseinate in PBS with 0.1 % Tween 20.

Antibodies used for blotting were goat polyclonal anti-Park7 (sc-27006, Santa Cruz

Biotechnology, Santa Cruz, CA USA), anti-DLK1 (provided by Dr. Ross L. Tellam,

CSIRO), and secondary antibodies were rabbit anti-goat antibody conjugated HRP or goat anti-rabbit conjugated HRP respectively. The blots were incubated in primary antibody 2 hours at room temperature with a dilution of 1:1000. After washing 3 times with DPBS, the blots were incubated with secondary antibody with dilution of 1:20000.

99

Super Signal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) was used to detect HRP on immunoblots. The blots were visualized using Gel Logic 2200 PRO

(Carestream Molecular Imaging System) with exposure times of 2-6 minutes. Carestream

Molecular Imaging Software was used to quantify the chemiluminescent signal intensity.

4.3.5 Analysis of Myotube Differentiation and Size

Primary myotubes were fixed in 4 % formaldehyde and permeabilized in 0.5 % Triton

X-100. Cells were blocked in 1 % bovine serum albumin (BSA) in PBS for 1 hour at room temperature and stained with 1:1000 anti-myosin heavy chain antibody (MF20,

Developmental Studies Hybridoma Bank, Iowa City, Iowa USA) for 2 hours. Cells were washed in PBS, and then incubated in 1:1000 Alexa Fluor 594-conjugated donkey anti- mouse IgG secondary antibody (Life Technologies) for 1 hour. Finally, cells were mounted with Prolong Gold antifade reagent with DAPI (Life Technologies). The IP Lab software (Scanalytics Inc., Madison, WI USA) and Leica DM6000 microscope were used to acquire pictures.

The fusion index was defined as the ratio of nuclei within the myotubes (>2 nuclei) to the total number of nuclei. The average number of nuclei per myotube was determined by counting over 500 nuclei from randomly chosen MHC-positive cells. Myotube diameters were measured at 5 points along the entire tube. A total of 150 counts were examined for each genotype in the experiment.

4.3.6 In situ ELISA Quantification of Myosin Expression

Primary myoblasts were put into Matrigel coated-96-well plate at a high density. The myoblasts were fused into myotubes for 3 days in fusion media with different concentration (12.5, 25, 50, 100 and 200 ng / mL) of IGF1. The mature myotubes were

100 fixed in 4 % formaldehyde in PBS for 5 minutes at room temperature, washed 3 times with PBS and permeabilized with 0.5 % Triton×100 for 5 minutes. After washing 3 times with PBS, the cells were blocked for 1 hour in 1 % BSA in PBS. Cells were incubated with anti-myosin heavy chain antibody (MF20, Developmental Studies Hybridoma Bank) diluted in 0.1 % BSA overnight at 4 ℃, and washed 5 times in PBS. Secondary antibody

(Donkey anti-mouse IgG, Life Technologies) were diluted in 0.1 % BSA and filtered through 0.2 µM filters. Cells were incubated in secondary antibody for 1 hour and washed 5 times with PBS.

The fluorescence signals were read on Tecan Genios Pro (Tecan Group Ltd.,

Morrisville, NC USA) plate reader and results were analyzed using SAS 9.2 software and

ANOVA procedure with IGF1 and genotype as main effects.

4.3.7 AKT Phosphorylation in Primary Myotubes

Cultured primary myoblasts or myotubes were used to examine AKT phosphorylation.

Different concentrations of IGF1 were added into culture for 15 minutes to induce phosphorylation of AKT. For the PTEN inhibitor experiment, different concentrations (0,

100 nM and 800 nM) of VO-OHpic trihydrate (Sigma-Aldrich) were added into culture and incubated with myotubes for 15 minutes after removal of IGF1. For testing sustained activity of phosphorylation of AKT, IGF1 was removed 15 minutes after incubation with myotubes. The cells were incubated in normal differentiation conditions and cell lysis was collected at the indicated time points (0, 45, 90, 180, 360, 720 minutes). Cells attached to plates were rinsed with ice-cold DPBS, and scraped on ice in cell lysis buffer

(50 mM Tris, pH 7.5, 150 mM NaCl, 20 mM sodium fluoride, 1 % Triton 100, 1 X phos- stop (Roche Applied Science) and 1 × complete protease inhibitor cocktail ). Cells were

101 collected in 1.5 mL microcentrifuge tubes, rotated for 45 minutes, and centrifuged at

12,000 × g for 10 minutes at 4 ℃ to remove insoluble debris.

A total of 45 µg protein from each cell sample was diluted in SDS loading buffer, and loaded in the 6 %-18 % gradient SDS-PAGE gel. The gel electrophoresis and transfer to

PVDF membranes were the same as described above. The PVDF membranes were blocked in 5 % non-fat milk in Tris-Buffered Saline (TBS) with 0.1 % Tween 20 for 3 hours. Antibodies used for blotting were rabbit polyclonal anti-AKT (Cat #: 4685, Cell

Signaling Technology, Danvers, MA USA), anti-phospho-AKT (Ser473) (Cat #: 4695

Cell Signaling Technology), anti-PTEN (Cat #: 9188 Cell Signaling Technology). The primary antibody was incubated at 4 ℃ overnight at a dilution of 1:1000. The goat anti- rabbit conjugated HRP was used as secondary antibody and was incubated for 1 hour at

4 ℃ at a dilution of 1:20000. The visualization of blots was the same as described above.

4.4 Results

4.4.1 Up-regulation of PARK7 in Hypertrophied Muscle of

Callipyge Lambs

Semimembranosus and supraspinatus muscle samples were collected from 4 callipyge and 4 normal lambs at 30-35 days of age when muscle hypertrophy is detectable by muscle mass. The semimembranosus from the pelvic limb undergoes the largest magnitude of hypertrophy and supraspinatus from the thoracic limb does not become hypertrophied (Koohmaraie et al. 1995; Jackson et al. 1997b). Western blots

(Figure 4.1A) showed that PARK7 protein expression was elevated about 3-fold

(P=0.027; Figure 4.1B) in the semimembranosus of callipyge animals (+/C) but not in supraspinatus. Elevated levels of DLK1 protein were also confirmed in the callipyge

102 semimembranosus. No detectable DLK1 expression was found in the muscles of normal animals and non-hypertrophied muscles, along with a reduced PARK7 expression in these same animals and tissues.

4.4.2 Effects of Park7 Genotype on Myosin Heavy Chain

Gene Expression

The initial Park7 (-/-) mouse was obtained from Jackson Laboratory and back crossed with C57BL6 mice to generate Park7 (+/+), (+/-) and (-/-) littermate mice. Live animal body weights were monitored and collected from 3 – 6 weeks of age. Mice were euthanized at 6 weeks and carcass (muscle and skeleton) weight and internal organs weights were collected. The phenotypic data from male and female mice was analyzed separately to account for gender differences. No significant differences were found between genotypes for analysis of live weight by age, carcass weight by live weight, or organ weight by live weight analysis in males or females (Figure B.1 and Table B1).

The expression of PARK7 protein in the vastus lateralis muscle was examined to verify the loss of expression in Park7 (-/-) mice (Figure 4.2). The results showed that the expression of PARK7 was easily detectable in the muscles in Park7 (+/+) and Park7 (+/-) animals, with lower expression in heterozygotes (+/-). No PARK7 protein was detectable in Park7 (-/-) muscles.

Primary myoblasts were isolated from Park7 (+/+) and Park7 (-/-) animals and fused into myotubes in order to model the effect of Park7 levels on growth and myosin expression. The relative sizes of myotubes were determined after 72hours of differentiation in fusion media (Figure 4.3A). The fusion index was calculated to determine the proportion of myoblasts that fused into myotubes, and myotube diameters

103 were measured to estimate relative myotube size. There were no differences (p=0.4103) in the fusion index between the Park7 (-/-) and (+/+) cultures (Figure 4.3B). Park7 (+/+) myotubes were significantly larger (1.6-fold; p<0.0001) than Park7 (-/-) myotubes

(Figure 4.3C). These results indicated that Park7 activity can influence myotube growth through a hypertrophy mechanism. An in vitro ELISA assay was performed to detect total sarcomeric myosin protein accretion to test the hypertrophy mechanism. IGF1 treatments were included due to its well-established role in regulating muscle hypertrophy (Bodine et al. 2001; Rommel et al. 2001). Statistical analysis (Figure 4.4) indicated the overall effect of genotype was significant (p=0.0471) with the Park7 (+/+) myotubes having about 10% higher myosin expression than Park7 (-/-) myotubes, regardless of IGF1 treatment. All IGF1 treatments had a significant effect compared to no added IGF1 (p=0.0015), with 34 % higher myosin expression in IGF1 treated myotubes.

However, the genotype by IGF1 interaction effect was not significant (p=0.5208).

Quantitative PCR was used to detect the effect of Park7 genotype on Myh4, Myh7,

Myh8 and Myh3 expression in IGF1 treated mature myotubes (Figure 4.5). The mRNA abundance of Myh4 was 40 % greater (p=0.0032) in Park7 (+/+) myotubes, relative to

Park7 (-/-) myotubes. The addition of IGF1 in culture induced significantly higher Myh4 expression with 1.6-fold increase at 10 ng / mL, 1.9-fold increase at 25 ng / mL and 1.3- fold increase at 50 ng / mL of IGF1 respectively. The Myh7 and Myh8 genes had similar expression patterns as Myh4. The mRNA abundance of Myh7 and Myh8 were increased

20 % (p=0.0018) and 30 % (p=0.0001) respectively in Park7 (+/+) myotubes. IGF1 also stimulated Myh7 and Myh8 mRNA expression, but only at the lower concentration (10 ng

/ mL) with 23 % increase in Myh7 and 10 % increase in Myh8 respectively, relative to the

104 treatment without IGF1. At the high concentration of IGF1 (50 ng / mL), Myh7 expression dropped 12 % and Myh8 expression dropped 16 % compared to the treatment without IGF1. Myh3 was the only isoform measured that showed no genotype effect or

IGF1 effect. There was no significant genotype by IGF1 interactions for the four myosin isoforms.

4.4.3 Effect of Park7 Genotype on Phosphorylation Level of

AKT (S473)

In order to explore the mechanism of Park7 regulation on myotube size and myosin gene expression, a series of experiments were conducted to assess the activation of AKT by phosphorylation at S473 in presence or absence of Park7. It has been demonstrated that PARK7 can suppress PTEN phosphatase activity, which would have the effect of increasing receptor tyrosine kinase signaling through AKT (Kim et al. 2005a). IGF1 was used to test the effect of Park7 genotype on the phosphorylation of AKT. The level of phosphorylation of AKT was elevated in Park7 (+/+) myotubes relative to Park7 (-/-) in

5% horse serum differentiation media without added IGF1 (Figure 4.6). The phosphorylation of AKT was substantially elevated in Park7 (+/+) myotubes at all levels of added IGF1. To investigate if the activity of PARK7 could be mimicked by inhibition of PTEN function, VO-OHpic trihydrate, a known effective PTEN inhibitor (Rosivatz et al. 2006) was introduced into this study. Myotubes were first treated with IGF1 (5 ng / mL) for 15 minutes to induce increased phosphorylation of AKT. Different concentrations of VO-OHpic trihydrate was then added for an additional 15 minutes after removing IGF1. The addition of VO-OHpic trihydrate at 800 nM increased the level of AKT phosphorylation in Park7 (-/-) myotubes and eliminated the differences between

105 the two Park7 genotypes (Figure 4.7A). There were no detectable differences in PTEN protein levels (Figure 4.7A) or RNA expression (Figure 4.7B, p= 0.6057). This indicates that PARK7 inhibits the activity of PTEN but not its expression levels.

Since increased phosphorylation of AKT was found in Park7 (+/+) myotubes, the timing and duration of the elevated phospho-AKT was tested. Myotubes were treated with IGF1 for 15 minutes and protein was collected at several time points up to 12 hours.

Western blots showed increased phosphorylation of AKT in Park7 (+/+) myotubes

(Figure 4.8A). Quantitative analysis of relative signal intensity based on the ratio of phospho-AKT to total AKT indicated a 2-fold higher level of P-AKT in Park7 (+/+) myotubes relative to Park7 (-/-) myotubes with no added IGF1 (Figure 4.8B). The level of AKT phosphorylation in Park7 (+/+) myotubes reached its maximum at 45 minutes at

3.4-fold higher signal intensity than Park7 (-/-) myotubes after removal of IGF1. Park7 (-

/-) myotubes had maximum phosphorylation at 90 minutes and the decreases in phosphorylation over time were similar with Park7 (+/+) myotubes, generally maintaining approximately 20% higher signal intensity through 12 hours.

4.5 Discussion

Overall, the present results indicate that differential expression of Park7 altered the response to IGF1 signaling through inhibition of PTEN, and further affected myotube growth and protein accretion. A previous study showed elevated PARK7 expression in callipyge sheep at the transcriptional level (Fleming-Waddell et al. 2009). These western blot results confirmed the increased expression of PARK7 in hypertrophied muscles at the protein level.

106

The Park7 (-/-) mice lack obvious developmental abnormalities and no significant difference was found between Park7 (+/+) and (-/-) animals in vivo when we compared body weight, carcass weight and internal organ weight. These results were consistent with others findings, which indicated no significant differences in body weights between the two genotypes from birth to 12 months (Chandran et al. 2008). Skeletal muscle growth in live animals is stimulated by different hormones such as IGF1, androgens and

β-adrenergic agonists to initiate multiple signaling pathways to regulate growth.

Therefore, the loss of Park7 functions in Park7 (-/-) mice may be compensated by other hormones and signaling pathways in vivo. Furthermore, the viability of Park7 (-/-) mice suggests that Park7 is not essential for animal growth. An in vitro cell culture model was introduced to this study to investigate the effects of differential expression of Park7 in myogenesis. The in vitro comparison of myotube size showed Park7 (+/+) myotubes had a bigger size and higher myosin expression, but no significant change in the fusion index, which indicates Park7 causes myotube hypertrophy (increased myofiber diameter), not hyperplasia (increased myofiber number). This result also supports the idea that PARK7 is part of the physiological mechanism for the induced muscle hypertrophy in callipyge lambs.

The PI3K/ AKT pathway is one of the primary targets of IGF1 signaling and has been well characterized for its positive regulation on muscle growth (Bodine et al. 2001;

Rommel et al. 2001). The postnatal muscle mass and myofiber size generally reflects protein accretion. AKT stimulates protein synthesis by activating mammalian target of rapamycin (mTOR) and its downstream effectors. This study showed that the Park7 (+/+) myotubes had a higher increase of phosphorylation of AKT compared to Park7 (-/-) after

107

IGF1 stimulation, which induced significantly more total sarcomeric protein accretion.

Notably, this increase of protein accretion reached saturation at IGF1 concentrations of

25 ng / mL and above. Higher levels of Myh4, Myh7 and Myh8 mRNA expression were also observed in Park7 (-/-) myotubes. Myosin transcription as well as translation was elevated. Myh3, also known as embryonic myosin heavy chain 3, was the only myosin gene assayed that was not affected by the Park7 genotype. Muscle contractile characteristics partially depend on the expression of myosin heavy chain isoforms. The hypertrophied muscles in callipyge sheep have an increased size of fast twitch glycolytic myofibers along with increased MYH4 expression and a decreased frequency of oxidative fibers (Carpenter et al. 1996; Carpenter & Cockett 2000). Over-expression of constitutively active Akt had been reported to promote myofiber growth with no effect on fiber specification in regenerating skeletal muscle (Pallafacchina et al. 2002). The use of a doxycycline-inducible Akt transgene in mice resulted in the hypertrophy of glycolytic myofibers, but not oxidative myofibers (Izumiya et al. 2008). A recent study supported this result by identifying a regulatory cascade of AKT activation to drive the metabolic and contractile specification of fast-twitch muscle fibers (Meng et al. 2013). Similarly, the results presented here are congruent with the up-regulation of Myh4 and the enhanced activation of AKT in the presence of Park7. Interestingly, double-muscled cattle, in which the expression of Park7 gene is also elevated, have an increased proportion of fast- twitch glycolytic fibers as well (Stavaux et al. 1994).

The difference of phosphorylation of AKT in Park7 (+/+) and Park7 (-/-) myotubes was eliminated when treated with higher concentrations of PTEN inhibitor, but the total amount of PTEN had not been changed, suggesting PARK7 acts through inhibition of

108

PTEN phosphatase activity, not total PTEN expression. This result was consistent with the findings of Kim et al. (Kim et al. 2005a; Kim et al. 2009). In their studies, they also examined the phosphorylation level of PTEN at Ser380, Thr382, Thr383 and Ser385 in

Park7 transfected NIH3T3 cells, but no change was detected; indicating the inhibition of

PTEN phosphatase activity by PARK7 is not affected by phosphorylation of PTEN. The detailed mechanism on how PARK7 inhibits PTEN phosphatase activity remains unclear.

Some studies have proposed that PARK7 can directly bind to PTEN to confer an inactive conformation by forming a disulfide bond between cys71and cys124 of PTEN upon oxidative stress (Lee et al. 2002; Kwon et al. 2004; Kim et al. 2009). It has also been speculated that the interaction of PARK7 to PTEN may accelerate the oxidation of PTEN, thus inactivating the PTEN function (Kim et al. 2009). Further analysis will be necessary to determine how PARK7 inhibits PTEN function in muscle.

In live animals, skeletal muscle responds to the natural IGF1 stimulation to grow.

With the increased level of PARK7, the AKT phosphorylation in callipyge animals would be expected to be higher relative to normal lambs with natural IGF1 stimulation, thus causing increased muscle mass. However, the steady state level of AKT phosphorylation would be difficult to determine in the live lambs since IGF1 stimulation of individual in animals would be variable. Stress responses associated with transportation and slaughter could rapidly alter levels of AKT phosphorylation. However, this cell culture study provides evidence that PARK7 activity in muscle may be part of the physiological mechanism for the DLK1-induced muscle hypertrophy in callipyge lambs.

109

4.6 Conclusions

In summary, the present study provided a novel insight into the function of PARK7 in the regulation of skeletal muscle growth. The effect of PARK7 in muscle growth can contribute to increased protein synthesis and result in myotube hypertrophy. Since

PARK7 can positively regulate the PI3K/AKT pathway by inhibition of PTEN phosphatase activity, elevated expression of PARK7 in the muscles of callipyge lambs would lead to increased muscle growth in response to the normal IGF1 signaling present in young growing lambs. DLK1 and PARK7 expression were both up-regulated in hypertrophied muscle. Since DLK1 is one of the causative genes for the callipyge phenotype due to the inheritance of the mutation, PARK7 could be considered a downstream response to DLK1 signaling. These results support the hypothesis that elevated expression of PARK7 is part of the physiological mechanism for the induced muscle hypertrophy in callipyge lambs. In addition to the callipyge animals, the up- regulation of PARK7 in double muscled cattle also suggests the essential role of PARK7 in regulating muscle mass. These combined results indicated that PARK7 is a key modulator of PI3K/AKT pathway controlling muscle growth and protein accretion.

Identifying methods to increase the expression of PARK7 in muscle could provide a mechanism to increase livestock muscle growth and production efficiency or prevent the loss of muscle mass due to disease or aging.

4.7 Authors’ Contributions

HY designed, performed the experiments and wrote the paper. JNW sampled sheep muscles and helped with analysis of data. SK participated in the experimental design,

110 data analysis, and manuscript preparation. CAB was responsible for designing the entire project and helping with writing paper.

4.8 Acknowledgements

We want to thank Jun Wu for managing the mice colony, Gerald Kelly for his management of the sheep flocks and Weiyi Liu for his input in experimental techniques.

111

Figure 4.1 PARK7 Protein Expression Level in Sheep Skeletal Muscles. A: There were higher levels of PARK7 and DLK1 proteins in the semimembranosus (SM) of callipyge lambs (+/C) relative to normal lambs (+/+), but no difference in PARK7 or DLK1 protein levels in the supraspinatus (SS). B: Quantitative analysis of PARK7 protein expression was significantly higher in the SM of callipyge lambs. α-Tubulin was the control for protein loading. Data shown are mean signal intensity ± SE. The p-value for comparisons between genotypes for each muscle is given.

Figure 4.2 PARK7 Protein Expression in Vastus Lateralis. PARK7 protein expression was not detectable in vastus lateralis in Park7 (-/-) mice. α- Tubulin was used as a control to show equal protein loading.

112

Figure 4.3 Comparison of Myotube Size Between Park7 (+/+) and Park7 (-/-) Genotypes. A: Primary myoblasts were induced to differentiate for 72 hours and stained with an antibody for total myosin heavy chain (red: MF20) and DNA (blue: DAPI). B: No significant differences were detected between the two genotypes for fusion index. C: The distribution of myotube diameters were significantly larger (P<.0001) for Park7 (+/+; 1.70±0.24) than Park7 (-/-; 1.05±0.025) myotubes.

113

Genotype 0.0471 IGF1 0.0015 -/- Genotype*IGF1 0.5208 +/+ 300

250

200

150

100 Signal Intensity (x100) Intensity Signal 0 12.5 25 50 100 200 IGF1 (ng/mL)

Figure 4.4 Detection of Total Sarcomere Myosin Expression in Myotubes by ELISA. There were significant effects for genotype and IGF1 treatment, but no significant interaction. The Park7 (+/+) myotubes had significantly more total sarcomere myosin expression than Park7 (-/-) myotubes and IGF1 induced significant higher sarcomere myosin expression at all concentrations.

114

A Genotype 0.0032 B Genotype 0.0018 IGF1 0.0021 IGF1 0.0002 Genotype*IGF1 0.7719 Genotype*IGF1 0.2347 2.5 2.5 2.0 2.0 1.5 1.5 1.0 1.0 0.5 0.5

Mean Fold Change Fold Mean 0.0 Change Mean Fold 0.0 10 25 50 10 25 50 IGF1 (ng/mL) IGF1 (ng/mL) C D Genotype <0.0001 Genotype 0.1042 2.5 IGF1 <0.0001 2.5 IGF1 0.4261 2.0 Genotype*IGF1 0.9148 2.0 Genotype*IGF1 0.6951 1.5 1.5 1.0 1.0 0.5 0.5 Mean Fold Change Mean Fold 0.0 Change Mean Fold 0.0 10 25 50 10 25 50 IGF1 (ng/mL) IGF1 (ng/mL) - /- +/+

Figure 4.5 Detection of Myosin Heavy Chain Isoform mRNA Levels in Myotubes by Quantitative PCR. Primary myoblasts were isolated from 2 animals for each genotype. IGF1 was added to the culture 24hours after differentiation at the indicated concentration. A: Myh4 (Myosin Heavy Chain, Type IIB) expression; B: Myh7 (Myosin Heavy Chain, Type I) expression; C: Myh8 (Myosin Heavy Chain, perinatal) expression; D: Myh3 expression (Myosin Heavy Chain, embryonic). Myh4, Myh7 and Myh8 had significantly higher expression in Park7 (+/+) myotubes, however, no significant differences were detected for Myh3. The mean fold change value was calculated using the 2 –ΔΔCt method with Rplp38 as the control gene and IGF1 concentration of 0 as the control treatment.

115

Figure 4.6 Phosphorylation of AKT (S473) Proteein in Park7 (+/+) and Park7 (-/-) Myotubes. Myoblasts were induced to differentiation for 72 hours. Mature myotubes were treated with IGF1 for 15 minutes. There was increased phosphorylation of AKT (P-AKT) in Park7 (+/+) myotubes relative to total AKT (AKT) in myotubes in fusion medium (5% horse serum). There was a substantial increase inn AKT phosphorylation in Park7 (+/+) myotubes relative to Park7k (-/-) myotubes at all IGF1 concentrations. α-Tubulin was the control for protein loading.

116

Figure 4.7 PARK7 Inhibits PTEN Function, But Not PTEN Expression. A: Western blot analysis of phosphorylated AKT (S473) in Park7 (+/+) and Park7 (-/-) myotubes in the presence of different concentrations of PTEN inhibitor (VO-OHpic) after IGF1 stimulation. Differential phosphorylation of AKT due to Park7 genotype was eliminated by the PTEN inhibitor VO-Ohpic at 800 nM. No differences were detected in PTEN expression. α-Tubulin was the control for protein loading B: Detection of Pten mRNA level in myotubes by quantitative PCR. No significant differences were detected between the two genotypes or IGF1 treatment. The mean fold change was calculated using the 2 –ΔΔCt method with Rplp38 as the houseekeeping geene and no added IGF1 as the control treatment.

117

Figure 4.8 Sustained Activity of AKT Phosphorylation (S473) in Park7 (+/+) and Park7 (-/-) Myotubes After IGF1 Stimulation. Mature myotubes were stimulated with IGF1 (12.5 ng / mL) for 15 minutes. Total protein was extracted at the indicated time after removal of IGF1. A: Western blot analysis showed a higher level of AKT phosphorylation in Park7 (+/+) relative to Park7 (-/-) myotubes. B: Analysis of the signal intensity for the P-AKT/total AKT showed the Park7 (+/+) myotubes had higher AKT phosphorylation without added IGF1 and had a 3.4 fold higher level of P-AKT than Park7 (-/-) myotubes at 45 minutes after IGF1 treatment. The decline in AKT phosphorylation was similar between the genotypes after 90 minutes with Park7 (+/+) myotubes generally maintaining approximately 20% higher signal intensity.

118

CHAPTER 5. IMPLICATION AND FUTURE DIRECTIONS

In the meat animal industry, there is always a need to identify genes that can increase meat production. The callipyge sheep is an ideal model to screen these genes due to its muscle hypertrophy phenotype. Functional genomics experiments, such as microarrays, facilitate to narrow the candidate genes from a pool of genes to a certain number. The follow-up experiments after functional genomics are essentially required to validate the expression of candidate genes in multiple muscles, and to determine the true molecular mechanisms on how these candidate genes regulate protein accretion and muscle growth.

The work presented in this dissertation contains two themes. One is to identify the potential downstream effector genes that respond to the up-regulation of DLK1 and / or

RTL1 in hypertrophied muscles, and the other one is to explore the functional role of

PARK7, one of the candidate genes from the first study, in muscle growth and development. These two studies provide insights on the potential genes network in callipyge sheep and demonstrate how PARK7 could alter myotube size and myosin gene expression. However, there are other working hypotheses developed from this work and these should be tested in the future. This chapter covers these hypotheses from the two studies in this thesis.

119

5.1 Possible Physiological Roles of Effector Genes in Callipyge Sheep

The first study (Chapter 3) identified PARK7, DNTTIP1, SLC22A3, METTL21E and

PDE4D as the potential secondary effector genes in responding to DLK1 (primary inducer) signaling and also indicated PARK7 and DNTTIP1 could be the components in the signaling of DLK1 induced up-regulation of Myh4 (see Chapter 3). Though the current thesis only explores the function of PARK7 in muscle growth (see Chapter 4), specific studies on the regulations of other genes should be performed in the future in order to understand the gene regulation in callipyge muscles. Here are some clues that may facilitate future studies.

DNTTIP1 encodes TdT interacting factor 1 (TdIF1), which was first identified as a protein that directly binds to terminal deoxynucleotidyltransferase (TdT), and negatively regulates TdT activity. There are few studies on DNTTIP1 in muscle growth. A recent study revealed that DNTTIP1 preferentially binds to the sequence 5′-GNTGCATG-3′ following an AT-tract, through its helix-turn-helix and AT-hook motifs (Kubota et al.

2013). Since the increased MYH4 luciferase activity was reported in Chapter 3, the sequence analysis on MYH4 promoter region was conducted. However, no positive results were found. Nevertheless, the three DNA-binding regions of DNTTIP1 [within residues 1–75, an AT-hook domain between residues 159–173, and a predicted helix- turn-helix (HTH) region between residues 184–243] (Kubota et al. 2007) makes it with strong DNA-binding capacity. Herein, we cannot exclude the possibility that DNTTIP1 may bind to other DNA sequence to regulate MYH4 transcriptional activity. Identification of the binding sequences of DNTTIP1 may be the first step to study its regulatory function. Moreover, DNTTIP1 is reported to interact with HDAC1 and HDAC2 during

120 the M phase (Bantscheff et al. 2011). The HDACs usually repress transcriptional activity by deacetylating histones (Segre & Chiocca 2011). HDAC1 and HDAC2 interact with many transcriptional factors, including Rb binding protein-1, Sp1, and ZEB1(Kao et al.

2000; Aghdassi et al. 2012) in order to regulate gene transcription. They are subjected to various post-translational modifications, such as phosphorylation, ubiquitination, and

SUMOylation (Segre & Chiocca 2011). Based on the multiple function of the HDAC complex, the other option for future studies is to start with the interaction with HDACs and examine the regulatory role of this complex on gene expression during myogenisis.

SLC22A3 / OCT3 (Solute carrier 22A3 / Organic cation transporter 3) mediates the uptake of many important endogenous amines and basic drugs in a variety of tissues

(Chen et al. 2013). Transported endogenous substrates of human OCTs include: monoamine neurotransmitters, neuromodulators, and other compounds such as choline, creatinine, and guanidine [for reviews, see (Nies et al. 2011)]. Therefore, the studies on

SLC22A3 could start with the examination of the substrates of SLC22A3 in muscles, and the inhibitors of SLC22A3 can be used here. Furthermore, it is postulated that SLC22A3 has a role in the overall regulation of neurotransmission and maintenance of homeostasis within the central nervous system (Wu et al. 1998; Zwart et al. 2001). Since the muscle activity is controlled by the motor neuron, the other study could be conducted on the regulation of SLC22A3 in neuron function in muscle.

The functions of METTL21E and PDE4D in muscles have not been characterized.

METTL21E, also known as protein-lysine methyltransferase METTL21E in Bos taurus, shares 51 % similarity to human METTL21C whose protein family is consisted of other 9 proteins (Cloutier et al. 2013). Methyltransferases catalyze the transfer of a methyl group

121

(CH3) from a donor, generally S-adenosyl-L-methionine (AdoMet), to various acceptor molecules, such as proteins, DNA, RNA, lipids, and small metabolites (Martin &

McMillan 2002; Schubert et al. 2003). The function of METTL21E can be determined by identifying its acceptors in muscles. Furthermore, a recent study has shown that human

METTL22 family of proteins could interact with molecular chaperones to regulate their activities. This study also determined the modification sites of these chaperones (Cloutier et al. 2013). Notably, PARK7 has been suggested to have the chaperone activity due to the structural similarities to Hsp31 (see Chapter 1). Therefore, the other starting point of the future study is to examine whether METTL21E could modify the activity of PARK7, and in turn to regulate other genes expression. The affinity purification coupled to mass spectrometry method could be used in this study. The phosphodiesterases (PDEs) are enzymes that catalyze the hydrolysis of cyclic nucleotides (cAMP and cGMP). Using isoform-specific PDE inhibitors, the function of PDE4D has been proved to be essential for signaling of β2-adrenergic receptor (β2-AR), which is responsible for both the skeletal muscle hypertrophy and anti-atrophy effects of the β-adrenergic agonist (Hinkle et al.

2002; Xiang et al. 2005; Bruss et al. 2008). Therefore, future studies could be conducted to determine the effects of PDE4D in response of β-adrenergic agonist stimulation in muscles. Since most of PDE4D knockout mice died within four weeks of age, the muscle-specific knockout model could be helpful here (Jin et al. 1999).

5.2 PARK7 as a Muscle Growth Regulator

The second study (Chapter 4) characterized a positive role of PARK7 in regulating muscle growth. PARK7 is a molecule that occupies a pivotal position in cellular biology, because a loss or gain of its function drives abnormal cellular responses. This loss or gain

122 may lead either to cell death (loss of function in neurodegenerative disease) or unregulated cell survival (gain of function in cancer), respectively (see Chapter1). In the present thesis, we used the loss-of-function model to determine that the presence of

PARK7 alters the myotube size and myosin gene expression in vitro. However, there is no obvious phenotype observed in vivo, which could be a result of the multiple hormone stimulation, such as IGF1, androgens and β-adrenergic agonists. These different hormone stimulations initiate multiple signaling pathways to regulate growth. Therefore, the loss of Park7 functions in Park7 (-/-) mice may be compensated by other hormones and signaling pathways in vivo. Since the gain-of-function and loss-of-function in PARK7 leads to different cellular responses, the over-expression model will be needed to further determine the role of PARK7 in muscle growth. Furthermore, the expression of PARK7 was highly elevated in hypertrophied muscles. Thus the gain-of-function model is more appropriate to mimic the effects of PARK7 in muscle hypertrophy.

Opposite from muscle hypertrophy, which defines as the increase in muscle mass due to overall rates of protein synthesis exceed rates of protein degradation, the muscle atrophy means the decrease in muscle mass and fiber size when protein degradation rates exceed protein synthesis. Muscle atrophy results from aging, starvation, cancer, diabetes, bed rest, loss of neural input (denervation, motor neuron disease), or catabolic hormonal stimulation (corticosteroids). To better understand the role of PARK7 in muscle growth and development, characterization its function in muscle atrophy will be necessary.

Increased levels of Park7 were identified in sporadic inclusion-body myositis (s-

IBM), which is a progressive muscle disease associated with aging and is manifested by pronounced muscle weakness and wasting (Terracciano et al. 2008). PARK7 is highly

123 oxidized and increased in the mitochondria in s-IBM muscle fibers (Terracciano et al.

2008). A detailed description on the effects of PARK7 on maintaining mitochondrial homeostasis was given in Chapter 1. Though not fully understood, Park7 was reported to act in parallel with the Pink1 and Parkin to positively control mitochondrial homeostasis and autophagy (Thomas et al. 2011). The autophagy-lysosome system is one of the major proteolytic pathways in the cells that are coordinately activated in atrophying, and is crucial for atrophying [for reviews, see (Sandri 2010)]. For example, myofiber atrophy induced in vivo by over-expression of constitutively active FoxO3 requires autophagy.

Conversely, knocking down the critical autophagy gene, LC3, by RNAi partially prevents

FoxO3-mediated muscle loss (Mammucari et al. 2007). Therefore, future studies should address underlying molecular mechanisms on how PARK7 affects atrophy through modulating autophagy. In addition to the cell autophagy, the positive regulation of

PARK7 in NF-κB signaling (see Chapter 1) also implies its role in muscle atrophy, since

NF-κB signaling is known to induce muscle atrophy [for review, see (Peterson et al.

2011)]. The identification of Cezanne, a known deubiquitination enzyme that inhibits

NF-κB activity, as one of the PARK7 binding partners provides a clue to how PARK7 is involved in the NF-κB pathway. However, detailed working machinery on how

Cezanne/PARK7 complex exert its effects as well as identification of other NF-κB targets regulated by PARK7 will be needed in future study.

5.3 Conclusions

The two studies presented in this dissertation provide insights on the genes regulation in callipyge muscle hypertrophy. This chapter describes a few of the common hypothesis and possible pathways arising from these two studies that may contribute to understand

124 the altered muscle growth in callipyge sheep. The data presented here requires extensive further studies, and undoubtedly new future technologies will facilitate these studies in order to be more precise and efforts-saving. Since several of the DLK1 downstream genes play roles in human cancers, better understanding the signals in DLK1-induced muscle hypertrophy could not only benefits agriculture but also has implications for human health.

LIST OF REFERENCES

125

LIST OF REFERENCES

Abdulkhaliq A.M., Meyer H.H., Thompson J.M., Holmes Z.A., Forsberg N.E. & Davis S.L. (2002) Callipyge gene effects on lamb growth, carcass traits, muscle weights and meat characteristics. Small Ruminant Research 45, 89-93.

Abid M.R., Guo S., Minami T., Spokes K.C., Ueki K., Skurk C., Walsh K. & Aird W.C. (2004) Vascular endothelial growth factor activates PI3K/Akt/forkhead signaling in endothelial cells. Arterioscler Thromb Vasc Biol 24, 294-300.

Abou-Sleiman P.M., Healy D.G., Quinn N., Lees A.J. & Wood N.W. (2003) The role of pathogenic DJ-1 mutations in Parkinson's disease. Ann Neurol 54, 283-6.

Aghdassi A., Sendler M., Guenther A., Mayerle J., Behn C.O., Heidecke C.D., Friess H., Buchler M., Evert M., Lerch M.M. & Weiss F.U. (2012) Recruitment of histone deacetylases HDAC1 and HDAC2 by the transcriptional repressor ZEB1 downregulates E-cadherin expression in pancreatic cancer. Gut 61, 439-48.

Ahmadimoghaddam D., Hofman J., Zemankova L., Nachtigal P., Dolezelova E., Cerveny L., Ceckova M., Micuda S. & Staud F. (2012) Synchronized activity of organic cation transporter 3 (Oct3/Slc22a3) and multidrug and toxin extrusion 1 (Mate1/Slc47a1) transporter in transplacental passage of MPP+ in rat. Toxicol Sci 128, 471-81.

Ahmadimoghaddam D., Zemankova L., Nachtigal P., Dolezelova E., Neumanova Z., Cerveny L., Ceckova M., Kacerovsky M., Micuda S. & Staud F. (2013) Organic cation transporter 3 (OCT3/SLC22A3) and multidrug and toxin extrusion 1 (MATE1/SLC47A1) transporter in the placenta and fetal tissues: expression profile and fetus protective role at different stages of gestation. Biol Reprod 88, 55.

Andersen D.C., Petersson S.J., Jorgensen L.H., Bollen P., Jensen P.B., Teisner B., Schroeder H.D. & Jensen C.H. (2009) Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury. Stem Cells 27, 898-908.

126

Annesi G., Savettieri G., Pugliese P., D'Amelio M., Tarantino P., Ragonese P., La Bella V., Piccoli T., Civitelli D., Annesi F., Fierro B., Piccoli F., Arabia G., CaraccioloM., Ciro Candiano I.C. & Quattrone A. (2005) DJ-1 mutations and parkinsonism-dementia-amyotrophic lateral sclerosis complex. Ann Neurol 58, 803-7.

Ariga H., Takahashi-Niki K., Kato I., Maita H., Niki T. & Iguchi-Ariga S.M. (2013) Neuroprotective Function of DJ-1 in Parkinson's Disease. Oxid Med Cell Longev 2013, 683920.Aron L., Klein P., Pham T.T., Kramer E.R., Wurst W. & Klein R. (2010) Pro-survival role for Parkinson's associated gene DJ-1 revealed in trophically impaired dopaminergic neurons. PLoS Biol 8, e1000349.

Artavanis-Tsakonas S., Rand M.D. & Lake R.J. (1999) Notch signaling: cell fate control and signal integration in development. Science 284, 770-6.

Bachmann E., Krogh T.N., Hojrup P., Skjodt K. & Teisner B. (1996) Mouse fetal antigen 1 (mFA1), the circulating gene product of mdlk, pref-1 and SCP-1: isolation, characterization and biology. Journal of Reproduction & Fertility 107, 279-85.

Baladron V., Ruiz-Hidalgo M.J., Nueda M.L., Diaz-Guerra M.J.M., Garcia-Ramirez J.J., Bonvini E., Gubina E. & Laborda J. (2005) dlk acts as a negative regulator of Notch1 activation through interactions with specific EGF-like repeats. Experimental Cell Research 303, 343-59.

Balik V., Srovnal J., Sulla I., Kalita O., Foltanova T., Vaverka M., Hrabalek L. & Hajduch M. (2013) MEG3: a novel long noncoding potentially tumour- suppressing RNA in meningiomas. J Neurooncol 112, 1-8.

Bantscheff M., Hopf C., Savitski M.M., Dittmann A., Grandi P., Michon A.M., Schlegl J., Abraham Y., Becher I., Bergamini G., Boesche M., Delling M., Dumpelfeld B., Eberhard D., Huthmacher C., Mathieson T., Poeckel D., Reader V., Strunk K., Sweetman G., Kruse U., Neubauer G., Ramsden N.G. & Drewes G. (2011) Chemoproteomics profiling of HDAC inhibitors reveals selective targeting of HDAC complexes. Nat Biotechnol 29, 255-65. bCarpenter C.E., Rice O.D., Cockett N.E. & Snowder G.D. (1996) Histology and composition of muscles from normal and callipyge lambs. Journal of Animal Science 74, 388-93.

Berdeaux R. & Stewart R. (2012) cAMP signaling in skeletal muscle adaptation: hypertrophy, metabolism, and regeneration. Am J Physiol Endocrinol Metab 303, E1-17.

Bidwell C.A., Kramer L.N., Perkins A.C., Hadfield T.S., Moody D.E. & Cockett N.E. (2004) Expression of PEG11 and PEG11AS transcripts in normal and callipyge sheep. BMC Biol 2, 17.

127

Bidwell C.A., Shay T.L., Georges M., Beever J.E., Berghmans S. & Cockett N.E. (2001) Differential expression of the GTL2 gene within the callipyge region of ovine chromosome 18. Animal Genetics 32, 248-56.

Blackinton J., Lakshminarasimhan M., Thomas K.J., Ahmad R., Greggio E., Raza A.S., Cookson M.R. & Wilson M.A. (2009) Formation of a stabilized cysteine sulfinic acid is critical for the mitochondrial function of the parkinsonism protein DJ-1. J Biol Chem 284, 6476-85.

Bodine S.C. (2006) mTOR signaling and the molecular adaptation to resistance exercise. Med Sci Sports Exerc 38, 1950-7.

Bodine S.C., Stitt T.N., Gonzalez M., Kline W.O., Stover G.L., Bauerlein R., Zlotchenko E., Scrimgeour A., Lawrence J.C., Glass D.J. & Yancopoulos G.D. (2001) Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol 3, 1014-9.

Bohni R., Riesgo-Escovar J., Oldham S., Brogiolo W., Stocker H., Andruss B.F., Beckingham K. & Hafen E. (1999) Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4. Cell 97, 865-75.

Bonifati V., Rizzu P., van Baren M.J., Schaap O., Breedveld G.J., Krieger E., Dekker M.C., Squitieri F., Ibanez P., Joosse M., van Dongen J.W., Vanacore N., van Swieten J.C., Brice A., Meco G., van Duijn C.M., Oostra B.A. & Heutink P. (2003) Mutations in the DJ-1 gene associated with autosomal recessive early- onset parkinsonism. Science 299, 256-9.

Bray S.J., Takada S., Harrison E., Shen S.C. & Ferguson-Smith A.C. (2008) The atypical mammalian ligand Delta-like homologue 1 (Dlk1) can regulate Notch signalling in Drosophila. BMC Dev Biol 8, 11.

Bretaud S., Allen C., Ingham P.W. & Bandmann O. (2007) p53-dependent neuronal cell death in a DJ-1-deficient zebrafish model of Parkinson's disease. J Neurochem 100, 1626-35.

Bruss M.D., Richter W., Horner K., Jin S.L. & Conti M. (2008) Critical role of PDE4D in beta2-adrenoceptor-dependent cAMP signaling in mouse embryonic fibroblasts. J Biol Chem 283, 22430-42.

Byrne K., Colgrave M.L., Vuocolo T., Pearson R., Bidwell C.A., Cockett N.E., Lynn D.J., Fleming-Waddell J.N. & Tellam R.L. (2010) The imprinted retrotransposon-like gene PEG11 (RTL1) is expressed as a full-length protein in skeletal muscle from Callipyge sheep. PLoS ONE 5, e8638.

128

Caiment F., Charlier C., Hadfield T., Cockett N., Georges M. & Baurain D. (2010) Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. Genome Res 20, 1651-62.

Canet-Aviles R.M., Wilson M.A., Miller D.W., Ahmad R., McLendon C., Bandyopadhyay S., Baptista M.J., Ringe D., Petsko G.A. & Cookson M.R. (2004) The Parkinson's disease protein DJ-1 is neuroprotective due to cysteine-sulfinic acid-driven mitochondrial localization. Proc Natl Acad Sci U S A 101, 9103-8.

Carpenter C.E. & Cockett N.E. (2000) Histology of longissimus muscle from 2-week-old and 8-week-old normal and callipyge lambs. Canadian Journal of Animal Science 80, 511-4.

Carpenter E., Rice O.D., Cockett N.E. & Snowder G.D. (1996) Histology and composition of muscles from normal and callipyge lambs. Journal of Animal Science 74, 388-93.

Chandran J.S., Lin X., Zapata A., Hoke A., Shimoji M., Moore S.O., Galloway M.P., Laird F.M., Wong P.C., Price D.L., Bailey K.R., Crawley J.N., Shippenberg T. & Cai H. (2008) Progressive behavioral deficits in DJ-1-deficient mice are associated with normal nigrostriatal function. Neurobiol Dis 29, 505-14.

Charlier C., Segers K., Karim L., Shay T., Gyapay G., Cockett N. & Georges M. (2001a) The callipyge mutation enhances the expression of coregulated imprinted genes in cis without affecting their imprinting status. Nature Genetics 27, 367-9.

Charlier C., Segers K., Wagenaar D., Karim L., Berghmans S., Jaillon O., Shay T., Weissenbach J., Cockett N., Gyapay G. & Georges M. (2001b) Human-ovine comparative sequencing of a 250-kb imprinted domain encompassing the callipyge (clpg) locus and identification of six imprinted transcripts: DLK1, DAT, GTL2, PEG11, antiPEG11, and MEG8. Genome Research 11, 850-62.

Chavey C., Muhlbauer M., Bossard C., Freund A., Durand S., Jorgensen C., Jobin C. & Lazennec G. (2008) Interleukin-8 expression is regulated by histone deacetylases through the nuclear factor-kappaB pathway in breast cancer. Mol Pharmacol 74, 1359-66.

Chelh I., Meunier B., Picard B., Reecy M.J., Chevalier C., Hocquette J.F. & Cassar- Malek I. (2009) Molecular profiles of Quadriceps muscle in myostatin-null mice reveal PI3K and apoptotic pathways as myostatin targets. BMC Genomics 10, 196.

Chelh I., Picard B., Hocquette J.F. & Cassar-Malek I. (2011) Myostatin inactivation induces a similar muscle molecular signature in double-muscled cattle as in mice. Animal 5, 278-86.

129

Chen L., Hong C., Chen E.C., Yee S.W., Xu L., Almof E.U., Wen C., Fujii K., Johns S.J., Stryke D., Ferrin T.E., Simko J., Chen X., Costello J.F. & Giacomini K.M. (2013) Genetic and epigenetic regulation of the organic cation transporter 3, SLC22A3. Pharmacogenomics J 13, 110-20.

Chen W.S., Xu P.Z., Gottlob K., Chen M.L., Sokol K., Shiyanova T., Roninson I., Weng W., Suzuki R., Tobe K., Kadowaki T. & Hay N. (2001) Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev 15, 2203-8.

Cheng A.C., Huang T.C., Lai C.S., Kuo J.M., Huang Y.T., Lo C.Y., Ho C.T. & Pan M.H. (2006) Pyrrolidine dithiocarbamate inhibition of luteolin-induced apoptosis through up-regulated phosphorylation of Akt and caspase-9 in human leukemia HL-60 cells. J Agric Food Chem 54, 4215-21.

Clark L.N., Afridi S., Mejia-Santana H., Harris J., Louis E.D., Cote L.J., Andrews H., Singleton A., Wavrant De-Vrieze F., Hardy J., Mayeux R., Fahn S., Waters C., Ford B., Frucht S., Ottman R. & Marder K. (2004) Analysis of an early-onset Parkinson's disease cohort for DJ-1 mutations. Mov Disord 19, 796-800.

Clements C.M., McNally R.S., Conti B.J., Mak T.W. & Ting J.P. (2006) DJ-1, a cancer- and Parkinson's disease-associated protein, stabilizes the antioxidant transcriptional master regulator Nrf2. Proc Natl Acad Sci U S A 103, 15091-6.

Clop A., Marcq F., Takeda H., Pirottin D., Tordoir X., Bibe B., Bouix J., Caiment F., Elsen J.M., Eychenne F., Larzul C., Laville E., Meish F., Milenkovic D., Tobin J., Charlier C. & Georges M. (2006) A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat Genet 38, 813-8.

Cloutier P., Lavallee-Adam M., Faubert D., Blanchette M. & Coulombe B. (2013) A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. PLoS Genet 9, e1003210.

Cockett N.E., Jackson S.P., Shay T.L., Farnir F., Berghmans S., Snowder G.D., Nielsen D.M. & Georges M. (1996) Polar overdominance at the ovine callipyge locus. Science 273, 236-8.

Cockett N.E., Jackson S.P., Shay T.L., Nielsen D., Moore S.S., Steele M.R., Barendse W., Green R.D. & Georges M. (1994) Chromosomal localization of the callipyge gene in sheep (Ovis aries) using bovine DNA markers. Proceedings of the National Academy of Sciences, U.S.A. 91, 3019-23.

130

Cross D.A., Alessi D.R., Cohen P., Andjelkovich M. & Hemmings B.A. (1995) Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-9.

Davis E., Caiment F., Tordoir X., Cavaille J., Ferguson-Smith A., Cockett N., Georges M. & Charlier C. (2005) RNAi-Mediated Allelic trans-Interaction at the Imprinted Rtl1/Peg11 Locus. Current Biology 15, 743-9.

Davis E., Jensen C.H., Schroder H.D., Farnir F., Shay-Hadfield T., Kliem A., Cockett N., Georges M. & Charlier C. (2004) Ectopic expression of DLK1 protein in skeletal muscle of padumnal heterozygotes causes the callipyge phenotype. Current Biology 14, 1858-62.

De Mena L., Coto E., Sanchez-Ferrero E., Ribacoba R., Guisasola L.M., Salvador C., Blazquez M. & Alvarez V. (2009) Mutational screening of the mortalin gene (HSPA9) in Parkinson's disease. J Neural Transm 116, 1289-93.

Deeg S., Gralle M., Sroka K., Bahr M., Wouters F.S. & Kermer P. (2010) BAG1 restores formation of functional DJ-1 L166P dimers and DJ-1 chaperone activity. J Cell Biol 188, 505-13.

DeVol D.L., Rotwein P., Sadow J.L., Novakofski J. & Bechtel P.J. (1990) Activation of insulin-like growth factor gene expression during work-induced skeletal muscle growth. Am J Physiol 259, E89-95.

Dezso K., Halasz J., Bisgaard H.C., Paku S., Turanyi E., Schaff Z. & Nagy P. (2008) Delta-like protein (DLK) is a novel immunohistochemical marker for human hepatoblastomas. Virchows Arch 452, 443-8.

Dietz G.P., Stockhausen K.V., Dietz B., Falkenburger B.H., Valbuena P., Opazo F., Lingor P., Meuer K., Weishaupt J.H., Schulz J.B. & Bahr M. (2008) Membrane- permeable Bcl-xL prevents MPTP-induced dopaminergic neuronal loss in the substantia nigra. J Neurochem 104, 757-65.

Djarmati A., Hedrich K., Svetel M., Schafer N., Juric V., Vukosavic S., Hering R., Riess O., Romac S., Klein C. & Kostic V. (2004) Detection of Parkin (PARK2) and DJ1 (PARK7) mutations in early-onset Parkinson disease: Parkin mutation frequency depends on ethnic origin of patients. Hum Mutat 23, 525.

Dong C., Slattery M.J., Liang S. & Peng H.H. (2005) Melanoma cell extravasation under flow conditions is modulated by leukocytes and endogenously produced interleukin 8. Mol Cell Biomech 2, 145-59.

Duckett S.K., Snowder G.D. & Cockett N.E. (2000) Effect of the callipyge gene on muscle growth, calpastatin activity, and tenderness of three muscles across the growth curve. Journal of Animal Science 78, 2836-41.

131

Eltoweissy M., Muller G.A., Bibi A., Nguye P.V., Dihazi G.H., Muller C.A. & Dihazi H. (2011) Proteomics analysis identifies PARK7 as an important player for renal cell resistance and survival under oxidative stress. Mol Biosyst 7, 1277-88.

Fahrenkrug S.C., Freking B.A., Rexroad III C.E., Leymaster K.A., Kappes S.M. & Smith T.P.L. (2000) Comparative mapping of the ovine clpg locus. Mamm Genome 11, 871-6.

Fan J., Ren H., Fei E., Jia N., Ying Z., Jiang P., Wu M. & Wang G. (2008a) Sumoylation is critical for DJ-1 to repress p53 transcriptional activity. FEBS Lett 582, 1151-6.

Fan J., Ren H., Jia N., Fei E., Zhou T., Jiang P., Wu M. & Wang G. (2008b) DJ-1 Decreases Bax Expression through Repressing p53 Transcriptional Activity. J. Biol. Chem. 283, 4022-30.

Fleming-Waddell J.N., Olbricht G.R., Taxis T.M., White J.D., Vuocolo T., Craig B.A., Tellam R.L., Neary M.K., Cockett N.E. & Bidwell C.A. (2009) Effect of DLK1 and RTL1 but Not MEG3 or MEG8 on Muscle Gene Expression in Callipyge Lambs. PLoS ONE 4.

Fleming-Waddell J.N., Wilson L.M., Olbricht G.R., Vuocolo T., Byrne K., Craig B.A., Tellam R.L., Cockett N.E. & Bidwell C.A. (2007) Analysis of gene expression during the onset of muscle hypertrophy in callipyge lambs. Anim Genet 38, 28-36.

Freking B.A., Keele J.W., Beattie C.W., Kappes S.M., Smith T.P., Sonstegard T.S., Nielsen M.K. & Leymaster K.A. (1998a) Evaluation of the ovine callipyge locus: I. Relative chromosomal position and gene action. Journal of Animal Science 76, 2062-71.

Freking B.A., Keele J.W., Nielsen M.K. & Leymaster K.A. (1998b) Evaluation of the ovine callipyge locus: II. Genotypic effects on growth, slaughter, and carcass traits. Journal of Animal Science 76, 2549-59.

Freking B.A., Keele J.W., Shackelford S.D., Wheeler T.L., Koohmaraie M., Nielsen M.K. & Leymaster K.A. (1999) Evaluation of the ovine callipyge locus: III. Genotypic effects on meat quality traits. Journal of Animals Science 77, 2336-44.

Freking B.A., Murphy S.K., Wylie A.A., Rhodes S.J., Keele J.W., Leymaster K.A., Jirtle R.L. & Smith T.P.L. (2002) Identification of the single base change causing the callipyge muscle hypertrophy phenotype, the only known example of polar overdominance in mammals. Genome Research 12, 1496-506.

Gao H., Yang W., Qi Z., Lu L., Duan C., Zhao C. & Yang H. (2012) DJ-1 protects dopaminergic neurons against rotenone-induced apoptosis by enhancing ERK- dependent mitophagy. J Mol Biol 423, 232-48.

132

Georges M., Charlier C. & Cockett N. (2003) The callipyge locus: evidence for the trans interaction of reciprocally imprinted genes. Trends in Genetics 19, 248-52.

Giaime E., Yamaguchi H., Gautier C.A., Kitada T. & Shen J. (2012) Loss of DJ-1 does not affect mitochondrial respiration but increases ROS production and mitochondrial permeability transition pore opening. PLoS ONE 7, e40501.

Girgenrath S., Song K. & Whittemore L.A. (2005) Loss of myostatin expression alters fiber-type distribution and expression of myosin heavy chain isoforms in slow- and fast-type skeletal muscle. Muscle Nerve 31, 34-40.

Glass D.J. (2003a) Molecular mechanisms modulating muscle mass. Trends Mol Med 9, 344-50.

Glass D.J. (2003b) Signalling pathways that mediate skeletal muscle hypertrophy and atrophy. Nat Cell Biol 5, 87-90.

Glass D.J. (2005) Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 37, 1974-84.

Glass D.J. (2010) PI3 kinase regulation of skeletal muscle hypertrophy and atrophy. Curr Top Microbiol Immunol 346, 267-78.

Gonzalez-Polo R., Niso-Santano M., Moran J.M., Ortiz-Ortiz M.A., Bravo-San Pedro J.M., Soler G. & Fuentes J.M. (2009) Silencing DJ-1 reveals its contribution in paraquat-induced autophagy. J Neurochem 109, 889-98.

Goodson K.J., Miller R.K. & Savell J.W. (2001) Carcass traits, muscle characteristics, and palatability attributes of lambs expressing the callipyge phenotype. Meat Sci 58, 381-7.

Gorner K., Holtorf E., Odoy S., Nuscher B., Yamamoto A., Regula J.T., Beyer K., Haass C. & Kahle P.J. (2004) Differential effects of Parkinson's disease-associated mutations on stability and folding of DJ-1. J Biol Chem 279, 6943-51.

Gorner K., Holtorf E., Waak J., Pham T.T., Vogt-Weisenhorn D.M., Wurst W., Haass C. & Kahle P.J. (2007) Structural determinants of the C-terminal helix-kink-helix motif essential for protein stability and survival promoting activity of DJ-1. J Biol Chem 282, 13680-91.

Gu Q., Wang D., Wang X., Peng R., Liu J., Jiang T., Wang Z., Wang S. & Deng H. (2004) Basic fibroblast growth factor inhibits radiation-induced apoptosis of HUVECs. I. The PI3K/AKT pathway and induction of phosphorylation of BAD. Radiat Res 161, 692-702.

133

Gu T., He H., Han Z., Zeng T., Huang Z., Liu Q., Gu N., Chen Y., Sugimoto K., Jiang H. & Wu Q. (2012) Expression of macro non-coding RNAs Meg8 and Irm in mouse embryonic development. Acta Histochem 114, 392-9.

Guldberg P., thor Straten P., Birck A., Ahrenkiel V., Kirkin A.F. & Zeuthen J. (1997) Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event in malignant melanoma. Cancer Res 57, 3660-3.

Guo J.F., Zhang X.W., Nie L.L., Zhang H.N., Liao B., Li J., Wang L., Yan X.X. & Tang B.S. (2010) Mutation analysis of Parkin, PINK1 and DJ-1 genes in Chinese patients with sporadic early onset parkinsonism. J Neurol 257, 1170-5.

Gustin J.A., Ozes O.N., Akca H., Pincheira R., Mayo L.D., Li Q., Guzman J.R., Korgaonkar C.K. & Donner D.B. (2004) Cell type-specific expression of the IkappaB kinases determines the significance of phosphatidylinositol 3-kinase/Akt signaling to NF-kappa B activation. J Biol Chem 279, 1615-20.

Hague S., Rogaeva E., Hernandez D., Gulick C., Singleton A., Hanson M., Johnson J., Weiser R., Gallardo M., Ravina B., Gwinn-Hardy K., Crawley A., St George- Hyslop P.H., Lang A.E., Heutink P., Bonifati V., Hardy J. & Singleton A. (2003) Early-onset Parkinson's disease caused by a compound heterozygous DJ-1 mutation. Ann Neurol 54, 271-4.

Hancock J.T., Desikan R. & Neill S.J. (2001) Role of reactive oxygen species in cell signalling pathways. Biochem Soc Trans 29, 345-50.

Hardt S.E. & Sadoshima J. (2002) Glycogen synthase kinase-3beta: a novel regulator of cardiac hypertrophy and development. Circ Res 90, 1055-63.

Hasegawa K., Lee S.J., Jobe S.M., Markham B.E. & Kitsis R.N. (1997) cis-Acting sequences that mediate induction of beta-myosin heavy chain gene expression during left ventricular hypertrophy due to aortic constriction. Circulation 96, 3943-53.

Hattori K., Naguro I., Runchel C. & Ichijo H. (2009) The roles of ASK family proteins in stress responses and diseases. Cell Commun Signal 7, 9.

Hayakawa R., Hayakawa T., Takeda K. & Ichijo H. (2012) Therapeutic targets in the ASK1-dependent stress signaling pathways. Proc Jpn Acad Ser B Phys Biol Sci 88, 434-53.

Hayashi T., Ishimori C., Takahashi-Niki K., Taira T., Kim Y.C., Maita H., Maita C., Ariga H. & Iguchi-Ariga S.M. (2009) DJ-1 binds to mitochondrial complex I and maintains its activity. Biochem Biophys Res Commun 390, 667-72.

134

He X.Y., Liu B.Y., Yao W.Y., Zhao X.J., Zheng Z., Li J.F., Yu B.Q. & Yuan Y.Z. (2011) Serum DJ-1 as a diagnostic marker and prognostic factor for pancreatic cancer. J Dig Dis 12, 131-7.

Hedrich K., Djarmati A., Schafer N., Hering R., Wellenbrock C., Weiss P.H., Hilker R., Vieregge P., Ozelius L.J., Heutink P., Bonifati V., Schwinger E., Lang A.E., Noth J., Bressman S.B., Pramstaller P.P., Riess O. & Klein C. (2004) DJ-1 (PARK7) mutations are less frequent than Parkin (PARK2) mutations in early-onset Parkinson disease. Neurology 62, 389-94.

Heinlein C.A. & Chang C. (2002) Androgen receptor (AR) coregulators: an overview. Endocr Rev 23, 175-200.

Hennessy B.T., Smith D.L., Ram P.T., Lu Y. & Mills G.B. (2005) Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 4, 988-1004.

Hering R., Strauss K.M., Tao X., Bauer A., Woitalla D., Mietz E.M., Petrovic S., Bauer P., Schaible W., Muller T., Schols L., Klein C., Berg D., Meyer P.T., Schulz J.B., Wollnik B., Tong L., Kruger R. & Riess O. (2004) Novel homozygous p.E64D mutation in DJ1 in early onset Parkinson disease (PARK7). Hum Mutat 24, 321-9.

Hinkle R.T., Hodge K.M., Cody D.B., Sheldon R.J., Kobilka B.K. & Isfort R.J. (2002) Skeletal muscle hypertrophy and anti-atrophy effects of clenbuterol are mediated by the beta2-adrenergic receptor. Muscle Nerve 25, 729-34.

Hod Y., Pentyala S.N., Whyard T.C. & El-Maghrabi M.R. (1999) Identification and characterization of a novel protein that regulates RNA-protein interaction. J Cell Biochem 72, 435-44.

Honbou K., Suzuki N.N., Horiuchi M., Niki T., Taira T., Ariga H. & Inagaki F. (2003a) The crystal structure of DJ-1, a protein related to male fertility and Parkinson's disease. J Biol Chem 278, 31380-4.

Honbou K., Suzuki N.N., Horiuchi M., Taira T., Niki T., Ariga H. & Inagaki F. (2003b) Crystallization and preliminary crystallographic analysis of DJ-1, a protein associated with male fertility and parkinsonism. Acta Crystallogr D Biol Crystallogr 59, 1502-3.

Hornberger T.A., Sukhija K.B., Wang X.R. & Chien S. (2007) mTOR is the rapamycin- sensitive kinase that confers mechanically-induced phosphorylation of the hydrophobic motif site Thr(389) in p70(S6k). FEBS Lett 581, 4562-6.

Hulleman J.D., Mirzaei H., Guigard E., Taylor K.L., Ray S.S., Kay C.M., Regnier F.E. & Rochet J.C. (2007) Destabilization of DJ-1 by familial substitution and oxidative modifications: implications for Parkinson's disease. Biochemistry 46, 5776-89.

135

Irrcher I., Aleyasin H., Seifert E.L., Hewitt S.J., Chhabra S., Phillips M., Lutz A.K., Rousseaux M.W., Bevilacqua L., Jahani-Asl A., Callaghan S., MacLaurin J.G., Winklhofer K.F., Rizzu P., Rippstein P., Kim R.H., Chen C.X., Fon E.A., Slack R.S., Harper M.E., McBride H.M., Mak T.W. & Park D.S. (2010) Loss of the Parkinson's disease-linked gene DJ-1 perturbs mitochondrial dynamics. Hum Mol Genet 19, 3734-46.

Ishikawa S., Taira T., Takahashi-Niki K., Niki T., Ariga H. & Iguchi-Ariga S.M. (2010) Human DJ-1-specific transcriptional activation of tyrosine hydroxylase gene. J Biol Chem 285, 39718-31.

Ishikawa S., Tanaka Y., Takahashi-Niki K., Niki T., Ariga H. & Iguchi-Ariga S.M. (2012) Stimulation of vesicular monoamine transporter 2 activity by DJ-1 in SH-SY5Y cells. Biochem Biophys Res Commun 421, 813-8.

Izumiya Y., Hopkins T., Morris C., Sato K., Zeng L., Viereck J., Hamilton J.A., Ouchi N., LeBrasseur N.K. & Walsh K. (2008) Fast/Glycolytic muscle fiber growth reduces fat mass and improves metabolic parameters in obese mice. Cell Metab 7, 159-72.

Jackson S.P., Green R.D. & Miller M.F. (1997a) Phenotypic characterization of rambouillet sheep expressing the callipyge gene: I. Inheritance of the condition and production characteristics. Journal of Animal Science 75, 14-8.

Jackson S.P., Miller M.F. & Green R.D. (1997b) Phenotypic characterization of rambouillet sheep expressing the callipyge gene: II. Carcass characteristics and retail yield. Journal of Animal Science 75, 125-32.

Jackson S.P., Miller M.F. & Green R.D. (1997c) Phenotypic characterization of rambouillet sheep expression the callipyge gene: III. Muscle weights and muscle weight distribution. J Anim Sci 75, 133-8.

Jensen C., Krogh T., Hojrup P., Clausen P., Skjodt K., Larsson L., Enghild J. & Teisner B. (1994a) Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2. European Journal of Biochemistry 225, 83-92.

Jensen C.H., Krogh T.N., Hojrup P., Clausen P.P., Skjodt K., Larsson L.I., Enghild J.J. & Teisner B. (1994b) Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2. Eur J Biochem 225, 83-92.

Jeong H., Kim M.S., Kwon J., Kim K.S. & Seol W. (2006) Regulation of the transcriptional activity of the tyrosine hydroxylase gene by androgen receptor. Neuroscience Letters 396, 57-61.

136

Jin S.L., Richard F.J., Kuo W.P., D'Ercole A.J. & Conti M. (1999) Impaired growth and fertility of cAMP-specific phosphodiesterase PDE4D-deficient mice. Proc Natl Acad Sci U S A 96, 11998-2003.

Junn E., Jang W.H., Zhao X., Jeong B.S. & Mouradian M.M. (2009) Mitochondrial localization of DJ-1 leads to enhanced neuroprotection. J Neurosci Res 87, 123-9.

Junn E., Taniguchi H., Jeong B.S., Zhao X., Ichijo H. & Mouradian M.M. (2005) Interaction of DJ-1 with Daxx inhibits apoptosis signal-regulating kinase 1 activity and cell death. Proc Natl Acad Sci U S A 102, 9691-6.

Kambadur R., Sharma M., Smith T.P. & Bass J.J. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res 7, 910-6.

Kao H.Y., Downes M., Ordentlich P. & Evans R.M. (2000) Isolation of a novel histone deacetylase reveals that class I and class II deacetylases promote SMRT-mediated repression. Genes Dev 14, 55-66.

Karunakaran S., Diwakar L., Saeed U., Agarwal V., Ramakrishnan S., Iyengar S. & Ravindranath V. (2007) Activation of apoptosis signal regulating kinase 1 (ASK1) and translocation of death-associated protein, Daxx, in substantia nigra pars compacta in a mouse model of Parkinson's disease: protection by alpha-lipoic acid. FASEB J 21, 2226-36.

Kato I., Maita H., Takahashi-Niki K., Saito Y., Noguchi N., Iguchi-Ariga S.M. & Ariga H. (2013) Oxidized DJ-1 inhibits p53 by sequestering p53 from promoters in a DNA-binding affinity-dependent manner. Mol Cell Biol 33, 340-59.

Kaydos E.H., Suarez J.D., Roberts N.L., Bobseine K., Zucker R., Laskey J. & Klinefelter G.R. (2004) Haloacid induced alterations in fertility and the sperm biomarker SP22 in the rat are additive: validation of an ELISA. Toxicol Sci 81, 430-42.

Kerth C.R., Jackson S.P., Ramsey C.B. & Miller M.F. (2003) Characterization and consumer acceptance of three muscles from Hampshire x Rambouillet cross sheep expressing the callipyge phenotype. J Anim Sci 81, 2213-8.

Keyser R.J., van der Merwe L., Venter M., Kinnear C., Warnich L., Carr J. & Bardien S. (2009) Identification of a novel functional deletion variant in the 5'-UTR of the DJ-1 gene. BMC Med Genet 10, 105.

Kim K.S., Kim J.J., Dekkers J.C. & Rothschild M.F. (2004) Polar overdominant inheritance of a DLK1 polymorphism is associated with growth and fatness in pigs. Mamm Genome 15, 552-9.

137

Kim R.H., Peters M., Jang Y., Shi W., Pintilie M., Fletcher G.C., DeLuca C., Liepa J., Zhou L., Snow B., Binari R.C., Manoukian A.S., Bray M.R., Liu F.F., Tsao M.S. & Mak T.W. (2005a) DJ-1, a novel regulator of the tumor suppressor PTEN. Cancer Cell 7, 263-73.

Kim R.H., Smith P.D., Aleyasin H., Hayley S., Mount M.P., Pownall S., Wakeham A., You-Ten A.J., Kalia S.K., Horne P., Westaway D., Lozano A.M., Anisman H., Park D.S. & Mak T.W. (2005b) Hypersensitivity of DJ-1-deficient mice to 1- methyl-4-phenyl-1,2,3,6-tetrahydropyrindine (MPTP) and oxidative stress. Proc Natl Acad Sci U S A 102, 5215-20.

Kim Y.C., Kitaura H., Taira T., Iguchi-Ariga S.M. & Ariga H. (2009) Oxidation of DJ-1- dependent cell transformation through direct binding of DJ-1 to PTEN. Int J Oncol 35, 1331-41.

Kimball S.R., Shantz L.M., Horetsky R.L. & Jefferson L.S. (1999) Leucine regulates translation of specific mRNAs in L6 myoblasts through mTOR-mediated changes in availability of eIF4E and phosphorylation of ribosomal protein S6. J Biol Chem 274, 11647-52.

Kinumi T., Kimata J., Taira T., Ariga H. & Niki E. (2004) Cysteine-106 of DJ-1 is the most sensitive cysteine residue to hydrogen peroxide-mediated oxidation in vivo in human umbilical vein endothelial cells. Biochem Biophys Res Commun 317, 722-8.

Klinefelter G.R. (2008) Saga of a sperm fertility biomarker. Anim Reprod Sci 105, 90- 103.

Klinefelter G.R., Strader L.F., Suarez J.D., Roberts N.L., Goldman J.M. & Murr A.S. (2004) Continuous exposure to dibromoacetic acid delays pubertal development and compromises sperm quality in the rat. Toxicol Sci 81, 419-29.

Klinefelter G.R., Welch J.E., Perreault S.D., Moore H.D., Zucker R.M., Suarez J.D., Roberts N.L., Bobseine K. & Jeffay S. (2002) Localization of the sperm protein SP22 and inhibition of fertility in vivo and in vitro. J Androl 23, 48-63.

Koohmaraie M., Shackelford S.D. & Wheeler T.L. (1996) Effects of a beta-adrenergic agonist (L-644,969) and male sex condition on muscle growth and meat quality of callipyge lambs. Journal of Animal Science 74, 70-9.

Koohmaraie M., Shackelford S.D., Wheeler T.L., Lonergan S.M. & Doumit M.E. (1995) A muscle hypertrophy condition in lamb (callipyge): characterization of effects on muscle growth and meat quality traits. Journal of Animal Science 73, 3596-607.

138

Krebiehl G., Ruckerbauer S., Burbulla L.F., Kieper N., Maurer B., Waak J., Wolburg H., Gizatullina Z., Gellerich F.N., Woitalla D., Riess O., Kahle P.J., Proikas-Cezanne T. & Kruger R. (2010) Reduced basal autophagy and impaired mitochondrial dynamics due to loss of Parkinson's disease-associated protein DJ-1. PLoS ONE 5, e9367.

Kretchmar D.H., Hathaway M.R., Epley R.J. & Dayton W.R. (1990) Alterations in postmortem degradation of myofibrillar proteins in muscle of lambs fed a beta- adrenergic agonist. J Anim Sci 68, 1760-72.

Kuang S., Charge S.B., Seale P., Huh M. & Rudnicki M.A. (2006) Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J Cell Biol 172, 103-13.

Kuang S. & Rudnicki M.A. (2008) The emerging biology of satellite cells and their therapeutic potential. Trends Mol Med 14, 82-91.

Kubota T., Koiwai O., Hori K., Watanabe N. & Koiwai K. (2013) TdIF1 Recognizes a Specific DNA Sequence through Its Helix-Turn-Helix and AT-Hook Motifs to Regulate Gene Transcription. PLoS ONE 8, e66710.

Kubota T., Maezawa S., Koiwai K., Hayano T. & Koiwai O. (2007) Identification of functional domains in TdIF1 and its inhibitory mechanism for TdT activity. Genes Cells 12, 941-59.

Kwon J., Lee S.R., Yang K.S., Ahn Y., Kim Y.J., Stadtman E.R. & Rhee S.G. (2004) Reversible oxidation and inactivation of the tumor suppressor PTEN in cells stimulated with peptide growth factors. Proc Natl Acad Sci U S A 101, 16419-24.

Laborda J. (2000) The role of the epidermal growth factor-like protein dlk in cell differentiation. Histol Histopathol 15, 119-29.

Laborda J., Sausville E., Hoffman T. & Notario V. (1993) Dlk, a putative mammalian homeotic gene differentially expressed in small cell lung carcinoma and neuroendocrine tumor cell line. J. Biol. Chem. 268, 3817-20.

Lai K.M., Gonzalez M., Poueymirou W.T., Kline W.O., Na E., Zlotchenko E., Stitt T.N., Economides A.N., Yancopoulos G.D. & Glass D.J. (2004) Conditional activation of akt in adult skeletal muscle induces rapid hypertrophy. Mol Cell Biol 24, 9295- 304.

Latres E., Amini A.R., Amini A.A., Griffiths J., Martin F.J., Wei Y., Lin H.C., Yancopoulos G.D. & Glass D.J. (2005) Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-induced genes via the phosphatidylinositol 3- kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway. J Biol Chem 280, 2737-44.

139

Lawlor M.A. & Rotwein P. (2000) Insulin-like growth factor-mediated muscle cell survival: central roles for Akt and cyclin-dependent kinase inhibitor p21. Mol Cell Biol 20, 8983-95.

Le Bacquer O., Petroulakis E., Paglialunga S., Poulin F., Richard D., Cianflone K. & Sonenberg N. (2007) Elevated sensitivity to diet-induced obesity and insulin resistance in mice lacking 4E-BP1 and 4E-BP2. J Clin Invest 117, 387-96.

Lee S.J. (2004) Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20, 61- 86.

Lee S.J., Kim S.J., Kim I.K., Ko J., Jeong C.S., Kim G.H., Park C., Kang S.O., Suh P.G., Lee H.S. & Cha S.S. (2003) Crystal structures of human DJ-1 and Escherichia coli Hsp31, which share an evolutionarily conserved domain. J Biol Chem 278, 44552-9.

Lee S.R., Yang K.S., Kwon J., Lee C., Jeong W. & Rhee S.G. (2002) Reversible inactivation of the tumor suppressor PTEN by H2O2. J Biol Chem 277, 20336-42.

Lee W.K., Wolff N.A. & Thevenod F. (2009) Organic cation transporters: physiology, toxicology and special focus on ethidium as a novel substrate. Curr Drug Metab 10, 617-31.

Leevers S.J., Weinkove D., MacDougall L.K., Hafen E. & Waterfield M.D. (1996) The Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J 15, 6584-94.

Lev N., Ickowicz D., Barhum Y., Lev S., Melamed E. & Offen D. (2009) DJ-1 protects against dopamine toxicity. J Neural Transm 116, 151-60.

Li H.M., Niki T., Taira T., Iguchi-Ariga S.M. & Ariga H. (2005) Association of DJ-1 with chaperones and enhanced association and colocalization with mitochondrial Hsp70 by oxidative stress. Free Radic Res 39, 1091-9.

Liu H., Palmer D., Jimmo S.L., Tilley D.G., Dunkerley H.A., Pang S.C. & Maurice D.H. (2000) Expression of phosphodiesterase 4D (PDE4D) is regulated by both the cyclic AMP-dependent protein kinase and mitogen-activated protein kinase signaling pathways. A potential mechanism allowing for the coordinated regulation of PDE4D activity and expression in cells. J Biol Chem 275, 26615-24.

Liu H., Wang M., Li M., Wang D., Rao Q., Wang Y., Xu Z. & Wang J. (2008) Expression and role of DJ-1 in leukemia. Biochem Biophys Res Commun 375, 477-83.

Liu W., Wen Y., Bi P., Lai X., Liu X.S., Liu X. & Kuang S. (2012) Hypoxia promotes satellite cell self-renewal and enhances the efficiency of myoblast transplantation. Development 139, 2857-65.

140

Livak K.J. & Schmittgen T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-8.

Lorenzen C.L., Koohmaraie M., Shackelford S.D., Jahoor F., Freetly H.C., Wheeler T.L., Savell J.W. & Fiorotto M.L. (2000) Protein kinetics in callipyge lambs. Journal of Animal Science 78, 78-87.

Lu L., Sun X., Liu Y., Zhao H., Zhao S. & Yang H. (2012) DJ-1 upregulates tyrosine hydroxylase gene expression by activating its transcriptional factor Nurr1 via the ERK1/2 pathway. Int J Biochem Cell Biol 44, 65-71.

Macedo M.G., Verbaan D., Fang Y., van Rooden S.M., Visser M., Anar B., Uras A., Groen J.L., Rizzu P., van Hilten J.J. & Heutink P. (2009) Genotypic and phenotypic characteristics of Dutch patients with early onset Parkinson's disease. Mov Disord 24, 196-203.

Macintosh R.L. & Ryan K.M. (2013) Autophagy in tumour cell death. Semin Cancer Biol.

Maehama T. & Dixon J.E. (1998) The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5- trisphosphate. J Biol Chem 273, 13375-8.

Maita C., Maita H., Iguchi-Ariga S.M. & Ariga H. (2013) Monomer DJ-1 and its N- terminal sequence are necessary for mitochondrial localization of DJ-1 mutants. PLoS ONE 8, e54087.

Mammucari C., Milan G., Romanello V., Masiero E., Rudolf R., Del Piccolo P., Burden S.J., Di Lisi R., Sandri C., Zhao J., Goldberg A.L., Schiaffino S. & Sandri M. (2007) FoxO3 controls autophagy in skeletal muscle in vivo. Cell Metab 6, 458- 71.

Marchler-Bauer A., Anderson J.B., Derbyshire M.K., DeWeese-Scott C., Gonzales N.R., Gwadz M., Hao L., He S., Hurwitz D.I., Jackson J.D., Ke Z., Krylov D., Lanczycki C.J., Liebert C.A., Liu C., Lu F., Lu S., Marchler G.H., Mullokandov M., Song J.S., Thanki N., Yamashita R.A., Yin J.J., Zhang D. & Bryant S.H. (2007) CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res 35, D237-40.

Martin J.L. & McMillan F.M. (2002) SAM (dependent) I AM: the S- adenosylmethionine-dependent methyltransferase fold. Curr Opin Struct Biol 12, 783-93.

Martinat C., Shendelman S., Jonason A., Leete T., Beal M.F., Yang L., Floss T. & Abeliovich A. (2004) Sensitivity to oxidative stress in DJ-1-deficient dopamine neurons: an ES- derived cell model of primary Parkinsonism. PLoS Biol 2, e327.

141

Mavalli M.D., DiGirolamo D.J., Fan Y., Riddle R.C., Campbell K.S., van Groen T., Frank S.J., Sperling M.A., Esser K.A., Bamman M.M. & Clemens T.L. (2010) Distinct growth hormone receptor signaling modes regulate skeletal muscle development and insulin sensitivity in mice. J Clin Invest 120, 4007-20.

McCroskery S., Thomas M., Platt L., Hennebry A., Nishimura T., McLeay L., Sharma M. & Kambadur R. (2005) Improved muscle healing through enhanced regeneration and reduced fibrosis in myostatin-null mice. J Cell Sci 118, 3531-41.

McNally R.S., Davis B.K., Clements C.M., Accavitti-Loper M.A., Mak T.W. & Ting J.P. (2011) DJ-1 enhances cell survival through the binding of Cezanne, a negative regulator of NF-kappaB. J Biol Chem 286, 4098-106.

McPherron A.C. & Lee S.J. (1997a) Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A 94, 12457-61.

McPherron A.C. & Lee S.J. (1997b) Double muscling in cattle due to mutations in the myostatin gene. Proceedings of the National Academy of Sciences of the United States of America 94, 12457-61.

Meng Z.X., Li S., Wang L., Ko H.J., Lee Y., Jung D.Y., Okutsu M., Yan Z., Kim J.K. & Lin J.D. (2013) Baf60c drives glycolytic metabolism in the muscle and improves systemic glucose homeostasis through Deptor-mediated Akt activation. Nat Med 19, 640-5.

Menzies F.M., Yenisetti S.C. & Min K.T. (2005) Roles of Drosophila DJ-1 in survival of dopaminergic neurons and oxidative stress. Curr Biol 15, 1578-82.

Meulener M.C., Xu K., Thomson L., Ischiropoulos H. & Bonini N.M. (2006) Mutational analysis of DJ-1 in Drosophila implicates functional inactivation by oxidative damage and aging. Proc Natl Acad Sci U S A 103, 12517-22.

Miller D.W., Ahmad R., Hague S., Baptista M.J., Canet-Aviles R., McLendon C., Carter D.M., Zhu P.P., Stadler J., Chandran J., Klinefelter G.R., Blackstone C. & Cookson M.R. (2003) L166P mutant DJ-1, causative for recessive Parkinson's disease, is degraded through the ubiquitin-proteasome system. J Biol Chem 278, 36588-95.

Mitsumoto A. & Nakagawa Y. (2001) DJ-1 is an indicator for endogenous reactive oxygen species elicited by endotoxin. Free Radic Res 35, 885-93.

Mitsumoto A., Nakagawa Y., Takeuchi A., Okawa K., Iwamatsu A. & Takanezawa Y. (2001) Oxidized forms of peroxiredoxins and DJ-1 on two-dimensional gels increased in response to sublethal levels of paraquat. Free Radic Res 35, 301-10.

142

Miyajima Y., Sato Y., Oka H., Utsuki S., Kondo K., Tanizaki Y., Nagashio R., Tsuchiya B., Okayasu I. & Fujii K. (2010) Prognostic significance of nuclear DJ-1 expression in astrocytoma. Anticancer Res 30, 265-9.

Mo J.S., Kim M.Y., Ann E.J., Hong J.A. & Park H.S. (2008) DJ-1 modulates UV- induced oxidative stress signaling through the suppression of MEKK1 and cell death. Cell Death Differ 15, 1030-41.

Moon Y.S., Smas C.M., Lee K., Villena J.A., Kim K.-H., Yun E.J. & Sul H.S. (2002) Mice Lacking Paternally Expressed Pref-1/Dlk1 Display Growth Retardation and Accelerated Adiposity. Mol. Cell. Biol. 22, 5585-92.

Moore D.J., Zhang L., Dawson T.M. & Dawson V.L. (2003) A missense mutation (L166P) in DJ-1, linked to familial Parkinson's disease, confers reduced protein stability and impairs homo-oligomerization. J Neurochem 87, 1558-67.

Morgensztern D. & McLeod H.L. (2005) PI3K/Akt/mTOR pathway as a target for cancer therapy. Anticancer Drugs 16, 797-803.

Mosher D.S., Quignon P., Bustamante C.D., Sutter N.B., Mellersh C.S., Parker H.G. & Ostrander E.A. (2007) A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet 3, e79.

Murphy S.K., Nolan C.M., Huang Z., Kucera K.S., Freking B.A., Smith T.P., Leymaster K.A., Weidman J.R. & Jirtle R.L. (2006) Callipyge mutation affects gene expression in cis: a potential role for chromatin structure. Genome Res 16, 340-6.

Musaro A., McCullagh K., Paul A., Houghton L., Dobrowolny G., Molinaro M., Barton E.R., Sweeney H.L. & Rosenthal N. (2001) Localized Igf-1 transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet 27, 195-200.

Nachaliel N., Jain D. & Hod Y. (1993) A cAMP-regulated RNA-binding protein that interacts with phosphoenolpyruvate carboxykinase (GTP) mRNA. J Biol Chem 268, 24203-9.

Nagakubo D., Taira T., Kitaura H., Ikeda M., Tamai K., Iguchi-Ariga S.M. & Ariga H. (1997) DJ-1, a novel oncogene which transforms mouse NIH3T3 cells in cooperation with ras. Biochem Biophys Res Commun 231, 509-13.

Nies A.T., Koepsell H., Damme K. & Schwab M. (2011) Organic cation transporters (OCTs, MATEs), in vitro and in vivo evidence for the importance in drug therapy. Handb Exp Pharmacol, 105-67.

143

Niki T., Takahashi-Niki K., Taira T., Iguchi-Ariga S.M.M. & Ariga H. (2003) DJBP: A Novel DJ-1-Binding Protein, Negatively Regulates the Androgen Receptor by Recruiting Histone Deacetylase Complex, and DJ-1 Antagonizes This Inhibition by Abrogation of This Complex. Mol Cancer Res 1, 247-61.

Nishinaga H., Takahashi-Niki K., Taira T., Andreadis A., Iguchi-Ariga S.M.M. & Ariga H. (2005) Expression profiles of genes in DJ-1-knockdown and L166P DJ-1 mutant cells. Neuroscience Letters 390, 54-9.

Nofziger D., Miyamoto A., Lyons K.M. & Weinmaster G. (1999) Notch signaling imposes two distinct blocks in the differentiation of C2C12 myoblasts. Development 126, 1689-702.

Okada M., Matsumoto K., Niki T., Taira T., Iguchi-Ariga S.M. & Ariga H. (2002) DJ-1, a target protein for an endocrine disrupter, participates in the fertilization in mice. Biol Pharm Bull 25, 853-6.

Okamoto M., Takemori H., Halder S.K., Nonaka Y. & Osamu H. (1998) Implication of Zog protein (zona glomerulosa-specific protein) in zone development of the adrenal cortex. Endocr Res 24, 515-20.

Olzmann J.A., Brown K., Wilkinson K.D., Rees H.D., Huai Q., Ke H., Levey A.I., Li L. & Chin L.S. (2004) Familial Parkinson's disease-associated L166P mutation disrupts DJ-1 protein folding and function. J Biol Chem 279, 8506-15.

Pallafacchina G., Calabria E., Serrano A.L., Kalhovde J.M. & Schiaffino S. (2002) A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification. Proceedings of the National Academy of Sciences 99, 9213-8.

Pankratz N., Pauciulo M.W., Elsaesser V.E., Marek D.K., Halter C.A., Wojcieszek J., Rudolph A., Shults C.W., Foroud T., Nichols W.C. & Parkinson Study Group P.I. (2006) Mutations in DJ-1 are rare in familial Parkinson disease. Neuroscience Letters 408, 209-13.

Perkins A.C., Kramer L.N., Spurlock D.M., Hadfield T.S., Cockett N.E. & Bidwell C.A. (2006) Postnatal changes in the expression of genes located in the callipyge region in sheep skeletal muscle. Anim Genet 37, 535-42.

Perkinton M.S., Ip J.K., Wood G.L., Crossthwaite A.J. & Williams R.J. (2002) Phosphatidylinositol 3-kinase is a central mediator of NMDA receptor signalling to MAP kinase (Erk1/2), Akt/PKB and CREB in striatal neurones. J Neurochem 80, 239-54.

Peterson J.M., Bakkar N. & Guttridge D.C. (2011) NF-kappaB signaling in skeletal muscle health and disease. Curr Top Dev Biol 96, 85-119.

144

Pringle T.D., Calkins C.R., Koohmaraie M. & Jones S.J. (1993) Effects over time of feeding a beta-adrenergic agonist to wether lambs on animal performance, muscle growth, endogenous muscle proteinase activities, and meat tenderness. J Anim Sci 71, 636-44.

Pucci-Minafra I., Cancemi P., Albanese N.N., Di Cara G., Marabeti M.R., Marrazzo A. & Minafra S. (2008) New protein clustering of breast cancer tissue proteomics using actin content as a cellularity indicator. J Proteome Res 7, 1412-8.

Rebbapragada A., Benchabane H., Wrana J.L., Celeste A.J. & Attisano L. (2003) Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23, 7230-42.

Ren H., Fu K., Wang D., Mu C. & Wang G. (2011) Oxidized DJ-1 interacts with the mitochondrial protein BCL-XL. J Biol Chem 286, 35308-17.

Richter W., Jin S.L. & Conti M. (2005) Splice variants of the cyclic nucleotide phosphodiesterase PDE4D are differentially expressed and regulated in rat tissue. Biochem J 388, 803-11.

Riordan J.D., Keng V.W., Tschida B.R., Scheetz T.E., Bell J.B., Podetz-Pedersen K.M., Moser C.D., Copeland N.G., Jenkins N.A., Roberts L.R., Largaespada D.A. & Dupuy A.J. (2013) Identification of rtl1, a retrotransposon-derived imprinted gene, as a novel driver of hepatocarcinogenesis. PLoS Genet 9, e1003441.

Risson V., Mazelin L., Roceri M., Sanchez H., Moncollin V., Corneloup C., Richard- Bulteau H., Vignaud A., Baas D., Defour A., Freyssenet D., Tanti J.F., Le- Marchand-Brustel Y., Ferrier B., Conjard-Duplany A., Romanino K., Bauche S., Hantai D., Mueller M., Kozma S.C., Thomas G., Ruegg M.A., Ferry A., Pende M., Bigard X., Koulmann N., Schaeffer L. & Gangloff Y.G. (2009) Muscle inactivation of mTOR causes metabolic and dystrophin defects leading to severe myopathy. J Cell Biol 187, 859-74.

Rommel C., Bodine S.C., Clarke B.A., Rossman R., Nunez L., Stitt T.N., Yancopoulos G.D. & Glass D.J. (2001) Mediation of IGF-1-induced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat Cell Biol 3, 1009-13.

Rommel C., Clarke B.A., Zimmermann S., Nunez L., Rossman R., Reid K., Moelling K., Yancopoulos G.D. & Glass D.J. (1999) Differentiation stage-specific inhibition of the Raf-MEK-ERK pathway by Akt. Science 286, 1738-41.

Rosivatz E., Matthews J.G., McDonald N.Q., Mulet X., Ho K.K., Lossi N., Schmid A.C., Mirabelli M., Pomeranz K.M., Erneux C., Lam E.W., Vilar R. & Woscholski R. (2006) A small molecule inhibitor for phosphatase and tensin homologue deleted on chromosome 10 (PTEN). ACS Chem Biol 1, 780-90.

145

Rubie C., Frick V.O., Pfeil S., Wagner M., Kollmar O., Kopp B., Graber S., Rau B.M. & Schilling M.K. (2007) Correlation of IL-8 with induction, progression and metastatic potential of colorectal cancer. World J Gastroenterol 13, 4996-5002.

Russell A.P. (2010) Molecular regulation of skeletal muscle mass. Clin Exp Pharmacol Physiol 37, 378-84.

Sandirasegarane L. & Kester M. (2001) Enhanced stimulation of Akt-3/protein kinase B- gamma in human aortic smooth muscle cells. Biochem Biophys Res Commun 283, 158-63.

Sandri M. (2010) Autophagy in skeletal muscle. FEBS Lett 584, 1411-6.

Sartori R., Milan G., Patron M., Mammucari C., Blaauw B., Abraham R. & Sandri M. (2009) Smad2 and 3 transcription factors control muscle mass in adulthood. Am J Physiol Cell Physiol 296, C1248-57.

Savitt J.M., Jang S.S., Mu W., Dawson V.L. & Dawson T.M. (2005) Bcl-x is required for proper development of the mouse substantia nigra. J Neurosci 25, 6721-8.

Schiaffino S., Dyar K.A., Ciciliot S., Blaauw B. & Sandri M. (2013) Mechanisms regulating skeletal muscle growth and atrophy. FEBS J.

Schmidt J.V., Matteson P.G., Jones B.K., Guan X.J. & Tilghman S.M. (2000) The Dlk1 and Gtl2 genes are linked and reciprocally imprinted. Genes Dev 14, 1997-2002.

Schubert H.L., Blumenthal R.M. & Cheng X. (2003) Many paths to methyltransfer: a chronicle of convergence. Trends Biochem Sci 28, 329-35.

Segre C.V. & Chiocca S. (2011) Regulating the regulators: the post-translational code of class I HDAC1 and HDAC2. J Biomed Biotechnol 2011, 690848.

Seitz H., Royo H., Bortolin M.L., Lin S.P., Ferguson-Smith A.C. & Cavaille J. (2004) A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. Genome Res 14, 1741-8.

Seitz H., Youngson N., Lin S.-P., Dalbert S., Paulsen M., Bachellerie J.-P., Ferguson- Smith A.C. & Cavaillé J. (2003a) Imprinted microRNA genes transcribed antisense to a reciprocally imprinted retrotransposon-like gene. Nature Genetics 34, 261-2.

Seitz H., Youngson N., Lin S.P., Dalbert S., Paulsen M., Bachellerie J.P., Ferguson- Smith A.C. & Cavaille J. (2003b) Imprinted microRNA genes transcribed antisense to a reciprocally imprinted retrotransposon-like gene. Nat Genet 34, 261-2.

146

Sekita Y., Wagatsuma H., Nakamura K., Ono R., Kagami M., Wakisaka N., Hino T., Suzuki-Migishima R., Kohda T., Ogura A., Ogata T., Yokoyama M., Kaneko- Ishino T. & Ishino F. (2008) Role of retrotransposon-derived imprinted gene, Rtl1, in the feto-maternal interface of mouse placenta. Nat Genet 40, 243-8.

Shackelford S.D., Wheeler T.L. & Koohmaraie M. (1997) Effect of the callipyge phenotype and cooking method on tenderness of several major lamb muscles. Journal of Animal Science 75, 2100-5.

Shaikh S.I. & Verma H. (2011) Parkinson's disease and anaesthesia. Indian J Anaesth 55, 228-34.

Shay T.L., Berghmans S., Segers K., Meyers S., Beever J.E., Womack J.E., Georges M., Charlier C. & Cockett N.E. (2001) Fine-mapping and construction of a bovine contig spanning the ovine callipyge locus. Mammalian Genome 12, 141-9.

Shendelman S., Jonason A., Martinat C., Leete T. & Abeliovich A. (2004) DJ-1 is a redox-dependent molecular chaperone that inhibits alpha-synuclein aggregate formation. PLoS Biol 2, e362.

Shinbo Y., Niki T., Taira T., Ooe H., Takahashi-Niki K., Maita C., Seino C., Iguchi- Ariga S.M. & Ariga H. (2006) Proper SUMO-1 conjugation is essential to DJ-1 to exert its full activities. Cell Death Differ 13, 96-108.

Shinbo Y., Taira T., Niki T., Iguchi-Ariga S.M. & Ariga H. (2005) DJ-1 restores p53 transcription activity inhibited by Topors/p53BP3. Int J Oncol 26, 641-8.

Singh R.K. & Lokeshwar B.L. (2009) Depletion of intrinsic expression of Interleukin-8 in prostate cancer cells causes cell cycle arrest, spontaneous apoptosis and increases the efficacy of chemotherapeutic drugs. Mol Cancer 8, 57.

Smas C., Chen L. & Sul H. (1997) Cleavage of membrane-associated pref-1 generates a soluble inhibitor of adipocyte differentiation. Mol. Cell. Biol. 17, 977-88.

Smas C.M. & Sul H.S. (1993) Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73, 725-34.

Smas C.M., Sul, HS. (1993) Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73, 725-34.

Smit M., Segers K., Carrascosa L.G., Shay T., Baraldi F., Gyapay G., Snowder G., Georges M., Cockett N. & Charlier C. (2003) Mosaicism of Solid Gold supports the causality of a noncoding A-to-G transition in the determinism of the callipyge phenotype. Genetics 163, 453-6.

147

Smith N.D., Rubenstein J.N., Eggener S.E. & Kozlowski J.M. (2003) The p53 tumor suppressor gene and nuclear protein: basic science review and relevance in the management of bladder cancer. J Urol 169, 1219-28.

Stavaux D., Art T., McEntee K., Reznick M. & Lekeux P. (1994) Muscle fibre type and size, and muscle capillary density in young double-muscled blue Belgian cattle. Zentralbl Veterinarmed A 41, 229-36.

Stitt T.N., Drujan D., Clarke B.A., Panaro F., Timofeyva Y., Kline W.O., Gonzalez M., Yancopoulos G.D. & Glass D.J. (2004) The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14, 395-403.

Swoap S.J. (1998) In vivo analysis of the myosin heavy chain IIB promoter region. Am J Physiol 274, C681-7.

Taira T., Saito Y., Niki T., Iguchi-Ariga S.M., Takahashi K. & Ariga H. (2004) DJ-1 has a role in antioxidative stress to prevent cell death. EMBO Rep 5, 213-8.

Takahashi K., Taira T., Niki T., Seino C., Iguchi-Ariga S.M. & Ariga H. (2001) DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J Biol Chem 276, 37556-63.

Takeda H., Caiment F., Smit M., Hiard S., Tordoir X., Cockett N., Georges M. & Charlier C. (2006) The callipyge mutation enhances bidirectional long-range DLK1-GTL2 intergenic transcription in cis. Proc Natl Acad Sci U S A 103, 8119- 24.

Takeda S., North D.L., Lakich M.M., Russell S.D. & Whalen R.G. (1992) A possible regulatory role for conserved promoter motifs in an adult- specific muscle myosin gene from mouse. J. Biol. Chem. 267, 16957-67.

Tang B., Xiong H., Sun P., Zhang Y., Wang D., Hu Z., Zhu Z., Ma H., Pan Q., Xia J.H., Xia K. & Zhang Z. (2006) Association of PINK1 and DJ-1 confers digenic inheritance of early-onset Parkinson's disease. Hum Mol Genet 15, 1816-25.

Tanimizu N., Nishikawa M., Saito H., Tsujimura T. & Miyajima A. (2003) Isolation of hepatoblasts based on the expression of Dlk/Pref-1. J Cell Sci 116, 1775-86.

Tarantino P., Civitelli D., Annesi F., De Marco E.V., Rocca F.E., Pugliese P., Nicoletti G., Carrideo S., Provenzano G., Annesi G. & Quattrone A. (2009) Compound heterozygosity in DJ-1 gene non-coding portion related to parkinsonism. Parkinsonism Relat Disord 15, 324-6.

Taylor W.E., Bhasin S., Artaza J., Byhower F., Azam M., Willard D.H., Jr., Kull F.C., Jr. & Gonzalez-Cadavid N. (2001) Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am J Physiol Endocrinol Metab 280, E221-8.

148

Terracciano C., Nogalska A., Engel W.K., Wojcik S. & Askanas V. (2008) In inclusion- body myositis muscle fibers Parkinson-associated DJ-1 is increased and oxidized. Free Radical Biology and Medicine 45, 773-9.

Thomas K.J., McCoy M.K., Blackinton J., Beilina A., van der Brug M., Sandebring A., Miller D., Maric D., Cedazo-Minguez A. & Cookson M.R. (2011) DJ-1 acts in parallel to the PINK1/parkin pathway to control mitochondrial function and autophagy. Hum Mol Genet 20, 40-50.

Tillman J.E., Yuan J., Gu G., Fazli L., Ghosh R., Flynt A.S., Gleave M., Rennie P.S. & Kasper S. (2007) DJ-1 binds androgen receptor directly and mediates its activity in hormonally treated prostate cancer cells. Cancer Res 67, 4630-7.

Trempe J.F. & Fon E.A. (2013) Structure and Function of Parkin, PINK1, and DJ-1, the Three Musketeers of Neuroprotection. Front Neurol 4, 38.

Trendelenburg A.U., Meyer A., Rohner D., Boyle J., Hatakeyama S. & Glass D.J. (2009) Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size. Am J Physiol Cell Physiol 296, C1258-70.

Trepos-Pouplard M., Lardenois A., Staub C., Guitton N., Dorval-Coiffec I., Pineau C., Primig M. & Jegou B. (2010) Proteome analysis and genome-wide regulatory motif prediction identify novel potentially sex-hormone regulated proteins in rat efferent ducts. Int J Androl 33, 661-74.

Turanyi E., Dezso K., Paku S. & Nagy P. (2009) DLK is a novel immunohistochemical marker for adrenal gland tumors. Virchows Arch 455, 295-9. van der Brug M.P., Blackinton J., Chandran J., Hao L.Y., Lal A., Mazan-Mamczarz K., Martindale J., Xie C., Ahmad R., Thomas K.J., Beilina A., Gibbs J.R., Ding J., Myers A.J., Zhan M., Cai H., Bonini N.M., Gorospe M. & Cookson M.R. (2008) RNA binding activity of the recessive parkinsonism protein DJ-1 supports involvement in multiple cellular pathways. Proc Natl Acad Sci U S A 105, 10244- 9. van der Velden J.L., Schols A.M., Willems J., Kelders M.C. & Langen R.C. (2008) Glycogen synthase kinase 3 suppresses myogenic differentiation through negative regulation of NFATc3. J Biol Chem 283, 358-66.

Vasseur S., Afzal S., Tardivel-Lacombe J., Park D.S., Iovanna J.L. & Mak T.W. (2009) DJ-1/PARK7 is an important mediator of hypoxia-induced cellular responses. Proc Natl Acad Sci U S A 106, 1111-6.

Vuocolo T., Byrne K., White J., McWilliam S., Reverter A., Cockett N.E. & Tellam R.L. (2007) Identification of a gene network contributing to hypertrophy in callipyge skeletal muscle. Physiol Genomics 28, 253-72.

149

Waak J., Weber S.S., Gorner K., Schall C., Ichijo H., Stehle T. & Kahle P.J. (2009) Oxidizable residues mediating protein stability and cytoprotective interaction of DJ-1 with apoptosis signal-regulating kinase 1. J Biol Chem 284, 14245-57.

Waddell J.N., Zhang P., Wen Y., Gupta S.K., Yevtodiyenko A., Schmidt J.V., Bidwell C.A., Kumar A. & Kuang S. (2010) Dlk1 Is Necessary for Proper Skeletal Muscle Development and Regeneration. PLoS ONE 5, e15055.

Wagenfeld A., Gromoll J. & Cooper T.G. (1998) Molecular cloning and expression of rat contraception associated protein 1 (CAP1), a protein putatively involved in fertilization. Biochem Biophys Res Commun 251, 545-9.

Wang Y. & Sul H.S. (2006) Ectodomain shedding of preadipocyte factor 1 (Pref-1) by tumor necrosis factor alpha converting enzyme (TACE) and inhibition of adipocyte differentiation. Mol Cell Biol 26, 5421-35.

Welle S.L. (2009) Myostatin and muscle fiber size. Focus on "Smad2 and 3 transcription factors control muscle mass in adulthood" and "Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size". Am J Physiol Cell Physiol 296, C1245-7.

Wen Y., Bi P., Liu W., Asakura A., Keller C. & Kuang S. (2012) Constitutive Notch activation upregulates Pax7 and promotes the self-renewal of skeletal muscle satellite cells. Mol Cell Biol 32, 2300-11.

Wendel H.G., De Stanchina E., Fridman J.S., Malina A., Ray S., Kogan S., Cordon- Cardo C., Pelletier J. & Lowe S.W. (2004) Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy. Nature 428, 332-7.

White J.D., Vuocolo T., McDonagh M., Grounds M.D., Harper G.S., Cockett N.E. & Tellam R. (2008) Analysis of the callipyge phenotype through skeletal muscle development; association of Dlk1 with muscle precursor cells. Differentiation 76, 283-98.

Wilson E.M. & Rotwein P. (2007) Selective control of skeletal muscle differentiation by Akt1. J Biol Chem 282, 5106-10.

Wilson M.A., Collins J.L., Hod Y., Ringe D. & Petsko G.A. (2003) The 1.1-A resolution crystal structure of DJ-1, the protein mutated in autosomal recessive early onset Parkinson's disease. Proc Natl Acad Sci U S A 100, 9256-61.

Wu X., Kekuda R., Huang W., Fei Y.J., Leibach F.H., Chen J., Conway S.J. & Ganapathy V. (1998) Identity of the organic cation transporter OCT3 as the extraneuronal monoamine transporter (uptake2) and evidence for the expression of the transporter in the brain. J Biol Chem 273, 32776-86.

150

Xiang Y., Naro F., Zoudilova M., Jin S.L., Conti M. & Kobilka B. (2005) Phosphodiesterase 4D is required for beta2 adrenoceptor subtype-specific signaling in cardiac myocytes. Proc Natl Acad Sci U S A 102, 909-14.

Xu X., Liu R.F., Zhang X., Huang L.Y., Chen F., Fei Q.L. & Han Z.G. (2012) DLK1 as a potential target against cancer stem/progenitor cells of hepatocellular carcinoma. Mol Cancer Ther 11, 629-38.

Yamaguchi H. & Shen J. (2007) Absence of dopaminergic neuronal degeneration and oxidative damage in aged DJ-1-deficient mice. Mol Neurodegener 2, 10.

Yamashita N., Shimazaki N., Ibe S., Kaneko R., Tanabe A., Toyomoto T., Fujita K., Hasegawa T., Toji S., Tamai K., Yamamoto H. & Koiwai O. (2001) Terminal deoxynucleotidyltransferase directly interacts with a novel nuclear protein that is homologous to p65. Genes Cells 6, 641-52.

Yanai H., Nakamura K., Hijioka S., Kamei A., Ikari T., Ishikawa Y., Shinozaki E., Mizunuma N., Hatake K. & Miyajima A. (2010) Dlk-1, a cell surface antigen on foetal hepatic stem/progenitor cells, is expressed in hepatocellular, colon, pancreas and breast carcinomas at a high frequency. J Biochem 148, 85-92.

Yu H.H., Xu Q., Chen H.P., Wang S., Huang X.S., Huang Q.R. & He M. (2013) Stable overexpression of DJ-1 protects H9c2 cells against oxidative stress under a hypoxia condition. Cell Biochem Funct.

Zhang L., Shimoji M., Thomas B., Moore D.J., Yu S.W., Marupudi N.I., Torp R., Torgner I.A., Ottersen O.P., Dawson T.M. & Dawson V.L. (2005) Mitochondrial localization of the Parkinson's disease related protein DJ-1: implications for pathogenesis. Hum Mol Genet 14, 2063-73.

Zhong N., Kim C.Y., Rizzu P., Geula C., Porter D.R., Pothos E.N., Squitieri F., Heutink P. & Xu J. (2006) DJ-1 transcriptionally up-regulates the human tyrosine hydroxylase by inhibiting the sumoylation of pyrimidine tract-binding protein- associated splicing factor. J Biol Chem 281, 20940-8.

Zhou W. & Freed C.R. (2005) DJ-1 up-regulates glutathione synthesis during oxidative stress and inhibits A53T alpha-synuclein toxicity. J Biol Chem 280, 43150-8.

Zhou W., Zhu M., Wilson M.A., Petsko G.A. & Fink A.L. (2006) The oxidation state of DJ-1 regulates its chaperone activity toward alpha-synuclein. J Mol Biol 356, 1036-48.

Zhou Y., Zhang X. & Klibanski A. (2012) MEG3 noncoding RNA: a tumor suppressor. J Mol Endocrinol 48, R45-53.

151

Zwart R., Verhaagh S., Buitelaar M., Popp-Snijders C. & Barlow D.P. (2001) Impaired activity of the extraneuronal monoamine transporter system known as uptake-2 in Orct3/Slc22a3-deficient mice. Mol Cell Biol 21, 4188-96.

APPENDICES

Appendix A Gene Expression Data for 7-muscle Experiment

Table A. 1 Quantitative PCR Primer Sequences and Amplification Conditions Gene Anneal Symbol Gene Title Primer Sequence Temp DLK1 Delta-Like 1 homolog (Drosophila) F5’-GGTTACTTCAAATGGCGTCAA-3’ 58˚C R5’-GGATTCCGCACAAACAACTC-3’ RTL1 Retrotransposon-like , Paternally expressed gene 11 F5'-AGGAACACCGCTGTGGAGGTAGAA-3' 55˚C R5'-ACAGCAGAGGCAGCCAAGCA-3' APOD Apolipoprotein D F5’-TCTTGCTTTGCTTTTCCCCTATACC-3’ 55˚C R5’-AGCTTGCCTTGGGTTCTTCTCC-3’ LPL Lipoprotein Lipase F5’-TCACGTATGAAGCCCCACAT-3’ 55˚C R5’-AAGGAGTGTTCCGGCACCA-3’ PDE7A cAMP Specific Phosphodiesterase, 7A F 5'-GGAGGTCGGCCGTGAGAGAT-3' 55˚C R 5'-TTCGTCAAAGGGAGGGACGAGAA-3' PARK7 Parkinson disease (autosomal recessive, early onset) 7 F5’-CGAGTCCGCTGCTGTGA-3’ 51˚C R5’-TGACTTCCGTTCATCATTTTGT-3’ DNTTIP Deoxynucleotidyltransferase, Terminal, Interacting F 5'-ATGGCCTACCTTCTCATTGA-3' 49˚C Protein 1 R 5'-TGTACTTCCGCATCTTCTCA-3' BHLHB3 Basic Helix-Loop-Helix domain containing, class B3 F5’-ATGTAAGGGGTGAGACACAACAGT-3’ 54˚C R5’-CAAACAGTAGCAACAGCAGCAG-3’ METTL21E Similar to SAM dependent methyltransferase family F 5’-GCCCTTGTTCTGTGCTATT-3’ 50˚C R 5’-CAGGTAAATCTGTGGCAGTC-3’

152

Continued Gene Anneal Symbol Gene Title Primer Sequence Temp PFKM Phosphofructokinase, Muscle F 5’-GAGCCCAACTCCATTTGACA-3’ 50˚C R 5’-CTTACGCATCCCCAGAACAC-3’ RSPRY1 Ring Finger and SPRY Domain Containing 1 F 5’-CTTCCTTCCCCACCGTTTC-3’ 50˚C R 5’-AATCCAGCACCCCAACAAGT-3’ PDE4D cAMP Specific Phosphodiesterase 4D F5’-TAAACAGTACAAAGGGGACACT-3’ 50˚C R5’-CTGTAAGAGAGGCTAAGAAACC-3’ HDAC9 Histone Deacetylase 9 F5'-CCTTTTCACTGGTTCCAGGTAG-3' 55˚C R5'-GGCTGAGCAGGCTTTTGTATAAT-3' RPLPO Ribosomal Protein , Large, P0 F 5’-CAACCCTGAAGTGCTTGACAT-3’ 50˚C R 5’-AGGCAGATGGATGGATCAGCCA-3’ CDO1 Cysteine Dioxygenase Type 1 F5’- AAGGTCCAGCGAAGTTCC-3’ 52˚C R5’- CAGGGGCTCTAGGCTAACA-3’ MAPK6 Mitogen Activated Protein Kinase 6 F5’-TCAAAGTCAGTAAGCCGAGAA-3’ 52˚C R5’-AACAGTCCTCCCCACCAC-3’ SLC22A3 Similar to Solute Carrier Family 22 member 3 F5’-TGAACAAAGGGAGAATGTAGGTA-3’ 52˚C R5’-GCCTTAAAGCACATCAGCAT-3’ TXNIP Thioredoxin Interacting Protein F5’-ATGTTGCCATGAGAAACCAGAA-3’ 52˚C R5’-TAAGGCGGAGAGTGACTGACC-3’ KCNN3 Potassium Intermediate/Small Conductance Calcium- F5’-CGGGAAACGTGGCTAATCTACA-3’ 55˚C Activated Channel, family N3 R5’-GTGTTGGCTTGGTCACTCAGCT-3’

CAST Calpastatin F5’- AGAGACCCACCAGGACGTG-3’ 54˚C R5’- CAGGGGCTCTAGGCTAACA-3’

153

Continued Gene Anneal Symbol Gene Title Primer Sequence Temp COQ10A Coenzyme Q10 homolog A F 5’-GCTGTGCGGTCATCTCT-3’ 50˚C R 5’-ATTTCAGGTAGGCAAGGTTA-3’ IDH2 Isocitrate Dehydrogenase 2 (NADP+), Mitochondrial F5’-CTGGACGCGTGGCCTAGAACA-3’ 59˚C R5’-TTGCTGAGGCCGTGGATGC-3’ FCGRT Fc Fragment of IgG, Receptor, Transporter, alpha F5’-TCGTCATCGGCTTATTCCT-3’ 52˚C R5’-GATGATCGGCAGTTGCTG-3’ AKR1C4 Aldo-keto Reductases 1C4 F5’-GGATCCCAACTATCATCAGA-3’ 48˚C R5’-GGTTTGCTTGTGCTTTTT-3’ MEG8 Maternal Expressed Gene 3, GTL2 variant D F 5'-CACTGAAAAGCACGTGCCTTCT-3' 54˚C R 5'-GATTTAGCATCTGCCATGGACAA-3' CABC1 Chaperone, ABC1 Activity of bc1 Complex Homolog F5’-GAGCTGAGCAGTGCCAACAAGTA-3’ 57˚C (S. pombe) R5’-TAGGAGGCGGCAGTTCTCTG-3’ MEG3 Maternal Expressed gene 8 F5'-GCATAGACGAGGCGGTCAGTAAATG-3' 55˚C R5'-CGGAGCGCTGTGGGAGAATAA-3' MYH7 Myosin, Heavy Chain Type I, Skeletal Muscle, adult F 5'-AAGAACCTGCTGCGGCTG-3' 57˚C R 5'-CCAAGATGTGGCACGGCT-3' F 5'- MYH2 Myosin, Heavy Chain Type IIA, Skeletal Muscle, 51˚C GAGGAACAATCCAATACAAATCTATCT-3' adult R 5'-CCCATAGCATCAGGACACGA-3' MYH4 Myosin, Heavy Chain Type IIB, Skeletal Muscle, F 5'-AAATGCAAGTGCTATCCCAGAG-3' 54˚C adult R 5'-AGTGCGCGTGATGAGTTGA-3'

154

Continued Gene Anneal Symbol Gene Title Primer Sequence Temp MYH1 Myosin, Heavy Chain Type IIX, Skeletal Muscle, F 5'-GGAGGAACAATCCAATGTCAAC-3' 52˚C adult R 5'-GTCACTTTTTAGCATTTGGATGAGTTA-3' Myh4 Myosin, Heavy Chain Type IIB, Skeletal Muscle, F 5'- AGTCCCAGGTCAACAAGCTG-3' 55˚C (Mouse) adult R 5'-TTTCTCCTGTCACCTCTCAACA-3' DNTTIP1 Deoxynucleotidyltransferase, Terminal, F 5'-ATGGCCTACCTTCTCATTGA-3' 49˚C (Mouse) Interacting Protein 1 R 5'-TGTACTTCCGCATCTTCTCA-3' Park7 Parkinson disease F 5'-AGGTCCTACGGCTCTGTTG-3' 55˚C (Mouse) (autosomal recessive, early onset) 7 R 5'-CACAATGGCTAGTGCAAACTCA-3' Rplp38 Ribosomal protein large protein 38 F 5'-GAAGGATGCCAAGTCTGTCAA-3' 55˚C (Mouse) R 5'-GAGGGCTGGTTCATTTCAGA-3'

155

Table A. 2 Quantitative Analysis of Gene Expression Gene Genotype LD SM ST TB SS IS HT DLK1 +/C 4.800 ± 0.065 5.002 ± 0.135 4.782 ± 0.261 4.181 ± 0.130 4.086 ± 0.165 3.749 ± 0.182 3.552 ± 0.163 +/+ 3.695 ± 0.056 3.813 ± 0.117 3.672 ± 0.226 3.528 ± 0.112 3.944 ± 0.143 3.566 ± 0.158 3.416 ± 0.141 RTL1 +/C 5.359 ± 0.167 5.475 ± 0.095 5.215 ± 0.143 4.909 ± 0.059 4.556 ± 0.382 4.390 ± 0.308 2.466 ± 0.133 +/+ 1.130 ± 0.145 1.000 ± 0.082 1.015 ± 0.124 1.023 ± 0.051 1.403 ± 0.331 1.000 ± 0.267 1.000 ± 0.094 APOD +/C 5.994 ± 0.103 6.129 ± 0.070 5.908 ± 0.176 5.806 ± 0.179 5.272 ± 0.132 5.503 ± 0.132 4.442 ± 0.171 +/+ 5.522 ± 0.089 5.649 ± 0.061 5.312 ± 0.152 5.115 ± 0.155 5.130 ± 0.114 5.234 ± 0.114 4.272 ± 0.148 LPL +/C 4.988 ± 0.080 5.080 ± 0.059 5.065 ± 0.234 5.610 ± 0.110 5.643 ± 0.163 5.748 ± 0.145 6.285 ± 0.098 +/+ 5.312 ± 0.069 5.522 ± 0.051 5.071 ± 0.202 5.718 ± 0.095 5.907 ± 0.141 5.860 ± 0.128 6.182 ± 0.085 PDE7A +/C 5.012 ± 0.126 5.004 ± 0.145 5.052 ± 0.112 5.014 ± 0.147 4.565 ± 0.105 4.876 ± 0.147 4.943 ± 0.093 +/+ 4.581 ± 0.109 4.700 ± 0.126 4.630 ± 0.097 4.691 ± 0.128 4.527 ± 0.091 4.884 ± 0.127 4.912 ± 0.081 RPLPO(GSP) +/C 6.999 ± 0.144 6.953 ± 0.094 7.111 ± 0.188 6.997 ± 0.109 6.952 ± 0.095 7.164 ± 0.126 6.868 ± 0.081 +/+ 6.994 ± 0.125 6.980 ± 0.081 6.742 ± 0.163 6.892 ± 0.095 6.841 ± 0.083 6.965 ± 0.109 6.793 ± 0.071 PARK7 +/C 6.534 ± 0.095 6.671 ± 0.059 6.443 ± 0.084 6.389 ± 0.058 6.145 ± 0.103 6.191 ± 0.056 5.951 ± 0.055 +/+ 6.047 ± 0.082 6.051 ± 0.051 5.900 ± 0.072 5.992 ± 0.050 5.954 ± 0.089 6.104 ± 0.048 5.877 ± 0.048 DNTTIP +/C 5.547 ± 0.095 5.587 ± 0.078 5.473 ± 0.060 5.311 ± 0.127 4.669 ± 0.086 4.837 ± 0.087 4.735 ± 0.037 +/+ 4.866 ± 0.082 5.027 ± 0.068 4.857 ± 0.052 4.721 ± 0.110 4.456 ± 0.086 4.602 ± 0.076 4.660 ± 0.032 DEC2 +/C 4.772 ± 0.041 4.810 ± 0.047 4.828 ± 0.114 4.908 ± 0.070 5.001 ± 0.065 5.039 ± 0.099 4.853 ± 0.081 +/+ 4.830 ± 0.036 4.927 ± 0.040 4.758 ± 0.098 4.994 ± 0.061 5.018 ± 0.056 4.994 ± 0.086 4.832 ± 0.070 LOC513822 +/C 5.537 ± 0.101 5.706 ± 0.097 5.868 ± 0.106 5.768 ± 0.086 5.196 ± 0.184 5.407 ± 0.093 4.549 ± 0.166 +/+ 4.708 ± 0.088 4.860 ± 0.084 4.925 ± 0.092 5.022 ± 0.074 4.995 ± 0.159 5.153 ± 0.080 4.442 ± 0.144 PFKM +/C 6.259 ± 0.039 6.267 ± 0.025 6.182 ± 0.037 6.157 ± 0.096 5.584 ± 0.091 5.725 ± 0.159 5.504 ± 0.085 +/+ 5.955 ± 0.034 6.024 ± 0.022 5.846 ± 0.032 5.864 ± 0.083 5.322 ± 0.079 5.564 ± 0.138 5.416 ± 0.074 RSPRY1 +/C 4.489 ± 0.030 4.492 ± 0.040 4.490 ± 0.087 4.477 ± 0.029 4.394 ± 0.083 4.427 ± 0.032 4.421 ± 0.082 +/+ 4.263 ± 0.026 4.293 ± 0.035 4.083 ± 0.075 4.230 ± 0.025 4.151 ± 0.072 4.300 ± 0.028 4.336 ± 0.071 PDE4A +/C 5.941 ± 0.085 5.998 ± 0.114 5.861 ± 0.076 5.739 ± 0.073 5.611 ± 0.122 5.552 ± 0.120 4.769 ± 0.061 +/+ 5.454 ± 0.073 5.501 ± 0.098 5.263 ± 0.066 5.272 ± 0.063 5.283 ± 0.106 5.349 ± 0.104 4.785 ± 0.053 HDAC9 +/C 3.959 ± 0.076 3.889 ± 0.065 3.704 ± 0.134 4.131 ± 0.069 4.278 ± 0.089 4.327 ± 0.071 4.555 ± 0.060 +/+ 4.157 ± 0.066 4.269 ± 0.056 3.867 ± 0.116 4.190 ± 0.060 4.228 ± 0.077 4.328 ± 0.062 4.551 ± 0.052 156

Continued Gene Genotype LD SM ST TB SS IS HT RPLPO(RP) +/C 6.821 ± 0.048 6.763 ± 0.038 6.740 ± 0.067 6.768 ± 0.048 6.928 ± 0.067 6.784 ± 0.040 6.687 ± 0.062 +/+ 6.838 ± 0.042 6.809 ± 0.033 6.643 ± 0.058 6.663 ± 0.042 6.779 ± 0.058 6.716 ± 0.035 6.660 ± 0.053 CDO1 +/C 4.024 ± 0.201 3.943 ± 0.175 3.856 ± 0.288 4.111 ± 0.232 4.058 ± 0.156 4.211 ± 0.147 4.117 ± 0.097 +/+ 4.307 ± 0.174 4.260 ± 0.151 3.723 ± 0.249 4.127 ± 0.201 4.126 ± 0.135 4.242 ± 0.128 3.930 ± 0.084 MAPK6 +/C 5.739 ± 0.057 5.884 ± 0.087 5.939 ± 0.134 6.046 ± 0.059 5.413 ± 0.106 5.886 ± 0.099 5.365 ± 0.142 +/+ 5.453 ± 0.049 5.550 ± 0.075 5.602 ± 0.116 5.730 ± 0.051 5.283 ± 0.092 5.738 ± 0.086 5.183 ± 0.123 SLC22A3 +/C 3.454 ± 0.152 3.710 ± 0.183 3.320 ± 0.255 3.773 ± 0.189 3.517 ± 0.283 3.845 ± 0.165 4.129 ± 0.145 +/+ 2.242 ± 0.132 2.459 ± 0.159 2.412 ± 0.211 2.961 ± 0.163 2.906 ± 0.245 3.404 ± 0.143 4.065 ± 0.125 TXNIP +/C 6.054 ± 0.073 6.102 ± 0.078 6.107 ± 0.166 6.339 ± 0.061 6.083 ± 0.098 6.328 ± 0.054 6.564 ± 0.056 +/+ 5.942 ± 0.064 6.042 ± 0.068 5.803 ± 0.144 6.061 ± 0.053 5.962 ± 0.085 6.232 ± 0.047 6.481 ± 0.049 KCNN3 +/C 5.145 ± 0.076 5.207 ± 0.042 5.092 ± 0.131 5.126 ± 0.049 4.637 ± 0.143 5.011 ± 0.141 4.020 ± 0.074 +/+ 4.400 ± 0.066 4.419 ± 0.036 4.454 ± 0.114 4.459 ± 0.043 4.111 ± 0.123 4.523 ± 0.122 3.956 ± 0.064 CAST +/C 5.419 ± 0.028 5.454 ± 0.061 5.388 ± 0.065 5.481 ± 0.072 5.282 ± 0.099 5.486 ± 0.053 6.059 ± 0.059 +/+ 5.076 ± 0.025 5.152 ± 0.053 5.171 ± 0.056 5.273 ± 0.062 5.158 ± 0.085 5.405 ± 0.046 6.025 ± 0.051 COQ10A +/C 5.891 ± 0.117 5.886 ± 0.098 5.871 ± 0.220 5.699 ± 0.190 5.541 ± 0.134 5.823 ± 0.152 5.931 ± 0.166 +/+ 5.723 ± 0.102 5.752 ± 0.085 5.539 ± 0.191 5.766 ± 0.164 5.406 ± 0.116 5.713 ± 0.131 5.823 ± 0.144 IDH2 +/C 5.276 ± 0.050 5.392 ± 0.058 5.359 ± 0.134 5.763 ± 0.055 5.681 ± 0.103 5.878 ± 0.035 6.170 ± 0.080 +/+ 5.483 ± 0.043 5.546 ± 0.050 5.319 ± 0.116 5.710 ± 0.048 5.677 ± 0.189 5.823 ± 0.030 6.095 ± 0.069 FCGRT +/C 5.192 ± 0.080 5.255 ± 0.088 5.461 ± 0.166 5.704 ± 0.032 5.415 ± 0.086 5.754 ± 0.095 5.461 ± 0.122 +/+ 5.243 ± 0.070 5.284 ± 0.076 5.184 ± 0.144 5.487 ± 0.027 5.282 ± 0.074 5.599 ± 0.083 5.320 ± 0.106 AKR1C4 +/C 4.586 ± 0.115 4.238 ± 0.127 4.662 ± 0.173 5.011 ± 0.146 4.922 ± 0.165 5.230 ± 0.083 3.852 ± 0.156 +/+ 5.404 ± 0.099 5.313 ± 0.110 5.181 ± 0.150 5.457 ± 0.127 5.154 ± 0.143 5.421 ± 0.072 3.902 ± 0.135 MEG8 +/C 3.849 ± 0.096 3.851 ± 0.157 3.760 ± 0.188 3.060 ± 0.150 2.798 ± 0.140 2.942 ± 0.212 2.626 ± 0.162 +/+ 2.708 ± 0.083 2.622 ± 0.136 2.813 ± 0.162 2.382 ± 0.130 2.367 ± 0.121 2.562 ± 0.183 2.560 ± 0.140 CABC1 +/C 6.198 ± 0.081 5.906 ± 0.041 7.466 ± 0.082 7.778 ± 0.024 5.691 ± 0.134 7.385 ± 0.051 +/+ 6.297 ± 0.071 6.055 ± 0.035 7.433 ± 0.071 7.731 ± 0.021 5.596 ± 0.116 7.375 ± 0.044 GTL2 +/C 7.039 ± 0.217 6.917 ± 0.189 7.241 ± 0.168 6.626 ± 0.138 5.721 ± 0.157 6.472 ± 0.157 6.080 ± 0.147 +/+ 5.606 ± 0.188 5.442 ± 0.164 6.078 ± 0.146 5.931 ± 0.120 5.109 ± 0.136 6.125 ± 0.136 6.016 ± 0.127 157

Continued Gene Genotype LD SM ST TB SS IS HT MYH7 +/C 6.703 ± 0.037 6.605 ± 0.046 6.516 ± 0.188 7.079 ± 0.054 7.280 ± 0.122 7.409 ± 0.101 7.435 ± 0.095 +/+ 6.791 ± 0.032 6.765 ± 0.040 6.616 ± 0.163 7.089 ± 0.047 7.242 ± 0.105 7.372 ± 0.088 7.317 ± 0.082 MYH2 +/C 6.086 ± 0.065 6.139 ± 0.082 6.335 ± 0.094 6.515 ± 0.104 6.574 ± 0.082 6.903 ± 0.125 3.573 ± 0.259 +/+ 6.891 ± 0.056 6.776 ± 0.071 6.781 ± 0.081 6.766 ± 0.090 6.608 ± 0.071 6.767 ± 0.108 3.011 ± 0.224 MYH4 +/C 4.153 ± 0.294 4.825 ± 0.238 5.869 ± 0.275 4.072 ± 0.132 2.856 ± 0.235 3.470 ± 0.291 1.749 ± 0.115 +/+ 2.287 ± 0.255 2.867 ± 0.206 4.162 ± 0.238 2.641 ± 0.115 2.223 ± 0.203 2.546 ± 0.252 1.554 ± 0.099 MYH1 +/C 7.661 ± 0.082 7.703 ± 0.059 7.657 ± 0.116 7.662 ± 0.080 7.225 ± 0.092 7.356 ± 0.302 4.411 ± 0.208 +/+ 7.382 ± 0.071 7.459 ± 0.051 7.569 ± 0.100 7.396 ± 0.069 7.079 ± 0.082 7.125 ± 0.262 3.546 ± 0.180

158

159

Table A. 3 Analysis of Variance of Genotype Effects in qPCR Analysis Gene LD SM ST TB SS IS HT DLK1 0.0001 0.0012 0.0235 0.0125 0.5434 0.4831 0.5571 DNTTIP 0.0028 0.0029 0.0006 0.0169 0.1566 0.0982 0.1847 PARK7 0.0118 0.0005 0.0045 0.0035 0.2206 0.2897 0.3602 METTL21E 0.0016 0.0012 0.0011 0.0012 0.4466 0.0932 0.6473 MEG8 0.0003 0.0020 0.0124 0.0189 0.0678 0.2325 0.7686 SLC22A3 0.0018 0.0036 0.0434 0.0226 0.1639 0.0994 0.7540 PDE4D 0.0074 0.0211 0.0019 0.0048 0.0982 0.2560 0.8451 APOD 0.0178 0.0036 0.0506 0.0328 0.4498 0.1834 0.4861 PFKM 0.0019 0.0008 0.0010 0.0701 0.0818 0.4799 0.4684 AKR1C4 0.0030 0.0014 0.0731 0.0697 0.3350 0.1425 0.8169 CAST 0.0003 0.0137 0.0519 0.0805 0.3872 0.3024 0.6741 MEG3 0.0041 0.0020 0.0034 0.0126 0.0323 0.1546 0.7535 RTL1 0.0000 0.0000 0.0000 0.0000 0.0016 0.0004 0.0009 KCNN3 0.0007 0.0000 0.0144 0.0002 0.0385 0.0480 0.5429 RSPRY1 0.0024 0.0135 0.0167 0.0013 0.0770 0.0302 0.4678 MAPK6 0.0123 0.0330 0.1158 0.0095 0.3987 0.3080 0.3781 IDH2 0.0255 0.1006 0.8324 0.4994 0.9745 0.2903 0.5130 LPL 0.0283 0.0024 0.9841 0.4894 0.2742 0.5850 0.4634 PDE7A 0.0485 0.1745 0.0355 0.1584 0.7970 0.9658 0.8107 HDAC9 0.1051 0.0068 0.3997 0.5484 0.6852 0.9960 0.9624 TXNIP 0.2998 0.5872 0.2247 0.0186 0.3938 0.2387 0.3156 COQ10A 0.3275 0.3465 0.3057 0.8007 0.4794 0.6064 0.6433 CDO1 0.3359 0.2290 0.7413 0.9613 0.7566 0.8806 0.2066 DEC2 0.3383 0.1143 0.6624 0.4019 0.8514 0.7466 0.8565 FCGRT 0.6453 0.8115 0.2612 0.0035 0.2923 0.2756 0.4206 CABC1 0.4002 0.0401 0.7727 0.1930 0.6174 0.9025 MYH7 0.1355 0.0450 0.7061 0.8885 0.8260 0.7920 0.3918 MYH2 0.0002 0.0021 0.0158 0.1293 0.7686 0.4483 0.1617 MYH4 0.0049 0.0016 0.0054 0.0004 0.0971 0.0615 0.2534 MYH1 0.0505 0.0263 0.5915 0.0538 0.2841 0.5889 0.0254 RPLP0(RP) 0.8046 0.3995 0.3222 0.1635 0.1548 0.2511 0.7559 RPLP0(GSP) 0.9811 0.8317 0.1985 0.5024 0.4212 0.2837 0.5159

160

Table A. 4 Plasmids Compositions of Effector Luciferase Assay

Effector Effector Null Plasmids MYH4 or MYH7 Transfection Gene Gene % (µg) (GW-CAT) % (µg) Plasmids % (µg) Control PARK7 0% (0 µg) 60% (1.8 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) PARK7 30% (0.9 µg) 30% (0.9 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) PARK7 60% (1.8 µg) 0% (0 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) METTL21E 0% (0 µg) 60% (1.8 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) METTL21E 30% (0.9 µg) 30% (0.9 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) METTL21E 60% (1.8 µg) 0% (0 µg) 30% (0.9 µg) pRL-TK, 10 %, (0.3 µg) DLK1 0% (0 µg) 48% (1.44 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg) DLK1 24% (0.72 µg) 24% (0.72 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg) DLK1 48% (1.44 µg) 0% (0 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg) DNTTIP1 0% (0 µg) 48% (1.44 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg) DNTTIP1 12% (0.36 µg) 36% (1.08 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg) DNTTIP1 24% (0.72 µg) 24% (0.72 µg) 50% (1.5 µg) pRL-SV40, 2 %, (0.06 µg)

161

Figure A. 1 Cellular Localization of DNTTIP1. C2C12 cells were transfected with pDNTTIP1-pcDNA3.2 /V5 construct and stained with anti-DNTTIP1 antibody (red), anti-V5 epitope tag antibody (green) and DAPI (nuclei, blue). The merged cells (orange) showed the detection of the same cells by anti- DNTTIP1 and anti-V5 antibodies. DNTTIP1 localized exclusively in nucleus in C2C12 cells.

162

Figure A. 2 Cellular Localization of PARK7. C2C12 cells were transfected with pPARK7-pcDNA3.2 /V5 construct and stained with anti-PARK7 (green), anti-V5 epitope tag (red) and DAPI (nuclei, blue). The merged cells (orange) showed the detection of the same cells by anti-PARK7 and anti-V5 antibodies. PARK7 localized both in the cytoplasm and nucleus in C2C12 cells.

163

Figure A. 3 Cellular Localization of METTL21E and GW-CAT. C2C12 cells were transfected with pMETTL21E-pcDNA3.2 /V5 construct (A to C) or pGWCAT- pcDNA3.2/V5 (D to F) and stained with anti-METTL21E or anti-GW-CAT antibody (green), and DAPI (nuclei, blue). METTL21E (A to C) localized both in the cytoplasm and nucleus but mostly accumulated in cytoplasm in C2C12 cells. GW-CAT (D to F) localized mostly in nucleus.

164

Appendix B Park7 (-/-) Mice Phenotypic Analysis

Live weight & age analysis (female)

20.00 18.00 (-/-) y = 3.43x - 3.13 16.00 (+/-) y = 2.88x + 0.82 14.00 (+/+) y = 2.97x + 0.15 12.00 10.00 8.00 Park7 (+/+) 6.00 Live Body Weight Body Live 4.00 Park7 (+/-) 2.00 Park7 (-/-) 234567 Age

Live weight & age analysis (male) 26.00 24.00 22.00 (-/-) y = 4.18x - 2.96 20.00 (+/-) y = 4.06x - 2.13 18.00 16.00 (+/+) y = 4.44x - 3.57 14.00 12.00 10.00 Park7 (-/-) 8.00

Live Body Weight Body Live 6.00 Park7 (+/-) 4.00 2.00 Park7 (+/+) 2468 Age

Figure B. 1 Analysis on Live Body Weight by Age in Park7 (+/+), (+/-) and (-/-) Mice. Twenty females with 4 Park7 (+/+), 12 (+/-) and 4 (-/-) animals and twenty-five males with 4 Park7 (+/+), 11 (+/-) and 10 (-/-) were examined to analyze the live animal growth. Animals live body weights were collected from 3 weeks to 6 weeks old. Live body weights were regressed on age. Equations were given for each genotype. There were no genotype effect on the slopes and intercepts of any regression lines in both male and female.

165

Table B. 1 Analysis on Carcass Weights and Internal Organs Weights in Park7 (+/+), (+/-) and (-/-) Mice

Organs Equation Organs Equation

+/+ y=0.6009lw-5.3759 +/+ y=0.6396lw-4.2095

+/- y=0.0191lw+7.0533 +/- y=0.6389lw-4.7451 Carcass Carcass Carcass Carcass -/- y=0.8254lw-9.8533 -/- y=0.3022lw+0.3916

+/+ y=0.0042lw+0.0195 +/+ y=0.0025lw+0.0504

+/- y=0.0017lw+0.0722 +/- y=0.005lw+0.00550 Heart Heart -/- y=0.0087lw-0.0750 -/- y=0.0025lw+0.0465 Male Male

+/+ y=0.0637lw-0.5389 Female +/+ y=0.0737lw-0.4577

+/- y=-0.0094lw+1.0736 +/- y=0.0744lw-0.5963 Liver Liver -/- y=-0.0733lw+2.4782 -/- y=-0.026lw+0.2008

+/+ y=0.0127lw-0.0277 +/+ y=0.0144lw-0.0370

+/- y=0.0176lw-0.1177 +/- y=0.0159lw-0.0749 Kidney Kidney -/- y=0.0116lw+0.0265 -/- y=0.0137lw-0.0373

166

Table B. 2 Quantitative PCR Primers. Gene Forward primer (5’-3’) Reverse primer (5’-3’) name Myh7 AGTCCCAGGTCAACAAGCTG TTCCACCTAAAGGGCTGTTG

Myh3 CGCAGAATCGCAAGTCAATA ATATCTTCTGCCCTGCACCA

Myh8 AGTCCCAGGTCAACAAGCTG CCTCCTGTGCTTTCCTTCAG

Myh4 AGTCCCAGGTCAACAAGCTG TTTCTCCTGTCACCTCTCAACA

Pten CCTTTTGAAGACCATAACCCACC GAATTGCTGCAACATGATTGTCA Rplp38 GAAGGATGCCAAGTCTGTCAA GAGGGCTGGTTCATTTCAGA (control)

167

Appendix C Lab Protocols

C1. 1 Primary Myoblast Isolation

 Collagen-Coated Plates

Product: Collage (rat tail), 10 mg/ bottle, 3 bottles/box. Cat#: 11179179001

1. Mix collagen in the bottle from the manufacturer with the filtered 0.2 % acetic

acid. 1 bottle of collagen (10 mg) is good for 100 mL 0.2 % acetic acid.

2. Add 4-5 mL collagen to a 10cm plate and let it sit for 1 hour to 2 hour in

incubator.

3. Aspirate off liquid or collect the collagen to reuse and allow drying in laminar

flow hood for 8 hours (overnight) (or O/N). Plates can be stored indefinitely at

4 Ԩ.

 Collagenase / Dispase Solution

Product: Collagenas / Dispase Mix (Roche) 500 mg. Cat#: 11097113001

1. Add 10 mL H2O (cell culture) to make a final concentration of 50 mg/mL, filter

and divide into 10 tubes.

2. For each tube, add 9 mL DPBS to make the working concentration of 5 mg/mL.

 Ham’s Complete Medium

1. Growth Medium

Ham’s F-10 medium (500 mL / bottle) with 20 % FBS, 1X PSG and 4 ng/mL

bFGF

2. Differentiation Medium

168

DMEM (500mL / bottle) with 5 % Horse Serum and 1X PSG.

 Procedure

1. Limb muscle collection. Before removing the skin and fascia, liberally spray the

entire mouse with 70 % ethanol.

2. Peel the skin and fascia from abdomen to the leg to expose the underlying

muscles. Dissect both hind limbs and place in a sterile 60 mm plate with DPBS.

(Remove all the fat from muscle).

The following work should be done in the hood.

3. Transfer all the muscles to a clean 60 mm plate and wash with DPBS twice.

4. Transfer all the muscles to an empty 60 mm plate and suck off DPBS left on the

muscles.

5. Mulch the tissue into smooth pulp using scissors.

6. Add 5 mL Collagenase / Dispase solution and mix well.

7. Incubate at 37 oC for 15min, then pipet up and down to homogenize the pulp and

incubate for another 15 min and mix well to get smooth pulp.

8. Add 5 mL Ham’s complete medium to stop the digestion and transfer all the pulp

into a 15 mL sterile tube.

9. Wash the plate with 5 mL DPBS and transfer the DPBS into the same tube.

10. Briefly spin down the tube (150 g*30s) and filter the supernatant through 100

µM filter (Partec Cell Trics cat.log: 04-004-2328) into another 15 mL tube. Add

10 mL Ham’s complete medium to the debris, mix and put them into a non-coated

plate labeled as “Debris”.

169

11. Spin down the filtered supernatant at 450 g*5 min, aspirate the supernatant, add

10 mL Ham’s complete medium, mix the pellet and transfer all the medium into

a 10 cm coated plate labeled as “Pellets”.

12. Add 5 ml Ham’s complete medium every day.

In 3 days

13. Collect both the debris and pellet into different tubes and spin down all the tubes

at 450 g * 5min.

14. Aspirate off the supernatants and wash with 5 mL DPBS. Spin down at 450 g *

5min again and aspirate the supernatant.

15. Dilute trypsin with DPBS (1:7) and add 5 mL diluted trypsin into each tube.

16. Incubate all the tubes in the 37 Ԩ water bath for 10 mins. (Gently mix the tube

every 2 mins).

17. Add 5 mL Ham’s complete medium to stop digestion. Pipet up and down for

several times to make sure the cells is mixed well.

18. Filter the cell mix through 100 uM filters into a new 15 mL tube. Spin down at

450 g * 5min, aspirate off the supernatants, put 10 mL Ham’s medium and put

them into 10 cm non-coated plate. (Fibroblasts will adhere to the plate and

myoblasts will remain in suspension).

19. After 45 min to 1 hour, transfer the medium into the coated plates. Pre-plate

procedure is critical to get rid of the fibroblast. And this procedure should be

repeated 3-4 times until the myoblasts are relatively clean. Extension of the pre-

plating time does help but keep an eye on the plate in case myoblasts attach to

the plates.

170

C1. 2 Cell Transfection (Neon System)

 Preparation:

1. Make the desired amount of growth medium without antibiotics.

For MyhIIB and MyhI luciferase assay, 400 µL (4 replicates) of the growth

medium for each treatment is aliquoted into 1.5mL tubes.

2. Thaw the plasmids that are needed to be transfected.

3. Calculate the number of cells, amount of plasmids and resuspension buffer as

needed. Usually, 2-3 µg plasmids is enough for 2 × 105 cells in one 10 µL tip and

keep in mind that the volume of plasmids should not exceed 10 % of the total

volume.

For MyhIIB and MyhI luciferase assay, 3 µg of plasmids complex is transfected

into 2 × 105 cells and the transfected cells are plated into 4 wells of 96-well plate

(4 replates).

 Plasmids Composition (For MyhIIB and MyhI luciferase assay)

Make sure that the concentration of each plasmid is around 2 µg / µL, so that the

volume of 3 µg of total plasmids does not exceed 10 % of the entire transfection

system (10 µL).

The plasmid compositions are indicated in Table A3.5

 Cell Preparation and Transfection Procedures

1. Resuspend cells with DPBS and count the cells.

2. Put desired number of cells into 1.5 mL tubes and spin down at 450 g * 5 min.

171

3. Resuspend the cells in resuspension buffer R and put the plasmids complex into

the cells.

For MyhIIB and MyhI luciferase assay, ~12 µL resuspension buffer R is added to

2 × 105 suspended cells in each tube and the calculated amount of plasmids

complex are then added into the cell system.

4. Take the cells, growth medium tubes, transfection tips, Neon Tube and

Electrolytic Buffer to Dr.Kuang’s lab.

For MyhIIB and MyhI luciferase assay, the prepared 400 µL medium (without

antibiotics) tubes will be needed to take along.

5. Turn on the Neon device and fill the Neon Tube with 3 mL Electrolytic Buffer.

6. Insert the Neon Tube into the Neon Pipette Station until you hear a click sound.

7. Press the push-button on the Neon Pipette to the first stop and immerse the Neon

Tip into the cell-DNA mixture. Slowly release the push-button on the pipette to

aspirate the cell-DNA mixture into the Neon Tip.

8. Insert the Neon Pipette with the sample vertically into the Neon Tube placed in

the Neon Pipette Station until you hear a click sound.

9. Select the appropriate electroporation protocol and press “Start” on the

touchscreen.

The transfection condition for primary myoblast is at 1500 V, 10 ms and 3 pulses.

For C2C12 cells is at 1650 V, 10 ms and 3 pulse.

10. The touchscreen displays “Complete” to indicate that electroporation is complete.

The tips can be reused for a couple of times if the cell-DNA mixture is the same.

Put the transfected cells in the medium without antibiotics.

172

For MyhIIB and MyhI luciferase assay, put the transfected cells into the prepared

400 µL medium.

11. After finishing all the transfecitons, take off the tip, turn off the Neon device and

clean the hood. Take everything back to the lab and spread the cells into

appropriate plates.

For MyhIIB and MyhI luciferase assay, spread the transfected cells into 96-well

plates with each well 100 µL cell-medium. Usually, 4 or 8 replicates (wells) for

each treatment are used.

173

C1. 3 Luciferase Assay

 Solutions

Luciferase buffer are made by mixing 1 vial of Dual-Glo luciferase buffer to 1 vial of

luciferase substrate (lyophilized). This reagent usually made when we get the product

and aliquot the mixing buffer into small tubes.

Stop & Glo reagent should be made just before use. Stop & Glo Substrate: Stop &

Glo buffer = 1:100.

 Procedure

1. Calculate the luciferase buffer with substrate and Stop & Glow reagent needed in

the experiments (50 µL for each reagent in each well).

Equal amount of DPBS is used to mix the luciferase buffer, therefore the volume

of the mixed luciferase buffer added to each well is 100 µL (50 µL luciferase

buffer : 50 µL DPBS). Turn on the Tecan plate reader and computer in Lilly 3-

204 at least 20 mins in advance.

2. Thaw the luciferase buffer with substrate and Stop & Glo buffer (Put back the

left reagent into freezer).

3. Take the 96-well plate out of incubator and wash 1*PBS.

4. Put 100 µL mixed luciferase buffer into each well.

5. Gently shake for 2 mins and during this time, prepare the Stop & Glow buffer by

adding 1/50 amount of substrate to the calculated desired amount of Stop &

Glow buffer.

174

6. Take the plate along with gloves, repeater and repeater tips to Lilly 3-204 to

measure luminescence in Tecan plate reader. (Software: Magellan; Program

name: Hui luciferase with 100ms measurement and 15ms shake time).

7. After measuring the firefly luciferase luminescence, add 50 uL Stop & Glow

Reagent into each well and measure the renilla luminescence (Program name:

Hui renilla with 100ms measurement, 15ms shake time and 600ms settlement

time).

8. Copy the data into excel file and save it in the flash drive.

Flush and discard the plate.

175

C1. 4 Mouse Genotyping

 Solutions

Base solution: A 50 X stock is prepared at 1.25 M NaOH, 10 mM EDTA, which

should be around pH=12. The concentration of 1 X working stock should be 25 mM

NaOH, 0.2 mM EDTA.

Neutralization solution: A 50 X stock is prepared at 2 M Tris-HCl, pH=5.0.The

concentration of 1 X working stock should be 40 mM Tris-HCl pH=5.0.

 Procedure:

1. After weaning the mouse, put a small piece of ear into 1.5 mL tube.

2. Add 75 µL of base solution (1 X working stock) to each sample.

3. Place tubes at 95 Ԩ in the heating block (In Dr.Lossie’s lab, the heating block

should be powered on 30 mins in advance) for 30 mins.

4. Cool the tubes to room temperature.

5. Add 75 µL neutralization solution (1 X working stock) and vortex.

6. The sample is ready for PCR.

176

C1. 5 Moue Genotyping PCR

 Master Mix for Park7

5 X Green Flexi Buffer (Promega): 3 µL

MgCl2: 2 µL;

DMSO: 1 µL

F Primer (20 pmol / µL): 0.6 µL;

R Primer (20 pmol / µL): 0.6 µL

R Primer (20 pmol / µL): 0.6 µL

dNTPs (25 mM): 0.4 µL

Go Taq (Promega): 0.08 µL

H2O: 5.62 µL;

DNA: 1 µL

 Program is on the White Eppendorf PCR machine: mmuDJ1

177

C1. 6 ELISA

1. The amount of protein that can be absorbed by the plate needed to be titrated.

Both the primary and secondary antibody need to be titrated.

2. Put the equal amount and volume of protein into 96-well Maxisorb plate.

In the present study, 100 µL of protein (20 µg/100 µL) are added into each well.

3. Incubate at 4 Ԩ with rotation for 5 hours.

4. Add 200 µL blocking buffer (3 % BSA) into each well and incubate at 4 Ԩ

overnight.

5. Wash briefly and add 150 µL primary antibody diluted in 0.1 % BSA in each well.

Incubate the plate at room temperature for 2 hours.

6. Wash with PBS / Tween for 3 times and add 150 µL secondary HRP diluted in

0.1 % BSA into each well. Incubate at room temperature for 45 mins.

7. Wash with PBS / Tween 3 times and wash with PBS 3 times.

8. Make OPD tablets. Put 1 gold tablet and 1 silver tablet into 20 mL H2O.

9. Put 200 µL OPD solutions into each well, wait for 30-45 mins and read it in

USDA plate reader.

178

C1. 7 In situ ELISA

 Solution

4 % formaldehyde in PBS; 0.5 % Triton 100 (Dilute 10 % Triton with H2O); 1 % BSA solution (Dilute 3 % BSA with PBS); and 0.1 % BSA solution (Dilute 1 % BSA with

PBS)

 Procedure:

The concentrations of primary and secondary antibody are needed to be titrated. In the

present study, 1/500 for MF20 and 1/500 for Donkey anti-Mouse 594 are used.

1. Aspirate growth medium from 96-well plate and gently wash with DPBS twice.

2. Put 100 µL of 4 % formaldehyde and incubate for 5 mins.

3. Wash 3 times with DPBS, put 0.5 % Triton100 and incubate for 5 min.

4. Wash 3 times with DPBS, add 150 µL blocking buffer (1 % BSA) and incubate

for 5 hours.

5. Wash briefly with DPBS and add 100 µL primary antibody diluted in 0.1 % BSA

and incubate at 4 Ԩ overnight with rotation.

6. Wash 5 times with DPBS and add secondary antibody diluted in 0.1 % BSA and

incubate at RT for 45 mins.

7. Wash 5 times with DPBS and take the plate to LiLLY 3-204 (Tecan plate reader)

to measure the fluorescence.

179

C1. 8 Protein Extraction

 Preparation

RIPA buffer (Working Solution)

50 mM Tris HCl; 150 mM NaCl; 2 mM EDTA; 1 % Triton X 100; 0.5 %

Deoxycholate; 0.1 % SDS; 50 mM NaF, 1X Protease inhibitor and 1X Phosphatase

inhibitor.

 Procedure

1. Remove culture medium and rinse the cells with ice-cold DPBS twice.

2. Add the RIPA buffer to the plate and incubate the plate on ice for 10 mins with

rotation.

3. Scrape cells from the plate and collect cell lysate into 1.5mL tubes.

4. Votex tubes and rotate the protein tubes in cold-box for 45 mins to 1 hour.

5. Centrifuge tubes at 12000 X g for 15 mins at 4 ℃.

6. Transfer supernatant to a new tube for further analysis.

7. The cell lysate can be frozen at this point for long-term storage at -80 ℃.

180

VITA

180

VITA

Hui Yu grew up in Yi Chun, a small city surrounded by mountains in northern part of China. Her parents both worked in Yi Chun Feed Company, which brought Hui to the major of Animal Sciences. In 2002, Hui attended Northeast Agricultural University, where she got her Bachelor’s Degree with honors in Animal Science. She started her Master’s study in Northwest Agriculture and Forestry University, which was 3000 kilometers away from her hometown, in Dr. Hong Chen’s lab. Her project involved identification of the genes that related to the cashmere trait in Mongolian Cashmere goat and Shanbei Cashmere goat. She completed her M.S. in 2009 and came to Purdue to work on her Ph.D. with Dr. Christopher Bidwell on genes regulation in callipyge muscle hypertrophy. Hui met her husband Mou Wang in 2006 and they got married just before she came to Purdue. While working on her degree at Purdue, Hui has a lovely baby, Alexander Wang, in December 2012.