Volume 3, Number 2 December 2015 Gravitational and Space Research
Publication of the American Society for Gravitational and Space Research Gravitational and Space Research Volume 3, Number 2 December 2015 Publication of the American Society for Gravitational and Space Research ISSN 2332-7774
ASGSB EDITORIAL BOARD
R. Michael Banish, Ph.D. Ted A. Bateman, Ph.D. University of Alabama - Huntsville University of North Carolina - Chapel Hill Elison B. Blancaflor, Ph.D. Zhengdong Cheng, Ph.D. The Samuel Roberts Nobel Foundation Texas A&M University Luis Angel Cubano, Ph.D. Emily M. Holton, Ph.D. Uni. Central del Caribe Life Sciences - NASA ARC John Z. Kiss, Ph.D. Dennis F Kucik, M.D., Ph.D. University of Mississippi University of Alabama at Birmingham William J. Landis, Ph.D. Robert C. Morrow, Ph.D. The University of Akron Orbital Technologies Corp Gloria K. Muday, Ph.D. Danny A Riley Wake Forest Univ. Medical College of Wisconsin April E. Ronca, Ph.D. Michael Roberts Wake Forest Univ. Sch. of Medicine Center for the Advancement of Science in Space Paul W. Todd, Ph.D. Sarah Wyatt, Ph.D. Techshot, Inc. Ohio University
ASGSB PUBLISHING STAFF Editor in Chief: Anna-Lisa Paul, Ph.D. University of Florida Copy Editor: Copy Editor: Publishing Editor: Janet V. Powers Karen Goodman Timothy J. Mulkey, Ph.D. NASA Research & Education University of Colorado-Boulder Indiana State University Support Services
From the cover: A hypothetical model showing that a gradient of extracellular nucleotides could activate calcium channels, contributing to a calcium differential that is essential for gravity-directed polarization in Ceratopteris richardii spores. From: “New Insights in Plant Biology Gained from Research in Space.” Cannon et al., p 3. GENERAL INFORMATION
Gravitational and Space Research (ISSN 2332-7774) is a journal devoted to research in gravitational and space sciences. It is published by the American Society for Gravitational and Space Research, a non-profit organization whose members share a common goal of furthering the understanding of the effects of gravity and the use of the unique environment of spaceflight for research. Gravitational and Space Research is overseen by a steering committee consisting of the Publications Committee, the Editor, the President, and the Secretary-Treasurer of the ASGSR. The American Society for Gravitational and Space Biology was created in 1984 and became The American Society for Gravitational and Space Research in 2012 to provide an avenue for scientists interested in gravitational and space biology to share information and join together to speak with a united voice in support of this field of science. The effects of gravity have been acknowledged since Galileo’s time, but only since the 1970s has gravitational research begun to attract attention. With the birth of the space age, the opportunity for experimentation over the full spectrum of gravity finally became a reality, and a new environment and research tool became available to probe gravitational phenomena and expand scientific knowledge. Space and spaceflight introduced new questions about space radiation and the physiological and psychological effects of the artificial environment of spacecraft. The objectives of ASGSR are:
To promote research, education, training, and development in the areas of gravitational and space research and to apply the knowledge gained to a better understanding of the effect of gravity and space environmental factors on the flora and fauna of Earth. To disseminate information on gravitational and space research and the application of this research to the solution of terrestrial and space problems. To provide a forum for communication among professionals in academia, government, business, and other segments of society involved in gravitational and space research and application. To promote the study of concepts and the implementation of programs that can achieve these ends and further the advancement and welfare of humankind. MEMBERSHIP: The American Society for Gravitational and Space Research welcomes individual, organizational, and corporate members in all of the basic and applied fields of the space and gravitational sciences. Members are active in the fields of space medicine, plant and animal gravitational physiology, cell and developmental biology, biophysics, and space hardware, and life support system and hardware development. Membership is open to nationals of all countries. Members must have education or research or applied experience in areas related to the Society’s purposes, and student members must be actively enrolled in an academic curriculum leading toward a career related to the Society’s purposes. Membership applications may be obtained at the society website (http://www.asgsr.org).
Copyright © 2015 by the American Society for Gravitational and Space Biology
ii Gravitational and Space Research Volume 3 (2) December 2015 Gravitational and Space Research Editorial Board Editor in Chief: Copy Editor: Anna-Lisa Paul, Ph.D Janet V. Powers E-Mail: [email protected] University of Florida Expertise: Gravitation & space biology, informatics E-Mail: [email protected] Expertise: Plant molecular genetics, gene expression, plant space biology Copy Editor: Publishing Editor: Karen Goodman Timothy J. Mulkey, Ph.D. University of Colorado-Boulder Indiana State University E-Mail: [email protected] E-Mail: [email protected] Expertise: Project management and system development Expertise: Plant growth, development, hormones, calcium Associate Editors:
R. Michael Banish, Ph.D. Ted A. Bateman, Ph.D. University of Alabama – Huntsville University of North Carolina - Chapel Hill E-Mail: [email protected] E-Mail: [email protected] Expertise: Chemical and materials engineering Expertise: Radiation and bone loss
Elison B. Blancaflor, Ph.D. Zhengdong Cheng, Ph.D. The Samuel Roberts Noble Foundation Texas A&M University E-Mail: [email protected] E-Mail: [email protected] Expertise: Cellular & molecular mechanisms; cytoskeleton; ion Expertise: Colloids; anisotropic particles, photonic crystals, solar signaling energy harvesting, liquid crystals, nano-composites Luis Angel Cubano, Ph.D. Emily M. Holton, Ph.D. Uni. Central del Caribe Life Sciences - NASA Ames Research Center E-Mail: [email protected] E-Mail: [email protected] Expertise: Cell biology, cytoskeleton, gene expression Expertise: Hindlimb unloading, calcium/bone metabolism John Z. Kiss, Ph.D. Dennis F Kucik, M.D., Ph.D. University of Mississippi University of Alabama at Birmingham E-Mail: [email protected] E-Mail: [email protected] Expertise: Plant gravitational biology, tropisms, growth and Expertise: Cell adhesion and integrins, atherosclerosis & immunology development William J. Landis, Ph.D. Robert C. Morrow, Ph.D.. The University of Akron Orbital Technologies Corp. E-Mail: [email protected] E-Mail: [email protected] Expertise: Bone structure & biochemistry, cartilage & tendon Expertise: Space flight hardware; environmental control systems; biology environment plant growth; plant disorders
Gloria K. Muday, Ph.D. Danny Riley, Ph.D. Wake Forest Univ Medical College of Wisconsin E-Mail: [email protected] E-Mail: [email protected] Expertise: Auxin transport, leptin signaling, hormone physiology, Expertise: Neuromuscular structure & function; spaceflight; biochemistry, and molecular biology vibration injury of tissue April E. Ronca, Ph.D. Michael Roberts, Ph.D. Wake Forest University School of Medicine Center for the Advancement of Science in Space (CASIS) E-Mail: [email protected] E-Mail: [email protected] Expertise: Reproduction, development, micro- & hyper-gravity Expertise: Reproduction, development, micro- & hyper-gravity Paul W. Todd, Ph.D. Sarah Wyatt, Ph.D. Techshot, Inc. Ohio University E-Mail: [email protected] E-Mail: [email protected] Expertise: Low-gravity physics, flight hardware, biotechnology, Expertise: Plant responses to gravity, genomics/gene expression and cell biology, osteogenesis and microbiology. proteomics
Gravitational and Space Biology Volume 3 (2) December 2015 iii Gravitational and Space Research Instructions for Authors
Brief Overview: The journal of the American Society for Gravitational and Space Research (ASGSR), Gravitational and Space Research, publishes quality, peer reviewed manuscripts in several categories. Manuscripts should be self-contained, and all conclusions substantiated and supported by results in the form of figures and/or tables. Authors are held to standards of writing (American English) for clarity and material appropriate for the Gravitational and Space Research (GSR) journal. Subject matter can include any topic within the following broad categories: the impact of gravity and changes in the gravity vector on biology, astrobiology, spaceflight and planetary analog environment research, advanced life support (ALS), biophysics, radiation biology, human-tended spaceflight, satellite payloads, suborbital research, parabolic flight, sounding rockets, high altitude balloons, hardware engineering and development, acceleration in altered gravity environments, combustion science, complex fluids, fluid physics, fundamental physics, and materials science. In addition, research wholly dedicated to terrestrial explorations of the impact of gravity and to changes in the gravity vector is welcome. The categories of papers include Short Communication, Methods, Research, Hypothesis, and Review. We are also open to publishing Educational Outreach papers, and can embed links to additional materials, including videos and large databases.
I. Short Communications Short communications are submissions typically 2 - 3 pages in length (1000 – 2500 words, excluding references). These manuscripts are generally comprised of preliminary data supporting work in progress, or a brief report to showcase a stand-alone facet of a larger project.
II. Methods Papers Methods papers are manuscripts typically 3 - 6 pages in length and, although there is no strict limitation to size, a reviewer may address extremes of brevity or length as appropriate to conveying the information presented. These manuscripts are primarily comprised of data and protocols that support the design and execution of experiments in any of the categories defined in the overview. The manuscripts should contain sufficient detail to enable a reader to replicate the protocol. Figures should include illustrations of procedures and set-up, and should include data that verify the efficacy of the procedures.
III. Research Papers Research papers are manuscripts of typically 8 - 15 pages in length. These manuscripts present original research of interest to the gravitational and space research community.
IV. Review Articles Review articles are typically 10 - 15 pages in length. These manuscripts are often solicited from symposium speakers at the annual ASGSR meeting, but they are not limited to those solicitations. Any author may approach the editorial board with a suggestion or request to submit a review article, which will be peer-reviewed as any other paper.
iv Gravitational and Space Biology Volume 3 (2) December 2015 Detailed Instructions Format The same basic format is used for each type of article. Consult a current issue of Gravitational and Space Research, as well as the instructions below, for guidance on formatting, organizing, and preparing references, figures, tables, and legends. An article must have a brief abstract (less than 250 words) that summarizes the principal conclusions of the paper. A Template in Microsoft Word can be downloaded from the Journal website (http://GravitationalAndSpaceResearch.org) that conforms to the general Journal requirements. Alternatively, the manuscript can be formatted for submission along the following guidelines (see also Arrangement section below):
Text: Single spaced, Times New Roman 11, paragraphs indent 0.25 inch. Do not insert line space after paragraph. Do not use page breaks. Citations: In text by (Author, year) mode; details below. Headings: HEADING LEVEL ONE; Bold, all capital. Subheadings: Heading level two; Bold, sentence case. Subheadings: Heading level three; Italics, non-bold, sentence case. Reference section: Must comply with format below, each citation separated by line space.
Length Length is dependent on the type of manuscript being submitted; see overviews above for specifics. One page of a GSR article is typically comprised of 750 – 950 words (depending on the number of figures) and articles range from 2-3 pages for Short Communications, to 15 pages for full Research Papers and Review Articles.
Abbreviations Do not use abbreviations other than those that are standard for international usage. Use SI units as far as possible. Use g (italicized) for unit gravity, to distinguish it from the standard abbreviation g (not italicized) for gram. Any acronyms that are used in the manuscript must be defined at first mention.
Arrangement Arrange the manuscript in the following order, with all pages numbered consecutively in the footer of the lower right corner. The last name of the first author should precede each page number. A Template in Microsoft Word can be downloaded from the Journal website (http://GravitationalAndSpaceResearch.org) that conforms to the general Journal requirements. Running Title: Title case. To be used as a header; it is not to exceed 60 characters, including spaces. Full Title: Title case. Use a descriptive title, but do not exceed 200 characters, including spaces. All Authors: Provide full names and affiliations (institution, city, state) in the order in which they are to be listed. Use numerical superscripts to identify affiliations. Corresponding Author: Full name, affiliation and address, e-mail, telephone number.
Gravitational and Space Research Volume 3 (2) December 2015 v Abstract: Summarize the principal approach and conclusions of the paper (not to exceed 250 words). Body of paper: For Research Papers, the body of the paper should be arranged into subsections for Introduction, Materials and Methods, Results, and Discussion. Review Papers should be organized in a manner appropriate to the subject. Methods papers should include a short Introduction and also a Discussion of the application addressing the significance of the method being described. References and Citations: Cite each reference in the text by author(s) name(s) and the publication date: Examples: Smith, 1989 (one author); Smith and Jones, 2001 (two authors); Smith et al., 2010 (more than two authors). An EndNote® Style file can be downloaded at the GSR website (http://GravitationalAndSpaceResearch.org). Alphabetize the reference list by authors' last names. List only published or in-press articles. Unpublished results, including personal communications and submitted manuscripts, should be cited as such in the text. References formatted as follows: last name(s) of author(s), followed by initials with no space; year of publication in parentheses; article title in sentence case, followed by a period; journal title (unabbreviated and italicized), followed by volume number in bold, issue number in parenthesis (if applicable), a colon, a space, and page numbers.
Four examples below: Journal Article: Salmi ML, Bushart TJ, Roux SJ (2011) Autonomous gravity perception and responses of single plant cells. Gravitational and Space Biology 25: 6-13 Book: Baker D (1981) The History of Spaceflight, New York: Crown Publishers, Inc. Edited Book: Horz F, Grieve R, Heiken G, Spudis P, Binder A (1991) Lunar surface processes. In Lunar Sourcebook: A User's Guide to the Moon, G.H. Heiken DTV, and B.M. French (ed), pp 61-120. Cambridge: Cambridge University Press Conference Proceedings: Peldszus R (2011) Surprise Payload Rack: A user scenario of a conceptual novelty intervention system for isolated crews on extended space exploration missions. In Workshop Proceedings of the 7th International Conference on Intelligent Environments, Vol. 10, p 290.
Figure legends: Provide full, descriptive figure legends for each figure; each figure legend should be composed of a short descriptive title, followed by a description of the material illustrated in the figure. Figure legends should provide any information key to understanding the material presented in the figure.
Figures: Submit Figures as individual graphics files (TIF, BMP, or high resolution JPG). Resolution must be at least 300dpi for photographs and 600dpi for line graphics. Include Figure number in the file name when uploaded. For publication, Figures will be formatted to either one column width (3 inches / 7.6cm) or across two columns (6.3 inches / 16cm). Note that all lettering and numbers within Figures must be at least font size 8 when reduced to publication width. This restriction includes numbers and axis information in graphs as well. Authors are encouraged to test size their Figures in these two dimensions to ensure compliance, as Figures which contain illegible annotations will be returned for
vi Gravitational and Space Biology Volume 3 (2) December 2015 reconfiguration. Number Figures consecutively as they are used in the text. Use Figure 1, i.e., capitalize and the full word “Figure” (do not use Fig. 1). The first time a Figure is discussed, refer to it actively rather than parenthetically. Provide enough information in the Figure Legend such that the reader can understand the Figure without significant input from the text. Designate Figure sections with letters and explain all symbols and abbreviations that are used in the Figure.
Tables: Provide at the end of the manuscript. Number Tables consecutively as they are used in the text. The first time a Table is discussed refer to it actively, rather than parenthetically. Give each Table a concise title, followed by a legend that makes the general meaning of the Table comprehensible without reference to the text. Tables should be constructed in Word or Excel with the general format below. Font size 10 should be used for the primary Table text, but font size 8 may be used for footnotes or annotations.
Table 1. Atmospheric pressure relative to altitude Pressure (kPa) Altitude (m) Comments 101 – 70 0 – 3000 tropical / temperate / taiga biome - many examples of human habitation 70 – 50 3000 – 5500 tundra / alpine biome - few examples of human habitation 50 – 30 5500 – 9000 extreme terrestrial elevations - humans require supplemental oxygen 30 – 5 9000 – 27000 plants can survive as long as temperature is mediated and water is available Footnotes as necessary
Manuscript Peer Review and Preparation of Final Version Prior to publication, manuscripts are reviewed by the managing editor who is assigned to an author’s article, and by two to three external scientific reviewers. Manuscripts submitted without complying with submission requirements may be returned for format changes before being accepted for review. Once a manuscript is accepted, the manuscript is reviewed internally for copyediting, and then sent to the publishing editor. Page proofs are provided to the authors for review prior to publication.
Journal Policies
Authorship Statement Authorship of articles implies that an individual has made a substantial contribution to the article, both in terms of the design of the study or collection/evaluation of data and with regard to the intellectual content of the manuscript.
Gravitational and Space Research Volume 3 (2) December 2015 vii Conflict-of-Interest Statement Reviewers recruited for the evaluation of manuscripts being considered for publication in Gravitational and Space Research will be held to Conflict of Interest standards comparable to those required of NSF panelists. You may be considered in conflict if: You have an association with the submitting institution: Employment as faculty at the submitting institution or as a consultant or advisor to the institution. Previous employment with the institution within the last 12 months. Being considered for employment at the institution. Hold any office, governing board membership, or relevant committee chair in the institution. Received and retained an honorarium or award from the institution within the last 12 months. Ownership of investments in the research technology.
You have a relationship with an author on the manuscript: A family relationship such as spouse, child, sibling, or parent. Any affiliation or relationship of your spouse, of your minor child, of a relative living in your immediate household, or of anyone who is legally your partner. A relationship, such as close personal friendship, that you think might tend to affect your judgment or be seen as doing so by a reasonable person familiar with the relationship. Business or professional partnership. Past or present association as thesis advisor or thesis student. Past or present association as post-doctoral advisor or postdoctoral student within the past 5 years. Collaboration on a project or on a book, article, report, or paper within the last 2 years. Co-editing of a journal, compendium, or conference proceedings within the last 1 year.
Published Statement of Human and Animal Rights: Research involving Human and Animal Subjects must have been approved by the author’s institutional review board. Authors must include in the Methods section a brief statement identifying the institutional and/or licensing committee approving the experiments. For experiments involving human subjects, authors must also include a statement confirming that informed consent was obtained from all subjects. All experiments involving human subjects must have been conducted according to the principles expressed in the Declaration of Helsinki. If doubt exists whether the research was conducted in accordance with the Helsinki Declaration, the authors must explain the rationale for their approach, and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. When reporting experiments on animals, authors should be asked to indicate whether the institutional and national guide for the care and use of laboratory animals was followed. For research using Recombinant DNA, physical and biological containment must conform to National Institutes of Health guidelines or those of a corresponding agency.
Published Statement of Informed Consent: The general requirements for informed consent conform to guidelines and requirements outlined by the National Science Foundation (http://www.nsf.gov/bfa/dias/policy/docs/45cfr690.pdf) and Health and Human services (http://www.hhs.gov/ohrp/policy/consent/). No investigator may involve a human being as a subject in research covered by this policy unless the investigator has obtained the legally effective informed consent of the subject or the subject's legally authorized representative. An investigator shall seek such consent only under circumstances that provide the prospective subject or the
viii Gravitational and Space Biology Volume 3 (2) December 2015 representative sufficient opportunity to consider whether or not to participate and that minimize the possibility of coercion or undue influence. The information that is given to the subject or the representative shall be in language understandable to the subject or the representative. No informed consent, whether oral or written, may include any exculpatory language through which the subject or the representative is made to waive or appear to waive any of the subject's legal rights, or releases or appears to release the investigator, the sponsor, the institution or its agents from liability for negligence.
Basic elements of informed consent: In seeking informed consent the following information shall be provided to each subject: A statement that the study involves research, an explanation of the purposes of the research, and the expected duration of the subject's participation, a description of the procedures to be followed, and identification of any procedures which are experimental; A description of any reasonably foreseeable risks or discomforts to the subject; A description of any benefits to the subject or to others which may reasonably be expected from the research; A disclosure of appropriate alternative procedures or courses of treatment, if any, that might be advantageous to the subject; A statement describing the extent, if any, to which confidentiality of records identifying the subject will be maintained; For research involving more than minimal risk, an explanation as to whether any compensation and an explanation as to whether any medical treatments are available if injury occurs and, if so, what they consist of, or where further information may be obtained; An explanation of whom to contact for answers to pertinent questions about the research and research subjects' rights, and whom to contact in the event of a research-related injury to the subject; and A statement that participation is voluntary, refusal to participate will involve no penalty or loss of benefits to which the subject is otherwise entitled, and the subject may discontinue participation at any time without penalty or loss of benefits to which the subject is otherwise entitled.
Gravitational and Space Research Volume 3 (2) December 2015 ix Table of Contents
General Information ...... ii
Editorial Board ...... iii Instruction to Authors & Journal Policies ...... iv
Table of Contents ...... 1
Reviews New Insights in Plant Biology Gained from Research in Space Ashley E. Cannon, Mari L. Salmi, Gregory Clark, and Stanley Roux ...... 3 Short Communications Microarray Identifies Transcription Factors Potentially Involved in Gravitropic Signal Transduction in Arabidopsis C. Adam Cook, Avery Tucker, Kaiyu Shen, and Sarah E. Wyatt ...... 20 Research Articles Compact Heat Rejection System Utilizing Integral Variable Conductance Planar Heat Pipe Radiator for Space Application Kuan-Lin Lee, Yeyuan Li, Brian J. Guzek, Jaikrishnan R. Kadambi, and Yasuhiro Kamotani ...... 30 Validation of Assays for Reactive Oxygen Species and Glutathione in Saccharomyces cerevisiae during Microgravity Simulation Timothy G. Hammond, Patricia L. Allen, and Holly H. Birdsall ...... 42 Mapping by VESGEN of Wing Vein Phenotype in Drosophila for Quantifying Adaptations to Space Environments Patricia Parsons-Wingerter, Ravikumar Hosamani, Mary B. Vickerman, and Sharmila Bhattacharya ...... 54
Index of Authors ...... 65
Gravitational and Space Research Volume 3 (2) Dec 2015 1 2 Gravitational and Space Research Volume 3 (2) Dec 2015 Review
New Insights in Plant Biology Gained from Research in Space
Ashley E. Cannon, Mari L. Salmi, Gregory Clark, and Stanley Roux
Department of Molecular Biosciences, The University of Texas, Austin, TX
ABSTRACT plants in space have used Arabidopsis thaliana, but the single-celled, Ceratopteris richardii spore Recent spaceflight experiments have provided is also a valuable model system that has been used many new insights into the role of gravity in plant to understand plant gravity response. Experiments growth and development. Scientists have been using these fern spores have revealed a dynamic taking seeds and plants into space for decades in and gravity-responsive trans-cell Ca2+ current that an effort to understand how the stressful directs polarization of these spores and a possible environment of space affects them. The resultant role of extracellular nucleotides in establishing or data have yielded significant advances in the contributing to this current. As technology development of advanced life-support systems for continues to improve, spaceflight experiments will long-duration spaceflight and a better provide many new insights into the role and understanding of the fundamental role of gravity effects of gravity on plant growth and in directing the growth and development of plants. development. Experiments have improved as new spaceflight hardware and technology paved the way for INTRODUCTION progressively more insightful and rigorous plant research in space. The International Space Station Studies on the role of gravity in plant growth (ISS) has provided an opportunity for scientists to and development, especially tropisms, have been both monitor and control their experiments in ongoing for well over a century. With the advent real-time. Experiments on the ISS have provided of space travel, the microgravity environment has valuable insights into endogenous growth provided a unique experimental condition where responses, light responses, and transcriptomic and scientists can investigate how altering the gravity proteomic changes that occur in the microgravity stimulus affects signaling and the subsequent environment. In recent years most studies of response. Plants have always been a topic of interest in relation to long-term human space travel because of their ability to provide food and Key words: Plant Space Research; to clean used water and air — essential Gravitropism; Polarization; Plant Biology; components of a life support system. In recent Arabidopsis; Ceratopteris; Gravity years, plant biology experiments in space have Perception provided many new insights about gravity-related Correspondence to: Stanley Roux signaling and how the microgravity allows for 1 University Station STOP A6700 novel or altered responses to environmental University of Texas stimuli. Austin, TX 78712 One major goal of plant space research is the Telephone: 512-471-4238 development of a self-sustained life support E-mail: [email protected] system (Galston, 1992; Paul et al., 2013b). Plants
Gravitational and Space Research Volume 3 (2) Dec 2015 3 Cannon et al. -- Plant Biology Insights from Space Research
have the unique ability to purify the air using changes in plant growth and development, genetic photosynthesis — a process by which water and material, tropisms, and endogenous movements carbon dioxide are converted into carbohydrates (Paul et al., 2013b). The first plant experiments in and oxygen. Plants also have the ability to purify space were focused on understanding how the water through the process of transpiration — a microgravity and cosmic radiation of the space process where water is filtered before being environment affect biological systems. Dormant transported through the plant until it eventually seeds of many different plant species were flown evaporates out of pores in the leaves. In an on Discoverer 17 in 1960 and Sputnik 4 in 1961 enclosed life-support system, the condensation (Halstead and Dutcher, 1984). After multiple un- formed from evaporated water would be potable. manned, orbiter missions, the first plant growth Additionally, if crops are the plants chosen to experiments began to take place on the manned grow in this life-support system, they will provide Skylab spacecraft and on the Russian Salyut space food for the crew. All of these resources would be station in the early 1970s. The experiments valuable on long-duration missions where conducted on the Russian spacecraft flights and carrying large amounts of supplies or going aboard the Salyut space station showed how through re-supply missions is not feasible. microgravity, long-term space exposure, and The National Aeronautics and Space flight conditions caused genetic changes that were Administration (NASA) has begun developing deleterious to seeds and seedlings (Dubinin et al., portions of the advanced life-support system on 1973; Vaulina et al., 1981; Kordyum et al., 1983; the International Space Station (ISS). A current Kostina et al., 1984). study that could provide a crop-based addition to Experiments conducted on the first space the life-support system is the development of the station developed by the United States — Skylab Vegetable Production System (VEGGIE). — showed the effects of the space environment VEGGIE was developed in an effort to provide on plant growth, phototropism, and cytoplasmic the crew not only with salad-type vegetables, but streaming (Summerlin, 1977). During the Skylab also the relaxation that comes from observing experiments, germination was delayed during green things growing (Retrieved from spaceflight but growth progressed normally after http://www.nasa.gov/mission_pages/station/resear the initial interruption. However, the direction of ch/experiments/863.html; Accessed 10/7/15). This plant growth was random and stems were not system will provide an additional resource for phototropic (Summerlin, 1977). Cytoplasmic plant space research because the tissue from crops streaming was initially observed by astronauts but grown inside can be preserved and used to stopped by the second observation because the evaluate how plants sense and respond to gravity. plants died, most likely because of their inability Although understanding the role of gravity in to photosynthesize due to a lack of access to CO2. plant growth and development through space Although there were many complications research is valuable, increasing our understanding associated with these experiments, they provided will also help improve our ability to grow plants valuable insight into the growth and development on Earth. The two missions VEG-01 and VEG-03 of plants in space and the need for further study have provided useful information about the (Summerlin, 1977). VEGGIE hardware, microbial load, and growth The construction of the space shuttle allowed media (Retrieved from http://www.nasa.gov for larger projects, advanced hardware, and /mission_pages/station/research/experiments/863. repeated experiments due to the shuttle’s capacity html, accessed 10/7/15 and http://www.nasa.gov/ and the crew’s ability to work on experiments mission_pages/station/research/experiments/1294. (Paul et al., 2013b). During the experiments flown html, accessed 10/7/15). on the shuttle, plant scientists initially In addition to developing plants for a self- encountered difficulties when they tried to grow sustained, advanced life-support system, space plants from seed-to-seed during spaceflight. In the travel has provided a venue for fundamental plant unfamiliar condition of space, plants experienced research. Since the beginning of the space delayed development. Through a series of program, scientists have been sending plants to experiments over the course of multiple missions, space and analyzing its effects by assessing plant growth chambers were modified to include
4 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research an air exchange system and supplemental carbon Research System (ABRS). The ABRS was dioxide (Kuang et al., 1996b; Musgrave et al., designed to support small biology experiments 1997). These changes allowed reproductive with plants, microorganisms, and small arthropods development to proceed normally and for pollen (Camacho, 2015; Paul and Ferl, 2015). The ABRS transfer and fertilization, leading to seed is useful for plant biology experiments because it production. These experiments, along with many can be equipped with a hydrated foam base and a others (Morrow et al., 1994; Kuang et al., 1996b; Green Fluorescent Protein (GFP) imaging system Kuang et al., 1996a; Musgrave et al., 1997; — two tools that have been used by plant Musgrave et al., 1998; Porterfield et al., 2000), biologists to conduct experiments in space (Paul allowed plant scientists to optimize plant growth and Ferl, 2015). Similar to the EMCS and Biolab, conditions in order to achieve results that could be the environmental and light conditions can be attributed confidently to true spaceflight managed and recorded throughout experiments conditions, not the poor growth conditions of the (Camacho, 2015; Paul and Ferl, 2015). hardware. Additionally, two units designed for vegetable As the shuttle program progressed and growth have recently been installed on the ISS. continued to succeed, the United States took up The Lada-Vegetable Production Unit was the task of developing a bigger and better space launched by the Russian Space Agency in 2002 station for scientific experiments. The components and was installed in the Russian segment of the were built, launched, and assembled beginning in ISS — the Zvezda module. This unit contains the late 1990s. The launch and assembly of the two independent greenhouse modules that are not ISS paved the way for the development of more temperature-regulated and are open to the cabin equipment designed for plant space research. The for air exchange. This unit was designed in an European Space Agency has provided a plant effort to provide a tool for investigating food research platform with the European Modular production and safety (Paul and Ferl, 2015). Cultivation System (EMCS) and Biolab NASA also designed a similar chamber for (Brinckmann, 2005). Both of these plant growth vegetable growth called Veggie-Vegetable facilities contain incubators equipped with a Production System (Veggie-VPS). Engineers centrifuge that can provide acceleration from installed LED lights in this unit that provide 0.001 g to 2.0 g. They also have illumination and optimal light for plant growth. Like the Lada- video options that allow experiments to be Vegetable Production Unit, Veggie-VPS is not tailored to collect plant growth images and videos. temperature-controlled and is open to the ISS for The installations of Biolab and the EMCS have gas exchange (Paul and Ferl, 2015). also improved investigators’ ability to monitor In the near future, NASA will be installing a and adjust environmental parameters. Both of new growth habitat on the ISS called the these plant growth chambers are hooked up to the Advanced Plant Habitat. The Advanced Plant Life Support System, creating a controlled Habitat will be a large volume chamber designed atmosphere where O2, CO2, and humidity levels for multigenerational studies. The atmosphere can be monitored and optimized. This Life and light in this chamber will be tightly monitored Support System also enables scientists to reduce and regulated during experiments. The Advanced CO2 and ethylene levels during experiments Plant Habitat is being designed as a tool that will (Brinckmann, 2005). Novel experiments contribute to the Bioregenerative Life Support investigating the threshold of gravity needed to System, an essential component of long-duration induce gravitropism (Driss-Ecole et al., 2008), space travel (Paul and Ferl, 2015). Space circumnutation (Johnsson et al., 2009), rosette leaf agencies worldwide have designed and installed movements (Solheim et al., 2009) in space, and plant growth facilities on the ISS that provide the the positive phototropic reaction of Arabidopsis to tools necessary for plant biologists to continue red-light in microgravity (Millar et al., 2010), conducting spaceflight experiments that contribute have been completed in the EMCS since it was a better understanding of the role of gravity in installed (Brinckmann, 2005; Kittang et al., 2014). plant growth and development. These tools also NASA designed and installed a similar system further improve the Bioregenerative Life Support on the ISS called the Advanced Biological system necessary for long-term space travel.
Gravitational and Space Research Volume 3 (2) Dec 2015 5 Cannon et al. -- Plant Biology Insights from Space Research
Another major advance for space research in process of applying for support to fund plant recent decades has been optimizing the process of spaceflight experiments. These reviews outlined in-flight preservation of samples for cellular or the considerations that have to be taken into molecular analysis after they return to Earth. account when planning an experiment, and they Initially, samples needed to be chemically fixed to provided information on data-collection strategies maintain the integrity of cell structure or frozen to to gain the most valuable information from a plant maintain high-quality nucleic acids and proteins. spaceflight experiment (Kiss, 2015; Paul and Ferl, Due to issues with flash freezing and maintaining 2015). Collectively, these articles provided ultra-cold temperature during their return to Earth, valuable information that will help future space scientists began to use a chemical fixative — plant biologists design and fly experiments. As the RNAlater™ (Ambion) — to preserve the multiple commercial companies continue to molecular integrity of samples. The study of this improve their space travel vehicles and the fixative under multiple conditions (Paul et al., international cooperation among space agencies 2005) — along with the development of the progresses, this new age of plant space biology Kennedy Space Center Fixation Tube (KFT) — should generate even more exciting and credible has allowed molecular biologists to conduct discoveries. transcriptomic (Paul et al., 2013a; Kwon et al., 2015) and proteomic (Ferl et al., 2015) studies on INSIGHTS ON THE EFFECTS OF tissue samples preserved in space and returned to GRAVITY ON PLANT GROWTH GAINED Earth. RNAlater has also been shown to be an FROM RECENT SPACEFLIGHT effective tool for preserving samples in space for EXPERIMENTS morphological studies using scanning electron Since the beginning of the space program, microscopy (Schultz et al., 2013). More recently, astronauts and scientists have collaboratively Nakashima et al. (2014b) optimized a explored how gravity affects plant growth using glutaraldehyde fixation method using KFTs by the space environment. In recent years, scientists increasing the concentration of glutaraldehyde, have begun to focus on understanding the role of storing the fixative at 4°C, and bubbling nitrogen gravity in plant rhythmic movements. (N2) gas over the fixative prior to loading the Specifically, the question, “is the force of gravity KFTs. All of these changes were made based on needed to initiate and sustain ultradian leaf previous studies where seedlings had not been movements?” has been explored. Ultradian leaf adequately preserved for morphological studies. movements follow a recurrent cycle repeated in These new methods of tissue preservation, and periods ranging from minutes to hours, and a others like them, have greatly improved the way recent report by Solheim et al. (2009) has scientists investigate morphological changes convincingly demonstrated that they can be associated with the extraterrestrial environment. affected or initiated by the force of gravity. These Since the beginning of plant experiments in authors carried out their novel studies by growing space, scientists and engineers have constantly Arabidopsis in the EMCS. In the microgravity worked to improve the condition of plant growth space environment, rhythmic leaf movements still facilities, ensuring future experiments would be occurred and their periods varied based on the better than the last. As we have now transitioned presence of light. After years of studies by several from the space shuttle to a new era of commercial labs on these ultradian leaf movements in the 1 g space travel, the technology available for plant environment on Earth, there was still debate on biology experiments in space has improved the role of gravity in initiating them. However, dramatically. These improvements have led to Solheim et al. (2009) showed that even when the many new insights about plant space biology. Paul force of gravity is minimal, leaves have rhythmic and Ferl (2015) and Kiss (2015) recently movements. In addition, they also observed when published thorough reviews that describe the leaves are grown in microgravity they have a lessons learned from decades of experiments in more pronounced gravitropic response when they space. Both reviews covered the approach and are transitioned to a 1 g environment. Both of constraints associated with spaceflight these findings provide novel insights on gravity- experiments. Kiss (2015) also described the
6 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research independent leaf movements and beg the question grown on rotors aboard the ISS and images of of what mechanisms cause them. inflorescence stems were taken over time to The mechanism behind the ultradian leaf document the effect of microgravity on movements may be explained by an additional circumnutation (Johnsson et al., 2009). Johnsson experiment using the data collected during the et al. (2009) showed that circumnutations in MULTIGEN-1 (MULTIple GENerations 1) microgravity, although present, have a much experiment use by Solheim et al. (2009). In this lower magnitude. Using controlled centrifuge experiment, the MULTIGEN-1 data were also pulses on the ISS, circumnutations at 0.8 g were used by Fisahn et al. (2015) to analyze the effects monitored. When stems were exposed to a higher of lunar gravity on leaf movement. The original g-force, circumnutations were amplified by a hypothesis, made by Dr. Gunter Klein, states that factor of five to ten (Johnsson et al., 2009). Data the movement of bean leaves grown in constant from monitoring leaves and stems of plants grown environmental conditions with no entraining on the ISS showed that although there are gravity- stimuli are a result of the lunar tidal force (Barlow independent endogenous growth movements, the et al., 2008). Barlow et al. (2008) demonstrated force of gravity has an effect on their magnitude this hypothesis by establishing a correlation or amplitude, showing these responses are between the two by monitoring the downward endogenous but can be affected by environmental movement of leaves and comparing this rhythm to factors like the force of gravity. changes in the tidal force. In order to find a direct Other plant movements associated with connection between the tidal force and leaf growth are root skewing and waving. These movements, Fisahn et al. (2015) designed an growth movements, which were first observed in experiment where the lunisolar gravitational force Arabidopsis roots (Okada and Shimura, 1990; would be altered by monitoring plants grown on Mullen et al., 1998; Thompson and Holbrook, the ISS. The ISS provides a unique environment 2004; Oliva and Dunand, 2007), were initially because the gravitational pull from Earth is hypothesized to be an integrated response to reduced and the location of the Moon changes gravity, mechanical, and touch stimulation as the constantly during orbit. In this experiment, the tip of the root grows along the surface of a growth periodicity and phase of leaf ultradian rhythms medium. However, experiments performed in were compared to changes in the lunisolar microgravity showed unexpectedly that root gravitational force. Fisahn et al. (2015) showed waving and skewing patterns do not require a lunisolar gravitational profiles had a periodicity of gravity stimulus. In fact, three spaceflight 45 minutes in orbit and that Arabidopsis leaf experiments showed significant differences in movements had a similar periodicity and growth patterns between space and ground-grown synchronous phase. This discovery corroborates Arabidopsis roots (Millar et al., 2011; Paul et al., the data collected by Klein and analyzed and 2012a; Nakashima et al., 2014a). Millar et al. summarized by Barlow et al. (2008) on Earth. All (2011) found Arabidopsis (ecotype Landsberg) of these findings provide unique insights into the roots exhibited increased skewing to the left and behavior of leaf movements when the interference suggested that this was due to an endogenous of Earth’s gravity is minimal. However, the response. Arabidopsis (ecotypes Wassilewskija answer to the question of the necessity of gravity and Columbia) roots also showed exaggerated in initiating and sustaining leaf movements is still skewing in microgravity conditions (Paul et al., not clear. 2012a). Another spaceflight study found that the In addition to leaf movements, scientists have actin cytoskeleton actively suppresses this long been fascinated by plant rotational growth endogenous skewing response in Arabidopsis patterns associated with growth oscillations called roots (Nakashima et al., 2014a). Thus it seems circumnutations. Much like the leaf movements more likely that root waving and skewing are mentioned above, circumnutation could be an directed mainly by mechanical stimuli, rather than endogenous plant action that can be altered by by gravity (Roux, 2012). environmental factors — like gravity — or it may In addition to modulating root waving and be caused by environmental stimuli. In order to skewing, mechanical stimuli also induce the investigate this question, Arabidopsis plants were release of adenosine triphosphate (ATP) into the
Gravitational and Space Research Volume 3 (2) Dec 2015 7 Cannon et al. -- Plant Biology Insights from Space Research extracellular matrix (ECM) of Arabidopsis roots due to unidirectional light — is an essential aspect (Weerasinghe et al., 2009). Extracellular ATP of plant survival, but studies of this phenomenon (eATP) can modulate the growth of plant cells on Earth always have to consider the force of (Clark et al., 2014), and the addition of ATP gravity as a contributing factor. Recently, Millar inhibits root gravitropism and induces root curling et al. (2010) conducted a study of red-light and (Tang et al., 2003). Exogenous ATP was also blue-light phototropic responses using the EMCS shown to increase root skewing in a pH-dependent on the ISS in order to avoid the complications of manner (Haruta and Sussman, 2012). The the 1 g environment. One advantage of the EMCS concentration of eATP is regulated partially by is the ability to use the centrifuge for a 1 g space enzymes called ecto-apyrases (ecto-nucleoside environment control. Using this growth chamber, triphosphate diphosphohydrolases). In plants, Millar et al. (2010) observed a novel red-light apyrases play a pivotal role in controlling growth phototropic response in Arabidopsis hypocotyls and development (Clark et al., 2014). Recently, grown from seed in microgravity. This response we found apyrases also play an important role in was not seen in Earth-grown controls or in the 1 g regulating the root skewing response in space environment controls. Millar et al. (2010) Arabidopsis (Yang et al., 2015). In combination also showed a more robust blue-light response with the results from spaceflight experiments, compared to the 1 g control. these new insights indicate that endogenous actin- In addition to providing an environment dependent signals and mechanical stimuli where the interference of gravity is minimal, mediated by eATP and ecto-apyrases help spaceflight experiments provide an opportunity regulate the Arabidopsis root skewing response. for organisms to experience an extraterrestrial Recently, a lectin kinase receptor — DORN1 — environment where conditions are distinctly was identified as the first plant eATP receptor and different from Earth. This allows scientists to found to play a role in defense responses (Choi et evaluate changes in gene expression caused by the al., 2014). Thus, it will be important to determine multiple environmental changes of the space if DORN1 mediates apyrase and eATP effects on environment. Microarray analysis of RNA from root skewing. seedlings and culture cells grown in space Also recently, a plasma membrane receptor- revealed a statistically significant difference in the like kinase — FERONIA — was demonstrated to expression of about 300 genes when compared to play an important role in Arabidopsis root ground controls (Paul et al., 2012b). Although skewing responses (Shih et al., 2014). FERONIA both seedlings and cell cultures showed changes is a receptor-like kinase in the CrRLK1L in gene expression due to spaceflight, the genes subfamily that has previously been implicated in that were differentially expressed in each system regulation of many aspects of plant growth and were not the same. Paul et al. (2012b) suggest this development (Escobar-Restrepo et al., 2007; could be due to the uniformity of the cell culture Deslauriers and Larsen, 2010; Kessler et al., 2010; compared to the complexity of the multi-cellular Duan et al., 2011). The study by Shih et al. (2014) seedling, or that it could be the presence of a found calcium signals induced by mechanical coordinated, organ-specific response in seedlings stimulation were lacking or altered in feronia (fer) compared to a generic response in undifferentiated mutants. In addition to an impaired skewing cells. This pioneering study showed how complex response, fer mutant roots showed disrupted the spaceflight response is in both undifferentiated ability to penetrate agar surfaces and altered cells and multi-cellular seedlings. The gene growth response to impenetrable objects. The fer expression changes could not easily be explained mutant also showed decreased levels of by changes in gravity or other environmental expression of certain touch-inducible genes in factors we associate with the terrestrial response to hypoosmotic stress compared to wild environment. type (WT). Another gene-expression study, conducted by The space environment provides a unique Kwon et al. (2015), examined how the space opportunity to study environmental effects environment alters gene expression by comparing without the interference of gravity. For example, the transcripts of plants grown in space for two phototropism — the directed growth of a plant weeks to plants grown on Earth. The evaluation of
8 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research the two transcriptomes showed genes associated expression changes similar enough to be with oxidative stress, cell wall remodeling, and compared using a relatively stringent statistical the endomembrane system are repressed in space- analyses (Paul et al., 2011). The gene expression grown Arabidopsis plants. Additionally, after changes due to parabolic flight were related to further analysis, Kwon et al. (2015) discovered changes in gravity and stress (Paul et al., 2011). many of the transcripts down-regulated in space Aubry-Hivet et al. (2014) showed roots exposed are enriched in root hairs. Data showing the to transient microgravity on parabolic flights have average root hair length of space-grown seedlings distinct transcriptomic changes that are dependent was significantly less than ground controls upon auxin signaling by comparing the transcripts support this observation. Kwon et al. (2015) from WT, pin2, and pin3 Arabidopsis seedlings. independently confirmed the transcriptome Hausmann et al. (2014) used transgenic 2+ changes seen in space-grown seedlings caused Arabidopsis callus to monitor H2O2 and Ca altered root hair growth by assessing root hair during parabolic flight. The same cells were used phenotypes of homozygous mutants of the genes to analyze transcripts after microgravity exposure; down-regulated in microgravity. This mutant many of the genes up-regulated were Ca2+ and screen led to the identification of two peroxidase ROS related (Hausmann et al., 2014). mutants with defective root hairs. These root hair Collectively, hardware improvements along changes could affect water and nutrient uptake in with knowledge gained from decades of space — an essential component of plant survival spaceflight experiments have paved the way for and growth. This novel observation provides scientists to design and conduct experiments that valuable insight into the effects of long-term provide valuable insight into the effects of gravity spaceflight on plant development. on plant growth. Recent experiments have To complement the studies of transcriptome explored the role of gravity in plant movements, changes done by Paul et al. (2012b), Ferl et al. revealed a novel red-light phototropic response, (2015) recently analyzed the proteome of space- and provided valuable information about plant grown Arabidopsis seedlings. This study gene expression changes in space. This new pioneered the use of RNAlater for the information will help engineers and scientists preservation of samples for protein analysis. This design a Bioregenerative Life Support System for method worked well enough to provide protein for long-duration missions using plants — a major the identification of 1570 proteins and the goal of international space agencies — and quantitation of 1432 proteins using the iTRAQ provide information that can be used to optimize method, with biological replicates allowing for a plant growth on Earth, which is a key contribution statistical analysis of quantitative differences. This as agricultural land availability decreases and our analysis was the first proteomic study in space- population increases. grown seedlings. Moreover, the lot of seedlings used came from a very similar group of plants ASSAYING GRAVITY EFFECTS IN SINGLE grown on the ISS for transcriptomic studies CELLS USING CERATOPTERIS RICHARDII completed by Paul et al. (2013a), so the SPORES AS A MODEL SYSTEM transcriptome changes could be compared to proteomic changes. As technology improves and In recent years, most studies of plants in space the ability to do more experiments on the ISS have focused on the model plant, Arabidopsis increases, scientists will have the opportunity to thaliana. However, another valuable model identify both cell-specific and generic responses system — the single-celled Ceratopteris richardii to the space environment (Ferl et al., 2015). fern spore — has also been used to understand the In addition to using the ISS to evaluate gene- effects of gravity on plant cells. This single-celled expression changes associated with spaceflight, model is valuable because it provides a simplified scientists have now developed methods to use system to monitor how plant cells sense gravity parabolic flights for molecular biology and direct subsequent development based on this experiments. Arabidopsis seedlings that went mechanical force. Ceratopteris richardii is a through parabolic flights on different days with homosporous fern with large, 100-150 μm different logistical aspects, showed gene diameter, spores. The fern life cycle, like all
Gravitational and Space Research Volume 3 (2) Dec 2015 9 Cannon et al. -- Plant Biology Insights from Space Research pteridophytes, consists of alternation of free-living Ceratopteris spores germinate readily in haploid and diploid generations. Ceratopteris standard laboratory culture conditions (Hickok et spores are produced on diploid fronds through al., 1987). The basic progression of spore meiosis. Ceratopteris spore germination is a red- germination events is depicted in Figure 1. While light induced process mediated by the it is still a single cell, the spore can sense and photoreceptor phytochrome. Germination results respond to gravity. Developmental polarity is in the development of haploid, photosynthetic, established in response to the vector of gravity, as monoecious, or male gametophytes. Ceratopteris demonstrated by Edwards and Roux (1994), and it spores are extremely resilient to environment results in the downward migration of the cell change; spores germinate after exposure to 4°C or nucleus, followed 48 hours later by the emergence 37°C for up to 30 days. Spores remain dormant of the primary rhizoid from the spore coat and its for many years if stored dry, and hydrated spores growth in the direction established in the first 30 will remain dormant if kept in the dark for up to hours of germination. 90 days.
Figure 1. Early growth and developmental time-line of Ceratopteris richardii spores. Spore germination is initiated by water and red light. Within hours of initiation, calcium enters through channels at the bottom of spores and there is an efflux of calcium out of the top. The calcium efflux peaks between 7 and 12 hours after light-initiated germination begins. Polarity of development is set by gravity after 24-30 hours of growth and it results in the downward migration of the cell nucleus and a subsequent asymmetrical cell division. A visual representation of the direction of polarity set by gravity is the emergence of a downward-growing rhizoid 72 hours after germination begins.
The continuous microgravity conditions on time and induced by the absence of the polarity the space shuttle flight STS-93 resulted in random directing force of gravity. Around 5% of the orientation of nuclear migration and rhizoid unique transcripts analyzed in this study exhibited emergence in germinating Ceratopteris spores, as a difference induced by microgravity conditions in demonstrated by Roux et al. (2003). In the same at least one of the developmental time points space shuttle mission, spore samples were analyzed. The stress of the space environment did exposed to light and allowed to develop for not result in a general trend toward gene various time points in microgravity before being suppression, as an approximately equal number of frozen and returned to Earth for analysis of gene down- and up-regulated changes were induced expression changes (Salmi and Roux, 2008). All under the conditions of this experiment. of the samples included in this study were frozen Transferase- and hydrolase-type enzymes were prior to the first division of the spore cell, the molecular functions most abundantly allowing gene expression analysis of differences represented in the differentially regulated in transcript abundance within the same cell over transcripts. Enzymes with these molecular
10 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research functions modify other proteins, suggesting the developmental period when spores are responsive post-translational modifications involved gravity to gravity (Salmi et al., 2011). Heterologous perception and might be altered in microgravity expression in yeast demonstrated this enzyme had conditions. functional pump activity (Bushart et al., 2013). Within the developmental stage when spores Spore plasma membrane specific Ca2+-ATPase are responsive to gravity reorientation (e.g., the activity was inhibited by treatment with 2′,4′,5′,7′- first 30 hours of development), there is a tetrabromofluorescein (Eosin Yellow), and this differential calcium ion flux around spores inhibition of calcium efflux was verified using the (Chatterjee and Roux, 2000; Salmi et al., 2011). CEL-C calcium sensor. Even though the Efflux is strongest at the top of the spore relative extracellular calcium differential was eliminated to gravity, and influx occurs primarily at the by treatment with Eosin Yellow, when this bottom of the spore. This calcium transport treatment was limited to the period of gravity differential reorients coincident with spore perception it did not alter the gravity-directed rotation (Salmi et al., 2011), indicating the ion polar growth of the primary rhizoid. However, channels and pumps responsible for calcium flux continuous treatment with Eosin Yellow does are regulated almost instantaneously by gravity completely inhibit rhizoid development, stimulation. indicating this calcium pumping activity is This rapid regulation of calcium flux was also necessary for polar tip growth of the rhizoid. observed in the changing g-force environment of These data are consistent with the important role parabolic flight. These flight experiments, in of Ca2+-ATPase in maintaining a low cytoplasmic which the periods of hyper-g (hypergravity) and calcium concentration and facilitating tip growth. hypo-g (hypogravity) were of short-duration, The results are also consistent with the model of demonstrated that the magnitude of the calcium spore gravity perception that implicates a differential is correlated with the level of gravity localized region of high cytoplasmic calcium at applied to spores (Salmi et al., 2011). They the bottom of a germinating spore as the key revealed how rapid the responses to gravity signal for the direction of gravity-directed fluctuations are in germinating spores, suggesting polarization. Consistent with this interpretation, changes in the magnitude and direction of the g- the calcium channel antagonist, nifedipine, blocks force can rapidly alter the transport activity of the gravity-directed downward polarization of calcium channels and pumps. rhizoid growth (Chatterjee and Roux, 2000). The Control of the gravity-directed calcium ion predicted gravity-induced calcium entry distribution in spores is the subject of continued specifically at the bottom of a spore may be investigation. Calcium signaling is important in mediated by a mechanosensitive channel. diverse physiological processes of bacteria, fungi, To date, three classes of MechanoSensitive plants, and animals. Cells generally keep their (MS) channels have been identified in plants cytoplasmic calcium concentrations low — based on their sequence similarity to channels in typically below micromolar — so temporal and other cell types: MscS-like, Mid1 complementing location-specific increases in calcium activity, and two-pore potassium channels concentration can serve as a specific signal (Hamilton et al., 2015). MscS channels are well- (Gilroy et al., 1993). This intracellular low characterized MS channels of small conductance. calcium concentration means that the efflux of In bacteria (i.e., E. coli) the MscS proteins form calcium observed at the top of germinating homoheptomers which have an open pore size of Ceratopteris spores would be the result of an just under 13Å (Wang et al., 2008). Recently, energy-requiring calcium pump, and the influx of point mutational analysis has demonstrated the calcium observed at the bottom of the spore would MscS channel is kept in a closed state due to be mediated by a calcium channel. There has been intrinsic membrane pressure, and it is the recent progress in identifying the transport application of tension to the membrane that causes proteins that facilitate these processes. the pore to open as a relief valve, like a jack-in- A candidate for calcium efflux activity has the-box (Malcolm et al., 2015). In the open been identified in a plasma membrane-type Ca2+- conformation, the bacterial MscS channel allows ATPase that is expressed coincident with the
Gravitational and Space Research Volume 3 (2) Dec 2015 11 Cannon et al. -- Plant Biology Insights from Space Research
ions into cells to relieve the osmotic stress that In the model plant Arabidopsis, annexin 1 exerts tension on the plasma membrane. (AnnAt1) is the best characterized of the eight In eukaryotic cells — including plants — MS annexins and is a strong candidate for channels have long been proposed as a gravity participating in the mediation of gravity sensing mechanism. In this model, some settling responses. There is abundant evidence that mass (e.g., statolith or protoplasm) exerts tension AnnAt1 facilitates calcium transport, either on the bottom of the cell that results in opening of directly or indirectly (Laohavisit and Davies, MS ion channels (Toyota and Gilroy, 2013). This 2009), and also plays an important role in stress results in local areas of high ion concentration. responses (Clark et al., 2012). Recently, This model of gravity perception is consistent experiments on Arabidopsis cell cultures during with the data obtained from Ceratopteris thus far. parabolic flight showed the onset of microgravity We have recently identified three members of the conditions induced an increase in calcium and MscS family of MS channel in Ceratopteris based H2O2 (Hausmann et al., 2014). This same study on sequence similarity (Salmi and Roux, found phosphorylation of AnnAt1 was rapidly unpublished results). It will be important to induced in Arabidopsis callus culture cells by demonstrate MS activity of the proteins encoded hypergravity condition.. This kind of post- by these genes and, if they prove to be functional, translational change would be expected to characterize their role in Ceratopteris spore decrease the peroxidase activity of AnnAt1 development. (Gorecka et al., 2005). Because changes in The current model of calcium directed gravity gravitational fields induce changes in reactive perception in spores also involves candidates for oxygen species (ROS) levels (Barjaktarović et al., gravity-induced downstream signaling steps 2009; Hausmann et al., 2014), and peroxidase including the Ca2+-binding proteins, calmodulin, activity can reduce ROS levels, changes in the Ca2+-dependent protein kinase (CDPK), and expression and phosphorylation status of AnnAt1 annexin. All of these proteins would be the likely might play an important role in regulating the signal transducers that help mediate cell changes in ROS that occur in microgravity. polarization events guided by gravity. Annexins AnnAt2 is closely related to AnnAt1 and are a multigene family of multifunctional calcium- hypergravity conditions, as well as horizontal dependent membrane proteins found in animal clinorotation (simulated weightless conditions), and plant cells (Clark et al., 2012). In plants, the induced an increase in AnnAt2 protein levels in number of annexin genes in any particular species root apices (Tan et al., 2011). This study also varies; e.g., the model plant Arabidopsis has eight found AnnAt2 was differentially expressed in the distinct annexin genes and rice has ten (Clark et root-cap columella cells of wild-type and pin2 al., 2012). An early study revealed annexins are mutants. This and other findings on gravity effects likely targets of calcium action during gravity on annexins raise the question, “Do Ceratopteris responses in plants because gravity induced a spores express any annexins during the period redistribution of annexin immunostain in pea when gravity is fixing the polarity of these cells?” plumules (Clark et al., 2000). The role of annexins Two full-length Ceratopteris annexins — in gravity responses was hypothesized based on AnnCr1 and AnnCr2 — have been identified and their participation in the Golgi-mediated both of these annexins are expressed at the 10 directional secretion of materials to the plasma hour time point after induction of spore membrane and ECM (Konopka-Postupolska et al., germination during the peak of the trans-cell Ca2+ 2011). Localized secretion is a key component current. Transient suppression of AnnCr1 required for polarity establishment and expression by RNAi resulted in polarity disruption maintenance in plant cells (Belanger and in Ceratopteris spores (Stout et al., 2003). So Quatrano, 2000). Control of secretion is likely to these annexins could play an important role in be important in the response phase of responding to the calcium current and/or gravitropism, because this phase requires the maintaining this current in germinating spores. A asymmetrically directed transport of wall key question that needs to be addressed is whether polysaccharides and newly synthesized plasma the distribution of AnnCr1 and/or AnnCr2 in membrane to the expanding cell periphery. spores becomes polarized as gravity fixes the
12 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research polarity of the cells between 9 and 18 hours after al., 2009; Demidchik et al., 2011). The they are induced to germinate, and, if so, does this hypothetical model shown in Figure 2 postulates polarity change when the spores are turned upside how applied ATP and PPADS (Pyridoxal- down? phosphate-6-azophenyl-2', 4'-disulfonate) could suppress the gravity response. In this model, HYPOTHETICAL MODEL OF THE gravity induces the opening of stretch-activated INITIAL GRAVITY RESPONSE IN channels preferentially along the bottom of the CERATOPTERIS SPORES spore as predicted by the data in Salmi et al. The data collected from experiments (2011), and these channels would release ATP, as investigating the mechanism of gravity perception they are known to do from animal and and response in Ceratopteris have led to the Arabidopsis cells (Weerasinghe et al., 2009). If development of a hypothetical model of the ATP is released primarily from the bottom of the cellular events that contribute to the gravity spore, this asymmetric distribution could induce response in Ceratopteris richardii spores. This the opening of calcium channels (Demidchik et model is based largely on the pharmacological al., 2009) primarily along the bottom of spore. observation that blocking calcium channels with The bottom-focused gradient of ATP would be nifedipine randomized the direction of rhizoid disrupted when extracellular nucleotides or ATP emergence (Chatterjee and Roux, 2000). This receptor antagonists are applied, thus altering the observation along with data showing that within asymmetrical entry of calcium. hours of germination initiation, gravity induces a Many of the aspects of this hypothetical calcium current that rapidly changes in parallel model have been verified. A key test of the model with changes in the g-force (ul Haque et al., 2007; will be to measure the eATP in order to determine Salmi et al., 2011), outlines the importance of the if a gradient between the top and bottom of calcium current to the gravity response. germinating spores exists. A self-referencing In addition to the calcium differential between electrochemical biosensor was developed by the top and bottom of spores, there is now Vanegas et al. (2015) to directly measure eATP in evidence for another gravity-induced chemical livings cells. Using this tool, a gradient of eATP gradient in spores that could help to regulate their was measured in germinating Ceratopteris spores polarization (i.e., an eATP gradient). A role for within 0.5 hours of light exposure and between eATP in gravity-directed polarization would be 16-22 hours after light-initiated germination. This consistent with studies showing calcium channels gradient persisted throughout the critical in plant cells can be regulated by extracellular polarization period. Support that this gradient nucleotides and that the concentration of these could play a role in mediating gravity-induced cell nucleotides is regulated by ecto-apyrases (Clark polarization is that disrupting it by applying and Roux, 2011) — enzymes necessary for the extracellular nucleotides uniformly around the polarized growth of pollen tubes and root hairs. spores, or blocking its activity by a purinoceptor The documented expression of an apyrase-like antagonist, inhibits the gravity response in enzyme in Ceratopteris during the period of Ceratopteris spores when they are applied during polarity fixation led us to hypothesize the polarization period. extracellular nucleotides and apyrases might play Additional data are needed to verify the a role in gravity-directed early growth and model. Among the model’s predictions, one of the development (Bushart et al., 2013). most important that remains to be demonstrated is Data in Bushart et al. (2013) show spores that extracellular ATP can actually establish or release ATP as they germinate and grow, and help contribute to the calcium current. To help applied nucleotides and a purinoceptor antagonist address this question, Ceratopteris spores harvested from plants expressing the Yellow suppress gravity-directed polarization. 2+ Collectively, these observations are consistent Cameleon 3.60 FRET-based Ca sensor will be with the hypothesis that extracellular nucleotides used. ATP will be applied both uniformly and could influence calcium transport in Ceratopteris unilaterally in order to determine if there is a link spores as they do in Arabidopsis (Demidchik et between extracellular nucleotides and calcium uptake in Ceratopteris spores. Using the newly
Gravitational and Space Research Volume 3 (2) Dec 2015 13 Cannon et al. -- Plant Biology Insights from Space Research developed Ceratopteris richardii transformation if knocking-out specific genes related to calcium methods (Plackett et al., 2014; Bui et al., 2015; and eATP signaling can block spore gravity Plackett., 2015), scientists can begin investigating response.
Figure 2. Hypothetical model showing the role of eATP and calcium in polarization of Ceratopteris richardii spores. In response to gravity, an undefined mass would settle, selectively activating mechano-sensitive channels primarily along the bottom of the spore. These mechano-sensitive channels could release ATP. The ATP released accumulates asymmetrically, resulting in a gradient where the eATP on the bottom of the spore is higher than the top. The eATP could activate calcium channels directly or indirectly, establishing or contributing to the initiation of the trans-cell Ca2+ current that is essential for gravity-directed polarization.
Ground-based experiments, along with results the results could assist both plant and animal from spores grown in space, have provided scientists in understanding how cells sense and valuable insight into the molecular mechanisms of respond to gravity, allowing them to improve gravity perception and response in single plant conditions for astronauts and plants in space. cells. These results are unique because they can be used to explain how many different eukaryotic CONCLUSION cells are affected by changes in mechanical forces, During the last several decades, the unique such as gravity. As these experiments progress, environment of space has provided valuable
14 Gravitational and Space Research Volume 3 (2) Dec 2015
2 Gravitational and Space Research Volume 3 (2) Dec 2015 2 Gravitational and Space Research Volume 3 (2) Dec 2015 2 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research insights into the role of gravity in plant growth on plants and spaceflight and man-made and development. As science and technology environments on biological systems. progresses, the experimental conditions for Advances in Space Research 36: 1162-1166 carrying out research in space have greatly Bui LT, Cordle AR, Irish EE, Cheng CL (2015) improved. These improvements included, Transient and stable transformation of prominently, providing “smarter” and more Ceratopteris richardii gametophytes. versatile growth chambers, opportunities for BioMed Central (BMC) Research Notes 8: longer-term experiments, better environmental 214 monitoring and control, and advanced data Bushart TJ, Cannon AE, ul Haque A, San Miguel telemetry of real-time operations. Additionally, P, Mostajeran K, Clark GB, Porterfield DM, scientists and engineers have also developed Roux SJ (2013) RNA-seq analysis identifies better preservation methods, ensuring genomic potential modulators of gravity response in and morphological studies will have high-quality spores of Ceratopteris (Parkeriaceae): results. Using all of these new tools, scientists evidence for modulation by calcium pumps have gained and will continue to gain many new and apyrase activity. American Journal of insights about the role of gravity in plant growth Botany 100(1): 161-174 and development of multicellular and single-cell Camacho J (2015) Advanced Biological Research plant systems. System (ABRS). National Aeronautics and Space Administration, Washington, D.C., ACKNOWLEDGEMENTS USA. Website http://www.nasa.gov/ Experimental work and support during the mission_pages/station/research/experiments/ preparation of this manuscript was provided by 645.html NASA grants NNX13AM54G to SJR and GC, Chatterjee A, Roux SJ (2000) Ceratopteris and NNX15AB85A to SJR and MLS. richardii: a productive model for revealing secrets of signaling and development. REFERENCES Journal of Plant Growth Regulation 19: 284- 289 Aubry-Hivet D, Nziengui H, Rapp K, Oliveira O, Choi J, Tanaka K, Cao Y, Qi Y, Qiu J, Liang Paponov IA, Li Y, Hauslage J, Vagt N, Y, Lee SY, Stacey G (2014) Identification of Braun M, Ditengou FA, Dovzhenko A, plant receptor for extracellular ATP. Palme K (2014) Analysis of gene expression Science 343: 290-294 during parabolic flights reveals distinct early Clark GB, Morgan RO, Fernandez MP, Roux SJ gravity responses in Arabidopsis roots. Plant (2012) Evolutionary adaptation of plant Biology 16: 129-141 annexins has diversified their molecular Barjaktarović Z, Schütz W, Madlung J, Fladerer structures, interactions, and functional roles. C, Nordheim A, Hampp R (2009) Changes in New Phytologist 196: 695-712 the effective gravitational field strength Clark GB, Morgan RO, Fernandez MP, Salmi affect the state of phosphorylation of stress- ML, Roux SJ (2014) Breakthroughs related proteins in callus cultures of spotlighting roles for extracellular Arabidopsis thaliana. Journal of nucleotides and apyrases in stress responses Experimental Botany 60: 779-789 and growth and development. Plant Science Barlow PW, Klingelé E, Klein G, Miroslav M 225: 107-116 (2008) Leaf movements of bean plants and Clark GB, Rafati DS, Bolton RJ, Dauwalder M, lunar gravity. Plant Signaling and Behavior Roux SJ (2000) Redistribution of annexin in 3: 1083-1090 gravistimulated pea plumules. Plant Belanger KD, Quatrano RS (2000) Polarity: the Physiology and Biochemistry 38: 937-947 role of localized secretion. Current Opinion Clark GB, Roux SJ (2011) Apyrases, extracellular in Plant Biology 3: 67-72 ATP, and the regulation of growth. Current Brinckmann E (2005) ESA hardware for plant Opinion in Plant Biology 14: 700-706 research on the International Space Station. Demidchik V, Shang Z, Shin R, Colaco R, Space Life Sciences: gravity-related effects Laohavisit A, Shabala S, Davies JM (2011)
Gravitational and Space Research Volume 3 (2) Dec 2015 15 Cannon et al. -- Plant Biology Insights from Space Research
Receptor-like activity evoked by Galston AW (1992) Photosynthesis as a basis for extracellular ADP in Arabidopsis root life-support on Earth and in space. epidermal plasma membrane. Plant Bioscience 42: 490-493 Physiology 15: 1375-1385 Gilroy S, Bethke PC, Jones RL (1993) Calcium Demidchik V, Shang Z, Shin R, Thompson E, homeostasis in plants. Journal of Cell Rubio L, Laohavisit A, Mortimer JC, Science 106: 453-462 Chivasa S, Slabas AR, Glover BJ, Gorecka KM, Konopka-Postupolska D, Hennig J, Schachtman DP, Shabala SN, Davies JM Buchet R, Pikula S (2005) Peroxidase (2009) Plant extracellular ATP signalling by activity of annexin 1 from Arabidopsis plasma membrane NADPH oxidase and Ca2+ thaliana. Biochemical and Biophysical channels. Plant Journal 58: 903-913 Research Communications 336: 868-875 Deslauriers SD, Larsen PB (2010) FERONIA is a Halstead TW, Dutcher FR (1984) Status and key modulator of brassinosteroid and prospects: Experiments on plants in space. ethylene responsiveness in Arabidopsis Annals of Botany 54: 3-18 hypocotyls. Molecular Plant 3: 626-640 Hamilton ES, Schlegel AM, Haswell ES (2015) Driss-Ecole D, Legue V, Carnero-Diaz E, Perbal United in diversity: mechanosensitive ion G (2008) Gravisensitivity and channels in plants. Annual Review of Plant automorphogenesis of lentil seedling roots Biology 66: 113-137 grown on board the International Space Haruta M, Sussman MR (2012) The effect of a Station. Physiologia Plantarum 134: 191- genetically reduced plasma membrane 201 protonmotive force on vegetative growth of Duan QH, Kita D, Li C, Cheung AY, Wu Arabidopsis. Plant Physiology 158: 1158- HM (2011) FERONIA receptor-like kinase 1171 regulates RHO GTPase signaling of root hair Hausmann N, Fengler S, Hennig A, Franz- development. Proceedings of the National Wachtel M, Hampp R, Neef M (2014) Academy of Sciences USA 107: 17821-17826 Cytosolic calcium, hydrogen peroxide, and Dubinin NP, Vaulina EN, Kosikov KV, Anikeeva related gene expression and protein ID, Moskvitin EV, Zapadnaya AA, Kostina modulation in Arabidopsis thaliana cell LN, Shtrauh GA, Kryzhanovskaya LM, cultures respond immediately to altered Gubareva IG, Nechitailo GS, Mashinsky AL gravitation: parabolic flight data. Plant (1973) Effects of spaceflight factors on the Biology 16: 120-128 heredity of higher and lower plants. Life Hickok LG, Warne TR, Slocum MK (1987) Sciences in Space Research 11: 105-110 Ceratopteris richardii: applications for Edwards ES, Roux SJ (1994) Limited period of experimental plant biology. American graviresponsiveness in germinating spores of Journal of Botany 74: 1304-1316 Ceratopteris richardii. Planta 195: 150-152 Johnsson A, Solheim BGB, Iversen TH (2009) Escobar-Restrepo JM, Huck N, Kessler S, Gravity amplifies and microgravity decreases Gagliardini V, Gheyselinck J, Yang WC, circumnutations in Arabidopsis thaliana Grossniklaus U (2007) The FERONIA stems: results from a space experiment. New receptor-like kinase mediates male-female Phytologist 182: 621-629 interactions during pollen tube reception. Kessler SA, Shimosato-Asano H, Keinath NF, Science 317: 656–660 Wuest SE, Ingram G, Panstruga R, Ferl RJ, Koh J, Denison F, Paul A-L (2015) Grossniklaus U (2010) Conserved molecular Spaceflight induces specific alterations in the components for pollen tube reception and proteomes of Arabidopsis. Astrobiology 15: fungal invasion. Science 330: 968-971 32-56 Kiss JZ (2015) Conducting plant experiments in Fisahn J, Klingelé E, Barlow P (2015) Lunar space. In Plant Gravitropism: Methods and gravity affects leaf movement of Arabidopsis Protocols, Methods in Molecular Biology, thaliana in the International Space Station. Blancaflor E.B. (ed.) 1309: 255-283. New Planta 241: 1509-1518 York: Humana Press
16 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research
Kittang AI, Iversen TH, Fossum KR, Mazars C, revealed in microgravity. New Phytologist Carnero-Diaz E, Boucheron-Dubuisson E, Le 186: 648-656 Disquet I, Legué V, Herranz R, Pereda-Loth Morrow RC, Bula RJ, Tibbitts TW, Dinauer WR V, Medina FJ (2014) Exploration of plant (1994) The ASTROCULTURE™ flight growth and development using the European experiment series, validating technologies for Modular Cultivation System (ECMS) facility growing plants in space. Advances in Space on the International Space Station. Plant Research 14: 29-37 Biology 16: 528-538 Mullen JL, Turk E, Johnson K, Wolverton C, Konopka-Postupolska D, Clark G, Hofmann A Ishikawa H, Simmons C, Söll D, Evans (2011) Structure, function, and membrane ML (1998) Root-growth behavior of the interactions of plant annexins: an update. Arabidopsis mutant rgr1 - roles of Plant Science 181: 230-241 gravitropism and circumnutation in the Kordyum EL, Sytnik KM, Chernyaeva II (1983) waving/coiling phenomenon. Plant Peculiarities of genital organ formation in Physiology 118: 1139-1145 Arabidopsis thaliana (L) Heynh. under Musgrave ME, Kuang AX, Brown CS, Matthews spaceflight conditions. Advances in Space SW (1998) Changes in Arabidopsis leaf Research 3: 247-250 ultrastructure, chlorophyll and carbohydrate Kostina L, Anikeeva I, Vaulina E (1984) The content during spaceflight depend on influence of spaceflight factors on viability ventilation. Annals of Botany 81: 503-512 and mutability of plants. Advances in Space Musgrave ME, Kuang AX, Matthews SW (1997) Research 4: 65-70 Plant reproduction during spaceflight: Kuang AX, Musgrave ME, Matthews SW (1996b) importance of the gaseous environment. Modification of reproductive development in Planta 203: S177-S184 Arabidopsis thaliana under spaceflight Nakashima J, Liao F, Sparks JA, Tang Y, conditions. Planta 198: 588-594 Blancaflor EB (2014a) The actin Kuang AX, Xiao Y, Musgrave ME (1996a) cytoskeleton is a suppressor of the Cytochemical localization of reserves during endogenous skewing behaviour of seed development in Arabidopsis thaliana Arabidopsis primary roots in microgravity. under spaceflight conditions. Annals of Plant Biology 16: 142-150 Botany 78: 343-351 Nakashima J, Sparks JA, Carver Jr JA, Stephens Kwon T, Sparks JA, Nakashima J, Allen SN, SD, Kwon T, Blancaflor EB (2014b) Tang Y, Blancaflor EB (2015) Delaying seed germination and improving Transcriptional response of Arabidopsis seedling fixation: lessons learned during seedlings during spaceflight reveals science and payload verification tests for peroxidase and cell wall remodeling genes Advanced Plant EXperiments (APEX) 02-1 associated with root hair development. in space. Gravitational and Space Research American Journal of Botany 102: 21-35 2: 54-67 Laohavisit A, Davies JM (2009) Multifunctional Okada K, Shimura Y (1990) Reversible root tip annexins. Plant Science 177: 532-539 rotation in Arabidopsis seedlings induced by Malcolm HR, Blount P, Maurer JA (2015) The obstacle-touching stimulus. mechanosensitive channel of small Science 250: 274-276 conductance (MscS) functions as a jack-in- Oliva M, Dunand C (2007) Waving and skewing: the-box. Biochimica Et Biophysica Acta- how gravity and the surface of growth media Biomembranes 1848: 159-166 affect root development in Arabidopsis. New Millar KDL, Johnson CM, Edelmann RE, Kiss JZ Phytologist 176: 37-43 (2011) An endogenous growth pattern of Paul A-L, Amalfitano CE, Ferl RJ (2012a) Plant roots is revealed in seedlings grown in growth strategies are remodeled by microgravity. Astrobiology 11: 787-797 spaceflight. BioMed Central (BMC) Plant Millar KDL, Kumar P, Correll MJ, Mullen JL, Biology 12: 232 Hangarter RP, Edelmann RE, Kiss JZ (2010) Paul A-L, Ferl RJ (2015) Spaceflight exploration A novel phototropic response to red light is in plant gravitational biology. In Plant
Gravitational and Space Research Volume 3 (2) Dec 2015 17 Cannon et al. -- Plant Biology Insights from Space Research
Gravitropism: Methods and Protocols, microgravity. Advances in Space Research Methods in Molecular Biology, Blancaflor 31: 215-220 E.B. (ed.) 1309: 285-305. New York: Salmi ML, Roux SJ (2008) Gene expression Springer Science Business Media changes induced by spaceflight in single- Paul A-L, Levine HG, McLamb W, Norwood KL, cells of the fern Ceratopteris richardii. Reed D, Stutte GW, Wells HW, Ferl RJ Planta 229: 151-159 (2005) Plant molecular biology in the space Salmi ML, ul Haque A, Bushart TJ, Stout SC, station era: utilization of Kennedy Space Roux SJ, Porterfield DM (2011) Changes in Center (KSC) fixation tubes with RNAlater. gravity rapidly alter the magnitude and Acta Astronautica 56: 623-628 direction of a cellular calcium current. Planta Paul A-L, Manak MS, Mayfield JD, Reyes MF, 233: 911-920 Gurley WB, Ferl RJ (2011) Parabolic flight Schultz ER, Kelley KL, Paul A-L, Ferl RJ (2013) induces changes in gene expression patterns A method for preparing spaceflight in Arabidopsis thaliana. Astrobiology 11: RNAlater-fixed Arabidopsis thaliana 743-758 (Brassicaceae) tissue for scanning electron Paul A-L, Wheeler RM, Levine HG, Ferl RJ microscopy. Applications in Plant Sciences (2013b) Fundamental plant biology enabled 1(8) by the space shuttle. American Journal of Shih HW, Miller ND, Dai C, Spalding EP, Botany 100: 226-234 Monshausen GB (2014) The receptor-like Paul A-L, Zupanska AK, Ostrow DT, Zhang YP, kinase FERONIA is required for mechanical Sun Y, Li JL, Shanker S, Farmerie WG, signal transduction in Arabidopsis seedlings. Amalfitano CE, Ferl RJ (2012b) Spaceflight Current Biology 24: 1887-1892 transcriptomes: unique responses to a novel Solheim BGB, Johnsson A, Iversen TH (2009) environment. Astrobiology 12: 40-56 Ultradian rhythms in Arabidopsis thaliana Paul A-L, Zupanska AK, Schultz ER, Ferl RJ leaves in microgravity. New Phytologist 183: (2013a) Organ-specific remodeling of the 1043-1052 Arabidopsis transcriptome in response to Stout SC, Clark GB, Archer-Evans S, Roux SJ spaceflight. BioMed Central (BMC) Plant (2003) Rapid and efficient suppression of Biology 13: 112 gene expression in a single-cell model Plackett ARG, Huang LD, Sanders HL, Langdale system, Ceratopteris richardii. Plant JA (2014) High-efficiency stable Physiology 131: 1165-1168 transformation of the model fern species Summerlin LB (1977) Skylab, Classroom in Ceratopteris richardii via microparticle Space. Scientific & Technical Information bombardment. Plant Physiology 165: 3-14 Office, National Aeronautics and Space Plackett ARG, Rabbinowitsch EH, Langdale JA Administration, U.S. Government Printing (2015) Protocol: genetic transformation of Office, Washington, D.C., USA the fern Ceratopteris richardii through Tan C, Wang H, Zhang Y, Qi B, Xu GX, Zheng microparticle bombardment. Plant Methods HQ (2011) A proteomic approach to 11: 37 analyzing responses of Arabidopsis thaliana Porterfield DM, Barta DJ, Ming DW, Morrow root cells to different gravitational conditions RC, Musgrave ME (2000) using an agravitropic mutant, pin2, and its ASTROCULTURE™ root metabolism and wild type. Proteome Science 9: 72 cytochemical analysis. Life Sciences: Space Tang WQ, Brady SR, Sun Y, Muday GK, Roux Life Support Systems and the Lunar Farside SJ (2003) Extracellular ATP inhibits root Crater SAHA Proposal. Advances in Space gravitropism at concentrations that inhibit Research 26: 315-318 polar auxin transport. Plant Physiology 131: Roux SJ (2012) Root waving and skewing - 147-154 unexpectedly in micro-g. BioMed Central Thompson MV, Holbrook NM (2004) Root-gel (BMC) Plant Biology 12: 231 interactions and the root waving behavior of Roux SJ, Chatterjee A, Hillier S, Cannon T (2003) Arabidopsis. Plant Physiology 135: 1822- Early development of fern gametophytes in 1837
18 Gravitational and Space Research Volume 3 (2) Dec 2015 Cannon et al. -- Plant Biology Insights from Space Research
Toyota M, Gilroy S (2013) Gravitropism and 6 orbital station. Advances in Space Research mechanical signaling in plants. American 1: 163-169 Journal of Botany 100: 111-125 Wang WJ, Black SS, Edwards MD, Miller S, ul Haque A, Rokkam M, De Carlo AR, Wereley Morrison EL, Bartlett W, Dong CJ, Naismith ST, Roux SJ, Irazoqui PP, Porterfield DM JH, Booth IR (2008) The structure of an (2007). A MEMS fabricated cell open form of an E. coli mechanosensitive electrophysiology biochip for in silico channel at 3.45 Å resolution. Science 321: calcium measurements. Sensors and 1179-1183 Actuators B: Chemical 123: 391-399 Weerasinghe RR, Swanson SJ, Okada SF, Garrett Vanegas DC, Clark GB, Cannon AE, Roux SJ, MB, Kim SY, Stacey G, Boucher RC, Gilroy Chaturvedi P, McLamore ES (2015) A self- S, Jones AM (2009) Touch induces ATP referencing biosensor for real-time release in Arabidopsis roots that is monitoring of physiological ATP transport in modulated by the heterotrimeric G-protein plant systems. Biosensors and Bioelectronics complex. Federation of European 74: 37-44 Biochemical Societies (FEBS) Letters 583: Vaulina EN, Anikeeva ID, Kostina LN, Kogan 2521-2526 IG, Palmbakh LR, Mashinsky AL (1981) Yang X, Wang B, Farris B, Clark G, Roux The role of weightlessness in the genetic SJ (2015) Modulation of root skewing damage from preflight gamma-irradiation of in Arabidopsis by apyrases and extracellular organisms in experiments aboard the Salyut ATP. Plant Cell Physiology 56: 2197-2206
Gravitational and Space Research Volume 3 (2) Dec 2015 19 Short Communication
Microarray Identifies Transcription Factors Potentially Involved in Gravitropic Signal Transduction in Arabidopsis
C. Adam Cook, Avery Tucker, Kaiyu Shen, and Sarah E. Wyatt
Environmental and Plant Biology, Ohio University, Athens, OH
ABSTRACT Arabidopsis lines containing T-DNA insertions in the genes were obtained, plants bred to Gravity is a fundamental stimulus that affects homozygosity, and the mutants analyzed for GPS plant growth and development. The gravity phenotype. Mutant analysis shows significant persistent signal (GPS) treatment uses a cold differences in curvature of inflorescence stems treatment to isolate the events of signal between mutants and wild type. transduction. Plants are reoriented horizontally in the dark at 4°C for 1 hour and then returned to INTRODUCTION vertical at room temperature. A gene expression microarray was designed to identify genes that are On Earth, gravity is a constant stimulus regulated during the GPS treatment. Arabidopsis governing a plant’s growth and orientation of its thaliana var. Columbia was grown to maturity organs. A plant’s response to gravity can be with inflorescence stems of 8-10 cm. Total mRNA separated into four phases: perception of the was collected from inflorescence stems at 2, 4, 10, gravity stimulus, transduction of that perception and 30 min after reorientation in the cold. cDNA event into a biochemical signal, transmission of was synthesized from the mRNA and then probed that signal to the site of response, and the against an Arabidopsis gene expression array with differential growth response of the plant organs 4 replicates per time point. Analyses presented (Morita and Tasaka, 2004). The gravity persistent here focus on transcription factors because of their signal (GPS) treatment involves a cold treatment regulatory functions in response pathways. Five to isolate the processes of signal transduction transcription factors (AtAIB, WRKY18, WRKY26, prior to auxin redistribution. When plants are WRKY33, and BT2) were selected for further reoriented with respect to gravity at 4°C, study based on their expression at 4 min. perception of the stimulus occurs, but auxin Quantitative real-time polymerase chain reaction transport is virtually eliminated; however, when ((PCR) RT-qPCR) was performed to confirm returned to vertical at room temperature (RT), expression seen in the microarray data. Seeds of auxin transport is restored and plants bend in response to the reorientation in the cold (Wyatt et Key words: Gravitropism; Gravity Signaling; al., 2002). The delayed curvature indicates that Arabidopsis; GPS Treatment; Transcription some component between perception and Factors; Microarray; RT-qPCR transmission of the signal is inhibited in the cold. Taking advantage of this GPS phenomenon, a Correspondence to: Dr. Sarah E. Wyatt gene expression microarray was conducted on 315 Porter Hall plants subjected to the GPS treatment to identify Athens, OH 45701 Telephone: 740-593-1133 additional molecular components or physiological E-mail: [email protected] processes involved in the gravitropic pathway. The goal of this ongoing research is to identify
20 Gravitational and Space Research Volume 3 (2) Dec 2015 Cook et al. -- Transcription Factors and Gravity genes involved in the early events of gravitropic total of 16 4X44k dual color Arabidopsis arrays signal transduction. Here, we describe our initial (Agilent Technologies, Santa Clara, CA) using a work focused on transcription factors that are dye swap protocol between control and treatment differentially expressed at early time points after samples. The probe arrays were scanned by a reorientation of plants at 4°C. SureScan Microarray scanner, and the raw optical intensities were captured by the feature collection METHODS AND MATERIALS software. Plant Materials and Growth Conditions Microarray Data Analysis Arabidopsis thaliana var. Columbia was used Data were analyzed using ArrayOU, a web both for the microarray experiment and as the based microarray analysis package (Shen et al., wild type (WT) control for the mutant analyses. 2012). Background noise was corrected using For all experiments, seeds were planted into Pro- normexp (offset=50), and the value of the signal Mix BX Mycorrhizae general purpose growing density in both treatment and control samples was medium (Premier Tech, Quebec, Canada) in 6 cm calculated for each array. Signal densities varied pots. Seeds were cold stratified at 4°C for two slightly and were normalized across each array days, then allowed to germinate and grow at 21°C using “loess” to adjust for effects caused by the in 16 h light:8 h dark photoperiod. Plants were dual channels of the microarray. Data were thinned to 3-4 per pot at 2 weeks after normalized within arrays using “Aquantile”. germination. Significance was calculated using an empirical Bayesian model with Benjamini and Hochberg Microarray Analysis corrections. Genes in the dataset having a log fold Plants were grown to maturity with change (LFC) greater than 1 or less than -1, and a inflorescence stems of 8-10 cm. All plants were p-value less than 0.05, were considered initially held vertically at 4°C for 1 h as a cold significant. A subset of genes identified to be acclimation period. Half the plants were then transcription factors were selected based on reoriented 90° (treatment) with respect to the annotation through the Database of Arabidopsis gravity vector and half the plants were gently Transcription Factors (Guo et al., 2005). moved to simulate the movement of reorientation but maintained vertical (control), all at 4°C. RNA Quantitative Real-time PCR was extracted from four time points after Two-step quantitative real-time PCR (RT- reorientation in the cold: 2, 4, 10, and 30 min. qPCR) was performed with the DyNAmo Color Inflorescence stems were flash frozen in liquid Flash SYBR Green kit (Thermo Fisher Scientific, nitrogen at each time point, leaves and flowers Marietta, OH). Real-time amplification was removed, and the apical 4 cm of the stems pooled recorded by the Mx3000P RT-qPCR machine and homogenized in liquid nitrogen. Four (Stratagene/Agilent Technologies, Santa Clara, biological replicates were prepared for each CA). PP2A (AT1G10430) was used as the control and treatment samples at each time point, reference gene for all RT-qPCR assays. The totaling 32 samples. Total RNA was extracted following primers were used for RT-qPCR: for using Direct-zol RNA MiniPrep kit (Zymo AtAIB, 5’- CCTGCTCCTGCTAACAAGCT -3’ Research, Irvine, CA). RNA samples with an and 5’-CTCTGCCTCTCAGCTTCCAC -3’; for RNA Integrity Number (RIN) value of 8.5 or WRKY18, 5’- ACACCAATCCTTTCTCCGCA -3’ greater (Bioanalyzer, Agilent Technologies, Santa and 5’- AAGACGAGAGCGCAAGTGAG -3’; for Clara, CA) were used for analysis. cDNA was WRKY26, 5 ’- GGCCAAGAGATGGAAAAGAG synthesized from RNA with the Applied AAG-3’ and 5’- TAAAACTGGACCTCTTCT Biosystems High Capacity cDNA Reverse TGGGG-3’; for WRKY33, 5’- AGCAAAG Transcription Kit (Thermo Fisher Scientific, AGATGGAAAGGGGACAA-3’ and 5’- TGTGA Marietta, OH) using thermocycler settings as follows: 10 min at 25°C, 120 min at 37°C, 5 min TTACTGCTCTCATGTCGTGT-3’; for BT2, 5’- at 85°C. cDNAs were labeled with Cy3 (yellow- CGATGACGCCGAATCGAGGAAG-3’ and 5’- green) and Cy5 (red) dyes, then hybridized to a CCGTATGCAAGAGGAGGAATAACG-3’.
Gravitational and Space Research Volume 3 (2) Dec 2015 21 Cook et al. -- Transcription Factors and Gravity
Primer concentrations were optimized, and inflorescence stems were 8-10 cm, cold amplification specificity ensured. The acclimated for 1 h, reoriented 90° at 4°C for 1 h, thermocycler was set to an initial 7 min cycle at and then returned to vertical at RT. Images were 95°C, 35 cycles of 15 sec at 95°C, and 30 sec at taken at 15 min intervals up to 90 min after the 60°C, then 10 min at 95°C to generate a return to vertical at RT. GNU Image dissociation curve. To ensure the selection of a Manipulation Program (GIMP2) software was stably expressed internal control, the geNorm used to quantify the curvature of stems after plants algorithm (Vandesompele et al., 2002) was used were returned to vertical at RT. The average angle to analyze potential reference genes recommended of curvature of the inflorescence stems was taken by Czechowski et al. (2005). The gene PP2A was from a minimum of 15 plants each. Standard error selected as the reference gene. Assays were run was calculated, and significance determined using using control and treatment template from all four a Student’s t-test. time points, with each assay in triplicate. Relative quantification of the gene expression levels was RESULTS performed using the comparative Cq method. A gene expression microarray analysis Mutant Phenotype Analysis combined with the GPS treatment was used to isolate genes involved in the early events of Arabidopsis lines with insertions in the genes gravity signal transduction. Samples were of interest were obtained as seed stock from collected across a time course of the GPS European Arabidopsis Stock Center (NASC) and response; RNA was isolated from inflorescence Arabidopsis Biological Resource Center (ABRC). stem tissue at 2, 4, 10, and 30 min after plants Seed of the following germplasms were obtained: were reoriented at 4°C. Transcription factors were for AtAIB, SAIL_536_F09 with an insertion in selected for analysis because of their potential role the exon; for WRKY18, GK_328G03 with an in gene regulation of the gravitropic signaling insertion in the intron; for WRKY26, pathway. Transcription factors can have large- SALK_063386 with an insertion in the gene; for scale downstream effects on gene regulation and WRKY33, SALK_006603 with an insertion in the are involved in the activation of regulatory intron; and for BT2, SALK_084470 with an cascades (Bolouri and Davidson, 2003). Of the insertion in the promoter. PCR to confirm 1,907 transcription factors identified in the homozygosity of the insertion was performed microarray dataset, five (AtAIB, WRKY18, using three primers in each reaction: two specific WRKY26, WRKY33, and BT2) were selected based to the gene of interest and the third on differential expression (LFC≤-1.0) at the 4 min complementary to the T-DNA insertion (5 - ’ time point (Figure 1). No transcription factors ATTTTGCCGATTTCGGAAC-3’ for SALK lines were found to be differentially expressed at 2 min. and 5’-TAGCATCTGAATTTCATAACCAATC Although BT2 had a LFC<-1.0 at 4 min, its TCGATACAC-3’ for SAIL lines). expression was not statistically significant (p- Gene specific primers: for AtAIB 5’- value<0.10); however, differential expression at AAGTCACCATTACTGGTTGCG-3’ and 5’-CA 10 min was significant (p-value<0.10) (Table 1), AGACTTGCTGGGGTAATTG-3’; for WRKY18 so it was included for further analysis. 5’-GTGGTAATGAACAGAGCGCA-3’ and 5’- Transcription factors in the WRKY family are CAAATTGAGACTACGCACCAACTA-3’; for expressed rapidly and transiently in response to WRKY26, 5’- AGTTTGACGTGGGTAACGTTG- many different environmental stresses (Rushton et 3’ and 5’- GAAATGTGCCTG TCGTAGGAG-3 ’; al., 1996; Hara et al., 2000). In this study, for WRKY33, 5’- CATTTTTCGTATGGCTGCT WRKY26 and WRKY33 were significantly down- TC-3’ and 5’- TGAGCCTT GTTCGAACTCATC- regulated only at 4 min, while WRKY18 was down-regulated at 4, 10, and 30 min (Table 1). 3’; and for BT2, 5’- AATAACCGAACCAAA Although microarrays are capable of whole CCAACC-3’ and 5’- GATGCCATGGAAACA genome profiling, they can also generate AAACAC-3’. Plants were grown to maturity and numerous false positive signals (Wang et al., subjected to the GPS treatment (Wyatt et al., 2006). Thus, RT-qPCR was performed on RNA 2002). Briefly, plants were grown until
22 Gravitational and Space Research Volume 3 (2) Dec 2015 Cook et al. -- Transcription Factors and Gravity
Figure 1. Selection of transcription factors for further study. A microarray analysis was performed on wild type Arabidopsis at 2, 4, 10, and 30 min after reorientation in the cold during the GPS treatment. Transcription factors were selected based on annotation from the Database of Arabidopsis Transcription Factors and evaluated based on differential gene expression at 2 and 4 min. No transcription factors were differentially expressed at 2 min. A scatter plot of gene expression of 33 transcription factors identified at the 4 min time point. Five transcription factors (circled) were selected for further analysis based on high differential expression (LFC≤-1): AtAIB, WRKY18, WRKY26, WRKY33, and BT2.
Table 1. Microarray expression values of the five transcription factors across the GPS treatment.
2 min 4 min 10 min 30 min Gene Locus ID LFC* P-value LFC P-value LFC P-value LFC P-value WRKY26 AT5G07100 1.35 0.11 -1.76 0.00 -0.53 0.31 -0.94 0.09 AtAIB AT2G46510 0.50 0.16 -1.03 0.04 -0.16 0.67 -0.24 0.32 WRKY33 AT2G38470 -0.34 0.18 -1.00 0.02 -0.01 0.99 0.13 0.76 BT2 AT3G48360 -0.41 0.74 -1.41 0.10 -1.59 0.01 -1.26 0.08 WRKY18 AT4G31800 -0.11 0.86 -1.08 0.05 -1.83 0.02 -1.24 0.03
*log2 fold change
Gravitational and Space Research Volume 3 (2) Dec 2015 23 Cook et al. -- Transcription Factors and Gravity collected from wild type (WT) plants to qPCR indicated that WKRY 26, WRKY 33, and independently assess the expression of AtAIB, AtAIB were all up-regulated at 2 min, which was WRKY18, WRKY26, WRKY33, and BT2. For all not evident in the microarray analysis but may genes, RT-qPCR showed significant differential prove interesting. expression at 2, 4, and 10 min (Figure 2). RT-
Figure 2. RT-qPCR analysis. Relative gene expression of each transcription factor was quantified in inflorescence stems of wild type Arabidopsis (var. Columbia) plants either reoriented (grey bars) or held vertical (black bars) across the GPS treatment. Expression levels were assessed at 2, 4, 10, and 30 min after reorientation of the treatment group in the cold and normalized to the 2 min vertical control. Each assay was performed in triplicate. Asterisks indicate significance determined by a Student’s t-test (p-value<0.05).
The GPS phenotype was assessed on five showed no significant difference in bending of individual Arabidopsis lines, each containing a T- inflorescence stems compared to WT, curvature in DNA insertion in one of the genes: AtAIB, the inflorescence stems of wrky26 only differed WRKY18, WRKY26, WRKY33, or BT2. First, significantly from WT after 45 min, and plants were bred for homozygosity of the T-DNA inflorescence stems of wrky33 curved less when insertion in the target gene (Figure 3). Once compared to those of WT (Figure 4). homozygous lines were isolated, plants were subjected to the GPS treatment using the WT var. DISCUSSION Columbia as the control. The inflorescence stems The GPS treatment involves a cold treatment of bt2 curved less as compared to those of WT, to isolate the processes of signal transduction and conversely inflorescence stems of ataib prior to auxin redistribution and may help to shed curved more than those of WT throughout the light on early events which link the perception of response phase (Figure 4). Interestingly, the three the biophysical stimulus and the biochemical WKRY mutants responded differently. wrky18 response. Because transcription factors are
24 Gravitational and Space Research Volume 3 (2) Dec 2015 Cook et al. -- Transcription Factors and Gravity
WT ataib
WT bt2
WT wrky18
WT wrky26
WT wrky33
Figure 3. Selection of homozygous mutants defective in each transcription factor: ataib, bt2, wrky18, wrky26, or wrky33. Arabidopsis lines with T-DNA inserts in the genes of interest were obtained from publicly available seed banks. Seed was planted, and DNA extracted from both wild type and mutant lines. PCR was used to confirm homozygous insertion in the gene of interest. Gene-specific forward and reverse primers and a primer complementary to the left border of the T-DNA insert for each mutant line were used to amplify DNA extracted from Columbia wild type (left) and the mutant indicated (right). Arrows (left) indicate the amplicon from the gene specific primers; the arrow heads (right) indicated the amplicon produced by a gene- specific primer and the T-DNA left border primer. Single bands in each lane indicate homozygosity of the allele.
essential elements of gene regulation and can have gravity stimulus. Of the 1,907 transcription large-scale downstream effects on the expression factors identified across the microarray data, and of other genes, here, we focused on analysis of as annotated in the Database of Arabidopsis transcription factors from a microarray gene Transcription Factors, none were differentially expression study across the GPS treatment. Early expressed at 2 min. Five genes were selected for time points after reorientation of plants was of analysis based on differential expression at the 4 particular interest and since the presentation time min time point: AtAIB, WRKY18, WRKY26, of Arabidopsis has been estimated to be between WRKY33, and BT2 (Figure 1). All transcription 30 sec and 5 min (Sack et al., 1985; Kiss et al., factors selected were down-regulated at the 4 min 1989), the 2 and 4 min time points were chosen to time point (Figure 1, Figure 2) but showed more survey the earliest transcription factors induced by variable expression at other time points (Figure 2).
Gravitational and Space Research Volume 3 (2) Dec 2015 25 Cook et al. -- Transcription Factors and Gravity
Figure 4. GPS phenotype of ataib, bt2, wrky18, wrky26, or wrky33. Seed for mutant (open circles) and Columbia wild type (closed circles) lines were planted, and plants grown to maturity with inflorescence stems of 8-10 cm. Plants were reoriented with respect to gravity at 4oC for 1 h then returned to vertical at RT. Images were taken every 15 min from 0-90 min after return to RT, and the angle of curvature for a minimum of 15 inflorescence stems was measured. Asterisks indicate significance difference, as determined by a Student’s t-test.
Initial analysis of the GPS phenotype of responses to exogenous stimulations and stresses, mutants defective in each of the transcription including ABA (Mandadi et al., 2009). BT2 is factors showed a potentially complex story. believed to be a key player in multiple signal Curvature of inflorescence stems of ataib transduction pathways, and now we provide increased after GPS treatment as compared to evidence to suggest a role in gravitropic signal WT. AtAIB is an abscisic acid (ABA)-induced transduction. basic helix-loop-helix-type (bHLH) protein which In our study, three WRKY transcription has been shown to positively regulate ABA factors (WRKY18, 26, and 33) were all down- response (Li et al., 2007). In the roots, curvature regulated at 4 min after reorientation in the cold. in response to gravity is known to be influenced However, mutants defective in these genes do not by ABA (Pilet and Barlow, 1987), as well as other share a phenotypic response; curvature of hormonal regulators. Application of exogenous inflorescence stems of wrky18 was not ABA to maize roots also promotes differential significantly different from WT; whereas those of growth in response to gravity stimulus in darkness wrky26 over responded after 45 min, and (Wilkins and Wain, 1975). Our results may inflorescence stems of wrky33 bend less than indicate a role of ABA in curvature of stems in those of WT. The WRKY superfamily is one of response to gravity. the largest groups of transcriptional regulators in Conversely, inflorescence stems of bt2 bent plants. These genes share the highly conserved less after the GPS treatment as compared to WT. WRKYGQK amino acid sequence at the N- BT2 has been found to be involved in telomerase terminus and function in various signaling regulation (Ren et al., 2007) and in multiple plant pathways in plants. Potential targets of
26 Gravitational and Space Research Volume 3 (2) Dec 2015
Cook et al. -- Transcription Factors and Gravity
downstream regulation by WRKYs contain the RT-qPCR, and Sean Fenstemaker for assistance W-box promoter element. WRKY18 was with mutant analysis. We would also like to thank previously found to be pathogen-induced, forming the Ohio University Genomics Facility for protein heterocomplexes with WRKY40 and assistance with microarray analysis and RT- WRKY60 that function as bacterial pathogen qPCR. This work was partially supported by NSF defenses (Xu et al., 2006). These paralogous IOS #1147087 and NASA #NNX13AM48G. WRKYs have also been implicated in the regulation of ABA-induced genes (Shang et al., REFERENCES 2010; Chen et al., 2010; Liu et al., 2012). Birkenbihl RP, Diezel C, Somssich IE (2012) WRKY33 is also known to function in response to Arabidopsis WRKY33 is a key pathogen defense (Zheng et al., 2006; Birkenbihl transcriptional regulator of hormonal and et al., 2012) and in abiotic stress (Jiyang and metabolic responses toward Botrytis cinerea Deyholos, 2009). WRKY33 and WRKY26 also infection. Plant Physiology 159(1): 266-285 appear to be involved in coordinating induction of Bolouri H, Davidson EH (2003) Transcriptional plant thermo tolerance (Li et al., 2011). In space- regulatory cascades in development: initial flown experiments, WRKY18 was upregulated rates, not steady state, determine network over 2-fold in the hypocotyls of 12-day-old kinetics. Proceedings of the National Arabidopsis (Paul et al., 2013) and several Academy of Sciences 100(16): 9371-9376 WRKY genes (including homologs of WRKY 18 Chen H, Lai Z, Shi J, Xiao Y, Chen Z, Xu X and 33) have been identified in Brassica rapa (2010) Roles of Arabidopsis WRKY18, flown for 27 days aboard the International Space WRKY40, and WRKY60 transcription Station (ISS) (Sugimoto et al., 2014). Although factors in plant responses to abscisic acid and only three WRKY genes were differentially abiotic stress. BioMed Central (BMC) Plant expressed in our dataset, these and others have Biology 10(1): 281 been implicated in other gravity-related studies, Czechowski T, Stitt M, Altmann T, Udvardi MK, including microgravity, hypergravity, and Scheible WR (2005) Genome-wide parabolic flight (Martzivanou et al., 2006; Fengler identification and testing of superior et al., 2015; Soh et al., 2015). reference genes for transcript normalization The role of transcription factors is complex. in Arabidopsis. Plant Physiology 139(1): 5- In these preliminary studies, we focused on 17 expression at early time points after reorientation Fengler S, Spirer I, Neef M, Ecke M, Nieselt K, hoping to identify transcriptional regulation of Hampp R (2015) A whole-genome early events in gravitropic signaling. However, microarray study of Arabidopsis thaliana transcription factors are necessary for long-term semisolid callus cultures exposed to responses to alterations in the gravity field or the microgravity and nonmicrogravity related spaceflight environment, and this adds to the spaceflight conditions for 5 days on board of complexity of the system. Further analysis of Shenzhou 8. BioMed Research International gravitropic phenotypes in the mutants will provide 2015(547495): 1-15 a better indication if these transcription factors are Guo A, He K, Liu D, Bai S, Gu X, Wei L, Luo J involved in early signaling events throughout the (2005) DATF: a database of Arabidopsis plant. Additional biochemical, physiological, and transcription factors. Bioinformatics 21: protein-protein interaction studies will be 2568-2569 necessary to sort out the role these, and other, Hara K, Yagi M, Kusano T, Sano H (2000) Rapid transcription factors play in gravitropic signaling systemic accumulation of transcripts and response. encoding a tobacco WRKY transcription factor upon wounding. Molecular and ACKNOWLEDGMENTS General Genetics (MGG) 263(1): 30-37 The authors would like to acknowledge the Jiang Y-Q, Deyholos MK (2009) Functional contributions of former lab members Brian characterization of Arabidopsis NaCl- Twarek for assistance with RNA extractions and inducible WRKY25 and WRKY33
Gravitational and Space Research Volume 3 (2) Dec 2015 27
Cook et al. -- Transcription Factors and Gravity
transcription factors in abiotic Stresses. Plant Rushton PJ, Torres JT, Parniske M, Wernert P, Molecular Biology 69(1-2): 91-105 Hahlbrock K, Somssich IE (1996) Interaction Kiss JZ, Hertel R, Sack FD (1989) Amyloplasts of elicitor-induced DNA-binding proteins are necessary for full gravitropic sensitivity with elicitor response elements in the in roots of Arabidopsis thaliana. promoters of parsley PR1 genes. The Planta 177(2): 198-206 European Molecular Biology Organization Li H, Sun J, Xu Y, Jiang H, Wu X, Li C (2007) (EMBO) Journal 15(20): 5690-5700 The bHLH-type transcription factor AtAIB Sack FD, Suyemoto MM, Leopold AC (1985) positively regulates ABA response in Amyloplast sedimentation kinetics in Arabidopsis. Plant Molecular Biology 65(5): gravistimulated maize roots. Planta 165(3): 655-665 295-300 Li S, Fu Q, Chen L, Huang W, Yu D (2011) Shang Y, Yan L, Liu Z-Q, Cao Z, Mei C, Xin Q, Arabidopsis thaliana WRKY25, WRKY26, Wu F-Q, Wang X-F, Du S-Y, Jiang T, Zhao and WRKY33 coordinate induction of plant R, Sun H-L, Liu R, Yu Y-T, Zhang D-P thermotolerance. Planta 233(6): 1237-1252 (2010) The Mg-Chelatase H subunit of Liu Z-Q, Yan L, Wu Z, Mei C, Lu K, Yu Y-T, Arabidopsis antagonizes a group of WRKY Liang S, Zhang X-F, Wang X-F, Zhang D-P transcription repressors to relieve ABA- (2012) Cooperation of three WRKY-domain responsive genes of inhibition. The Plant transcription factors WRKY18, WRKY40, Cell 22(6): 1909-1935 and WRKY60 in repressing two ABA- Shen K, Wyatt SE, Nadella V (2012) ArrayOU: A responsive genes ABI4 and ABI5 in web application for microarray data analysis Arabidopsis. Journal of Experimental and visualization. Journal of Biomolecular Botany 63(18): 6371-6392 Techniques 23(2): 37-39 Mandadi KK, Misra A, Ren S, McKnight TD Soh H, Srikanth K, Whang SS, Lee S (2015) (2009) BT2, a BTB protein, mediates Morphological and gene expression pattern multiple responses to nutrients, stresses, and changes in WRKY46 mutant Arabidopsis hormones in Arabidopsis. Plant thaliana under altered gravity conditions. Physiology 150(4): 1930-1939 Botany 93(6): 333-343 Martzivanou M, Babbick M, Cogoli-Greuter M, Sugimoto M, Oono Y, Gusev O, Matsumoto T, Hampp R (2006) Microgravity-related Yazawa T, Levinskikh MA, Sychev VN, changes in gene expression after short-term Bingham GE, Wheeler R, Hummerick M exposure of Arabidopsis thaliana cell (2014) Genome-wide expression analysis of cultures. Protoplasma 229(2): 155-162 reactive oxygen species gene network in Morita MT, Tasaka M (2004) Gravity sensing and Mizuna plants grown in long-term signaling. Current Opinion in Plant spaceflight. BioMed Central (BMC) Plant Biology 7(6): 712-718 Biology 14(1): 4 Paul A-L, Zupanska AK, Schultz ER, Ferl Vandesompele J, Preter KD, Pattyn F, Poppe B, RJ (2013) Organ-specific remodeling of the Roy NV, Paepe AD, Speleman F (2002) Arabidopsis transcriptome in response to Accurate normalization of real-time spaceflight. BioMed Central (BMC) Plant quantitative RT-PCR data by geometric Biology 13(1): 112 averaging of multiple internal control genes. Pilet P-E, Barlow PW (1987) The role of abscisic Genome Biology 3(7):research0034.1- acid in root growth and gravireaction: a research 0034.11 critical review. Plant Growth Wang Y, Barbacioru C, Hyland F, Xiao W, Regulation 6(3): 217-265 Hunkapiller KL, Blake J, Chan F, Gonzalez Ren S, Mandadi KK, Boedeker AL, Rathore KS, C, Zhang L, Samaha RR (2006) Large scale McKnight TD (2007) Regulation of real-time PCR validation on gene expression telomerase in Arabidopsis by BT2, an measurements from two commercial long- apparent target of TELOMERASE oligonucleotide microarrays. BioMed Central ACTIVATOR1. The Plant Cell 19(1): 23-31 (BMC) Genomics 7(1): 59
28 Gravitational and Space Research Volume 3 (2) Dec 2015
Cook et al. -- Transcription Factors and Gravity
Wilkins H, Wain RL (1975) Abscisic acid and the Xu X, Chen C, Fan B, Chen Z (2006) Physical response of the roots of Zea mays L. and functional interactions between seedlings to gravity. Planta 126(1): 19-23 pathogen-induced Arabidopsis WRKY18, Wyatt SE, Rashotte AM, Shipp MJ, Robertson D, WRKY40, and WRKY60 transcription Muday GK (2002) Mutations in the gravity factors. The Plant Cell 18(5): 1310-1326 persistence signal loci in Arabidopsis disrupt Zheng Z, Qamar SA, Chen Z, Mengiste T (2006) the perception and/or signal transduction of Arabidopsis WRKY33 transcription factor is gravitropic stimuli. Plant Physiology 130(3): required for resistance to necrotrophic fungal 1426-1435 pathogens. The Plant Journal 48(4): 592-605
Gravitational and Space Research Volume 3 (2) Dec 2015 29 Research Article
Compact Heat Rejection System Utilizing Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Kuan-Lin Lee, Yeyuan Li, Brian J. Guzek, Jaikrishnan R. Kadambi, and Yasuhiro Kamotani
Department of Mechanical and Aerospace Engineering, Case Western Reserve University, Cleveland, OH
ABSTRACT INTRODUCTION In order to meet heat rejection requirements Designing the heat rejection system for the for future NASA exploration, scientific, and space vehicle is a very challenging task. Due to discovery missions, a study is being conducted for the variation of solar position, the environmental the feasibility of integral variable conductance temperature can change nearly 300 K within a few planar heat pipe (VCPHP) technology. This hours (Stephan, 2009). In general, the radiator represents a novel, low technology readiness level panel is usually sized to meet the heat rejection (TRL) heat rejection technology that, when requirement at a high environmental temperature. developed, could operate efficiently and reliably In order to reject the same amount of heat when across a wide range of thermal environments. The the environmental temperature drops significantly, concept consists of a planar heat pipe whose the surface temperature of the radiator must evaporator acquires the excess thermal energy decrease. As a result, the coolant inside the from the thermal control system and rejects it at primary loop of system may freeze and cause a its condenser whose outer surface acts as a serious safety issue. To avoid this problem, it is radiating surface. The heat pipe is made from necessary to develop a heat rejection system thermally conductive polymers in order to which can maintain a nearly constant radiator minimize its mass. It has a non-condensable gas surface temperature under a high system turndown that changes the active radiator surface depending ratio, defined in Equation (1) as: on the heat load. A mathematical model of steady- Q T max state variable conductance heat pipe is developed. R Q Two planar heat pipes are designed, fabricated, min and tested to validate the theoretical model. The In order to meet this requirement, the variable feasibility of the proposed VCPHP working in a conductance technique is introduced in the present space environment is discussed, based on the work. The most effective way is to adjust the model. effective radiative area according to the heat dissipation rate. One approach is to decrease the Key words: Variable Conductance Heat Pipes; coolant fluid flow rate that passes through the Radiation; Liquid Crystal Polymer; Turn-Down radiator, which can be achieved by controlling Ratio several on/off valves actively (Miller et al., 2011). Correspondence to: Yasuhiro Kamotani This technique can reject heat ranges from 1000 Case Western Reserve University Glennan - 412 W to 6000 W. Dividing the flow path into many Cleveland, OH 44106 small diameter pipes confers a greater degree of Telephone: 216-368-6455 system control. However, long, small diameter E-mail: [email protected] piping introduces high-pressure losses into the system. Additionally, the surface tension of the
30 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application coolant and associated capillary back-pressure fluid, which is then transported down the heat makes recharging small diameter piping difficult. pipe by the induced pressure differential. At the Another idea is to replace the coolant pipeline condenser, heat is rejected to the environment by loop with tubular heat pipes. Stern and Anderson radiative cooling. To form a closed loop, the combine a series of titanium/water heat pipes with capillary force generated by a wick structure a high conductivity foam saddle and fin to build returns the liquid to the evaporator. The system the heat pipe radiator (Anderson et al., 2009). must maintain a constant heat rejection rate as the Introducing a carefully measured quantity of non- environmental conditions vary. This condition is condensable gas (NCG) into the heat pipe allows achieved by the NCG reservoir attached at the precise control of the active length of the condenser end. condenser. These variable conductance heat pipes The heat rejection rate is controlled by two (VCHPs) can handle turn-down ratios of 5:1 or factors: the temperature difference between the more. VCHPs also have the advantage of short radiative surface and environment, and the active recovery time after being frozen since the gas- area of the radiator panel. Maintaining the surface loading prevents sublimation from the evaporator temperature of the radiator panel as the when the condenser is frozen. However, between environmental temperature drops requires the circular heat pipes and the radiator panel, heat active area of the heat rejection to decrease. This transfer still relies on conduction, which makes environmental temperature drop causes the the temperature distribution non-uniform, pressure of working fluid vapor to decrease. This reducing the rate of heat rejection. drop in pressure causes an increase in the volume Therefore, the integral variable conductance of the NCG, covering a larger portion of the planar heat pipes (VCPHP) is proposed as a condenser. In this way, the surface temperatures solution for the heat rejection requirements for of the condenser and evaporator are maintained future NASA exploration and discovery missions above the working fluid freezing point. (Lee et al., 2014). This heat rejection technology In addition to performance, weight is a key operates efficiently and reliably across a wide driver for the development of electronics and range of thermal environments. The VCPHP is a aerospace cooling systems (Rosenfeld and planar heat pipe that acquires the excess thermal Zarembo, 2001). Polymeric materials offer lower energy from the thermal control system and density than those available with metals, and are a rejects it through its condenser at its outer viable approach to decreasing system mass. One radiating surface. The radiator contains a NCG such commercially available product is the that varies the active radiator surface, depending CoolPoly® E2 Thermally Conductive Liquid on the heating and cooling conditions. This study Crystalline Polymer (LCP), a thermally introduces a simple mathematical model that conducting injection molding resin based on a captures the flow and thermal characteristics of liquid crystalline matrix (Cool Polymers Inc., the VCPHP. Two supporting experiments are 2007). This material has high thermal conducted to validate the model. Subsequently, conductivity and is comparatively lightweight. the feasibility of a variable conductance planar The properties of CoolPoly® E2 are listed in heat pipe-radiator in a space environment is Table 1. Brass is also listed as a reference material investigated by the model. due to its common use in thermal applications. METHODS Mathematical Modeling Variable Conductance Planar Heat Pipe To support the development of experimental and practical heat pipes, a theoretical model to Radiator predict the steady-state thermal and hydrodynamic Figure 1 shows the schematic of the proposed characteristics of VCPHPs is developed. In this VCPHP. Heat generated inside of a space vehicle model, the planar heat pipe is separated into three is collected at heat sources and transported to the regions: the vapor chamber, capillary grooves, and rejection system through a single fluid loop. This solid wall. These regions are coupled by mass and heat is transferred to the VCPHP evaporator. This heat transfer. The NCG and working vapor are heat injection vaporizes a portion of the working both treated as ideal gases.
Gravitational and Space Research Volume 3 (2) Dec 2015 31 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Figure 1. Schematic of compact heat rejection with variable conductance planar heat pipe (VCPHP) radiator.
Heat transfer in the solid wall Table 1. Properties of brass and CoolPoly E2 Liquid Crystal Polymer. In the solid wall, the two-dimensional heat conduction equation is applied in Equation (2): Brass Liquid Crystal Polymer Density (g/cm3) 8.7 1.6
Thermal conductivity 109 20 (W/mK) Heat transfer model in groove-liquid region Tensile Modulus (Gpa) 100-125 24.3 Heat transfer in the liquid-groove region— which involves phase change within the mini Tensile Strength (Mpa) 200 80 groove—had been widely studied (Stephan and Busse, 1992; Do et al., 2008). At the evaporator Flexural Modulus (Gpa) 39 32.3 section—where the heat is transferred from solid to liquid—the analytical solution based on the Flexural Strength (Mpa) 235 139 thin-film evaporator theory derived by Wang is applied to evaluate the total heat flux across the liquid-vapor interface (Wang et al., 2008), as shown in Equation (3):
32 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
conservation equation (Equation (7)) are listed below:
By assuming the vapor phase pressure drop along the axial direction is negligible, the liquid pressure drop should be balanced by capillary pressure, described by the Young-Laplace equation:
From the conservation of energy at interface, the mass flux caused by phase change can be expressed as
q Boundary conditions m lv j h For the solid wall, the boundary conditions fg are:
For the condenser portion, the parallel In the evaporator region (x ≤ Le): conduction model introduced by Dunn and Reay (1976) is used to obtain the effective thermal conductivity, as shown in Equation (5):
kl kw[1 (1 )] At the condenser/radiator panel (x > Le): ks where 2w 2wf The liquid layer thickness can be determined from the radius of meniscus curvature if the Due to the wall conduction in the axial groove geometry is specified. direction, the evaporating region will expand beyond the heated region specified by Le. The For the liquid within the grooves: evaporating region needs to be calculated iteratively; the same is true for the condenser length. Capillary flow in liquid-grooves region Initial radius of curvature r0 is selected The liquid-flow driven by capillary pressure carefully to satisfy the conservation of total fluid in the axial grooves can be treated as one- mass. dimensional, incompressible, low Reynolds When the system reaches steady-state, heat number flow. The corresponding continuity input should be equal to the heat that radiates out equation (Equation (6)) and momentum to the space, which is:
Gravitational and Space Research Volume 3 (2) Dec 2015 33 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
fabricated, and tested to validate the model and prove the concept. Brass is chosen for the initial prototype for its easy machinability, high- Non-condensable gas model durability, and compatibility with a variety of working fluids. As shown in Figure 3, the brass As mentioned above, the surface temperature heat pipe (BHP) is constructed with a sandwich of the heat pipe can be maintained by injecting structure suggested in literature. The BHP NCG. The ideal gas model is used to analyze the consists of three main parts: two plates containing behavior of the NCG and its effects. For the sake a triangular groove structure and a spacer with of simplicity, several assumptions have been taps for charging and fluid injection. The three made: (1) both the vapor and NCG ideal gases are pieces are joined with machine screws and sealed distributed uniformly inside the reservoir and heat with a pair of soft silicone rubber gaskets (red pipe, and (2) diffusion between the NCG and portion). For the other experimental heat pipe, vapor is neglected, i.e., a sharp interface exists CoolPoly E2 LCP plate is selected as the base between the two gases. material. This material is chosen to test The governing equation for the NCG is the lightweight materials in this application. The ideal gas law: design of the LCP heat pipe is very similar to the BHP. It consists of two pieces of LCP plate, acrylic, and spacer. All pieces are fastened with bolts and sealed with rubber gaskets to ensure a The total pressure in the inactive portion of vacuum. The overall dimensions and geometry for heat pipe is the summation of the partial pressure these two heat pipes are given in Table 2. of NCG and working fluid vapor. When the system reaches steady-state, the total pressure Experimental set-up should balance the saturation pressure in the Two test systems to evaluate the thermal active portion of the heat pipe, shown in Equation performance of BHP and Liquid Crystalline (11): Polymer-Heat Pipe (LCP-HP) are designed and constructed. Heat is provided by a fluid loop PTPPTv()() v g v amb heated by a resistive heating element controlled Here, the vapor temperature is determined by by a variable DC power supply. Because of the the Clausius-Clapeyron relationship. Because the difficulty of maintaining a low temperature inactive length and the pressure of vapor are radiative environment, both heat pipes are cooled related, it is necessary to calculate iteratively. convectively. The condenser section of BHP is The governing equations are solved by the placed into the FLOTEK 1440 wind tunnel. By finite element method. A 100 element long by 10 varying the wind speed and heating voltage, a element thick formulation is used for the solid wide range of thermal conditions is studied. Wall wall. At each step of iteration, the thermodynamic temperature profile is measured using 10 T-type properties are updated according to the new thermocouples attached to the solid plate. saturated vapor temperature. With the additional For the LCP-HP experiment, the heat source effect of NCG, the length of cooling section is no consists of a 0-60 V DC power supply and two longer constant and should be evaluated by a 0.5×2 (1.27 cm×5.08 cm) Kapton film heaters pressure balance between the vapor phase and the attached to both polymer plates. The condenser is NCG. The calculation procedure for steady-state cooled by forced convection with a constant wind heat pipe operation is summarized in Figure 2. speed of 3 m/s. The wall temperature is measured by T type thermocouples. Five thermocouples are Supporting Ground-Based Experimental Work attached to each polymer plate. Design and manufacture of brass planar heat Both BHP and LCP-HP are carefully cleaned, pipe and LCP heat pipe evacuated, and charged with ethanol before testing. The fluid load is slightly lower than the Two planar heat pipes are designed, volume of the grooves.
34 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Table 2. Specifications of the two planar heat pipes.
Brass Heat Pipe (BHP) Liquid Crystal Polymer Heat Pipe (LCP-HP) Length (cm) 27.94 5.08 Width (cm) 13.97 5.08 Thick (cm) 1.27 0.8334 Wall thickness (mm) 3.175 3.175 Grooves type Triangular Rectangular Grooves dimensions 0.444mm 6.9 mm 1mm 0.762mm
0.9 mm 72 grooves per plate 32 grooves per plate
Program start
Data input: Geometries, fluid properties, etc.
initial guess : Lci NCG? Y N Calculate Pg and Pv initial guess : Tv=constant Clausius- T v Clapeyron relationship
initial guess : Le=constant
Calculate new 2D Wall Le conduction
Liquid-groove region heat transfer
System level energy conservation
N Qout=Qin N ?
Y
momentum & mass conservation in Liquid phase
Output
Figure 2. Steady-state planar heat pipe operation calculation flow chart.
Gravitational and Space Research Volume 3 (2) Dec 2015 35 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
(A) (B) Figure 3. (A) Brass planar heat pipe. (B) Liquid Crystal Polymer heat pipe (LCP-HP).
RESULTS AND DISCUSSION difference between the data and prediction is about 7%. Therefore, we can conclude the data Validation and prediction agree reasonably well. First, although it is assumed the pressure drop In addition, to ensure that the heat pipe is in the vapor flow is negligible so the vapor functional, the measured temperature distribution pressure is nearly uniform everywhere, it must be of the empty heat pipe and the prediction are justified since the vapor pressure of ethanol is shown in Figure 6. Without the working fluid, the relatively low (8.8 kPa at 300 K). The computed heat transfer is by conduction only. Consequently, pressure distributions in the vapor and liquid for the wall temperature varies monotonically. The both BHP and LCP heat pipes are shown in Figure overall temperature drop is about 33°C, compared 4. The figure shows the pressure drops during heat to 15°C for the same power input when the heat pipe operation are due primarily to the friction pipe is working. Therefore, based on the generated by the liquid travel through the small comparisons of the temperature profile and the grooves. The maximum capillary pressure drops overall temperature drop, it can be concluded the for BHP and PHP are 40 Pa and 44 Pa, heat pipe is indeed operating. respectively, while the vapor pressure drops are Similar agreement between the experimental both less than 1 Pa. It can be shown that even for data and predictions is found for the polymer heat the larger heat pipe (to be discussed later) the pipe, as shown in Figure 7. For the polymer heat vapor pressure drop is on the same order. pipe, due to its smaller dimension, its thermal Therefore, the uniform vapor pressure assumption performance is poor. But the main objective of is justified. this experiment is to show that this polymer For the BHP experiment, various loads and material can be used as a heat pipe material, wind speeds are applied. The heat transfer rate at which is demonstrated in the present work. the condenser is estimated by an empirical The index of thermal performance for the formula for boundary layer flow over flat plate. planar heat pipe can be characterized by the Typical experimental wall temperature effective thermal resistance defined as: distributions and the predicted values by the developed model are plotted in Figure 5. The dots are the measured data and the solid lines are the predictions. The evaporator is indicated as a red The corresponding effective thermal shaded region. The data tend to scatter. However, in terms of temperature difference between the resistance for BHP and LCP-HP is 0.6 K/W and wall and ambient temperatures, the average 2.5 K/W, respectively.
36 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Figure 4. Predicted vapor and liquid pressure Figure 7. Temperature distribution of LCP-HP. drops of BHP and PHP during operation.
Feasibility of VCPHP-Radiator for Space Environment The current computational model is applied to analyze the thermal behavior of VCPHP in a radiative cooling environment, such as space. The proposed VCPHP design is similar to the ground- based heat pipe design, but with a much larger cooling area to compensate for weaker radiation cooling. The proposed size of VCPHP is 1 m by 1 m. The liquid crystal wall thickness is 0.5 cm. On each LCP plate, 600 equilateral triangular grooves (1.154 mm size) are used to generate enough capillary pressure. The active area of the condenser is designed Figure 5. BHP temperature distributions with to maintain the working fluid temperature above different heat inputs. its freezing point. This can be done by attaching a NCG reservoir at the end of the planar heat pipe. In Figure 8, the heat pipe radiator is required to reject 200 W heat load from the heat source. The heat from the heat source is transported by the coolant fluid—in this case, water—to a heat exchanger attached to the evaporator section of the VCPHP. For simplicity, the black surface of the LCP plate is assumed to have an emissivity approaching unity. In the simulation, nitrogen and ethanol are used as the NCG and working fluid, respectively. The reservoir volume is 3.6×10-4 m3. The predicted wall temperature profiles of VCPHP at different sink temperatures are shown in Figure 8. The solid lines in Figure 8 represent the wall temperature profiles without the NCG, and the dash lines are for the VCPHP, with the Figure 6. Temperature distribution of BHP dry-run NCG as the ambient temperature drops from 250 test. K to 50 K.
Gravitational and Space Research Volume 3 (2) Dec 2015 37 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Without the NCG, when the with the NCG. As Q is reduced, the evaporator ambient temperature drops, the planar heat pipe temperature decreases. Eventually, the radiator surface temperature (solid line) decreases temperature of the liquid-vapor interface in the as well. At the evaporator (indicated as red shade evaporator is reduced to below the saturation region), the wall temperature for Tamb=50 K temperature and the heat pipe ceases to operate. cases are lower than the freezing point of We define Q corresponding to this limit as Qmin. the coolant (water) inside the heat The lower limit is 90 W with the NCG. exchanger. The heat exchanger and coolant loop will be frozen and the entire thermal control system may be damaged. To avoid this problem, 5 g of nitrogen is injected into the planar heat pipe radiator. As the dash lines show, the radiator with NCG is now being divided into two regions: active and inactive. In the inactive portion, the vapor chamber is covered by the NCG and no phase change happens inside this region. The surface temperature is approximately equal to the sink temperature. The surface temperature of the active portion can be maintained above the freezing temperature of coolant liquid (~273 K for water). This result suggests that the proposed planar heat pipe radiator with a small amount of NCG can still operate normally in a relatively cold environment. Figure 9. Wall temperature distributions of VCPHP with different heat loads (Tamb=250 K).
Figure 8. Wall temperature distributions of VCPHP under different sink temperature fields (Q=200 W).
Figure 9 is the case in which the ambient Figure 10. Wall temperature distributions of temperature is fixed at 250 K and the heat load is VCPHP with different heat loads (Tamb=50 K). varied. Since the present analysis does not include the cooling loop from the heat source, we impose The ambient temperature is reduced to 50 K the condition (somewhat arbitrary) in the present in Figure 10. The maximum Q is increased to 640 analysis that the evaporator temperature cannot go W (assuming the capillary limit is greater than above 350 K for the heat rejection system to this). The lower limit in Q is now given by the operate. This limit is reached when Q=500 W condition that the evaporator temperature cannot
38 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application go below the coolant freezing temperature. The CONCLUSIONS minimum Q is equal to 90 W. The present work deals with an alternative The heat rejection system is sometimes design of heat rejection system for space required to damp relatively large amount of Q application utilizing a planar heat pipe with NCG when T is high, and relatively small amount of amb to replace the traditional radiator panel. A two- Q when T is low. In order to quantify this amb dimensional heat transfer model combined with capability, the turndown ratio is used. Based on thin-film evaporator analytical solution is Figure 9 and Figure 10, when T is changed amb introduced. Two bench-top planar heat pipes are from 250 K to 50 K, Q (at 250 K) is 500 W and max designed, fabricated, and tested. The experimental Q (at 50 K) is 90 W, so that the turndown ratio min data are shown to agree reasonably well with the is Q /Q =5.6. max min predictions without the NCG. The numerical The turndown ratio is affected, among other model is used to assess the feasibility of the factors, by the amount of NCG and the heating present heat rejection system in a space zone size. For example, it can be shown that if environment. The results show the idea of using the amount of NCG is increased from 5 g to 6 g in NCG to adjust the cooling area and maintain the Figure 9 and Figure 10, Q will decrease to 490 max normal operation of heat rejection system is W, but Q will also decrease to 60 W so that the min feasible. turndown ratio will become 8.2. Also, with increased heating zone, the condenser (radiator) ACKNOWLEDGEMENTS area is reduced, which necessitates the condenser temperature to increase in order to radiate a given This work was sponsored by an Early Stage amount of Q. The increased condenser Innovations grant from NASA’s Space temperature also increases the heating zone Technology Research Grants Program (Grant temperature, which helps to decrease Qmin. For number: NNX13AC87G). Sincere appreciation example, if the heating zone is tripled in Figure 9 goes to Case Western Reserve University and Figure 10, Qmax will slightly increase to 530 mechanical engineering machine shop for their W, but Qmin will be reduced to 50 W, which will valuable advice on planar heat pipe fabrication. make Qmax/Qmin=10.6. Clearly conditions exist under which the turndown ratio is maximized. The optimization study is currently being performed.
NOMENCLATURE A Area -21 Ac Dispersion constant (for ethanol: 2.2x10 J) c Accommodation coefficient Dh Hydraulic diameter f Fin thickness fRe Poiseuille number h Heat transfer coefficient hfg Latent heat of vaporization k Thermal conductivity L Length mj Mass flux rate through liquid-vapor interface M Molecular weight N Number of the channels P Pressure Q Heat load q Heat flux R Gas constant
Gravitational and Space Research Volume 3 (2) Dec 2015 39 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Reff Effective thermal resistance rc Radius of meniscus T Temperature TR Turn-down ratio u Velocity in x-direction U Wind speed V Volume W Width w Half width of the channel wr Half meniscus surface area per unit length Greek letters β Liquid void fraction δ Liquid layer thickness ε Emissivity ρ Density σ Surface tension (for ethanol: 22.8x10-3 N/m @T=20°C) σr Stefan-Boltzmann constant ν Kinematic viscosity µ Dynamic viscosity Subscripts and superscripts amb Ambient b Groove base c Condenser e Evaporator g Non-condensable gas i Inactive region in Input l Liquid phase region lv Liquid-vapor interface max Maximum min Minimum out Output r Reservoir s Solid wall surface Surface t Total v Vapor phase region w Wick structure 0 Reference value
REFERENCES Anderson WG, Ellis MC, Walker KL (2009) Do KH, Kim SJ, Garimella SV (2008) A Variable conductance heat pipe radiators for mathematical model for analyzing the thermal lunar and Martian environments. In American characteristics of a flat micro heat pipe with Institute of Physics Conference Proceedings, grooved wick. International Journal of Heat 1103: 57-66 Journal of Heat and Mass Transfer 51: 4637- Cool Polymers Inc. (2007) E2 Thermally 4650 Conductive Liquid Crystalline Polymer (LCP) Dunn P, Reay DA (1976) Heat pipes, New York: data sheet. Cool Polymers, Inc. Pergamon Press
40 Gravitational and Space Research Volume 3 (2) Dec 2015 Lee et al. -- Integral Variable Conductance Planar Heat Pipe Radiator for Space Application
Lee K-L, Li Y, Guzek BJ, Kadambi J, Kamotani Spacecraft Thermal Management. Y (2014) A mathematical model for analysing Thermacore International Inc. the thermal characteristics of a planar heat Stephan RA (2009) Overview of NASA’s Thermal pipe for space application. In Proceedings of Control System Development for Exploration the 2014 International Conference on Heat Project. International Conference on Transfer and Fluid Flow Environmental Systems, SAE Technical Paper Miller JR, Birur GC, Ganapathi GB, Sunada ET, Number 2009-01-2436 Stephan PC, Busse CA (1992) Analysis of the Berisford DF (2011) Design and Modeling of heat transfer coefficient of grooved heat pipe a Radiator with Digital Turn-Down evaporator walls. International Journal of Capability under Variable Heat Rejection Heat and Mass Transfer 35(2): 383-391 Requirements. 41st International Conference Wang H, Garimella SV, Murthy JY (2008) An on Environmental Systems, AIAA Technical analytical solution for the total heat transfer in Paper Number 2011-5002 the thin-film region of an evaporating Rosenfeld J, Zarembo S (2001) Final Report of meniscus. International Journal of Heat and Ultra-Lightweight Magnesium Heat Pipes for Mass Transfer 51: 6317-6322
Gravitational and Space Research Volume 3 (2) Dec 2015 41 Research Article
Validation of Assays for Reactive Oxygen Species and Glutathione in Saccharomyces cerevisiae during Microgravity Simulation
Timothy G. Hammond1,2,3, Patricia L. Allen2, and Holly H. Birdsall1,4
1Department of Veterans Affairs Office of Research and Development, Washington, DC; 2Durham VA Medical Center, Research & Development Service, Durham, NC; 3Nephrology Division, Department of Internal Medicine, Duke University School of Medicine, Durham, NC; 4Departments of Otorhinolaryngology, Immunology, and Psychiatry, Baylor College of Medicine, Houston, TX
ABSTRACT ACRONYMS The effects of spaceflight on yeast have high DC-FDA 2',7'-dichlorodihydrofluorescein concordance with agents that induce a very low diacetate intracellular redox state and induce a massive DHE Dihydroethidium DMSO Dimethyl sulfoxide efflux of glutathione. These results raise important Em Emission issues. Can the reduced redox state during Ex Excitation spaceflight be reproduced and modulated in FRET Fluorescence resonance energy transfer ground-based simulations? Will this allow GSH Glutathione (reduced) definition of unique drug pathways as a low redox GSSH Glutathione (oxidized) potential state mirrors the electrophilic properties GST Glutathione S-transferase HPLC High performance liquid of mitochondria where many drugs are chromatography metabolized? Unfortunately, assays for redox mBCL Monochlorobimane status and its major cellular determinant— mcf mean channel fluorescence glutathione—are diverse and often cell-type- Msn4Δ Msn4 yeast deletion: Multicopy suppressor of SNF1 mutation specific. Currently, an accepted redox probe set (YKL062W) for yeast studies is not available. This paper NaOH Sodium hydroxide validates fluorescent probes for glutathione and NDA Naphthalene-2,3-dicarboxaldehyde reactive oxygen status in yeast to support NEM N-Ethylmaleimide mechanistic studies of microgravity and drug NMR Nuclear magnetic resonance metabolism. The plethora of fluorescent reagents PBS Phosphate buffered saline PI Propidium iodide PKC Protein kinase C ROS Reactive oxygen species Key words: Yeast; Redox Potential; Spaceflight; SEM Standard error of the mean Microgravity Simulation Sfp1Δ Sfp1 yeast deletion: Split Finger Protein Correspondence to: Timothy Hammond (YLR403W) Research & Development Sok2Δ Sok2 yeast deletion: Suppressor of Durham VA Medical Center (558/151) Kinase (YMR016C) 508 Fulton Street WT Wild type Durham, NC 27705 YE Yeast extract YPD Yeast peptone dextrose Telephone: 919-286-0411, Ext. 3809 E-mail: [email protected]
42 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation for reactive oxygen species and glutathione makes enormous extracellular release of glutathione from head-to-head comparisons of all the alternatives S. cerevisiae cells, changed the distribution of bud impractical. These reagents measure the scars, and activated the high osmolality glycerol physiological milieu of reactive oxygen species and cell integrity/protein kinase C (PKC) and diverse thiols, rather than specific individual pathways, as well as protein carbonylation molecules. We report that in yeast, (Bradamante et al., 2010). monochlorobimane (mBCL) and 2',7'- These results show promise for the use of dichlorodihydrofluorescein diacetate (DC-FDA) microgravity as a laboratory for the study of drug are suitable for fluorometric and flow cytometry pathways since low redox potential state mirrors studies of glutathione and reactive oxygen the electrophilic conditions of mitochondria, species, respectively. Both dyes have low where many drugs are metabolized (Blackman et background fluorescence, predictable loading, al., 2012; Cap et al., 2012a). To pursue this good retention, and are not acutely toxic to aspect of microgravity, we asked whether the Saccharomyces cerevisiae. Both dyes show reduced redox state developed during spaceflight concordance with other fluorescent and could be reproduced and modulated in ground- biochemical assays of reactive oxygen species. based simulations. Unfortunately, assays for redox status and its major cellular determinant, INTRODUCTION glutathione, are diverse, often cell-type-specific, We have previously reported on the use of and an accepted probe set for yeast studies does molecularly-barcoded yeast deletion series to not exist (Hedley and Chow, 1994; Kalyanaraman evaluate the effects of microgravity on living cells et al., 2012; Sebastià et al., 2003). To address this in a systematic, quantitative, and unbiased need, we have validated fluorescent probes for manner. We used the complete collection of glutathione and reactive oxygen status in the yeast ~4,800 homozygous and ~1,100 heterozygous S. cerevisiae to open the door for mechanistic and yeast deletion strains and obtained genome-wide pathway studies of microgravity and drug sensitivity profiles by comparing strain fitness for metabolism. Our approach focuses on clones grown in spaceflight versus the ground intracellularly-trapped fluorescent probes to (Nislow et al., 2015). The effects of spaceflight on access the sensitivity of fluorometry and flow yeast were compared to the effects of thousands of cytometry applications. The fluorescent probes drugs previously analyzed systematically with the were compared to biochemical and untrapped same deletion series (Lee et al., 2014). We found probe alternatives (Hedley and Chow, 1994; the effects of spaceflight have high concordances Kalyanaraman et al., 2012; Lewicki et al., 2006). with the effects of DNA-damaging agents and MATERIALS AND METHODS changes in redox state (Lin et al., 2008; Nislow et al., 2015). We also identified unique spaceflight- Chemicals and Reagents specific genes and gene pathways affecting cell S. cerevisiae strain BY4743 (i.e., wild type survival (Nislow et al., 2015). (WT)), and Msn4, Sfp1, and Sok2 haploid Yeast grown in spaceflight showed a profile deletion strains were purchased from Life very similar to that of yeast treated with diallyl Technologies (Grand Island, NY). Fluorescent disulfide profile, an agent that increases the dyes monochlorobimane (mBCL), 2',7'- production of the enzyme glutathione S- dichlorodihydrofluorescein diacetate (DC-FDA), transferase (GST) that binds electrophilic toxins in naphthalene-2,3-dicarboxaldehyde (NDA), dihy- cells (Lin et al., 2008; Nislow et al., 2015). droethidium (DHE), and propidium iodide (PI) Overloading the cell with inhibitory doses of were also purchased from Life Technologies diallyl disulfide reveals genes required for (Grand Island, NY). Molecular Probes’ MitoSOX survival in the presence of increased reactive Red kits for mitochondrial superoxide production oxygen species (ROS) (Lin et al., 2008). and Amplex Red horseradish peroxidase kit for Others have observed perturbation of release of peroxides were purchased from Life glutathione during spaceflight. During the Technologies. All other chemicals and reagents FOTON-M3 mission, spaceflight induced an
Gravitational and Space Research Volume 3 (2) Dec 2015 43 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation were purchased from Sigma-Aldrich (St. Louis, Mitochondrial superoxide production MO). MitoSOX reagents were prepared as per Giant Yeast Colony Cultures manufacturer’s directions. 100 l of 5 M MitoSOX reagent was added to an equal volume Round, 10 cm diameter plates were poured o with 2% agar in either yeast peptone dextrose of yeast in PBS, incubated at 30 C for 10 min, and (YPD) (1% yeast extract, 2% peptone, 2% read by a plate reader with Ex/Em 510/580 nm. dextrose (D-glucose), or YE (1% yeast extract, Release of hydrogen peroxide 3% glycerol, 1% ethanol, and 10 mM CaCl ). 2 The release of hydrogen peroxide from cells Differing media, culture intervals, and yeast was measured with the Amplex Red kit. Amplex clones were used in order to induce varying redox Red/Horseradish peroxidase reaction mix was states for the validation experiments. To maintain selection criteria for deletion clones, agar media prepared as per manufacturer’s directions. 50 l of for their growth was supplemented with 200 mg/L Amplex Red mixture was added to an equal volume of yeast in PBS and incubated for 30 min Geneticin (G418). Plates were inoculated from o overnight liquid cultures prepared by adding 100 at 30 C in the dark. Samples were read by a plate reader at Ex/Em 571/585 nm and Ex/Em 530/590 l of yeast from a stationary culture into 5 ml of nm. fresh YPD grown overnight in a shaking incubator at 30oC. Each plate was inoculated with six Glutathione Assays replicates of 10 l per dot, briefly dried to allow Fluorometric assay for glutathione the yeast to adhere to the agar, and sealed with Parafilm M (Bemis, Oshkosh WI). Plates were mBCL was diluted in PBS to the indicated incubated at room temperature for 7 to 28 days. concentrations and mixed in equal volumes with On the day of the assay, individual giant yeast yeast in PBS. Samples were incubated at 30oC for colonies were gently scraped from the agar the indicated times and read by a plate reader at surface using the side of a plastic drinking straw 2 Ex/Em 405/525 nm, or analyzed by flow cm in length, and were then placed in 1 mL of cytometry. phosphate buffered saline (PBS) and suspended Biochemical assay of glutathione by vortex. Glutathione (GSH) was extracted from the Fluorometric Assays for Reactive Oxygen yeast and assayed as described by Lewicki et al. Species (2006). In brief, yeast are pelleted in a 1.5 ml Eppendorf tube spun at 400 g for 3 min and DC-FDA washed twice with 1 ml of cold PBS. GSH is 2',7'-dichlorodihydrofluorescein diacetate was extracted by adding 1 ml of ice-cold 3.3% dissolved at 1 mg/ml (2 mM) in ethanol, and then perchloric acid and vortexing for 2 min. The tube is spun at 15,000 g for 5 min and the supernatant diluted into PBS to the indicated concentrations. o Equal volumes of yeast in PBS were mixed with is aspirated and stored at -80 C until assayed. The DC-FDA, incubated for the indicated times, and assay is performed by adding 100 l aliquots of read by a plate reader with an excitation/emission serially diluted GSH reference standards (325 M (Ex/Em) 485/530 nm, or analyzed by flow to 0.45 M diluted in 3.3% perchloric acid), or cytometry. 100 l of the yeast extract, prepared as above, into 25 l of 2 M sodium hydroxide (NaOH) in a 96- DHE well microliter plate. The solution is neutralized DHE was dissolved at 1 mg/ml in DMSO by addition of 75 l of 0.4 M borate at pH 9.0. (dimethyl sulfoxide) and then diluted to 25 g/ml GSH is detected by addition of 20 l of NDA (1 in PBS. Equal volumes of DHE and yeast in PBS mg/ml in ethanol). NDA is nonfluorescent until it o were incubated for 25 min at 30 C and read by a reacts with a primary amine in the presence of plate reader with Ex/Em 510/580 nm. excess cyanide or a thiol to yield a fluorescent isoindole. Fluorescence is read in a plate reader at
44 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Ex 485 + 10 nm and Em 530 + 12.5 nm after 2 often reviewed as the best measure of cellular min of shaking. The standard curve is generated redox status, but a variety of redox molecules with purified GSH diluted in 3.3% perchloric acid contribute to the assay findings (Jakubowski and from 325 M to 0.45 M. Showing inhibition Bartosz, 2000). Similarly there is no selective dye with addition of increasing quantities of the N- for glutathione, but mBCL is amongst the most ethylmaleimide (NEM) validated the assay. specific of available dyes for thiols, and glutathione is by far the most abundant Cell Death intracellular thiol (Hedley and Chow, 1994). To monitor viability during dye uptake To measure dye uptake and conversion, yeast studies, 2 M PI was added to the mBCL and DC- were mixed with 100 to 800 M mBCL, or 2.5 to FDA staining solutions. Uptake of PI by dead 20 M DC-FDA, and fluorescence was measured cells was assayed by flow cytometry. every 10 min for 8-12 h in a plate reader. Kinetic uptake curves show that uptake and conversion of Plate Reader and Flow Cytometer both dyes is time and dose dependent (Figure 1A Fluorescence was measured in a Molecular and Figure 1D). Conversion of dye is also Devices Spectramax M5e spectrofluorometer dependent on the quantity of yeast (Figure 1C and using kinetic measurements taken every 10 min Figure 1F). Changes measured within these dye for 8 h at 30oC as the dyes entered the cells and doses and times reflect changes without artifacts were activated by cleavage and/or target binding. due to dye saturation. The fluorescence of DC- Unless noted otherwise, values are presented as FDA alone increases very slightly with prolonged the net fluorescence above the background incubation, whereas mBCL is extremely stable determination made using PBS in lieu of yeast. (Figure 1B and Figure 1E). Because of this Flow cytometry was performed in the Duke background, fluorescence data from the Human Vaccine Institute Research Flow microplate reader is typically presented at net Cytometry Shared Resource Facility under the relative fluorescent units calculated by subtracting direction of Dr. Gregory D. Sempowski (Durham, the fluorescence signal from dye alone, from the NC). Flow cytometric studies were carried on a total fluorescence signal. Becton Dickinson (San Jose, CA) LSRII cell To evaluate whether the dyes were retained analyzer flow cytometer using Ex/Em of 405/515, intracellularly, we incubated a series of different 532/610, and 488/530 nm for mBCL, PI, and DC- yeast clones cultured under different conditions FDA, respectively. Measurements were collected with 400 M mBCL or 10 M DC-FDA, and then on at least 10,000 cells per sample. Data analysis measured the fluorescence in individual cells by was performed using Flo-Jo software (Ashland, flow cytometry at one and eight hours. During OR). Data in Figure 2 and Figure 6 are flow that time interval, the mean channel fluorescence cytometry and all other data from the fluorescent (mcf) of DC-FDA decreased by 49 + 3% (SEM plate reader. nine samples), suggesting efflux of some dye Statistics (Figure 2A). However, the mcf for mBCL increased by 89 + 10% (SEM nine samples), Data is presented as geometric mean + suggesting continued dye loading and or dye standard error with six replicates (unless conversion by the intracellular GSH (Figure 2B). otherwise noted). Correlations were analyzed by To evaluate toxicity from DC-FDA or mBCL, cell Statistica 6.1 (StatSoft Inc., Tulsa, OK) using death was measured by fluorescence of PI using correlation matrix product moment and partial flow cytometry. Viability in the 10 samples at one correlations. hour ranged from 86% to 98%. After eight hours of exposure to mBCL, viability had increased by RESULTS 16.3 + 3.8% over baseline (data not shown). After DC-FDA and mBCL are intracellularly eight hours of incubation with DC-FDA, viability trapped fluorescent probes that formed the starting had increased by 12.7 + 3.0% (mean + SEM; data reagents for our validation (Hedley and Chow, not shown). The increase in viability over eight 1994; Jakubowski and Bartosz, 2000). DC-FDA is hours suggested the yeast may have proliferated during the staining period. Based on these results,
Gravitational and Space Research Volume 3 (2) Dec 2015 45 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation we selected 400 M (final) as the optimum endpoint reads were performed at four hours after concentration for mBCL staining, and 10 M dye addition. (final) as the optimum concentration for DC-FDA;
Figure 1. Dose and time effects on staining with mBCL and DC-FDA. Giant WT yeast colonies harvested into PBS were mixed with dye in a 96 well plate, incubated at 30oC, and fluorescence measured with a microplate reader at 10-minute intervals for 8-12 hours. Values shown are the average total relative fluorescence units + SEM of 6-8 replicates. Figure 1A shows a constant amount of yeast mixed with monochlorobimane (mBCL) at 100, 200, 400, and 800 M (final). Figure 1B shows the same dilutions of mBCL mixed with PBS and is on the same y-axis as Figure 1A. Figure 1C shows varying dilutions of yeast mixed with mBCL at 400 M (final). Figure 1D shows a constant amount of yeast mixed with 2',7'-dichlorodihydrofluorescein diacetate (DC-FDA) at 2.5, 5, 10, and 20 M (final). Figure 1E shows the same dilutions of DC-FDA mixed with PBS and is on the same y-axis as Figure 1D. Figure 1E shows varying dilutions of yeast mixed with DC-FDA at 10 M (final).
46 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Figure 2. Intracellular retention and toxicity of DC-FDA and mBCL. Various clones of giant yeast colonies were grown under different conditions and time intervals, harvested into PBS, mixed with mBCL or DC- FDA, incubated at 30oC, and assayed by flow cytometry at one hour and eight hours. Values shown are the mean units + SEM of 6 replicates for each different samples. Figure 2A shows the mean channel fluorescence for DC-FDA in nine different samples. Figure 2B shows the mean channel florescence for mBCL in nine different clones. Figure 2C shows the viability of the samples, as defined by exclusion of propidium iodide in 18 different samples.
To verify mBCL fluorescence reflected yeast samples (vertical axis). Values plotted are intracellular glutathione concentrations, we the geomean + SEM of three replicates for the compared it to a biochemical assay that relies biochemical GSH assay and six replicates for the upon the reaction between cellular GSH extracted mBCL assay. GSH detected with mBCL dye with perchloric acid and a highly selective versus the fluorescence in the biochemical assay fluorogenic probe, i.e., NDA (Lewicki et al., for GSH is linear, embodied by the equation 2006). The standard curve for exogenous purified y=0.0448x + 132.91 with R2=1. Note the different GSH assayed by NDA fluorescence is linear, scales and baselines used to clarify the trend by embodied by the equation y=22.019x + 37.004 exaggeration. with R2=0.996 (Figure 3A). The fluorescence of To determine the relationship between related GSH in cell extracts detected with NDA can be dyes for fluorescent assay of glutathione and completely inhibited by addition of NEM in a ROS, we assayed a series of 84 samples with a dose-dependent manner (Figure 3B). NEM was panel of reagents: mBCL for low molecular able to inhibit 75% of the fluorescence generated weight thiols, including glutathione; DC-FDA for by NDA mixed with purified GSH (Figure 3C). hydroxyl, peroxyl, and other reactive oxygen The biochemical NDA-based assay and the species; Amplex Red for released hydrogen fluorometric mBCL assay showed excellent peroxide; DHE for reactive oxygen species and correlation when applied to the same samples. superoxide; and MitoSOX for mitochondrial Figure 4 shows the fluorescence for GSH in intact superoxide production. Figure 5 illustrates the yeast, detected with mBCL dye (horizontal axis), cellular location of the products detected by each versus the fluorescence in the biochemical assay reagent. Table 1 summarizes correlation for GSH in perchloric acid extracts from the same coefficients between the different assays.
Gravitational and Space Research Volume 3 (2) Dec 2015 47 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Figure 3. Validation of the GSH biochemical assay. Figure 3A shows the fluorescence of naphthalene-2,3- dicarboxaldehyde (NDA) in an assay of purified glutathione (GSH) in doses of 0-325 µM. Values are the mean of triplicate determinations. Figure 3B shows that NEM inhibits the NDA-based detection of GSH in WT yeast perchloric acid cell extracts. A constant amount of GSH was mixed with serial dilution of NEM in doses of 0.2 to 0.002 mg/ml and assayed with NDA. Figure 3C shows that NEM inhibits 75% of the NDA-based detection of purified GSH. A constant amount of WT yeast perchloric acid extract was mixed with serial dilution of NEM in doses of 1 to 0.002 mg/ml and assayed with NDA. Results are the mean of triplicates.
Figure 4. Comparison of cell-based fluorescent assay and biochemical assays for GSH. The graph shows the net fluorescence for GSH in intact WT yeast, detected with monochlorobimane (mBCL) dye (horizontal axis), versus the net fluorescence in the biochemical assay for GSH in extracts from the same yeast samples (vertical axis). Values plotted are the geomean + SEM of three replicates for the biochemical GSH assay and six replicates for the mBCL assay. Note the different scales and baselines used to clarify the trend by exaggeration.
48 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Figure 5. Cellular locations of the targets of fluorescent dyes for detection of GSH and ROS. Asterisks are used to denote the fluorescent product. Propidium iodide (PI) enters the nuclei of dead cells (upper left) where it fluoresces when it intercalates into DNA. PI does not enter viable cells (upper right) and thus can be used to discriminate between live and dead yeast. mBCL (monochlorobimane) is converted to a fluorescent product by intercellular GSH. DC-FDA (2',7'-dichlorodihydrofluorescein diacetate) detects both intracellular and extracellular ROS. Dihydroethidium (DHE) detects intracellular ROS, Amplex Red detects extracellular ROS, and MitoSOX detects mitochondrial ROS.
Table 1. Correlations between different assays of yeast redox potential.
Correlations (* denotes p<0.05) Amplex Dye Variable MitoSOX DHE mBCL DC-FDA Red Mitochondrial MitoSOX 1.00 0.62* -0.36 -0.20 0.56* superoxide production Reactive oxygen DHE 1.00 0.67* -0.23* 0.34* species: superoxide Amplex Release of hydrogen 1.00 0.55* -0.08 Red peroxide Low MW thiols, mBCL 1.00 -0.28* including glutathione Hydroxyl, peroxyl, and DC-FDA 1.00 other ROS species
Gravitational and Space Research Volume 3 (2) Dec 2015 49 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Results from Table 1 suggest DC-FDA and 2012b; Nislow et al., 2015): Sok2 (defective mBCL are not only not concordant, but even trend ammonia production), Sfp1 (deleted shear stress towards an inverse relationship. The next promoter), and Msn4 (deleted shear stress experiments were designed to verify that DC- promoter) after seven days of culture as colonies FDA (used to detect reactive oxygen species) and on YPD agar. These clones were selected for the mBCL (used to detect glutathione) are measuring present validation studies in anticipation of future different substances in the cells. Figure 6 shows experiments to define the signaling pathways for the intensity of the two dyes when used to stain redox changes in microgravity. The non-linear WT and a battery of deletion strains implicated in scatter pattern verifies the two dyes are measuring microgravity and/or redox responses (Cap et al., different targets in the yeast.
Figure 6. Comparison of DC-FDA and mBCL signal in different clones of yeast. mBCL (400 µM final; horizontal axis) or DC-FDA (10 µM final; vertical axis) were used to stain a series of different yeast clones: WT, Sok2Δ (defective ammonia production), Sfp1Δ (deleted shear stress promoter), and Msn4Δ (deleted shear stress promoter), grown on YPD agar for 7 days. Values are the mean of six replicate determinations made by flow cytometry and are presented as arbitrary fluorescence units.
unknown, and as fluorescent probes respond to DISCUSSION physiological conditions, quench at different rates Because fluorescent probes are easy to in response to different substrates, and suffer measure, have a broad dynamic range, and are spectral overlap when used in combination with commonly used in diverse cell types, there is a other probes, their utility for assays requires tendency to believe they are reliable, sensitive, validation (Smith et al., 2012). and specific. In reality, each fluorescent probe Assays of reactive oxygen species tend to must be validated for the application and cell type measure the general status of the cell with to which it is applied—the cellular uptake contributions from a variety of molecules, mechanisms are often poorly defined or entirely including: superoxide, hydroxyl radicals, and
50 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
various peroxide and hydro peroxides utilized to detect hydrogen peroxide (H2O2) and/or (Kalyanaraman et al., 2012). Due to their near peroxidase activity; there was no detectable instantaneous metabolism in the cell, H2O2 species correlation with the DC-FDA assay. This is not are challenging to measure and we must instead surprising given the extremely short life of H2O2 focus our efforts on the physiological milieu of and the prolonged loading time of DC-FDA secondary products (Kalyanaraman et al., 2012). (Kalyanaraman et al., 2012). It should be noted Oxidation of H2DCF to its fluorescent form that in some systems the rate of DC-FDA requires the presence of either cytochrome c, or of oxidation depends on the concentration of both redox-active transition metals and H2O2 glutathione, which is an alternative target for (Karlsson et al., 2010). When staining yeast reactive oxygen species (Jakubowski and Bartosz, grown in liquid YPD with DC-FDA, the protocol 2000). should include washing, but not so much as to mBCL also measures a variety of molecules deplete transition metals (Karlsson et al., 2010). as it reacts with several low molecular weight Several lines of evidence suggest that DC- thiols including: glutathione, N-acetylcysteine, FDA is an excellent indicator of general redox mercaptopurine, peptides, and plasma thiols status in yeast. It is taken up and cleaved to its (Lewicki et al., 2006). Intracellular reduced GSH fluorescent form with a linear time course, is by far the most abundant intracellular thiol and allowing for substantial dye loading and plays a key role in protecting cells from toxicity producing a broad dynamic range for as it maintains intracellular redox status measurements. The dye has low acute toxicity conjugating with electrophilic xenobiotics and and is well retained during one to four hours, free radicals and detoxifying reactive peroxides although some does leak out after prolonged (Jakubowski and Bartosz, 2000). Several lines of incubations, e.g., eight hours. Others have noted evidence suggest mBCL is an excellent indicator this slow leakage, but also concluded the leak is of thiols — predominantly glutathione — in yeast. slow enough to allow quantitative measurements It is taken up and forms a fluorescent conjugate (Jakubowski and Bartosz, 2000). By using DC- with a linear time course, allowing for substantial FDA and a microplate reader, one captures a dye loading, which produces a broad dynamic snapshot of ROS in all of its compartments — the range for measurements. The dye is well retained mitochondria, the cytoplasm, and ROS that was and is not acutely toxic to the cells, even during released into the extracellular medium. By prolonged dye loading for hours. The mBCL collecting the microplate data at four hours, we signal was NEM sensitive and correlated well are favoring the detection of intracellularly with the biochemical assay of Lewicki et al. converted DC-FDA. This data can be (2006). As glutathione plays a major role in complemented by the use of flow cytometry, cytosolic redox buffering, it was predictable that it which detects only cell-associated fluorescence should negatively correlate with the cytosolic while free dye is diluted away in the sheath fluid. DHE superoxide measures and Amplex Red As much of the reactive oxygen in cells is hydrogen peroxide measures, but not thought to be generated in mitochondria, it was mitochondrial superoxide production. In encouraging that DC-FDA measurements comparative studies of glutathione probes for flow correlated with the MitoSOX assay for cytometry use in neurons, mBCL has the lowest mitochondrial superoxide production. Unlike background and correlates well with glutathione MitoSOX, the DC-FDA correlation with DHE depletion (Hedley and Chow, 1994). The cell wall was also predictable, as DHE reports the cytosolic of yeast prevents known glutathione depletion contribution of superoxide to reactive oxygen reagents from entering the cells, meaning status. Unlike DC-FDA, DHE undergoes minimal depletion studies are not feasible in yeast (Hedley oxidation by cell-free peroxide (Kalyanaraman et and Chow, 1994). al., 2012) and thus is more specific for Several non-fluorescent methods — such as intracellular ROS. In contrast, when 10-acetyl- High Performance Liquid Chromatography 3,7-dihydroxyphenoxazine (Amplex Red reagent) (HPLC) or Nuclear Magnetic Resonance (NMR) in combination with horseradish peroxidase was — are available for measuring GSH and oxidized
Gravitational and Space Research Volume 3 (2) Dec 2015 51 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation glutathione (GSSH). They have some Veterans Health Administration. Contents do not disadvantages, including the need to generate represent the views of the Department of Veterans derivatives, lack of sufficient sensitivity to allow Affairs, NASA, or the United States of America. detection in small samples, and the inability to None of the authors have any commercial conveniently measure both GSH and GSSH associations that might create a conflict of (Lakritz et al., 1997). Alternatives — such as interest. high-performance liquid chromatography- electrochemical methods — reproducibly measure REFERENCES both GSH and GSSH (Lakritz et al., 1997). The Blackman RK, Cheung-Ong K, Gebbia M, Proia fluorescent methods, by allowing application of DA, He S, Kepros J, Jonneaux A, Marchetti flow cytometry, allow quantitative detection of P, Kluza J, Rao PE, Wada Y, Giaever G, subpopulations of cells and co-localization of Nislow C (2012) Mitochondrial electron markers. Development of redox-sensing transport is the cellular target of the oncology fluorescent proteins (redox probe proteins) has drug elesclomol. PLoS ONE 7: e29798 enabled live imaging of the physiological redox Bradamante S, Villa A, Versari S, Barenghi L, state within a cell (Oku and Sakai, 2012). These Orlandi I, Vai M (2010) Oxidative stress and include single fluorophore redox probes — such alterations in actin cytoskeleton trigger as roGFP and rxYFP proteins — and double glutathione efflux in Saccharomyces fluorescence resonance energy transfer (FRET)- cerevisiae. Biochimica et Biophysica Acta based redox probes (Oku and Sakai, 2012). Redox 1803: 1376-1385 probe proteins will likely be very useful for Cap M, Stepanek L, Harant K, Vachova L, microgravity studies when appropriate analysis Palkova Z (2012a) Cell differentiation within hardware is available during flight or on ground- a yeast colony: metabolic and regulatory based simulators. parallels with a tumor-affected organism. The plethora of fluorescent reagents for Molecular Cell 46: 436-448 reactive oxygen species and glutathione can be Cap M, Vachova L, Palkova Z (2012b) Reactive bewildering and makes head-to-head comparisons oxygen species in the signaling and of all the alternatives impractical (Hedley and adaptation of multicellular microbial Chow, 1994; Jakubowski and Bartosz, 2000; communities. Oxidative Medicine and Kalyanaraman et al., 2012). Understanding that Cellular Longevity 2012: 976753 these reagents measure the physiological milieu of Hedley DW, Chow S (1994) Evaluation of ROS and diverse thiols — rather than specific methods for measuring cellular glutathione content using flow cytometry. Cytometry 15: individual molecules — we conclude that in yeast, 349-358 mBCL and DC-FDA are suitable for fluorometric Jakubowski W, Bartosz G (2000) 2,7- and flow cytometry studies. Both dyes have low dichlorofluorescin oxidation and reactive background fluorescence, predictable loading, oxygen species: what does it measure? Cell good retention, and have low acute toxicity Biology International (CBI) 24: 757-760 towards S. cerevisiae. This report defines the way Kalyanaraman B, Darley-Usmar V, Davies KJ, forward for future studies of redox potentials in Dennery PA, Forman HJ, Grisham MB, yeast under real and simulated microgravity Mann GE, Moore K, Roberts LJ 2nd, conditions. Ischiropoulos H (2012) Measuring reactive oxygen and nitrogen species with fluorescent ACKNOWLEDGEMENTS probes: challenges and limitations. Free These studies were supported by NASA Grant Radical Biology & Medicine 52: 1-6 NNX13AN32G. This material is the result of Karlsson M, Kurz T, Brunk UT, Nilsson SE, work supported with resources and the use of Frennesson CI (2010) What does the facilities at the Durham Veterans Affairs Medical commonly used DCF test for oxidative stress Center, and the Office of Research and really show? Biochemical Journal 428: 183- Development, Department of Veterans Affairs, 190
52 Gravitational and Space Research Volume 3 (2) Dec 2015 Hammond et al. -- Measuring Redox Potential in Yeast during Microgravity Simulation
Lakritz J, Plopper CG, Buckpitt AR (1997) induces apoptosis in human cervical cancer Validated high-performance liquid Ca Ski cells via reactive oxygen species and chromatography-electrochemical method for Ca2+-dependent mitochondria-dependent determination of glutathione and glutathione pathway. Anticancer Research 28: 2791- disulfide in small tissue samples. Analytical 2799 Biochemistry 247: 63-68 Nislow C, Lee AY, Allen PL, Giaever G, Smith Lee AY, St Onge RP, Proctor MJ, Wallace IM, A, Gebbia M, Stodieck LS, Hammond JS, Nile AH, Spagnuolo PA, Jitkova Y, Gronda Birdsall HH, Hammond TG (2015) Genes M, Wu Y, Kim MK, Cheung-Ong K, Torres required for survival in microgravity NP, Spear ED, Han MK, Schlecht U, Suresh revealed by genome-wide yeast deletion S, Duby G, Heisler LE, Surendra A, Fung E, collections cultured during spaceflight. Urbanus ML, Gebbia M, Lissina E, Miranda BioMed Research International 2015: M, Chiang JH, Aparicio AM, Zeghouf M, 976458 Davis RW, Cherfils J, Boutry M, Kaiser CA, Oku M, Sakai Y (2012) Assessment of Cummins CL, Trimble WS, Brown GW, physiological redox state with novel FRET Schimmer AD, Bankaitis VA, Nislow C, protein probes. Antioxidants & Redox Bader GD, Giaever G (2014) Mapping the Signaling 16: 698-704 cellular response to small molecules using Sebastià J, Cristòfol R, Martín M, Rodríguez- chemogenomic fitness signatures. Science Farré E, Sanfeliu C (2003) Evaluation of 344: 208-211 fluorescent dyes for measuring intracellular Lewicki K, Marchand S, Matoub L, Lulek J, glutathione content in primary cultures of Coulon J, Leroy P (2006) Development of a human neurons and neuroblastoma SH- fluorescence-based microtiter plate method SY5Y. Cytometry Part A 51: 16-25 for the measurement of glutathione in yeast. Smith AM, Durbic T, Kittanakom S, Giaever G, Talanta 70: 876-882 Nislow C (2012) Barcode sequencing for Lin YT, Yang JS, Lin SY, Tan TW, Ho CC, Hsia understanding drug-gene interactions. TC, Chiu TH, Yu CS, Lu HF, Weng YS, Methods in Molecular Biology 910: 55-69 Chung JG (2008) Diallyl disulfide (DADS)
Gravitational and Space Research Volume 3 (2) Dec 2015 53 Research Article
Mapping by VESGEN of Wing Vein Phenotype in Drosophila for Quantifying Adaptations to Space Environments
Patricia Parsons-Wingerter1*, Ravikumar Hosamani1, Mary B. Vickerman2, and Sharmila Bhattacharya1§
1Ames Research Center, National Aeronautics and Space Administration (NASA), Moffett Field, CA; 2John H. Glenn Research Center, National Aeronautics and Space Administration (NASA), Cleveland, OH
ABSTRACT Vascular patterning is a key, genetically antagonist Hairless (Johannes and Preiss, responsive phylogenetic classifier of tissues in 2002) were mapped and quantified by major organisms flown in space, such as the NASA’s VESsel GENeration Analysis wings of Drosophila melanogaster (the fruit (VESGEN) software. By several confirming fly), mouse retina, and leaves of Arabidopsis vascular parameters, the eight stereotyped thaliana. Phenotypes of increasingly wing veins remained quite constant in wild abnormal ectopic wing venation in the highly type compared to Class 5 H-C2, the most stereotyped Drosophila wing generated by perturbed category of the H-C2 overexpressing the H-C2 construct of Notch overexpression phenotypes. However, ectopic veins increased in number from 1 in the wild Key words: Drosophila melanogaster; Wing; type, to 18 in Class 5 H-C2. We therefore Venation; VESGEN; Spaceflight; Genetics; demonstrate the feasibility of using VESGEN Gravity; Vein Patterning; Fruit Fly to quantify microscopic images of altered wing venation in Drosophila melanogaster. Correspondence to: Patricia Parsons-Wingerter* Space Biosciences Research Branch (SCR) We further determined that several of the Mailstop N236-7 signal transduction pathways affecting wing Vascular Analysis Laboratory R212 vein patterning were altered by spaceflight, Ames Research Center according to gene expression differences National Aeronautics and Space Administration observed in our transcriptomic data from a Moffett Field, CA 94035-1000 previous shuttle flight experiment. Future Telephone: 650-604-1729 studies will help characterize the extent to E-mail: [email protected] which these gene expression changes can Sharmila Bhattacharya§ cause even subtle developmental changes Ames Research Center using model organisms, such as Drosophila. National Aeronautics and Space Administration Therefore, we propose that the sensitive Moffett Field, CA 94035-1000 analyses provided by VESGEN software will Telephone: 650-604-1531 not only serve as a useful tool to map the E-mail: [email protected] genetics of wing vein patterning for terrestrial *Corresponding Author for VESGEN Vascular applications, but also for future phenotypic Analysis studies with Drosophila for spaceflight § Corresponding Author for Drosophila missions. melanogaster and Genetics
54 Gravitational and Space Research Volume 3 (2) Dec 2015 Parsons-Wingerter et al. -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
INTRODUCTION The fruit fly, Drosophila melanogaster, is phenotypes may reflect gene expression a major model organism for space responses to environmental alterations. Thus, experiments (Benguria et al., 1996; Ikenaga et we investigated the potential relevance to al., 1997; Le Bourg, 1999; Marcu et al., 2011; wing venation patterning from gene Taylor et al., 2014) because of its expression changes reported in Drosophila susceptibility to targeted mutation, ease of larvae and female adults from previous culture, small size, short life span, ability to spaceflight data (Marcu et al., 2011). While it fly, and sequenced genome (Adams et al., is yet to be tested whether these levels of gene 2000). Approximately 75% of known human expression changes induced by travel to low genetic diseases can be matched with genes of Earth orbits will result in changes in wing the fruit fly (Pandey and Nichols, 2011; Reiter vein patterning after spaceflight, future et al., 2001). Only a handful of higher longer-duration deep space missions, coupled organisms (e.g., the fruit fly, mouse (Mus with significantly higher backgrounds of musculus), zebrafish (Danio rerio), ionizing radiation, could result in much transparent nematode (Caenorhabditis greater perturbations to biological organisms. elegans), and thale cress (Arabidopsis Therefore, model organisms such as thaliana)) have been identified that are Drosophila will be important to assess the relatively convenient for targeted single effects of these novel spaceflight mutations. All of these model organisms that environments as a precursor to long-term are of critical importance to terrestrial deep space exploration by humans. Miquel biomedical and developmental biology and Philpott (1978) observed blistered and research are also important in space biology tattered wings on Drosophila specimens for investigating genetic and physiological returned from space on a Soviet Satellite response to space stressors, such as Cosmos 936, and Drosophila flight remains microgravity, radiation, and engineered an active area of research (Costa et al., 2014; environmental factors, such as temperature Fry et al., 2003). and light. A series of increasingly severe pheno- Venation patterning in the wings of types in Drosophila wing venation (Johannes Drosophila is highly stereotyped (i.e., and Preiss, 2002) was mapped and quantified identical among individual flies). Venation by the VESGEN software (Chen et al., 2013; development is highly responsive to genetic Vickerman et al., 2009; Zamanian-Daryoush manipulation and results from precise, multi- et al., 2013) as a step toward developing step coordination of signaling by the Notch, methods suitable for testing whether gene epidermal growth factor receptor (EGFR), expression changes seen in spaceflight could Decapentaplegic (Dpp), Hedgehog (Hh), Wnt, affect wing vein phenotypes. Abnormal Wingless (Wg), and possibly other pathways ectopic veins that resulted from during the overall process of Drosophila overexpressing the H-C2 construct of Notch development (reviewed by Blair, 2007; De antagonist Hairless (H) \, which contains a Celis, 2003). We therefore hypothesize the deletion of the binding domain to Suppressor Drosophila wing and its venation phenotypes of Hairless [Su(H)], were quantified using our may provide sensitive, quantified readouts of software. The VESGEN software was the effects of environmental factors originally developed to analyze human and encountered during spaceflight when mapped vertebrate vascular remodeling according to and quantified by NASA’s VESsel specific physiological rules, such as vessel GENeration Analysis (VESGEN) software. In bifurcation and tapering, but is now being general, Drosophila development is a highly expanded to the analysis of vessel patterning choreographed process requiring the precise in major tissues of other experimental expression of a series of temporally and organisms, such as the Drosophila wing and spatially expressed cues. Modified venation Arabidopsis leaf.
Gravitational and Space Research Volume 3 (2) Dec 2015 55 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
METHODS process or from genetic manipulations are easily identified. By common nomenclature, Drosophila Wing Venation adult wing venation (Figure 1) is composed of Because venation patterning in the five major longitudinal veins (LVs, L1-L5); Drosophila wing is stereotyped (Blair, 2007), two smaller abbreviated veins (L0 and L6); ectopic (additional) veins resulting from and three cross veins (CVs), the anterior and perturbations to the normal developmental posterior CVs (ACV and PCV) that
Figure 1. Mappings by VESGEN of increasing ectopic wing venation from variable overexpression of Hairless (H-C2). (Left Column, images reproduced from Johannes and Preiss, 2002) Venation in the adult Drosophila wing generated by overexpression of H-C2 (Classes 1-5) is compared to wild type (Class 0). We have labeled stereotyped vessels in the wild type according to the terminology of these authors and Blair, 2007. Asterisks indicate sensitive, variable regions identified by Johannes and Preiss, 2002, where ectopic veins can arise by H-C2 overexpression. Class 0 (wild type), no ectopic veins; Class 1 (H-C2), ectopic veins in distal region of the costal cells between LV1 and LV2; Class 2 (H-C2), ectopic veins distal between LV1 and LV2 and close to LV5 in marginal cells; Class 3 (H-C2), increased branching of ectopic veins with vein dots between LV4 and LV5; Class 4 (H-C2), increased branching and detachment of posterior CV from LV5; and Class 5 (H-C2), massive network of ectopic veins and veinlets. (Right Column) Maps generated by VESGEN compare stereotyped venation (red) with ectopic venation (orange).
56 Gravitational and Space Research Volume 3 (2) Dec 2015 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila bridge L3-L4 and L4-L5 and humeral cross arrays using standard Affymetrix protocols. vein (HCV) that connects L0 with the anterior Six sets of larval arrays and three sets of adult wing margin. Terminology for the anterior arrays were used as repeats to provide marginal vein is more variable. The statistical validation. Differentially expressed circulatory system in insects and other genes were identified by fitting the moderated arthropods is open (Tögel et al., 2013), unlike t-test linear model to the data (separately for the closed circulation of vertebrates. each gene). Bayesian smoothing was used to Hemolymph, the arthropod analogue of control the number of arrays. The False vertebrate blood, is pumped by peristaltic Discovery Rate (FDR) criterion introduced by muscular contractions from the dorsal vessel Benjamini and Hochberg (1995) was applied (heart) and supported by accessory pulsatile to p-values to control the FDR during multiple organs like the wing vein heart, which ensures testing. FDR adjusted p-values are reported. circulation in the wing appendage. Except for The significance threshold used for FDR was the veins, however, the adult wing is 5% (0.05). Lists of differentially expressed composed of dead cuticle. genes were compiled using conditional hyper- We chose to analyze wing venation from geometric testing and computing p-values for the study by Johannes and Preiss (2002) due overrepresentation of genes in all GO terms. to the clarity of both the images and the VESGEN Mapping and Quantification progression of increasingly abnormal phenotypes within the series. These vein Vascular patterns are first mapped and mutations are relatively subtle. Although then quantified by the automated, user- important for research on metazoan interactive VESGEN software to generate morphogenesis, greater extremes in deformed major vessel parameters that include vessel wing and venation phenotypes are less diameter (Dv), fractal dimension (Df), and relevant to developing sensitive analysis densities of vessel area (Av), length (Lv), methods for subtle changes induced by life number (Nv), and branch point (Brv). support and spaceflight factors. To briefly Grayscale images of venation pattern within summarize the study by Johannes and Preiss the wing (Figure 1) were digitally acquired by (2002), Hairless (H) is known to antagonize high-resolution screen capture from a PDF of Notch signaling by binding to the Notch the paper by Johannes and Preiss (2002), post- signal transducer, Suppressor of Hairless processed into black/white (binary) images, [Su(H)]. Deletion of the Su(H)-binding and analyzed with the VESGEN Vascular domain in a transgenic construct, denoted H- Tree-Network option as described previously C2, results in loss of H activity. (Vickerman et al., 2009). Our results are Overexpression of H-C2 (Figure 1, Class 1 to reported in dimensions of pixels (px) because 5) by varying the copy number and heat shock a scale factor was not provided for the (hs) induction levels of the hs promoter of the original images. Because venation patterning H-C2 transgene generated the phenotypes of in the normal adult Drosophila wing is so increasing ectopic venation. stereotyped, the basic aim guiding our vessel classification approach was to differentiate Gene Expression Analyses from Drosophila between stereotyped (normal) veins and the Spaceflight-reared larvae and adult ectopic (abnormal or additional) veins. samples were collected, processed, and Images were cut digitally just to the right of analyzed as described previously by Marcu et the humeral cross vein prior to analysis by al. (2011). Briefly, the Gal4-UAS transgenic VESGEN because our study focused on line of D. melanogaster that expresses two ectopic veins appearing in the distal regions of copies of eGFP under the control of the the wing; the original grayscale images of hemolectin promoter was used in all Johannes and Preiss (2002) were sometimes experiments. cut off to the left of the humeral cross vein. RNA samples were processed and Marginal veins were not included in our hybridized to Drosophila 2.0 Affymetrix present study.
Gravitational and Space Research Volume 3 (2) Dec 2015 57 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
RESULTS category, only the stereotyped PCV is incomplete. However, for ectopic veins in the Increasingly severe ectopic venation in wild type compared to Class 5 H-C2, N the adult Drosophila wing resulting from H- v increased from 1 to 18 and L increased from C2 overexpression are compared to v 0.0004 to 0.0095 px-px2. A , L , and N for stereotyped venation in the wild type with v v v vascular maps generated by VESGEN (Figure ectopic vessels in Class 5 H-C2 are 24, 42, 1). Vascular parameters measured by the and 18 greater than wild type. Johannes and software within the vascular maps confirm Preiss (2002) then used this ectopic-vein that abnormal ectopic venation is greatly phenotype to identify several more genes increased in the Class 5 H-C2 phenotype, involved in Notch and EGF signaling by compared to wild type (Table 1). screening for genetic modifiers of the Interestingly, results by VESGEN also phenotype. Therefore, VESGEN provides a demonstrate that in contrast to ectopic sensitive tool that can be used to analyze venation, the stereotyped venation patterning Drosophila wing vein phenotypes of genetic is quite equivalent in the wild type and Class mutants terrestrially. We hope to use VESGEN in future spaceflight studies to 5 phenotype. For example, Av and Lv for stereotyped Class 5 vessels are 1.03 and investigate whether wing vein patterns are altered, since data from a previous spaceflight 1.13 relative to wild type (e.g., L =0.0250 v mission indicates significant changes in and 0.0257 px-px-2 for stereotyped vessels, expression of genes that influence wing vein respectively). In the Class 5 phenotypic development and patterning.
Table 1. Overexpression of Hairless (H-C2) induces an ectopic vein phenotype in the adult Drosophila wing, but does not significantly affect stereotyped venation patterning. Stereotyped and ectopic wing venation resulting from overexpression of H-C2 (Johannes and Preiss, 2002) was -2 quantified by VESGEN in vascular maps (Figure 1) to obtain densities of vessel length (Lv, px px ), 2 -2 -2 vessel area (Av, px px ), and vessel number (Nv, px ). Results for the wild type and Class 5 wing are reproduced here. Wing Veins Ectopic Veins Phenotype Lv Av Lv Av Nv
Wild type 0.0250 0.0789 0.0004 0.0006 1
Class 5 veins 0.0257 0.0892 0.0095 0.0254 18 Comparison to wild type 1.03 1.13 24 42 18
Microarray data analyzed by us from both fold change; p-value-0.00). Similarly, larvae and adult flies returned from space expression of rhomboid 7 (-0.7 fold; p-value- suggest significant changes in genes related to 0.00) and aveugle (-0.8 fold; p-value-0.00) wing vein development that include the was significantly down-regulated in space- EGFR, Notch, Hh, Wg, and Dpp signaling returned adult flies, compared to ground pathways (Table 2 and Table 3), compared to control. For the case of space-returned larvae, ground control samples. Expression of however, expression of ash2 (absent, small, or Smoothened, a gene that possesses Hh homeotic discs 2) was significantly up- receptor activity, was significantly down- regulated (+0.6 fold; p-value-0.00). regulated in space-returned adult flies (-0.8
58 Gravitational and Space Research Volume 3 (2) Dec 2015 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
Table 2. Changes in mRNA expression of selected genes in space returned 3rd instar larvae that are involved in wing development.
Fold Gene Name p-value Biological Processes Change Imaginal disc-derived wing hair organization and vrille -1.30 0.00 (CG14029) biogenesis Absent, small, or Imaginal disc-derived wing morphogenesis; homeotic discs 2 Imaginal disc-derived wing vein specification; +0.60 0.00 or ash2 Phenotypes of alleles manifest in wing vein L3, (CG6677) wing margin CTP:phospho- choline cytidylyl +0.60 0.00 Imaginal disc-derived wing morphogenesis transferase 1 (CG1049) Imaginal disc-derived wing morphogenesis; Pox neuro -0.60 0.00 Phenotypes of alleles manifest in ventral wing (CG8246) blade Notch signaling pathway; Phenotypes of alleles Bx42 +0.50 0.00 (CG8264) manifest in anterior cross vein
DISCUSSION AND CONCLUSIONS The goals of our Methods study are confirms observations by Johannes and Preiss twofold. Our first goal is to demonstrate the that the stereotyped patterning of wing mapping and quantification methodology of venation was preserved as an essentially normal stereotyped and abnormal ectopic equivalent patterning in all H-C2 specimens, vessel patterning in the Drosophila wing by despite the increasingly severe phenotypes of VESGEN analysis. Our second goal is to additional ectopic venation. Our second justify the relevance of future studies on the finding with the VESGEN analysis was that response of Drosophila wing venation increasingly severe phenotypes of ectopic patterning to the stresses of space wing venation increased quantitatively in both environments, in part by analyzing gene vessel number and density, as was previously expression data from our previous spaceflight observed qualitatively by Johannes and Preiss. experiment. Our third finding was that many of the The first finding by VESGEN for our genes altered by spaceflight, and previously Methods study is that the stereotypical reported by one of the authors in our present patterning of Drosophila wing venation was study (Marcu et al., 2011), are also known to not significantly altered in successively severe be involved in the development of wing ectopic phenotypes (Figure 1; Table 1). venation (Blair, 2007). Developmental Quantification of both stereotyped and programs of Drosophila respond sensitively to abnormal ectopic venation in the Drosophila environmental factors, in which normal veins wing were generated by VESGEN from can be lost due to failure in maintenance. increasingly severe phenotypes produced Blistered and tattered wings upon return of previously by varying expression conditions Drosophila specimens from spaceflight have of H-C2 construct of the Notch antagonist been reported previously (Miquel and Hairless (Johannes and Preiss, 2002). Philpott, 1978). Imaginal wing discs are Insightful quantification by VESGEN defined during embryogenesis and form
Gravitational and Space Research Volume 3 (2) Dec 2015 59 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
Table 3. Changes in mRNA expression of various genes of signaling pathways across wing disc and vein development in adult female flies.
Fold Gene Name p-value Biological Processes Change Epidermal Growth Factor Receptor (EGFR) Signaling Pathway stem cell tumor -1.50 0.00 EGFR signaling pathway; Wing vein (CG33166) morphogenesis; Phenotypes of alleles manifest in wing vein aveugle -0.80 0.00 EGFR signaling pathway; (CG30476) Phenotypes of alleles manifest in wing vein and wing disc rhomboid-4 +0.70 0.00 EGFR signaling pathway; Phenotypes of alleles (CG1697) manifest in wing and wing vein rhomboid-7 -0.70 0.00 EGFR signaling pathway; (CG8972) Expressed in developing wing veins pointed +0.80 0.00 EGFR signaling pathway; (CG17077) Imaginal disc-derived wing morphogenesis Notch Signaling Pathway Sp1070 +2.20 0.00 Negative regulation of Notch signaling pathway; (CG9138) Notch binding bunched +1.90 0.00 Negative regulation of Notch signaling pathway; (CG5461) Phenotypes of alleles manifest in wing discs brainiac -0.90 0.00 Notch signaling pathway (CG4934) shibire +2.10 0.00 Positive regulation of Notch signaling pathway; (CG18102) Wing vein extension; Veined wing generated song production Hedgehog Receptor Activity Smoothened -0.80 0.00 Negative regulation of Notch signaling pathway; (CG11561) Wing disc anterior/posterior pattern formation; Smoothened signaling pathway Other discs overgrown +0.80 0.00 Establishment of imaginal disc-derived wing hair (CG2048) orientation piopio +1.50 0.00 Apposition of dorsal and ventral imaginal disc- (CG2079) derived wing surfaces; Imaginal disc-derived wing morphogenesis held out wings +0.90 0.00 Apposition of dorsal and ventral imaginal disc- (CG10293) derived wing surfaces penguin -0.80 0.00 Apposition of dorsal and ventral imaginal disc- (CG1685) derived wing surfaces guftagu +0.70 0.00 Imaginal disc-derived wing morphogenesis (CG11861) Downstream of -1.10 0.00 Imaginal disc-derived wing morphogenesis; kinase (CG2079) Phenotypes of alleles manifest in wing glut4EF +1.30 0.00 Imaginal disc-derived wing morphogenesis; (CG34360) Phenotypes of alleles manifest in wing
60 Gravitational and Space Research Volume 3 (2) Dec 2015 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila mature discs during larval development. As in future spaceflight missions different wild summarized previously, the main regulators type and sensitized mutant background lines of wing disc development are epidermal could be flown to investigate the use of growth factor receptor (EGF), Notch, altered wing venation in offspring developed Hedgehog (Hh), Wingless (Wg), and the in space as a phenotypic measure/readout by Decapentaplegic (Dpp) signaling pathways VESGEN of spaceflight-induced stress. The (Blair, 2007). VESGEN software will allow a careful We report here significant changes in analysis of the response of Drosophila wing genes related to these specific pathways from venation to space environments and other microarray data of both larvae and adult flies factors, such as space radiation, since these returned from space, compared to ground effects have not yet been systematically control samples (Tables 2 and 3). Although mapped and quantified. Other interesting most of these genes play a vital role in wing software measures wing venation landmarks disc-derived wing morphogenesis and wing and wing shape related to sexual dimorphism vein morphogenesis, their exact role in vein (Kunkel and Bettencourt, 2011) or patterning as phenotypic responses to Drosophilid species (Houle et al., 2003). The spaceflight environments is not yet clear. VESGEN approach is distinguished by an However, vein pattern formation starts in the automated, insightful grouping of vascular imaginal disc and progressively depends on characteristics that have been used extensively Hedgehog, EGF, and DPP signaling pathways to map other similar patterns. (Bier, 2000). For instance, Hedgehog pathway Previously perturbed vascular patterns regulates the positioning of longitudinal veins, mapped by VESGEN include: mouse such as L3 and L4 (Blair, 2007). Expression coronary and intestinal vessels (Liu et al., of the gene Smoothened, which possesses 2009; Parsons-Wingerter and Reinecker, Hedgehog receptor activity, was significantly 2012; Vickerman et al., 2009), Arabidopsis down-regulated in space-returned adult flies. leaf venation (Parsons-Wingerter et al., 2014), Expression of rhomboid-7 and aveugle was the avian chorioallantoic membrane also significantly down-regulated in space- (Vickerman et al., 2009), and the human and returned adult flies compared to ground mouse retinas (Parsons-Wingerter et al., 2010; control; rhomboid and aveugle are critical in Vickerman et al., 2009). We propose that EGF-regulated stereotypical vein patterning. VESGEN mappings of healthy or pathological Previous studies have shown that mutations in adaptations in vascular patterning to space the rhomboid gene inhibit vein development environmental factors by major genetic and disrupt vein patterning (Brentrup et al., organisms, such as Drosophila, offer 2000). In the case of space-returned larvae, sensitive, quantifiable phenotypic read-outs expression of ash2 (absent, small, or homeotic that help to integrate the many molecular discs 2) was also significantly up-regulated, signals generated by complex, interacting suggesting possible changes in intervein cell genetic pathways. Furthermore, analysis by fate that determines intervein patterning. VESGEN of the response of wing venation Our spaceflight data further indicate that patterning in the Drosophila model to various several genes whose expression patterns are types of terrestrial environmental stressors, as important for wing vein patterning are altered well as studies of different genetic mutants, at different stages of development during can be useful for terrestrial research on spaceflight. While genomic data from the developmental, environmental, and other prepupal stage are not available, and the biomedical applications. prepupae is thought to be a phenocritical stage for wing vein patterning, data from ACKNOWLEDGEMENTS spaceflight returned adult flies and late third This work was supported by NASA grant instar larvae indicate changes in expression of NNH09ZTT003N/FSB09PROP-0022 to key components of the Hedgehog, EGF, and Sharmila Bhattacharya and NASA Space Life related pathways. Therefore, it is possible that
Gravitational and Space Research Volume 3 (2) Dec 2015 61 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila and Physical Sciences Program for Patricia Shen H, Shue BC, Sidén-Kiamos I, Parsons-Wingerter. Simpson M, Skupski MP, Smith T, Spier E, Spradling AC, Stapleton M, Strong R, REFERENCES Sun E, Svirskas R, Tector C, Turner R, Adams MD, Celniker SE, Holt RA, Evans Venter E, Wang AH, Wang X, Wang CA, Gocayne JD, Amanatides PG, ZY,Wassarman DA, Weinstock GM, Scherer SE, Li PW, Hoskins RA, Galle Weissenbach J, Williams SM, RF, George RA, Lewis SE, Richards WoodageT, Worley KC, Wu D, Yang S, S,Ashburner M, Henderson SN, Sutton Yao QA, Ye J, Yeh RF, Zaveri JS, Zhan GG, Wortman JR, Yandell MD, Zhang M, Zhang G, Zhao Q, Zheng L, Zheng Q, Chen LX, Brandon RC, Rogers YH, XH, Zhong FN, Zhong W, Zhou X, Zhu Blazej RG, Champe M, Pfeiffer BD, S, Zhu X, Smith HO, Gibbs RA, Myers Wan KH,Doyle C, Baxter EG, Helt G, EW, Rubin GM, Venter JC (2000) The Nelson CR, Gabor GL, Abril JF, genome sequence of Drosophila Agbayani A, An HJ, Andrews- melanogaster. Science 287: 2185-2195 Pfannkoch C, Baldwin D, Ballew RM, Benguria A, Grande E, de Juan E, Ugalde C, Basu A, Baxendale J,Bayraktaroglu L, Miquel J, Garesse R, Marco R (1996) Beasley EM, Beeson KY, Benos PV, Microgravity effects on Drosophila Berman BP, Bhandari D, Bolshakov S, melanogaster behavior and aging. Borkova D, Botchan MR, Bouck J, Implications of the IML-2 experiment. Brokstein P, Brottier P, Burtis Journal of Biotechnology 47: 191-201 KC,Busam DA, Butler H, Cadieu E, Benjamini Y, Hochberg Y (1995) Controlling Center A, Chandra I, Cherry JM, Cawley the false discovery rate: a practical and S, Dahlke C, Davenport LB, Davies P, powerful approach to multiple testing. de Pablos B, Delcher A, Deng Z, Mays Journal of the Royal Statistical Society AD, Dew I, Dietz SM, Dodson K, Doup Series B(57): 289-300 LE, Downes M, Dugan-Rocha S, Bier E (2000) Drawing lines in the Dunkov BC, Dunn P, Durbin KJ, Drosophila wing: initiation of wing vein Evangelista CC, Ferraz C, Ferriera S, development. Current Opinion in Fleischmann W, Fosler C,Gabrielian AE, Genetics and Development 10: 393-398 Garg NS, Gelbart WM, Glasser K, Blair SS (2007) Wing vein patterning in Glodek A, Gong F, Gorrell JH, Gu Z, Drosophila and the analysis of Guan P, Harris M, Harris NL, Harvey D, intercellular signaling. Annual Review of Heiman TJ, Hernandez JR, Houck J, Cell and Developmental Biology 23: Hostin D, Houston KA, Howland TJ, 293-319 Wei MH, Ibegwam C, Jalali M, Kalush Brentrup D, Lerch H, Jackle H, Noll M (2000) F, Karpen GH, Ke Z, Kennison JA, Regulation of Drosophila wing vein Ketchum KA, Kimmel BE, Kodira CD, patterning: net encodes a bHLH protein Kraft C,Kravitz S, Kulp D, Lai Z, Lasko repressing rhomboid and is repressed by P, Lei Y, Levitsky AA, Li J, Li Z, Liang rhomboid-dependent EGFR signaling. Y, Lin X, Liu X, Mattei B, McIntosh TC, Development 127: 4729-4741 McLeod MP, McPherson D, Merkulov Chen X, Yang G, Song JH, Xu H, Li D, G, Milshina NV,Mobarry C, Morris J, Goldsmith J, Zeng H, Parsons-Wingerter Moshrefi A, Mount SM, Moy M, PA, Reinecker HC, Kelly CP (2013) Murphy B, Murphy L, Muzny DM, Probiotic yeast inhibits VEGFR Nelson DL, Nelson DR, Nelson KA, signaling and angiogenesis in intestinal Nixon K, Nusskern DR, Pacleb inflammation. PLOS ONE 8: e64227 JM,Palazzolo M, Pittman GS, Pan S, Costa M, Calleja M, Alonso CR, Simpson P Pollard J, Puri V, Reese MG, Reinert K, (2014) The bristle patterning genes hairy Remington K, Saunders RD, Scheeler F, and extramacrochaetae regulate the development of structures required for
62 Gravitational and Space Research Volume 3 (2) Dec 2015 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
flight in Diptera. Developmental Biology Miquel J, Philpott DE (1978) Effects of 388(2): 205-215 Weightlessness on the Genetics and De Celis JF (2003) Pattern formation in the Aging of Drosophila melanogaster (COS Drosophila wing: the development of the 936-5). NASA Technical Memorandum veins. BioEssays: News and Reviews in Number 78526 Molecular, Cellular, and Developmental Pandey UB, Nichols CD (2011) Human Biology 25: 443-451 disease models in Drosophila Fry SN, Sayaman R, Dickinson MH (2003) melanogaster and the role of the fly in The aerodynamics of free-flight therapeutic drug discovery. maneuvers in Drosophila. Science 300: Pharmacological Reviews 63: 411-436 495-498 Parsons-Wingerter P, Radhakrishnan K, Houle D, Mezey J, Galpern P, Carter A Vickerman MB, Kaiser PK (2010) (2003) Automated measurement of Oscillation of angiogenesis with vascular Drosophila wings. BioMed Central dropout in diabetic retinopathy by (BMC) Evolutionary Biology 3: 25 VESsel GENeration Analysis Ikenaga M, Yoshikawa I, Kojo M, Ayaki T, (VESGEN). Investigative Ophthalmo- Ryo H, Ishizaki K, Kato T, Yamamoto logy and Visual Science 51: 498-507 H, Hara R (1997) Mutations induced in Parsons-Wingerter P, Reinecker HC (2012) Drosophila during spaceflight. For application to human spaceflight and Biological Sciences in Space 11: 346- ISS experiments: VESGEN mapping of 350 microvascular network remodeling Johannes B, Preiss A (2002) Wing vein during intestinal inflammation. formation in Drosophila melanogaster: Gravitational and Space Research 26: 2- hairless is involved in the cross-talk 12 between Notch and EGF signaling Parsons-Wingerter P, Vickerman MB, Paul A- pathways. Mechanisms of Development L, Ferl RJ (2014) Mapping by VESGEN 115: 3-14 of leaf venation patterning in Kunkel JG, Bettencourt BR (2011) Arabidopsis with bioinformatic Transformer-2 controls subtle sexually dimensions of gene expression. dimorphic features in Drosophila Gravitational and Space Research 2: 68- melangoaster wing development. Online 81 manuscript: http://bcrc.bio.umass.edu/fly Reiter LT, Potocki L, Chien S, Gribskov M, club/kunkel/kunkel_bettencourt/index.ht Bier E (2001) A systematic analysis of ml (Accessed December 17, 2015) human disease-associated gene Le Bourg E (1999) A review of the effects of sequences in Drosophila melanogaster. microgravity and of hypergravity on Genome Research 11: 1114-1125 aging and longevity. Experimental Taylor K, Kleinhesselink K, George MD, Gerontology 34: 319-336 Morgan R, Smallwood T, Hammonds Liu H, Yang Q, Radhakrishnan K, Whitfield AS, Fuller PM, Saelao P, Alley J, Gibbs DE, Everhart CLM, Parsons-Wingerter AG, Hoshizaki DK, von Kalm L, Fuller P, Fisher SA (2009) Role of VEGF and CA, Beckingham KM, Kimbrell DA tissue hypoxia in patterning of neural and (2014) Toll mediated infection response vascular cells recruited to the embryonic is altered by gravity and spaceflight in heart. Developmental Dynamics 238: Drosophila. PLOS ONE 9(1): e86485 2760-2769 Tögel M, Pass G, Paululat A (2013) In vivo Marcu O, Lera MP, Sanchez ME, Levic E, imaging of Drosophila wing heart Higgins LA, Shmygelska A, Fahlen TF, development during pupal stages. The Nichol H, Bhattacharya S (2011) Innate International Journal of Developmental immune responses of Drosophila Biology 57: 13-24 melanogaster are altered by spaceflight. PLOS ONE 6: e15361
Gravitational and Space Research Volume 3 (2) Dec 2015 63 Parsons-Wingerter et al -- Mapping by VESGEN of Wing Vein Phenotype in Drosophila
Vickerman MB, Keith PA, McKay TL, Zamanian-Daryoush M, Lindner D, Tallant Gedeon DJ, Watanabe M, Montano M, TC, Wang Z, Buffa J, Klipfell E, Parker Karunamuni G, Kaiser PK, Sears JE, Y, Hatala D, Parsons-Wingerter P, Ebrahem Q, Ribita D, Hylton AG, Rayman P, Yusufishaq MSS, Fisher EA, Parsons-Wingerter P (2009) VESGEN Smith JD, Finke J, DiDonato JA, Hazen 2D: automated, user-interactive software SL (2013) The cardioprotective protein for quantification and mapping of apolipoprotein A1 promotes potent anti- angiogenic and lymphangiogenic trees tumorigenic effects. The Journal of and networks. The Anatomical Record Biological Chemistry 288: 21237-21252 292: 320-332
64 Gravitational and Space Research Volume 3 (2) Dec 2015 Index of Authors
Allen, Patricia L...... 42 Kamotani, Yasuhiro ...... 30
Bhattacharya, Sharmila ...... 54 Lee, Kuan-Lin ...... 30
Birdsall, Holly H...... 42 Li, Yeyuan ...... 30
Cannon, Ashley E...... 3 Parsons-Wingerter, Patricia ...... 54
Clark, Gregory ...... 3 Roux, Stanley ...... 3
Cook, C. Adam ...... 20 Salmi, Mari L...... 3
Guzek, Brian J...... 30 Shen, Kaiyu ...... 20
Hammond, Timothy G...... 42 Tucker, Avery ...... 20
Hosamani, Ravikumar ...... 54 Vickerman, Mary B...... 54
Kadambi, Jaikrishnan R...... 30 Wyatt, Sarah E...... 20
Gravitational and Space Research Volume 3 (2) Dec 2015 65