Dynamic, Stage-Course Protein Interaction Network Using High
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genome-Wide Analysis of 5-Hmc in the Peripheral Blood of Systemic Lupus Erythematosus Patients Using an Hmedip-Chip
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 35: 1467-1479, 2015 Genome-wide analysis of 5-hmC in the peripheral blood of systemic lupus erythematosus patients using an hMeDIP-chip WEIGUO SUI1*, QIUPEI TAN1*, MING YANG1, QIANG YAN1, HUA LIN1, MINGLIN OU1, WEN XUE1, JIEJING CHEN1, TONGXIANG ZOU1, HUANYUN JING1, LI GUO1, CUIHUI CAO1, YUFENG SUN1, ZHENZHEN CUI1 and YONG DAI2 1Guangxi Key Laboratory of Metabolic Diseases Research, Central Laboratory of Guilin 181st Hospital, Guilin, Guangxi 541002; 2Clinical Medical Research Center, the Second Clinical Medical College of Jinan University (Shenzhen People's Hospital), Shenzhen, Guangdong 518020, P.R. China Received July 9, 2014; Accepted February 27, 2015 DOI: 10.3892/ijmm.2015.2149 Abstract. Systemic lupus erythematosus (SLE) is a chronic, Introduction potentially fatal systemic autoimmune disease characterized by the production of autoantibodies against a wide range Systemic lupus erythematosus (SLE) is a typical systemic auto- of self-antigens. To investigate the role of the 5-hmC DNA immune disease, involving diffuse connective tissues (1) and modification with regard to the onset of SLE, we compared is characterized by immune inflammation. SLE has a complex the levels 5-hmC between SLE patients and normal controls. pathogenesis (2), involving genetic, immunologic and envi- Whole blood was obtained from patients, and genomic DNA ronmental factors. Thus, it may result in damage to multiple was extracted. Using the hMeDIP-chip analysis and valida- tissues and organs, especially the kidneys (3). SLE arises from tion by quantitative RT-PCR (RT-qPCR), we identified the a combination of heritable and environmental influences. differentially hydroxymethylated regions that are associated Epigenetics, the study of changes in gene expression with SLE. -
Evidence for Differential Alternative Splicing in Blood of Young Boys With
Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling. -
For Reference Only
Datasheet Version: 1.0.0 Revision date: 05 Nov 2020 Histone H3R2me2a Antibody Catalogue No.:abx000029 Western blot analysis of extracts of various cell lines, using Asymmetric Dimethyl-Histone H3- R2 antibody (abx000029). Dot-blot analysis of various methylation peptides using Asymmetric Dimethyl-Histone H3-R2 antibody (abx000029). Immunofluorescence analysis of 293T cells using Asymmetric Dimethyl-Histone H3-R2 antibody (abx000029). Blue: DAPI for nuclear staining. Histone H3R2me2a Antibody is a Rabbit Polyclonal antibody against Histone H3R2me2a. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. TranscriptsFor from this Reference gene lack polyA tails; instead, they contain a palindromic Only termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3. Target: Histone H3R2me2a Clonality: Polyclonal Reactivity: Human, Mouse, Rat v1.0.0 Abbexa Ltd, Cambridge, UK · Phone: +44 1223 755950 · Fax: +44 1223 755951 1 Abbexa LLC, Houston, TX, USA · Phone: +1 832 327 7413 www.abbexa.com · Email: [email protected] Datasheet Version: 1.0.0 Revision date: 05 Nov 2020 Tested Applications: WB, IHC, IF/ICC, IP, ChIP Host: Rabbit Recommended dilutions: WB: 1/500 - 1/2000, IHC: 1/50 - 1/200, IF/ICC: 1/50 - 1/200, IP: 1/50 - 1/200, ChIP: 1/20 - 1/100, ChIPseq: 1/20 - 1/100. -
Supp Material.Pdf
Simon et al. Supplementary information: Table of contents p.1 Supplementary material and methods p.2-4 • PoIy(I)-poly(C) Treatment • Flow Cytometry and Immunohistochemistry • Western Blotting • Quantitative RT-PCR • Fluorescence In Situ Hybridization • RNA-Seq • Exome capture • Sequencing Supplementary Figures and Tables Suppl. items Description pages Figure 1 Inactivation of Ezh2 affects normal thymocyte development 5 Figure 2 Ezh2 mouse leukemias express cell surface T cell receptor 6 Figure 3 Expression of EZH2 and Hox genes in T-ALL 7 Figure 4 Additional mutation et deletion of chromatin modifiers in T-ALL 8 Figure 5 PRC2 expression and activity in human lymphoproliferative disease 9 Figure 6 PRC2 regulatory network (String analysis) 10 Table 1 Primers and probes for detection of PRC2 genes 11 Table 2 Patient and T-ALL characteristics 12 Table 3 Statistics of RNA and DNA sequencing 13 Table 4 Mutations found in human T-ALLs (see Fig. 3D and Suppl. Fig. 4) 14 Table 5 SNP populations in analyzed human T-ALL samples 15 Table 6 List of altered genes in T-ALL for DAVID analysis 20 Table 7 List of David functional clusters 31 Table 8 List of acquired SNP tested in normal non leukemic DNA 32 1 Simon et al. Supplementary Material and Methods PoIy(I)-poly(C) Treatment. pIpC (GE Healthcare Lifesciences) was dissolved in endotoxin-free D-PBS (Gibco) at a concentration of 2 mg/ml. Mice received four consecutive injections of 150 μg pIpC every other day. The day of the last pIpC injection was designated as day 0 of experiment. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
Anti-Histone H3 (Mono Methyl K4) Polyclonal Antibody (CABT-LM00401) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
Anti-Histone H3 (mono methyl K4) polyclonal antibody (CABT-LM00401) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description Modulation of chromatin structure plays an important role in the regulation of transcription in eukaryotes. The nucleosome, made up of DNA wound around eight core histone proteins (two each of H2A, H2B, H3, and H4), is the primary building block of chroma Target Histone H3K4me2 Immunogen A synthetic methylated peptide corresponding to residues surrounding K4 of human histone H3 Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Antibodies were produced by immunizing rabbits and were purified by antigen affinity- chromatography. Conjugate Unconjugated Applications WB,IHC,IF,IP,ChIP Molecular Weight 15kDa Format Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Preservative 0.02% Sodium Azide Storage Store at -20°C or -80°C. Avoid freeze / thaw cycles. GENE INFORMATION Gene Name HIST3H3 histone cluster 3, H3 [ Homo sapiens (human) ] Official Symbol HIST3H3 Synonyms HIST3H3; histone cluster 3, H3; H3 histone family, member T , H3FT, histone 3, H3; histone H3.1t; H3/g; H3t; H3/t; histone 3, H3; H3 histone family, member T; H3.4; H3FT; MGC126886; MGC126888; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Entrez Gene ID 8290 Protein Refseq NP_003484 UniProt ID Q16695 Chromosome Location 1q42 Pathway Alcoholism; Cell Cycle; Cellular Senescence; Cellular responses to stress; Chromosome Maintenance; DNA Damage/Telomere Stress Induced Senescence; EGFR1 Signaling Pathway; FSH signaling pathway; Meiosis; Meiotic Recombination; Meiotic Synapsis; Packaging O Function DNA binding; protein binding; protein heterodimerization activity References 1. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
The Conserved DNMT1-Dependent Methylation Regions in Human Cells
Freeman et al. Epigenetics & Chromatin (2020) 13:17 https://doi.org/10.1186/s13072-020-00338-8 Epigenetics & Chromatin RESEARCH Open Access The conserved DNMT1-dependent methylation regions in human cells are vulnerable to neurotoxicant rotenone exposure Dana M. Freeman1 , Dan Lou1, Yanqiang Li1, Suzanne N. Martos1 and Zhibin Wang1,2,3* Abstract Background: Allele-specifc DNA methylation (ASM) describes genomic loci that maintain CpG methylation at only one inherited allele rather than having coordinated methylation across both alleles. The most prominent of these regions are germline ASMs (gASMs) that control the expression of imprinted genes in a parent of origin-dependent manner and are associated with disease. However, our recent report reveals numerous ASMs at non-imprinted genes. These non-germline ASMs are dependent on DNA methyltransferase 1 (DNMT1) and strikingly show the feature of random, switchable monoallelic methylation patterns in the mouse genome. The signifcance of these ASMs to human health has not been explored. Due to their shared allelicity with gASMs, herein, we propose that non-tradi- tional ASMs are sensitive to exposures in association with human disease. Results: We frst explore their conservancy in the human genome. Our data show that our putative non-germline ASMs were in conserved regions of the human genome and located adjacent to genes vital for neuronal develop- ment and maturation. We next tested the hypothesized vulnerability of these regions by exposing human embryonic kidney cell HEK293 with the neurotoxicant rotenone for 24 h. Indeed,14 genes adjacent to our identifed regions were diferentially expressed from RNA-sequencing. We analyzed the base-resolution methylation patterns of the predicted non-germline ASMs at two neurological genes, HCN2 and NEFM, with potential to increase the risk of neurodegenera- tion. -
17 - 19 October 2019
THE 12TH INTERNATIONAL SYMPOSIUM ON HEALTH INFORMATICS AND BIOINFORMATICS T G T A A A T G A G A A G T T G G G T A A A A A A A A T T T A A A A A A G G A A A A A A A G G G G G G G G A A A G G G G G G T T G G G G G G G T T T T G G T T G G G T T T G G T A A T T G G T T T A A A A A A A A T T T A A A A A A T T A A A A A A A T A T T T T T T A A A T T T T G T A G A A T T T A A 17 - 19 OCTOBER 2019 HIBIT 2019 ABSTRACT BOOK THE 12TH INTERNATIONAL SYMPOSIUM ON HEALTH INFORMATICS AND BIOINFORMATICS TABLE OF CONTENTS 1 8 WELCOME MESSAGE KEYNOTE LECTURERS 2 19 ORGANIZING COMMITEE INVITED SPEAKERS 3 29 SCIENTIFIC COMMITEE SELECTED ABSTRACTS FOR ORAL PRESENTATIONS 6 61 PROGRAM POSTER PRESENTATIONS Welcome Message The International Symposium on Health Informatics and Bioinformatics, (HIBIT), now in its twelfth year HIBIT 2019, aims to bring together academics, researchers and practitioners who work in these popular and fulfilling areas and to create the much- needed synergy among medical, biological and information technology sectors. HIBIT is one of the few conferences emphasizing such synergy. -
A Mutation in Histone H2B Represents a New Class of Oncogenic Driver
Author Manuscript Published OnlineFirst on July 23, 2019; DOI: 10.1158/2159-8290.CD-19-0393 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A Mutation in Histone H2B Represents A New Class Of Oncogenic Driver Richard L. Bennett1, Aditya Bele1, Eliza C. Small2, Christine M. Will2, Behnam Nabet3, Jon A. Oyer2, Xiaoxiao Huang1,9, Rajarshi P. Ghosh4, Adrian T. Grzybowski5, Tao Yu6, Qiao Zhang7, Alberto Riva8, Tanmay P. Lele7, George C. Schatz9, Neil L. Kelleher9 Alexander J. Ruthenburg5, Jan Liphardt4 and Jonathan D. Licht1 * 1 Division of Hematology/Oncology, University of Florida Health Cancer Center, Gainesville, FL 2 Division of Hematology/Oncology, Northwestern University 3 Department of Cancer Biology, Dana Farber Cancer Institute and Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School 4 Department of Bioengineering, Stanford University 5 Department of Molecular Genetics and Cell Biology, The University of Chicago 6 Department of Chemistry, Tennessee Technological University 7 Department of Chemical Engineering, University of Florida 8 Bioinformatics Core, Interdisciplinary Center for Biotechnology Research, University of Florida 9 Department of Chemistry, Northwestern University, Evanston IL 60208 Running title: Histone mutations in cancer *Corresponding Author: Jonathan D. Licht, MD The University of Florida Health Cancer Center Cancer and Genetics Research Complex, Suite 145 2033 Mowry Road Gainesville, FL 32610 352-273-8143 [email protected] Disclosures: The authors have no conflicts of interest to declare Downloaded from cancerdiscovery.aacrjournals.org on September 27, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 23, 2019; DOI: 10.1158/2159-8290.CD-19-0393 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. -
Supp Table 6.Pdf
Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin -
Successful Implementation of Chip-Seq Quality Control At
Successful implementation of ChIP-seq Quality Control at Diagenode using automated ChIP protocol on the SX-8G IP-Star® Compact Jan Hendrickx, Géraldine Goens, Catherine D’andrea, Ignacio Mazon, Geoffrey Berguet, Sharon Squazzo, Céline Sabatel, Miklos Laczik, Dominique Poncelet. Diagenode sa, CHU, Tour GIGA B34, 3ème étage 1 Avenue de l’Hôpital, 4000 Liège, Sart-Tilman, Belgium Introduction Results Figure 3 ZNF12 Chromatin immunoprecipitation (ChIP) is the most widely used method to study protein-DNA We have validated 19 of the Diagenode ChIP-grade antibodies using ChIP-seq (see table 1). interactions. A successful ChIP, however, is largely depending on the use of well characterised, Scale 100 kb Figure 1 shows the profiles obtained with antibodies against (1) H3K4me3, H3K9ac and H3K9/14ac, chr7: 6620000 6630000 6640000 6650000 6660000 6670000 6680000 6690000 6700000 6710000 6720000 6730000 6740000 6750000 6760000 6770000 6780000 6790000 6800000 highly specific ChIP-grade antibodies. histone modifications that are present at active promoters, (2) H3K4me2 which is surrounding 35 - We have established a robust QC procedure to be able to provide researchers with the highest quality promoters of active genes, (3) H3K79me3 present at promoters of active genes and extending into H3K9me3 ChIP-grade antibodies. The recent development of high throughput sequencing (HTS) technologies the gene body, and (4) H3K36me3, present at the gene bodies of active genes. The screenshots below 1 _ has also opened new possibilities for epigenetic research. ChIP followed by HTS (ChIP-seq) enables show the peak distribution along the complete X-chromosome and in a 75 kb region surrounding the C7orf26 AK123300 ZNF12 PMS2CL RSPH10B C7orf26 ZNF12 RSPH10B the extension of the target directed analysis of ChIP results to a genome wide analysis.