Pro-Inflammatory Cytokines Drive Deregulation of Potassium Channel Expression in Primary Synovial 2 Fibroblasts 3 4 Omar Haidar1, Nathanael O'neill1, Caroline A
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Potassium Channels in Epilepsy
Downloaded from http://perspectivesinmedicine.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Potassium Channels in Epilepsy Ru¨diger Ko¨hling and Jakob Wolfart Oscar Langendorff Institute of Physiology, University of Rostock, Rostock 18057, Germany Correspondence: [email protected] This review attempts to give a concise and up-to-date overview on the role of potassium channels in epilepsies. Their role can be defined from a genetic perspective, focusing on variants and de novo mutations identified in genetic studies or animal models with targeted, specific mutations in genes coding for a member of the large potassium channel family. In these genetic studies, a demonstrated functional link to hyperexcitability often remains elusive. However, their role can also be defined from a functional perspective, based on dy- namic, aggravating, or adaptive transcriptional and posttranslational alterations. In these cases, it often remains elusive whether the alteration is causal or merely incidental. With 80 potassium channel types, of which 10% are known to be associated with epilepsies (in humans) or a seizure phenotype (in animals), if genetically mutated, a comprehensive review is a challenging endeavor. This goal may seem all the more ambitious once the data on posttranslational alterations, found both in human tissue from epilepsy patients and in chronic or acute animal models, are included. We therefore summarize the literature, and expand only on key findings, particularly regarding functional alterations found in patient brain tissue and chronic animal models. INTRODUCTION TO POTASSIUM evolutionary appearance of voltage-gated so- CHANNELS dium (Nav)andcalcium (Cav)channels, Kchan- nels are further diversified in relation to their otassium (K) channels are related to epilepsy newer function, namely, keeping neuronal exci- Psyndromes on many different levels, ranging tation within limits (Anderson and Greenberg from direct control of neuronal excitability and 2001; Hille 2001). -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Fiorio Pla Gkika2019 Rev Nohighlights
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institutional Research Information System University of Turin Ca2+ channels toolkit in Neuroendocrine tumors Alessandra Fiorio Pla1, 2, 3* and Dimitra Gkika2, 3 1 Department of Life Science and Systems Biology, University of Torino, Turin, Italy. 2 Université de Lille, Inserm U1003, PHYCEL laboratory and Villeneuve d’Ascq, France. 3 Laboratory of Excellence, Ion Channels Science and Therapeutics, Université de Lille, Villeneuve d’Ascq, France. Short Title: Ca2+ channels in Neuroendocrine tumors *Corresponding Author Alessandra Fiorio Pla Department of Life Science and Systems Biology University/Hospital Via Accademia Albertina 13 Torino, 10123, Italy Tel: +390116704660 E-mail: [email protected] Keywords: Neuroendocrine tumors, Ca2+ signals, ion channels. Abstract Neuroendocrine tumors (NET) constitute an heterogenous group of malignancies with various clinical presentations and growth rates but all rising from neuroendocrine cells located all over the body. NET present a relatively low frequency disease being mostly represented by gastroenteropancreatic (GEP) and bronchopulmonary tumors (pNET); on the other hand an increasing frequency and prevalence has been associated to NET. Beside the great effort of the latest years, management of NET is still a critical unmet point due to the lack in the knowledge of the biology of the disease, lack of adequate biomarkers, late presentation, the relative insensitivity of imaging modalities and a paucity of predictably 1 effective treatment options. In this context Ca2+ signals, being pivotal molecular devices in sensing and integrating signals from the microenvironment, are emerging to be particularly relevant in cancer, where they mediate interactions between tumor cells and the tumor microenvironment to drive different aspects of neoplastic progression (e.g. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Potassium Channels in Peripheral Pain Pathways: Expression, Function and Therapeutic Potential
Send Orders for Reprints to [email protected] Current Neuropharmacology, 2013, 11, 621-640 621 Potassium Channels in Peripheral Pain Pathways: Expression, Function and Therapeutic Potential Xiaona Du1,* and Nikita Gamper1,2,* 1Department of Pharmacology, Hebei Medical University, Shijiazhuang, China; 2Faculty of Biological Sciences, University of Leeds, Leeds, UK Abstract: Electrical excitation of peripheral somatosensory nerves is a first step in generation of most pain signals in mammalian nervous system. Such excitation is controlled by an intricate set of ion channels that are coordinated to produce a degree of excitation that is proportional to the strength of the external stimulation. However, in many disease states this coordination is disrupted resulting in deregulated peripheral excitability which, in turn, may underpin pathological pain states (i.e. migraine, neuralgia, neuropathic and inflammatory pains). One of the major groups of ion channels that are essential for controlling neuronal excitability is potassium channel family and, hereby, the focus of this review is on the K+ channels in peripheral pain pathways. The aim of the review is threefold. First, we will discuss current evidence for the expression and functional role of various K+ channels in peripheral nociceptive fibres. Second, we will consider a hypothesis suggesting that reduced functional activity of K+ channels within peripheral nociceptive pathways is a general feature of many types of pain. Third, we will evaluate the perspectives of pharmacological enhancement of K+ channels in nociceptive pathways as a strategy for new analgesic drug design. + + Keywords: K channel/ M channel/ two-pore K channel/ KATP channel/ Dorsal root ganglion/ Pain/ Nociception. INTRODUCTION TRPV1 [4] while strong mechanical stimulation activates mechanosensitive channels which can be Piezo2 [5]. -
The Chondrocyte Channelome: a Novel Ion Channel Candidate in the Pathogenesis of Pectus Deformities
Old Dominion University ODU Digital Commons Biological Sciences Theses & Dissertations Biological Sciences Summer 2017 The Chondrocyte Channelome: A Novel Ion Channel Candidate in the Pathogenesis of Pectus Deformities Anthony J. Asmar Old Dominion University, [email protected] Follow this and additional works at: https://digitalcommons.odu.edu/biology_etds Part of the Biology Commons, Molecular Biology Commons, and the Physiology Commons Recommended Citation Asmar, Anthony J.. "The Chondrocyte Channelome: A Novel Ion Channel Candidate in the Pathogenesis of Pectus Deformities" (2017). Doctor of Philosophy (PhD), Dissertation, Biological Sciences, Old Dominion University, DOI: 10.25777/pyha-7838 https://digitalcommons.odu.edu/biology_etds/19 This Dissertation is brought to you for free and open access by the Biological Sciences at ODU Digital Commons. It has been accepted for inclusion in Biological Sciences Theses & Dissertations by an authorized administrator of ODU Digital Commons. For more information, please contact [email protected]. THE CHONDROCYTE CHANNELOME: A NOVEL ION CHANNEL CANDIDATE IN THE PATHOGENESIS OF PECTUS DEFORMITIES by Anthony J. Asmar B.S. Biology May 2010, Virginia Polytechnic Institute M.S. Biology May 2013, Old Dominion University A Dissertation Submitted to the Faculty of Old Dominion University in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY BIOMEDICAL SCIENCES OLD DOMINION UNIVERSITY August 2017 Approved by: Christopher Osgood (Co-Director) Michael Stacey (Co-Director) Lesley Greene (Member) Andrei Pakhomov (Member) Jing He (Member) ABSTRACT THE CHONDROCYTE CHANNELOME: A NOVEL ION CHANNEL CANDIDATE IN THE PATHOGENESIS OF PECTUS DEFORMITIES Anthony J. Asmar Old Dominion University, 2017 Co-Directors: Dr. Christopher Osgood Dr. Michael Stacey Costal cartilage is a type of rod-like hyaline cartilage connecting the ribs to the sternum. -
KCNMB3 (NM 171830) Human Untagged Clone – SC306700
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC306700 KCNMB3 (NM_171830) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: KCNMB3 (NM_171830) Human Untagged Clone Tag: Tag Free Symbol: KCNMB3 Synonyms: BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_171830, the custom clone sequence may differ by one or more nucleotides ATGTTCCCCCTTCTTTATGAGCTCACTGCAGTATCTCCTTCTCCCTTTCCCCAAAGGACAGCCTTTCCTG CCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCTGCCATC CAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATGTTCTTC TTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCACTGCCA TCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGGTCAGGG GAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACATTATAAT GAAGAGGCTGTCCAGATAAATCCCAAGTGCTTTTACACACCTAAGTGCCACCAAGATAGAAATGATTTGC TCAACAGTGCTCTGGACATAAAAGAATTCTTCGATCACAAAAATGGAACCCCCTTTTCATGCTTCTACAG TCCAGCCAGCCAATCTGAAGATGTCATTCTTATAAAAAAGTATGACCAAATGGCTATCTTCCACTGTTTA TTTTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGCATGGTGAGATTAACACAACACCTGT CCTTACTGTGTGAAAAATATAGCACTGTAGTCAGAGATGAGGTAGGTGGAAAAGTACCTTATATAGAACA GCATCAGTTCAAACTGTGCATTATGAGGAGGAGCAAAGGAAGAGCAGAGAAATCTTAA Restriction Sites: SgfI-MluI ACCN: NM_171830 -
Screening of 109 Neuropeptides on Asics Reveals No Direct Agonists
www.nature.com/scientificreports OPEN Screening of 109 neuropeptides on ASICs reveals no direct agonists and dynorphin A, YFMRFamide and Received: 7 August 2018 Accepted: 14 November 2018 endomorphin-1 as modulators Published: xx xx xxxx Anna Vyvers, Axel Schmidt, Dominik Wiemuth & Stefan Gründer Acid-sensing ion channels (ASICs) belong to the DEG/ENaC gene family. While ASIC1a, ASIC1b and ASIC3 are activated by extracellular protons, ASIC4 and the closely related bile acid-sensitive ion channel (BASIC or ASIC5) are orphan receptors. Neuropeptides are important modulators of ASICs. Moreover, related DEG/ENaCs are directly activated by neuropeptides, rendering neuropeptides interesting ligands of ASICs. Here, we performed an unbiased screen of 109 short neuropeptides (<20 amino acids) on fve homomeric ASICs: ASIC1a, ASIC1b, ASIC3, ASIC4 and BASIC. This screen revealed no direct agonist of any ASIC but three modulators. First, dynorphin A as a modulator of ASIC1a, which increased currents of partially desensitized channels; second, YFMRFamide as a modulator of ASIC1b and ASIC3, which decreased currents of ASIC1b and slowed desensitization of ASIC1b and ASIC3; and, third, endomorphin-1 as a modulator of ASIC3, which also slowed desensitization. With the exception of YFMRFamide, which, however, is not a mammalian neuropeptide, we identifed no new modulator of ASICs. In summary, our screen confrmed some known peptide modulators of ASICs but identifed no new peptide ligands of ASICs, suggesting that most short peptides acting as ligands of ASICs are already known. Acid-sensing ion channels form a small family of proton-gated ion channels that belongs to the degenerin/epi- thelial Na+ channel (DEG/ENaC) gene family1. -
Identification of Key Genes and Pathways Involved in Response To
Deng et al. Biol Res (2018) 51:25 https://doi.org/10.1186/s40659-018-0174-7 Biological Research RESEARCH ARTICLE Open Access Identifcation of key genes and pathways involved in response to pain in goat and sheep by transcriptome sequencing Xiuling Deng1,2†, Dong Wang3†, Shenyuan Wang1, Haisheng Wang2 and Huanmin Zhou1* Abstract Purpose: This aim of this study was to investigate the key genes and pathways involved in the response to pain in goat and sheep by transcriptome sequencing. Methods: Chronic pain was induced with the injection of the complete Freund’s adjuvant (CFA) in sheep and goats. The animals were divided into four groups: CFA-treated sheep, control sheep, CFA-treated goat, and control goat groups (n 3 in each group). The dorsal root ganglions of these animals were isolated and used for the construction of a cDNA= library and transcriptome sequencing. Diferentially expressed genes (DEGs) were identifed in CFA-induced sheep and goats and gene ontology (GO) enrichment analysis was performed. Results: In total, 1748 and 2441 DEGs were identifed in CFA-treated goat and sheep, respectively. The DEGs identi- fed in CFA-treated goats, such as C-C motif chemokine ligand 27 (CCL27), glutamate receptor 2 (GRIA2), and sodium voltage-gated channel alpha subunit 3 (SCN3A), were mainly enriched in GO functions associated with N-methyl- D-aspartate (NMDA) receptor, infammatory response, and immune response. The DEGs identifed in CFA-treated sheep, such as gamma-aminobutyric acid (GABA)-related DEGs (gamma-aminobutyric acid type A receptor gamma 3 subunit [GABRG3], GABRB2, and GABRB1), SCN9A, and transient receptor potential cation channel subfamily V member 1 (TRPV1), were mainly enriched in GO functions related to neuroactive ligand-receptor interaction, NMDA receptor, and defense response. -
Ion Channels 3 1
r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia.