Juntendo Medical Journal ISSN 2187－9737 CODEN：JIZUA2 61（4）350―472（2015）
順天堂醫 事雑誌
August 2015
61－ 4 What’s New from Juntendo University, Tokyo C
urrent Research Topics in Tropical Diseases; Towards Successful Control and Elimination Screening for Sleep Disordered Breathing (SDB) in Truck Drivers in the US Hiroo Wada, et al. Santosh Nigam Memorial “Outstanding Young Scientist” Award Takehiko Yokomizo A Report of the 1st Symposium and the 2nd Workshop on Intractable Itch in Juntendo University Mitsutoshi Tominaga, et al.
Current Topics: Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Introduction Toshihiro Mita Preclinical Studies on a New Vaccine Formulation of BK―SE36, a Malaria Vaccine Candidate Nirianne Marie Q. Palacpac, et al. Founded Challenging Malaria Control: Do Our New Genetic Tools Pave the Way for Malaria Eradication? in 1875 Makoto Hirai, et al. Elimination of Lymphatic Filariasis: Roles of Research, International Cooperation, and Participation of Endemic Community Making an Unprecedented Global Program to Eliminate the Neglected Disease into a Reality Eisaku Kimura Current Situation of Chagas Disease in Non―Endemic Countries Takeshi Nara, et al. An Overview of Ebola Virus Disease: History, Pathogenesis, and Treatment Norio Yamamoto The Current Situation of Dengue Research Takeshi Kurosu
Original Articles An Overview of Dialysis Treatment in Juntendo Tokyo Koto Geriatric Medical Center During the First Ten Years of Operation: a Comparison with a Nationwide Statistical Survey in Japan at the End of 2012 Kazuhiko Funabiki, et al. Clinical Significance of Renal Interstitial Fibrosis in Patients with Lupus Nephritis Daisuke Honda, et al. Effectiveness of Interdisciplinary Team Conference to Manage Skeletal Related Events in u.21 The Juntendo Medical Society Aug. 2015 Rehabilitation for Patients with Cancer Yasuko Hayashi, et al.
Juntendo Research Profiles Department of Immunology, Department of Pediatrics and Adolescent Medicine, Department of Anesthesiology and Pain Medicine, Department of Clinical Laboratory Medicine, Department of Esophageal & Gastroenterological Surgery, Department of Breast and Endocrine Surgery (Breast Center), Department of Cardiovascular Surgery, Department of General Thoracic Surgery, Department of Urology, Department of Transfusion Medicine and Stem Cell Regulation
Publication List Publications from Juntendo University Graduate School of Medicine, 2013 [2/6]
The Juntendo Medical Society 2－1－1 Hongo Bunkyo-ku, Tokyo, 113－8421 JAPAN Tel：+81－3－5802－1586 E-mail：[email protected] Juntendo Medical Journal Vol. 61 No. 4 p. 350－472 Tokyo 2015. 8 61－4 （897th issue） 順天堂醫事雑誌
Editor-in-Chief: Isao Nagaoka
Editorial Board: Machiko Hatsuda Eri Hirasawa Toshiaki Iba Kazuo Kaneko Shunsuke Kato Hiroyuki Kobayashi Seiki Konishi Ryohei Kuwatsuru Takashi Miida Toshihiro Mita Sachiko Miyake Akira Murakami Masanori Nagaoka Takumi Ochiai Kazuhisa Takahashi Robert F Whittier Kazuhito Yokoyama
Illustration: Akiko Miyamichi
The History of Juntendo Medical Journal This Juntendo Medical Journal has been published under the Japanese name Juntendo Igaku (順天堂医学) from 1964 to 2012. However, the origin of Juntendo Medical Journal dates back to the oldest medical journal in Japan, Juntendo Iji Zasshi (順天堂醫事雑誌), which had been published between 1875 and 1877 (total of 8 issues). Between 1885 and 1886, Juntendo issued a limited release of a research journal titled Houkoku [Juntendo Iji Kenkyukai](報告) for a total of 39 issues. In 1887, Juntendo Iji Kenkyukai Houkoku (順天堂醫事研究會報告) was published with the governmentʼs approval and we used to regard this as the first issue of Juntendo Medical Journal. Since then, Juntendo Medical Journal has undergone a series of name changes: Juntendo Iji Kenkyukai Zasshi (順天堂醫事研究会 雑誌), Juntendo Igaku Zasshi (順天堂医学雑誌), and Juntendo Igaku (順天堂医学). Now in commemoration of the 175th anniversary of Juntendo University, starting with the first volume issued in 2013 (Volume 59 Number 1), we return to Juntendo Medical Journalʼs original Japanese title in 1875-Juntendo Iji Zasshi (順天堂醫事雑誌). We also reconsidered the numbering of the journal and set the first issue in 1875 as the initial publication of Juntendo Medical Journal. The Volume-Number counting system and the English name Juntendo Medical Journal started in 1955 from the January 10 issue. Although this is not our intension, we will retain the Volume-Number counting system to avoid confusion. However, Volume 59 Number 1 will be the 882nd issue, reflecting the sum of all issues to date: 8 issues of Juntendo Iji Zasshi (順天堂醫事雑誌), 39 issues of Houkoku [Juntendo Iji Kenkyukai](報告)(47 issues combined), and 834 issues from Juntendo Iji Kenkyukai Houkoku (順天堂醫事研究會報告) in 1887 to the present. 出典：小川秀興（OGAWA Hideoki, M.D., Ph.D.）：順天堂醫事雑誌（Juntendo Medical Journal）2013；59：6-10.
本誌は昭和39年（1964年）から平成24年（2012年）末まで『順天堂医学』として刊行されてきた．しかし， その起源は明治8年（1875年）から10年（1877年）にかけて発刊された日本最古の医学誌『順天堂醫事雑誌』 （計8巻）にある．さらに明治18年（1885年）から19年（1886年）まで，会員限定配本として順天堂醫事研 究會の雑誌『報告』（計39集）が発行されている． その後『順天堂醫事研究會報告』が明治20年（1887年）に官許を受けて公刊されたので，順天堂ではこれ を通刊1号としてきた．以来，『順天堂醫事研究会雑誌』，『順天堂医学雑誌』，『順天堂医学』と名称を変更し て刊行されてきた． 今般，順天堂が創立175周年を迎える平成25年（2013年）の59巻1号を期して，本来の名称である『順天 堂醫事雑誌』と復刻し，その起源である明治8年（1875年）第1巻をもって創刊号（通刊第1号）とすること とした．従来の巻号と欧文誌名は，昭和30年（1955年）1月10日発行のものを1巻1号としており，欧文誌名 もこれより付け始めたもので不本意であるが，混乱を避けるためにこれらを継承する．ただし，通刊数は明 治8年（1875年）から19年（1886年）にかけて刊行された『順天堂醫事雑誌』8巻分と順天堂醫事研究會の雑 誌『報告』39集，計47巻分を通巻834号に加え，59巻1号を通刊882号とした． 出典：小川鼎三，酒井シヅ：順天堂医学 1980；26：414-418. 小川秀興：順天堂醫事雑誌 2013；59：6-10.
Published by The Juntendo Medical Society Printed by Shinkosha Printing Co. Ltd. 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan 19-2 Sarugaku-cho, Shibuya-ku, Tokyo 150-0033 Japan TEL 03-5802-1586 E-mail [email protected] TEL 03-3462-1182 E-mail [email protected] Ⓒ The Juntendo Medical Society 2015 Tokyo Japan 20150831 JUNTENDO MEDICAL JOURNAL Vol. 61 No. 4 (897th issue) August 2015
Contents
Whatʼs New from Juntendo University, Tokyo Screening for Sleep Disordered Breathing (SDB) in Truck Drivers in the US ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Hiroo Wada, et al. ㌀㌀㌀㌀㌀㌀㌀350 Santosh Nigam Memorial“Outstanding Young Scientist”Award ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Takehiko Yokomizo ㌀㌀㌀㌀㌀㌀㌀352 A Report of the 1 st Symposium and the 2 nd Workshop on Intractable Itch in Juntendo University ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Mitsutoshi Tominaga, et al. ㌀㌀㌀㌀㌀㌀㌀353
Current Topics: Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Introduction ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Toshihiro Mita ㌀㌀㌀㌀㌀㌀㌀358 Preclinical Studies on a New Vaccine Formulation of BK-SE36, a Malaria Vaccine Candidate ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Nirianne Marie Q. Palacpac, et al. ㌀㌀㌀㌀㌀㌀㌀360 Challenging Malaria Control: Do Our New Genetic Tools Pave the Way for Malaria Eradication? ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Makoto Hirai, et al. ㌀㌀㌀㌀㌀㌀㌀370 Elimination of Lymphatic Filariasis: Roles of Research, International Cooperation, and Participation of Endemic Community Making an Unprecedented Global Program to Eliminate the Neglected Disease into a Reality ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Eisaku Kimura ㌀㌀㌀㌀㌀㌀㌀378 Current Situation of Chagas Disease in Non-Endemic Countries ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Takeshi Nara, et al. ㌀㌀㌀㌀㌀㌀㌀389 An Overview of Ebola Virus Disease: History, Pathogenesis, and Treatment ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Norio Yamamoto ㌀㌀㌀㌀㌀㌀㌀396 The Current Situation of Dengue Research ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Takeshi Kurosu ㌀㌀㌀㌀㌀㌀㌀407
Original Articles An Overview of Dialysis Treatment in Juntendo Tokyo Koto Geriatric Medical Center During the First Ten Years of Operation: a Comparison with a Nationwide Statistical Survey in Japan at the End of 2012 ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Kazuhiko Funabiki, et al. ㌀㌀㌀㌀㌀㌀㌀413 Clinical Significance of Renal Interstitial Fibrosis in Patients with Lupus Nephritis ㌀㌀㌀㌀Daisuke Honda, et al. ㌀㌀㌀㌀㌀㌀㌀418 Effectiveness of Interdisciplinary Team Conference to Manage Skeletal Related Events in Rehabilitation for Patients with Cancer ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀Yasuko Hayashi, et al. ㌀㌀㌀㌀㌀㌀㌀426
Juntendo Research Profiles Department of Immunology ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀437 Department of Breast and Endocrine Surgery (Breast Department of Pediatrics and Adolescent Medicine Center) ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀444 ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀438 Department of Cardiovascular Surgery ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀446 Department of Anesthesiology and Pain Medicine Department of General Thoracic Surgery ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀448 ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀440 Department of Urology ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀450 Department of Clinical Laboratory Medicine ㌀㌀㌀㌀㌀㌀㌀㌀㌀442 Department of Transfusion Medicine and Stem Cell Department of Esophageal & Gastroenterological Regulation ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀452 Surgery ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀443
Publication List Publications from Juntendo University Graduate School of Medicine, 2013 [2/6] ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀453
Instruction to Authors ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀466 Editorʼs Note ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀471
The Juntendo Medical Society
From the illustrator: More than 30years have passed since I became fascinated with Okinawa, and I never grew tired of visiting there. The heat and humidity, characteristic smell, and nostalgic music. The moment I arrive at Naha Airport, they relax my mind and body. This time, I visited Okinawa Churaumi Aquarium for the first time (Akiko Miyamichi). Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2015. 61(4), 350-351 Screening for Sleep Disordered Breathing (SDB) in Truck Drivers in the US
HIROO WADA＊1),AI IKEDA-NODA＊1),STEFANOS KALES＊2),TAKESHI TANIGAWA＊1)
＊1) Department of Public Health, Juntendo University Graduate School of Medicine, Tokyo, Japan, ＊2) Harvard Medical School and Harvard School of Public Health, Boston, USA
On 9 th March 2015, Dr. KALES Stefanos, Associate Professor of Harvard Medical School and Harvard School of Public Health, visited the Juntendo University and gave a talk, entitled“Screening for sleep disordered breathing (SDB) in truck drivers in the US”(Figure-1). After Professor DAIDA Hiroyuki, Director of Juntendo University Hospital & Professor of Department of Cardiovascular Medicine, kindly introduced him with a warm-hearted welcoming speech, Dr. Kales started his talk by referring to the current situation in the US; obstructive sleep apnea (OSA), one of major diseases that cause SDB in the adult population, is characterized by excessive daytime sleepiness, psychomotor deficits, impaired vigilance, and sleep which is frequently disrupted by SDB. This constellation of symptoms increases the risk of traffic accidents. It was estimated that 10-30% of truck crashes are associated with driver fatigue/sleepiness. Similar issues are also shared by Japanese truck drivers, as the prevalence of SDB in truck drivers is estimated to be as high as 25% in both countries. Obesity is also a common risk for SDB, and furthermore, OSA is “under-recognized”in both countries. On the other hand, many Japanese truck drivers with SDB are not obese. Dr. Kales emphasized that screening for SDB in truck drivers is an urgent issue in the US, as well as in Japan, and he also described some potential future approaches to screening for SDB, using psychomotor vigilance test and driving simulator. In addition, he described standard occupational health and safety tools, including education, administrative controls, OSA screening, drug tests, driver monitors, and vehicle controls. By summarizing these various approaches, Dr. Kales proposed an overall approach, based on the“Swiss cheese model”:you may be able to look through one of many holes on a single slice of Swiss cheese, but you cannot do so through several layers of Swiss cheese slices in series (Swiss cheese model theory, Figure-2). Likewise, any one of the individual approaches to screening SDB cannot completely identify all individuals who are at high risk for traffic accidents. However, a combination of those tools could considerably decrease the risk of traffic accidents. Dr. Kalesʼs talk clearly depicted that SDB is socially under-recognized although it is one of the socially un-ignorable causes of traffic accidents, and effective diagnostic and therapeutic strategies are already established, suggesting that we can reduce traffic accidents now. Because the US and Japan share many common issues, Dr. Kales and Professor Tanigawa launched a global project to tackle SDB, attempting to reduce traffic accidents. We held a symposium last October at the Harvard School of Public Health in Boston and had a discussion of issues regarding why companies, governments and/or societies in both countries were reluctant to introduce more aggressive SDB screening programs. We are not describing it in detail here, but we, faculty members at both Juntendo and Harvard, will continue to work hand in hand to establish the evidence, showing that SDB screening is effective and can decrease accidents among truck drivers in both countries. Herein, it should be noted that International Association for Traffic and Safety Sciences (IATSS) supported not only the two meetings, one in Harvard School of Public Health and another in Juntendo University, but also the associated research project organized by Professor Tanigawa. The talk given by Dr. Kales attracted as much as 48 participants, even including two officers of the Traffic Bureau of the National Police Agency, which encouraged us greatly. Several medical students of Juntendo also joined the talk and enjoyed the discussion. We believe that this surely provided them with a unique opportunity to consider global issues and enlarge their horizons for their own future. Finally, we would like to express sincere gratitude to Professor OGAWA Hideoki, CEO, Juntendo University, who understood the significance of this meeting, kindly supported and encouraged us to organize this meeting in the desirable milieu in Century Tower, the Main Building of Juntendo University. Key words: OSA, SDB, Swiss cheese model, traffic accident, Harvard University
Corresponding author: Takeshi Tanigawa Department of Public Health, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-3813-3111 (ext. 3535) E-mail: [email protected] 〔Received May 5, 2015〕
350 Juntendo Medical Journal 61(4), 2015
Figure-1 A scene in Dr. Kalesʼ talk on 9 March 2015
Excess Hours, Poor Rest Driver Sleep Disorder Alcohol, Drug, Medication Vehicle Issue Road or Other Driver Issue Synergistic Exposures Crash Exposed Driver OSA Screening
Prevention Requires a Hierarchy of Controls
Exposed Driver No Crash Driver Monitors OSA Screening Vehicle Controls PVT, Driver Sim. Education/Admin Drug/Alcohol Tests
Proposed Control Hierarchy－Adapted from Reason’s Swiss Cheese Model Figure-2 Swiss Cheese Model using a combination of SDB screening and mitigation tools
351 Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2014. 61(4), 352 Santosh Nigam Memorial“Outstanding Young Scientist”Award
TAKEHIKO YOKOMIZO＊
＊Department of Molecular and Cellular Biochemistry, Juntendo University Graduate School of Medicine, Tokyo, Japan
“The awardee of Santosh Nigam Memorial Outstanding Young Scientist Award is Dr. Min Liu from Juntendo University, Tokyo!”This announcement reached our ears at the party on the Danube River, Hungary. Min Liu, who was sitting next to me, was almost crying upon hearing this announcement. Probably she was remembering the long tough days we spent preparing to publish our exciting data in a Journal 1). This international conference on lipid mediators is held every two years at various locations in the world, and this year we had the 14 th conference with more than 300 researchers at Budapest, Hungary. Professor Shuh Narumiya of Kyoto University received a Lifetime Achievement Award and Professor TimothyHla of Weill Cornell Medical College received an Outstanding Achievement Award, both of which had been announced earlier on the web page. The Santosh Nigam Memorial“Outstanding Young Scientist”Award is to recognize the great contribution of the Late Professor Santosh Nigam from Berlin to this series of conferences, and awarded onlyto one presentation of a total 220 presentations. Dr. Min Liu, a former research associate of the Department of Molecular and Cellular Biochemistry,Juntendo UniversityGraduate School of Medicine, successfullyreceived this award on her excellent presentation entitled“Crucial role of the 12-HHT receptor BLT2 in epidermal wound healing”.At the partyon the ferryboat on the Danube River, Mrs. Nigam honored Min Liu for her finding on the roles of lipid mediators in skin wound healing processes. We are now working to generate a new drug for skin ulcers based on Min Liuʼs findings 2). Key words: aspirin, wound healing, skin ulcer, eicosanoid, keratinocyte
References 2) Yokomizo T: Aspirin delays skin wound healing. Juntendo Medical Journal, 2014; 60: 284-286. 1) Liu M, Saeki K, Matsunobu T, et al: 12-hydroxyheptade- catrienoic acid promotes epidermal wound healing by accelerating keratinocyte migration via the BLT2 receptor. J Exp Med, 2014; 211: 1063-1078.
Lab members on a Danube River cruise. Professor Yokomizo Mrs. Nigam (right) is celebrating Min Liu (left) in the (center) and Min Liu (right) Award ceremonyat the party
Takehiko Yokomizo Department of Molecular and Cellular Biochemistry, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-5802-1030 E-mail: [email protected] 〔Received July. 31, 2015〕
352 Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2015. 61(4), 353-357 A Report of the 1 st Symposium and the 2 nd Workshop on Intractable Itch in Juntendo University
MITSUTOSHI TOMINAGA＊1),KENJI TAKAMORI＊1)2)
＊1) Institute for Environmental and Gender-Specific Medicine, Juntendo University Graduate School of Medicine, Chiba, Japan, ＊2)Department of Dermatology, Juntendo University Urayasu Hospital, Chiba, Japan
We applied for funding in the form of Strategic Research Foundation Grant-aided Project for Private Universities from the Ministry of Education, Culture, Sports, Science and Technology, to support our project regarding intractable itch, and were awarded funds in 2013. This project will be financially supported for 5 years. To progress in this project, we held the 1 st and 2 nd Workshops and the 1 st Symposium from 2013 to 2014 in fine meeting places of Juntendo University. In this“Whatʼs New from Juntendo University, Tokyo”,we report selected aspects of the 1 st Symposium and the 2 nd Workshop and advances in the field of itch research. Key words: brain imaging, GPCRs, itch, lipid mediator, skin
Background we held the 1 st Workshop on 4 th September, 2013 (as a closed workshop). The Institute for Environmental and Gen- In pursuit of the project, we held the 1 st der-Specific Medicine, Juntendo University Gradu- Symposium on 26 th April, 2014 in the Ariyama ate School of Medicine (Original Director; CEO Noboru Memorial Hall in Juntendo University Hideoki Ogawa), was founded in April 2002, (Table-1). There were 95 attendees at the sympo- supported by a grant of the High-Tech Research sium which comprised 8 lectures by top scientists Center Project for Private Universities: matching including itch researchers. fund subsidy from the Ministry of Education, On 29 th November, 2014, the 2 nd Workshop on Culture, Sports, Science and Technology (MEXT) recent progress in the project of intractable itch of Japan. To date, we have conducted research in was held in the Century Tower in Juntendo environmental and gender-specific medicine and University (Table-2). There were 106 attendees related fields with the help of visiting faculty (68 from this university and 38 from outside the members and many collaborators. university) at the workshop. There were 10 Based on previous achievements in our institute, progress reports of basic and clinical aspects during we applied for funding in the form of Strategic a half-day. Research Foundation Grant-aided Project for In both the 1 st Symposium and the 2 nd Workshop, Private Universities from MEXT, to support our expertise spanned clinical and basic academia, and project entitled“Basic construction of research for the opportunity for translation beyond was demon- elucidation of the pathogenic mechanism and strated by the presence of attendees from industry. development of preventive and therapeutic method The present report highlights selected aspects of in intractable itch”,and were awarded funds in the 1 st Symposium and the 2 nd Workshop and latest 2013. This project (Grant Number S1311011) will be advances in the field. supported for 5 years. At the kickoff of the project,
Corresponding author: Kenji Takamori Institute for Environmental and Gender-Specific Medicine, Juntendo University Graduate School of Medicine 2-1-1 Tomioka, Urayasu-shi, Chiba 279-0021, Japan TEL: +81-47-353-3171 FAX: +81-47-353-3178 E-mail: [email protected] 〔Received June 17, 2015〕
353 Tominaga, et al: A research project for intractable itch
Table-1 Program of the 1 st Symposium on intractable itch (26 th April, 2014)
Presenters Topic titles 1．Ryusuke Kakigi Central mechanisms of itch perception 2．Hiroshi Matsuda The utility of NC/Tnd mouse as an atopic dermatitis model 3．Yoshio Hirabayashi Cell function and signaling of a novel glycolipid 4．Kenji Izuhara Chronic mechanism of allergic disease 5．Chikao Morimoto Control of itch by CD26/DPPIV molecule and basic research for drug discovery 6．Takehiko Yokomizo A role of BLT2, bioactive lipid receptor, in cutaneous wound healing 7．Fumiyuki Yamakura Nitration stress and skin disease: implication for itch 8．Mitsutoshi Tominaga Mechanisms of itch in atopic dermatitis
354 Juntendo Medical Journal 61(4), 2015
Reports on the 1 st Symposium on intractable itch diseases such as atopic dermatitis. Prof. Chikao Morimoto of the Department of In his opening speech, CEO Hideoki Ogawa of Therapy Development and Innovation for Immune Juntendo University informed us of the scientific Disorders and Cancers, Juntendo University history of the foundation of our institute. When he described several roles of CD26/DPPIV molecule on visited Florida in the USA to attend a dermatologi- itch of allergic dermatitis. cal meeting a long time ago, he had learned that Prof. Takehiko Yokomizo of the Departments of almost all of the alligators were feminized due to Biochemistry (I), Juntendo University reviewed a endocrine disruptive effects of environmental history of BLT1 and BLT2 receptors for leukotriene chemical contaminants. It was then that he had an B4, and reported recent findings regarding a role of idea that a research center of environmental/gen- BLT2 receptor in skin wound healing. der-specific medicine would be needed worldwide Prof. Fumiyuki Yamakura of the Faculty of in the near future. After that, he exerted high Health Care and Nursing, Juntendo University leadership and performance as the original director focused on relationships between nitration of of our institute which was founded in April 2002 and proteins and skin diseases including itch, and supported by a grant as described above. He also highlighted the importance of nitrated carbonic informed us that our institute has attained a lot of anhydrase 3 in control of skin surface pH. significant achievements in the field of environmen- Associate Prof. Mitsutoshi Tominaga of the tal/gender-specific medicine and related fields to Institute for Environment and Gender-Specific date, including this project regarding intractable Medicine, Juntendo University Graduate School of itch selected from among our projects awarded by Medicine reported about a mechanism of spinal itch MEXT. He finally explained that this was the 1 st transmission from electrophysiological findings. Symposium of this project, and he expected that Finally, in his closing speech, Prof. Takashi achievements of this organization would contribute Sakurai of the Department of Cellular and Molecu- to improvement in patients suffering from intract- lar Pharmacology, Juntendo University commented able itch. that all of the presentations had been excellent and Prof. Ryusuke Kakigi of the National Institute for had given us new insights regarding itch research. Physiological Sciences described the central mecha- nism of itch in human using functional brain Progress reports on the 2 nd Workshop on imaging. He also discussed the central itch modula- intractable itch tion system and cerebral mechanisms of contagious itch and the pleasurable sensation evoked by In his opening speech, President Eiki Kominami scratching. of Juntendo University informed the members that Prof. Hiroshi Matsuda of the Division of Animal itch research had recently come into focus world- Life Science, Institute of Agriculture, Tokyo Univer- wide. He also encouraged us with the knowledge sity of Agriculture and Technology made a presen- that this project will likely help patients with tation showing that skin pH is the master switch of intractable itch. kallikrein 5-mediated skin barrier destruction in a In the Introduction, Director Kenji Takamori of mouse model NC/Tnd for human atopic dermatitis the Institute for Environment and Gender-Specific which he had established. Medicine, Juntendo University briefly described the Dr. Yoshio Hirabayashi (Team Leader) of RIKEN recent trend of itch research worldwide, especially Brain Science Institute (BSI) introduced us to the in the USA. He also told us that intense itch, more knowledge that his research group recently had than pain, decreases the quality of life (QOL), and discovered anovel glycolipid. He went on to discuss that development of anti-pruritic treatments cur- its roles in skin biology including itch. rently requires an understanding of the fundamental Prof. Kenji Izuhara of the Department of Biomo- mechanisms of itch. Consequently, he emphasized lecular Sciences, Saga Medical School presented the importance of elucidating the pathogenic mecha- research detailing the involvement of periostin in nisms and developing preventive and therapeutic the pathological mechanism of chronic allergic methods to treat intractable itch in this project.
355 Tominaga, et al: A research project for intractable itch
Table-2 Program of the 2 nd Workshop on intractable itch (29 th November, 2014) Presenters Topic titles 1．Isao Nagaoka Structure and diversity of antimicrobial (or host defense) peptides including their effects on mast cells 2．Yuji Kamikubo Analyses of interactional GPCRs regarding itch transmission using cultured spinal neurons 3．Katsuhisa Ikeda Screening of pruritogens in nasal salute 4．Rie Saitoh A relationship between postherpetic pruritus and neuralgia 5．Shigeki Yamaguchi Effects of itch and pain caused by herpes zoster on QOL 6．Kazunori Kajino Elucidation of molecular mechanism in malignant transformation and itch 7．Yoko Tabe Low-dose radiation-induced pathways regarding itch and inflammation in microenvironments 8．Yuji Ueno Axonal regeneration and expression of axonal inhibitory factor in peri-infarct areas after cerebral ischemia 9．Kazuhisa Iwabuchi Effects of sphingolipid-derived metabolite in production of itch-related factors from human keratinocytes 10．Shinji Morimoto Investigation regarding CTGF in psoriasis with itch
356 Juntendo Medical Journal 61(4), 2015
In his progress report, Prof. Isao Nagaoka of the L-carnitine enhances axonal plasticity and Department of Host Defense and Biochemical improves white matter lesions after chronic hypo- Research, Juntendo University described the struc- perfusion in rat brain. He is investigating the ture and diversity of antimicrobial peptides includ- molecular mechanisms associated with axonal ing their effects on mast cells and itching. plasticity in experimental rat brain and itching. Assistant Prof. Yuji Kamikubo of the Department Prof. Kazuhisa Iwabuchi of the Laboratory for of Cellular and Molecular Pharmacology, Juntendo Biochemistry, Juntendo University, School of Health University presented a crosstalk between metabo- Care and Nursing, informed us that sphingosine- tropic glutamate receptor and gastrin-releasing 1-phosphate (S1P) induced endothelin-1 (ET-1) peptide receptor in synaptic itch transmission. His production in three-dimensional cultured keratino- results suggested that distinct neuronal G-protein cytes. He speculated that S1P-induced ET-1 is at coupled receptors (GPCRs), each of which play a least partly involved in intractable pruritus of different role, may interact and thereby coopera- atopic dermatitis. tively regulate synaptic itch transmission. Associate Prof. Shinji Morimoto of the Depart- Prof. Katsuhisa Ikeda of the Department of ment of Internal Medicine and Rheumatology, Otorhinolaryngology, Juntendo University described Juntendo University, Urayasu Hospital discussed his findings of some candidate itch-related cyto- the involvement of connective tissue growth factor kines in epithelial cells and fibroblasts from patients (CTGF) in psoriasis with pruritus. with allergic rhinitis and nasal polyps. He proposed a mechanism of itch in sinonasal tissues. Summary Dr. Rie Saitoh of the Department of Anesthesia and Pain Medicine, Juntendo University reported a Prof. Yasuyuki Igarashi of Hokkaido University relationship between profiles of postherpetic itching commented on this project. He highly evaluated the and rates of pain retention from the standpoint of performance of Prof. Kenji Takamori and this clinicians. Currently, she is undertaking a follow-up organizationʼ s steady achievements in the itch study of this in patients from the acute phase to 6 project, although it had only recently begun and is months. only in its second year. He provided his comments Prof. Shigeki Yamaguchi of the Department of and expectations that this organization will contrib- Anesthesiology, Dokkyo Medical University intro- ute to the development of preventive and therapeu- duced clinical research plans to investigate the tic methods to treat intractable itch, and that it will effects of pain and itch on the QOL of patients with evolve into the leading Japanese center for itch herpes zoster. going into the future. Assistant Prof. Kazunori Kajino of the Depart- ment of Molecular Pathogenesis, Juntendo Univer- Conflicts of interest sity reported changes in cell adherence and epidermal growth factor receptor (EGFR) in ERC The authors declare they have no conflicts of overexpressing sarcomatoid type cells. He plans to interest. investigate the roles of ERC in cutaneous side effe- cts including dry skin and pruritus in anti-EGFR- Acknowledgements treated patients. Associate Prof. Yoko Tabe of the Department of This workshop was supported by a grant of Clinical Laboratory Medicine, Juntendo University Strategic Research Foundation Grant-aided Project described low-dose radiation-induced pathways for Private Universities from MEXT (S1311011). regarding itch and inflammation in the microenvir- We thank members of our institute and university onment by using cDNA microarray and proteomic for helping us to hold the 1 st Symposium and the 2 nd analyses. Workshop on intractable itch. Associate Prof. Yuji Ueno of the Department of Neurology, Juntendo University described that
357 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 358-359
Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination
TOSHIHIRO MITA＊
＊Department of Molecular and Cellular Parasitology, Juntendo University Faculty of Medicine, Tokyo, Japan
Introduction smallpox among infectious diseases has been eradicated so far. The Guinea worm (dracontiasis), The extensive spread of infection with Ebola filariasis and polio have been eliminated in many virus disease (EVD) and the resulting death toll in endemic regions and these pathogens are approach- West Africa since 2014 remains a global health ing eradication. Although 97 countries are still at priority 1). An autochthonous outbreak of dengue risk of indigenous infection, malaria has not been fever, that had been recognized as an imported reported in 12 countries for 13 years 7) and it is infectious disease 2) for the past 70 years or so, gradually approaching elimination in many South- simultaneously occurred in Japan. However, a Ger- east Asian countries. The Asia Pacific Leaders man visitor to Japan developed dengue fever after Malaria Alliance has set the final goal of eliminating returning home one year before the 2014 out- malaria from the Asia-Pacific region by 2030. break 3). Most tropical diseases except malaria are The World Health Organization (WHO) in 1955, included in a group called neglected tropical dis- embarked on the Global Malaria Eradication eases (NTDs) (http: //www. who. int/neglected_ Program that was the first attempt to tackle a diseases/diseases/en/) that mainly target socially worldwide infectious disease. However, the cam- vulnerable groups such as those living in poverty paign relied heavily on a single strategy, namely and those residing in remote areas 4). Chagas radical vector control using dichloro-diphenyl-tri- disease, which causes chronic heart failure after a chloroethane (DDT) 8). At that time, vector control prolonged silent phase, is mostly distributed in alone was thought sufficient to eradicate malaria, remote areas of South and Central America. despite the fact that the first DDT-resistant However, it is also prevalent in the USA with an mosquito had been identified four years earlier in estimated 300, 000 patients, most of whom are 1951 9). In the meantime, all knowledge required to socially vulnerable 5). Indeed, opportunities to eradicate malaria was already available, but the acquire tropical diseases are increasing because of wide experience and knowledge of malaria investi- factors such as global warming and an increase in gators were viewed as redundant 8). The program intercontinental travel among humans and perhaps therefore precluded further attempts to develop causative vectors 6). new operational tools and any possibility of novel Elimination is defined as a reduction in the approaches to attain a deeper understanding of incidence of infection in a defined geographical malaria biology, parasitology and epidemiology 8). area to zero. Once elimination is achieved, the The campaign was discontinued in 1969 without next step is eradication, namely, permanent re- achieving its goal. Although malaria has elimi- duction of the worldwide incidence to zero 7). Only nated in previous endemic regions mostly in
Toshihiro Mita Department of Molecular and Cellular Parasitology, Juntendo University Faculty of Medicine 2-1-1 Hongo, Bunkyo-ku,Tokyo 113-8421, Japan TEL: + 81-3-5802-1042 E-mail: [email protected] 〔Received Sep. 9, 2015〕
358 Juntendo Medical Journal 61(4), 2015
Europe and the USA, it has resurged in other reviews current advances in understanding dengue areas. The annual number of patients with malar- fever, with focus on details of the clinical presenta- ia in Sri Lanka had dropped to only 17, but the this tion and a putative mechanism of the severe form of number surged to 500,000 after the DDT program this disease. was stopped 10). A comprehensive review of the Tropical medicine research was an important history of the Global Malaria Eradication Program avenue to prevent a reduction of military forces provides hints for a global fight against tropical caused by infection with tropical diseases during diseases. The common perception today is that the age of imperialism. We now believe that tropical new technology and further understanding of diseases are not an indigenous health problem tropical diseases are absolutely imperative to confined to tropical regions; rather, they are global achieve control and elimination. health issues that every country needs to address This research topic offers a comprehensive through collaboration. This special topic will offer review of recent advances in tropical diseases further understanding of how academia contributes including malaria, filariasis, Chagas disease, EVD to global health problems induced by tropical and dengue fever. The first article about malaria by diseases. Dr. Palacpac and Professor Horii reviews preclinical studies of BK-SE36, a promising blood-stage References malaria vaccine that they developed. The malaria parasite possesses numerous ingenious mecha- 1) WHO: Ebola Response Team: Ebola virus disease in nisms to evade human immunity, rendering an West Africa - the first 9 months of the epidemic and forward projections. N Engl JMed, 2014; 371: 1481- effective vaccine difficult to develop. Dr. Hirai 1495. focuses on malarial drug resistance, an ongoing 2) Arima Y, Matsui T, Shimada T, et al: Ongoing local obstacle against effective malaria control, and has transmission of dengue in Japan, August to September 2014. Western Pac Surveill Response J, 2014; 5: 27-29. developed a novel genetic technology. This is 3) Schmidt-Chanasit J, Emmerich P, Tappe D, et al: discussed with an emphasis on future applications Autochthonous dengue virus infection in Japan im- in an operational context, which will enables ported into Germany, September 2013. Eurosurveillance, 2014; 19. forecasts about antimalarial resistance. Dr. Kimura 4) Hotez PJ: Forgotten People, Forgotten Diseases: The reviews the ongoing elimination of lymphatic Neglected Tropical Diseases And Their Impact On filariasis under the Global Program to Eliminate Global Health And Development. Second Edition: Wash- ington, DC: ASM Press, 2013. Lymphatic Filariasis (GPELF) launched in 2000. 5) Bern C, Kjos S, Yabsley MJ, Montgomery SP: Trypano- This achievement, along with public health and soma cruzi and Chagasʼ disease in the United States. Clin scientific implications are discussed along with Microbiol Rev, 2011; 24: 655-681. 6) Khasnis AA, Nettleman MD: Global warming and basic and translational research and application to infectious disease. Arch Med Res, 2005; 36: 689-696. field operations. Drs. Nara and Miura summarize 7) WHO: World Malaria Report 2014. Geneva: WHO, 2014. the current epidemiology of Chagas disease in 8) Najera JA, Gonzalez-Silva M, Alonso PL: Some lessons for the future from the Global Malaria Eradication non-endemic countries including Japan. This NTD Programme (1955-1969). PLoS Med, 2011; 8: e1000412. is extant even in developed countries, where it is 9) Livadas G, Georgopoulos G: Development of resistance also neglected. Dr. Yamamoto draws a comprehen- to DDT by Anopheles sacharovi in Greece. Bull World Health Organ, 1953; 8: 497-511. sive picture of EVD from a basic understanding of 10) Cohen JM, Smith DL, Cotter C, et al: Malaria resurgence: the causative pathogen to the recent development a systematic review and assessment of its causes. Malar of a vaccine and anti-Ebola agents. Dr. Kurosu J, 2012; 11: 122.
359 Current Research Topics in TropicalDiseases; Towards SuccessfulControland Elimination Juntendo MedicalJournal 2015. 61(4), 360-369
Preclinical Studies on a New Vaccine Formulation of BK-SE36, a Malaria Vaccine Candidate
NIRIANNE MARIE Q. PALACPAC＊,TAKAHIRO TOUGAN＊,TOSHIHIRO HORII＊
＊Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan
An effective blood-stage vaccine remains elusive but necessary if we are to reduce malaria morbidity and mortality. The SE36 antigen derived from serine repeat antigen 5 (SERA5) of Plasmodium falciparum remains a promising blood-stage malaria vaccine candidate. The protective efficacy of BK-SE36, SE36 recombinant protein and aluminum hydroxide gel, is continuously being studied in clinical trials. However, the efficacy of BK-SE36 may still be improved with the use of DNA sequences containing CpG motifs that can selectively promote cellular and/or humoral immune responses. Preclinical studies in non-human primates show promising results. A clinical trial of the vaccine candidate BK-SE36/CpG in a malaria-exposed population is awaited as this can give valuable clues on the immune responses towards K3 CpG formulation in malaria-endemic populations. Key words: BK-SE36, malaria vaccine; Plasmodium falciparum; TLR9 ligand adjuvant, K3 CpG
Malaria is an Anopheles-mosquito-borne infec- candidate in development, was applied for licensure. tious disease. Of the five species of malaria parasites This pre-erythrocytic vaccine (based on the cir- that can infect humans, P. falciparum is the most cumsporozoite protein and hepatitis B surface virulent, causing pandemics mainly in tropical and antigen fusion protein) induces approximately subtropical regions. Recently, with increasing 30-50% reduction in the risk of clinical malaria. support for preventive, diagnostic and treatment Thus, a vaccine with higher levels of protection is measures, progress has been achieved in reducing still sought 6). A blood-stage vaccine, either alone or malaria burden (World Malaria Report 2014: http: as a component of a multi-stage vaccine, is needed //apps. who. int/iris/bitstream/10665/144852/2/97 to protect against clinical disease or epidemic 89241564830_eng.pdf?ua=1). However, still an esti- malaria. mated 198 million cases (uncertainty range 124-283 Serine repeat antigen 5 (SERA5) protein (120 million) occurred globally in 2013 with 584,000 kDa) is an antigen abundantly secreted in the deaths (367,000-755,000) of which children under parasitophorous vacuole by the malaria parasite 7)-9). 5 years old in Africa account for 78% of all deaths. It is a member of a multigene family that encodes Because of country level limitations in implementa- proteins with a putative papain-like cysteine pro- tion of controlstrategies, uncertainty in interna- tease motif 10). Recently, SERA5 has been demon- tionalfunding 1), spread of drug and insecticide- strated to have no enzymatic role, yet indispensable, resistant malaria 2)-4) as well as concerns in global during blood-stage growth and is suggested to be warming 5), there has been great expectations for involved in substrate-like interactions or in regula- developing a vaccine as an additional intervention tion of active enzyme counterparts that leads to for global malaria control and eradication. In the parasite egress 11). The N-terminalpart of the protein latter part of 2014, RTS,S, the most advance vaccine has been identified as a criticaldomain that
Corresponding author: Toshihiro Horii Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University 3-1 Yamadaoka, Suita-shi, Osaka 565-0871, Japan TEL: +81-6-6879-8280 FAX: +81-6-6879-8281 E-mail: [email protected] 〔Received Mar. 31, 2015〕
360 Juntendo MedicalJournal 61(4), 2015
correlates with reduced parasite density 12) and 10/100, 50/500 or 450/4500 SE36/AHG (μg/μg) 15). absence of clinical symptoms in infected chil- Antibodies induced after administration of 50/500 dren/adults 13)-15). Moreover, the N-terminalrepeti- or 450/4500 SE36/AHG were maintained for 2 years tive sequence regions were identified as immunodo- and two administrations were sufficient for serum minant IgG epitopes in Ugandan malaria-immune anti-SE36 antibody levels to reach a plateau level. volunteers and the physicochemical properties of Experimentalinfection studies in squirrelmon- these protective epitopes suggest that they are keys also demonstrated that monkeys who received intrinsically unstructured and, thus, a strict tertiary two subcutaneous administrations of 50/500 SE36/ structure of SE36 epitopes is not required to elicit AHG, with two-week vaccination interval, and then protective antibodies 16). challenged with heterologous parasites (P. falcipa- A recombinant form of SERA5 N-terminaldomain rum IPC/Ray strain) have markedly lower parasi- (based from P. falciparum Honduras I strain), SE36, temia than controlmonkeys that received phos- together with aluminum hydroxide gel (AHG) as phate buffered saline alone. Another critical adjuvant is referred to as the malaria vaccine observation was that the antibody titer induced by candidate BK-SE36 (SE36/AHG). BK-SE36 is pro- the vaccine was further boosted by the challenge duced under Good Manufacturing Practice (GMP) infection. Thus, BK-SE36 can prime the immune conditions at the Research Foundation for Microbial response to the SERA5 protein of the infecting Diseases of Osaka University (BIKEN). Plasmodium strain, suggesting that vaccine effi- cacy in endemic areas can be further enhanced by Pre-clinical studies in primates malaria infection.
Good Laboratory Practice (GLP) tests for Phase 1a in malaria naïve Japanese adults BK-SE36 were conducted in 2003 with no safety issues identified. In addition, immunogenicity of the After nonclinical studies, in 2005 a phase 1a vaccine product was assessed in chimpanzees, clinical trial was conducted to evaluate safety and which have a similar immune system to humans. immunogenicity in humans. Based on data from The study showed significant increase in anti-SE36 preclinical studies, two doses of BK-SE36 were antibody titer with no safety concerns at doses of selected for testing: 50 μg SE36 (half-dose or 0.5
A 800 Control half－dose 600 full－dose
400 SE36（IgG）titer － 200 Anti （Geometric mean＋SD）
0 0 21 42 63 Trial days
B Sero－conversion rate（%） Trial Days 21 42 63 Full－dose BK－SE36 （3/15）20 （14/14）100 （14/14）100 Half－dose BK－SE36 0 （14/15）93 （15/15）100 Control 0 0 0
Figure-1 Anti-SE36 antibody responses in non-immune Japanese adult volunteers that participated in the phase 1a trial A. Geometric mean of the antibody titers in two arms (half- and full-dose) before each vaccination at Days 0, 21 and 42. B. Sero-conversion rates during phase 1a. Number of volunteers who have anti-SE36 antibodies/total number of subjects vaccinated.
361 Horii, et al: New adjuvant formulation of BK-SE36
ml of BK-SE36) and 100 μg SE36 (full-dose or 1.0 by ELISA was 93.3% (14/15 subjects) and 100% ml of BK-SE36). Each dose was subcutaneously (14/14 subjects) after second vaccination for half- administered on Days 0, 21 and 42 15). and full-dose of BK-SE36, respectively. Sero-con- The first-in-human clinicaltrialhadno safety version was 100% in all vaccinees after three concerns after three administrations of either the vaccinations (Figure-1). Notably, even if 100% half- or full-dose of BK-SE36 as shown in Table-1. sero-conversion rates were achieved, the mean Anti-SE36 protein sero-positivity rate as measured anti-SE36 antibody titer was several fold lower than that in African high-titer pooled sera 15).
Table-1 Localand systemic reactogenicity in Japanese Phase 1b in malaria immune Ugandan adults and non-immune adults young children Half-dose (0.5 ml) Full-dose (1.0 ml) BK-SE36 BK-SE36 From 2010 through 2011, a phase 1b clinical trial Localreactogenicity was conducted in Uganda, followed by a 1-year Induration 15/15 10/15 follow-up study 17). Localand systemic adverse Pain 0/15 1/15 events were more or less similar to the phase 1a Erythema 14/15 10/15 clinical trial, with no volunteers withdrawn due to Swelling 2/15 0/15 adverse events (Table-2) ; although transient ele- Itchiness 0/15 4/15 vation in AST and ALT were noted in one Systemic reactogenicity volunteer right after treatment for lower respira- Fever 2/15 4/15 tory tract infection. There was one serious adverse Fatigue 2/15 2/15
Table-2 Local, systemic reactogenicity and other adverse events in Ugandan adults and young children 21-32 years old 6-20 years old BK-SE36 (1 ml) full dose (1 ml) full dose (0.5 ml) half-dose Localreactogenicity Induration 33/36 32/33 31/33 Pain 14/36 11/33 6/33 Erythema 1/36 4/33 1/33 Swelling 3/36 0 0/33 Tenderness 23/36 17/33 17/33 Redness 1/36 0 0 Hyperpigmentation 2/36 1/33 0 Hyperemia 1/33 0 Systemic reactogenicity Fever 5/36 1/33 1/33 Fatigue 2/36 0 0 Blood pressure decrease 1/36 0 0 Blood pressure increase 5/36 0 0 Dizziness 1/36 0 0 Headache 2/36 0 0 Laboratory adverse events Elevated AST 1 0 0 1/33 Elevated ALT 2 0 0 1/33 Serious Adverse Event Acute gastritis 1/36 0 0
1AST, aspartate aminotransferase 2ALT, alanine aminotransferase
362 Juntendo MedicalJournal 61(4), 2015
A 15 Control half－dose full－dose 10
5 Geometric mean of
the fold increase in antibody titer 0 16－20 11－15 6－10 Age（years）
B Fold increase in antibody titer＞1.9（%） 16－20 y－old 11－15 y－old 6－10 y－old Full－dose BK－SE36 2/11（18） 3/11（27） 7/11（64） Half－dose BK－SE36 2/11（18） 0 4/11（36） Control 0 0 0
Figure-2 Fold increase in anti-SE36 antibody titers in malaria-exposed Ugandan adults and young children that participated in the phase 1b trial A. Geometric mean of the fold-increase in antibody titers in two arms (half- and full-dose) at each age group. B. Proportion of subjects in whom antibody titer increased by > 1.9-fold after two vaccinations in comparison with pre-vaccination titer/totalsubjects vaccinated per cohort. event due to acute bacterialgastritis. regarded as a weak adjuvant for antibody induction In this first clinical trial of BK-SE36 in malaria to recombinant antigens. We expect that the utility endemic areas, the vaccine was demonstrated to of BK-SE36 can be further enhanced with an have acceptable immunogenicity (Figure-2). The adjuvant that can stimulate innate immunity. follow-up study generated data on malaria inciden- Likewise, current effective adjuvant formulations ces covering two malaria peak seasons (from 130 to consist of several molecules that act synergistically 365 days post-second vaccination). Hazard ratio to by activating both innate and acquired immune first episodes of ≥5,000 parasites/μl in BK-SE36 mechanisms 20). Innate immunity is induced by was 0.50 (95% CI, 0.28-0.92, p=0.02) and for first exposure to conserved pathogen-associated molec- episodes of high parasitemia + fever, 0.28 (95% CI, ular patterns that are expressed in a variety of 0.12-0.66, p < 0.01). Against all/multiple malaria infectious microorganisms, the recognition of which episodes the hazard ratio for high parasitemia was is mediated by several receptors including the most 0.57 (95% CI, 0.33-0.99, p = 0.05) and for high extensively studied Toll-like receptors (TLRs) 20) 21). parasitemia + fever, 0.34 (95% CI, 0.15-0.76, p = There are now four licensed vaccines that contain 0.01). From these, there was substantialdifference multiple TLR agonists: BCG vaccine which con- in time-to-first high parasitemia and multiple tains both TLR2 and TLR4; Cervarix and Fendrix malaria episodes of BK-SE36 vaccinees in a malaria which contains alum and monophosphoryl lipid A; endemic area where 84% coverage of bednets and and the Mycobacterium indicuspranii adjuvant minimalpractice of indoor insecticide spraying was (Immuvac/Cadi-05) for leprosy 20). These develop- reported. ments attest to the success in multi-adjuvanting, and consequently, agents that support the efficient Immunostimulatory DNA sequences induction of innate immunity. Synthetic oligonucleotides (ODN) containing unmeth- The phase 1b trial in Uganda demonstrated low ylated cytosine guanine dinucleotide (CpG) motifs have sero-conversion in malaria exposed adults (Fig- been shown to be strong adjuvants for DNA or ure-2) which might be interpreted as due to protein-based immunogens and have been used for immunotolerance 18) 19). Also, AHG is generally human trials 22)-26). Because CpGs are only present at
363 Horii, et al: New adjuvant formulation of BK-SE36
Table-3 Some studies using CpG ODN for candidate malaria vaccines CpG ODN in vaccine for- Vaccine candidate Phase Outcome References mulation CpG 1968 1 P. falciparum circumsporo- Pre-clinical (Aotuslemur- Identification of CpG motifs Jones et al., 1999 CpG 2006 2 zoite protein (PADRE 45) inuslemurinus) that are stimulatory to Aotus in saline and Montanide 720 monkey 3 48) CpG 1826 Plasmodium vivax MSP119 Pre-clinical and sporozoite Protective efficacy in Kumar et al., 2004 in Montanide ISA 51 challenge murine model CpG10105 4 (250μg) Pfs25/Pvs25 in Alhydrogel Pre-clinical (Rhesus mon- Evaluation of Miura et al., 2007 49) or Montanide ISA720 key and mosquito feeding transmission-blocking assay) activity CpG 1826 Killed parasites (whole- Pre-clinical (rodent) Vaccine with CpG adju- Pinzon-Charry et al., 2010 parasite vaccine) and alu- vant elicited strong, cross- minium hydroxide reactive T cell responses
CpG7909 5 (564μg) P. falciparum AMA1-C1/ Phase 1a (non-immune Safety, immunogenicity and Mullen et al., 2008 50) Alhydrogel adults) in vitro growth inhibition (GIA) studies Phase 1a (non-immune Safety, immunogenicity and Ellis et al., 2009 51) adults) GIA studies Phase 1b (malaria exposed Safety and immunogenic- Sagara et al., 2009 adults) ity; Acquisition of memory B Traore et al., 2009 52) cells Phase 1/2a (non-immune Human experimental Duncan et al., 2011 adults) malaria infection studies BSAM2/Alhydrogel Phase 1 (non-immune Safety, immunogenicity and Ellis et al., 2012 53) (AMA1 and MSP142) adults) GIA studies
MSP142-C1/Alhydrogel Phase 1 (non-immune Safety, immunogenicity and Ellis et al., 2010 adults) GIA studies
1TCGTCGCTGTTGTCGTTTCTT 2TCGTCGTTTTGTCGTTTTGTCGTT 3TCCATGACGTTCCTGACGTT 4TCGTCGTTTTGTCGTTTTTTTCGA 5TCGTCGTTTTGTCGTTTTGTCGTT about 25% in mammalian DNA and are highly are crucial for parasite clearance in the latter stages methylated, once recognized, these DNA sequences of infection, severalstudies have shown that the stimulate the immune system through a specific control of malaria is partially dependent on the receptor, TLR9. TLR9 activation, restricted to B generation of Th1-type immunity 32). cells and plasmacytoid dentritic cells (pDC) in man, CpG 7909 (Coley Pharmaceutical Group, Welles- enhance the immune system biased towards a Th1 ley, MA) has been studied extensively in humans in type response 27) 28). B cells are activated to secrete combination with hepatitis B vaccine, inactivated interleukins (IL-6 and IL-10), immunoglobulin (IgG), influenza vaccine and anthrax vaccine 26). In the and to express increased levels of co-stimulatory malaria field, a number of studies also demonstrated molecules 29) 30). Monocytes and macrophages that CpG7909 boosted the immunogenicity of alum- secrete IL-12, leading to natural killer (NK) cell based vaccines (Table-3). With regards to the activation and interferon (IFN) -γ secretion 31). safety aspect, so far, there were transient fluctua- Moreover, expression of co-stimulatory molecules tions in white blood cell counts and platelet count as can also lead to enhanced antigen presentation. expected with CpG 7909 and other TLR9 agonists. Thus, these immunostimulatory properties have No clinical events associated with these fluctuations been tapped for a range of non-antigen specific have been reported by severalauthors and given therapy of allergens and cancers; as well as the rapid return to baseline, their clinical signifi- antigen-specific generation of B and T cell immune cance has been judged to be minimal. So far, there responses to synthetic peptide- and recombinant were no reports of clinically relevant changes in protein-based vaccines 21). Besides antibodies which liver or renal function. Systemic symptoms
364 Juntendo MedicalJournal 61(4), 2015
(short-lived flu-like symptoms, fatigue, rigor, advantage 36) 37). myalgia, pyrexia) were most commonly described ranging from mild to moderate in severity; with Studies of BK-SE36 with K3 CpG frequency increasing with higher CpG doses (refer to Table-3 studies). These reactogenicities were A study to optimize the immunogenicity of deemed generally manageable and acceptable BK-SE36 was done in combination with K3 CpG given that volunteers mounted significantly higher (ATCGACTCTCGAGCGTTCTC), D35 CpG (GG levels of antibodies against antigenic proteins (from tgcatcgatgcaggggGG) (GeneDesign, Inc), or syn- 2- to 49-fold) 33) 34). Disappointingly, the increase in thetic hemozoin (sHZ) as adjuvant 38). K3 CpG antibody titers achieved by the vaccinees, did not activate memory B cells to proliferate and differen- protect volunteers against in vivo malaria infection tiate into IgG producing cells, secrete IgM, stimu- or reduce parasite multiplication rate in the late pDC precursors to mature and secrete IL-8, CpG7909 + apicalmembrane antigen 1 trial 35). and indirectly activate monocytes to produce IL-6. Further assessments are ongoing to identify D35 CpG, on the other hand, induces plasmacytoid additional CpGs; establish their safety and activity DCs to produce IFN-α and IFN-γ, either directly or profiles; and identify populations and conditions indirectly trigger IFN-α production by NK, and where addition of CpG ODNs exert substantial enhance maturation of myeloid DC 39) 40). sHz was
A （ⅰ） （ⅱ） （ⅲ） 4 10 SE36＋AHG＋CpG（K3）
SE36＋AHG＋CpG（D35） 103 SE36＋AHG＋sHZ
102 SE36＋AHG
101 SE36 IgG titer（1/N） －
Anti 100 0 50 100 150 200 250 300 350 400 450 500 550 600 （Day） 0 22 101 365
（ⅰ）Day 36：2 weeks （ⅱ）Day 112：2 weeks （ⅲ）Day 379：2 weeks B after 2nd immunization after 3rd immunization after 4th immunization ＊ ＊ 104 ＊ 104 ＊ 104 ＊ ＊ 103 103 103
102 102 102 SE36 titer（1/N） SE36 titer（1/N） SE36 titer（1/N） － － － 101 101 101 Anti Anti Anti
100 100 100 － K3 D35 sHZ － K3 D35 sHZ － K3 D35 sHZ
＊：p＜0.05
Figure-3 Kinetics of the antibody response in cynomolgus monkeys A. Anti SE36-specific IgG antibody titers against the day the animals were immunized and/or bled. Cynomolgus monkeys were administered subcutaneously on days 0, 22, 101, and 365 (arrows) with a mixture of 10 μg SE36 and 125 μg AHG with or without 500 μg K3 CpG, or D35 CpG; or 1.5 mM sHz in 1.0 ml. Closed circles, triangles, squares, and diamonds show the median titers (n = 3/group) of BK-SE36, BK-SE36 + K3 CpG, BK-SE36 + D35 CpG, and BK-SE36 + synthetic hemozoin (sHZ), respectively. Bars represent standard error of the mean. B. Comparison of antibody titers on days 36 (i), 112 (ii), and 379 (iii). Results from individual monkeys are shown. Non-parametric ANOVA (Kruskal-Wallis) with Dunnʼs post-hoc test was used for statistical analyses between groups; ＊indicates significant difference at p<0.05.
365 Horii, et al: New adjuvant formulation of BK-SE36
included in the study as it was reported to be a To investigate the involvement of SE36 anti- potent adjuvant for malaria antigens 41). The original gen-specific helper T cells, cytokine secretion levels formulation of BK-SE36 was used as control. were measured under ex-vivo SE36 stimulation that Although earlier reported to give primarily a Th2 included IFN-γ as a Th1 response marker and IL-5 response in mice, it is now known that in humans, and IL-13 as Th2 response markers. Significant proteins with alum adjuvants activate a mixture of inductions of IFN-γ, IL-5, and IL-13 were observed Th2 and Th1 cells 28) 42). These different formula- in the K3 CpG adjuvant group indicating that K3 tions were compared and preclinical studies were can induce both Th1/Th2 responses, while sHZ done in cynomolgusmonkeys, an animalmodelused adjuvant induces only the Th2 response (Fig- as a surrogate species for humans. Twelve cynomol- ure-4). As in earlier studies, injection of crude P. gus monkeys were divided into four groups falciparum 3D7 extract resulted to an increase in (BK-SE36, BK-SE36 with K3 CpG, BK-SE36 with anti-SE36 antibody titer suggesting that the D35 CpG, and BK-SE36 with sHZ). Monkeys were immune response can be boosted by malaria immunized subcutaneously four times (Day 0, 22, infection. 101 and 365), followed by approximately 600-day Further studies on K3 CpG were conducted using follow-up with periodic blood-sample collection for squirrelmonkeys as an animalmodelfor human serum anti-SE36 antibody titer measurements malaria. Three groups were evaluated: BK-SE36 (Figure-3). TLR9 ligand adjuvants were demon- with K3, BK-SE36 alone and AHG with K3 CpG strated to significantly enhance antibody titers only. The monkeys were immunized subcutane- compared to BK-SE36 alone. Antibody titer in the ously twice within a 3-week interval and at K3 CpG adjuvant group was approximately 10 9-weeks after the first immunization received a times greater than BK-SE36 (Figure-3A). K3 CpG challenge infection of 5 × 108 parasites. Monkeys also has dose sparing effect, as no statistical immunized with BK-SE36 and K3 CpG effectively difference was observed in post-immunization suppressed parasitemia 38). Anti-SE36 antibody antibody titers between the third and fourth titer was also subsequently boosted by malaria immunization, indicating that three administrations infection. From these promising results, a combina- are sufficient to induce maximalantibody titers tion of TLR9 ligand adjuvant with BK-SE36 can (Figure-3A and B [ii]-[iii]). induce higher humoral and cellular immune
Th1 Th2
IFNγ IL－5 IL－13 104 ＊ 104 104 ＊ ＊ 103 103 103 ＊ ＊
102 102 102
101 101 101 Concentration（pg/ml） Concentration（pg/ml） Concentration（pg/ml） 100 100 100 N 36 N 36 N 36 N 36 N 36 N 36 N 36 N 36 N 36 N 36 N 36 N 36 － K3 D35 sHZ － K3 D35 sHZ － K3 D35 sHZ
＊：p＜0.05
Figure-4 Levels of IFN-γ, IL-5, and IL-13 in PBMCs of cynomolgus monkeys stimulated in vitro with SE36 antigen. Formulation of BK-SE36 with K3 CpG adjuvant promotes both Th1 and Th2 responses, in contrast to BK-SE36+D35 CpG or BK-SE36 + sHz. PBMCs of cynomolgus monkeys on Day 36 were purified by Ficoll and isolated cells stimulated with SE36 (“36”)(closed symbols) antigen or PBS (“N”)(open symbols) at 37℃ for 24h. ＊ indicates significant difference from PBS at p < 0.05. Statistical analysis was performed for pre- and post-immunization sera using a Mann-Whitney U test.
366 Juntendo MedicalJournal 61(4), 2015
BK－SE36 BK－SE36 with K3 CpG AHG with K3 CpG 100 100 100 dt dt dt
10 10 10
1 1 1 Parasitemia（%） Parasitemia（%） Parasitemia（%）
0.1 0.1 0.1 1 234567891011121314 1 2 3 4 5 6 7 8 9 1011121314 1 234567891011121314 Days after infection Days after infection Days after infection
Figure-5 Parasitemia in squirrel monkeys at different time points during a vaccine trial. Parasite densities among the different treatment groups (BK-SE36, BK-SE36 with K3 CpG and AHG with K3 CpG) are compared up to 14 days post challenge infection. The monkeys were immunized with the different formulations nine weeks before challenged with 5×108 infected IPC/Ray red blood cells.“dt”stands for a monkey that was euthanized, or succumbed to infection. Closed circles for BK-SE36 group, triangles for BK-SE36 with K3 CpG and squares for AHG with K3 CpG. Results for individualmonkeys are shown. response compared to BK-SE36 alone (Figure-5). may likely overcome challenges with regards to Concerning safety, toxicity studies using sin- extensive polymorphism 43) and strict structural gle-dose/repeated intramuscular administration to requirement for protective epitopes 16). Further rats, foreign body-related granuloma at the vacci- studies on the phase 1b clinicaltrialinUganda nation site was observed, but there was no systemic suggest that BK-SE36 does not show allele-specific toxicity (Horii et al., unpublished). In a safety efficacy (Arisue et al., in preparation) and protec- pharmacology study using rats, there were no tive efficacy may not be influenced by African HLA influence on the central nervous or respiratory II haplotype (Tougan et al., unpublished). Although systems. Using dogs, there was likewise no influ- early indicators of vaccine efficacy for BK-SE36 is ence on the cardiovascular system. In a topical promising, use of K3 CpG as an adjuvant to enhance irritation study involving intramuscular administra- immunogenicity and possibly efficacy may be one tion to rabbits, Grade 2 topicalskin-irritating approach to broaden immune responses. A robust properties were noted. Histopathologically, fibrosis immune response may overcome immune tolerance was advanced, suggesting recovery, although or help immunocompromised individuals. Indeed, topical skin reactions macroscopically persisted to immunity against malaria involves timely and 35 days after vaccination (Horii et al., unpublished). coordinated interplay of both innate and adaptive Further safety and GLP tests are underway. In immunity involving multiple cell types like den- parallel, supported by results from vaccine trials in dritic cells, NK cells; B cells, CD4 + and CD8 + T non-human primates, a first-in-human investiga- cells. Adjuvant formulations have been described tor-initiated clinicaltrialwasdone for BK-SE36/ taking into account not only the amount of antibody CpG. The trial has just been completed (Horii et al., induced by the vaccine but also the quality of the in preparation) and follow-up of vaccinees is antibody (different fine specificities or the matura- on-going. tion of the antibody response). K3 CpG in our studies was identified as an effective TLR9 ligand Conclusion that can induce both humoral and cellular immunity when compared to BK-SE36 alone. The advantage There are a number of challenges in malaria in the activation of multiple innate receptors that vaccine development: (a) the parasiteʼ s complex could target redundant pathways of innate respon- life cycle and diverse protein repertoire; (b) anti- siveness rather than a single pathway was genic variation and polymorphisms across parasite observed with RTS, S. RTS, S administered with strains and species; and (c) the parasitesʼ devel- alum did not confer protection, whereas, RTS, S oped strategies for host immunity evasion. SERA5 mixed with TLR-4 ligand resulted to increased
367 Horii, et al: New adjuvant formulation of BK-SE36
antibody production and induction of Th1 cell resistance mechanisms associated with different envi- immunity with 30-50% protection 28). ronments in the malaria vector Anopheles gambiae:a case study in Tanzania. Malar J, 2014; 13: 28. A public health concern, is the ability of CpG 5) Caminade C, Kovats S, Rocklov J, et al: Impact of climate adjuvants to cause autoimmune disease. These are change on global malaria distribution. Proc Natl Acad Sci U S A, 2014; 111: 3286-3291. in part based on observations that infections can 6) Fowkes FJ, Simpson JA, Beeson JG: Implications of the trigger some autoimmune diseases and pattern licensure of a partially efficacious malaria vaccine on evaluating second-generation vaccines. BMC Med, 2013; recognition receptors are capable of breaking 11: 232. tolerance in animal models 26) 44). The occurrence of 7) Palacpac NM, Arisue N, Tougan T, Ishii KJ, Horii T: Wegeners Granulomatosis (an autoimmune vasculi- Plasmodium falciparum serine repeat antigen 5 (SE36) as a malaria vaccine candidate. Vaccine, 2011; 29: tis affecting the lungs and kidneys) was reported in 5837-5845. a volunteer who received a recombinant hepatitis B 8) Alam A, Chauhan VS: Inhibitory potential of prodomain of Plasmodium falciparum protease serine repeat vaccine adjuvanted with the oligonucleotide ISS antigen 5 for asexual blood stages of parasite. PLoS One, (TGACTGTGAACGTTCGAGATGA) 45). How- 2012; 7: e30452. 9) Kanodia S, Kumar G, Rizzi L, et al: Synthetic peptides ever, it is also noted that specific antigen-adjuvant derived from the C-terminal6kDa region of Plasmo- combinations can influence both safety and immune dium falciparum SERA5 inhibit the enzyme activity and responses. What we know now is that TLR9 binding malaria parasite development. Biochim Biophys Acta, 2014; 1840: 2765-2775. is influenced partly by specific base sequences, as 10) Arisue N, Kawai S, Hirai M, et al: Clues to evolution of well as the sugar phosphate backbone, conjugation the SERA multigene family in 18 Plasmodium species. PLoS One, 2011; 6: e17775. to the antigen and dose of the antigen, as well as 11) Stallmach R, Kavishwar M, Withers-Martinez C, et al: administration route and schedule 21) 28) 42) 44)-47). Plasmodium falciparum SERA5 plays a non-enzymatic role in the malarial asexual blood-stage lifecycle. Mol These highlight considerations on careful formula- Microbiol, 2015; 96: 368-387. tion and evaluation of the antigen with CpG ODN. 12) Aoki S, Li J, Itagaki S, et al: Serine repeat antigen Further clinical studies would assess these con- (SERA5) is predominantly expressed among the SERA multigene family of Plasmodium falciparum, and the cerns, especially with the advent of some in vitro acquire antibody titers correlate with serum inhibition of assays that can be predictors of in vivo toxicity or, the parasite growth. J BiolChem, 2002; 277: 47533- 47540. whenever possible, assay for extensive T-cell 13) Okech BA, Nalunkuma A, Okello D, et al: Natural profiling 32). Research and clinical trials to answer human immunoglobulin G subclass responses to Plasmo- dium falciparum serine repeat antigen in Uganda. Am J whether the CpG adjuvants cause autoimmune Trop Med Hyg, 2001; 65: 912-917. diseases or not are underway. 14) Okech B, Mujuzi G, OgwalA, Shirai H, Horii T, Egwang TG: High titers of IgG antibodies against Plasmodium falciparum serine repeat antigen 5 (SERA5) are associ- Acknowledgments ated with protection against severe malaria in Ugandan children. Am J Trop Med Hyg, 2006; 74: 191-197. 15) Horii T, Shirai H, Jie L, et al: Evidences of protection We thank all collaborators in these studies: Ken J against blood-stage infection of Plasmodium falciparum Ishii, Taiki Aoshi, Cevayir Coban, Yuko Katakai, by the novelprotein vaccine SE36. ParasitolInt, 2010; 59: 380-386. Chieko Kai, Yasuhiro Yasutomi, and other members 16) Yagi M, Bang G, Tougan T, et al: Protective epitopes of from the Department of Molecular Protozoology, the Plasmodium falciparum SERA5 malaria vaccine Research Institute for MicrobialDiseases, Osaka reside in intrinsically unstructured N-terminal repeti- tive sequences. PLoS One, 2014; 9: e98460. University, Osaka, Japan. 17) Palacpac NM, Ntege E, Yeka A, et al: Phase 1b randomized trial and follow-up study in Uganda of the blood-stage malaria vaccine candidate BK-SE36. PLoS References One, 2013; 8: e64073. 18) Sirima SB, Nébié I, Ouédraogo A, et al: Safety and immunogenicity of the Plasmodium falciparum mero- 1) Zelman B, Kiszewski A, Cotter C, Liu J: Costs of zoite surface protein-3 long synthetic peptide eliminating malaria and the impact of the global fund in (MSP3-LSP) malaria vaccine in healthy, semi-immune 34 countries. PLoS One, 2014; 9: e115714. adult males in Burkina Faso, West Africa. Vaccine, 2007; 2) KimY, Schneider KA: Evolution of drug resistance in 25: 2723-2732. malaria parasite populations. Nature Education Knowl- 19) Sirima SB, Tiono AB, Ouédraogo A, et al: Safety and edge, 2013; 4: 6. immunogenicity of the malaria vaccine candidate MSP3 3) Ashley EA, Dhorda M, Fairhurst RM, et al: Tracking long synthetic peptide in 12-24 months-old Burkinabe resistance to artemisinin collaboration (TRAC). Spread children. PLoS One, 2009; 4: e7549. (Erratum in: PLoS of artemisinin resistance in Plasmodium falciparum One. 2010; 5 (4) ) malaria. N Engl J Med, 2014; 371: 411-423. 20) Levast B, Awate S, Babiuk L, Mutwiri G, Gerdts V, van 4) Nkya TE, Akhouayri I, Poupardin R, et al: Insecticide
368 Juntendo MedicalJournal 61(4), 2015
Drunen Littel-van den Hurk S: Vaccine potentiation by 4: 407. combination adjuvants. Vaccines, 2014; 2: 297-322. 38) Tougan T, Aoshi T, Coban C, et al: TLR9 adjuvants 21) Shirota H, Klinman DM: Recent progress concerning enhance immunogenicity and protective efficacy of the CpG DNA and its use as a vaccine adjuvant. Expert Rev SE36/AHG malaria vaccine in nonhuman primate Vaccines, 2014; 13: 299-312. models. Hum Vaccin Immunother, 2013; 9: 283-290. 22) Halperin SA, Van Nest G, Smith B, Abtahi S, Whiley H, 39) Verthelyi D, Kenney RT, Seder RA, Gam AA, Friedag B, Eiden JJ: A phase I study of the safety and immunoge- Klinman DM: CpG oligodeoxynucleotides as vaccine nicity of recombinant hepatitis B surface antigen adjuvants in primates. J Immunol, 2002; 168: 1659-1663. co-administered with an immunostimulatory phosphor- 40) Scheiermann J, Klinman DM: Clinical evaluation of CpG othioate oligonucleotide adjuvant. Vaccine, 2003; 21: oligonucleotides as adjuvants for vaccines targeting 2461-2467. infectious diseases and cancer. Vaccine, 2014; 32: 6377- 23) Krieg AM: CpG motifs: the active ingredient in bacte- 6389. rialextracts? Nat Med, 2003; 9: 831-835. 41) Coban C, Ishii KJ, Sullivan DJ, Kumar N: Purified 24) Murad YM, Clay TM, Lyerly HK, Morse MA: CPG-7909 malaria pigment (hemozoin) enhances dendritic cell (PF-3512676, ProMune) : toll-like receptor-9 agonist in maturation and modulates the isotype of antibodies cancer therapy. Expert Opin BiolTher, 2007; 7: 1257- induced by a DNA vaccine. Infect Immun, 2002; 70: 1266. 3939-3943. 25) Vollmer J, Krieg AM: Immunotherapeutic applications 42) Wang W, Manmohan Singh M: Selection of adjuvants of CpG oligodeoxynucleotide TLR9 agonists. Adv Drug for enhanced vaccine potency. World J Vaccines, 2011; Deliv Rev, 2009; 61: 195-204. 1: 33-78. 26) Bode C, Zhao G, Steinhagen F, Kinjo T, Klinman DM: 43) Tanabe K, Arisue N, Palacpac NM, et al: Geographic CpG DNA as a vaccine adjuvant. Expert Rev Vaccines, differentiation of polymorphism in the Plasmodium 2011; 10: 499-511. falciparum malaria vaccine candidate gene SERA5. 27) Roman M, Martin-Orozco E, Goodman JS, et al: Immu- Vaccine, 2012; 30: 1583-1593. nostimulatory DNA sequences function as T helper-1- 44) Mohan T, Verma P, Rao DN: Noveladjuvants & promoting adjuvants. Nat Med, 1997; 3: 849-854. delivery vehicles for vaccines development: a road 28) Coffman RL, Sher A, Seder RA: Vaccine adjuvants: ahead. Indian J Med Res, 2013; 138: 779-795. putting innate immunity to work. Immunity, 2010; 33: 45) Cooper C, Mackie D: Hepatitis B surface antigen-1018 492-503. ISS adjuvant-containing vaccine: a review of 29) Yamamoto S, Yamamoto T, Kataoka T, Kuramoto E, HEPLISAVTM safety and efficacy. Expert Rev Vaccines, Yano O, Tokunaga T: Unique palindromic sequences in 2011; 10: 417-427. synthetic oligonucleotides are required to induce INF 46) Jones TR, Obaldia N 3rd, Gramzinski RA, et al: and augment INF-mediated natural killer activity. J Synthetic oligodeoxynucleotides containing CpG motifs Immunol, 1992; 148: 4072-4076. enhance immunogenicity of a peptide malaria vaccine in 30) Krieg AM, Yi AK, Matson S, et al: CpG motifs in Aotus monkeys. Vaccine, 1999; 17: 3065-3071. bacterialDNA trigger direct B-cellactivation.Nature, 47) Aebig JA, Mullen GE, Dobrescu G, et al: Formulation of 1995; 374: 546-549. vaccines containing CpG oligonucleotides and alum. J 31) Pinzon-Charry A, McPhun V, Kienzle V, et al: Low ImmunolMethods, 2007; 323: 139-146. doses of killed parasite in CpG elicit vigorous CD4+ T cell 48) Kumar S, Jones TR, Oakley MS, et al: CpG oligodeoxynu- responses against blood-stage malaria in mice. J Clin cleotide and Montanide ISA 51 adjuvant combination Invest, 2010; 120: 2967-2978. enhanced the protective efficacy of a subunit malaria 32) Chia WN, Goh YS, Rénia L: Novelapproaches to identify vaccine. Infect Immun, 2004; 72: 949-957. protective malaria vaccine candidates. Front Microbiol, 49) Miura K, Keister DB, Muratova OV, Sattabongkot J, Long 2014; 5: 586. CA, Saul A: Transmission-blocking activity induced by 33) Sagara I, Ellis RD, Dicko A, et al: A randomized and malaria vaccine candidates Pfs25/Pvs25 is a direct and controlled Phase 1 study of the safety and immunogenic- predictable function of antibody titer. Malar J, 2007; 6: 107. ity of the AMA1-C1/Alhydrogel + CPG 7909 vaccine for 50) Mullen GE, Ellis RD, Miura K, et al: Phase 1 trialof Plasmodium falciparum malaria in semi-immune Malian AMA1-C1/Alhydrogel plus CPG 7909: an asexual adults. Vaccine, 2009; 27: 7292-7298. blood-stage vaccine for Plasmodium falciparum malaria. 34) Ellis RD, Martin LB, Shaffer D, et al: Phase 1 trialof the PLoS One, 2008; 3: e2940. Plasmodium falciparum blood stage vaccine MSP1 (42) 51) Ellis RD, Mullen GE, Pierce M, et al: A Phase 1 study of -C1/Alhydrogel with and without CPG 7909 in malaria the blood-stage malaria vaccine candidate AMA1-C1/ naïve adults. PLoS One, 2010; 5: e8787. Alhydrogel with CPG 7909, using two different formula- 35) Duncan CJ, Sheehy SH, Ewer KJ, et al: Impact on tions and dosing intervals. Vaccine, 2009; 27: 4104-4109. malaria parasite multiplication rates in infected volun- 52) Traore B, Koné Y, Doumbo S, et al: The TLR9 agonist teers of the protein-in-adjuvant vaccine AMA1-C1/ CpG fails to enhance the acquisition of Plasmodium Alhydrogel+CPG 7909. PLoS One, 2011; 6: e22271. falciparum-specific memory B cells in semi-immune 36) McCluskie MJ, Weeratna RD, Evans DM, Makinen S, adults in Mali. Vaccine, 2009; 27: 7299-7303. Drane D, Davis HL: CpG ODN and ISCOMATRIX 53) Ellis RD, Wu Y, Martin LB, et al: Phase 1 study in adjuvant: a synergistic adjuvant combination inducing malaria naïve adults of BSAM2/Alhydrogel® + CPG strong T-Cell IFN-γ responses. Biomed Res Int, 2013; 7909, a blood stage vaccine against P. falciparum 2013: 636847. malaria. PLoS One, 2012; 7: e46094. 37) Pérez O, Romeu B, Cabrera O, et al: Adjuvants are key factors for the development of future vaccines: lessons from the Finlay adjuvant platform. Front Immunol, 2013;
369 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 370-377
Challenging Malaria Control: Do Our New Genetic Tools Pave the Way for Malaria Eradication?
MAKOTO HIRAI＊,TOSHIHIRO MITA＊
＊Department of Molecular and Cellular Parasitology, Juntendo University Graduate School of Medicine, Tokyo, Japan
Malaria is caused bythe Plasmodium genus in the phylum Apicomplexa, and P. falciparum is the most malignant parasite species. Because the malaria parasite possesses antigenic variation through a varietyof gene families, it can evade human immune surveillance, which makes vaccine development difficult. In addition, the parasite quicklyacquires drug resistance/tolerance to existing antimalarial drugs bymutating its genome and changing its gene expression levels. In this context, there is no effective vaccine or drug available for malaria control. In 2002, sequencing of P. falciparum genome was completed and it appears that approximately5,300 genes are coded in its genome, of which 60% have unknown function. Because genetic manipulations such as knock-in, knockout and the transient expression of foreign genes are applicable to the Plasmodium species, we anticipate that understanding of the parasite biologywill be accelerated and that the accumulated knowledge will soon lead to identification of new vaccine targets or drugs. However, the malaria burden still threatens human life because the current genetic tools are not sufficient to unravel Plasmodium biology; thus, novel genetic tools are necessary. Recently, we have succeeded in the creation of“malaria mutator”.Malaria mutator showed a mutation rate that was 80 times higher than that of the wild-type parasite. We readily isolated drug-resistant parasites from the malaria mutator libraryin a few rounds of screening. Whole-genome sequencing and subsequent single nucleotide polymorphism (SNP) analysis identified candidate causative gene mutations for drug resistance. In this review, we introduce our malaria mutator and discuss its usefulness for Plasmodium biologyresearch compared with conventional tools. We describe our recent attempt to deepen our understanding of Plasmodium biology, including drug resistance and immune evasion byusing malaria mutator. Key words: malaria parasite, drug resistance, mutator
Introduction Africa in 2012 (http://www.who.int/malaria/publi cations/world_malaria_report_2014/wmr-2014-no- Malaria is one of three major infectious diseases profiles.pdf?ua = 1). Although scientists have been of the world, and over one-third of the worldʼs searching for a potent weapon to eradicate malaria, population is estimated to be at risk of contracting the disease remains a life-threatening burden. malaria 1). Malaria is caused bya protozoan parasite There are two possible reasons whymalaria from the genus Plasmodium. The species that are remains a global health crisis. The malaria parasite infectious to human are P. falciparum, P. vivax, possesses antigenic variation through a varietyof P. ovale, P. malariae and P. knowlesi. Of these, gene families 2). These are the so-called“smoke P. falciparum is the most virulent parasite species. screen molecules”bywhich the parasite evades Infection with P. falciparum is responsible for the human immune surveillance. Given that the para- death of 627, 000 people, mostlypregnant women site utilizes many types of smoke screen molecules, and children under age of five, in sub-Saharan creating an effective vaccine is enormouslydifficult.
Corresponding author: Makoto Hirai Department of Molecular and Cellular Parasitology, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-5802-1043 FAX: +81-3-5800-0476 E-mail: [email protected] 〔Received June 15, 2015〕
370 Juntendo Medical Journal 61(4), 2015
The second reason is that the parasite has suc- ance, pathogenicityand transmission of Plasmo- cessfullyacquired resistance to all existing antima- dium. larial drugs. This resistance is conferred bygene mutations or changes in gene expression levels in Life cycle of the malaria parasite the parasite 3). Once the parasite acquires resistance to one drug, the same drug is no longer used in The human malaria parasite is transmitted by malaria treatment because a population of drug- anopheline mosquitos (Figure-1). When a malaria- resistant parasites would selectivelypredominate infected female mosquito bites a human, the over wild-type (drug-sensitive) parasites, ulti- Plasmodium“sporozoite”is injected with saliva matelyresulting in the failure of malaria treatment. under the skin, where it enters into a blood vessel. For these reasons, scientists have been forced to Subsequently, the sporozoite undergoes transition develop/seek a new drug each time a new drug- to“liver stage” (also known as the exo-erythro- resistant parasite emerges. Thus, we need to create cytic stage), during which the sporozoite invades a novel strategyfor malaria control that is not just hepatocytes and asymptomatically multiplies to seeking drugs and vaccines. Greater insight into tens of thousands of“merozoites”.In P. falciparum, Plasmodium biologymayprovide a new Achilles this liver stage is completed in roughly 7 to 10 days. heel and lead to the discoveryof a new strategyfor The mature merozoite enters into circulation and malaria control. proceeds to“erythrocytic stage”.The merozoite In this review, we first introduce basic aspects of infects an erythrocyte and develops into a ring, a the malaria parasite, namely, its life cycle. Next, we trophozoite and finallyto a schizont in which 8 to 32 describe the reason whythe malaria control is merozoites are produced. The mature merozoites extremelydifficult, focusing specificallyon the issue rupture the schizont and infect new erythrocytes. of drug-resistant parasites. Finally, we introduce The erythrocytic stage is repeated cyclically, and it the new molecular weapon named as malaria takes different time periods for one cycle in each mutator bywhich we are attempting to uncover parasite species. In P. falciparum, it takes 48 hours molecular mechanisms that regulate drug resist- for one cycle. At the moment of merozoite invasion
Mosquito Stage 1 Liver Stage （sexual stage）
2
3 8
6 74
♂ ♀ 5 Sexual Stage
Blood Stage
Figure-1 Life cycle of the human malaria parasite The parasite life cycle is initiated by blood sucking of infected anopheline mosquito to human. The sporozoite (1) is injected to the vertebrate during blood meal. The sporozoite enters to and multiplies in hepatocyte. Mature merosome (2) containing merozoite inside is released into blood circulation and merozoite (3) infects to erythrocyte. After infection to erythrocyte, merozoite differentiates to ring (4), trophozoite (5) and schizont (6). The mature schizont ruptures erythrocyte membrane and merozoite (7) is released and it infects to new erythrocyte. Small population of parasites differentiates to gametocytes (8), and sexual reproduction takes place in the mosquito.
371 Hirai, et al: New genetic tool for malaria biology
into the erythrocyte, the host immunity attacks the emergence of artemisinin-resistant parasites in the parasite and causes malaria symptoms. Apart from border of Thailand and Cambodia 7). Researchers asexuallyproliferating parasites, a small part of the are now seeking a new class of drug that can parasite population differentiates to male/female replace artemisinin. Even when new drugs are gametocytes. When gametocytes are introduced discovered, researchers will be forced to find into a mosquito during blood sucking, theydifferen- additional new classes of drugs because the parasite tiate to gametes, fuse (fertilize) and differentiate will acquire tolerance. To escape from this cycle, it into ookinetes in the luminal side of the mosquito is quite important to uncover the molecular midgut. The motile ookinete penetrates midgut mechanisms behind parasite drug resistance, rather cells and arrives to the basal side of midgut, where than just screening new drug candidates. The it transforms to an oocyst. In the oocyst, thousands malaria parasite acquires drug resistance by of sporozoites are produced. The sporozoite rup- increasing copynumber, changing expression level tures the oocyst and finally migrates to the salivary or mutating of the drug target genes 3). In this gland, where it waits for the next chance for trans- context, elucidating the molecular mechanisms mission to humans. behind these phenomena will provide crucial information for controlling drug-resistant parasites. Emergence of drug-resistant parasites and In this context, genetic manipulation should be a obstacles for malaria control powerful strategyto dissect the molecular machi- nerythat underlies parasite drug resistance. In the While preventive measures such as insecticide following section, we introduce the genetic tools and bed nets are important for malaria control, available for Plasmodium and discuss their useful- chemotherapyhas been one of the most effective ness and potential limitations for drug resistance ways to control symptoms and eliminate parasites. research. However, as in the case of other pathogenic microbes, malaria parasites have acquired drug Genetic tools for Plasmodium resistance soon after new treatments are intro- duced. As an example, atovaquone-resistant It is clear that greater insight into Plasmodium P. falciparum was identified in one area in the same biologyfacilitates the identification and character- year when atovaquone was introduced in that ization of novel targets for vaccine and drug region 4). Similarly, P. falciparum acquired resist- development. Genetic manipulations such as gene ance to chloroquine, pyrimethamine, sulfadoxine knock-in, knockout and transient/stable expression and mefloquine shortlyafter these chemicals were have been utilized and have provided enormous introduced for malaria treatment 5). This is a serious amounts of information, especiallyin the identifica- issue in malaria control and makes malaria chemo- tion of critical genes in the Plasmodium life cycle. therapyextremelydifficult. To find new antimalar- Transfection of Plasmodium is performed by ial drugs, researchers have screened traditional electroporation of plasmid DNA to blood-stage medicines that cured rodent and simian malaria and parasites when the genome is haploid. An intro- discovered artemisinin from the sweet wormwood duced circular plasmid replicates episomallyin the plant, Artemisia annua 6). Currently, artemisinin and parasite and expresses a foreign gene in the its derivatives are used as a first-line treatment presence of selectable drug pressure. When a with partner drugs such as lumefantrine, pipera- plasmid contains a nucleic acid sequence partially quine and amodiaquine in patients infected with identical to a target gene, the entire DNA plasmid is P. falciparum. This is termed artemisinin-based integrated into the parasite genome byhomologous combination therapy(ACT). Artemisinin mono- recombination, therebypermitting the mutation or therapyis not recommended because it risks the disruption of a gene of interest. Gene knockout is emergence of artemisinin-resistant parasites. impossible for genes with functions that are crucial Recently, there have been increasing cases report- for the blood-stage parasite because the disruption ing that artemisinin monotherapyand ACT are of such genes is lethal. To solve this issue, condition- losing their effectiveness, thus indicating the al knockout systems have been engineered and
372 Juntendo Medical Journal 61(4), 2015
allow researchers to analyze the function of a gene resistance seems to be matured. The remaining of interest at blood stages 8). fundamental issue facing us is how to obtain a There are manyreports speculating the relation parasite with“stable drug resistance”. between drug resistance and causative gene mutation, but onlya handful of papers validate the Difficulty in establishment of relation of genotype (gene mutation) and pheno- drug-resistant parasite lines type (drug resistance) experimentally. Triglia et al. provided evidence that alteration of Ala437 to Gly To facilitate research on parasite drug resistance, (A437G) in dihydropteroate synthase (DHPS) is establishing a drug-resistant parasite line is essen- the causative mutation of sulfadoxine-resistant tial. Such parasites can be isolated from patients P. falciparum 9). In this study, they generated who show delayed clearance of the parasite after transgenic P. falciparum in which the wild-type malaria treatment. P. falciparum can be maintained DHPS gene was replaced with a mutated (A437G) in in vitro culture, but it is difficult to adapt patient- one. This mutation has been detected in the derived parasites directly to a cell culture system. corresponding genes of samples from malaria In addition, such experiments require laboratory patients and has been inferred as the causative equipment, such as a sterile hood and incubator, in mutation of sulfadoxine resistance. The resulting malaria epidemic areas. Hence, establishing drug- transgenic parasite showed a 5-fold increase in resistant parasite lines from patients is challenging. sulfadoxine resistance compared with the WT- An alternative strategyis to obtain drug-resistant parasite 9). This is the first experimental evidence parasites from laboratory-adapted parasite strains. showing that a DHPS mutation indeed determines This can be undertaken byadding continuous drug sulfadoxine resistance. However, this allelic replace- pressure on parasites in in vitro culture. Ariey et al. ment bya single crossover recombination is quite isolated artemisinin-resistant P. falciparum from in challenging in P. falciparum because the efficiency vitro culture through a continuous and gradual of a recombination event at a desired position is increase in drug pressure. Whole-genome rese- extremelylow and requires, in some cases, more quencing and SNPs analysis revealed that a than a year of experimental time. Recently, genome mutation in the PF3D7_1343700 kelch propeller editing methods such as zinc finger, TALEN and domain (ʻK13-propellerʼ) gene is tightlyassociated CRISPR/CAS9 have been applied to various with artemisinin resistance 12). Although the molec- organisms 10). These methods are based on double ular mechanisms of K13-propeller mutations for stranded repair at a site where nucleases are artemisinin resistance are partiallyelucidated 13) 14), recruited to break the double strand. During the it is unlikelythat onlyK13-propeller mutations repair process, mutated donor DNA is replaced determine artemisinin resistance. Several artemisi- with an endogenous sequence. Gene mutation/dele- nin-resistant parasite lines from independent tion bygenome editing is much more efficient than experiments should be compared with each other to conventional homologous recombination. Recently, investigate whether K13-propeller mutation is the it has been reported that CRISPR/CAS9 was sole cause for artemisinin resistance. This is not an applied to P. falciparum and stable transformant easytask because Ariey et al. continued their in parasites with desired mutations were generated as vitro culture for five years to generate artemisinin early as 8 days after transfection 11). The application resistant parasite lines 12). In the following section, of genome editing allows for the easyand fast we introduce a new genetic tool that allows us to identification and validation of causative gene rapidlyand efficientlyisolate drug-resistant para- mutations that determine parasite drug resistance. sites. Once we obtain drug-resistant parasites, whole- genome resequencing and subsequent SNPs analy- Random mutagenesis of malaria parasite genome: sis would also identifycandidate gene mutations for artificial or genetic? drug resistance. Finally, genome editing provides proof of a causative gene mutation. In this context, As Ariey et al. reported, it is time consuming to molecular tools for the dissection of parasite drug isolate drug-resistant parasites from in vitro
373 Hirai, et al: New genetic tool for malaria biology
culture byadding continuous drug pressure 12). As each knockout lines will reveal which MMR gene has been employed in other model organisms, has the greatest influence on parasite mutation rate. generating a random mutant libraryand subse- In contrast to MMR, it has been reported that quentlyisolating the mutants with desired traits is disruption of proofreading activities of DNA poly- an efficient strategyto uncover the relationship merase delta and epsilon increase mutation rate as between phenotype and genotype. Random muta- much as ten-fold to >100-fold in yeast and genesis using artificial mutagens such as alkylating fungi 20) 21). Furthermore, a proofreading-based agents or irradiation maybe applicable to Plasmo- mutator system has been validated as a useful tool dium. However, it is experimentallyevident that for generating drug-resistant organisms 22). In this artificial mutagen-induced mutations are highly sense, we focused on the proofreading activity, biased. Chemical mutagens such as ethyl methane- especially that of DNA polymerase delta, because sulfonate (EMS) and N-ethyl-N-nitrosourea (ENU) disruption of its proofreading activityhas shown induce G/C to A/T transition and A to T and T to A remarkable mutator phenotypes in other organ- transversions, respectively 15). UV irradiation indu- isms 23). ces pyrimidine dinucleotide-associated C to T transitions 16). These biases maydeteriorate the Generation of malaria mutator library quality, and the isolation of mutants with the desired trait maybe unsuccessful. Even if the We utilized P. berghei, a rodent malaria parasite, isolation is successful, such mutations maybe as an experimental model because the genetic confined to an experimental model and maynot manipulation of this parasite species can be per- reproduce the mutations that actuallyoccur in the formed more efficientlycompared with P. falcipa- malaria parasite. rum. In addition, the mutator phenotype of In living organisms, spontaneous mutation is P. berghei can be analyzed at all stages of the principallygenerated during the process of DNA parasite life cycle in both mouse and mosquito. In replication, and the misincorporation or deletion of the P. berghei genome (PlasmoDB; http: //plas nucleotides is strictlycorrected bythe proofreading modb.org/plasmo/), DNA polymerase delta gene is activity of DNA polymerases or mismatch repair detected as a single copy(PBANKA_050130). The (MMR) enzymes. Of these, DNA polymerases delta two amino acids that are critical for proofreading and epsilon are involved in lagging and leading activity of DNA polymerase delta are highly strand DNA synthesis, respectively. These poly- conserved from prokaryotes to eukaryotes 21), merases possess 3´→5´ exonuclease proofreading including in P. berghei. These two amino acids were activity 17). It is conceivable that the disruption of changed to alanine bysite-directed mutagenesis. proofreading or MMR activitycan preserve muta- The resultant transgenic parasite line has been tions without correction, which in turn generates a maintained in mouse byserial passage of infected mutant parasite librarysuch that drug-resistant red blood cells (103) to a new mouse weekly, and parasites maybe easilyisolated. On the one hand, it two mutator clones were isolated after 122 pas- has been reported that disruption of PbMsh2-2 sages. Genome-wide SNP analysis of the clones gene, a member of the mismatch repair enzymes of revealed that the mutation rate of the malaria rodent malaria parasite P. berghei, did not increase mutator was 86- to 90-fold higher than that of the the mutation rate 18). P. berghei possesses 6 MMR control parasite 24). genes, and it is likelythat other MMR genes may compensate for the function of PbMsh2-2. On the Current status and future perspective of other hand, the chloroquine-resistant P. falciparum malaria mutator research lines W2, Dd2, 7C12, T9-94 and 7G8 showed defective MMR, suggesting that defective MMR Biological phenotypes of malaria parasites such as mayincrease mutation rate bywhich the chloro- drug resistance are often caused bypoint muta- quine-resistant parasite emerged 19). Further study tions. It is therefore conceptuallyacceptable that a involving, for example, the serial knockout of each malaria mutator would be a suitable tool for re- MMR gene and investigation of mutation rate for search into malaria drug resistance (Figure-2). As
374 Juntendo Medical Journal 61(4), 2015
proof of this concept, we screened the malaria showed a large proportion of similarity, which mutator and obtained a sulfadiazine-resistant indicated that few mutant clones maypredomi- parasite from the mutator libraryin two weeks. nantlyproliferate under selection pressure 24).A Whole-genome SNP analysis of the resistant clones mutant libraryconstituting various mutants will be revealed that theyhad a mutation in the DHPS useful to readily acquire novel phenotypes and gene, which is a known target for this drug. Most traits. Thus, the diversityor complexitydetermines importantly, this mutation is the same one detected the qualityof mutant library.If mouse immunityis a in the P. falciparum DHPS gene, which indicates major source for selective pressure, it could be that the rodent malaria mutator could provide valuable to test whether diversitycould be im- useful information or insight for the drug-resistant proved when the malaria mutator is maintained in research of human malaria (Hirai et al. in prepara- immune-deficient mouse. There is another limita- tion). In addition to drug resistance, a population in tion to overcome. Once the mutator parasite with the mutant libraryafter the 122 nd passage lost the novel phenotype is isolated, the accumulation of ability to produce male and female gametocytes, a further mutations in the parasite must be stopped. sexual-stage parasite. Whole-genome SNP analysis Similarly, there is a need to discern the gene revealed that a defect of ApiAP2, Plasmodium mutation as it relates to the phenotype of interest transcription factor gene, caused the gameto- from various unrelated mutations. One approach is cyte-less phenotype 24). Subsequently, it has been through a genetic cross with a wild-type parasite. reported that ApiAP2 is a central factor for malaria Through this approach, the mutated DNA polymer- sexual differentiation 25) 26). Because onlysexual- ase delta is replaced with a wild-type enzyme. stage parasites are transmitted from vertebrate to After the genetic cross, a population of progenycan mosquito, mechanisms of parasite sexual differen- be selected bythe same pressure, and several prog- tiation will provide crucial information to aid in enyclones would be subjected to whole-genome blocking transmission 27). SNP analysis. The SNP that is commonly conserved Although we succeeded in the rapid isolation of a in all progenywould be the most promising sulfadiazine-resistant parasite from a malaria candidate mutation for the phenotype. An alterna- mutator (Hirai et al. in preparation), the current tive and possiblymore rapid method is to utilize the mutator system needs to be improved. The two Plasmodium artificial chromosome (PAC). Iwa- independent mutator clones from the 122nd passage naga et al. created a P. berghei genomic PAC
Error prone DNA polymeraseδ Identification of parasite’s Achilles heel for malaria eradication
Insertion of candidate gene mutation to Lagging strand wild－type parasite by CRISPR/CAS9
SNPs analysis ・Drug resistance ・Virulence ・Vaccine ・Host determination ・Infectivity
Mutant library in mouse Library Screening
Figure-2 Creation of malaria mutator and its utilityfor malaria eradication The mutator malaria-infected mouse is used as a source of mutant library, from which a clone showing a phenotype of interest is isolated. The relation between phenotype and genotype is validated by genome edition whereby candidate mutation is introduced into wild-type parasite. A set of this experimental system identifies novel Achilles heel, a target for malaria control.
375 Hirai, et al: New genetic tool for malaria biology
library, and its estimated coverage was 19.3 Lancet, 2014; 384: 1005-1070. genome equivalents, which is sufficient coverage for 2) Joseph DS: The role of pfemp1 adhesion domain clas- functional screening 28). With this method, genera- sification in Plasmodium falciparum pathogenesis research. Mol Biochem Parasitol, 2014; 195: 82-87. tion of a genomic PAC libraryusing the mutator 3) Rosenthal PJ: The interplaybetween drug resistance clone and functional screening will accelerate the and fitness in malaria parasites. Mol Microbiol, 2013; 89: identification of gene mutations that are directly 1025-1038. involved in a novel phenotype of interest. 4) Looareesuwan S, Viravan C, Webster HK, Kyle DE, The mutator malaria parasite has been main- Hutchinson DB, Canfield CJ: Clinical studies of atova- tained byserial passage through mouse. Therefore, quone, alone or in combination with other antimalarial drugs, for treatment of acute uncomplicated malaria in deleterious mutations in genes that are essential for Thailand. Am J Trop Med Hyg, 1996; 54: 62-66. mosquito or liver stages are not eliminated, 5) Mita T, Tanabe K: Evolution of Plasmodium falciparum provided they grow in mouse erythrocytes. It might drug resistance: implications for the development and be interesting to compare SNPs of the clones before containment of artemisinin resistance. Jpn J Infect Dis, and after transmission through the mosquito. The 2012; 65: 465-475. 6) Louis HM, Xinzhuan S: Artemisinin: discoveryfrom the mutator clones possessing deleterious mutations in Chinese herbal garden. Cell, 2011; 146: 855-858. genes essential for mosquito stages must be 7) AshleyEA, Dhorda M, Fairhurst RM, et al: Spread of eliminated via passage through the mosquito. Such artemisinin resistance in Plasmodium falciparum malaria. selection and comparative SNP analysis may pro- N Engl J Med, 2014; 371: 411-423. vide information related to genes that are essential 8) OʼNeill MT, Phuong T, Healer J, Richard D, Cowman AF: for mosquito stages. Gene deletion from Plasmodium falciparum using FLP and Cre recombinases: implications for applied site- We are currentlyendeavoring to create specific recombination. Int J Parasitol, 2011; 41: 117-123. P. falciparum mutator. While P. berghei cannot be 9) Triglia T, Wang P, Sims PF, Hyde JE, Cowman AF: cultured continuously, P. falciparum could be Allelic exchange at the endogenous genomic locus in maintained in in vitro culture, making it easyto Plasmodium falciparum proves the role of dihydropter- perform experiments such as drug sensitivitytests. oate synthase in sulfadoxine-resistant malaria. EMBO J, In addition, P. falciparum would be maintained 1998; 17: 3807-3815. 10) de Koning-Ward TF, Gilson PR, Crabb BS: Advances in without immune pressure under in vitro culture. molecular genetic systems in malaria. Nat Rev Microbiol, Therefore, it is anticipated that P. falciparum 2015; 13: 373-387. mutator librarymayshow increased diversity.By 11) Ghorbal M, Gorman M, Macpherson CR, Martins RM, using these in vitro and in vivo mutator systems, we Scherf A, Lopez-Rubio JJ: Genome editing in the human hope that manymutator clones with novel pheno- malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system. Nat Biotechnol, 2014; 32: 819- types will be isolated. As a final goal, intensive 821. research using these lines will increase our under- 12) ArieyF, Witkowski B, Amaratunga C, et al: A molecular standing of Plasmodium biologyand further our marker of artemisinin-resistant Plasmodium falciparum efforts toward the elimination of malaria. malaria. Nature, 2014; 505: 50-55. 13) Dogovski C, Xie SC, Burgio G, et al: Targeting the cell Acknowledgments stress response of Plasmodium falciparum to overcome artemisinin resistance. PLoS Biol, 2015; 13: e1002132. 14) Mbengue A, Bhattacharjee S, Pandharkar T, et al:A We dedicate this review to the late Professor molecular mechanism of artemisinin resistance in Kazuyuki Tanabe (Osaka University), who guided Plasmodium falciparum malaria. Nature, 2015; 520: the malaria mutator project, and to all members 683-687. involved in this project. 15) Flibotte S, EdgleyML, ChaudhryI, et al: Whole-genome profiling of mutagenesis in Caenorhabditis elegans. Genetics, 2010; 185: 431-441. References 16) Belfield EJ, Gan X, Mithani A, et al: Genome-wide analysis of mutations in mutant lineages selected 1) MurrayCJ, Ortblad KF, Guinovart C, et al: Global, following fast-neutron irradiation mutagenesis of Arabi- regional, and national incidence and mortalityfor hiv, dopsis thaliana. Genome Res, 2012; 22: 1306-1315. tuberculosis, and malaria during 1990-2013: A system- 17) Morrison A, Sugino A: The 3ʼ-->5ʼ exonucleases of both atic analysis for the global burden of disease study 2013. DNA polymerases delta and epsilon participate in
376 Juntendo Medical Journal 61(4), 2015
correcting errors of DNA replication in Saccharomyces 1315-1326. cerevisiae. Mol Gen Genet, 1994; 242: 289-296. 23) Furusawa M: Implications of fidelitydifference between 18) Bethke L, Thomas S, Walker K, Lakhia R, Rangarajan R, the leading and the lagging strand of DNA for the Wirth D: The role of DNA mismatch repair in generat- acceleration of evolution. Front Oncol, 2012; 2: 144. ing genetic diversityand drug resistance in malaria 24) Honma H, Hirai M, Nakamura S, et al: Generation of parasites. Mol Biochem Parasitol, 2007; 155: 18-25. rodent malaria parasites with a high mutation rate by 19) Castellini MA, Buguliskis JS, Casta LJ, et al: Malaria destructing proofreading activity of DNA polymerase drug resistance is associated with defective DNA delta. DNA Res, 2014; 21: 439-446. mismatch repair. Mol Biochem Parasitol, 2011; 177: 143- 25) Kafsack BF, Rovira-Graells N, Clark TG, et al:A 147. transcriptional switch underlies commitment to sexual 20) Fortune JM, Pavlov YI, Welch CM, Johansson E, Burgers development in malaria parasites. Nature, 2014; 507: PM, Kunkel TA: Saccharomyces cerevisiae DNA poly- 248-252. merase delta: high fidelityfor base substitutions but 26) Sinha A, Hughes KR, Modrzynska KK, et al: A cascade lower fidelityfor single- and multi-base deletions. J Biol of DNA-binding proteins for sexual commitment and Chem, 2005; 280: 29980-29987. development in Plasmodium. Nature, 2014; 507: 253- 21) Simon M, Giot L, Faye G: The 3ʼ to 5ʼ exonuclease 257. activity located in the DNA polymerase delta subunit of 27) Hirai M, Mori T: Fertilization is a novel attacking site for Saccharomyces cerevisiae is required for accurate the transmission blocking of malaria parasites. Acta replication. EMBO J, 1991; 10: 2165-2170. Trop, 2010; 114: 157-161. 22) Park EY, Ito Y, Nariyama M, Sugimoto T, Lies D, Kato T: 28) Iwanaga S, Kaneko I, Yuda M: A high-coverage artifi- The improvement of riboflavin production in Ashbya cial chromosome libraryfor the genome-wide screening gossypii via disparity mutagenesis and DNA micro- of drug-resistance genes in malaria parasites. Genome array analysis. Appl Microbiol Biotechnol, 2011; 91: Res, 2012; 22: 985-992.
377 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 378-388
Elimination of Lymphatic Filariasis: Roles of Research, International Cooperation, and Participation of Endemic Community Making an Unprecedented Global Program to Eliminate the Neglected Disease into a Reality
EISAKU KIMURA＊
＊Research Institute for Microbial Diseases, Osaka University, Osaka, Japan
The Global Programme to Eliminate Lymphatic Filariasis (GPELF) inaugurated in 2000 is a unique ʻadventureʼ in a sense that it targets one of the most neglected diseases at a global scale. To accomplish this ambitious program, not only health professionals but community people have been playing an essential role in distributing a huge number of antifilarial drugs. Approximately 500 million people are treated annually worldwide, including numberless ʻneglectedʼ people in remote rural areas. GPELF is said to be one of the most rapidly expanding global health programs in the history of public health. With its cost-effective, systematic mechanism, 60 of 73 endemic countries are conducting national ʻmass drug administrationʼ campaign, and 15 of them are now close to the elimination of filariasis. How can this kind of program be implemented and maintained for more than a decade? What are the achievements and their public health and scientific implications? This review summarizes these topics with emphasis on key researches and field operations which have facilitated this unprecedented program. Key words: Global Programme to Eliminate Lymphatic Filariasis (GPELF), ICT rapid diagnostic test, diethylcarbamazine (DEC), ivermectin (IVM), mass drug administration (MDA)
What is lymphatic filariasis? 13-14 days, and then, L3s invade into a new human host during mosquito bites. The life span of adults 1. Parasite reproducing Mf is about 5 years 1). There are 8 species of filarial parasite that can It is known that symbiotic bacterium, Wolbachia, mature and reproduce in a human body. Three of parasitizes filarial cells, and is vertically transmitted them (Wuchereria bancrofti, Brugia malayi and B. to progeny (Mf). Without Wolbachia, adult filariae timori) are called lymphatic filariae because their cannot survive normally and die eventually. Thus, adults parasitize the lymphatic system. W. bancrofti this bacterium, a kind of rickettsia, can be the target (W.b.) is by far the commonest among them (90% of treatment. of all infected cases), and in this review, W.b. is the species of discussion if not specified otherwise. 2. Pathology and symptoms Adult females (9 cm in length) reproduce micro- Basic pathology of lymphatic filariasis (LF) is filariae (Mf) (Figure-1A), which are 260 μm in inflammation and disturbance in lymph flow caused length, actively motile and circulate in the periph- by adult worms. The parasitized lymph vessels are eral blood at night (with some exceptions), and are dilated and branching with collaterals. The patho- sucked by vector mosquitos. Mf in the mosquitos genesis is complicated. Lymphatic endothelial cell developto infective 3rd-stage larvae (L3s) in about growth, proliferation and differentiation are stimu-
Eisaku Kimura Research Institute for Microbial Diseases, Osaka University 3-1 Yamadaoka, Suita-shi, Osaka 565-0871, Japan TEL: +81-6-6879-8279 E-mail: [email protected] 〔Received Mar. 20, 2015〕
378 Juntendo Medical Journal 61(4), 2015
A (from Kiseichu-gaku Tekisuto [Bunkodo, Tokyo] with permission)
B
Figure-1 Microfilaria of Wuchereria bancrofti (A) and a Japanese case with elephantiasis of the scrotum (B) [Courtesy of Prof. Yoshito Otsuji]
lated by live adults and their excretory/secretory BinaxNOW® Filariasis is an immunochromato- products, angiopoietins, matrix metalloproteinases, graphic (ICT) card test to detect circulating filarial vascular endothelial growth factors (VEGFs), etc. 2). antigen. It has been used widely due to its high In a study with human LF cases, Wolbachia is sensitivity and specificity, ease in handling in the related to the increase of VEGF-C and soluble field and very quick result (10 minutes). However, VEGFR-3 and considered as an important cause of this test is effective only for W.b. For Brugia spp., lymphatic pathology 3). the different ICT test to detect Brugia-specific IgG4 Depending on the parasitic site, pathology and antibody (Brugia Rapid test) is used 5). duration of infection, lymphedema of limb(s), funiculitis, epididymitis, orchitis, hydrocele, chyluria, 4. Treatment etc. will occur. Secondary bacterial infection espe- Antifilarial drugs used in GPELF are diethylcar- cially through injuries on the edematous skin will bamazine (DEC), ivermectin (IVM) and albenda- cause acute inflammation with high fever (acute zole (ALB). In LF only endemic areas, the dermatolymphangioadenitis), and the repeated combination of DEC at 6 mg/kg and ALB at 400 mg infections may induce thickening and abnormal is given once a year as a single dose. In parts of growth of the skin resulting in disfiguring elephantia- Africa, where LF is co-endemic with onchocercia- sis (Figure-1B). It is also shown that endotoxin-like sis, another filariasis caused by Onchocerca volvu- substance released from Wolbachia can induce lus, a single dose of IVM (150-200 μg/kg) and ALB systemic inflammatory reactions after treatment of (400 mg) is used, because DEC may cause severe B. malayi infection 4). adverse reactions with the Onchocerca infection. Mf are harmless in general, but may cause In GPELF, the annual mass drug administration allergic reactions in rare cases (tropical pulmonary (MDA) is repeated minimum 5 times. MDA is a eosinophilia). unique treatment scheme: all people at risk, includ- ing infected and non-infected people living in the 3. Diagnosis endemic areas, are included, except ineligible To detect Mf in the peripheral blood and identify people like very young children, pregnant women, the species morphologically has been the common- etc. est method of diagnosis (finger-prick blood smear Treatments of clinical cases with lymphedema/ method). However, it is cumbersome to collect elephantiasis and hydrocele are variable depending night blood, make smears and stain with Giemsa. on available health services. WHOʼs program for
379 Kimura: Global program to eliminate filariasis
morbidity management and disability prevention considered a public health problem. Operationally, a (MMDP) puts emphasis on local hygiene to prevent certain level of infection prevalence (threshold) bacterial and fungal infections. For example, was fixed, below which no more transmission would washing affected limb(s) with soapand clean occur after stopping MDAs (Mf prevalence of <1%, water, and following drying upwith a cloth is the revised in 2011 11) ). principal measure, and exercise and elevation of the The GPELF was inaugurated in 2000 with the affected limb to drain congested lymph fluid are target to accomplish the elimination by 2020. The essential supportive measures. Antibiotics are two strategic aims are (i) to interrupt transmission necessary for severe fever cases with bacterial using MDAs (repeat a minimum of 5 times), and infection. Hydrocele is treated surgically 6) 7). (ii) to alleviate suffering and disability by providing It is reported that doxycycline (DOX), which access to basic care for people with symptoms such selectively destroys Wolbachia endosymbiont, as lymphedema and hydrocele. eventually kills adult filariae, reduces plasma The magnitude of GPELF can be recognized by concentration of VEGF-C and soluble VEGFR-3, the estimation that a total of 1.4 billion people have and improves lymphatic pathologies 3). to be treated annually, covering 120 million infected people and nearly 1.3 billion non-infected people 5. Epidemiology living in the endemic areas. A 1997 paper by WHO listed 73 LF endemic Each endemic country organizes the national countries in the world. W.b. only was endemic in 65 program to eliminate LF and carries out mapping of countries, B. malayi was co-endemic with W.b.in7 endemic areas to be treated, MDAs (registration of countries and B. malayi only was endemic in people, drug delivery and evaluation of treatment Republic of Korea. All B. malayi endemic countries coverage), and follow-upsurveys to confirm the are in Asia 8). It was estimated that there were a effects of MDAs. More recently, after successful total of 119 million infected cases globally (106 MDAs in an increasing number of countries, a more million W.b. cases and 13 million B. malayi cases). systematic transmission assessment survey (TAS) India and Sub-Saharan Africa accounted for 43% has been implemented to decide when to stop MDA and 38% of the total global cases, respectively. China and, further, to confirm the elimination 11). had 5.5 million cases, occupying 5% of the global total. The number of clinical cases with hydrocele or 2. Why lymphatic filariasis was selected as a lymphedema was 43 million in total. As a whole, the target of the global elimination? prevalence in the 0-4 year age group was the In 1980, WHO proudly declared the eradication of lowest (0.5%), which gradually increased upto smallpox. Thirteen years later, the International 4.2% in the 45-59 year group. Males had 1.7 times Task Force for Disease Eradication (ITFDE) more cases than females 9). B. timori infection was selected 6 eradicable or potentially eradicable reported only on several islands in Indonesia 10). diseases after reviewing more than 90 diseases 12). The global elimination program must have They are dracunculiasis, poliomyelitis, lymphatic reduced the burden of filariasis significantly in the filariasis, mumps, rubella, and taeniasis/cysticerco- past 14 years. However, the baseline epidemiologi- sis. Here the“eradication”was defined by the task cal figure (120 million infected people) has been still force as“reduction of the worldwide incidence of a surviving in recent WHO documents. disease to zero as a result of deliberate efforts, obviating the necessity for further control meas- GPELF: the background of establishment, ures.”Lymphatic filariasis was selected as a activities and achievements potentially eradicable one, and it will be enlighten- ing to know how well LF meets the ITFDE 1. Outline of the GPELF selection criteria of eradication. The 50th World Health Assembly held in May1997 resolved to eliminate lymphatic filariasis from the Scientific feasibility (Criteria [1] to [3]) world. The“elimination”is to control the clinical [1] Epidemiological vulnerability manifestations so that the disease is no longer Transmission efficiency of lymphatic filaria is
380 Juntendo Medical Journal 61(4), 2015
very low in several respects. First, as a matter of regimens, including DEC-medicated salt, success- fact, the parasite does not multiply in mosquitos and fully reduced mf rate to < 1% throughout the humans. Second, in the vector, a large majority of province by 1983, and follow-up studies revealed Mf cannot developto infective larvae (L3s) 13), further decline of the rates, even to 0% in many though mosquito species and other factors could study sites without DEC treatment 23). In Korea, B. influence the result. Thirdly, the majority of L3s malayi was endemic countrywide with 3 major foci, released on the human skin during mosquito bites including Jeju island. Extensive DEC treatments in cannot penetrate the skin and reach to the human 1960s - early 70s successfully reduced the infection tissues for further development, and furthermore, it and in the mid-1980s, it was considered that filarial takes > 8 months for L3s to mature, mate and transmission had been almost ceased except in reproduce in human body 14). Finally, the parasite groups of islands in the southwestern part of does not have animal reservoirs, indicating that Korean Peninsula 24). treatment of humans can reduce the source of infection. Relatively easy diagnosis of LF infection is Political will/Popular support (Criteria [4] to [7]) another advantage for elimination/eradication. [4] Perceived burden of the disease LF is a disease of global scale. The number of [2] Effective way of treatment patients enduring physical and mental suffering DEC has been the most effective antifilarial drug from lymphedema/elephantiasis and hydrocele was since it was introduced in 1947. It was also shown to estimated to be 43 million, and LF was ranked by be safe for use in mass chemotherapy. Before the WHO as the second important cause of permanent mid-1980s, several studies had confirmed that and long-term disability 25). Acute filarial fever also annual single-dose DEC treatment at 6 mg/kg incapacitates infected people and causes a vast loss could reduce Mf count by 80-90% 12 months after of working days. Thus, economic loss due to the treatment 15)-17), indicating that a large scale chemo- disease is huge: in India alone, it was estimated that therapy in endemic areas is feasible. On another a minimum of US$ 842 million were lost to patients front, DEC, which is tasteless, odorless and heat- and households/year from treatment costs and loss resistant, was shown to be effective when mixed of working days 26). with cooking salt and taken daily at a very low dosage. The DEC-medicated salt was employed [5] Cost of eradication successfully in China as a simple and safe mass Any eradication program should cost tremen- treatment of a large population 18). Fortunately, no dously. However, this cost can be balanced by the drug resistance has been confirmed with DEC so benefit the eradication will bring about, which can far. also be enormous due to its scale. In India, the above IVM, which had been used for onchocerciasis mentioned economic loss (US$ 842 million) was mass treatment before GPELF was implemented, estimated to be far more costly than carrying out was tested for LF treatment, and the efficacy to kill dozens of annual MDA with DEC. On the other Mf and the safety were confirmed 19) 20). hand, there was a favorable environment for a LF elimination program: Merck & Co. was donating [3] Demonstrated feasibility of elimination IVM for onchocerciasis mass therapy in West Elimination of filariasis had been reported in Africa since 1986 (Mectizan® Donation Program), several Asian countries. In Japan, the disease was and community people were supporting the drug highly endemic especially in the southern parts. distribution. The government-supported nationwide control initiative started in 1962 with DEC mass treatment [6] Synergy of eradication efforts with other (including Mf positive people only), and success- interventions fully eliminated the infection by around 1978 21). Most of the helminthic infections can be cured In China, there are many success stories 22). For easily by taking medicine, but hundreds of millions example, in Shandong province, the antifilariasis of people continue suffering from them. A program campaign in 1970-1983 based on various DEC to eliminate LF globally is a real challenge to such
381 Kimura: Global program to eliminate filariasis
gloomy reality in the history of health services. If total of > 1.9 billion doses were given through successful, the implication will be tremendous: annual MDAs. These treatments reduced LF based on the experiences obtained, all neglected transmission progressively, and stopped new infec- diseases will be re-evaluated and new challenges tions. As a result, it was estimated that 6.6 million can be organized to combat the problems. In fact, newborns had been protected from contracting later in 2005, WHO set up the Department of filariasis, and this would prevent 1.4 million Neglected Tropical Diseases (NTDs), and now hydrocele and 0.8 million lymphedema cases in NTDs are a big health topic, for which government their lifetimes. Also, 9.5 million infected but agencies, NGOs, companies, etc. have been collabo- subclinical cases were protected from developing a rating 27). total of 6 million hydrocele or 3.5 million lymphe- dema. Altogether, an estimate of 32 million DALYs [7] Necessity for eradication rather than control (Disability Adjusted Life Years) were averted 28). LF is not a fatal disease and drug treatments can The economic impact of the first 8 years of prevent the infection. The disease may even GPELF was also analyzed. It was estimated that disappear as living conditions improve. Considering US$ 21.8 billion of direct benefit would be gained misery of clinical cases being ignored, it would be over the lifetime of 31.4 million individuals treated, reasonable to start elimination program quickly which include children born into areas freed of LF rather than preparing for eradication, which is transmission, and already infected people benefitted much more challenging. from the program. In addition, the health systems of endemic countries could save US$ 2.2 billion. It is 3. Achievements by GPELF concluded that GPELF is an excellent investment in First of all, it was confirmed that 5 rounds of global health 29). This owes much to generous annual MDA could reduce Mf load in the endemic donation of antifilarial drugs by pharmaceutical population significantly: Of 68 pre-selected sentinel companies. sites to monitor treatment efficacy, the MDAs WHO summarized the achievements at the reduced the Mf prevalence to zero in 43 (63%) halfway point of the program, covering the years sites. During the first 8 years of GPELF from 2000 to 2009 30). In this report, the number of (2000-2007), a minimum of 570 million individuals in endemic countries is 83. China and Korea declared 48 endemic countries were treated, or accumulated the elimination in 2007 and 2008 respectively. Of
600 No. of people treated（all medicines＊） 60 No. of people treated with combination of 2 medicines No. of countries delivering MDA 500 50
400 40
300 30
200 20 No. of countries
No. of people treated（millions） 100 10
－ － 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Year ＊Before 2009, some countries such as India used only DEC for MDA. [Source: ref. No. 32]
Figure-2 No. of people receiving treatment through mass drug administration (MDA) for lymphatic filariasis and number of countries delivering MDA, 2000‒2012
382 Juntendo Medical Journal 61(4), 2015
remaining 81 endemic countries, 68 had completed annual scheme is the most important basis for the mapping of endemic foci, and 10 of the 68 were global elimination program. considered unnecessary to implement MDA due to extremely low transmission levels. In 2009, 53 2. MDA by community members countries were implementing MDA and 37 of them MDA has a definite advantage: time-consuming have completed 5 or more rounds of annual MDA and costly night blood surveys to identify infected (nationwide or partially). Meanwhile, the progress people are not necessary. On the contrary, a huge of morbidity management program was delayed. number of people have to be treated: a total of 1.4 Only 27 endemic countries had implemented the billion people globally. How can MDAs be carried program. out when many endemic communities are in remote According to the latest WHO report on GPELF 31), areas without established health services? This is a in 2013, out of the 73 endemic countries, 60 have very serious problem especially in sub-Saharan started implementing MDA, and 15 of them have Africa. moved to the post-MDA surveillance phase, which An epoch-making study was carried out in is the first steptoward declaring the elimination. 1995-96 in 5 African countries, where onchocercia- sis is endemic, and annual MDAs with IVM were ALB and IVM are well known drugs for soil- conducted by the onchocerciasis control programs. transmitted helminthiasis (STH). Between 2000- Using a total of 153 villages, the study compared 2007, GPELF concomitantly treated 56.6 million two different methods of drug distribution: one children and 44.6 million women-of-childbearing designed by community people and the other age, improving nutritional status, anemia, and other designed by experienced program staff. The study health conditions 28). After this evaluation, the revealed that the community-designed treatment, treatment data between 2009 and 2011 show that carried out by drug distributers selected by each approximately 500 million people were treated community, was not only feasible but more efficient annually, implying enormous impact of MDAs not than the program-designed one 39). It is probable only on LF but STH-related health problems that people are more motivated when they can (Figure-2) 32). decide and act themselves than they were instructed what to do by outsiders. Community Important researches and operations contributed directed treatment with ivermectin (CDTI) has for the successful execution of the global program become the platform for onchocerciasis control, and the system has been adopted in LF elimination and 1. Annual single-dose treatment with DEC other mass treatment programs in Africa particu- Before the mid-1980s, it was almost the must to larly. The drug distributers have evolved gradually give DEC at 6 mg/kg, 12 times to make the total into reliable health manpower in remote areas, and dosage of 72 mg/kg 33) 34). In practice, this was a very are playing essential role in distributing vitamin A difficult regimen to carry out in most endemic supplement, anti-malarial bednets, anti-helminth countries. Several earlier studies reported very drugs, etc. 40). high efficacy of a single dose DEC at 6 mg/kg, that is, the mean Mf count reduced by 91.4% in Brazil 15), 3. Donation of antifilarial drugs by pharmaceuti- 80% in French Polynesia 16) and 94.4% in Samoa 17) cal companies when assessed 12 months after treatment. A report The stable supply of drugs is the most crucial from Fiji compared a course of 5 annual MDAs at 6 requirement for the global program, and it is the mg/kg (total dosage 30 mg/kg) with a 28-dose most costly process too. Two pharmaceutical com- DEC treatment spread in 2 years at 5 mg/kg (total panies helped in removing the barrier. In 1998, dosage 140 mg/kg), and obtained 87% reduction in SmithKline Beecham (GlaxoSmithKline since 2001) Mf prevalence in the former scheme and 93% started collaboration with WHO, and donating reduction in the latter 35). The practical value of ALB for GPELF free of charge for as long as it is annual single-dose treatment had been accepted needed for the elimination program 27). As men- gradually by the mid-1990s 36)-38), and now the tioned before, the combination of ALB adds extra
383 Kimura: Global program to eliminate filariasis
significance to GPELF: each MDA cures highly pathology, pathogenesis, diagnosis and treatment 46). endemic intestinal parasites. The dance sign is particularly valuable to judge The next year, Merck & Co., Inc. decided to whether adult worms are alive or dead after donate IVM for African LF programs, where treatment 47), and can be utilized in the development onchocerciasis is co-endemic. Donation of DEC by of a new drug capable of killing the adults in a Eisai Co., Ltd. (Japan) has given an additional human body. As will be discussed later, GPELF has strong impetus for GPELF. The delivery started in been eager to find such a drug. October 2013, and the company is to donate 2.2 billion DEC tables in 2013-2020. Recent and future researches/operations
4. Immunochromatographic (ICT) antigen test for 1. Diagnosis the diagnosis of filariasis ICT card tests to detect W.b. antigen (Binax A convenient rapid diagnostic test had been NOW® Filariasis) have been an indispensable tool awaited to facilitate GPELF activities. ICT Filariasis for the global program, but with some inconvenien- test (ICT Diagnostics, Australia) to detect circulat- ces: short shelf life under tropical climate, false ing W.b. antigen appeared just in time for the global positive results if not read at the indicated time, and program 41). To make accurate diagnosis in the high cost. Long efforts to improve the antigen test daytime in only 15 minutes was a kind of miracle for have finally produced a new generation product, field workers. For more than a decade, the rapid Alere Filariasis Test Strip(Alere Scarborough, Inc.), diagnostic test (presently BinaxNOW® Filariasis which has a longer shelf life at ambient tempera- card test is used) has been playing a key role in ture, and reported to be more sensitive and easier to GPELF: prior to MDAs, it is prerequisite to read results 48). It is expected to be employed soon in delineate the target areas for the treatment, and GPELF and will facilitate the transmission assess- collect accurate pre-treatment base-line data. ment surveys (TAS). After MDAs, the effects have to be monitored and There are other immunodiagnostic methods evaluated. The test has been particularly valuable developed for the filariasis elimination activities. in areas where diagnostic capability is not sufficient. They are not used in GPELF presently, but have practical significance in that they may become 5. Morbidity control based on basic hygiene useful tools in near future. In order to know filarial People or even doctors used to believe that transmission to humans, W.b. infective larva (L3) lymphedema/elephantiasis is incurable or too -specific antigen Wb123 is used to detect IgG difficult to treat. Bacteriological and careful clinical antibody with luciferase immunoprecipitation sys- studies broke down the ʻsuperstitionʼ. The studies tem. The Wb123-based assay is useful to detect found that repeated bacterial infections are the exposure to W.b. infection, or possible transmission cause of worsening lymphedema 42)-44). This finding levels, and also it has been shown to have a very has led to an unforeseen new morbidity manage- high specificity to exclude other species of filarial ment program based on simple hygiene to prevent infection 49). The Wb123-based diagnosis has been the bacterial infections: washing the swollen leg modified to a lateral-flow strip format for rapid with soapand water 6). The method is not only a diagnosis 50). remedy for the cursed symptom but an entry into A RT-PCR detecting L3-specific cDNA is also interactions between the sufferers, who are isolated reported 51). This technique can be applied to study and often depressed, and family/community mem- the infectivity status of vector mosquitos. bers, who can now take care of the patients. Non-invasive sample collection may be valuable to obtain acceptance by people particularly in areas 6. Ultrasonography in LFstudy with a very low infection rate, or at the stage of Live and moving adult filariae in the human confirming elimination. In this regard, ELISA to lymphatics were visualized with ultrasonography detect recombinant SXP-1 W. b. antigen-specific and was named ʻfilaria dance signʼ 45). This technique IgG4 in urine has been employed successfully in has opened the new way for researches on several countries 52) 53). A latex agglutination test to
384 Juntendo Medical Journal 61(4), 2015
detect SXP-1-specific IgG4 in urine is also reported, Drug resistance is a serious problem for GPELF 63), with which visual diagnosis is possible 54). However, which will continue for 2 decades. Although DEC the present urine tests crossreact with other filarial resistance has not been reported, with Onchocerca parasites, and cannot be used as they are in Africa volvulus, protracted control programs have already where different species of filarial parasites are induced possible IVM resistance 64). As for albendazole endemic. resistance, in Burkina Faso, benzimidazole resis- tance-associated mutation is detected in Mf of W.b. 2. Treatment more frequently after ALB plus IVM treatments 65). Antifilarial drugs are categorized into microfilari- One of the two strategic aims of GPELF is to cide (killing Mf) and macrofilaricide (killing adults). alleviate suffering and disability by providing DEC is known to have stronger macrofilaricidal effect access to basic care for people with symptoms. This than ALB and IVM, but even DEC can kill only about aim has not been attained. Effective treatments are a half of parasitic adults 55). available, but most of the sufferers live far away Macrofilaricidal effect is crucial in the elimination from hospitals. Patients with leg edema may have to program, because the adults surviving after MDAs work barefoot in the field or bush, or they may not can be a source of Mf for continuous transmission get enough clean water to wash the affected limb and will hinder clinical improvements. Thus with- daily. These are big challenges for GPELF. out a potent macrofilaricidal drug, the elimination schedule will be protracted. 3. Integrated vector management and preventive Flubendazole, which is used for intestinal nemato- chemotherapy diasis, is known to have a strong macrofilaricidal Vector management effect. Studies are going on for use in GPELF and The elimination of LF has been executed under for onchocerciasis control 56). A recent study with GPELF, and malaria control under the Global rats showed embryotoxic activity 57). Moxidectin is Malaria Programme. However, in a large part of another drug under extensive evaluation. With Africa, LF and malaria are co-endemic and human subjects of onchocerciasis, 8 mg dosage was Anopheles mosquitoes transmit both of the diseases. safe and showed much stronger microfilaricidal So, if the two programs are integrated in an effect than IVM. However, the macrofilaricidal effective manner, substantive merits can be effect was not conclusive 58). expected operationally and financially. For example, Outside GPELF, the use of doxycycline (DOX) as the two programs may coordinate and rationalize macrofilaricide has been reported. The treatment the distribution of insecticide-treated mosquito requires a long period (200 mg/day for 4-6 weeks), nets and indoor residual spraying 66). but this is the most effective way to remove adult In relation to integrated vector management, worms so far: more than 80% of them were killed several recent studies put a focus on IVM as one of when judged 24 months after treatment 59). This possible vector control agents for malaria: the drug treatment has a significance in that the antibiotic administered for LF/onchocerciasis can kill Anoph- destroys Wolbachia endosymbiont and then indi- eles mosquitoes when they suck blood from treated rectly kills adult filariae. It is observed that DOX humans 67) 68). induced extensive apoptosis of adult germline cells, embryos and somatic cells of Mf with B. malayi 60). Preventive chemotherapy DOX, as a result of killing adults, can improve In sub-Saharan Africa, IVM is used for LF and lymphedema, and hydrocele. This is another reason onchocerciasis, which are often co-endemic. To anti-Wolbachia chemotherapy draws attention 61). It rationalize the treatment, the WHO Regional Commit- is reported that ʻAnti-Wolbachiaʼ (A · WOL) con- tee for Africa agreed, in 2013, to coordinate MDAs for sortium has screened 2,664 registered drugs and LF (under GPELF) and onchocerciasis (under obtained 9 compounds which are more potent than African Program for Onchocerciasis Control) 27). DOX. One of them, minocycline is under efficacy Large-scale, periodic and single-dose mass chemo- trial with Onchocerca volvulus-infected humans in therapy similar to the MDA for LF has been em- Ghana. Other basic studies are also going on 62). ployed as a control strategy for several NTDs, i. e.,
385 Kimura: Global program to eliminate filariasis
schistosomiasis, soil-transmitted helminthiasis (STH), lagging. Also, integration or coordination of differ- and trachoma. Albendazole is distributed in GPELF, ent programs has to be accelerated. Despite these, and also in school-based deworming programs to GPELF with more than a decade-long solid experi- treat STH. This may be coordinated relatively easily. ence will be able to overcome them, achieve the In Mali, a preliminary trial to integrate MDA for LF elimination of long-neglected disease of LF, and set (with IVM and ALB) and trachoma control with a precious precedent for public health program. azithromycin is reported 69). The coadministration of the 3 drugs was reported to be safe. References Although the integration is most essential in the long run, the implementation may not be simple. 1) Vanamail P, Ramaiah KD, Pani SP, et al: Estimation of Careful and methodical processes seem to be the fecund life span of Wuchereria bancrofti in an 70) endemic area. Trans R Soc TropMed Hyg, 1996; 90: necessary for successful integration . 119-121. 2) Nutman TB: Insights into the pathogenesis of disease in 4. Co-infection of Loa loa filaria with lymphatic human lymphatic filariasis. Lymphat Res Biol, 2013; 11: 144-148. filaria in Africa 3) Debrah AY, Mand S, Specht S, et al: Doxycycline Loa loa is another species of filaria endemic in 10 reduces plasma VEGF-C/sVEGFR-3 and improves countries of Central and West Africa 71). Loa pathology in lymphatic filariasis. PLoS Pathog, 2006; 2: e92. infection with very high Mf counts (>30,000 Mf/1 4) Taylor MJ: Wolbachia in the inflammatory pathogenesis ml of blood) causes serious side effects such as of human filariasis. Ann NY Acad Sci, 2003; 990: 444- encephalopathy and death when Mf are killed with 449. 5) Noordin R, Muhi J, Md Idris Z, et al: Duration of IVM. Thus, in Loa endemic areas, MDAs for LF detection of anti-BmR1 IgG4 antibodies after mass-drug cannot be implemented without detailed informa- administration (MDA) in Sarawak, Malaysia. Trop tion on Loa loa. In fact, 6 of 13 countries which have Biomed, 2012; 29: 191-196. 6) WHO: Global Programme to Eliminate Lymphatic not started the MDA yet are with co-endemic Filariasis. Lymphatic filariasis: managing morbidity and loiasis. This is a big concern for GPELF whose preventing disability. An aide-mémoire for national target of elimination is the year 2020. programme managers. 2013. (WHO/HTM/NTD/PCT/ 2013.7) To avoid the severe reactions of treatment, a 7) Addiss DG, Brady MA: Morbidity management in the fine-resolution distribution mapof loiasis and global programme to eliminate lymphatic filariasis: a co-endemic LF (and onchocerciasis) is essential, review of the scientific literature. Filaria J, 2007; 6: 2. 72) 8) Ottesen EA, Duke BOL, Karam M, et al: Strategies and but to create such a mapis often not easy . Under tools for the control/elimination of lymphatic filariasis. the specific setting, in which LF, loiasis and malaria Bull World Health Organ, 1997; 75: 491-503. are co-endemic, but there is no onchocerciasis, ALB 9) Michael E, Bundy DAP, Grenfell BT: Re-assessing the global prevalence and distribution of lymphatic filariasis. 400 mg twice/year mass treatment for 5 years plus Parasitol, 1996; 112: 409-428. integrated vector management is recommended for 10) Supali T, Wibowo H, Ruckert P, et al: High prevalence of LF elimination 73). A single dose of ALB at 400 mg is Brugia timori infection in the highland of Alor Island, 74) 75) Indonesia. Am J TropMed Hyg, 2002; 66: 560-565. reported to be effective against W.b. . 11) WHO: Global Programme to Eliminate Lymphatic Filariasis. Monitoring and epidemiological assessment of In GPELF, research work has been playing a mass drug administration. 2011. (WHO/HTM/NTD/ PCT/2011.4) crucial role: the adoption of annual single-dose 12) CDC: Recommendations of the International Task Force MDA and the development of ICT rapid diagnostic for Disease Eradication. MMWR Recomm Rep, 1993; 42 test contributed greatly to the swift global deploy- (RR-16) : 1-38. 13) Brito AC, Fontes G, Williams P, et al: Bancroftian ment of the program. Intensive efforts are being filariasis in Maceio, State of Alagoas, Brazil: Observa- made to developmacrofilaricides, which can tions on Culexquinquefasciatus after blood feeding on shorten the duration of program, prevent/improve individuals with different densities of microfilariae in the peripheral blood stream. Am J Trop Med Hyg, 1998; 58: clinical symptoms, and counteract drug resistance 489-494. problem. However, there are some challenges 14) Hairston NG, de Meillon B: On the inefficiency of trans- remaining before the completion of the program: mission of Wuchereria bancrofti from mosquito to human host. Bull World Health Organ, 1968; 38: 935-941. MDA has not been implemented yet in 13 countries, 15) Rachou RG, Scaff LM. Rev. bras. Malar., 1958. (quoted by and morbidity management activities are still Hawking FA: A review of progress in the chemotherapy
386 Juntendo Medical Journal 61(4), 2015
and control of filariasis since 1955. Bull World Health Organ, 28-dose treatment spread over 2 years against diurnally 1962; 27: 555-568.) subperiodic Wuchereria bancrofti in Fiji. Fiji Med J, 16) Laigret J, Fagneaux G, Tuira E: Progrès dans lʼemploi de 1993; 19: 2-6. la diéthylcarbamazine en chimiothérapie de la filariose 36) Kazura J, Greenberg J, Perry R, et al: Comparison of lymphatique à Wuchereria bancrofti var. pacifica: la single-dose diethylcarbamazine and ivermectin for méthode des doses espacées. Bull World Health Organ, treatment of bancroftian filariasis in Papua New Guinea. 1978; 56: 985-990. Am J TropMed Hyg, 1993; 49: 804-811. 17) Kimura E, Penaia L, Spears GF: The efficacy of annual 37) Andrade LD, Medeiros Z, Pires ML, et al: Comparative single-dose treatment with diethylcarbamazine citrate efficacy of three different diethylcarbamazine regimens against diurnally subperiodic bancroftian filariasis in in lymphatic filariasis. Trans R Soc Trop Med Hyg, 1995; Samoa. Bull World Health Organ, 1985; 63: 1097-1106. 89: 319-321. 18) Gelband H: Diethylcarbamazine salt in the control of 38) Hakim SL, Vythilingam I, Marzukhi MI, et al: Sin- lymphatic filariasis. Am J Trop Med Hyg, 1994; 50: 655- gle-dose diethylcarbamazine in the control of periodic 662. brugian filariasis in Peninsular Malaysia. Trans R Soc 19) Diallo S, Aziz MA, Ndir O, et al: Dose-ranging study of TropMed Hyg, 1995; 89: 686-689. ivermectin in treatment of filariasis due to Wuchereria 39) WHO/TDR: Community Directed Treatment with bancrofti. Lancet, 1987; 1: 1030. Ivermectin. Report of a Multi-Country Study. 1996. 20) Kumaraswami V, Ottesen EA, Vijayasekaran V, et al: (TDR/AFR/RP/96.1) Ivermectin for the treatment of Wuchereria bancrofti 40) Hotez PJ, Fenwick A, Savioli L, et al: Rescuing the filariasis. Efficacy and adverse reactions. JAMA, 1988; bottom billion through control of neglected tropical 259: 3150-3153. diseases. Lancet, 2009; 373: 1570-1575. 21) Sasa M: Human Filariasis - a global survey of epidemiol- 41) Weil GJ, Lammie PJ, Weiss N: The ICT Filariasis test: A ogy and control. Tokyo: University of Tokyo Press, rapid-format antigen test for diagnosis of bancroftian 1976. filariasis. Parasitol Today, 1997; 13: 401-404. 22) Sun DJ, Chen PL: Filariasis surveillance at the post-con- 42) Olszewski WL, Jamal S, Manokaran G, et al: Bacterio- trol stage in China. Southeast Asian J TropMed Public logic studies of skin, tissue fluid, lymph, and lymph nodes Health, 1992; 23: 369-376. in patients with filarial lymphedema. Am J Trop Med 23) Cao W, Van der Ploeg CPB, Ren Z, et al: Success against Hyg, 1997; 57: 7-15. lymphatic filariasis. World Health Forum, 1997; 18: 17- 43) Dreyer G, Medeiros Z, Netto MJ, et al: Acute attacks in 20. the extremities of persons living in an area endemic for 24) Cheun HI, Kong Y, Cho SH, et al: Successful control of bancroftian filariasis: differentiation of two syndromes. lymphatic filariasis in the Republic of Korea. Korean J Trans R Soc TropMed Hyg, 1999; 93: 413-417. Parasitol, 2009; 47: 323-335. 44) Dreyer G, Norões J, Figueredo-Silva J, et al: Pathogene- 25) WHO: World Health Report 1995 - bridging the gaps. sis of lymphatic disease in bancroftian filariasis: a clinical 1995. perspective. Parasitol Today, 2000; 16: 544-548. 26) Ramaiah KD, Das PK, Michael E, et al: The economic 45) Amaral F, Dreyer G, Figueredo-Silva J, et al: Live adult burden of lymphatic filariasis in India. Parasitol Today, worms detected by ultrasonography in human bancrof- 2000; 16: 251-253. tian filariasis. Am J TropMed Hyg, 1994; 50: 753-757. 27) Uniting to Combat NTDs: Delivering on Promises and 46) Fox LM, Furness BW, Haser JK, et al: Ultrasonographic Driving Progress. 2014. examination of Haitian children with lymphatic filariasis: 28) Ottesen EA, Hooper PJ, Bradley M, et al: The global a longitudinal assessment in the context of antifilarial programme to eliminate lymphatic filariasis: Health drug treatment. Am J TropMed Hyg, 2005; 72: impact after 8 years. PLoS Negl Trop Dis, 2008; 2: e317. 642-648. 29) Chu BK, Hooper PJ, Bradley MH, et al: The economic 47) Dreyer G, Norões J, Amaral F, et al: Direct assessment benefits resulting from the first 8 years of the Global of the adulticidal efficacy of a single dose of ivermectin in Programme to Eliminate Lymphatic Filariasis (2000- bancroftian filariasis. Trans R Soc TropMed Hyg, 1995; 2007). PLoS Negl TropDis, 2010; 4: e708. 89: 441-443. 30) WHO: Global Programme to Eliminate Lymphatic 48) Weil GJ, Curtis KC, Fakoli L, et al: Laboratory and field Filariasis. Progress report 2000-2009 and Strategic plan evaluation of a new rapid test for detecting Wuchereria 2010-2020. 2010. (WHO/HTM/NTD/PCT/2010.6) bancrofti antigen in human blood. Am J TropMed Hyg, 31) WHO: Global programme to eliminate lymphatic filaria- 2013; 89: 11-15. sis: progress report, 2013. Weekly Epidemiological 49) Steel C, Kubofcik J, Ottesen EA, et al: Antibody to the Record, 2014; 89: 409-418. filarial antigen Wb123 reflects reduced transmission and 32) WHO: Global programme to eliminate lymphatic filaria- decreased exposure in children born following single sis: progress report for 2012. Weekly Epidemiological mass drug administration (MDA). PLoS Negl TropDis, Record, 2013; 88: 389-399. 2012; 6: e1940. 33) WHO: WHO Expert Committee on Filariasis: Third 50) Steel C, Golden A, Kubofcik J, et al: Rapid Wuchereria Report 1974. World Health Organ Tech Rep Ser, 1974; bancrofti-specific antigen Wb123-based IgG4 immuno- 542: 1-54. assays as tools for surveillance following mass drug 34) WHO: Lymphatic Filariasis: Fourth report of the WHO administration programs on lymphatic filariasis. Clin Expert Committee on Filariasis. World Health Organ Vaccine Immunol, 2013; 20: 1155-1161. Tech RepSer, 1984; 702: 3-112. 51) Vasuki V, Hoti SL, Patra KP: RT-PCR assay for the
35) Mataika JU, Kimura E, Koroivueta J, et al: Comparison detection of infective (L3) larvae of lymphatic filarial of the efficacy of diethylcarbamazine between 5 rounds parasite, Wuchereria bancrofti, in vector mosquito Culex of annual single-dose treatment and an intensive quinquefasciatus. J Vector Borne Dis, 2008; 45: 207-216.
387 Kimura: Global program to eliminate filariasis
52) Itoh M, Wu W, Sun D, et al: Confirmation of elimination 65) Schwab AS, Boakye DA, Kyelem D, et al: Detection of of lymphatic filariasis by an IgG4 enzyme-linked benzimidazole resistance-associated mutations in the immunosorbent assay with urine samples in Yongjia, filarial nematode Wuchereria bancrofti and evidence for Zhejiang province and Gaoan, Jiangxi province, Peopleʼs selection by albendazole and ivermectin combination Republic of China. Am J Trop Med Hyg, 2007; 77: 330- therapy. Am J Trop Med Hyg, 2005; 73: 234-238. 333. 66) WHO: WHO position statement on integrated vector 53) Itoh M, Weerasooriya MV, Yahathugoda TC, et al: management to control malaria and lymphatic filariasis. Effects of 5 rounds of mass drug administration with Weekly Epidemiological Record, 2011; 86: 121-127. diethylcarbamazine and albendazole on filaria-specific 67) Chaccour CJ, Kobylinski KC, Bassat Q, et al: Ivermectin IgG4 titers in urine: 6-year follow-upstudy in Sri to reduce malaria transmission: a research agenda for a Lanka. Parasitol Int, 2011; 60: 393-397. promising new tool for elimination. Malar J, 2013; 12: 54) Nagaoka F, Itoh M, Samad MS, et al: Visual detection of 153. filaria-specific IgG4 in urine using red-colored high 68) Ouédraogo AL, Bastiaens GJH, Tiono AB, et al: Efficacy density latex beads. Parasitol Int, 2013; 62: 32-35. and safety of the mosquitocidal drug ivermectin to 55) Norões J, Dreyer G, Santos A, et al: Assessment of the prevent malaria transmission after treatment: a dou- efficacy of diethylcarbamazine on adult Wuchereria ble-blind, randomized, clinical trial. Clin Infect Dis, 2015; bancrofti in vivo. Trans R Soc TropMed Hyg, 1997; 91: 60: 357-365. 78-81. 69) Coulibaly YI, Dicko I, Keita M, et al: A cluster 56) Mackenzie CD, Geary TG: Flubendazole: a candidate randomized study of the safety of integrated treatment macrofilaricide for lymphatic filariasis and onchocercia- of trachoma and lymphatic filariasis in children and sis field programs. Expert Rev Anti Infect Ther, 2011; 9: adults in Sikasso, Mali. PLoS Negl TropDis, 2013; 7: 497-501. e2221. 57) Longo M, Zanoncelli S, Messina M, et al: In vivo 70) Hanson C, Weaver A, Zoerhoff KL, et al: Integrated preliminary investigations of the effects of the benzimi- implementation of programs targeting neglected tropi- dazole anthelmintic drug flubendazole on rat embryos cal diseases through preventive chemotherapy: identi- and fetuses. Reprod Toxicol, 2014; 49: 33-42. fying best practices to roll out programs at national 58) Awadzi K, Opoku NO, Attah SK, et al: A randomized, scale. Am J TropMed Hyg, 2012; 86: 508-513. single-ascending-dose, ivermectin-controlled, double- 71) Zouré HGM, Wanji S, Noma M, et al: The geographic blind study of moxidectin in Onchocerca volvulus distribution of Loa loa in Africa: Results of large-scale infection. PLoS Negl TropDis, 2014; 8: e2953. implementation of the rapid assessment procedure for 59) Debrah AY, Mand S, Marfo-Debrekyei Y, et al: Macrofi- loiasis (RAPLOA). PLoS Negl TropDis, 2011; 5: e1210. laricidal effect of 4 weeks of treatment with doxycycline 72) Kelly-Hope LA, Thomas BC, Bockarie MJ, et al: on Wuchereria bancrofti. TropMed Int Health, 2007; 12: Lymphatic filariasis in the Democratic Republic of 1433-1441. Congo; micro-stratification overlap mapping (MOM) as 60) Landmann F, Voronin D, Sullivan W, et al: Anti-filarial a prerequisite for control and surveillance. Parasit activity of antibiotic therapy is due to extensive Vectors, 2011; 4: 178. apoptosis after Wolbachia depletion from filarial nemato- 73) WHO: Provisional Strategy for Interrupting Lymphatic des. PLoS Pathog, 2011; 7: e1002351. Filariasis Transmission in Loiasis-endemic Countries. 61) Hoerauf A: Filariasis: new drugs and new opportunities Report of the meeting on lymphatic filariasis, malaria for lymphatic filariasis and onchocerciasis. Curr Opin and integrated vector management. 2012. Infect Dis, 2008; 21: 673-681. (WHO/HTM/NTD/PCT/2012.6) 62) Taylor MJ, Hoerauf A, Townson S, et al: Anti-Wolba- 74) Gyapong JO, Kumaraswami V, Biswas G, et al: Treat- chia drug discovery and development: safe macrofilari- ment strategies underpinning the global programme to cides for onchocerciasis and lymphatic filariasis. Parasi- eliminate lymphatic filariasis. Expert Opin Pharmac- tol, 2014; 141: 119-127. other, 2005; 6: 179-200. 63) McCarthy J: Is anthelmintic resistance a threat to the 75) Hoti SL, Pani SP, Vanamail P, et al: Effect of a single dose program to eliminate lymphatic filariasis? Am J Trop of diethylcarbamazine, albendazole or both on the Med Hyg, 2005; 73: 232-233. clearance of Wuchereria bancrofti microfilariae and 64) Osei-Atweneboana MY, Eng JKL, Boakye DA, et al: antigenaemia among microfilaria carriers: a randomized Prevalence and intensity of Onchocerca volvulus infec- trial. Natl Med J India, 2010; 23: 72-76. tion and efficacy of ivermectin in endemic communities in Ghana: a two-phase epidemiological study. Lancet, 2007; 369: 2021-2029.
388 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 389-395
Current Situation of Chagas Disease in Non-Endemic Countries
TAKESHI NARA＊1),SACHIO MIURA＊2)
＊1)Department of Molecular and Cellular Parasitology, Juntendo University Graduate School of Medicine, Tokyo, Japan, ＊2)Central Blood Institute, Blood Service Headquarters, Japanese Red Cross Society, Tokyo, Japan
Chagas disease, or American trypanosomiasis, is caused by the parasitic protist Trypanosoma cruzi. 10 million people are estimated to live with this disease. Chagas disease is endemic to the Americas, which corresponds to the distribution of the insect vectors, blood-sucking triatomine bugs. The presence of many mammalian species as reservoir hosts and the occurrence of a long asymptomatic phase of infection that may last more than 10 years make control difficult. In the United States, domestic transmissions from triatomines to humans are rarely reported, but it is estimated that there are 300,000 people living with Chagas disease among Latin American immigrants. Patients with Chagas disease are also found outside the Americas, as well as in Japan, via international migration. Thus, there is a growing need to understand the current situation in non-endemic countries in terms of establishing better preparedness against the incursion of Chagas disease. Key words: Chagas disease, Trypanosoma cruzi, Latin America, insect vector, transfusion
Introduction
Chagas disease, which was discovered by the Triatomine bug（defecation） Metacyclic Brazilian physician Carlos Chagas in 1909, is trypomastigote endemic in 21 countries of Latin America and affects 10 million people with some 12,000 annual deaths 1). Chagas disease is typical zoonosis, where more than 100 mammalian species including Metacyclogenesis marsupials, rodents, bats, armadillos, and carni- vores, can be infected with T. cruzi and become Amastigotes reservoir hosts 2). The transmission of T. cruzi from Epimastigote infected bugs occurs via their feces, a unique （intestine） feature among the vector-borne parasites, and is called stercorarian transmission (Figure-1). Although more than half of 141 triatomine species are potentially able to transmit T. cruzi, only several species are epidemiologically important for human transmission 2). Other routes of transmission
include blood transfusion, organ transplantation, Trypomastigote and congenital transmission. To minimize risks of Triatomine bug（blood－sucking） the transfusional transmission, screening of blood Figure-1 The life cycle of Trypanosoma cruzi, a pathogen donors by detecting anti-T. cruzi antibody has of Chagas disease
Corresponding author: Takeshi Nara Department of Molecular and Cellular Parasitology, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-5802-1043 FAX: +81-3-5800-0476 E-mail: [email protected] 〔Received Apr. 24, 2015〕
389 Nara, et al: Chagas disease in non-endemic countries
the unawareness of Chagas disease by both of the patients themselves and the physicians in the non-endemic areas makes diagnosis difficult. Therefore, the estimate of the prevalence of Chagas disease is largely dependent on the limited epide- miological data. In this review, the current situa- tions of and the efforts against Chagas disease in non-endemic countries are summarized.
Chagas disease in the US and Canada
＝100％ The burdens of Chagas disease in the US have ＞99％ been estimated by applying seroprevalence figures 90～75％ of country of origin to the relevant immigrant ＜50％ populations; 300,167 persons with T. cruzi infec- No data tion, 30,000-45,000 with cardiomyopathy, and about 300 with congenital infections per year Figure-2 Screening of donated blood for identification of 5) Chagas disease in Latin America. The data are (Table-1) . These estimates suggest the potential based on the ref 3). risks for Chagas disease in the US, due particularly to blood transfusion and congenital infection. In fact, T. cruzi transmission via transfusion has been been implemented in all Latin American countries, reported in the US and European counties 6). The with the relatively lower coverage in Mexico and source of infection was found to be exclusively Panama (Figure-2) 3). Oral infection also occurs via platelet concentrates. There is no report suggesting foods and fresh fruit juice, which are presumably the occurrence of transmission by red blood cells contaminated with T. cruzi-infected bugs. (RBC) or frozen plasma products. Therefore, trans- Manifestation and progress of Chagas disease are mission by RBC or frozen plasma products seems complex but generally divided into acute and unlikely, although such possibilities cannot be ruled chronic phases 4). After invasion of an infective form out. In 2007, the American Red Cross and Blood of T. cruzi via wound skin or mucosa, the parasite Systems Inc. introduced screening of ALL donated parasitizes and multiplies inside any type of host bloods for Chagas disease using the Ortho EIA kit cell, followed by successive multiplication and (Ortho Clinical Diagnostics Inc., NJ) that has been subsequent destruction of the tissues such as heart. approved by the Food and Drug Administration The acute phase lasts about 2 months with (FDA). A second serologic test kit (Abbott PRISM" detectable parasitemia in the blood and accompa- Chagas Assay, Abbott Laboratories, Abbott Park, nies malaise, fever, and anorexia as the systemic IL) was also approved by the FDA in 2010. There is expansion occurs. The acute phase is often obscure no report of the blood-borne transmission of T. and confused with common infectious diseases. cruzi since 2007. Myocarditis rarely occurs in the acute phase, but Although the data for seroprevalence of Chagas becomes a main cause of death. Almost all patients disease has not yet been available, the highly enter the indeterminate (asymptomatic) phase and suspected cases for vector-borne transmission of up to 30% of the patients develop chronic symptoms T. cruzi have been reported in Louisiana, Texas, years to decades after infection. Manifestations of California, Tennessee, and Mississippi 7)-12). As for the chronic phase include heart failure, such as the congenital infection, the Centers for Disease arrhythmia, cardiomyopathy, and thromboembol- Control and Prevention (CDC) have reported the ism, which lead to sudden death. detection of the blood-circulating parasite in a boy, Chagas disease now becomes a global concern whose mother recently has moved to the US from because a multitude of people migrates into and out Bolivia and had previously been diagnosed as of the endemic areas of Latin America. In particular, Chagas disease 13).
390 Juntendo Medical Journal 61(4), 2015
Table-1 The estimate of the potential Chagas disease patients in non-endemic countries Country No. of immigrants No. of estimated Pre-donation Blood screening Other implementations patients questionnaire North America USA＊ 22,843,939 300,167 Yes Mandatory for One-time screening. Negative blood all donors is used for transfusion Canada† 374,305 5,779 ND Mandatory for Negative blood is used for at-risk donors transfusion Europe‡ Spain 1,445,751 39,985-65,258 Yes Mandatory for Negative blood is used for at-risk donors transfusion National guidelines for transplantation available Italy 440,000 5,520-7,081 Yes (regional) In progress National guidelines for transplantation available UK 400,000 14,000 Yes No. All at-risk donors are deferred for donation National guidelines for transplantation available France 208,395 2,166 Yes Mandatory for Negative blood is used for at-risk donors transfusion Portugal 83,000 850 ND In progress Sweden 58,196 1,118 Yes No. Donors having > 5 year stay in endemic areas are deferred Germany 58,000 935 ND Not provided Belgium 38,133 1,982 ND Not provided Netherlands 35,211 480 ND Not provided Switzerland 35,000 3,000 Yes Mandatory for Negative blood is used for at risk donors transfusion Austria 7,552 140-180 ND Not provided Asia Japan† 240,101 3,148 Yes At-risk donors Negative blood is only used for consented to plsma products the examination Australia† 116,430 1,871 Yes Mandatory for Negative blood is used for at-risk donors transfusion New Zealand† 6,315 101 Yes Mandatory for Negative blood is used for at-risk donors transfusion
The data are based on the ref 17) ＊Adopted from ref 5) †Infection rate was adopted from ref 20) ‡Countries where the data are available are listed. ND; not available.
In Canada, the Canadian Blood Service has components intended for transfusion 16). The Poten- implemented pre-donation questionnaire followed tial donors are primarily asked“Have youever had by targeted screening for the risk group 14) . The Chagas disease?”and the person who answered risk group comprises those who or whose mothers “Yes”are indefinitely deferred for blood donation. were born in Latin America and those who received One-time testing of each donor using a licensed test transfusion or lived in these areas. In 2011, a case of for anti-T. cruzi antibody is implemented for all congenital transmission was reported 15). A mother donors and the person who are nonreactive are of this donor was found to be seropositive, likely ready for blood donation. Donors who are repeat- being infected via transfusion from 1978 to 1983. edly reactive using a licensed test are indefinitely In 2010, FDA issued the guideline for prevention deferred for blood donation. FDA highly recom- of T. cruzi transmission via whole blood and blood mends that blood and blood components donated by
391 Nara, et al: Chagas disease in non-endemic countries
repeatedly seropositive persons should be traced Regarding prevention via transfusion, a systematic back to 10 years and that the relevant bloods and screening for identifying at-risk donors is con- blood products must be destroyed. Thus, donor ducted in France, Spain, Sweden, Switzerland, and deferral in the US is based on the evidence of the UK 19). The UK adopted most strict settings for seroreactivity, as well as the personal history of blood donation; blood, cells, and organs of at Chagas disease. risk-donors, who or whose mothers were born in South America or Central America including Chagas disease in Europe and Oceania Southern Mexico but excluding Caribbean coun- tries and donors who received transfusion or lived Europe hosts more than 2 million of legal Latin continuously for 4 weeks or more in these areas American immigrants and therefore has a substan- must not donate their blood. The person who tial burden of Chagas disease (Figure-3). An returned from endemic areas and are subsequently attention also should be paid for a hidden population found nonreactive to T. cruzi antibody using of illegal immigrants. Spain hosts the largest Latin validated test for at least 6 months after their American communities with about 1.5 million return can be considered discretionarily for dona- people, as Spanish is the most common language in tion. Similarly to the US, Spain, France, and Latin America. Seroprevalence figures of the Switzerland implement mandatory screening of country of origin to the relevant immigrant blood donors at risk for T. cruzi infection. Donors populations have been applied to the European who were judged as negative are able to donate countries (Table-1) 17) 18). More than 80% of the blood. In non-European countries, Australia and immigrants are hosted by 3 countries, Spain, Italy, New Zealand have established the similar and UK and the estimated 86,000 persons with T. guidelines 20). In Sweden, persons who lived more cruzi infection live in these countries. than five years in endemic areas are automatically Because the vectorial transmission does not occur deferred for donation, irrespective of country of in Europe, almost all Chagas patients are detected origin. Italy and Portugal are going to develop among the immigrants; hundreds of cases of guidelines for the blood transfusion service. domestic infections caused by transfusion, organ Screening of congenital infection with T. cruzi is transplantation, and congenital transmission have also not implemented in most of non-endemic been reported. Preventive measures against the countries. The epidemiological surveillance for transmission, however, vary among the countries. pediatric Chagas disease in Barcelona, Spain and Geneva, Switzerland was conducted between 2004 and 2012 and detected 45 cases of congenital infection, whose mothers were all born in Latin America. Majority of mothers (41 of 45 cases) originated from Bolivia, clearly suggesting that Bolivia is a Chagas disease“hotspot” 21).
Chagas disease in Japan
Historically, many Japanese have settled in Latin America, especially in Brazil, Peru, and Bolivia, before and after the World War II. In 2014, of 240,000 Latin American immigrants, the majority is ＞10,000 the Japanese diaspora (Nikkei) from Brazil. ≧1,000 Because the occurrence of the domestic life cycle of ＜1,000 No data triatomine bugs is not officially reported in Japan, as well as in European countries, these immigrants Figure-3 The estimated incidence of Chagas disease in and their offspring are typically the risk group. Europe(2009). The data are based on the ref 17). Based on the seroprevalence figures of the country
392 Juntendo Medical Journal 61(4), 2015
Figure-4 Awareness poster for blood donors at risk of Chagas disease by JRCS. The image is reproduced under permission 22).
of origin 5), the estimated 3,148 of 240,101 immi- traceable and they were found to be negative. grants in 2014 live with T. cruzi infection in Japan Nowadays, JRCS provides awareness poster and (Table-1). counter display for at-risk donors of Chagas disease In August 14 2013, Japanese Red Cross Society (Figure-4) and is implementing a questionnaire to (JRCS) and the Ministry of Health, Labour and those who or whose mother originated from Latin Welfare of Japan announced that one male blood America and those who have stayed more than 4 donor, who and whose mother have originated from weeks (in total) in Latin American countries 22). Latin America, was found to be seropositive for Bloods from at-risk donors who consented to Chagas disease. Retrospective analysis revealed being enrolled in the epidemiological surveillance that this patient had already donated his blood 9 are tested using the Ortho ELISA kit and the times and these blood products had been delivered positive bloods are permanently excluded. At to 8 medical institutions and used for 11 recipients. present, the blood of the negative donor is only used Fortunately, there was no secondary infection for fractionation into plasma derivatives in Japan. investigated so far; 5 of 11 recipients were finally Epidemiological surveillance by JRCS to identify
393 Nara, et al: Chagas disease in non-endemic countries
the prevalence of Chagas disease is now underway. or Medical Biology in the Medical Universities is Recently, a case of congenital transmission was helpful. Differential diagnosis using authorized kits reported 23). A 13-year-old boy who was born to a and diagnostic PCR should be carried out. Because Bolivian mother in Japan was hospitalized due to the improvement of awareness of Chagas disease severe constipation. His family is a Bolivian Nikkei and the establishment of a systematic medical care and used to live in endemic areas. He was diagnosed system including differential diagnosis and chemo- using the Ortho ELISA kit, PCR using a standar- therapy are still lacking in Japan, further implemen- dized T. cruzi-specific primer set, and the haemo- tation in terms of better control of Chagas disease is culture; all of testing showed positive to T. cruzi necessary. infection. His mother was also found to be seroposi- tive for T. cruzi. Chemotherapy and recent advances in drug development for Chagas disease How do we prepare for Chagas disease in Japan? Two drugs, benznidazole and nifurtimox, are Diagnosis based on clinical symptoms: Because of currently available but not a silver bullet. In the the absence of triatomine bugs in Japan, vectorial acute phase of infection, where T. cruzi can be and food-borne transmissions are negligible. In detected in the blood, both drugs are effective. By addition, donated blood is becoming secured by contrast, the treatment of asymptomatic or chronic introduction of a questionnaire to donors from Latin Chagas disease without detectable parasitemia in America. Therefore, the risk groups should include the blood is still a matter of debate, because the cure those who were born or grown in Latin America or rates in these phases are considerably inferior to born to a Latin American mother, or who tempora- the acute phase. In Bolivia, chemotherapy is only rily lived in Latin American countries; particularly, conducted in the patients who possess the parasites Bolivian immigrants are at highest risk for Chagas in the blood (personal communication). During disease according to seroprevalence. Because treatment, severe side effects including rash, Chagas disease patients inhabiting in Japan seem peripheral neuropathy for benznidazole and ano- largely asymptomatic or chronic, physicians should rexia, nausea, vomiting, weight loss, and abdominal take Chagas disease into account for a person with pain for nifurtimox may appear, which often results the following conditions. in discontinuation of chemotherapy. Nifurtimox is available from the Drug Service of the Research (1)A person who is of Latin American origin and Group on Chemotherapy of Tropical Diseases in has abnormalities of cardiac electrogram or Japan 24). constipation. Thus, the development of new, truly effective (2)A person who was born to a mother of a Latin drugs for Chagas disease is required. Recently, two American origin and has typical manifestations compounds, ravuconazole 25) and posaconazole 26) of Chagas disease as above. were offered to the prospective, randomized clinical (3)A pregnant woman of a Latin American origin. trials (phase II) in endemic areas. Both compounds have been developed as an antifungal agent, which The condition (1) may be pointed out by a are a potent inhibitor of fungal ergosterol biosynthe- routine health checkup for foreign employees. By sis. Unfortunately, both of compounds were well contrast, the conditions (2) and (3) may be unno- tolerated but did not show the comparable effects to ticeable. Therefore, pediatricians and obstetricians, benznidazole. in particular, should keep those possibilities in their minds. Conclusion
Differential diagnosis: When an outpatient is In non-endemic countries, Chagas disease cannot suspected of Chagas disease, physicians should be regarded as a fire on the other side of the river. consult nearby experts; consultation to the experts Due particularly to the prolonged indeterminate at Department of Parasitology, Tropical Medicine, phase and subsequent incurable damages to vital
394 Juntendo Medical Journal 61(4), 2015
organs in the chronic phase, Chagas disease is being US case of autochthonous transmission of Trypanosoma recognized as a lifetime, deadly disease, like AIDS, cruzi, in Tennessee, 1998. J Infect Dis, 2000; 181: 395- 399. in endemic areas. Therefore, not only clinical 12) Diaz JH: Chagas disease in the United States: A cause treatment but also social supports for both patients for concern in Louisiana? J La State Med Soc, 2007; 159: and their family are undoubtedly needed. 21-23, 25-29. 13) Centers for Disease Control and Prevention (CDC) : Congenital transmission of Chagas disease - virginia, Acknowledgments 2010. MMWR Morb Mortal Wkly Rep, 2012; 61: 477- 479. 14) Notice to family physicians: Implementation of selective We thank ShigeruIgarashi at JRCS for providing Chagas disease (Trypanosoma cruzi) antibody testing us information of current blood screening for for at-risk blood donors. Canada: The Canadian Blood Chagas disease in Japan and for critical reading. T. Service, 2010. (http: //www. transfusionmedicine. ca/si tes/transfusionmedicine/files/news/2010_Notice_CMAJ. p N. acknowledges support in part by grants-in-aid df). for scientific research Nos. 24390102 and 25670205 15) Fearon MA, Scalia V, Huang M, Dines I, Ndao M, and by the Foundation of Strategic Research Lagace-Wiens P: A case of vertical transmission of Chagas disease contracted via blood transfusion in Projects in Private Universities (S1201013) from Canada. Can J Infect Dis Med Microbiol, 2013; 24: 32-34. the Ministry of Education, Culture, Sport, Science, 16) Guidance for industry: Use of serological tests to reduce and Technology, Japan (MEXT). the risk of transmission of Trypanosoma cruzi infection in whole blood and blood components intended for transfusion. U.S. Food and Drug Administration, OMB References Control No. 0910-0681, 2010. 17) Control and prevention of Chagas disease in Europe. WHO/HTM/NTD/IDM/2010.1, Geneva: World Health 1) Crompton DWT, ed. First WHO report on neglected Organization, 2010. tropical diseases: Working to overcome the global 18) Requena-Mendez A, Aldasoro E, de Lazzari E, et al: impact of neglected tropical diseases. Geneva: World Prevalence of Chagas disease in Latin-American Health Organization, 2010. migrants living in europe: A systematic review and 2) Telleria J, Tibayrenc M, eds. American Trypanosomiasis meta-analysis. PLoS Negl Trop Dis, 2015; 9: e0003540. Chagas Disease: One Hundred Years of Research. 19) Requena-Mendez A, Albajar-Vinas P, Angheben A, London/Burlington: Elsevier, 2010. Chiodini P, Gascon J, Munoz J: Health policies to control 3) Schmunis GA: Epidemiology of Chagas disease in non- Chagas disease transmission in European countries. endemic countries: The role of international migration. PLoS Negl Trop Dis, 2014; 8: e3245. Mem Inst Oswaldo Cruz, 2007; 102 (Suppl 1) : 75-85. 20) Jackson Y, Pinto A, Pett S: Chagas disease in Australia 4) Longo D, Fauci A, Kasper D, et al, eds. Harrisonʼ s and New Zealand: Risks and needs for public health Principles of Internal Medicine. 18th ed. Columbus: interventions. Trop Med Int Health, 2014; 19: 212-218. McGraw-Hill Education, 2011. 21) Rodriguez-Guerineau L, Posfay-Barbe KM, Monsonis- 5) Bern C, Montgomery SP: An estimate of the burden of Cabedo M, et al: Pediatric Chagas disease in Europe: 45 Chagas disease in the United States. Clin Infect Dis, 2009; cases from Spain and Switzerland. Pediatr Infect Dis J, 49: e52-54. 2014; 33: 458-462. 6) Benjamin RJ, Stramer SL, Leiby DA, Dodd RY, Fearon 22) Awareness poster for blood donors at risk of Chagas M, Castro E: Trypanosoma cruzi infection in North disease. The Jpan Red Cross Society, 2012. (http: America and Spain: Evidence in support of transfusion //www.jrc.or.jp/activity/blood/news/pdf/ketsueki_201 transmission. Transfusion, 2012; 52: 1913-1921; quiz 21002_sha-gasu.pdf). 1912. 23) Imai K, Maeda T, Sayama Y, et al: Mother-to-child 7) Garcia MN, Aguilar D, Gorchakov R, et al: Evidence of transmission of congenital Chagas disease, Japan. Emerg autochthonous Chagas disease in southeastern Texas. Infect Dis, 2014; 20: 146-148. Am J Trop Med Hyg, 2015; 92: 325-330. 24) A guideline for treatment of tropical and parasitic 8) Cantey PT, Stramer SL, Townsend RL, et al: The United diseases in Japan (ed 8.2). Research Group on Chemo- States Trypanosoma cruzi infection study: Evidence for therapy of Tropical Diseases, 2014. (http://trop-parasit. vector-borne transmission of the parasite that causes jp/docDL/tebiki_2014ver82.pdf). Chagas disease among United States blood donors. 25) Press release: Drug trial for leading parasitic killer of Transfusion, 2012; 52: 1922-1930. the Americas shows mixed results but provides new 9) Woody NC, Woody HB: American trypanosomiasis evidence for improved therapy. DNDi, 2013. (http://ww (Chagasʼ disease) ; first indigenous case in the United w.dndi.org/media-centre/press-releases/1700-e1224.ht States. J Am Med Assoc, 1955; 159: 676-677. ml). 10) Schiffler RJ, Mansur GP, Navin TR, Limpakarnjanarat K: 26) Molina I, Gomez i Prat J, Salvador F, et al: Randomized Indigenous Chagasʼ disease (american trypanosomiasis) trial of posaconazole and benznidazole for chronic in California. JAMA, 1984; 251: 2983-2984. Chagasʼ disease. N Engl J Med, 2014; 370: 1899-1908. 11) Herwaldt BL, Grijalva MJ, Newsome AL, et al: Use of polymerase chain reaction to diagnose the fifth reported
395 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 396-406
An Overview of Ebola Virus Disease: History, Pathogenesis, and Treatment
NORIO YAMAMOTO＊
＊Department of Infection Control Science, Juntendo University Graduate School of Medicine, Tokyo, Japan
Ebola virus disease (EVD), formerly known as Ebola hemorrhagic fever, is a severe disease in humans and other primates caused by viruses in the genus Ebolavirus; the mostpathogenic variantsof the virusare the members of the species Zaire ebolavirus, with fatality ratesashigh as40-90%. The 2014-15 Ebola outbreak isthe largest in history, and there is an urgent need to develop effective countermeasures against EVD. Viral proteins such as VP35 block some of the interferon pathways in the host, and these mechanisms contribute to efficient viral replication in dendritic cells, monocytes, and macrophages. EVD is associated with rapid viral dissemination and marked dysregulation of the immune and vascular systems, which leads to hemorrhage and multiple organ failure. ChAd3-EBOV and VSV-EBOV have shown the most promise as vaccine candidates for EVD. Favipiravir, ZMapp, and TKM-Ebola-Guinea are emerging as promising drug candidates. Increasing data on the virus and EVD pathogenesis will accelerate the establishment of vaccines, antiviral drugs, and other novel strategies to counter EVD. This review provides an outline of the history, pathogenesis, and treatment of EVD and summarizes current effortsto develop vaccinesagainstEVD. Key words: Ebola virus disease, pathogenesis, vaccine, antiviral therapy
Introduction Zaire ebolavirus, Sudan ebolavirus, Reston ebolavi- rus, Taï Forest ebolavirus, and Bundibugyo ebolavi- Ebola virus disease (EVD), formerly known as rus. The respective viruses are Ebola virus Ebola hemorrhagic fever, is a severe disease in (EBOV), Sudan virus (SUDV), Reston virus humans and other primates caused by ebolaviruses. (RESTV), Taï Forest virus (TAFV), and Bundibu- The genus Ebolavirus isone of the three members gyo virus(BDBV). EBOV, SUDV, and BDBV are of the family Filoviridae, together with the genera responsible for most of the EVD outbreaks in Marburgvirus and Cuevavirus (Table-1). The humans,whereasRESTV hasbeen reported to genus Ebolavirus includes five species, namely, cause the disease only in nonhuman primates.
Table-1 Classification of Filoviruses Order Family GenusSpecies Virus Mononegavirales Filoviridae Ebolavirus Zaire ebolavirus Ebola virus(EBOV) Sudan ebolavirus Sudan virus(SUDV) Reston ebolavirus Reston virus (RESTV) Taï Forest ebolavirus Taï Forest virus (TAFV) Bundibugyo ebolavirus Bundibugyo virus(BDBV) Marburgvirus Marburg marburgvirus Marburg virus(MARV) Ravn virus(RAVV) Cuevavirus Lloviu cuevavirus Lloviu virus(LLOV)
Norio Yamamoto Department of Infection Control Science, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-5802-1041 FAX: +81-3-5684-7830 E-mail: [email protected] 〔Received Apr. 21, 2015〕
396 Juntendo Medical Journal 61(4), 2015
EBOV poses the most serious threat to humans progresshasbeenachieved in the development of among ebolaviruses,asitsfatality ratesare ashigh such drugs and vaccines. The aim of this review is as40-90%. to provide an overview of the history, pathogenesis, At present, no proven treatment or preventive and treatment of EVD. Current effortsto develop vaccine isavailable for Ebola. However, rapid vaccines against EVD are also summarized.
Table-2 Outbreaks of Ebola virus disease Human Mortality VirusYear Country Deaths cases (%) EBOV 1976 DRC 318 280 88 1977 DRC 1 1 100 1994 Gabon 52 31 60 1995 DRC 315 254 81 1996 Gabon 37 21 57 1996-1997 Gabon 60 45 75 1996 Russia 1 1 100 2001-2002 RC, Gabon 124 79 64 2002-2003 RC, Gabon 143 128 90 2003 RC 35 29 83 2004 Russia 1 1 100 2005 RC 12 9 75 2007 DRC 264 187 71 2008-2009 DRC 32 15 47 2014 DRC 66 49 74 Guinea, Liberia, 2014-2015 Sierra Leone, and 24,907 10,326 41 other countries
SUDV 1976 South Sudan 284 151 53 1976 UK 1 0 0 1979 South Sudan 34 22 65 2000-2001 Uganda 425 224 53 2004 South Sudan 17 7 41 2011 Uganda 1 1 100 2012 Uganda 11 4 36 2012 DRC 36 13 36 2012-2013 Uganda 6 3 50
RESTV 1989 US 0 0 - 1990 US 4 0 0 1989-1990 Philippines3 0 0 1992 Italy 0 0 - 1996 US 0 0 - 1996 Philippines0 0 - 2008 Philippines6 0 -
TAFV 1994 Côte d'Ivoire 1 0 0 1995 Liberia 1 0 0
BDBV 2007-2008 Uganda 149 37 25 2012 DRC 36 13 36 DRC: the Democratic Republic of Congo, RC: the Republic of Congo UK: the United Kingdom, US: the United States
397 Yamamoto: An overview of Ebola virus disease
History Four people in contact with the monkeysdeveloped antibodies to RESTV but did not become sick. To The first 2 outbreaks of EVD occurred in 1976, date, no symptomatic human cases with RESTV when EBOV and SUDV appeared around the same infection have been reported, which suggests that period in the Democratic Republic of Congo (DRC, the pathogenicity of RESTV towardshumansmay erstwhile Zaire) and South Sudan, respectively 1)-3) be low. (Table-2). In these outbreaks, 318 cases were identified in DRC with 280 fatalities(88% mortal- EBOV outbreak in 2014-2015 ity), and 284 cases were identified in Sudan with 151 fatalities (53% mortality). These epidemics were The World Health Organization (WHO) publicly caused by two distinct species (EBOV and SUDV), announced an Ebola epidemic in West Africa on but this aspect was not recognized until some years March 23, 2014, and declared the outbreak a Public later. The name“Ebola virus”was derived from Health Emergency of International Concern on that of the Ebola river in DRC, because this river August 8, 2014 9). The current outbreak isthe wasnear Yambuku, the focusof the firstEBOV largest in history, with 24,907 cases and 10,326 outbreak in 1976. deathsasof March 22, 2015 (http: //www. who. From 1976 to 2013, 1,395 cases of EBOV infection, int/csr/disease/ebola/situation-reports/en/). including 1, 081 fatalities(77% mortality) and 815 Virological investigation identified EBOV as the cases of SUDV with 425 fatalities (52% mortality) causative agent of this West African outbreak 10). were reported. The fatality rate of EBOV isthe Full-length genome sequencing and phylogenetic highest of the five viruses in the genus Ebolavirus analysisindicatedthat EBOV from Guinea formsa according to the data from 1976 to 2013. separate clade from the known EBOV strains from Following the emergence of EBOV and SUDV, the DRC and Gabon. Retrospective studies identi- TAFV was isolated in 1994 from an ethologist who fied the index patient in West Africaʼs Ebola fell ill after performing a necropsy on a dead epidemic asa 2-year-old boy who died in Melian- chimpanzee in the Taï Forest, Côte dʼIvoire 4) 5) dou, Guéckédou prefecture, Guinea, in December (Table-2). The patient was transported to Switzer- 2013 10) 11). From Guéckédou, EVD was transmitted land for treatment and recovered without sequelae. to Macenta by early February 2014 and subse- TAFV infection appears to be symptomatic in quently to Kissidougou by late February 2014 10). humans, but no fatal case has been reported thus EVD further spread into other areas of Guinea, far. followed by Liberia, Sierra Leone, Nigeria, Senegal, BDBV isthe fourth speciesthatincludesviruses and Mali. Countries outside Africa, the USA, Spain, pathogenic to humans(Table-2), and was identi- and the UK were also affected by EVD. There were fied as the causative agent for the outbreak in the such 4 cases, including 1 fatality in the USA. The Bundibugyo district in western Uganda in 2007 6), in WHO was informed of 1 case in Spain and 1 case in which there were 149 cases with 37 fatalities (25% the UK, both of which recovered from EVD. mortality). In total, 185 cases of BDBV infection, On August 24, 2014, when the West African EVD including 50 fatalities, were reported with a outbreak wasspreading,the WHO wasnotified of mortality rate of 27%. another unrelated EVD outbreak in the area near In 1989, RESTV was identified in a shipment of Boende town, Équateur province, in western cynomolgusmonkeyshousedat quarantine facili- DRC 12). The index patient wasa pregnant woman tiesin Reston,Virginia (RESTV isnamed after who butchered a monkey that had been found dead Reston) 7) 8) (Table-2). These monkeys had been by her husband. She became ill on July 26 and died imported from the Philippines. During transporta- on August 11. Although the DRC outbreak was also tion and quarantine, an unusually high mortality caused by EBOV, the lineage was most closely rate was observed in the animals, but no human related to a variant from the 1995 Ebola outbreak in casewasdetected. In 1990, RESTV wasintroduced Kikwit in the DRC and not to EBOV variantsthat once again into quarantine facilitiesin Virginia and are currently circulating in West Africa. This Texasby monkeysimported from the Philippines. outbreak in DRC wasthe countryʼsseventh
398 Juntendo Medical Journal 61(4), 2015
outbreak, and health officialsknew the measuresto A feature of the filovirusgenome isthe presence take to contain the outbreak, despite a weak health of gene overlaps, as shown in Figure-2. There are system and a severe shortage of healthcare staff. three overlaps(VP35-VP40, GP-VP30, and VP24- The control measures, including case detection, L) in the genomesof EBOV, SUDV, BDBV, and isolation, contact tracing, safe burial, and infection TAFV. RESTV hastwo overlapsin itsgenome; the prevention, were applied quickly and worked GP-VP30 overlap isreplaced by an intergenic effectively. On November 21, 2014, the WHO region. The genomesof marburgvirusescontain formally declared that the outbreak wasover in the only a VP30-VP24 overlap, which is not present in DRC. ebolaviruses.
Virion structure Pathogenesis
The virionsof ebolavirusesarepleomorphic, Three pathogenic ebolaviruses cause the most appearing as U-shaped, 6-shaped, circular, branched, severe hemorrhagic fever syndromes in humans or filamentousformswith varying lengths(up to and non-human primates. EVD is associated with 14,000 nm). The Latin word filum means“thread,” rapid virus replication and a marked dysregulation and the elongated filamentous form characteristic of of the immune and vascular systems. Dendritic the viruses in the genera Ebolavirus, Marburgvirus, cells, monocytes, and macrophages are the primary and Cuevavirus therefore inspired the name filovirus. targetsof ebolavirusinfection. The viral protein The shapesofviral particlesare varied, but all VP35 blocksthe production of type I interferons formshave a uniform diameter of 80 nm (Figure- (IFNs) (namely, IFN-α and IFN-β) by preventing 1). Virionscontain a helical ribonucleoprotein the activation of IFN regulatory factor (IRF)-3 and complex or nucleocapsid roughly 50 nm in diameter, IRF-7 15)-18). Furthermore, VP35 interfereswith the which is surrounded by a matrix protein. Virions activation of dsRNA-dependent protein kinase have a central axial space (〜20 nm in diameter) PKR 19) and suppresses antiviral RNAi response 20). spanning the length of the particle. The viral VP24 inhibitsthe nuclear accumulation of the envelope is derived from the host-cell plasma tyrosine-phosphorylated signal transducer and membrane, which is studded with viral peplomers activator of transcription (STAT) 1 and thereby projecting approximately 10 nm from the surface. inhibits the signaling of IFN-α, IFN-β, and IFN-γ (Figure-3 and Table-3) 21) 22). These mechanisms Genome structure contribute to the efficient replication of ebolaviruses in dendritic cells, monocytes, and macrophages. The filovirusvirion containsa non-segmented, These cells are important in viral dissemination and single-stranded, negative-sense RNA molecule systemic infection because they are extensively with a length of approximately 19,000 bases. The distributed across different tissues and possess viral genome encodes seven structural proteins: migratory capacity through blood and lymphatic nucleoprotein (NP), virion protein (VP) 35, VP40, systems 23). VP30, VP24, glycoprotein (GP), and L (polymer- Infected dendritic cellsproduce only a limited ase). The genomic RNA also encodes two non- panel of cytokines, without full activation and structural proteins, namely, soluble GP (sGP) and maturation. It has been shown that active co-stimu- small soluble GP (ssGP), which are not expressed in latory molecules are silenced and co-inhibitory marburgviruses 13) 14). The expression of structural molecules are expressed in the infected dendritic GP and nonstructural ssGP requires transcriptional cells 23)-26). Dysregulation of co-stimulation may editing events at the RNA editing site, which has contribute to the anergy and apoptosis of T cells. T seven uridines on the RNA genomic template. cell death may also be mediated by Fas/FasL These transcriptional editing events result in the signaling, TRAIL/TRAIL-R signaling, soluble insertion of one or two additional adenosines, mediators of apoptosis, and superantigenic activity leading to the production of GP or ssGP, whereas of viral proteins 23) 27)-29). The dysfunction of den- the unedited transcript produces sGP. dritic cellsleadsto defective adaptive immunity.
399 Yamamoto: An overview of Ebola virus disease
Peplomers Nucleocapsid VP30
VP35
80 nm
Matrix VP40 VP24 Envelope Polymerase（L） Figure-1 Schematic representation of a filovirus particle Four proteins are involved in the formation of the ribonucleoprotein complex: polymerase (L), nucleoprotein (NP), virion protein 30 (VP30), and VP35. VP40 and VP24 are membrane-associated proteins.
RNA edit site EBOV VP40 Trailer GP L SUDV 3’ 5’ NP sGP BDBV Leader VP35 ssGP VP30 VP24 TAFV
IR Overlap IR Overlap IR Overlap
RNA edit site VP40 Trailer GP L RESTV 3’ 5’ NP sGP Leader VP35 ssGP VP30 VP24
IR Overlap IR IR IR Overlap
VP40 VP24 Trailer MARV GP L 3’ 5’ RAVV NP Leader VP35 VP30
IRIR IR IROverlapIR
Nucleoproteins Polymerase complex
Membrane－associated proteins Nonstructural proteins
Gene noncoding regions
IR：Intergenic Region Figure-2 Organization of filovirusgenomes EBOV, SUDV, BDBV, and TAFV have three overlapsin their genomes,whereasRESTV hastwo overlaps.MARV and RAVV only have the VP30-VP24 overlap, which is absent in ebolaviruses.
400 Juntendo Medical Journal 61(4), 2015
Ebolaviruses
Dendritic cell Recruitment of additional Monocyte/Macrophage monocytes/macrophages to the site of infection
Inhibition of IFN pathway Inhibition of IFN pathway Production of cytokines, chemokines, Impaired DC function and NO
Endothelial cells ＋ ＋ Dysregulated costimulation CD4 T cell CD8 T cell NK cell
Activation of death receptors Immunosuppression Apoptosis Increased vascular permeability Lymphopenia Coagulation dysregulation（DIC）
Hepatocytes Liver dysfunction Uncontrolled viral replication Inhibition of Hemorrhagic syndrome clotting－factor synthesis
Adrenal cortical cells Hypotension Shock Metabolic disorder Multiple organ failure
Figure-3 Pathogenesis model of the Ebola virus diseases The primary target cells for ebolavirus infection are dendritic cells (DCs) and monocytes/macrophages. In DCs, infection leads to impaired function and dysregulation of lymphocyte co-stimulation. Macrophage infection leads to production of proinflammatory mediators, which may induce bystander apoptosis in lymphocyte populations, thereby contributing to lymphopenia and immunosuppression. Immunosuppres- sion caused by T cell anergy and lymphopenia enables uncontrolled viral replication. Dysregulation of cytokine production causes increased vascular permeability. In addition, the production of tissue factors by infected macrophages leads to the dysregulation of coagulation, which is further reinforced by liver dysfunction that leads to decreased synthesis of liver-derived clotting factors. Infection of adrenal cortical cells results in hypotension and metabolic disorders, which together with coagulopathy contribute to multiple organ failure and shock.
In contrast to infected dendritic cells, infected tory substances from monocytes/macrophages monocytes and macrophages produce massive may play a role in the induction of T cell apoptosis, amounts of pro-inflammatory factors, including together with dendritic cell dysfunction. Immuno- tumor necrosis factor (TNF) -α; interleukin (IL) suppression resulting from T cell anergy and -1β, IL-2, IL-6, IL-8, IL-10; monocyte chemo- lymphopenia enablesuncontrolled viral replication attractant protein (MCP) -1; regulated on activa- in the body. The dysregulated production of tion normal T cell expressed and secreted inflammatory substances causes increased vascular (RANTES) ; and reactive nitrogen and oxygen permeability and disseminated intravascular coagu- species (RNS and ROS, respectively) 27) 30) 31). These lation, which results in hemorrhagic syn- factorsrecruit additional macrophagesto the dromes 27) 28) 32)-38). Viral replication in hepatocytes infected areas, which facilitates the expansion of inhibits clotting factor synthesis, which also pro- virusinfection. Thisaberrant releaseof inflamma- motes the onset of hemorrhagic diseases. Damage
401 Yamamoto: An overview of Ebola virus disease
Table-3 List of treatment options for infection with ebolaviruses Drug candidatesCategory Mode of action Status Approved in Japan for pandemic influ- Favipiravir (T-705, avigan) RNA chain termination and/or lethal Nucleoside analogue enza (Fujifilm HoldingsCorp) mutagenesis Phase 2 study Effective in rodentsinfected with EBOV BCX-4430 Nucleoside analogue RNA chain termination Effective in non-human primatesinfected (BioCryst Pharmaceuticals) with MARV ZMapp Inhibition of EBOV replication by the Antibody therapy Phase 2 study (Mapp Biopharmaceutical) cocktail of three anti-EBOV antibodies TKM-Ebola EBOV gene silencing by siRNA in lipid siRNA Phase 2 study (Tekmira Pharmaceuticals) nanoparticles Phosporodiamidate AVI-7537 Effective in rodentsand non-human morpholino oligomer Inhibition of EBOV replication by PMO (Sarepta Therapeutics) primates (PMO) Recombinant human Inhibition of procoagulant activity Effective in non-human primates Coagulation modulator activated protein C (rhAPC) induced by EBOV infection Withdrawn from global market Recombinant nematode Inhibition of procoagulant activity anticoagulant protein C2 Coagulation modulator Effective in non-human primates induced by EBOV infection (rNAPC2) S-adenosylhomocysteine Enhancement of interferon-dependent Effective in rodentsbut not in non- Immune modulator hydrolase inhibitors antiviral pathway human primates Antiviral activity induced by interfer- Effective in rodentsbut not in non- Type I interferonsImmune modulator ons human primates
to adrenal cortical cellsby viral infection resultsin to suppress EBOV replication in cell cultures and to hypotension and metabolic disorder. This dysfunc- be effective in mice lacking the type I IFN tion in adrenal glandsand the hemorrhagic receptor 41). Initiation of favipiravir administration syndromes caused by increased vascular perme- at day 6 after infection induced prompt viral ability and liver dysfunction result in hemorrhagic clearance, reduced biochemical parametersof shock and multiple organ failure. disease severity, and prevented lethal outcome in 100% of tested animals. Favipiravir also provided Treatment 100% protection against aerosol EBOV infection in immune-deficient mice 42). By contrast, only one of To date, no specific therapy has been established six tested animals survived in a non-human pri- for EVD. Supportive care isadopted for EVD mate model (http: //www. who. int/csr/resources patients to maintain blood volume, blood pressure, /publications/ebola/potential-therapies-vaccines/ and electrolyte balance. To save the lives of more en/). A clinical trial was conducted to test the EVD patients, it is imperative to develop more efficacy of favipiravir in reducing the mortality of effective therapeuticsfor ebolavirusinfection. EBOV-infected individualsin Guinea(http://www. Based on the understanding of the mechanisms of msf. org/article/preliminary-results-jiki-clinical- virus replication and pathogenesis, new targets for trial-test-efficacy-favipiravir-reducing-mortality). therapeutic intervention have been identified, and Preliminary data from thisclinical trial indicated some drug candidates have shown positive results that favipiravir monotherapy reduced mortality in in animal models(Table-3). populations with a moderate viral load and less Favipiravir (Fujifilm Holdings Corporation), also advanced disease but could not reduce mortality in known asT-705 or Avigan, isa broad-spectrum populationswith very high viral load and advanced inhibitor of viral RNA polymerase that can inhibit disease. the replication of many RNA viruses, including BCX-4430 (BioCryst Pharmaceuticals) is an ade- influenza viruses, West Nile virus, yellow fever nosine analog with an inhibitory effect towards viral virus, foot-and-mouth disease virus, and noro- RNA polymerase. It has been found to be effective virus 39) 40). Favipiravir wasapproved in 2014 in against EBOV and MARV in the rodent model and Japan for influenza pandemicsand hasbeen shown to completely protect non-human primatesfrom
402 Juntendo Medical Journal 61(4), 2015
MARV infection when administeredaslate as48 h treatment for EVD (http: //www. niaid. nih. gov/ after infection 43) 44). news/newsreleases/2015/Pages/ZMapp.aspx). ZMapp (Mapp Biopharmaceutical) isa cocktail of TKM-Ebola (Tekmira Pharmaceuticals) includes three monoclonal antibodiesfor EBOV, which were three small interfering RNAs (siRNAs) targeting selected from six antibodies used in the monoclonal EBOV L polymerase, membrane-associated protein antibody cocktailsMB-003 and ZMAb. MB-003 VP24, and polymerase complex protein VP35. includes three humanized or human-mouse chi- These siRNAs are formulated as stable nucleic meric monoclonal antibodies: c13C6, h13F6, and acid-lipid particles. A phase 1 clinical trial of TKM- c6D8 45). ZMAb is a mixture of three mouse Ebola was conducted for assessing the safety of monoclonal antibodiesm1H3, m2G4, and m4G7 46). TKM-Ebola in healthy people. The FDA placed the To extend the antibody half-life in humansand to trial on clinical hold in July 2014 after some subjects facilitate clinical acceptance, the individual murine had flu-like responses. In August, the FDA chang- antibodiesin ZMAb were chimerized with human ed the status to“partial hold,”allowing the drug to constant regions (c1H3, c2G4, and c4G7). Experi- be used under expanded access for people infected mentsusingguinea pigsand non-human primates with EBOV. A new phase 2 clinical trial of TKM- were performed to determine the best combination Ebola-Guinea, which is designed specifically to tar- of antibodies. The most effective was the mixture of get the strain of EBOV responsible for the present c13C6 (from MB-003), c2G4, and c4G7 (from outbreak in Guinea, Liberia, and Sierra Leone, is cZMAb), which wasnamed ZMapp. ZMapp has set to start in Sierra Leone (http: //www. who. been reported to rescue 100% of rhesus macaques int/tdr/news/2015/trial-TKM-ebola-trmnt/en/). when treatment isinitiated up to 5 daysafter EBOV infection 47). Until the occurrence of the current Vaccination Ebola outbreak, ZMapp had not been used in humans. However, the FDA allowed ZMapp to be Vaccination is considered one of the most used for EVD patients. In 2014, ZMapp was used to important strategiestocontrol ebolavirusinfection. treat seven individuals infected with EBOV. Two of Although no licensed vaccine is available for them died and five of them recovered from EVD. prevention of EVD to date, significant progress has The outcome was not considered statistically been made in recent years(Table-4). The following significant because of the limited number of different vaccine platformshave been evaluated and patients who received ZMapp. The National Insti- have shown promising results: virus-like particles, tutes of Allergy and Infectious Diseases (NIAID) Venezuelan equine encephalitisvirusreplicons, announced on February 27, 2015 that the Liberian replication-competent recombinant human parain- government and NIAID had launched a clinical trial fluenza type 3, replication-incompetent adenovirus to obtain safety and efficacy data on ZMapp as a vectors, and recombinant vesicular stomatitis virus
Table-4 List of vaccine candidates for ebolaviruses Vaccine candidatesCompany Feature Status GlaxoSmithKline, U.S. National Institute of Chimpanzee adenovirus 3-based vector ChAd3-EBOV Phase 2/3 Allergy and Infectious expressing EBOV glycoprotein Diseases NewLink Genetics, Vesicular stomatitis virus (VSV)-based vector VSV-EBOV Merck Vaccines, and Public expressing EBOV glycoprotein instead of Phase 2/3 Health Agency of Canada VSV-G A two-dose vaccine using different products for heterologous prime-boost vaccination Priming: adenovirus 26 expressing EBOV glyco- Ad26-EBOV and MVA-EBOV Crucell, Bavarian Nordic Phase 1 protein Boosting: Multivalent modified vaccinia virus Ankara containing EBOV glycoprotein Recombinant nanoparticle containing EBOV EBOV GP nanoparticle Novavax Phase 1 glycoprotein with Matrix-M adjuvant
403 Yamamoto: An overview of Ebola virus disease
(VSV) 48) 49). Very recently, it wasreported that the general population. Multiple studies in cynomol- replication-incompetent EBOV lacking VP30 gus macaques have shown that a single administra- (EBOVΔVP30) protectsnon-human primatesfrom tion of the vaccine confersa high level of protection lethal EBOV infection 50). To address any potential against lethal challenge, including that through the concernsover recombination eventsthat would aerosol route 51) 52). In a phase 1 trial, the most restore the replication ability of EBOVΔVP30, common adverse events were pain at the injec- virionswere additionally treated with hydrogen tion-site, myalgia, and fatigue. Because there was a peroxide (3% final concentration) for inactivation. report from another ongoing study of VSV-EBOV
The vaccineswith and without H 2O2 were protec- regarding arthritis with onset in the second week tive in non-human primates, whereas administra- after injection, participants were specifically que- tion of a gamma-irradiated, inactive form of the ried about the development of new arthralgia, virus did not protect animals. arthritis, or rash during the second week or later Currently, at least two vaccine candidates are in after vaccination. One participant reported arthral- advanced stages of development: ChAd3-EBOV gia, but thisappeared to be unrelated to vaccination from GlaxoSmithKline and the US NIAID, and with VSV-EBOV. No casesofarthritiswere iden- VSV-EBOV from NewLink Genetics, Merck Vac- tified. There were no deaths or serious adverse cines, and the Public Health Agency of Canada events resulting in withdrawal from the study, and (http: //www. who. int/medicines/emp_ebola_q_as anti-Ebola immune responses were detected in /en/). all the volunteers 53). The VSV-EBOV vaccine has The ChAd3 vaccine against EBOV infection is a been selected for the phase 2/3 PREVAIL trial, viral-vectored vaccine that expresses the glycopro- together with ChAd3-EBOV (http: //www. niaid. tein of EBOV. Thisvaccine isbasedon a non-repli- nih. gov/news/QA/Pages/EbolaVaxResultsQA. cating adenovirusthat primarily infectschimpan- aspx). In Guinea, a phase 3 trial was launched on zees in the wild. Use of a chimpanzee adenovirus March 7, 2015 to test the VSV-EBOV vaccine for alleviatesproblemsof high levelsof pre-existing efficacy and effectiveness in preventing EVD (http: immunity to human adenoviruses, which may //www.who.int/mediacentre/news/releases/2015/ reduce the efficacy of some human adenovi- ebola-vaccine-trial/en/). This VSV-based vaccine rus-based vectors. ChAd3 encoding EBOV glyco- will also be evaluated in a phase 2/3 trial called the protein wasfound to protect non-human primates Sierra Leone Trial to Introduce a Vaccine against from lethal infection with EBOV. Phase 1 clinical Ebola (STRIVE) (http: //www. cdc. gov/vhf/ebola/ trials to assess the safety and immunogenicity of strive/). ChAd3-EBOV vaccine were conducted, and no safety concerns were identified. The vaccine was Conclusion shown to induce antibody production and cell-medi- ated immune responses in a dose-dependent EVD is a major threat to humans, and the recent manner in healthy adults. A phase 2/3 trial (Part- 2014-15 outbreak indicatesthe need for prepared- nership for Research on Ebola Vaccines in Liberia; ness against future outbreaks. The development of PREVAIL) has been initiated in West Africa for effective vaccinesand therapiesistherefore press- testing the ChAd3-EBOV vaccine (http: //www. ingly important. To date, ChAd3-EBOV and VSV- niaid. nih. gov/news/QA/Pages/EbolaVaxResultsQ EBOV have shown the most progress as vaccine A.aspx). candidatesfor EVD. Favipiravir, ZMapp, and The VSV-EBOV vaccine consists of a recombi- TKM-Ebola-Guinea are also moving ahead as nant VSV in which the VSV glycoprotein isdeleted promising drug candidates. Compounds that can and substituted with EBOV glycoprotein. The counteract the antagonistic activity of EBOV VSV-based system is advantageous as a vaccine proteins against IFN or that can inhibit coagulop- vector because of its replication in mammalian cells, athy induced by EBOV infection would be the next growth to very high titers, and strong induction of drug candidates. The ongoing accumulation of innate and adaptive immunity, and because of the information on the virus and EVD pathogenesis very low levels of pre-existing immunity to VSV in is expected to accelerate the establishment of
404 Juntendo Medical Journal 61(4), 2015
vaccines, antiviral drugs, and other novel strategies. 19) Feng Z, Cerveny M, Yan Z, He B: The VP35 protein of Ebola virusinhibitsthe antiviral effect mediated by double-stranded RNA-dependent protein kinase PKR. J References Virol, 2007; 81: 182-192. 20) HaasnootJ, de VriesW, GeutjesEJ, PrinsM, de Haan P, 1) Bowen ET, Lloyd G, Harris WJ, Platt GS, Baskerville A, Berkhout B: The Ebola virusVP35 protein isa sup- Vella EE: Viral haemorrhagic fever in southern Sudan pressor of RNA silencing. PLoS Pathog, 2007; 3: e86. and northern Zaire. Preliminary studies on the aetiologi- 21) Reid SP, Leung LW, Hartman AL, et al: Ebola virus cal agent. Lancet, 1977; 1: 571-573. VP24 bindskaryopherin alpha1 and blocksSTAT1 2) Ebola haemorrhagic fever in Sudan, 1976. Report of a nuclear accumulation. J Virol, 2006; 80: 5156-5167. WHO/International Study Team. Bull World Health 22) Reid SP, Valmas C, Martinez O, Sanchez FM, Basler CF: Organ, 1978; 56: 247-270. Ebola virusVP24 proteinsinhibit the interaction of 3) Ebola haemorrhagic fever in Zaire, 1976. Bull World NPI-1 subfamily karyopherin alpha proteins with Health Organ, 1978; 56: 271-293. activated STAT1. J Virol, 2007; 81: 13469-13477. 4) Formenty P, Hatz C, Le Guenno B, Stoll A, Rogenmoser 23) Geisbert TW, Hensley LE, Larsen T, et al: Pathogenesis P, Widmer A: Human infection due to Ebola virus, of Ebola hemorrhagic fever in cynomolgus macaques: subtype Cote dʼIvoire: clinical and biologic presentation. evidence that dendritic cells are early and sustained J Infect Dis, 1999; 179 Suppl 1: S48-53. targetsof infection. Am J Pathol, 2003; 163: 2347-2370. 5) Le Guenno B, Formenty P, WyersM, Gounon P, Walker 24) Mahanty S, Gupta M, ParagasJ, Bray M, Ahmed R, F, Boesch C: Isolation and partial characterisation of a Rollin PE: Protection from lethal infection isdetermined new strain of Ebola virus. Lancet, 1995; 345: 1271-1274. by innate immune responses in a mouse model of Ebola 6) Towner JS, Sealy TK, Khristova ML, et al: Newly virusinfection. Virology, 2003; 312: 415-424. discovered ebola virus associated with hemorrhagic 25) Bosio CM, Aman MJ, Grogan C, et al: Ebola and fever outbreak in Uganda. PLoS Pathog, 2008; 4: Marburg viruses replicate in monocyte-derived den- e1000212. dritic cellswithout inducing the production of cytokines 7) Dalgard DW, Hardy RJ, Pearson SL, et al: Combined and full maturation. J Infect Dis, 2003; 188: 1630-1638. simian hemorrhagic fever and Ebola virus infection in 26) Jin H, Yan Z, Prabhakar BS, et al: The VP35 protein of cynomolgus monkeys. Lab Anim Sci, 1992; 42: 152-157. Ebola virusimpairsdendritic cell maturation induced by 8) Jahrling PB, Geisbert TW, Dalgard DW, et al: Prelimi- virus and lipopolysaccharide. J Gen Virol, 2010; 91: 352- nary report: isolation of Ebola virus from monkeys 361. imported to USA. Lancet, 1990; 335: 502-505. 27) Baize S, Leroy EM, Georges-Courbot MC, et al: Defec- 9) Briand S, Bertherat E, Cox P, et al: The international tive humoral responses and extensive intravascular Ebola emergency. N Engl J Med, 2014; 371: 1180-1183. apoptosis are associated with fatal outcome in Ebola 10) Baize S, Pannetier D, Oestereich L, et al: Emergence of virus-infected patients. Nat Med, 1999; 5: 423-426. Zaire Ebola virus disease in Guinea. N Engl J Med, 2014; 28) Wauquier N, Becquart P, Padilla C, Baize S, Leroy EM: 371: 1418-1425. Human fatal zaire ebola virus infection is associated with 11) Mari Saez A, Weiss S, Nowak K, et al: Investigating the an aberrant innate immunity and with massive lympho- zoonotic origin of the West African Ebola epidemic. cyte apoptosis. PLoS Negl Trop Dis, 2010; 4. EMBO Mol Med, 2015; 7: 17-23. 29) Leroy E, Baize S, Gonzalez JP: Ebola and Marburg 12) Maganga GD, Kapetshi J, Berthet N, et al: Ebola virus hemorrhagic fever viruses: update on filoviruses. Med disease in the Democratic Republic of Congo. N Engl J Trop (Mars), 2011; 71: 111-121. Med, 2014; 371: 2083-2091. 30) Baize S, Leroy EM, GeorgesAJ, et al: Inflammatory 13) Sanchez A, Trappier SG, Mahy BW, PetersCJ, Nichol responses in Ebola virus-infected patients. Clin Exp ST: The virion glycoproteinsof Ebola virusesare Immunol, 2002; 128: 163-168. encoded in two reading frames and are expressed 31) Villinger F, Rollin PE, Brar SS, et al: Markedly elevated through transcriptional editing. Proc Natl Acad Sci U S levelsof interferon (IFN)-gamma, IFN-alpha, inter- A, 1996; 93: 3602-3607. leukin (IL)-2, IL-10, and tumor necrosis factor-alpha 14) Mehedi M, Falzarano D, Seebach J, et al: A new Ebola associated with fatal Ebola virus infection. J Infect Dis, virus nonstructural glycoprotein expressed through 1999; 179 Suppl 1: S188-191. RNA editing. J Virol, 2011; 85: 5406-5414. 32) Feldmann H, Klenk HD: Marburg and Ebola viruses. 15) Basler CF, Mikulasova A, Martinez-Sobrido L, et al: The Adv Virus Res, 1996; 47: 1-52. Ebola virusVP35 protein inhibitsactivation of interferon 33) Stroher U, West E, Bugany H, Klenk HD, Schnittler HJ, regulatory factor 3. J Virol, 2003; 77: 7945-7956. Feldmann H: Infection and activation of monocytesby 16) CardenasWB, Loo YM, Gale M Jr, et al: Ebola virus Marburg and Ebola viruses. J Virol, 2001; 75: 11025- VP35 protein binds double-stranded RNA and inhibits 11033. alpha/beta interferon production induced by RIG-I 34) Schnittler HJ, Feldmann H: Marburg and Ebola hemor- signaling. J Virol, 2006; 80: 5168-5178. rhagic fevers: does the primary course of infection 17) PrinsKC, CardenasWB, BaslerCF: Ebola virusprotein depend on the accessibility of organ-specific macro- VP35 impairsthe function of interferon regulatory phages? Clin Infect Dis, 1998; 27: 404-406. factor-activating kinases IKKepsilon and TBK-1. J 35) Hensley LE, Young HA, Jahrling PB, Geisbert TW: Virol, 2009; 83: 3069-3077. Proinflammatory response during Ebola virus infection 18) Basler CF, Wang X, Muhlberger E, et al: The Ebola of primate models: possible involvement of the tumor virusVP35 protein functionsasa type I IFN antagonist. necrosis factor receptor superfamily. Immunol Lett, Proc Natl Acad SciUSA,2000; 97: 12289-12294. 2002; 80: 169-179. 36) Gerszten RE, Garcia-Zepeda EA, Lim YC, et al: MCP-1
405 Yamamoto: An overview of Ebola virus disease
and IL-8 trigger firm adhesion of monocytes to vascular 45) Pettitt J, Zeitlin L, Kim do H, et al: Therapeutic endothelium under flow conditions. Nature, 1999; 398: intervention of Ebola virusinfection in rhesusmacaques 718-723. with the MB-003 monoclonal antibody cocktail. Sci 37) Baize S, Leroy EM, Mavoungou E, Fisher-Hoch SP: Transl Med, 2013; 5: 199ra113. Apoptosisinfatal Ebola infection. Doesthe virustoll the 46) Qiu X, Audet J, Wong G, et al: Successful treatment of bell for immune system? Apoptosis, 2000; 5: 5-7. ebola virus-infectedcynomolgusmacaqueswith mono- 38) Reed DS, Hensley LE, Geisbert JB, Jahrling PB, Geisbert clonal antibodies. Sci Transl Med, 2012; 4: 138ra181. TW: Depletion of peripheral blood T lymphocytesand 47) Qiu X, Wong G, Audet J, et al: Reversion of advanced NK cells during the course of ebola hemorrhagic Fever Ebola virus disease in nonhuman primates with ZMapp. in cynomolgus macaques. Viral Immunol, 2004; 17: Nature, 2014; 514: 47-53. 390-400. 48) Marzi A, Feldmann H, Geisbert TW, Falzarano D: 39) Furuta Y, Gowen BB, Takahashi K, Shiraki K, Smee DF, Vesicular Stomatitis Virus-Based Vaccines for Prophy- Barnard DL: Favipiravir (T-705), a novel viral RNA laxisand Treatment of FilovirusInfections.J Bioterror polymerase inhibitor. Antiviral Res, 2013; 100: 446-454. Biodef, 2011; S1. 40) Rocha-Pereira J, Jochmans D, Dallmeier K, Leyssen P, 49) Falzarano D, Geisbert TW, Feldmann H: Progress in Nascimento MS, Neyts J: Favipiravir (T-705) inhibits filovirusvaccine development: evaluating the potential in vitro norovirusreplication. Biochem BiophysRes for clinical use. Expert Rev Vaccines, 2011; 10: 63-77. Commun, 2012; 424: 777-780. 50) Marzi A, Halfmann P, Hill-Batorski L, et al: An Ebola 41) Oestereich L, Ludtke A, Wurr S, Rieger T, Munoz- whole-virusvaccine isprotective in nonhuman pri- Fontela C, Gunther S: Successful treatment of advanced mates. Science, 2015; 348: 439-442. Ebola virus infection with T-705 (favipiravir) in a small 51) Geisbert TW, Feldmann H: Recombinant vesicular animal model. Antiviral Res, 2014; 105: 17-21. stomatitis virus-based vaccines against Ebola and 42) Smither SJ, Eastaugh LS, Steward JA, Nelson M, Lenk Marburg virus infections. J Infect Dis, 2011; 204 Suppl 3: RP, Lever MS: Post-exposure efficacy of oral T-705 S1075-1081. (Favipiravir) against inhalational Ebola virus infection 52) Geisbert TW, Daddario-Dicaprio KM, Geisbert JB, et al: in a mouse model. Antiviral Res, 2014; 104: 153-155. Vesicular stomatitis virus-based vaccines protect non- 43) Warren TK, WellsJ, Panchal RG, et al: Protection human primates against aerosol challenge with Ebola against filovirus diseases by a novel broad-spectrum and Marburg viruses. Vaccine, 2008; 26: 6894-6900. nucleoside analogue BCX4430. Nature, 2014; 508: 402- 53) RegulesJA, Beigel JH, Paolino KM, et al: A Recombinant 405. VesicularStomatitisVirusEbola Vaccine - Preliminary 44) Vere Hodge RA: Meeting report: 27th International Report. N Engl J Med, 2015. DOI: 10.1056/NEJMoa1414 conference on antiviral research, in Raleigh, NC, USA. 216 Antiviral Res, 2014; 111: 143-153.
406 Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Juntendo Medical Journal 2015. 61(4), 407-412
The Current Situation of Dengue Research
TAKESHI KUROSU＊
＊Research Institute for Microbial Diseases, Osaka University, Osaka, Japan
Dengue is a mosquito-borne disease that is caused bythe dengue virus (DENV) and that represents an important public health problem in tropical and subtropical countries. Because it is carried bymosquitos, there were no cases of domestic infection in Japan for the last 70 years. However, 162 persons were infected with DENV in Japan last year, possibly due to the changes in climate or human migration. Research on dengue has a long history, but many important questions have not yet been answered. For instance, it is still unknown why severe dengue occurs when a patient is secondarily infected with a different serotype of DENV. It is believed that severe dengue is the result of vascular leakage induced byan excessive host defense reaction, but it remains unknown what triggers the change in vascular permeability. DENV-infected patients often show thrombocytopenia, a typical symptom of dengue, but it is not known what causes the thrombocytopenia and if there is a correlation between thrombocytopenia and vascular leakage. This review describes the features of DENV infection and the current state of developing dengue vaccines and treatments. Key words: dengue fever, dengue hemorrhagic fever, tropical diseases, mosquito-borne infection
Introduction Clinical features
The first recorded case of probable dengue fever Dengue is clinically categorized into two types was described in a Chinese medical encyclopedia that differ in severity. One type is dengue fever from the Jin Dynasty. The text, written in AD (DF), which causes fever, rash, myalgia, joint pain, 265-420, associated the disease with a flying insect abdominal pain, and thrombocytopenia. Another is (Dengue Virus Net, http: //www. denguevirusnet. dengue hemorrhagic fever (DHF), a more severe com/history-of-dengue.html). The first recognized form of the disease that causes hemorrhagic dengue epidemics occurred in Asia, Africa, and symptom, hepatic injury, and severe thrombocyto- North America in the 1780s. The first confirmed penia. Although severe dengue is called dengue case was reported in 1789 byBenjamin Rush, and “hemorrhagic” fever, hemorrhage is not the basis he named as “breakbone fever” because of the for the severitybut the result of increased vascular symptoms of myalgia and arthralgia. The dengue permeability. In patients with DHF, an accumula- virus (DENV) was first isolated byJapanese tion of fluid in the abdominal and pleural cavities is researchers in 1943 1). Since then, manyDENVs often observed, and hemorrhage can even occur in have been isolated using mosquitoes, suckling mice, brain in severe cases. DHF has a fatalityrate of and cultured cells. Recently, a mosquito cell line, about 1% when patients are not properlytreated. which was also established bya Japanese In the case of the most severe form of DHF, researcher 2), has become a commonlyused tool for patients die of hypotonic shock because of the loss virus isolation because of its high virus isolation rate of bodyfluids from the blood circulation; therefore, and easier handling. the maintenance of bodyfluid balance improves
Takeshi Kurosu ＊Present Address: Department Virology1, National Institute of Infectious Diseases 4-7-1 Gakuen, Musashimurayama-shi, Tokyo 208-0011, Japan TEL: +81-42-561-0771 E-mail: [email protected] 〔Received Apr. 1, 2015〕
407 Kurosu: The current situation of dengue research
survival. Once patients survive the shock syn- Primary Secondary drome, theydo not have anysequelae. Compared to other viral hemorrhagic fevers, such as Ebola virus DENV－1 DENV－1 Protection infection, DHF is a relativelycurable disease. DENV－2 During a dengue epidemic in Japan, there was only one DHF case. Indeed, most dengue-infected DENV－3 DHF patients experienced onlya flu-like illness that completely resolved within 7-10 days. However, DENV－4 dengue is a leading cause of hospitalization and death among children in South East Asia 3) because Figure-1 Primaryinfection vs. secondaryinfection the absolute number of patients with dengue is huge in manyof these countries. A unique feature of DHF is that vascular leakage Another unique feature of dengue is that severe occurs during the recoveryperiod. Vascular disease often occurs in patients secondarilyinfected leakage does not occur at the peak of viremia or with other serotypes of dengue different from that fever, but onlywhen patients start recovering from of the primary infection. Dengue has four serotypes, dengue at the time of defervescence 4). Vascular DENV-1-4, and all four serotypes can cause severe leakage starts suddenlyand ends rapidlyin cases dengue. For example, once a person becomes with a positive outcome, taking just 24-36 hours infected with one type of DENV (e.g., DENV-1), he from start to recovery. Patients usually visit the or she will never be infected again with same clinic 1 or 2 days after the onset of fever. During this serotype of DENV (Figure-1). However, this per- period, patients have the highest viremia while son could still become infected with other serotypes their platelet counts are alreadydropped. However, of DENV (e.g., DENV-2, -3, or -4). This is called until theyexperience increased vascular permeabil- secondary infection. In these cases, symptoms are ity, there is no clear sign that distinguishes between often more severe than in the primaryinfection. A DF and DHF, suggesting that vascular changes are hypothesis to explain this greater severity is that not predictable. This is the most challenging the secondaryinfection increases viral production problem for clinicians, who need to decide whether through antibody-dependent enhancement (ADE). to treat patients or to monitor for vascular leakage Indeed, higher viremia has often been observed in bymeasuring hematocrit values when theysuspect patients with secondaryinfection or severe dengue. severe dengue. Because there is no marker to In a secondaryinfection, antibodies (Abs) from the predict vascular leakage, clinicians need to judge primaryinfection do not have neutralizing effects. from clinical symptoms and blood test results. They Because target cells for dengue, such as mono- mainlypayattention to platelet counts, and a cyte/macrophages, express Fcγ receptors (FcγRs) sudden drop in platelet count or a diagnosis of on their surface, immune complexes containing severe thrombocytopenia at the first medical DENV and non-neutralizing anti-DENV Abs examination is regarded as a sign of severe disease. (virus-Ab immune complexes) could efficiently There is a negative correlation between platelet enter these cells through FcγR (Figure-2). As a counts and severity, but a low platelet count does result, patients have a higher viral production. not always lead to severe disease (vascular However, this is not the end of the story. Higher leakage) 5). Moreover, most patients recover with- viral production induces a stronger immune out experiencing critical vascular leakage or response, such as a cytokine storm, excessive hemorrhage. Therefore, there is a risk that hospitals complement activation, or massive production of treat patients unnecessarily, which is not economi- non-neutralizing Abs, which mayincrease vascular callyor administrativelyeffective because these permeability. patients occupythe limited number of beds There is a unique feature observed in DENV- available. To avoid this situation, a reliable marker infected patients that is thought to be related to molecule that can predict vascular leakage must be vascular leakage and severe disease. At the found. beginning of a DENV infection, the soluble form of
408 Juntendo Medical Journal 61(4), 2015
Mosquito bite Antibody－dependent enhancement Monocyte/ （ADE） Macrophages
Anti－E Ab DC－SIGN
Fc receptor Dendritic cells
Anti－E Ab （Non－neutraliging）
Blood vessel Dengue virus particle
Soluble NS1 Complement Cytokines Factor X?
Increased vascular leakage Figure-2 Secondaryinfection with DENV the DENV nonstructural protein 1 (NS1) is solely research. In the next section, the possible mechanis- found in the circulating blood (Figure-2). This is tic hypotheses for severe dengue are discussed. unusual because nonstructural proteins usually function in viral replication in the cytoplasm. Vascular leakage Nonstructural, in fact, means not included in the viral particle, and so not usuallyreleased from cells. Various types of inflammatory reactions can At present, we do not know whyNS1 is released increase vascular permeability. Inflammation is a into the blood circulation. Nonetheless, this soluble protective immunovascular response that aims to form of NS1 (sNS1) in patientsʼ sera is now used as eliminate the initial cause of tissue damage trig- a diagnostic marker for DENV infection because gered byvarious factors, including infection. sNS1 is present in blood at an earlystage of disease However, a state of inflammation that lasts too long progression 6). In fact, most of the currently or affects the whole body can injure the body. In the available kits for an earlydiagnosis of dengue assay case of dengue, virus infection increases vascular sNS1 levels. permeability as described above. Presumably, the The causative mechanisms of the two major changes in vascular permeabilityresult from the symptoms, vascular leakage and thrombocytopenia, virus-induced increases in levels of cytokines, remain unknown. It is verydifficult to know their chemokines, soluble chemical mediators, or acti- pathogenesis because it is likely that the symptoms vated components of the complement system. of severe dengue are the result of an excessive host Although studies have identified several candidate response, as described above. For example, pleural molecules that maybe responsible for the vascular and abdominal effusions are often observed in leakage in DENV-infected patients, we still do not patients with DHF, but still we do not know in know which is the most likelyagent. which organs the fluid leakage was triggered. Analyzing the virus will not provide a final answer 1. Cytokine hypothesis about the pathogenesis. The best wayto under- Several cytokines and chemokines, such as stand the pathologyof DHF is to studypatients; TNF-α, IL-6, IL-8, IL-10, IL-12, IFN-γ, and MCP-1, however, there is an ethical limitation to this kind of have been reported to be elevated in severe cases of
409 Kurosu: The current situation of dengue research
dengue 7)-9). Elevation of TNF-α, which is well of dengue since the 1970s because it is a strong known for its abilityto induce vascular leakage, is inducer of vascular permeability. Indeed, dengue the most commonlyobserved change. This is true patients have raised levels of blood and urinary even in a mouse model of lethal dengue, where histamine, produced bymast cells and basophils. types I and II interferon receptor knockout mice However, thus far there is no direct evidence to had a sudden elevation of TNF-α in the morbid prove a link between histamine and vascular stage of disease, as observed byseveral groups leakage. Other chemical mediators mayalso cause including our own 10). Treatment with an anti- vascular leakage, but they have not yet been TNF-α neutralizing antibodyprevented vascular studied in detail. leakage and protected mice from lethal infection. These results suggest that massive production of Thrombocytopenia TNF-α maybe a critical factor in severe dengue. Severe thrombocytopenia is not sufficient to 2. Complement hypothesis cause hemorrhage or vascular leakage; however, High levels of circulating immune complexes severe thrombocytopenia is observed in the most (CICs) can also be detected in DENV-infected severe cases and there is a negative correlation patients 11). Complement activation is thought to be between platelet counts and severity. For this extremelyhigh because there is an apparent con- reason, clinicians monitor platelet counts in dengue sumption of complement. At least two types of patients as an empirical wayto predict shock immune complexes exist in DENV-infected syndrome. Here, I will discuss the hypotheses that patients: one is composed of the DENV particle and may explain severe thrombocytopenia in DENV- anti-DENV envelope (E) protein Abs, and another infected patients. is composed of the DENV NS1 protein and anti-NS1 Abs. Since high levels of sNS1 seem to be related to 1. Bone marrow suppression severity, several groups have studied the role of Severe thrombocytopenia has been observed in immune complexes containing sNS1 in plasma DHF patients since the first studies of dengue 5). leakage. Indeed, immune complexes activate the Thrombocytopenia is thought to be due to bone classical pathwayof complement, which maycause marrow (BM) suppression. Indeed, BM-derived vascular leakage. cells are susceptible to DENV infection, although The effects of immune complexes on the body the target cell has not been clearlyidentified. depend on their affinityto organs and on their size. Although the two symptoms, vascular leakage and Small CICs usuallylast longer in the blood thrombocytopenia, are typically observed in severe circulation and sometimes cause vasculitic syn- dengue, the critical difference between them is the drome by a type III allergic reaction. The size of timing of their onsets. Vascular leakage occurs CICs containing NS1 is thought to be small during recoveryperiod, when viremia starts to compared to the viral particle because NS1 forms decrease and bodytemperature returns to normal, no more than a hexamer, while the viral particle is as described above. On the other hand, thrombocy- large because it contains several hundreds of C, M, topenia starts together with high fever in the acute and E protein molecules. The activation of comple- phase. At the beginning of DENV infection, patients ment byDENV infection can potentiallyincrease alreadyhave high levels of thrombopoietin, which vascular permeability. Although recent research stimulates megakaryocytes to produce platelets has focused on cytokines and soluble cellular after sensing a drop in platelet numbers 12). This mediators, there maybe still potential involvement observation suggests that an event triggering of CICs or complement in vascular leakage. thrombocytopenia starts even earlier than the manifestation of thrombocytopenia in the periph- 3. Chemical mediator hypothesis eral blood because the patientʼs bodyis already In addition to the factors described above, trying to recover from the acute phase. Therefore, chemical mediators mayalso have a role in vascular there maybe no direct connection between throm- leakage. Histamine has been studied in the context bocytopenia and vascular leakage because the
410 Juntendo Medical Journal 61(4), 2015
timings are different. immunityagainst E protein expressed on the Regarding the target cells of DENV in BM, Clark surface of virions. et al. recentlydemonstrated that CD61-positive A phase IIb clinical trial performed bySanofi cells derived from human BM are highlysuscepti- Pasteur partlydemonstrated the efficacyof Chi- ble to DENV 13). The integrin CD61 is a surface meriVax vaccine; however, it also showed little marker specificallyexpressed byplatelets and their protection against DENV-2, although sera from megakaryocyte precursors. Although further vaccinees had neutralizing Abs to this serotype 15). research is needed, this finding seems to fit with This observation provided some veryimportant previous observations. In addition, we have information. There is an on-going debate on why observed that DENV preferentiallyinfects CD11b- vaccination with ChimeriVax showed no protection and CD11c-positive cells in mouse BM. Further- to DENV-2, and four hypotheses have been put more, an engineered chimeric virus, which carries forward: 1) DENV-2 vaccine strain did not match the prM and E (prME) genes of DENV within the with the DENV-2 strain currentlyprevalent in Japanese encephalitis virus, caused complete loss of Thailand, where the studywas conducted. 2) The megakaryocytes and elimination of thrombocytope- four viruses interfered with each other, and nia in mice (unpublished data). Therefore, DENV DENV-2 failed to replicate in the vaccineesʼ bodies infection is likelyto directlyor indirectlydisrupt as a result. 3) DENV-2 escaped from the vaccine megakaryocytes. because it was the major serotype in that epidemic and major virus strains have a greater chance of 2. Phagocytosis accumulating mutations that help them escape from Although BM suppression is an attractive story immunological pressure. 4) In addition to humoral to explain thrombocytopenia in dengue, there is an immunity, cellular immunity plays an important additional hypothesis about this symptom. Part of role in protection. In fact, although prM and E the thrombocytopenia may be due to the phagocy- proteins of DENV induced cellular immunity, most tosis of platelets bymacrophages 12). DENV par- T-cell epitopes are located in the NSs, which, in the ticles are thought to attach to platelets directlyor case of ChimeriVax vaccine viruses, are derived indirectlythrough anti-DENV Abs, because human from the YFV vaccine strain. If cellular immunityis platelets express Fcγ receptors. As a result, keyto clearance of DENV, the vaccineesʼ immune platelets in dengue patients may be phagocytosed, systems might fail to eliminate DENV because the explaining, at least in part, the observed thrombo- NS region of ChimeriVax Dengue vaccine virus cytopenia. Taken together, although this work is does not match that of DENV. However, it is unclear preliminary, BM seems to play an important role in how important cellular immunityis for the protec- the thrombocytopenia observed in dengue. tion against DENV. There was a big concern that vaccination might Vaccines and antiviral drugs cause ADE. If the vaccine failed to induce sufficient immunity, non-neutralizing Abs or very low Ab 1. Dengue vaccines titer could result. So far, ADE has not been ob- Manygroups have been developing vaccines served after vaccination with ChimeriVax Dengue against DENV 14). Currently, the most advanced vaccine. However, this issue must be followed-up in vaccine is a chimeric, live-attenuated vaccine the future because the production of Abs decreases named ChimeriVax Dengue Tetravalent Vaccine, in the long term. In vitro and in mice, ADE occurs derived from the yellow fever virus (YFV) vaccine when a low level of anti-DENV Abs is introduced strain 17D. YFV-17D has been used in the world (unpublished data). We need to know if the level of and its efficacyhas been proved. ChimeriVax Abs can be maintained for more than 10 years. Vaccine viruses carries the prME genes of DENV, while the rest of the genome, including genes 2. Antivirals against DENV encoding the capsid, NS1-5, and the 5ʼ - and 3ʼ - Unfortunately, development of an antiviral drug UTRs, is derived from YFV-17D. The protective against DENV is far behind the progress being effect of vaccination is probablydue to humoral made with vaccines. There is no effective, approved
411 Kurosu: The current situation of dengue research
drug against DENV, although several research 7) Avirutnan P, Malasit P, Seliger B, et al: Dengue virus groups and companies have been struggling to find infection of human endothelial cells leads to chemokine production, complement activation, and apoptosis. J a novel treatment for DENV over the past few Immunol, 1998; 161: 6338-6346. decades. As for other viruses, several steps of the 8) Cardier JE, Mariño E, Romano E, et al: Proinflammatory DENV replication life cycle can be targeted, such as factors present in sera from patients with acute dengue infection induce activation and apoptosis of human viral entry, viral RNA synthesis by RNA polyme- microvascular endothelial cells: possible role of TNF- rase, and maturation of the viral polyprotein by alpha in endothelial cell damage in dengue. Cytokine, viral protease. Because of the success achieved with 2005; 230: 359-365. 9) Kurane I: Dengue hemorrhagic fever with special an anti-HIV-1 protease drug, dengue researchers emphasis on immunopathogenesis. Comp Immunol are endeavoring to find antivirals against DENV Microbiol Infect Dis, 2007; 30: 329-340. protease. Mycolleagues and I have identified a 10) Shresta S, Sharar KL, Prigozhin DM, et al: Murine model for dengue virus-induced lethal disease with increased potential antiviral drug called SK-12 that targets vascular permeability. J Virol, 2006; 80: 10208-10217. the viral protease; 16) however, it is still under 11) Ruangjirachuporn W, Boonpucknavig S, Nimmanitya S: development. Circulating immune complexes in serum from patients with dengue haemorrhagic fever. Clin Exp Immunol, 1979; 36: 46-53. References 12) Alonzo MT, Lacuesta TL, Dimaano EM, et al: Platelet apoptosis and apoptotic platelet clearance bymacro- phages in secondarydengue virus infections. J Infect 1) Kimura R, Hotta S: Inoculation of dengue virus into Dis, 2012; 205: 1321-1329. mice. Nippon Igaku, 1944; 3379: 629-633. 13) Clark KB, Noisakran S, Onlamoon N, et al: Multiploid 2) Igarashi A: Characteristics of Aedes albopictus cells CD61 + cells are the pre-dominant cell lineage infected persistentlyinfected with dengue viruses. Nature, 1979; during acute dengue virus infection in bone marrow. 280: 690-691. PLoS One, 2012; 7: e52902. 3) Gubler DJ: Dengue and dengue hemorrhagic fever. Clin 14) MurphyBR, Whitehead SS: Immune response to Micro Rev, 1998; 11: 480-496. dengue virus and prospects for a vaccine. Annu Rev 4) Gubler DJ, Kuno G: Dengue and Dengue Hemorrhagic Immunol, 2011; 29: 587-619. Fever. London: CAB International, 1997; 89-113. 15) Sabchareon A, Wallace D, Sirivichayakul C: Protective 5) Srichaikul T, Nimmannitya S: Haematology in dengue efficacyof the recombinant, live-attenuated, CYD and dengue haemorrhagic fever. Baillieres Best Pract tetravalent dengue vaccine in Thai schoolchildren: a Res Clin Haematol, 2000; 13: 261-276. randomised, controlled phase 2b trial. Lancet, 2012; 380: 6) Alcon S, Talarmin A, Debruyne M, et al: Enzyme-linked 1559-1567. immunosorbent assay specific to Dengue virus type 1 16) Pambudi S, Kawashita N, Phanthanawiboon S: A small nonstructural protein NS1 reveals circulation of the compound targeting the interaction between nonstruc- antigen in the blood during the acute phase of disease in tural proteins 2B and 3 inhibits dengue virus replication. patients experiencing primaryor secondaryinfections. J Biochem Biophys Res Commun, 2013; 440: 393-398. Clin Microbiol, 2002; 40: 376-381.
412 Original Articles
Juntendo Medical Journal 2015. 61(4), 413-417 An Overview of Dialysis Treatment in Juntendo Tokyo Koto Geriatric Medical Center During the First Ten Years of Operation: a Comparison with a Nationwide Statistical Survey in Japan at the End of 2012
KAZUHIKO FUNABIKI＊1),SATOMI KUBO＊2),YOKO UEDA＊2),
TOMONORI ISHII＊2),TAKUYA KONNO＊2),MASASHI AIZAWA＊1),
DAISUKE SATO＊1),REO KANDA＊1),YASUHIKO TOMINO＊3)
＊1) Division of Kidney and Hypertension, Juntendo Tokyo Koto Geriatric Medical Center, Tokyo, Japan, ＊2) Division of Clinical Engineering Technologists, Juntendo Tokyo Koto Geriatric Medical Center, Tokyo, Japan, ＊3) Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, Tokyo, Japan
Objective: Juntendo Tokyo Koto Geriatric Medical Center (KGMC) has been operated for more than ten years from June 1 st, 2002. We analyzedandrevieweddialysispatients admittedtoour hospital for ten years, andcomparedthe results with a nationwidestatistical survey performedat the endof 2012 in Japan. Patients and Methods: The subjects were 2,011 patients (1,281 men and 730 women) undergoing maintenance dialysis from June 2002 to December 2012. There were 4 patients who underwent peritoneal dialysis (PD). We evaluated the each patient statistically every year, and analyzed the underlying disease and cause of death during hospitalization. Results: The number of all and new dialysis patients over the ten-year period increased. The total number of new patients each year was 337 (226 men and111 women) with the mean age of new patients at 70.8±11.4 years (69.0±11.3 for men vs. 74.4± 10.5 for women) andthat of all patients at 71.9±10.8 years (70.4±10.6 for men vs. 74.9±10.8 for women). The percentage distribution of all patients over the ten-year period who underwent dialysis according to the underlying disease showed that 58.3% haddiabeticnephropathy (DN), 19.5% hadnephrosclerosis (NS) and10.5% hadchronic glomerulonephritis (GN). The most frequent cause of death during hospitalization in all years was infection (22.6%), followed by malignancy (17.6%), and cardiac failure (16.0%). Conclusions: The mean age of patients entering maintenance dialysis treatment decreased to 68.8 ± 11.7 years in 2012 at KGMC, which was nearly in accordance with the mean age of dialysis patients in Japan. The recent increase in aged patients undergoing hemodialysis was attributed to the high incidence of DN. It has been the most common cause of end stage kidney disease (ESKD) in patients receiving chronic dialysis treatment, and this accounts for up to 50% of ESRD patients over the period. Key words: end stage kidney disease, dialysis therapy, geriatric medicine
hospital itself as Juntendo Tokyo KGMC and the Introduction number of beds increased to 348 (219 for general Tokyo Metropolitan KGMC (Koto Geriatric Med- diseases and 129 for dementia, respectively). ical Center) was established in 2002 with duties Since the founding of KGMC, we have maintained being entrusted to Juntendo University in 2004. In four to five beds in the dialysis unit and three 2002, there were 102 beds for patients with general emergency beds equipped for HD treatment. diseases and 86 beds for patients with dementia. In Initially we acceptedonly hospitalizedpatients, but 2004, Juntendo University started to manage the now accept partial outpatients with many complica-
Corresponding author: Kazuhiko Funabiki Division of Kidney and Hypertension, Juntendo Tokyo Koto Geriatric Medical Center 3-3-20 Shinsuna, Koto-ku, Tokyo 136-0075, Japan TEL: +81-3-5632-3111 E-mail: [email protected] 〔Received Nov. 5, 2014〕〔AcceptedMar. 30, 2015〕
413 Funabiki, et al: Juntendo Tokyo Koto Geriatric Medical Center
tions. In addition, we started offering peritoneal patients in Japan, we analyzedandreviewed dialysis (PD) treatment from 2010. In the first five dialysis patients admitted to KGMC for the past ten years of operation, there was a tendency towards an years, andcomparedthe results with a nationwide increasing number of new dialysis patients, espe- statistical survey performedat the endof 2012. cially amongst the agedpopulation 1). Patients and Methods The number of dialysis patients has been growing every year in Japan; it was 310,007 at the There were 2,011 patients (1,281 men and730 end of 2012 with the number of new dialysis women) undergoing maintenance dialysis therapy patients at 38,055 anda mean age of 68.5 years 1). at KGMC from June 2002 to December 2012. Furthermore, the most common primary cause of Patients with a history of acute renal failure renal failure among new dialysis patients was DN escaped from dialysis treatment within two weeks (44.2%) in 2012 2). were excluded from the study. We have always strivedto achieve progressive We evaluatedeach patient statistically every geriatric medicine for patients suffering from year andanalyzedthe underlyingdiseaseandcause kidney disease and hypertension. In order to better of death during hospitalization. These results were understand the current condition of dialysis weighed against a nationwide statistical survey
Number of Patients
300
250
200
150
100
50
0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Male Female Total Year
Figure-1A The number of all dialysis patients each year from 2002 to 2012 in KGMC
Number of Patients 60
50
40
30
20
10
0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Male Female Total Year
Figure-1B The number of new dialysis patients each year from 2002 to 2012 in KGMC
414 Juntendo Medical Journal 61(4), 2015
performedat the endof 2012. Data are expressedas women) in KGMC. The proportion of males means±standard deviation (SD). remainedconsistent over the time course of this study. The mean age of new patients was 70.8 ± Results 11.4 years (69.0±11.3 for men vs. 74.4±10.5 for The number of all and new dialysis patients each women) andthat of all patients was 71.9 ± 10.8 year over the ten-year periodgrew five-fold years (70.4 ± 10.6 for men vs. 74.9 ± 10.8 for when comparedwith the first five years of women). The mean age of patients entering operation (Figure-1A, B). The total number of new maintenance dialysis treatment decreased to 68.8 patients each year was 337 (226 men and111 ±11.7 years in 2012 at KGMC, which was nearly in
Age 80.0
75.0
70.0
65.0
60.0 KGMC Japan
55.0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Year
Figure-2 The mean age of new patients each year in KGMC comparedto Japan
Table-1 The percentage distribution of patients each year according to the underlying disease in KGMC and Japan Year 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 KGMC Diabetic Nephropathy (%) 100 50.0 45.5 60.0 75.0 72.2 51.2 53.5 47.5 57.7 60.4 Nephroscrelosis (%) 0.0 25.0 27.3 16.0 3.6 13.9 19.5 25.6 35.0 19.2 14.6 Glomerulonephritis (%) 0.0 0.0 9.1 0.0 7.1 8.3 14.6 11.6 7.5 15.4 14.6 Japan Diabetic Nephropathy (%) 39.1 41.0 41.3 42.0 42.9 43.4 43.3 44.5 43.6 44.3 44.2 Nephrosclerosis (%) 7.8 8.5 8.8 9.0 9.4 10.0 10.6 10.7 11.7 11.8 12.3 Glomerulonephritis (%) 31.9 29.1 28.1 27.4 25.6 23.8 22.8 21.9 21.0 20.2 19.4
Table-2 Cause of death during hospitalization each year in KGMC compared to Japan Year 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 All KGMC Infection (%) 66.7 20.0 0.0 16.7 10.0 25.0 0.0 23.1 26.7 30.8 42.9 22.6 Malignancy (%) 0.0 20.0 16.7 8.3 10.0 0.0 18.2 30.8 13.3 30.8 14.3 17.0 Heart Failure (%) 0.0 20.0 33.3 0.0 30.0 50.0 0.0 0.0 20.0 15.4 28.6 16.0 Cachexia/Uremia (%) 0.0 20.0 0.0 16.7 30.0 0.0 18.2 7.7 0.0 7.7 7.1 10.4 Japan Infection (%) 15.9 18.5 18.8 1.2 19.9 18.9 19.9 20.7 20.3 20.3 20.4 Malignancy (%) 8.5 8.5 9.0 9.0 9.2 9.2 9.5 9.4 9.8 9.1 9.1 Heart Failure (%) 25.1 25.0 25.1 25.8 24.9 24.0 23.7 23.6 27.0 26.6 27.2 Cachexia/Uremia (%) 4.7 2.7 2.3 3.0 3.1 3.1 3.0 2.7 4.2 3.9 3.7
415 Funabiki, et al: Juntendo Tokyo Koto Geriatric Medical Center
accordance with the mean age of all dialysis 1998, followedby chronic GN. In our institution, this patients in Japan over this period(Figure-2). accounts for up to 50% of ESKD patients over the The percentage distribution of patients over the period, presumably the result of a higher preva- entire period who underwent dialysis according to lence of type 2 diabetes, secondarily due to ageing, the underlying disease showed that 58.3% had DN, physical inactivity, obesity, etc. In more recent 19.5% hadnephrosclerosis (NS), and10.5% had years, diabetes-related ESKD incidences have chronic glomerulonephritis (GN)(Table-1). DN has declined in Europe 6) andUS 8). The actual number been the most common cause of ESKD in patients of new dialysis patients with DN has been receiving chronic dialysis treatment in KGMC. In approximately 16,000 for the last few years. addition, there was also a significant rise in the Reasons to explain the flat trend line may include percent of patients with NS, as comparedto the the early detection and management of DN and nationwide statistical survey in Japan. Conversely, improved treatment with the specific blockade of there was significant decrease in the proportion of the renin-angiotensin-aldosterone axis. patients with GN over the study period. In Japan, 3% of patients underwent PD treatment There were four cases of patients who under- in 2012 1). In this study, a total of 4 patients (1.2%) went peritoneal dialysis with different causes of began PD therapy at the Juntendo University renal disease, i. e. GN, NS, and polycystic kidney Hospital andwere caredfor at our outpatient clinic, disease. KGMC. They were observedto be younger and 106 patients (69 men and37 women) diedafter without diabetes mellitus. Most of ESKD patients admission to KGMC during the study period. The andtheir famillies hadthe tendencyto accept HD mean age of the deceased was 76.0 ± 9.8 years treatment rather than PD treatment. One factors (74.6 ± 8.4 for men vs. 78.7 ± 11.6 for women). associatedwith the lower percentage of patients on The most frequent cause of death during hospital- PD includes a higher diabetes prevalence 9), since ization in all years was infection (22.6%), followed many studies have reported poorer outcomes for by malignancy (17.6%), andheart failure (16.0%) PD when comparedwith HD for patients with DN. (Table-2). In the nationwide survey in 2012, the There has been a significant difference in the leading cause of death in Japan was heart failure cause of death as compared with the nationwide (27.2%) 1). survey. Infection andmalignancy were major causes of death in KGMC, thereby matching the Discussion rising trendin diabetesandan aging population. There has been a remarkable rise in the number Microinflammation is a common finding in HD of patients receiving dialysis therapy in Japan. In patients with a history of type-II diabetes particular, male participants except those with type mellitus 10). Because the most frequent cause of 1 diabetes were likely to develop ESKD, which death during hospitalization during all years was might be explained in part by differences in HbA1c infection in our unit, we shouldemploy an early levels, hypertension andlipidlevels between the detection system for the risk factors and proper sexes 3). management of the nutritional status of these In addition, the demographics of the population patients. have changedfrom relatively young patients with References primary GN to older patients with systemic co-morbidities such as diabetes and cardiovascular 1) Funabiki K, Okazaki K, Nakamoto H, et al: An overview diseases 4). This is comparable to epidemiological of dialysis treatment in Juntendo Koto Geriatric Medical 5) 6) center (KGMC) for the five years of operation -Compar- studies conducted in Europe . ison with the findings of a nationwide statistical survey In KGMC, most patients were relatively old at the end of 2006-. Juntendo Medical Journal, 2008; 54: without GN and there was an increase in older 318-323. 2) Nakai S, Hanafusa N, Masakane I, et al: An Overview of patients with DN andNS. Currently, DN has regular dialysis treatment in Japan (As of December 31, reached epidemic proportions worldwide 7). In 2012). Ther Apher Dial, 2014; 47: 1-56. Japan, it was the most common primary disease 3) Costacou T, FriedL, Ellis D, et al: Sex differences in the development of kidney disease in individuals with type 1 among the entire dialysis patient population from
416 Juntendo Medical Journal 61(4), 2015
diabetes mellitus: a contemporary analysis. Am J Kidney 2011; 170: 19-27. Dis, 2011; 58: 565-573. 8) Burrows NR, Li Y, Geiss LS: Incidence of treatment for 4) Prabhavalkar SM, Verghis R, McNamee PT, et al: Four end-stage renal disease among individuals with diabetes decades of chronic haemodialysis: Lessons from the past in the U.S. continues to decline. Diabetes Care, 2010; 33: andimplications for the future. Nephron Clin Pract, 2012; 73-77. 121: c54-c59. 9) Van de Luijtgaarden MWM, Jager KJ, Stel VS, et al: 5) Hoffmann F, Haastert B, Koch M, et al: The effect of Global differences in dialysis modality mix: the role of diabetes on incidence and mortality in end-stage renal patient characteristics, macroeconomics andrenal disease in Germany. Nephrol Dial Transplant, 2011; 26: service indicators. Nephrol Dial Transplant, 2013; 28: 1634-1640. 1264-1275. 6) Hill CJ, Fogarty DG: Changing trends in end-stage renal 10) Nath I, Nath CK, Baruah M, et al: A study of inflamma- disease due to diabetes in the United Kingdom. J Ren tory status in nephropathy patients with history of Care, 2012; 38 (Suppl 1) : 12-22. type-II diabetes mellitus undergoing haemodialysis. J Clin 7) Ritz E, Zeng XX, Rychlik I: Clinical manifestation and Diagn Res, 2013; 7: 2143-2145. natural history of diabetic nephropathy. Contrib Nephrol,
417 Original Articles
Juntendo Medical Journal 2015. 61(4), 418-425 Clinical Significance of Renal Interstitial Fibrosis in Patients with Lupus Nephritis
DAISUKE HONDA＊1),KISARA TSUESHITA＊1),ISAO OHSAWA＊1),
TOMOKO MIYASHITA＊2),HIROYUKI INOSHITA＊1),MAMIKO SHIMAMOTO＊1),
SATOSHI HORIKOSHI＊1),SHINJI MORIMOTO＊3),YOSHINARI TAKASAKI＊2),YASUHIKO TOMINO＊1)
＊1)Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, Tokyo, Japan, ＊2)Division of Rheumatology, Department of Internal Medicine, Juntendo University Faculty of Medicine, Tokyo, Japan, ＊3)Division of Rheumatology, Department of Internal Medicine, Juntendo University Urayasu Hospital, Chiba, Japan
Objective: Authorized pathological classification schemes pay much attention to glomerular changes but little to renal interstitial injuries in patients with lupus nephritis (LN). Since the degree of interstitial injury may be a better renal predictor than glomerular damage in some chronic glomerular diseases, we explored the clinical significance of interstitial fibrosis in the prognosis of LN. Materials: Forty-three patients of systemic lupus erythematosus (SLE) who had undergone renal biopsy were enrolled in the present study. Methods: All patients were categorized using the International Society of Nephrology/Renal Pathology Society (ISN/RPS) classification and their interstitial fibrosis severity was semi-quantitatively graded. Clinical data was evaluated at the time of renal biopsy and at the last follow-up period. Results: In each group classified by the ISN/RPS classification, renal function had no statistical difference at both times. When all patients were divided into interstitial fibrosis grades, there was no significant difference in renal function at the time of renal biopsy. However, renal function in patients with severe fibrosis at the last follow-up period was significantly worse than those in other fibrosis grades. On the other hand, the serological activity of SLE had significantly ameliorated after treatments in both categorizations. Conclusion: It is concluded that severe interstitial fibrosis may be a renal predictor apart from glomerular lesions and the serological activity of SLE. Key words: interstitial fibrosis, prognosis, International Society of Nephrology/Renal Pathology Society (ISN/RPS) classification, lupus nephritis (LN), systemic lupus erythematosus (SLE)
levels of the complements C3 and C4 in sera are Introduction signs of active SLE. We also previously reported Systemic lupus erythematosus (SLE) is a crypto- that cases under histological activation of plural genic autoimmune disease and may cause multiple complement pathways had a worse renal progno- organ injuries because of immune-complex deposi- sis 2). tion. Renal complications are the most common Over the last three decades, there have been clinical signs of SLE 1). Renal histopathological several attempts proposed by the World Health lesions are closely associated withdifferent clinical Organization (WHO) and the International Society characteristics, therapeutic responses, and out- of Nephrology/Renal Pathology Society (ISN/RPS) comes in eachpatient withlupus nephritis(LN). In to classify LN 3) 4). At present, the ISN/RPS classifi- addition, many researchers have revealed that cation, which is a modification of the older system elevated levels of anti-DNA antibodies and low proposed by the WHO, is widely used all over the
Corresponding author: Yasuhiko Tomino Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-5802-1065 FAX: +81-3-3813-1183 E-mail: [email protected] 〔Received Mar. 17, 2015〕〔Accepted Apr. 24, 2015〕
418 Juntendo Medical Journal 61(4), 2015
world 5). The ISN/RPS classification divides the Materials and methods glomerular disorders of LN into six classes 3). Traditionally, much attention has been focused on 1. Materials the extent of glomerular changes but little on All forty-three patients who had been diagnosed interstitial injuries. as SLE using the American College of Rheumatol- It is a well-known fact that interstitial injuries are ogy (ACR) criteria and as LN in our hospital were independent risk factors in the progression of some retrospectively enrolled in the present study 17). All glomerular diseases, such as LN, IgA nephropathy, patients had undergone renal biopsy in our membranous nephropathy, and membranoprolifera- department from 1987 to 2012 and had been tive glomerulonephritis 6)-13). Actually, the degree of diagnosed as LN. All patients enrolled in this study interstitial injury might be a predictor of the provided sufficient informed consent based on glomerular filtration rate (GFR) and long-term guidelines from the Juntendo University Hospital prognosis in chronic progressive glomerular dis- Ethics Committee. eases 6)-11). Interstitial injury has been associated We collected the treatment history for SLE from with the infiltration of inflammatory cells, and some the medical records of forty-three LN patients, researchers have reported that infiltration might be which included 40 females and 3 males. The age of a better predictor of renal prognosis than glomeru- the onset of SLE was 30.72 ± 12.15 (Mean ± SD) lar injury 14)-16). If patients with SLE had a renal years old. The mean age at the time of renal biopsy biopsy at an adequately early time, such as at the was 34.98 ± 10.71 years old. The interval from beginning of infiltration, these findings would be onset to renal biopsy was 53.91 ± 70.75 (Mean ± useful. But in fact, patients might already have been SD) months. Twenty-five patients (58.2%) had treated withmedications, like corticosteroids been already treated for SLE by the time of renal and/or immunosuppressants before renal biopsy, biopsy. such that the distribution of infiltration might be affected by these treatments. Since fibrosis is 2. Pathological analysis generally an irreversible change, we have focused Two nephrologists and a rheumatologist who on the evaluation of renal interstitial fibrosis as one were sufficiently familiar with LN pathology of the indicators of renal prognosis in patients with reviewed all 43 cases from light microscopic (Hema- LN. toxylin-Eosin stain, Periodic acid-Schiff stain, Periodic acid-methenamine-silver stain, Masson trichrome stain, Azan stain, and Elastica van Gieson
Table-1 Glomerular classification of ISN/RPS and interstitial fibrosis grade Interstitial fibrosis grade No Mild Moderate Severe Total (n) class I/II 21003 class III (+V) 31206 class IV (+V) 177823 class V 272011 Total (n) 8 16 11 8 43 Active lesion (n) 1.25±1.75 1.75±1.95 2.45±1.13 2.75±1.49 2.02±1.68 Chronic lesion (n) 0.88±0.64 1.06±0.77 1.27±0.90 1.88±0.64 1.23±0.81
Active lesion (n) and chronic lesion (n) are defined within ISN/RPS classification and they are represented as the number of those active and chronic lesions (mean±SD). Bothactive lesion (n) and chroniclesion (n) are not significantly different between eachinterstitial fibrosis grade. Class I/II includes class I and class II. Class III (+V) includes class III and class III+V. Class IV (+V) includes class IV and class IV+V. ISN/RPS: International Society of Nephrology/Renal Pathology Society, n: number
419 Honda, et al: Interstitial fibrosis in lupus nephritis
stain), immunofluorescent microscopic (deposition sis grade, 8 cases (18.6%) 3). Since all 8 severe of IgG, IgA, IgM, C3c, and C1q), and electron fibrosis grade cases came from class IV, we paid microscopic findings. special attention to these cases and evaluated the First, all cases were classified using the ISN/RPS clinical data in two ways: 1) the four interstitial classification: class I, 1 case (2.3%) ; class II, 2 fibrosis grades composed of all cases, and 2) two cases (4.7%) ; class III, 6 cases (14.0%) including interstitial fibrosis grades (the no, mild, and moder- 2 cases from class III+V (4.7%) ; class IV, 23 cases ate fibrosis grades group (combined group) and (53.5%) including 4 cases from class IV+V the severe fibrosis grade) composed of only class IV (9.3%) ; class V, 11 cases (25.6%) ; and class VI, 0 cases. Because the patient number in the no fibrosis cases. Classes I and II were integrated into class I/II grade group was only 1 in class IV, the no, mild and with 3 cases (7.0%) because they were quite small moderate fibrosis grade groups were integrated as in number (Table-1). Twenty-three cases of class a combined group. IV included 5 of class IV-S and 18 of class IV-G. Next, we also evaluated the severity of renal 3. Clinical analysis interstitial fibrosis semi-quantitatively and divided Blood and urinary examinations, including serum the cases into the following four grades using urea nitrogen (sUN), serum creatinine (sCre), esti- Masson trichrome stain or Azan stain findings for mated glomerular filtration rate (eGFR), serum eachcase in a previously reported way: no inter- levels of IgG, IgA, IgM, C3, C4, and anti-DNA stitial fibrosis, almost no fibrosis of the interstitial antibodies, qualitative urinary protein, urinary area; mild interstitial fibrosis, 1-25% fibrosis of the N-acetyl-β-D-glucosaminidase (NAG), and uri- interstitial area; moderate interstitial fibrosis, 26- nary β2-microglobulin (β2MG), were collected at 50% fibrosis of the interstitial area; severe intersti- the time of renal biopsy and at the last follow-up tial fibrosis, more than 50% fibrosis of the interstitial period. eGFR was calculated using a Japanese area 14)-16) (Figure-1). The distribution of all cases formula (Male, eGFR = 194 × sCre−1.094 × age−0.287; were as follows: no fibrosis grade, 8 cases (18.6%) ; Female, eGFR = 194 × sCre−1.094× age−0.287× 0.739; mild fibrosis grade, 16 cases (37.2%) ; moderate as defined by the Japanese Society of Nephrol- fibrosis grade, 11 cases (25.6%) ; and severe fibro- ogy 18)).
A B
C D
Figure-1 Semi-quantitative renal interstitial fibrosis grade (Masson trichrome stain and Azan stain) These photographs are Masson trichrome stain and Azan stain, and represent semi-quantitative renal interstitial fibrosis grade as follows A (Masson trichrome stain) : no interstitial fibrosis, almost no fibrosis of the interstitial area; B (Masson trichrome stain) : mild interstitial fibrosis, 1-25 % fibrosis of the interstitial area; C (Masson trichrome stain) : moderate interstitial fibrosis, 26-50 % fibrosis of the interstitial area; D (Azan stain) : severe interstitial fibrosis, more than 50 % fibrosis of the interstitial area.
420 Juntendo Medical Journal 61(4), 2015
4. Statistical analysis tion in the clinical data between the time of renal GraphPad Prism 6J software for Windows (ver- biopsy and the last follow up period within class IV sion 6.01; GraphPad, San Diego, CA, USA) was was observed in serum C3 (p<0.01), C4 (p<0.01), used for statistical analysis. For the comparison of and anti-DNA antibodies (p < 0.01) and in the clinical data, a t-test and one-way ANOVA were qualitative urinary protein (p < 0.01). Moreover, used with the Bonferroni correction for multiple there was no significant difference in the clinical comparisons, and a two-sided p-value of <0.05 was data between class IV-S cases and class IV-G cases taken as the level for statistical significance. All data among class IV cases (data not shown). were expressed as mean ± standard deviation (SD). 2. Renal function according to the interstitial fibrosis grade (Table-3) Results There was no significant difference in renal 1. Clinical data according to the ISN/RPS classifi- function (sUN, sCre, and eGFR) among the four cation (Table-2) interstitial fibrosis grades at the time of renal Renal function (sUN, sCre, and eGFR) at the time biopsy. However, the severe fibrosis grade was of renal biopsy was not different among the classes significantly worse than other fibrosis grades at the of the ISN/RPS classification. At the time of renal last follow up period in the levels of sUN (p<0.01), biopsy, clinical data which indicates the serological sCre (p < 0.05), and eGFR (no, p < 0.01; mild, p < activity of SLE between class IV and class V was 0.05; and moderate, p < 0.01) (Figure-2). In this significantly different in serum C3 (p < 0.01) and time, there was no significant difference in the C4 (p < 0.05). Furthermore, a significant ameliora- duration from the renal biopsy until the last
Table-2 Clinical data according to the ISN/RPS classification ISN/RPS classification class I/II class III (+V) class IV (+V) class V At the time of renal biopsy sUN (mg/dl) 11.50±3.54 12.50±3.39 18.52±9.52 12.82±3.79 sCre (mg/dl) 0.57±0.09 0.54±0.08 0.83±0.47 0.61±0.16 eGFR (ml/min) 106.50±14.00 104.92±18.87 84.48±41.05 96.84±27.35 U-Prot 2.33±1.15 1.67±1.03 2.40±0.74a 2.50±0.53 C3 (mg/dl) 49.00±16.46 51.67±11.13 46.39±20.14b, c 89.67±45.09b C4 (mg/dl) 4.33±2.08 6.83±3.66 8.61±6.01d, e 16.67±11.06d Anti-DNA antibody (IU/ml) 15.50±16.93 58.28±81.53 100.20±120.89f 14.74±24.94 At the last follow-up period sUN (mg/dl) 9.00±2.65 12.00±2.53 15.45±7.21 12.55±3.14 sCre (mg/dl) 0.55±0.10 0.56±0.15 0.80±0.78 0.54±0.12 eGFR (ml/min) 103.80±25.75 103.67±31.43 89.40±32.37 105.75±28.24 U-Prot 1.00±1.73 0.83±1.33 0.61±1.12a 1.10±1.37 C3 (mg/dl) 87.33±36.02 70.17±21.68 88.30±22.04c 83.00±21.80 C4 (mg/dl) 17.00±10.15 11.50±8.76 17.70±7.55e 15.38±6.32 Anti-DNA antibody (IU/ml) 2.77±1.33 19.80±26.21 6.65±4.93f 18.33±31.33
ap<0.01, bp<0.01, cp<0.01, dp<0.05, ep<0.01 and fp<0.01. ISN/RPS: International Society of Nephrology/Renal Pathology Society sUN: serum urea nitrogen, sCre: serum creatinine, eGFR: estimated glomerular filtration rate, and U-prot: qualitative urinary protein sUN, sCre, and eGFR at the time of renal biopsy were not different among the classes of the ISN/RPS classification. At the time of renal biopsy, serum C3 (p < 0.01) and C4 (p < 0.05) between class IV and class V were significantly different. A significant difference between the time of renal biopsy and the last follow up period within class IV was observed in serum C3 (p < 0.01), C4 (p < 0.01), and anti-DNA antibodies (p < 0.01) and in the qualitative urinary protein (p<0.01).
421 Honda, et al: Interstitial fibrosis in lupus nephritis
follow-up period between them. On the other hand, In this time, there was no significant difference in there was no significant change in renal function the duration from the renal biopsy until the last from the time of renal biopsy to the last follow up follow-up period between them. Moreover, among period among eachinterstitial fibrosis grade group. class IV cases, class IV-S cases were composed of 0 When the no, mild, and moderate interstitial of no fibrosis, 1 of mild fibrosis, 3 of moderate fibrosis grades were unified as combined group in fibrosis and 1 of severe fibrosis, and class IV-G only class IV, there were significant differences at cases were composed of 1 of no fibrosis, 6 of mild the last follow-up period in the levels of sUN (class fibrosis, 4 of moderate fibrosis and 7 of severe IV combined group, 12.73 ± 3.28 mg/dl, and class fibrosis. IV severe interstitial fibrosis grade, 21.30 ± 9.95 mg/dl, p < 0.01), sCre (class IV combined group, 3. Serological activity of SLE according to the 0.56 ± 0.10 mg/dl, and class IV severe interstitial interstitial fibrosis grade (Table-3) fibrosis grade, 1.25 ± 1.23 mg/dl, p < 0.05), and Serological activity markers of SLE (serum C3, eGFR (class IV combined group, 103.78 ± 23.47 C4, and anti-DNA antibodies) were not signifi- ml/min, and class IV severe interstitial fibrosis cantly different between the four fibrosis grades at grade, 62.43 ± 30.30 ml/min, p < 0.01)(Figure-3). the time of renal biopsy and at the last follow-up
Table-3 Clinical data according to interstitial fibrosis grade Interstitial fibrosis grade No Mild Moderate Severe At the time of renal biopsy sUN (mg/dl) 12.88±5.17 16.56±12.9 19.27±12.1 18.50±7.46 sCre (mg/dl) 0.56±0.18 1.05±1.69 0.72±0.34 1.05±0.64 eGFR (ml/min) 106.79±29.50 92.98±35.17 93.91±42.34 60.15±25.37 U-Prot 1.67±1.03 2.50±0.67 2.44±0.73 2.20±0.84 Urinary NAG (U/l) 9.48±6.64 24.84±32.59 11.90±9.31 53.80±80.74 Urinary B2MG (μg/l) 2353.67±3688.78 375.29±537.22 462.00±276.02 345.33±259.95 C3 (mg/dl) 57.25±21.14 60.21±36.60d 60.27±38.12f 45.88±19.22h C4 (mg/dl) 7.88±6.38 10.36±9.87e 10.55±6.53g 9.75±7.83i Anti-DNA antibody (IU/ml) 71.69±133.85 55.60±85.47 83.11±98.10 55.04±109.78 At the last follow-up period sUN (mg/dl) 11.50±3.07a 12.69±2.77a 12.09±3.78a 21.29±9.95a sCre (mg/dl) 0.50±0.09b 0.58±0.10b 0.55±0.13b 1.25±1.23b eGFR (ml/min) 111.76±25.03c 99.26±21.41c 106.45±31.33c 62.43±30.30c U-Prot 0.63±1.19 0.80±1.21 1.27±1.49 0.25±0.71 Urinary NAG (U/l) 27.25±51.83 14.51±13.39 12.50±11.06 16.15±13.93 Urinary B2MG (μg/l) 893.43±1564.65 188.92±242.54 386.89±554.82 3279.00±4782.34 C3 (mg/dl) 72.29±26.52 87.85±27.05d 90.45±17.33f 78.33±15.85h C4 (mg/dl) 11.86±7.06 16.54±9.65e 17.45±6.52g 17.83±5.08i Anti-DNA antibody (IU/ml) 15.63±22.56 14.64±25.41 7.038±5.00 3.99±2.74
ap<0.01 severe- versus no-, mild- and moderate interstitial fibrosis. bp<0.05 severe- versus no-, mild- and moderate interstitial fibrosis cp<0.01 severe- versus no- and moderate interstitial fibrosis, p<0.05 severe- versus mild interstitial fibrosis dp<0.01, ep<0.05, fp<0.05, gp<0.05, hp<0.01 and ip<0.05 sUN: serum urea nitrogen, sCre: serum creatinine, eGFR: estimated glomerular filtration rate, and U-prot: qualitative urinary protein There was no significant difference in renal function (sUN, sCre, and eGFR) among the four interstitial fibrosis grades at the time of renal biopsy. The severe fibrosis grade was significantly worse than the other fibrosis grades at the last follow up period in the levels of sUN (p<0.01), sCre (p<0.05), and eGFR (no, p<0.01; mild, p<0.05; and moderate, p <0.01). There was no significant change in renal function among each interstitial fibrosis grade from the time of renal biopsy to the last follow up period.
422 Juntendo Medical Journal 61(4), 2015
A. sUN（mg/dl） B. sCre（mg/dl） C. eGFR（ml/min）
50 5 ＊ ＊＊ ＊ 200 ＊＊ ＊＊ ＊ ＊ 40 ＊＊ 4 150 ＊＊ 30 3 100 20 2
10 1 50
0 0 0 No Mild Moderate Severe No Mild Moderate Severe No Mild Moderate Severe Interstitial fibrosis grade Interstitial fibrosis grade Interstitial fibrosis grade
＊＊：p＜0.01 ＊ ：p＜0.05 Figure-2 Renal function data according to interstitial fibrosis grade at the last follow-up period sUN, sCre, and eGFR in the severe fibrosis grade were significantly worse than those in the other fibrosis grades at the last follow up period (sUN (p<0.01), sCre (p<0.05), and eGFR (no, p<0.01; mild, p<0.05; and moderate, p<0.01) ). sUN: serum urea nitrogen, sCre: serum creatinine, eGFR: estimated glomerular filtration rate for Japanese
A. sUN（mg/dl） B. sCre（mg/dl） C. eGFR（ml/min） 5 50 150 ＊＊ ＊＊ ＊ 40 4 100 30 3
20 2 50 10 1
0 0 0 No, mild, moderate Severe No, mild, moderate Severe No, mild, moderate Severe Interstitial fibrosis grade Interstitial fibrosis grade Interstitial fibrosis grade
＊＊：p＜0.01 ＊ ：p＜0.05 Figure-3 Renal function data according to interstitial fibrosis grade at the last follow up period in class IV At the last follow-up period, there were significant differences in the levels of sUN (class IV combined group, 12.73±3.28 mg/dl, and class IV severe interstitial fibrosis, grade 21.3 ± 9.95 mg/dl, p < 0.01), sCre (class IV combined group, 0.56 ± 0.10 mg/dl, and class IV severe interstitial fibrosis grade, 1.25 ± 1.23 mg/dl, p < 0.05) and eGFR (class IV combined group, 103.78 ± 23.47 ml/min, and class IV severe interstitial fibrosis grade, 62.43±30.30 ml/min, p<0.01). sUN: serum urea nitrogen, sCre: serum creatinine, eGFR: estimated glomerular filtration rate for Japanese period. However, serum C3 and C4 in the mild, 4. Treatment history moderate, and severe interstitial fibrosis grades at Forty out of a total of 43 patients (93.0%) had the last follow-up period were significantly elevated been treated withcorticosteroids (no interstitial compared with that at the time of renal biopsy fibrosis grade, 75.0% cases; mild interstitial fibrosis (Table-3). Moreover, in the combined group grade, 93.8% cases; moderate interstitial fibrosis composed of only class IV, there are significant grade, 100% cases; and severe interstitial fibrosis ameliorations at the last follow-up period in serum grade, 100% cases), and 31 cases (72.1%) were also C3 and C4, and anti-DNA antibodies (respectively, treated withimmunosuppressant drugs, suchas p < 0.0001, p < 0.005, p < 0.01) (data not shown). tacrolimus, mizoribine, azathioprine, lobenzarit Since the severe fibrosis grade group was all disodium, ciclosporin, or cyclophosphamide (no composed of class IV of the ISN/RPS classification, interstitial fibrosis grade, 50.0% cases; mild inter- the result is the same as above. stitial fibrosis grade, 75.0% cases; moderate inter- stitial fibrosis grade 90.9% cases; and severe
423 Honda, et al: Interstitial fibrosis in lupus nephritis
interstitial fibrosis grade, 62.5% cases) by the last cation, is suggestive that glomerular lesion severity follow-up period in contrast with58.2% cases wasnʼt different among those fibrosis grades either treated for SLE with any drugs at the time of renal (Table-1), and in only class IV (data not shown). biopsy. The associations between the patientsʼ Whether glomerular lesions were segmental or therapeutic strategies and their interstitial fibrosis global, it seemed not to be associated with the grades were not observed in this study. severity of interstitial fibrosis grade from the present results. Thus, severe interstitial fibrosis in Discussion LN patients might participate in renal prognosis When we classified all 43 cases according to the apart from the evaluation of glomerular lesions. ISN/RPS classification based on glomerular lesions, The occurrence of glomerular damage causes there was no significant difference in clinical data on atrophy of its accessory tubule and infiltration of renal function, such as sUN, sCre, or eGFR, either at inflammatory cells. In consequence, the interstitial the time of renal biopsy or at the last follow-up damage results in interstitial fibrosis of the sur- period. Moreover, there was no significant change rounding nephron. However, Bohle et al. 19) found in renal function from the time of renal biopsy to the another fibrotic mechanism whereby the upper last follow-up period among eachclass. Treatments capillary internal pressure within glomeruli might were seemingly very effective in all cases, even rise and cause a decrease in the glomerular though the level of glomerular lesions was worse in filtration rate. This is because peritubular capilla- cases such as class IV. This is also supported by a ries or tubules are ruined by interstitial fibrosis 19), significant improvement of serum C3, C4, and and we can assume that the progressed interstitial anti-DNA antibodies and the qualitative urinary fibrosis might reflect a renal prognosis in addition to protein at the last follow-up period within class IV. glomerular injury. When we divided all cases based on the severity of Since serum C3, C4, and anti-DNA antibodies, their interstitial fibrosis grades, clinical data at the which reflect the serological activities of SLE, were time of renal biopsy showed no difference. In ameliorated even in the severe fibrosis grade group, addition, there was no significant change in renal we could discover that accurate treatments had function from the time of renal biopsy to the last been performed in our subjects. We could confirm follow-up period among eachinterstitial fibrosis that the serological activity of SLE didnʼt corre- grade. However, sUN, sCre, and eGFR in only spond withrenal function, particularly in severe severe interstitial fibrosis grade patients at the last interstitial fibrosis cases. Previous papers have follow-up period were significantly worse than reported that there was a tendency for decreasing those in the other fibrosis grades in spite of no serological activity of SLE following the onset of significant difference in the duration from the onset end-stage renal disease 20) 21). Although, urinary of SLE until the renal biopsy, and from the renal β2MG or NAG, which are renal tubular markers, biopsy until the last follow-up period. It might had the tendency to be higher both at the time of suggest that the amelioration of renal function in renal biopsy and at the last follow-up period severe fibrosis cases is difficult. Since all cases of the according to the severity of interstitial fibrosis, they severe interstitial fibrosis grade belonged to the didnʼt show a significant correlation. So far, there is cases of class IV, we suspect that severe glomerular not an accurate appropriate marker that can lesions might have a direct influence on renal exactly reflect interstitial fibrosis severity for daily dysfunction. However, the severe interstitial fibro- clinical use 22)-25). In the context of LN, it implies that sis grade cases within only class IV cases were histological findings in the interstitial area have significantly worse at the last follow-up period in very important information for the progression of the levels of sUN, sCre, and eGFR, when compared renal damage. with the combined group, in spite of no significant Suffice it to say that the ISN/RPS classification difference in the duration between the onset of SLE, sets a high value on evaluating glomerular lesions, the time of renal biopsy and the last follow-up however, severe interstitial fibrosis, particularly in period. Additionally, the number of active lesions or class IV of the ISN/RPS classification, should be chronic lesions, as defined by the ISN/RPS classifi- considered as a significant factor in the evaluation of
424 Juntendo Medical Journal 61(4), 2015
renal prognosis. 11) Meyer TW: Tubular injury in glomerular disease. Kidney Int, 2003; 63: 774-787. Acknowledgement 12) Ong AC, Fine LG: Loss of glomerular function and tubulointerstitial fibrosis: cause or effect? Kidney Int, A part of this work was supported by MEXT 1994; 45: 345-351. KAKENHI Grant Number 26650065. 13) Wright JR, Duggal A, Thomas R, et al: Clinicopathologi- cal correlation in biopsy-proven atherosclerotic nephro- Conflict of interest pathy: implications for renal functional outcome in atherosclerotic renovascular disease. Nephrol Dial None declared. Transplant, 2001; 16: 765-770. 14) Alsuwaida A: Interstitial inflammation and long-term References renal outcomes in lupus nephritis. Lupus, 2013; 22: 1446- 1454. 1) Beck LH Jr, Salant DJ: Treatment of membranous lupus 15) Yu F, Wu LH, Tan Y, et al: Tubulointerstitial lesions of nephritis: where are we now? J Am Soc Nephrol, 2009; patients with lupus nephritis classified by the 2003 20: 690-691. International Society of Nephrology and Renal Pathol- 2) Sato N, Ohsawa I, Nagamachi S, et al: Significance of ogy Society system. Kidney Int, 2010; 77: 820-829. glomerular activation of the alternative pathway and 16) Hsieh C, Chang A, Brandt D, Guttikonda R, Utset TO, lectin pathway in lupus nephritis. Lupus, 2011; 20: Clark MR: Predicting outcomes of lupus nephritis with 1378-1386. tubulointerstitial inflammation and scarring. Arthritis 3) Weening JJ, DʼAgati VD, Schwartz MM, et al: The Care Res, 2011; 63: 865-874. classification of glomerulonephritis in systemic lupus 17) Tan EM, Cohen AS, Fries JF, et al: The 1982 revised erythematosus revisited. Kidney Int, 2004; 65: 521-530. criteria for the classification of systemic lupus erythema- 4) Furness PN, Taub N: Interobserver reproducibility and tosus. Arthritis Rheum, 1982; 25: 1271-1277. application of the ISN/RPS classification of lupus nephri- 18) Matsuo S, Imai E, Horio Y, et al: Revised equations for tis-a UK-wide study. Am J Surg Pathol, 2006; 30: 1030- estimated GFR from serum creatinine in Japan. Am J 1035. Kidney Dis, 2009; 53: 982-992. 5) Yokoyama H, Wada T, Hara A, et al: The outcome and a 19) Bohle A, Mackensen-Haen S, Wehrmann M: Signifi- new ISN/RPS 2003 classification of lupus nephritis in cance of postglomerular capillaries in the pathogenesis Japanese. Kidney Int, 2004; 66: 2382-2388. of chronic renal failure. Kidney Blood Press Res, 1996; 6) Nath KA: Tubulointerstitial changes as a major deter- 19: 191-195. minant in the progression of renal damage. Am J Kidney 20) Mojcik CF, Klippel JH: End-stage renal disease and Dis, 1992; 20: 1-17. systemic lupus erythematosus. Am J Med, 1996; 101: 7) DʼAmico G: Influence of clinical and histological features 100-107. on actuarial renal survival in adult patients with 21) Cheigh JS, Stenzel KH: End-stage renal disease in idiopathic IgA nephropathy, membranous nephropathy, systemic lupus erythematosus. Am J Kidney Dis, 1993; and membranoproliferative glomerulonephritis: survey 21: 2-8. of the recent literature. Am J Kidney Dis, 1992; 20: 22) Rovin BH, Zhang X: Biomarkers for lupus nephritis: the 315-323. quest continues. Clin J Am Soc Nephrol, 2009; 4: 8) Alexopoulos E, Seron D, Hartley RB, Cameron JS: Lupus 1858-1865. nephritis: correlation of interstitial cells with glomerular 23) Coremans IE, Spronk PE, Bootsma H, et al: Changes in function. Kidney Int, 1990; 37: 100-109. antibodies to C1q predict renal relapses in systemic 9) Bajema IM, Hagen EC, Hermans J, et al: Kidney biopsy lupus erythematosus. Am J Kidney Dis, 1995; 26: 595- as a predictor for renal outcome in ANCA-associated 601. necrotizing glomerulonephritis. Kidney Int, 1999; 56: 24) Schwartz N, Rubinstein T, Burkly LC, et al: Urinary 1751-1758. TWEAK as a biomarker of lupus nephritis: a multicen- 10) Bazzi C, Petrini C, Rizza V, et al: Urinary N-acetyl- ter cohort study. Arthritis Res Ther, 2009; 11: R143. beta-glucosaminidase excretion is a marker of tubular 25) Rubinstein T, Pitashny M, Levine B, et al: Urinary cell dysfunction and a predictor of outcome in primary neutrophil gelatinase-associated lipocalin as a novel glomerulonephritis. Nephrol Dial Transplant, 2002; 17: biomarker for disease activity in lupus nephritis. 1890-1896. Rheumatology (Oxford), 2010; 49: 960-971.
425 Original Articles
Juntendo Medical Journal 2015. 61(4), 426-436 Effectiveness of Interdisciplinary Team Conference to Manage Skeletal Related Events in Rehabilitation for Patients with Cancer
YASUKO HAYASHI＊1),MASANORI NAGAOKA＊1),TATSUYA TAKAGI＊2),
ERIKO KITAHARA＊3),KOZO HATORI＊1),ATSUHIKO TERAKADO＊1),NANA IZAWA＊1)
＊1)Department of Rehabilitation Medicine, Juntendo University Graduate School of Medicine, Tokyo, Japan, ＊2)Department of Orthopedic Surgery, Juntendo University Graduate School of Medicine, Tokyo, Japan, ＊3) Division of Rehabilitation, Juntendo University Hospital, Tokyo, Japan
Objective: We started a skeletal related events (SRE) management team to conduct rehabilitation interventions safely in cancer patients with metastatic bone lesions. SRE conferences were held 24 times from April 2011 to April 2012. Based on this experience, we investigated how the conferences benefited these patients. Participants: 78 individual patients (36 males and 42 females; aged 12-84 years, mean 63.6 years) were discussed in SRE conferences. Some became the subject of discussion repeatedly, and a total of 120 patients were discussed. Methods: This report analyzed retrospectively the effects of SRE conferences on the patients. Results: Primary cancers included breast cancer in 21 patients, lung cancer in 19, renal cancer in 7, liver cancer in 7, prostatic cancer in 6, esophageal cancer in 3, and gastric cancer in 3, and others in 12. No patients sustained pathological bone fracture during rehabilitation interventions. Rehabilitation achieved the goal of mobility in 75% of patients. Through substantial discussions within the interdisciplinary team, 16 patients with critical bone lesions assumed anti-gravity posture on average 4.4 days after (minimum 6 days before, maximum 23 days after) completion of radiotherapy. This was clearly earlier than the empirical schedule of around 2 weeks. The proportion of patients who were discharged to their own home increased significantly since SRE conference was started, compared to the pre-SRE conference period between 2006 and 2007. Conclusion: The present study suggests that implementation of SRE conference for cancer patients with bone metastases is effective to improve activity level with low risk of inducing pathological fracture, and is useful to achieve patientsʼ goals including mobility improvement and independent ADL. Key words: rehabilitation, interdisciplinary care team, bone neoplasm
List of abbreviations is not uniform for all cancer types. Cancers with ADL; activities of daily living, SRE; skeletal relatively favorable 5-year survival rate include related events breast cancer, uterine cancer, prostate cancer and thyroid cancer 1). With the advances in therapeutics, Cancer patients were not generally considered as the relative 5-year survival rate for all cancer subjects for rehabilitation in the past. Even now, patients is 59% in Japan 1), while two-thirds of the there are not many cancer patients undergoing cancer patients are reported to be cured in the rehabilitation in convalescent phase rehabilitation United States 2). On the other hand, even for rapidly units that target mainly chronic phase stroke progressing cancers with poor survival prognosis, patients. However, the number of rehabilitation there are still considerable needs for rehabilitation requests for cancer patients is increasing in acute in these patients considering the disuse syndrome care hospitals, accompanying an increase in number after surgery or chemotherapy and the quality of of cancer patients. The effect of cancer on survival the remaining life (such as dysphagia caused by
Corresponding author: Masanori Nagaoka Department of Rehabilitation Medicine, Juntendo University Graduate School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan TEL: +81-3-3813-3111 (ext. 71411 (PHS)) E-mail: [email protected] 〔Received Jan. 27, 2014〕〔Accepted Apr. 30, 2015〕
426 Juntendo Medical Journal 61(4), 2015
mucosal edema after radiotherapy). consisting of multiple health care providers. Details To address these situations, the revision of of the team activities have been reported 5). medical treatment fees by the Japanese Govern- ment in 2010 has added“cancer patient rehabilita- 2. Items analyzed tion fee”to the list of procedures remunerable by Information of the clinical courses of the patients health insurance. According to a study that discussed in SRE conferences was extracted from examined what terminal cancer patients desired in patientsʼ electronic medical records. Patientsʼ infor- their activities of daily living (ADL), the needs mation was converted into a database using related to mobility were the highest 3). On the other FileMaker Pro12. The following items were hand, pain and pathological fracture associated with reviewed: age, gender, diagnosis, date of first SRE metastatic bone tumor pose problems with rehabili- conference, major items discussed, success or tation for terminal cancer patients, and spinal failure of discussed items, subsequent clinical paralysis due tovertebral metastasis has a high risk course; and for inpatients, dates of admission and of deteriorating the prognosis of cancer patients, discharge, outcome (discharge to home, transfer to especially impeding discharge to their own homes 4). other hospital, death, unknown), and date of last In managing the progress of rehabilitation in outpatient visit after discharge. Based on these patients with metastatic bone tumor, our hospital records, a retrospective analysis was conducted to has established a skeletal related events (SRE) examine the significance of conducting SRE confer- management team and started activities from April ence for cancer patients, especially those with 2011. The purpose of SRE management is to metastatic bone tumors. The effectiveness of SRE prevent risks of inducing pathological fracture that conference was evaluated by comparing the data would aggravate the patientʼs functional status, and after introducing SRE conferences with the data of to improve or maintain the QOL of cancer patients. metastatic patients during the pre-SRE conference In this study, we investigated retrospectively the period from 2005 to 2007 4). At this stage of the activities of the rehabilitation team and the impact study, interventions were conducted within the of the activities on the outcome of patients with scope of routine clinical activities; therefore the metastatic bone tumors. present study has not been subjected to ethical review for clinical studies. Methods Mean age, duration from onset to first SRE 1. Activities of the SRE management team conference, and duration from first SRE conference The SRE management team (SRE team) started to last visit by type of cancer were analyzed by trial activities from April 2011. From September ANOVA. Significance of differences in outcome 2011, the activities were officially approved by the (discharge to home, or transfer to other hospital) hospital as a part of the activities of the Cancer was analyzed by χ2 test. Differences in ages and Treatment Center. Activities of the SRE team frequency of paresis and cancer diagnoses between include (1) SRE round made by an orthopedic pre-SRE and SRE conference periods were ana- surgeon specialized in tumors (also affiliated to lyzed by Mann Whitney test and χ2 test. A p value division of rehabilitation; TT) and therapists; (2) less than 0.05 was considered statistically signifi- examinations requested through departments of cant. All statistical analyses were conducted using rehabilitation and orthopedics; and (3) SRE confer- the statistical software GraphPad Prism 6. ence. The SRE conference is managed by the Results rehabilitation division and is held approximately twice a month in the Cancer Treatment Center. 1. Cases discussed at SRE conferences One orthopedic surgeon, rehabilitation doctors Between April 2011 and April 2012, a total of 24 (physiatrists), physiotherapists, occupational thera- SRE conferences were conducted. The net number pists, attending doctors, ward and outpatient clinic of patients studied was 78 (36 males and 42 females; nurses, palliative care team, medical social workers ages ranging from 12 to 84 years, mean 63.6 years), and pharmacist attend the conference. The goal and and the gross number was 120, because some plan for each patient are discussed by the team patients became subject of discussion repeatedly. In
427 Hayashi, et al: Effectiveness of SRE conference
principle, the target subjects were patients with a 1,350 days (approximately 3.7 years) for renal definitive diagnosis of metastatic bone tumor, but cancer, and 1,119 and 1,047 days (approximately 3 the number included 7 patients for whom differen- years) for hepatocarcinoma and gastric cancer, tial diagnosis was required. respectively, with a significant difference among The primary cancers were breast cancer in 21 cancer types (ANOVA, p ＝ 0.0031). On the other patients, lung cancer in 19, renal cancer in 7, liver hand, the durations were short for esophageal cancer in 7, prostate cancer in 6, esophageal cancer cancer with a mean of 241 days (less than 1 year), in 3, gastric cancer in 3, and others in 12. The mean lung cancer with a mean of 376 days (approxi- ages by type of cancer ranged from 56 to 67 years, mately 1 years) and other cancers with a mean of with no difference among cancer types (ANOVA, p 584 days (approximately 1.6 years). = 0.4073) (Table-1). Mean durations from pri- Among the patients discussed in SRE conferen- mary cancer detection to SRE conference following ces, 68 were inpatients and the remaining 10 onset of bone metastasis were 2,211 days (approxi- were outpatients (Figure-1). Fifty of 68 inpa- mately 6 years) for breast cancer, 1,533 days tients underwent rehabilitation, while the remain- (approximately 4.2 years) for prostate cancer, ing 18 inpatients and all 10 outpatients did not
Table-1 Characteristics of patients by cancer type (data as of May 2013) and comparison to data of pre-SRE period (2005-2007) Duration from onset to Duration from SRE conference to Age ＊ N SRE conference (days) last follow-up (days) Mean (Min-Med-Max) Mean (Min-Med-Max) N Mean (Min-Med-Max) Breast cancer 21 63.2 (43-66-83) 2211 (294-1545-8019) 14 369 (52-354-656) Lung cancer 19 66.8 (42-67-84) 376 (53-111-1565) 13 329 (3-430-656) Kidney cancer 7 65.3 (50-66-81) 1350 (38-871-5357) 4 438 (29-513-698) Hepatocarcinoma 7 63.7 (56-64-77) 1119 (106-787-3341) 5 193 (36-134-509) ＊＊ Prostate cancer 6 66.3 (54-66.5-79) 1533 (51-562-5525) 4 268 (30-192-656) Esophageal cancer 3 67.3 (62-68-72) 241 (185-199-339) 2 28 (26-28-30) Gastric cancer 3 64 (51-68-73) 1047 (37-262-2343) 2 120 (78-120-161) Others 12 55.9 (12-55-77) 584 (68-303.5-1553) 6 195 (12-162-411)
SRE conference period Total 78 63.6† (12-66-84) 1166 (37-332-8019) 50 289 (12-265-747) in-hospital death 11 66.8 (43-71-79) 1010 (53-339-5357) 11 32 (12-29-78) Number of paresis 28(36%)‡ Breast cancer 9 58.6 (42-58-83) Lung cancer 17 66.5 (40-70-82) Kidney cancer 4 67.3 (58-65-81) Hepatocarcinoma 3 65.7 (51-70-76) ＊＊ Prostate cancer 6 80 (62-82-92) Esophageal cancer 3 81 (60-91-92) Gastric cancer 4 55.3 (37-56-72) Others 19 64.6 (42-65-85) Total 65 66.1† (37-67-92) Pre-SRE conference period in-hospital death 24 69.9 (40-72-91) Number of paresis 32(49%)‡
N; number of patients, Min; minimum, Med; medium; Max; maximum, ＊; excluding cases lost to follow-up after discharge There is no significant difference in mean age among cancer types (ANOVA, p=0.4073). Duration from onset to SRE conference is significantly different among cancer types (ANOVA, p=0.0031). Duration from SRE conference to the last outpatient follow-up is not significantly different among cancer types (ANOVA, p=0.6130). Comparing pre-SRE conference and SRE conference period, there are no significant differences in age [Mann Whitney test, p = 0.3525 (†)] and diagnosis [Chi-square test, p=0.3382(＊＊)]. Numbers of subjects with paresis are also not significantly different between two periods [Chi-square test, p=0.3382(‡)].
428 Juntendo Medical Journal 61(4), 2015
1) Case report A 75 year-old female patient with a diagnosis of SRE subjects N＝78 cancer of left renal pelvis with metastases to bones had been followed in the out-patient clinic for one year because of hematuria and class II urinary Inpatients Outpatient N＝68 cytology. She was admitted to the hospital for N＝10 （include 12 death） investigation of suspected cancer of upper urinary tract, because she complained of lower abdominal
No prescription Rehabilitation pain. On admission, she had difficulties in walking for rehabilitation Intervention due to severe pain in the lower abdomen as well as N＝18 N＝50 lumbar and posterior aspects of the right thigh, but Figure-1 Breakdown of patients discussed in SRE confer- no paresis. An orthopedic doctor specialized in bone ence tumor (TT) diagnosed that the pain was caused by metastatic bone lesions to spinal bodies. Techne- tium (99mTc) bone scintigraphy identified hot undergo rehabilitation. lesions in lower thoracic and lumbar areas. A CT scan revealed destructive lesions from Th12 to L3, 2. Contents discussed in SRE conferences particularly osteolytic changes in Th12 and L2 During SRE conferences, various aspects con- (Figure-2). The clinical course and discussion cerning rehabilitation including the current bed during SRE conferences are shown in Figure-3. On rest level based on therapeutic strategy, methods day 5 of admission, radiotherapy (30 Gy/10 frac- of daily activities in bed, time of initiating anti- tions) was started to prevent further destruction of gravity posture following radiotherapy, and pre- bones and to relieve pain. Rehabilitation was started scription of spinal orthosis and walking aid were for the prevention of disuse syndrome. Muscle discussed. strengthening exercise in recumbent position was To illustrate how the SRE conference functions, prescribed. we present one case that was discussed in SRE At the first SRE conference (day 28 of admission) conferences, which has been reported in Japanese 5). after completion of radiotherapy, taking sitting position with the aid of an electrical hospital bed
AB
CT sagittal view
scintigram of technetium（99mTc） Figure-2 Scintigram (A) and CT scan (B) of presented case Modified from reference number 5.
429 Hayashi, et al: Effectiveness of SRE conference
1st SRE 2nd SRE 3rd SRE
One month Independent walk Radiotherapy for short distance
Exercise and Transfer to wheel chair Gait exercise with functional achievement with spinal orthosis caster walker
Taking sitting position
Muscle strengthening exercise on bed Admission Return home Involved disciplines Medical social Nurses support for Physiotherapist Palliative care team workers discharge
1w 9w8w7w6w5w4w3w2w 10w 11w 12w 13w 14w 15w 16w
Figure-3 Clinical course of presented case Modified from reference number 5. was added to the rehabilitation prescription, after this period, the patient was able to walk with checking that the patient had noremarkable walking aids. lumbar pain. At the conference, the urologist At the third SRE conference (day 70 of admis- advised not to add any curative treatment because sion), she was able to walk independently for a of her poor performance status (PS). The decision short distance. Finally, the patient and family that no chemotherapy would be planned for the accepted the decision of no chemotherapy because reason of poor physical condition was explained to of the unavailability of effective regimen and the patient and her family. However, the patient advanced stage of cancer with remote metastasis. and family understood that chemotherapy would be Considering her improved physical condition, the started if her physical condition improved. patient and her husband decided to return home At the second SRE conference (day 35 of instead of moving to another hospital. However, admission), a physiotherapist reported that the arrangements had tobe made toallowthem tolive level of pain decreased while the patient was in at home with the help of long-term care services, Fowlerʼs position, and by changing from supine to including renting of bed, planning of home care and sitting position. Transfer to a wheel chair was set as nursing. It took one month to complete these the next goal, after adjustment of the spinal preparations for discharge to home. orthotics which was already built but did not fit completely. Through successive accomplishment of 2) Lessons learnt the targets of rehabilitation, the patient and family 1. For patients with metastatic bone lesions but no hoped that chemotherapy could be started and took paresis, preventive measures for pathological a more positive attitude toward training. The fracture and treatment for pain may improve urologist in charge further explained that the functional outcome. reason for no further curative treatment was that 2. In rehabilitation for cancer patients, the goal is no known effective chemotherapy was available for not clearly defined and sometimes changes the type of cancer and the advanced clinical stage. depending on physical and mental conditions. He advised that the patient should be moved to a 3. Even with consecutive SRE conferences con- long-term care hospital, and asked medical social ducted by a multidisciplinary team involving the workers to find a suitable hospital. For several patient and family, attending doctors from weeks, the patient and family did not accept the relevant specialties, orthopedic surgeon, physia- recommendation of the urologist in charge. During trist, rehabilitation staff, radiologist, nurses, and
430 Juntendo Medical Journal 61(4), 2015
Table-2 Contents of discussion at SRE conferences 1. Patient with a diagnosis of metastatic bone tumor (A) Possibility of paralysis has to be discussed (1) Currently noparesis ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀5 cases (2) Incomplete paralysis (paresis) ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀24 cases (a) Therapeutic strategy (b) Discussions on bed rest level, methods and time of initiation of daily activities and standing/gait training (3) Complete paralysis㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀3 cases (a) Therapeutic strategy (b) For paraplegia and quadriplegia, discussions on transfer techniques (prescription of spinal orthosis, use of sliding board, prescription of wheelchair, etc.) (B) No risk of developing paralysis, but has risk of pathological fracture㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀27 cases (1) Discussions on therapeutic strategy (2) Discussions on orthosis, walking stick, wheelchair, daily activities, standing/gait training (C) Pain control necessary㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀9 cases (1) Discussions on therapeutic strategy (should radiotherapy be first priority, choice of chemotherapy, etc.) (2) Discussions on bed rest level, prescription of spinal orthosis, etc. (D) Others ㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀㌀3 cases Discussions on paralysis prevention, expansion of ADL accompanying pain control, method to address change in PS
2. Patients requiring differential diagnosis of metastatic bone tumor on diagnostic imaging㌀㌀㌀㌀㌀㌀ 7 cases Diagnosis by orthopedic surgeon specializing in tumor and radiologist (educational discussions for participants)
medical social workers, the team decision mak- ulum with metastasized lesion during an overnight ing was not completely effective. stay at home. Also, five outpatients (cases 11, 18, 31, 4. Finally the patient accomplished her wish of 45 and 55) were at risk of pathological fracture, and returning home, but it took four months. This were discussed in SRE conferences regarding suggests that the team did not necessarily treatment strategies. These 5 outpatients also did function efficiently for this patient. not have any pathological fracture.
Among patients who were discussed in multiple 2) Could the progression of paresis be prevented? conferences, improvement of activity level as At the time of initial SRE conference, a total of 29 treatment progressed resulting in a change of the patients were discussed regarding the issue of initial rehabilitation goal was observed in some paresis, comprising5 patients whohad noparesis, patients. For the 78 patients studied, we retrospec- but development of paresis was anticipated from tively analyzed the contents discussed at the initial the lesion site, and 24 patients who had already SRE conference from the electronic medical records developed mild paralysis (incomplete paresis). and were able to classify the patients according to Among them, rehabilitation intervention was imple- the criteria proposed by Katagiri 6) as shown in mented in 20 patients (no paresis in 2, incomplete Table-2. paralysis in 18), and the outcome of these patients were analyzed (Figure-4). 3. Effects of SRE conference on outcome of Of two patients without paresis, one achieved the patients with metastatic bone tumor rehabilitation goal (no development of paresis, pain 1) Frequency of pathological fracture associated control, discharge to home) but one showed deterio- with rehabilitation intervention ration of general condition. Of 18 patients with some Among 50 patients who underwent rehabilitation symptoms of paresis, 12 not only achieved the goal intervention, no case of pathological fracture caused (no deterioration of paresis) but also paresis by rehabilitation intervention during the hospital- improvement and attainment of walking capability; ization period was observed. However, in one one showed no change of paresis; one showed inpatient (case 56), fracture occurred in the acetab- progression of paresis; two showed deterioration of
431 Hayashi, et al: Effectiveness of SRE conference
Discussion on paralysis N＝29
Rehabilitation N＝20
Incomplete No paresis paralysis N＝2 N＝18
Goal General Goal Paralysis General No change Goal changed achieved condition achieved progressed condition N＝1＊ N＝1＋1† N＝1＊ worsen N＝12＊ N＝1 worsen N＝1 N＝2
Figure-4 Outcome of rehabilitation in patients discussed at SRE conferences The groups that achieved maintenance of functional level or improvement of paresis are marked with asterisks. One patient who attained the goal by modifying the program is marked with obelisk (†).
general condition; and two had a change of goal. study (12 patients), and classified the remaining 56 The 12 patients who achieved goal comprised 8 who patients (27 males and 29 females; age range 12 to recovered from paresis and 4 who maintained 84 years, mean 63.7 years) by outcome into functions or had improved capability by walking discharge to home and transfer to other hospital. As aids. For the 2 patients with goal change, both had a result, 48 patients (86%) were discharged to the initial goal of paresis improvement, but 1 home and 8 patients (14%) were transferred to changed the rehabilitation goal to palliative inter- other hospital (Figure-6). When outcome was vention and the other to achieve mobility by examined by classifying the 56 patients according selecting walking aids instead of aiming at func- to the main issue discussed, 19 of 20 patients tional recovery (Figure-4). examined for the issue of pathological fracture, 18 of 23 for the issue of paresis, and 11 of 13 for other 3) Role of SRE conference in improving ADL: issues were discharged to home. On the other hand, duration between radiotherapy completion those transferred to other hospital comprised 1 and permission of anti-gravity posture discussed for the issue of pathological fracture, 5 for Among the patients discussed at SRE conferen- the issue of paresis, and 2 for other issues. When ces, 16 patients whohad spinal metastasis were paralysis became complete, the probability of prescribed bed rest during radiotherapy. We transferring to other institution was increased. Of 3 analyzed these patients regarding the duration patients with complete paralysis, 2 were trans- from the beginning of radiotherapy to permission of ferred to other hospital, and 1 died while in hospital. anti-gravity posture (Figure-5). The time of the beginning of anti-gravity posture ranged from 6 5) Comparing data with those of patients with days before (minus mark in figure) to 23 days after spinal metastasis from pre-SRE conference completion of radiotherapy, with a mean duration of period (Table-1) 4.4 days. During the period of 2005 to 2007 before SRE conference was implemented, 65 cancer patients 4) Outcome: discharge to home were referred to rehabilitation because of metasta- Of the 78 patients discussed in SRE conferences sis to the vertebral bones (38 males and 27 females; between April 2011 and April 2012, we excluded age range 37-92 years, mean 66.1 years). Compar- those who were outpatients at the time of examina- ing patients in the pre-SRE and SRE conference tion (10 patients) and those who died during the periods, mean age was apparently slightly older in
432 Juntendo Medical Journal 61(4), 2015
0 5 10 15 20 25 30 35 40 54 Lung cancer 1 17 4 73 Prostate cancer Days 1 11 66 Lung cancer －1 day 6 13 59 Prostate cancer －1 day 6 10 19 75 Ureteral cancer 10 13 23 68 Esophageal cancer 11 27 50 Renal cancer －6 day 12 20 4 59 Hepatic cancer 12 17 4 58 Breast cancer 13 6 5 57 Breast cancer 13 14 3 63 Renal cancer Duration of radiotherapy 15 7 6 Days to initiating anti－gravity 56 Hepatic cancer 16 7 2 posture 54 Prostate cancer 18 7 1 81 Renal cancer 18 7 －1 day 73 Lung cancer Mean irradiation duration：12 days 18 7 7 Mean time to start anti－gravity posture：4.4 days 83 Breast cancer 24 7 1
↑No. of SRE conferences conducted
Figure-5 Duration of radiotherapy and the time of starting anti-gravity posture in patients with metastatic bone cancer Modified from reference number 5.
SRE subjects N＝78
Subjects Outpatient excluding Death N＝10 outpatients and N＝12 deaths N＝56
Pathological Paralysis related Pain, others fracture N＝23 N＝13 N＝20
Discharge to Hospital Discharge to Hospital Discharge to Hospital home transfer home transfer home transfer N＝19 N＝1 N＝18 N＝5 N＝11 N＝2
Figure-6 Outcome at discharge (discharge to home or transfer to other hospital) in patients discussed at SRE conferences pre-SRE group (66.1 years) than in SRE group was also not significantly different between (63.6 years), but the difference was not significant pre-SRE period (32 of 65 patients, 49%) and SRE (Mann Whitney test, p = 0.3535). The cancer with period (28 of 78 patients, 36%) (unpaired t test, p= the highest frequency was breast cancer in SRE 0.1092). period and lung cancer in pre-SRE period, but there Among 65 patients in the pre-SRE period, 21 was no significant difference in frequency of cancer were discharged to home and 16 were transferred type (χ2 test: p=0.3382). The frequency of paresis to other hospital. Analysis by chi-squared test
433 Hayashi, et al: Effectiveness of SRE conference
Table-3 Influence of SRE conference on frequency of discharge to home Pre-SRE conference period SRE conference period Total Discharge to home 21 48 (18＊) 69 (39＊) Transferred to hospital 16 8 (5＊) 24 (21＊) Total 37 56 (13＊) 93 (50＊)
Comparing between pre-SRE conference and SRE conference periods, there is a significant difference in the rate of discharge to home (chi-square test, p=0.0032) but no significant difference if only cases of paralysis are included (*) (chi-square test, p=0.104).
showed a significantly higher rate of discharge to On the other hand, the presence of bone metastatic home among patients discussed at SRE conferences lesions increases the risks of pathological fracture (48 patients discharged to home and 8 patients and progression to paralysis. For the medical care transferred to other hospital) than that in pre-SRE providers, to what extent rehabilitation training period (χ2 test: p = 0.0032) (Table-3). When anal- should be conducted actively is a question that has ysis was conducted in the subset of patients with to be decided constantly. Usually, the decision is paresis, the rate of discharge to home in pre-SRE made based on the opinion or experience of the period (18 patients discharged to home and 5 rehabilitation doctor or the attending doctor. In patients transferred to other hospital) was not some cases, the opinions of orthopedic surgeon and significantly higher than in SRE period (χ2 test: p= radiologist are also sought. In the SRE conference 0.1042). evaluated in this study, however, all parties involved in care of the patients gather together, and 6) Follow-up after SRE conference (Table-1) the conference provides a highly efficient means for Of 78 patients studied, 11 died in hospital. Among collecting information and opinions from multiple the remaining 67 patients, we excluded those who disciplines to develop treatment strategy. We have were transferred to other hospital and those who a Cancer Treatment Center in our hospital, where were changed to domiciliary care at discharge, and an interdisciplinary staff discusses with doctors investigated the status of outpatient visit of the from different specialties regarding chemotherapy, remaining 50 patients from the electronic medical palliative care, medical consultation, and nutritional records. As of May 2013, a record of outpatient visit guidance of the cancer patients. The SRE confer- was found in 5 of 14 patients with breast cancer, 4 of ence, being held in the Center, is characterized by 13 with lung cancer, 3 of 4 with renal cancer, 1 active participation of many paramedics. patient each with hepatocarcinoma and prostate We found no case of pathological fracture or cancer, and 2 of 6 with other cancers, with a total of accelerated progression of paresis induced by 16 patients. rehabilitation interventions per se. One patient When the duration from SRE conference to the attained acetabular fracture during an overnight last follow-up was investigated, the mean duration stay at home. In this case, we cannot deny the was over 1 year for breast cancer, lung cancer, and possibility that improved activity through rehabili- renal cancer. The duration for hepatocarcinoma, tation was a remote cause. In the analysis of 20 esophageal cancer and gastric cancer was less than patients regarding whether the initial rehabilitation 200 days, although the number of patients was goal for paralysis was achieved, functional level was small. There was no significant difference among maintained in 1 of 2 patients with risk but no actual cancer types (ANOVA, p=0.6130). The functional paresis, and in 13 (paresis improved in 12 and status of outpatients at the time of study was maintained at the same level in 1) of 18 patients unknown. with mild paresis at the beginning of rehabilitation (total 14 of 20 patients with asterisks in Figure-4, Discussion 70%). Of the remaining 5 patients with paresis, 1 The greatest expectation of cancer patients from attained the goal of achieving mobility by modifying rehabilitation relates to the capability of mobility. the program of using walking aid. Including this
434 Juntendo Medical Journal 61(4), 2015
case, rehabilitation was effective for achieving goal hospital 7). In multidisciplinary team, attending or maintaining and improving mobility in 75% of the doctor sends discrete orders to various specialists, patients. Bed rest is often prescribed during and horizontal communication among various radiotherapy, which delays the time of assuming an specialists has been considered to be insufficient. anti-gravity posture. Although there is no data For patients discussed in SRE conference, it is before the implementation of SRE conference, in the important to have mutual communication between past patients were instructed toassume an anti- different specialists to share common understand- gravity posture gradually after completion of radio- ing of patientʼs needs and goals as illustrated in the therapy, which usually took a couple of weeks. case report. Accordingly, interdisciplinary team Through substantial discussions in SRE conferen- may be a suitable style for the SRE team 8). ces, patients with critical bone lesions assumed an Reviewing the prolonged hospitalization of the anti-gravity posture at a mean of 4.4 days after presented case, we need to promote more active completion of radiotherapy, which is clearly earlier participation of each discipline attended the SRE than the empirical schedule of around 2 weeks. conferences. We analyzed outcome by dividing patients into Study limitations discharge to home and transfer to other hospital. Analysis was conducted on 56 patients after This study has some limitations. First, patients excluding 10 patients who were outpatients when with bone metastases are treated with bisphos- discussed at SRE conferences and 12 patients who phonates 9), strontium-89 and radiotherapy for bone died during the study. Of 56 patients, 48 (86%) metastasis, chemotherapy for the primary cancers, were discharged to home. Comparing to the as well as analgesics for pain control. Therefore the outcome of 37 patients (excluding deaths and consequences and outcome shown in this study are patients being in hospital from a total of 65 patients) not achieved by rehabilitation alone. Further who underwent rehabilitation because of spinal studies taking into consideration of the above metastasis in a pre-SRE conference period (2005 to treatments are needed to examine the optimal 2007), 21 patients were discharged to home and 16 treatments for these patients. Second, the present were transferred to other hospital 4), and the rate of study did not evaluate the effects on QOL and discharge to home was significantly higher in the psychological state of the study patients. In a group discussed at SRE conferences. In general, previous study, early palliative care in patients with whether a patient can be discharged to home non-small cell lung cancer improved the scores of depends also on the social background such as the Functional Assessment of Cancer Therapy- family structure and economic situation, and Lung (FACT-L) scale (a QOL scale) and the Hos- multifactorial analysis is necessary. Furthermore, pital Anxiety and Depression Scale 10). The present while bone metastasis generally indicates stage 4 study was a retrospective analysis of the data cancer, outpatient visit could be confirmed in 16 of obtained from routine clinical care. In the future, a 50 patients as of May 2013. The mean duration from prospective clinical study with clinical trial registra- SRE conference to the time of last follow-up tion and ethical approval is required to investigate exceeded one year for breast cancer, lung cancer the impact of rehabilitation based on SRE confer- and renal cancer. The duration for hepatocarci- ence on patientsʼ QOL and mood. noma, esophageal cancer and gastric cancer was Conclusion around 200 days although the number of patients was small. The present study suggests that implementation Besides the beneficial findings described above, of SRE conference for cancer patients with bone SRE conference could provide a productive and metastases is efficient to improve activity with low educational milieu for different disciplines of risk of increasing the frequencies of falls and rehabilitation within a setting of acute hospital as pathological fracture, and is useful to achieve the our university hospital. Considering the structure of patientsʼ desired goals including mobility improve- the team, multidisciplinary and interdisciplinary ment and independent ADL. teams are applicable in acute hospitals such as our
435 Hayashi, et al: Effectiveness of SRE conference
cancer patients. JMDD, 2013; 23: 51-59. (in Japanese) References 6) Katagiri H: Palliative care conducted by cancer rehabili- 1) Japan Cancer Statistics 2012: Foundation for Promotion tation team, rehabilitation for metastatic bone tumor. of Cancer Research, 2012. MB Med Reha, 2012; 140: 19-27. (in Japanese) 2) Longo DL: Approach to the patient with cancer. In: 7) King JC, Blankenship KJ, Schalla W, Mehta A: Rehabili- Longo DL, Fauci AS, Kasper DL, et al, eds. Harrisonʼs tation team function and prescriptions, referrals, and Principles of Internal Medicine, 18th ed. 2012. Retrieved order writing. In: Frontera WR, ed. DeLisaʼs Physical May 17, 2013 from http://www.accessmedicine.com/con Medicine and Rehabilitation: Principles and Practice, tent.aspx?aID=9114033. 5th ed. Philadelphia: Lippincott Williams & Wilkins, 3) Tsuneto A: Study on the status of terminal cancer 2010: 359-412. patients. Terminal Care, 1996; 6: 482-490. (in Japanese) 8) Lisa AB: Cancer rehabilitation: does it make a differ- 4) Hayashi Y, Kitahara E, TerakadoA, et al: Development ence? Rehabilitation Nursing, 2003; 2: 42-47. and application of guideline of rehabilitation for patients 9) Kinnane N: Burden of bone disease. Eur J Oncol with cancers in their advanced stages: factors worsen- Nursing, 2007; 11: 528-531. ing tospinal paraplegia in vertebral metastasis. JMDD, 10) Temel JS, Greer JA, Muzikansky A, et al: Early 2008; 18: 43-49. (in Japanese) palliative care for patients with metastatic non-small- 5) Nagaoka M, Hayashi Y, Takagi T, et al: Introduction of cell lung cancer. N Engl J Med, 2010; 363: 733-742. SRE meeting and their effects on the rehabilitation of
436 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 437 Department of Immunology
Principal Investigator: Prof. Sachiko Miyake 3. Costimulatory molecules regulate CD4 T cell function and/or differentiation Research Topics and Investigators Hisaya Akiba (Associate Professor) 1. MAIT cells in autoimmunity Optimal activation of antigen-specific T cells Asako Chiba (Associate Professor) requires engagement of the TCRwith antigen/MHC Mucosal-associated invariant T (MAIT) cells are a and a costimulatory signal provided by antigen-pre- unique subset of T cells that express invariant TCRα senting cells. We have previously demonstrated that chain associated with a biased β chain. MAIT cells are OX40/OX40 ligand-mediated costimulation promotes restricted by a non-polymorphic MHC-related mole- the development of Th2 cells in a murine leishmania- cule-1 (MR-1) and are selected in the thymus. MAIT sis and asthma model. These in vivo observations cells require B cells, as well as commensal microbiota, raise the possibility that some costimulatory mole- for their peripheral expansion. Recently, vitamin cules may be involved in the development and/or metabolites were demonstrated to be antigens function of CD4 T cells in vivo. We are investigating created by intestinal microbiota for MAIT cells. an important role of costimulatory molecules in the MAIT cells are involved in a variety of infection and control of CD4 T cell function. inflammation pathways, including in autoimmune Publications: diseases, inflammatory colitis, and metabolic syn- 1) Kamachi F, Harada N, Usui Y, et al: OX40 ligand dromes. We investigate the role of MAIT cells in both regulates splenic CD8 - dendritic cell-induced Th2 healthy and in a variety of disease conditions in mice responses in vivo. Biochem Biophys Res Commun, 2014; 444: 235-240. and humans. 2) Abe Y, Kamachi F, Kawamoto T, et al: TIM-4 has dual Publications: function in the induction and effector phases of murine 1) Miyake S*, Miyamoto K*, Yamamura T: A synthetic arthritis. J Immunol, 2013; 191: 4562-4572. glycolipid prevents autoimmune encephalomyelitis by inducing Th2 of natural killer T cells. Nature, 2001; 413: 4. Crosstalk of commensal bacteria and thymus 531-534. Akihito Nakajima (Assistant Professor) 2) Croxford JL, Miyake S, Huang YY, Shimamura M, Recent studies have suggested that commensal Yamamura T: Invariant Vα19i T cells regulate autoim- mune inflammation. Nat Immunol, 2006; 7: 987-994. bacteria regulate the immune system not only in the gut, but also in other organs. We have previously 2. Crosstalk between the neuroendocrine and im- shown that thymic autoimmune regulator (Aire), is mune systems regulated by commensal bacteria-derived peptido- Fumiaki Ogawa (Assistant Professor) glycan and superantigens. We are now investigating Crosstalk between the neuroendocrine and how the metabolites of commensal bacteria regulate immune systems is essential for the maintenance of T cell development in the thymus. homeostasis in our bodies. Although the neural Publication: regulation of immune responses has been extensively 1) Nakajima A, Negishi N, Tsurui H, et al: Commensal studied, the interactions between the neuroendocrine bacteria regulate thymic Aire expression. PLoS One, and immune systems are bidirectional. We investi- 2014; 9: e105904. gate the immunological regulation of the development and function of neural systems. Publications: 1) Theil MM, Miyake S, Mizuno M, et al: Suppression of experimental autoimmune encephalomyelitis by Ghrelin. J Immunol, 2009; 83: 2859-2866. 2) Miyake S, et al: Dysbiosis in the gut microbiota of patients with multiple sclerosis, with a striking depletion of species belonging to Clostridia XIVa and IV clutsers. PLoS One, 2015; 10: e0137429.
437 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4),438-439 Department of Pediatrics and Adolescent Medicine
Principal Investigator: Toshiaki Shimizu (Professor) 4) Cardiology group Twelve research groups exist in our department. Masahiko Kishiro (Associate Professor) Each subspecialty group has an active research team Ken Takahashi (Associate Professor) and carries out basic and clinical research actively. We examine cardiovascular function in congenital and acquired heart diseases using novel two-dimen- Group Leaders and Research Topics sional speckle tracking imaging and three-dimen- 1) Gastroenterology group sional volume measurements. We analyze arterial Toshiaki Shimizu (Professor) function in adults with a history of Kawasaki disease. Takahiro Kudo (Associate Professor) Reference: We examine the pathogenesis of mucosal immunity 1) Tobayama H,Takahashi K,Kishiro M,Shimizu T,et al: including inflammatory bowel disease,food protein- Analysis of arterial function in adults with a history of induced enterocolitis syndrome,and Helicobacter Kawasaki disease. J Cardiol,2013; 61: 330-335. pylori infection,using mucosal biopsy samples. In mucosal immunologic research,cytokine profiles such 5) Neonatology group as TNF-α,IFN-γ,IL-17,and IL-26,and lymphoid Hiromichi Shoji (Associate Professor) follicle proliferation factors have been analyzed. Ken Hisata (Associate Professor) Furthermore,functional digestive examinations for We examine lipid profile,insulin sensitivity,IGF-1, functional gastrointestinal disorders,using gastroe- and oxidative stress in preterm infants. The effects of lectromyogram and C13-acetate breath test for gastric breastfeeding on the risk factors for metabolic emptying examination,have also been performed. syndrome in preterm infants are also studied. We Reference: examine glucose metabolism soon after birth in very 1) Jimbo K,Kudo T,Shimizu T,et al: Increased expression premature infants with low and appropriate-for-ges- of CXCR3 axis components and MMPs in pediatric IBD tational-age birth weights. patients. Pediatr Int,2014; 56: 873-883. Reference: 1) Suganuma H,Shoji H,Shimizu T, et al: Fat emulsion 2) Nutrition group given to very low-birth weight infants increases urinary Toshiaki Shimizu (Professor) L-FABP. Pediatr Int,2014; 56: 207-210. Tomohiro Kitamura (Assistant Professor) The efficacy of nutritional treatment for premature 6) Infection group and very low-birth-weight infants is examined. We Ken Hisata (Associate Professor) also carry out clinical trials researching the safety of We examine the clinical application of nucleic acid artificial milk supplemented with proteins and other amplification test (NAT) in pediatric infectious diseases nutrients,such as biotin and oligosaccharide. As and the molecular epidemiology of methicillin-resistant clinical research,nutritional support team activities Staphylococcus aureus (MRSA) in Japan. Extended- for inpatients are performed. spectrum beta-lactamases (ESBLs) for treatment,pre- Reference: vention,and surveillance are also studied. We further 1) Shoji H,Shimizu T,et al: Lipid profile and atherogenic examine the metagenomics of neonatal gut microbiomes indices soon after birth in Japanese preterm infants. and probiotics in children. Acta Paediatr,2014; 103: 22-26. Reference: 1) Nakao A,Hisata K,Shimizu T, et al: The clinical utility of 3) Allergy and immunology group a near patient care rapid microarray-based diagnostic Yoshikazu Ohtsuka (Associate Professor) test for influenza and respiratory syncytial virus infec- Mari Mori (Assistant Professor) tions in the pediatric setting. Diagn Microbiol Infect Dis, We analyze signaling molecules related to FcεRI 2014; 78: 363-367. expression in allergic patients and investigate mecha- nisms of rectal bleeding in infancy in relation to the 7) Hematology and oncology group induction of tolerance. We also examine the effects of Jyunya Fujimura (Associate Professor) probiotics and omega-3 fatty acids in allergic and Sachi Sakaguchi (Assistant Professor) rheumatic diseases. We examine the molecular mechanisms of differen- Reference: tiation and proliferation of lymphoblasts in BCP-ALL 1) Mori M,Ohtsuka Y,Shimizu T,et al: Outcome of infants and new tyrosine kinase-related fusion genes and presenting rectal bleeding: a retrospective study in a their roles in Ph-like ALL. Personalized long-term single institution. Pediatr Int,2014; 56: 884-890. follow-up of pediatric cancer survivors using an electronic database is also performed. We further
438 Juntendo Medical Journal 61(4),2015
study the prophylaxis of febrile neutropenia by effect of mizoribine and a direct renin inhibitor, reducing chemotherapy-induced gastrointestinal aliskiren,on unilateral ureteral obstruction-induced mucosal injury. renal fibrosis in rats. Increased urinary angiotensino- Reference: gen is also studied as an effective marker of chronic 1) Tomita O,Kiyokawa N,Shimizu T,et al: Sensitivity of renal impairment in very low-birth-weight infants. SNX2-ABL1 toward tyrosine kinase inhibitors distinct Reference: from that of BCR-ABL1. Leuk Res,2014; 38: 361-370. 1) Endo A,Shimizu T,et al: Synergistic protective effects of mizoribine andangiotensin II receptor blockade on cyclos- 8) Endocrinology and metabolism group porine A nephropathy in rats. Pediatr Res,2014; 75: 38-44. Hidenori Haruna (Associate Professor) Noriyuki Takubo (Associate Professor) 12)Child and adolescent mental health group We examine the effect of short stature homeo- Kyoko Tanaka (Associate Professor) box-containing (shox) gene on early embryonic Naomi Yoshikawa (Assistant Professor) growth and bone formation in zebrafish. We also We provide assessment,and diagnostic and treat- examine growth disturbance in Japanese children ment services for infants to adolescents with develop- with IBD and prolonged intracranial hypertension mental and psychiatric problems. Our research inter- after recombinant growth hormone therapy. ests include areas such as developmental disorders Reference: (autism spectrum disorder,ADHD,specific language 1) Sawada R,Shimizu T,et al: In vivo loss of function study impairment),high-risk infants,children with psycho- reveals the short stature homeobox-containing (shox) somatic illness,and battered children. gene plays indispensable roles in early embryonic Reference: growth and bone formation in zebrafish. Dev Dyn,2015; 1) Tanaka K,Yoshikawa N,Shimizu T,et al: The pilot 244: 146-156. study: Sphingomyelin-fortified milk has a positive asso- ciation with the neurobehavioural development of very 9) Hepatology and metabolism group low birth weight infants during infancy,randomized Mitsuyoshi Suzuki (Assistant Professor) control trial. Brain Dev,2013; 35: 45-52. Kei Minowa (Assistant Professor) We examine a scoring system for the prediction of 13)Other references severe acute pancreatitis in children and familial and 1) Fujitake Y,Ohtsuka Y,Shimizu T,et al: Analysis of in- hereditary pancreatitis. The transmission route and flammatory signals in Japanese children with Crohnʼs genotype of chronic hepatitis B virus infection in chil- disease. Pediatr Int,2013; 55: 753-756. dren in Japan are further studied. We also examine 2) Shoji H,Shimizu T,et al: Oxidative stress early in infan- the association of IL28B polymorphisms with virologi- cy and neurodevelopmental outcome in very low-birth- cal response to peginterferon and ribavirin therapy in weight infants. Pediatr Int,2014; 56: 709-713. children and adolescents with chronic hepatitis C. 3) Tanaka N,Shimizu T,et al: Assessment of the develop- mental change in the left atrial volume using real time Reference: three-dimensional Echocardiography. Echocardiography, 1) Suzuki M,Shimizu T,et al: Acute pancreatitis in chil- 2015; 32: 1131-1139. dren and adolescents. World J Gastrointest Pathophysiol, 4) Obinata K,Shimizu T,et al: Two cases of partial dominant 2014; 15: 416-426. interferon-γ receptor 1 deficiency that presented with dif- ferent clinical courses of bacille Calmette-Guérin multi- 10)Neurology group ple osteomyelitis. J Infect Chemother,2013; 19: 757-760. Shinpei Abe (Assistant Professor) 5) Tamaichi H,Shimizu T,et al: Ataxia telangiectasia mu- Mitsuru Ikeno (Assistant Professor) tated-dependent regulation of topoisomerase II alpha We study the utility of amplitude-integrated expression and sensitivity to topoisomerase II inhibitor. electroencephalography for various neurological dis- Cancer Sci,2013; 104: 178-184. eases in childhood. The efficacy and safety of 6) Tsubahara M,Okumura A,Shimizu T,et al: Isolated fosphenytoin for neonatal and infantile neurological growth hormone deficiency in two siblings because of diseases are also examined. We further study the paternal mosaicism for a mutation in the GH1 gene. Clin correlation between genotype and phenotype in Endocrinol,2012; 76: 420-424. benign partial epilepsy in infants. 7) Suzuki M,Shimizu T,et al: Scoring system for the pre- Reference: diction of severe acute pancreatitis in children. Pediatr Int,2015; 57: 113-118. 1) Igarashi A,Abe S,Ikeno M,Shimizu T,et al: Ampli- 8) Nakazawa M,Shimizu T,Okumura A,et al: Efficacy and tude-integrated EEG revealed nonconvulsive status safety of fosphenytoin for benign convulsions with mild epilepticus in children with non-accidental head injury. gastroenteritis. Brain Dev,2015; 37: 864-867. Eur J Paediatr Neurol,2014; 18: 806-810. 9) Sakuraya K,Shimizu T,et al: The synergistic effect of mizoribine and a direct renin inhibitor,aliskiren,on 11)Nephrology group unilateral ureteral obstruction induced renal fibrosis in Amane Endo (Assistant Professor) rats. J Urol,2014; 191: 1139-1146. We examine the synergistic protective effects of 10) Hosozawa M,Tanaka K,Shimizu T,et al: How children mizoribine and angiotensin II receptor blockade on with specific language impairment view social situations: cyclosporine A nephropathy and the synergistic an eye tracking study. Pediatrics,2012; 129: e1453-1460.
439 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 440-441 Department of Anesthesiology and Pain Medicine
Principal Investigator: Eiichi Inada (Professor and 2015; 10: e0116885. Chairman) 2) Ide S, Nishizawa D, Fukuda K, et al: Haplotypes of P2RX7 gene polymorphisms are associated with both The research in our department encompasses a cold pain sensitivity and analgesic effect of fentanyl. Mol wide range of topics on pain medicine, including Pain, 2014; 10: 75. kampo medicine, neurophysiological study, pulmo- 3) Nishizawa D, Fukuda K, Kasai S, et al: Association nary physiology, anaphylactic shock, obstetric anes- between KCNJ6 (GIRK2) gene polymorphism rs2835859 and postoperative analgesia, pain sensitivity, and nicotine thesia, and blood transfusion. We have performed dependence. J Pharmacol Sci, 2014; 126: 253-263. extensive basic and clinical research in these areas. 4) Nishizawa D, Fukuda K, Kasai S, et al: Genome-wide association study identifies a potent locus associated Group Leaders and Research Topics with human opioid sensitivity. Mol Psychiatry, 2014; 19: 55-62. 1. Eiichi Inada (Professor) We have conducted multicenter epidemiological 4. Masako Iseki (Professor) study on critical bleeding in the perioperative period. The research in our group targets various aspects We have also conducted clinical and experimental of pain including the utility of interventional pain studies on the pathophysiology of pain. treatment techniques against non-cancer pain, and Publication: pathological elucidation of and the development of 1) Takeda J, Namiki A, Ozaki M, et al: A prospective randomized multicenter comparative study of BLM-240 preventive measures against neuropathic pain. (desflurane) versus sevoflurane in Japanese patients. J Publication: Anesth, 2013; 27: 468-471. 1) Enomoto T, Yamashita A, Torigoe K, et al: Effects of mirtazapine on sleep disturbance under neuropathic 2. Kinya Nishimura (Professor) pain-like state. Synapse, 2012; 66: 483-488. We have studied the effects of anesthetic agents on the CNS, particularly on the developing brain. 5. Hiroyuki Sumikura (Professor) Publication: We have studied obstetric patients and conducted 1) Ando N, Sugasawa Y, Inoue R, et al: Effects of the clinical studies. volatile anesthetic sevoflurane on tonic GABA currents Publication: in the mouse striatum during postnatal development. 1) Sumikura H: When was the last time you induced Eur J Neurosci, 2014; 40: 3147-3157. general anesthesia for cesarean section? J Anesth 2015, Feb 18 [Epub ahead of print] 3. Masakazu Hayashida (Professor) We have investigated the influences of single- 6. Yoichiro Kamiyama (Professor Emeritus), Tetsuro nucleotide polymorphisms (SNPs) in a variety of Ohwada (Associate Professor), Koji Watanabe (Assis- pain-related or opioid-related genes on the sensitiv- tant Professor) ity to pain or opioids. We have found that various Our departmental research encompasses a wide SNPs can significantly affect the intensity of postoper- range of topics examining the effect of sevoflurane on ative pain and/or postoperative requirements for pulmonary epithelial cells, the effect of remifentanil on opioids. Our final goal is to develop a simple geno- the cardiovascular system during laparoscopic sur- typing kit to predict individual differences in pain or gery and thermoregulation during anesthesia. opioid sensitivity for tailor-made pain treatment. Publications: Publications: 1) Watanabe K, Iwahara C, Nakayama H, et al: Sevoflurane 1) Yoshida K, Nishizawa D, Ichinomiya T, et al: Prediction suppresses tumor necrosis factor-a-induced inflamma- formulas for individual opioid analgesics requirements tory responses in small airway epithelial cells after based on genetic polymorphism analyses. PLoS One, anoxia/reoxygenation. Br J Anaesth, 2013; 110: 637-645.
440 Juntendo Medical Journal 61(4), 2015
2) Watanabe K, Kashiwagi K, Kamiyama T, et al: High- with sevoflurane and propofol. Mol Med Rep, 2013; 8: dose remifentanil suppresses stress response associated 1643-1648. with pneumoperitoneum during laparoscopic colectomy. 2) Wakabayashi S, Yamaguchi K, Kumakura S, et al: J Anesth, 2014; 28: 334-340. Effects of anesthesia with sevoflurane and propofol on the cytokine/chemokine production at the airway epithelium during esophagectomy. Int J Mol Med, 2014; 7. Hiromasa Mitsuhata (Professor) 34: 137-144. My group is devoted to research on the clinical treatment of anaphylactic shock and the clinical 11. Toshihiro Kikuchi (Senior Associate Professor ) application of kampo in pain medicine. We conduct clinical researches primarily on post- Publication: operative pain management. 1) Mitsuhata H: Effect of Kampo, Japanese herbal medi- Publication: cine, against neuropathic pain. Pain Clinic, 2014; 35: 454-465. 1) Kikuchi T, Tanabe Y, Tanaka H: Local anesthetic infiltration of the wound for postoperative management in pediatric cases. Juntendo Medical Journal, 2014; 60: 8. Ju Mizuno (Professor) 166-169. Our interest is on the hemodynamic changes in the perioperative period. 12. Yutaka Tanabe (Associate Professor) Publication: We conduct clinical research on chronic pain and its 1) Mizuno J, Kato S, Sato T, et al: Pre-anesthesia systolic treatment. We have reported the mechanism of action blood pressure increases with age regardless of sex. J of low-reactive-level light therapy. Anesth, 2012; 26: 496-502. Publication: 1) Tanabe Y, Yuuki N, Nakamura T, et al: LLLT (Low 9. Minoru Narita (Visiting Professor) reactive Level Light Therapy) in Pain clinic. JLTA, We have conducted extensive experimental studies 2014; 13: 7-12. on pain medicine. Publications: 13. Yusuke Sugasawa (Associate Professor) 1) Takada T, Yamashita A, Date A, et al: Changes in the We have studied the effects of anesthetic agents on circadian rhythm of mRNA expression for μ-opioid respiratory inflammatory response. receptors in the periaqueductal gray under a neuro- pathic pain-like state. Synapse, 2013; 67: 216-223. Publication: 2) Odo M, Koh K, Takada T, et al: Changes in circadian 1) Sugasawa Y, Yamaguchi K, Kumakura S, et al: Effects of rhythm for mRNA expression of melatonin 1A and 1B sevoflurane and propofol on pulmonary inflammatory receptors in the hypothalamus under a neuropathic responses during lung resection. J Anesth, 2012; 26: 62-69. pain-like state. Synapse, 2014; 68: 153-158. 14. Izumi Kawagoe (Associate Professor) 10. Keisuke Yamaguchi (Senior Associate Professor) We have investigated postoperative pain manage- Our main interest is on the effects of anesthetics on ment after thoracic surgery. the lung. Publication: Publications: 1) Kawagoe I, Inada E, Ishikawa S, et al: Perioperative 1) Kumakura S, Yamaguchi K, Sugasawa Y, et al: Effects of management of carinal pneumonectomy: a retrospec- nitrous oxide on the production of cytokines and tive review of 13 patients. J Anesth, 2015; 29: 446-449. chemokines by the airway epithelium during anesthesia
441 Juntendo Research Profiles Juntendo Medical Journal 2014. 61(4), 442 Department of Clinical Laboratory Medicine
Our department was founded as the Department of Clinical Pathology by Professor Nozomu Kosakai in 1964. In the field of clinical laboratory medicine, this department has been around longer than any other department at Japanese universities. In 2006, it was renamed the Department of Clinical Laboratory Medicine. This department has 6 faculty and 3 medical doctors who are actively engaged in biomedical research. In addition, postgraduate students and laboratory technicians are working in the lab. Two other faculty members, belonging to affiliated hospitals, help in the education of medical students in a bedside learning program. The main research interests of our members are hematology, clinical chemistry, microbiology and medical informatics. The faculty members also oversee the Central Clinical Laboratory, Juntendo University Medical Hospital. Additionally, we are actively involved in teaching with the School of Medicine as well as graduate (PhD) level teaching. Each year, nearly 10 residents rotate to our department to gain hands-on experience in interpretation and utilization of diagnostic tests. Laboratory medicine covers a wide range of research areas. Strongly-motivated residents, postgraduate students, postdoctoral fellows and doctors are always welcome to join our department. Non-MD students and researchers may be accepted as postgraduate students.
Principal Investigator: Takashi Miida (Professor) pital. He has been conductingclinical and experimen- tal research, and showed the antifungal activities of Professor Miida has been leadingthis department Gentian Violet against gram positive bacteria 4). since 2008. He has a special interest in high-density lipoprotein (HDL) metabolism, and has published a 4. Kazunori Miyake (Associate Professor) number of papers regarding preβ1-HDL, a minor but Dr. Miyake has deep expertise about clinical important HDL subfraction 1). In addition, he recently laboratory medicine, and collaborates with other reported the results of multicenter studies on the research groups using computer-based data mining 5) accuracy and imprecision of direct assays for LDL-C methodology . and HDL-C. These results are expected to promote Publications global standardization of homogenous assays for lipoproteins. 1) Miida T, Hirayama S: Preβ1-HDL: A native lipid-poor Group Leaders and Research Topics HDL, and its potential as a new marker for HDL metab- olism (Chapter 12). In: Komoda T, ed. The HDL Hand- book - Biological Functions and Clinical Implications -. 1. Yoko Tabe (Senior Associate Professor) London (UK), Burlington: San Diego (U.S.A.) : Academ- Dr. Tabe who holds appointment of adjunct asso- ic Press, 2010: 243-259. (Book) ciate professor at the University of Texas, MD 2) Tabe Y, Konopleva M: Advances in understandingthe leukaemia microenvironment. Br J Haematol, 2014; 164: Anderson Cancer, is an experienced hematopatholo- 767-778. (Review article) gist and a professional researcher in the area of 3) Hirayama S, Miida T: Small dense LDL: An emerging leukemia/microenvironment interactions and drug risk factor for cardiovascular disease. Clin Chim Acta, resistance 2). 2012; 414: 215-224. (Review article) 4) Kondo S, Tabe Y, Yamada T, et al: Comparison of anti- 2. Satoshi Hirayama (Associate Professor) fungal activities of Gentian Violet and Povidone-Iodine Dr. Hirayama has mainly worked on the sterol against clinical isolates of Candida species and other yeasts: a framework to establish topical disinfectant activities. markers and lipoprotein subfractions in metabolic Mycopathologia, 2012; 173: 21-25. (Original article) diseases such as dyslipidemia, diabetes and metabolic 5) Miyake M, Miyake N, Kondo S, Tabe Y, Ohsaka A, Miida syndrom 3). T: Seasonal variation in liver function tests: a time- series analysis of outpatient data. Ann Clin Biochem, 3. Shigemi Kondo (Associate Professor) 2009; 46: 377-384. (Original article) Dr. Kondo is the chairperson of the committee of antimicrobial agents, and collaborates with other Please refer to the followingURL for the latest publi- medical staff at Juntendo University Medical Hos- cations: http: //www. juntendo. ac. jp/graduate/laborato ry/labo/byotaikaiseki/k6.html
442 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 443 Department of Esophageal & Gastroenterological Surgery
Principal Investigator: Yoshiaki Kajiyama (Professor 5) Motomi Nasu (Assistant Professor) & Chairman) Research interest: Esophageal adenocarcinoma Research in the Department of Esophageal and We examine the epigenetic alternations in tumor- Gastroenterological Surgery ranges from clinical to related genes. An abundance of cases lets us investigate basic science. We operate on more than 100 cases of the diagnosis and prognosis of rare histological types, esophageal cancer annually and have many clinical such as small-cell carcinoma. We are also studying the specimens for scientific research. The aim of our effectiveness of chemotherapy. research is to achieve discoveries that are really 6) Daisuke Fujiwara (Assistant Professor) beneficial for patients. We have investigated experimental methods for Group Leaders and Research Topics the identification and culture of cancer stem cells 1) Yoshimi Iwanuma (Associate Professor) from esophageal cancer cells using NanoCulture® Group member: Daisuke Fujiwara Plate for 3-dimensional (3D) cell culture, which was This group has experience with the design, designed as a means for experimentally reproducing development, and use of immunodeficient mouse the 3D structures found in the body. human tumor xenograft models, composed of human Publications peripheral blood lymphocytes and an allogeneic 1) Kajiyama Y: The reality and the reliability of esopha- tumor cell line. In addition, we are studying the geal cancer treatment: which will you choose for convalescence of malignant esophageal melanoma yourself? Ann Thorac Cardiovasc Surg, 2009; 15: 211- patients treated surgically in this university. 212. 2) Iwanuma Y, Tomita N, Amano T, et al: Current status of 2) Natsumi Tomita (Associate Professor) primary malignant melanoma of the esophagus: clinical Research Interests: Endoscopy, Laparoscopic Surgery features, pathology, management and prognosis. J Gastroenterol, 2012; 47: 21-28. Group members: Kohei Yoshino, Yuka Hattori 3) Sakai N, Kajiyama Y, Iwanuma Y, et al: Study of abnor- My group investigates connections between prog- mal chromosome regions in esophageal squamous cell nosis and cytokines by analyzing the various cyto- carcinoma by comparative genomic hybridization: rela- kines within the blood serum of esophageal squamous tionship of lymph node metastasis and distant metastasis to selected abnormal regions. Dis Esophagus, 2010; 23: cell carcinoma patients using the BD Cytometric 415-421. Bead Array (CBA) system. 4) Hashimoto T, Kajiyama Y, Tsutsumi-Ishii Y, et al: Cir- culating micrometastases of esophageal cancer detected 3) Noritaka Sakai (Assistant Professor) by carcinoembryonic antigen mRNA reverse transcrip- We conducted an analysis of chromosomal abnor- tase-polymerase chain reaction: clinical implications. malities in squamous cell carcinoma of the esophagus Dis Esophagus, 2008; 21: 690-696. 5) Nasu M, Yoshimura S, Uomori T, et al: The efficacy of (ESCC) using comparative genomic hybridization intraoperative ultrasonography during laparoscopic chol- (CGH). We identified abnormal chromosome regions ecystectomy. Hepatogastroenterology, 2012; 59: 1003- in patients with advanced lymph node metastasis or 1005. distant metastasis. We then correlated these findings 6) Fujiwara D, Kato K, Nohara S, et al: The usefulness of three-dimensional cell culture in induction of cancer with survival. stem cells from esophageal squamous cell carcinoma cell lines. Biochem Biophys Res Commun, 2013; 434: 773- 4) Takashi Hashimoto (Assistant Professor) 778. Topic: Circulating micrometastases of esophageal cancer
443 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 444-445 Department of Breast and Endocrine Surgery (Breast Center)
Principal Investigator: Mitsue Saito (Professor) of breast cancer has not been revealed at all. I am The research in our department encompasses a engaged in studies on epigenetic change for breast wide range of topics on breast cancer. Dr. Nakai is a cancer dependent on stimulation with estrogen. In leader of translational research on triple-negative addition, MMC/MTX treatment for metastatic breast breast cancer and Dr. Tokuda is a leader of trans- cancer is among my interests for clinical work 12). lational research on endocrine and HER2-type breast cancer. Epidemiology and carcinogenesis research 4) Hideo Shimizu (Assistant Professor) will be driven by Dr. Tanabe and others 15), while Our major research interest is to develop prognos- mainly basic research related to the interaction tic and predictive factors for breast cancer; for between cancer cells and stroma or dormancy has example, the application of a 70-gene expression been promoted by Dr. Horimoto. In addition, clinical profile to Japanese breast cancer patients is our research related to the gene expression profile is recent work 14). conducted by Dr. Shimizu and translational research to develop new predictive markers collaborating 5) Emiko Tokuda (Assistant Professor) with Riken is administered by the postgraduate Our major research interest is to clarify the student Dr. Sai supported by Dr. Saito. My strong mechanism of the crosstalk between ER and HER2 personal interest is on supportive care in breast signaling pathway, and we hope to achieve break- cancer treatment, such as bone mineral preservation, throughs regarding the mechanism of drug resistance antiemetics 2)-5), and the development of a QOL related to such crosstalk 13). questionnaire, as well as the management of multidis- ciplinary medical teams 1) 16)-18). Publications 1) Saito M: Faculty development of oncology experts. Group Leaders and Research Topics Juntendo Medical Journal, 2014; 60: 220-223. 2) Saito M, Tsukuda M: Review of palonosetron: Emerg- 1) Katsuya Nakai (Associate Professor) ing data distinguishing it as a novel 5-HT3 receptor My research is focused on triple-negative breast antagonist for chemotherapy-induced nausea and vom- cancer (TNBC). TNBC has a poor prognosis and has iting. Expert Opinion Pharmacother, 2010; 11: 1003- few treatment options. Therefore, a new treatment 1014. 3) Saito M: Review of Palonosetron in the Prevention of strategy is strongly desired. I have been working on Chemotherapy-Induced Nausea and Vomiting. Clinical the drug resistance and methylation of the DNA in Medicine Reviews in Oncology, 2010; 2: 209-220. TNBC. I am investigating epigenetic mechanisms 4) Roila F, Herrstedt J, Aapro M, Gralla RJ, Einhorn LH, such as histone modifications 6) 7). Ballatori E, Bria E, Clark-Snow RA, Espersen BT, Feyer P, Grunberg SM, Hesketh PJ, Jordan K, Kris MG, Maranzano E, Molassiotis A, Morrow G, Olver I, 2) Yoshiya Horimoto (Associate Professor) Rapoport BL, Rittenberg C, Saito M, Tonato M, Warr D: I have dedicated myself to doing real translational Guideline update for MASCC and ESMO in the research 8)-11). My personal research themes are: 1. prevention of chemotherapy- and radiotherapy and radiotherapy-induced nausea and vomiting: results of how in situ nests of breast cancer achieve invasion the Perugia multinational consensus conference. Ann through an interaction with stroma and 2. cancer cell Oncol, 2010; 21: 232-243. dormancy induced by endocrine therapy. 5) Saito M, Aogi K, Sekine I, Yoshizawa H, Yanagita Y, Sakai H, Inoue K, Kitagawa C, Ogura T, Mitsuhashi S: Palonosetron plus dexamethasone versus granisetron 3) Masahiko Tanabe (Associate Professor) plus dexamethasone for prevention of nausea and The epidemiology of breast cancer is well known, vomiting during chemotherapy: a double-blind, double- but the molecular mechanism that connects epidemi- dummy, randomized, comparative phase III trial. Lancet ology and biology associated with the carcinogenesis Oncology, 2009; 10: 115-124.
444 Juntendo Medical Journal 61(4), 2015
6) Alkam Y, Mitomi H, Nakai K, Himuro T, Saito T, combination chemotherapy with mitomycin C and Takahashi M, Arakawa A, Yao T, Saito M: Protein methotrexate for metastatic breast cancer pretreated expression and methylation of DNA repair genes with anthracycline and taxanes. Breast Cancer, 2009; 16: hMLH1, hMSH2, MGMTand BRCA1 and their correla- 301-306. tion with clinicopathological parameters and prognosis 13) Tokuda E, Seino Y, Arakawa A, Saito M, Kasumi F, in basal-like breast cancer. Histopathology, 2013; 63: Hayashi S, Yamaguchi Y: Estrogen receptor-a directly 713-725. regulates sensitivity to paclitaxel in neoadjuvant chemo- 7) Nakai K, Mitomi H, Alkam Y, Arakawa A, Yao T, therapy for breast cancer. Breast Cancer Res Treat, Tokuda E, Saito M, Kasumi F: Predictive value of 2012; 133: 427-436. MGMT, hMLH1, hMSH2 and BRCA1 protein expression 14) Shimizu H, Horimoto Y, Arakawa A, Sonoue H, Kurata for pathological complete response to neoadjuvant M, Kosaka T, Nakai K, Himuro T, Tokuda E, Takahashi chemotherapy in basal-like breast cancer patients. Y, Taira F, Ito M, Abe I, Senuma K, Stork-Sloots L, de Cancer Chemother Pharmacol, 2012; 69: 923-930. Snoo F, Saito M: Application of a 70-gene expression 8) Horimoto Y, Arakawa A, Harada-Shoji N, Sonoue H, profile to Japanese breast cancer patients. Breast Care, Yoshida Y, Himuro T, Igari F, Tokuda E, Mamat O, 2015; 10: 118-122. Tanabe M, Hino O, Saito M: Low FOXA1 expression 15) Takahashi Y, Iwai M, Kawai T, Arakawa A, Ito T, predicts good response to neo-adjuvant chemotherapy Sakurai-Yageta M, Ito A, Goto A, Saito M, Kasumi F, resulting in good outcomes for luminal HER2-negative Murakami Y: Aberrant expression of tumor suppres- breast cancer cases. Br J Cancer, 2015; 112: 345-351. sors CADM1 and 4.1B in invasive lesions of primary 9) Horimoto Y, Arakawa A, Tanabe M, Sonoue H, Igari F, breast cancer. Breast Cancer, 2012; 19: 242-252. Senuma K, Tokuda E, Shimizu H, Kosaka T, Saito M: 16) Inoue K, Nakagami K, Mizutani M, Hozumi Y, Fujiwara Ki67 expression and the effect of neo-adjuvant chemo- Y, Masuda N, Tsukamoto F, Saito M, Miura S, Eguchi K, therapy on luminal HER2-negative breast cancer. BMC Shinkai T, Ando M, Watanabe T, Masuda N, Ohashi Y, Cancer, 2014; 14: 550. Sano M, Noguchi S: Randomized phase III trial of 10) Wang J, Taylor A, Showeil R, Trivedi P, Horimoto Y, trastusumab monotherapy followed by trastuzumab Bagwan I, Ewington L, Lam EW, El-Bahrawy MA: plus docetaxel versus trastuzumab plus docetaxel as Expression profiling and significance of VEGF-A, first-line therapy in patients with HER2-positive metas- VEGFR2, VEGFR3 and related proteins in endometrial tatic breast cancer: the JO17360 Trial Group. Breast carcinoma. Cytokine, 2014; 68: 94-100. Cancer Res Treat, 2010; 119: 127-136. 11) Coombes R, Tat T, Miller ML, Reise JA, Mansi JL, 17) Hirowatari H, Karasawa K, Izawa H, Ito K, Sasai K, Hadjiminas DJ, Shousha S, Elsheikh SE, Lam EW, Furuya T, Ozawa S, Arakawa A, Orihata G, Saito M: Horimoto Y, El-Bahrawy M, Aboagye EO, Contractor Full dose Capecitabine with local radiotherapy is one of KB, Shaw JA, Walker RA, Marconell MH, Palmieri C, the treatment options for inoperable T4 breast cancer. Stebbing J: An open-label study of lapatinib in women Jap J Radiology, 2011; 29: 222-225. with HER-2 negative early breast cancer: the lapatinib 18) Karasawa K, Saito M, Hirowatari H, Izawa H, Furuya T, pre-surgical study. Ann Oncol, 2013; 24: 924-930. Ozawa S, Ito K, Suzuki T, Mitsuhashi N: The role of 12) Tanabe M, Ito Y, Tokudome N, Sugihara T, Miura H, chemoradiotherapy in patients with unresectable T4 Takahashi S, Seto Y, Iwase T, Hatake K: Possible use of breast tumors. Breast Cancer, 2013; 20: 254-261.
445 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 446-447 Department of Cardiovascular Surgery
Principal Investigator: Atsushi Amano (Professor) hospital is a high-volume center for pediatric surgery, The research in our department encompasses a collaborative research with the Department of Pediatric wide range of topics from clinical research to basic Surgery is planned. science. All of our faculty members have a Ph.D. and Publication: focus on a unique research topic. The background of 1) Nakanishi K, Kawasaki S, Takahashi K, Amano A: A our staff is varied, including not only surgeons but new technique for venous unifocalization of the bilateral also cardiologists and experts in basic research, superior vena cava with the Glenn procedure. J Thorac Cardiovasc Surg, 2014; 148: 356-358. giving us a wide perspective for our studies. To promote the enhancement of knowledge, our depart- ment encourages attendance at scientific meetings 3) Terumasa Morita (Associate Professor) and conferences, and defrays all attendance fees MICS has spread worldwide as it reduces the including travel expenses. We also welcome overseas trauma and pain associated with open-chest surgery students. and improves the quality of life of patients. We develop specialized surgical instruments for cardiac surgery to promote less invasive approaches. Group Leaders and Research Topics The initial enthusiasm for MICS has been tempered 1) Taira Yamamoto (Senior Associate Professor) by concerns over reduced surgical exposure in highly We have been investigating the prognosis of complex operations and patient safety. Cardiac patients with a certain risk factor for cardiac surgery, imaging using 3-D CT is an evaluation method with for example, diabetes mellitus (DM) or hepatic dys- high spatial resolution. Our group is a pioneer in function. In particular, we have been investigating the surgical cardiac imaging. cellular mechanisms of DM, and also used basic Publication: science techniques with culture cells or animal 1) Furtado H, Stüdeli T, Sette M, Morita T, Trunk P, experiments to determine the effect of hyperglycemia Freudenthal A, Samset E, Bergsland J, Gersak B: Endo- on the duration of engraftment of transplanted heart clamp balloon visualization and automatic placement or on mitochondrial function. system. Heart Surg Forum, 2010; 13: E205-211. Publications: 1) Li R, Takazawa K, Suzuki H, Hariya A, Yamamoto T, 4) Kenji Kuwaki (Associate Professor) Matsushita S, Hirose H, Amano A: Synergistic effect of My groupʼs main interest is to determine the risk triptolide and tacrolimus on rat cardiac allotransplanta- tion. Jpn Heart J, 2004; 45: 657-665. factors associated with the peri-operative outcome of 2) Tsuruta R, Miyauchi K, Yamamoto T, Dohi S, Tambara patients undergoing cardiac surgery. The identifica- K, Dohi T, Inaba H, Kuwaki K, Daida H, Amano A: Effect tion of high-risk surgical patients using several risk of preoperative hemoglobin A1c levels on long-term score systems is another interest. We have also been outcomes for diabetic patients after off-pump coronary investigating immune reactivity against xenograft of artery bypass grafting. J Cardiol, 2011; 57: 181-186. bio-prosthetic heart valve and elucidated one of the mechanisms that decrease the durability of such 2) Shiori Kawasaki (Associate Professor) valves. Bioprosthetic heart valves from Gal-knockout Our specialty is pediatric cardiac surgery. Our pig might improve this durability in the future. research themes are as follows: 1) surgical treatment of Publications: congenital aortic valve disease, 2) minimally invasive 1) Kuwaki K, Tseng YL, Dor FJ, Shimizu A, Houser SL, cardiac surgery (MICS) in pediatric patients, 3) perio- Sanderson TM, Lancos CJ, Prabharasuth DD, Cheng J, perative management of total cavo-pulmonary connec- Moran K, Hisashi Y, Mueller N, Yamada K, Greenstein tion, and 4) a novel surgical method for a functional JL, Hawley RJ, Patience C, Awwad M, Fishman JA, single ventricle with bilateral superior vena cava. Our Robson SC, Schuurman HJ, Sachs DH, Cooper DK: Heart transplantation in baboons using alpha1,3-galac- group has built a close relationship with the Department tosyltransferase gene-knockout pigs as donors: initial of Pediatrics, not only in clinically but also in terms of experience. Nat Med, 2005; 11: 29-31. research. We promote and conduct joint research with 2) Kuwaki K, Amano A, Inaba H, Yamamoto T, Matsumura pediatrics researchers. Furthermore, because our T, Dohi S, Matsushita S: Predictors of Early and
446 Juntendo Medical Journal 61(4), 2015
Mid-Term Results in Contemporary Aortic Valve K, Inaba H, Amano A: Factors for sac size change of Replacement for Aortic Stenosis. J Card Surg, 2012; 27: abdominal aortic aneurysm after endovascular repair. 139-145. Ann Thorac Cardiovasc Surg, 2014; 20: 1016-1020.
5) Tomoko S.Kato (Associate Professor) 7) Satoshi Matsushita (Associate Professor) I have been working as a heart failure cardiologist My group mainly performs basic research. Our and joined this department in Nov. 2013. My research main interest is regenerative medicine, especially cell interests include hemodynamic evaluation, heart therapy and gene therapy against heart injury. We failure, transplant, mechanical circulatory support, are using cardiac stem cells or adipose-derived stem echocardiograms, and cardiac pathology. I have cells from human and animal tissue conjugated to an published over 120 peer-reviewed publications in this original hydrogel provided by an international field, being assigned as a guideline member of acute collaborator. I believe this basic research with a heart failure by the Japanese Circulation Society, and surgical background offers immediate benefits to am on the Editorial Board of the American Journal of patients. Cardiology. Here at Juntendo University, which is the Publications: largest-volume cardiac surgery center in Japan, I 1) Lee ST, White AJ, Matsushita S, Malliaras K, Steenber- engage in clinical research work such as pre-and gen C, Zhang Y, Li TS, Terrovitis J, Yee K, Simsir S, post-cardiac surgery risk stratification and hemody- Makkar R, Marbán E: Intramyocardial injection of autologous cardiospheres or cardiosphere-derived cells namic evaluation. Since I am a female researcher with preserves function and minimizes adverse ventricular kids, female researchers are very much welcome to remodeling in pigs with heart failure post-myocardial join my team. infarction. J Am Coll Cardiol, 2011; 57: 455-465. Publications: 2) White AJ, Smith RR, Matsushita S, Chakravarty T, Czer LS, Burton K, Schwarz ER, Davis DR, Wang Q, 1) Kato TS, Jiang J, Schulze PC, Jorde U, Uriel N, Kitada S, Reinsmoen NL, Forrester JS, Marbán E, Makkar R: Takayama H, Naka Y, Mancini D, Gillam L, Homma S, Intrinsic cardiac origin of human cardiosphere-derived Farr M: Serial echocardiography using tissue Doppler cells. Eur Heart J, 2013; 34: 68-75. and speckle tracking imaging to monitor right ventricu- lar failure before and after left ventricular assist device surgery. JACC Heart Fail, 2013; 1: 216-222. 8) Kan Kajimoto (Associate Professor) 2) Kato TS, Cheema FH, Yang J, Kawano Y, Takayama H, Lipid disorder plays a central role in the progres- Naka Y, Farr M, Lederer DJ, Baldwin MR, Jin Z, Homma S, Mancini DM, Schulze PC: Preoperative serum albumin sion of arterial sclerotic change. Statins mainly have levels predict 1-year postoperative survival of patients an effect to reduce low-density-lipoprotein choles- undergoing heart transplantation. Circ Heart Fail, 2013; 6: terol (LDL-c), also have anti-inflammatory effects. 785-791. We have elucidated the signal cascade behind these effects and revealed a better clinical outcome. Our 6) Shizuyuki Dohi (Associate Professor) group has also performed clinical research to evaluate Endovascular stenting is now becoming a standard the surgical risk or benefit of treatments using therapy as surgical treatment for aortic aneurysm. statistical techniques. Since I have certifications to perform both thoracic Publications: and abdominal aorta treatments, we have analyzed 1) Kajimoto K, Miyauchi K, Kasai T, Shimada K, Kojima Y, the outcomes of a large number of patients. We also Shimada A, Niinami H, Amano A, Daida H: Short-term assess the morphological indication of stent treat- 20-mg atorvastatin therapy reduces key inflammatory factors including c-Jun N-terminal kinase and dendritic ment. cells and matrix metalloproteinase expression in human Publications: abdominal aortic aneurysmal wall. Atherosclerosis, 2009; 1) Dohi S, Kajimoto K, Miyauchi K, Yamamoto T, Tambara 206: 505-511. K, Inaba H, Kuwaki K, Tamura H, Kojima T, Yokoyama 2) Kajimoto K, Yamamoto T, Amano A: Coronary Artery K, Kurata T, Daida H, Amano A: Comparing outcomes Bypass Revascularization Using Bilateral Internal after off-pump coronary artery bypass versus Thoracic Arteries in Diabetic Patients: A Systematic drug-eluting stent in diabetic patients. J Cardiol, 2012; Review and Meta-Analysis. Ann Thorac Surg, 2015; 99: 59: 195-201. 1097-1104. 2) Tsuyuki Y, Matsushita S, Dohi S, Yamamoto T, Tambara
447 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4), 448-449 Department of General Thoracic Surgery
Principal Investigator: Kenji Suzuki (Professor) Cancer Study Group in 1995. This gold standard is Clinical and basic research on thoracic malignancy going to be revised based on our trial named has been conducted at our department. Our research JCOG0802 (Figure-1). This trial is based on our is based on the third largest number of surgical cases previous trial on radiological early lung cancer 1), and on thoracic malignancy and a detailed database. Our compares lobectomy and sublobar resection for stage division is one of the major institutes presenting data I lung cancer. With regard to sublobar resection, of high quality and quantity, which cannot be segmental resection should be one of the choices for achieved without this detailed database. Our interests the operative mode of surgery. In some cases, are as follows. segmentectomy is technically difficult, so we have 1) Early-stage lung cancer developed innovations in segmentectomy supported 2) Advanced-stage lung cancer by the use of indocyanine green dye 2). 3) Thymic malignancy Publication: 4) Pleural malignancy 2) Oh S, Suzuki K, Miyasaka Y, Matsunaga T, Tsushima Y, 5) Trimodal treatment Takamochi K: New technique for lung segmentectomy using indocyanine green injection. Ann Thorac Surg, 6) Molecular biology 2013; 95: 2188-2190. Publication: 1) Suzuki K, Koike T, Asakawa T, Kusumoto M, Asamura 2) Kazuya Takamochi (Associate Professor) H, Nagai K, et al: A prospective radiological study of thin-section computed tomography to predict pathologi- My group organizes translational research on cal non-invasiveness in peripheral clinical IA lung thoracic malignancies such as lung cancer, thymic cancer (JCOG0201). J Thorac Oncol, 2011; 6: 751-756. tumors, and malignant mesothelioma. Our studies are conducted on specimens stored in a tissue bank, with Group Leaders and Research Topics the approval of the institutional review board of 1) Shiaki Oh (Associate Professor) Juntendo University. We actively pursue collabora- The standard surgical procedure for lung cancer tive research with other departments in Juntendo since 1960 has been major pulmonary resection and University and RIKEN. We have recently reported mediastinal nodal dissection. This strategy was new findings on the etiology of lung carcinoma and a supported by the study conducted by the Lung rational diagnostic algorithm for the identification of
Non－inferiority design PI：Asamura H.
Lobectomy Peripheral Randomize carcinoma, ＜＝2 cm Negative hilar node Segmentectomy
Stratified factors； Institute, Gender, Endpoints： Histology（Ad vs., Non－ad）, Primary：OS Solid or non－solid Secondary：pulmonary function Sample size：1,100
Figure-1 Randomized trial comparing lobectomy and segmentectomy for T1a lung cancer
448 Juntendo Medical Journal 61(4), 2015
ALK rearrangement in lung cancer. N2 alone or the number of node stations involved. Eur J Publications: Cardiothorac Surg, 2014; 46: 86-91. 3) Takamochi K, Oh S, Suzuki K: Differences in EGFR and KRAS mutation spectra in lung adenocarcinoma of 4) Aritoshi Hattori (Assistant Professor) never and heavy smokers. Oncol Lett, 2013; 6: 1207- Recent developments in imaging technology and 1212. the widespread use of thin-section CT have made it 4) Takamochi K, Takeuchi K, Hayashi T, Oh S, Suzuki K: A rational diagnosticalgorithm for the identification of possible to detect small-sized lung cancers. The ALK rearrangement in lung cancer: a comprehensive prognostic significance of a radiological solid compo- study of surgically treated Japanese patients. PLoS One, nent has already been addressed in the literature 7)-11). 2013; 8: e69794. Nonetheless, there are still several discrepancies 5) Takamochi K, Oh S, Matsuoka J, Suzuki K: Clonality status of multifocal lung adenocarcinomas based on the between radiological findings and the degree of mutation patterns of EGFR and K-ras. Lung Cancer, pathological behavior in patients with early-stage 2012; 75: 313-320. lung cancer. Owing to the wide pathological diversity despite the small-sized lesions, understanding the 3) Takeshi Matsunaga (Associate Professor) characteristics and appropriate surgical strategies for Generally, chemoradiotherapy is recommended for these lesions is crucial in current general thoracic patients with cN2 stage IIIA non-small cell lung surgery. Hence, we have intensively attempted to cancer (NSCLC). However, the treatment of stage identify the clinical features of small-sized lung IIIA NSCLC is still very difficult and controversial cancers in Juntendo University. because of the high heterogeneity in the pathological Publications: status and the wide range of overall 5-year survival 7) Hattori A, Suzuki K, Matsunaga T, et al: Is limited rate in these patients. Therefore, stage IIIA NSCLC resection appropriate for radiologically “solid” tumors in should be classified into subgroups and we examined small lung cancers? Ann Thorac Surg, 2012; 94: 212- 215. the number of clinically involved mediastinal lymph 8) Hattori A, Suzuki K, Matsunaga T, et al: What is the node stations and the relationship between the appropriate operative strategy for radiologically solid primary tumor and involved mediastinal nodes. Our tumours in subcentimetre lung cancer patients? Eur J study concluded that clinical mediastinal lymph node Cardiothorac Surg, 2015; 47: 244-249. 9) Hattori A, Suzuki K, Maeyashiki T, et al: The presence status based on the location of the primary tumor and of air bronchogram is a novel predictor of negative nodal involved node is an important preoperative prognos- involvement in radiologically pure-solid lung cancer. tic factor. Thus, this factor should be considered when Eur J Cardiothorac Surg, 2014; 45: 699-702. planning and evaluating clinical trials. Another 10) Hattori A, Suzuki K, Matsunaga T, et al: Visceral pleural invasion is not a significant prognostic factor in patients important finding was that clinical single-station N2 with a part-solid lung cancer. Ann Thorac Surg, 2014; 6) is not always pathological single-station N2 disease . 98: 433-438. Publication: 11) Hattori A, Suzuki K, Matsunaga T, et al: Tumour 6) Matsunaga T, Suzuki K, Takamochi K, Oh S: Time to standardized uptake value on positron emission tomog- refine N2 staging? cN2α and cN2β based on local regional raphy is a novel predictor of adenocarcinoma in situ for involvement provide a more accurate prognosis in c-Stage IA lung cancer patients with a part-solid nodule surgically treated IIIA non-small-cell lung cancer than on thin-section computed tomography scan. Interact Cardiovasc Thorac Surg, 2014; 18: 329-334.
449 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4),450-451 Department of Urology
Principal Investigator: Shigeo Horie (Professor) circulate in the bloodstream. They play an important The research topics in our department are diverse, role in the formation of metastasis,which is,needless ranging from cancer,menʼs health,and geriatrics to to say,the major cause of cancer-related death. hereditary kidney disease (Figure-1). Recently,some research showed that CTCs are not only a prognostic marker but can also be a treatment Research on urological cancer outcome response marker. Reproducible practical methods to It is imperative to establish a patientsʼ database of detect CTCs from a variety of cancers have not been urological cancer for appropriate evaluation and the established yet. We are now striving to devise further improvement of clinical outcomes in our methods to capture CTCs and analyze their genetic department. Recently,we have completed a clinical properties,so that we can unveil a yet-to-be-discov- database for bladder cancer based on more than 1000 ered mechanism of metastasis. patients at Juntendo University Hospital. Using this database,we are now attempting to identify the risk Comprehensive research of ADPKD factors for progression of Japanese patients with Autosomal dominant polycystic kidney disease bladder cancer. We also share this database with five (ADPKD) is the most common hereditary kidney prestigious Korean hospitals (Seoul National,Yonsei, disease. Numerous renal cysts appear bilaterally and Asan,Hyundai,and St. Mary) in order to achieve their number increases in proportion to patient age. international collaboration in this field. As a result,kidney function gradually deteriorates. We are currently performing the genotypic analysis Molecular genetics of circulating tumor cells of ADPKD patients in order to investigate whether Circulating tumor cells (CTCs) are cells that are there is any genetic mutation responsible for disease shed into the vasculature from a primary tumor and progression. We are also determined to find new
Cancer ADPKD
Data base genome research Exosome
Circulating Tumor Cells intestinal bacteria Biomarkers
Stem cell research
autophagy Sarcopenia Frailty QOL
Imaging study biological markers
Men’s health Geriatrics
Figure-1 Scope of research of the department of urology
450 Juntendo Medical Journal 61(4),2015
biomarkers for ADPKD from urine,such as urinary radical cystectomy. Preoperatively,we determine exosome. patients eligible for invasive surgery using the Comprehensive Geriatric Assessment (CGA). It ena- Group Leaders and Research Topics bles us to assess patients with geriatric syndrome. We 1) Akira Tsujimura (Senior Associate Professor) also evaluate the validity and usefulness of this and Shin-ichi Hisasue (Associate Professor) measure,and hope to detect some biological markers Our department is one of the main international for geriatric syndrome in the near future. research centers studying late-onset hypogonadism (LOH) and sexual dysfunction in elderly males. LOH 3) Haruna Kawano (Assistant Professor) is induced by the decrease in testosterone with aging. Newly developed molecular inversion probe (MIP) Recently,LOH has attracted tremendous interest as a technology could allow us to obtain genomic profiles factor deteriorating QOL among middle-aged males. from formalin-fixed paraffin-embedded (FFPE) tis- We are investigating the influence of testosterone on sue even if such samples are old. This technique QOL in males from various perspectives. We have allows us to determine whole-genome copy number revealed that testosterone decrease leads to low QOL, and loss of heterozygosity (LOH) and to analyze key dry mouth,sleep disturbance,anxiety,and lower somatic mutations of cancer. urinary tract symptoms. There are some rare cancers in the urology field, Regarding erectile dysfunction (ED),we discov- such as urachal carcinoma,prostatic sarcoma,neuro- ered the significant causal relationship between silent endocrine-differentiated prostate cancer,adrenal myocardial infarction and ED in diabetic patients. We carcinoma,and malignant pheochromocytoma. The assessed the degree of ED and diabetes in outpatients mechanism of development of those tumors remains using multidetector computed tomography (MDCT). to be elucidated. Hence,there are no established standard treatments for them. To explore new 2) Hiroaki Aoki (Assistant Professor) treatment strategies for these rare cancers,we are Recently,the elderly population has been rising attempting to detect genes responsible for the rapidly. Accordingly,the number of patients with tumorigenesis of these rare cancers using MIP. To urological symptoms has increased. Sarcopenia, unveil the mechanism of development of renal cancer, which is defined as loss of muscle mass and strength we utilize an animal model in cooperation with the with aging,and frailty,is a major geriatric syndrome. Department of Molecular Pathogenesis. The Eker rat There is an urgent need for its definitive care and is a model animal of renal cell carcinoma (RCC). This management. rat has a germline mutation in the tuberous sclerosis We are now creating a protocol with regard to the 2 gene (Tsc2). Heterozygous mutants develop RCCs management of invasive treatments such as operation within one year after birth due to LOH of the and chemotherapy for elderly patients. For this wild-type Tsc2 allele,whereas homozygous mutants purpose,we evaluated patientsʼ muscle mass before die at the embryonic stage. We established embryonic and after treatment. We could clearly demonstrate a stem cells (ESCs) from Eker rats to study the significant inverse correlation between muscle mass mechanism of Tsc2 mutation-associated carcinogene- and predisposition to postoperative sarcopenia after sis.
451 Juntendo Research Profiles Juntendo Medical Journal 2015. 61(4),452 Department of Transfusion Medicine and Stem Cell Regulation
Group Leaders and Research Topics mutant protein function in terms of cell proliferation Marito Araki (Associate Professor), Norio Komastu and differentiation. More recently,we adopted iPS cell (Professor at the Department of Hematology), and technology for further investigation in a more Akimichi Ohsaka (Professor) relevant in vitro model system. We focus on studying Philadelphia chromosome- Other research projects include developing diag- negative myeloproliferative neoplasms (MPNs). We nostic tools for hematological malignancies,under- developed original assay systems for the detection of standing the molecular mechanisms of all-trans JAK2V617F and MPLW515K/L mutations that are retinoic acid (ATRA) -dependent granulocytic dif- frequently found in MPN patients (Morishita S, et al., ferentiation in acute promyloid leukemia cells Leuk Res,2011; 35: 1632-1636,Takei H,et al.,PLoS (Sunami et al.,PLoS One,2013; 8: e57633),and screen- One,2014; 9: e104958). Utilizing these assays,we ing diagnostic markers for lymphoma by cap analysis investigated clinical features associated with gene of gene expression (CAGE) in collaboration with mutations in Japanese MPN patients and found that RIKEN. “triple-negative”MPN patients are substantially younger than those harboring JAK2, MPL,or CALR Publications mutation in Japan (Shirane S, et al.,Haematologica, 1) Morishita S,Takahashi K,Araki M,Hironaka Y,Sunami 2015; 100: e46-48,Edahiro Y, et al.,Int J Hematol, Y,Edahiro Y,Tsutsui M,Ohsaka A,Tsuneda S,Komatsu N: Melting curve analysis after T allele enrichment 2014; 99: 625-634). This strongly suggests that“tri- (MelcaTle) as a highly sensitive and reliable method for ple-negative”Japanese MPN patients have a genetic detection of JAK2V617F mutation. PLoS One,2015; 10: background that promotes MPN development,which e0122003. we are currently investigating by next-generation 2) Shirane S,Araki M,Morishita S,Edahiro Y,Takei H,Yoo Y,Choi M,Sunami Y,Hironaka Y,Noguchi M,Koike M, sequencing. Noda N,Ohsaka A,Komatsu N: JAK2,CALR,and MPL JAK2,MPL,or CALR mutant proteins found in mutation spectrum in Japanese patients with myelopro- MPN have been shown to activate cytokine-receptor liferative neoplasms. Haematologica,2015; 100: e46-48. signaling pathways constitutively,which results in 3) Takei H,Morishita S,Araki M,Edahiro Y,Sunami Y, Hironaka Y,Noda N,Sekiguchi Y,Tsuneda S,Ohsaka A, MPN patientsʼ cells being hypersensitive to cytokines, Komatsu N: Detection of MPLW515L/K mutations and particularly erythropoietin (EPO) and thrombopoie- determination of allele frequencies with a single-tube tin (TPO). Understanding the molecular mechanisms PCR assay. PLoS One,2014; 9: e104958. by which mutant proteins transform cells is crucial 4) Edahiro Y,Morishita S,Takahashi K,Hironaka Y, Yahata Y,Sunami Y,Shirane S,Tsutsui M,Noguchi M, for the development of better MPN diagnosis and Koike M,Imai K,Kirito K,Noda N,Sekiguchi Y,Tsuneda treatment. Since we previously established a multi- S,Ohsaka A,Araki M,Komatsu N: JAK2V617F muta- potent hematopoietic cell line,UT-7,and its sublines, tion status and allele burden in classical Ph-negative such as UT-7/GM,UT-7/EPO,and UT-7/TPO myeloproliferative neoplasms in Japan. Int J Hematol, 2014; 99: 625-634. (Komatsu N, et al.,Cancer Res,1991; 51: 341-348, 5) Sunami Y,Araki M,Hironaka Y,Morishita S,Kobayashi Komatsu N, et al.,Blood,1993; 82: 456-464,Komatsu M,Liew EL,Edahiro Y,Tsutsui M,Ohsaka A,Komatsu N, et al.,Blood,1996; 87: 4552-4560),that respond to N: Inhibition of the NAD-dependent protein deacety- various cytokines such as EPO and TPO,we utilize lase SIRT2 induces granulocytic differentiation in human leukemia cells. PLoS One,2013; 8: e57633. these cell lines to study JAK2,MPL,and CALR
452 Publication List
Juntendo Medical Journal 2015. 61(4), 453-465
Publications from Juntendo University Graduate School of Medicine, 2013 [2/6]
cell proliferation and spontaneous behaviors Department of Psychiatry and Behavioral Science in the rat. Brain Res, 2013; 1491: 88-97. 〈Original Articles〉 ＊ 8）MatsuzakaH, Maeshima H, Kida S, Kurita H, 1）FujishiroH, Iseki E, Kasanuki K, Chiba Y, Ota Shimano T, Nakano Y, Baba H, Suzuki T, Arai K, Murayama N, Sato K: A follow up study of H: Gender differences in serum testosterone non-demented patients with primary visual and cortisol in patients with major depressive cortical hypometabolism: prodromal demen- disorder compared with controls. Int J tia with Lewy bodies. J Neurol Sci, 2013; 334: Psychiatry Med, 2013; 46: 203-221. 48-54. 9）Shibata N, Nagata T, Shinagawa S, Ohnuma 2）Nagata T, Shinagawa S, Kuerban B, Shibata T, Shimazaki H, Komatsu M, Kuerban B, N, Ohnuma T, Arai H, Nakayama K, Yamada Tomson K, Nakayama K, Yamada H, Arai H: H: Age-Related Association between Apoli- Genetic association between APOA1 and poprotein E ε4 and Cognitive Function in APOD polymorphisms and Alzheimerʼs dis- Japanese Patients with Alzheimerʼs Disease. ease in a Japanese population. J Neural Dement Geriatr Cogn Dis Extra, 2013; 3: Transm, 2013; 120: 1599-1603. 66-73. ＊10）Namekawa Y, Baba H, Maeshima H, Nakano ＊ 3）Toda A, Tagata Y, Nakada T, Komatsu M, Y, Satomura E, Takebayashi N, Nomoto H, Shibata N, Arai H: Changes in Mini-Mental Suzuki T, Arai H: Heterogeneity of elderly State Examination score in Alzheimerʼs dis- depression: increased risk of Alzheimerʼs dis- ease patients after stopping habitual drink- ease and Aβ protein metabolism. Prog Neuro- ing. Psychogeriatrics, 2013; 13: 94-98. psychopharmacol Biol Psychiatry, 2013; 43: 4）Tanaka S, Maezawa Y, Kirino E: Classifica- 203-208. tion of schizophrenia patients and healthy 11）Murayama N, Iseki E, Tagaya H, Ota K, controls using p100 event-related potentials Kasanuki K, Fujishiro H, Arai H, Sato K: for visual processing. Neuropsychobiology, Intelligence or years of education: which is 2013; 68: 71-78. better correlated with memory function in 5）FujishiroH, Iseki E, Nakamura S, Kasanuki K, normal elderly Japanese subjects? Psycho- Chiba Y, Ota K, Murayama N, Sato K: De- geriatrics, 2013; 13: 9-16. mentia with Lewy bodies: early diagnostic 12）Ohnuma T, Takebayashi Y, Higashiyama R, challenges. Psychogeriatrics, 2013; 13: 128- Shibata N, Arai H: Low-dose lamotrigine 138. augmentation therapy improves residual 6）Kasanuki K, Iseki E, Nishida Y, Fujishiro H, symptoms in treatment-resistant schizophre- Chiba Y, Sato K, Arai H: Effectiveness of nia: a report of five cases. Asia Pac Psychia- ramelteon for treatment of visual hallucina- try, 2013; 5: 336-343. tions in dementia with Lewy bodies: a report 13）KuritaH, Maeshima H, Kida S, Matsuzaka H, of 4 cases. J Clin Psychopharmacol, 2013; 33: Shimano T, Nakano Y, Baba H, Suzuki T, Arai 581-583. H: Serum dehydroepiandrosterone (DHEA) ＊ 7）Nakamura K, Ito M, Liu Y, Seki T, Suzuki T, and DHEA-sulfate (S) levels in medicated Arai H: Effects of single and repeated patients with major depressive disorder electroconvulsive stimulation on hippocampal compared with controls. J Affect Disord, 2013; 146: 205-212. An asterisk (＊) denotes doctoral works by Japanese students. 14）Usui C, Hatta K, Aratani S, Yagishita N, A dugger (†)denotes doctoral works by non-Japanese students.
453 Publication List, 2013
Nishioka K, Kanazawa T, Itoh K, Yamano Y, of stroke among Japanese: the Circulatory Nakamura H, Nakajima T, Nishioka K: The Risk in Communities Study (CIRCS). J Japanese version of the modified ACR Stroke Cerebrovasc Dis, 2013; 22: 1046-1055. preliminary diagnostic criteria for fibromyal- 2）FurukawaS, Saito I, Yamamoto S, Miyake T, gia and the fibromyalgia symptom scale: Ueda T, Niiya T, Torisu M, Kumagi T, Sakai reliability and validity. Mod Rheumatol, 2013; T, Minami H, Miyaoka H, Sakurai S, Matsuura 23: 846-850. B, Onji M, Tanigawa T: Nocturnal intermit- 15）HattaK, Takebayashi H, Sudo Y, Katayama S, tent hypoxia as an associated risk factor for Kasuya M, Shirai Y, Morikawa F, Nakase R, microalbuminuria in Japanese patients with Nakamura M, Ito S, Kuga H, Nakamura M, type 2 diabetes mellitus. Eur J Endocrinol, Ohnuma T, Usui C, Nakamura H, Hirata T, 2013; 169: 239-246. Sawa Y; JAST study group: The possibility 3）SaitoI, Yamagishi K, Chei CL, Cui R, Ohira T, that requiring high-dose olanzapine cannot Kitamura A, Kiyama M, Imano H, Okada T, be explained by pharmacokinetics in the Kato T, Hitsumoto S, Ishikawa Y, Tanigawa treatment of acute-phase schizophrenia. T, Iso H: Total and high molecular weight Psychiatry Res, 2013; 210: 396-401. adiponectin levels and risk of cardiovascular ＊16）UtumiY, Iseki E, Arai H: Three patients with disease in individuals with high blood glucose mood disorders showing catatonia and fronto- levels. Atherosclerosis, 2013; 229: 222-227. temporal lobes atrophy. Psychogeriatrics, 4）Chei CL, Yamagishi K, Kitamura A, Kiyama 2013; 13: 254-259. M, Imano H, Ohira T, Cui R, Tanigawa T, 17）MaeshimaH, Baba H, Nakano Y, Satomura E, Sankai T, Ishikawa Y, Sato S, Hitsumoto S, Iso Namekawa Y, Takebayashi N, Nomoto H, H; CIRCS Investigators: High-density lipo- Suzuki T, Mimura M, Arai H: Time course protein subclasses and risk of stroke and its for memory dysfunction in early-life and subtypes in Japanese population: the Circula- late-life major depression: a longitudinal tory Risk in Communities Study. Stroke, 2013; study from the Juntendo University Mood 44: 327-333. Disorder Project. J Affect Disord, 2013; 151: 5）TabaraY, Igase M, Saito I, Nishida W, Kohara 66-70. K, Sakurai S, Kawamura R, Okada Y, Hitsumoto S, Onuma H, Nagai T, Takata Y, Department of Forensic Medicine Uetani E, Takita R, Kido T, Ochi N, Osawa H, 〈Original Articles〉 Tanigawa T, Miki T: Association of hemato- 1）Nakanishi H, Shojo H, Ohmori T, Hara M, logical parameters with insulin resistance, Takada A, Adachi N, Saito K: Identification insulin sensitivity, and asymptomatic cere- of feces by detection of Bacteroides genes. brovascular damage: the J-SHIP and Toon Forensic Sci Int Genet, 2013; 7: 176-179. Health Study. Clin Hemorheol Microcirc, 2）Kajihara H, Tachiyama Y, Hirose T, Takada 2013; 55: 297-311. A, Saito K, Murai T, Yasui W: Eosinophilic 6）Yuasa M, Ukawa S, Ikeno T, Kawabata T: coronary periarteritis (vasospastic angina Multi-level, cross-sectional study on social and sudden death), a new type of coronary capital with health outcomes among Japanese arteritis: report of seven autopsy cases and a elderly dwelling at rural areas. Australas J review of the literature. Virchows Arch, 2013; Ageing, 2013; doi: 10.1111/ajag.12024. 462: 239-248. 7）Ukawa S, Araki A, Kanazawa A, Yuasa M, Kishi R: The relationship between atopic Department of Public Health dermatitis and indoor environmental factors: 〈Original Articles〉 a cross-sectional study among Japanese 1）Shimizu Y, Imano H, Ohira T, Kitamura A, elementary school children. Int Arch Occup Kiyama M, Okada T, Ishikawa Y, Shimamoto Environ Health, 2013; 86: 777-787. T, Yamagishi K, Tanigawa T, Iso H; CIRCS 8）Hoshi T, Yuasa M, Yang S, Kurimori S, Investigators: Alkaline phosphatase and risk Sakurai N, Fujiwara Y: Causal relationships
454 Juntendo Medical Journal 61(4), 2015
between survival rates, dietary and lifestyle 13: 125. habits, socioeconomic status and physical, 2）Katayama Y, Baba T, Sekine M, Fukuda M, mental and social health in elderly urban Hiramatsu K: Beta-hemolysin promotes skin dwellers in Japan: A chronological study. colonization by Staphylococcus aureus. J Health, 2013; 5: 1303-1312. Bacteriol, 2013; 195: 1194-1203. 9）Yuasa M, Yamaguchi Y, Imada M: Contribu- Department of Hospital Administration tion of the Japan International Cooperation Agency health-related projects to health 〈Original Articles〉 system strengthening. BMC Int Health Hum ＊ 1）Suzuki S, Kobayashi H, Ogawa T: Implant Rights, 2013; 13: 39. stability change and osseointegration speed 10）Aung MN, Yuasa M, Lorga T, Moolphate S, of immediately loaded photofunctionalized Fukuda H, Kitajima T, Yokokawa H, Mine- implants. Implant Dent, 2013; 22: 481-490. matsu K, Tanimura S, Hiratsuka Y, Ono K, ＊ 2）山口静子，雪下岳彦，丸井英二：医療サービス Naunboonruang P, Thinuan P, Kawai S, Suya 活動における顧客評価に関する研究：患者満 Y, Chumvicharana S, Marui E: Evidence- 足度調査と患者の意見．順天堂醫事雑誌， based new service package vs. routine ser- 2013；59：49-58． vice package for smoking cessation to pre- ＊ 3）本多ゆみえ，李 慶湖，小林弘幸：本邦におけ vent high risk patients from cardiovascular る救急領域の医療訴訟の実態と分析．日救急 diseases (CVD): study protocol for random- 医会誌，2013；24：847-856． ized controlled trial. Trials, 2013; 14: 419. Department of Emergency and Disaster Medicine 11）IkedaA, Iso H, Sasazuki S, Inoue M, Tsugane S; JPHC Study Group: The combination of 〈Original Articles〉 Helicobacter pylori- and cytotoxin-associ- 1）Iba T, Aihara K, Watanabe S, Yanagawa Y, ated gene-A seropositivity in relation to the Takemoto M, Yamada A, Yang D: Recombi- risk of myocardial infarction in middle-aged nant thrombomodulin improves the visceral Japanese: The Japan Public Health Cen- microcirculation by attenuating the leuko- ter-based study. Atherosclerosis, 2013; 230: cyte-endothelial interaction in a rat LPS 67-72. model. Tromb Res, 2013; 131: 295-299. 12）Ikeda A, Kawachi I, Iso H, Iwasaki M, Inoue 2）Iba T, Aihara K, Watanabe S, Yanagawa Y, M, Tsugane S: Social support and cancer Yamada A, Koichiro N, Ohsaka A: Factor Xa incidence and mortality: the JPHC study inhibitor attenuates leukocyte adhesion and cohort II. Cancer Causes Control, 2013; 24: thrombus formation in an experimental 847-860. mouse model of the metabolic syndrome. 13）Tamakoshi A, Ikeda A, Fujino Y, Tamakoshi Cardiovasc Ther, 2013; 31: 280-284. K, Iso H; JACC Study Group: Multiple roles 3）Gando S, Saitoh D, Ishikura H, Ueyama M, and all-cause mortality: the Japan Collabora- Otomo Y, Oda S, Kushimoto S, Tanjoh K, tive Cohort Study. Eur J Public Health, 2013; Mayumi T, Ikeda T, Iba T, Eguchi Y, 23: 158-164. Okamoto K, Ogura H, Koseki K, Sakamoto Y, ＊14）善福正夫，湯浅資之：看護系女子短大新入生 Takayama Y, Shirai K, Takasu O, Inoue Y, の主観的健康度の変化−入試形態および志望 Mashiko K, Tsubota T, Endo S: A random- の動機の違いによる比較．学校保健研究， ized, controlled, multicenter trial of the effects 2013；55：214-219． of antithrombin on disseminated intravascu- lar coagulation in patients with sepsis. Crit Department of Medical Education Care, 2013; 17: R297. 〈Original Articles〉 4）Yanagawa Y, Yoshihara T, Kato H, Iba T, 1）Takeda Y, Morio K, Snell L, Otaki J, Taka- Tanaka H: Significance of urinary inconti- hashi M, Kai I: Characteristic profiles among nence, age, and consciousness level on arrival students and junior doctors with specific among patients with stroke. J Emerg Trauma career preferences. BMC Med Educ, 2013; Shock, 2013; 6: 83-86.
455 Publication List, 2013
5）Yanagawa Y, Aihara K, Watanabe S, Take- distress syndrome by the Berlin definition. moto M, Naito T, Iba T, Tanaka H: Whole Crit Care, 2013; 17: R132. body CT for a patient with sepsis. World 13）Endo T, Kushimoto S, Yamanouchi S, Saka- Academy of Science, Engineering and Tech- moto T, Ishikura H, Kitazawa Y, Taira Y, nology, 2013; 7: 1789-1792. Okuchi K, Tagami T, Watanabe A, Yama- 6）YanagawaY, Sakamoto T: Characteristics of guchi J, Yoshikawa K, Sugita M, Kase Y, patients that experience cardiopulmonary Kanemura T, Takahashi H, Kuroki Y, Izu- arrest following aortic dissection and aneur- mino H, Rinka H, Seo R, Takatori M, Kaneko ysm. J Emerg Trauma Shock, 2013; 6: 159- T, Nakamura T, Irahara T, Saito N; PiCCO 163. Pulmonary Edema Study Group: Limitations 7）Yanagawa Y: Significance of urinary inconti- of global end-diastolic volume index as a nence, age, and consciousness level on arrival parameter of cardiac preload in the early among patients with stroke, “Beyond the phase of severe sepsis. J Intensive Care, 2013; Abstract”. Uro Today, October 28, 2013 1: 11. 8）Yanagawa Y, Tomoki Nakamori T, Ishikura 〈Reviews〉 K, Ishii F, Yamaguchi E, Kouzu S, Saruta M, 1）Iba T, Nagaoka I, Boulat M: The anticoagu- Kitakawara S, Aoki M, Ohta M, Kogasaka N, lant therapy for sepsis-associated dissemi- Takekawa R, Koido Y: Disaster drill for a nated intravascular coagulation. Thromb Res, huge Nankai Trough Earthquake and the 2013; 131: 383-389. construction of a medical staging care unit on 2）Iba T, Hashiguchi N, Nagaoka I, Tabe Y, a navy destroyer in Japan. EMS World, Murai M: Neutrophil cell-death in response November 27, 2013. to infection and its relation to coagulation. J ＊ 9）OmoriK, Sato S, Sumi Y, Inoue Y, Okamoto K, Intensive Care, 2013; 1: 13. Uzura M, Tanaka H: The Analysis of efficacy 3）Iba T: Harmonized guidance for DIC from for AutoPulseTMsystem in flying helicopter. the ISTH and the current status of anticoagu- Resuscitation, 2013; 84: 1045-1050. lant therapy in Japan. J Thromb Haemost, 10）YamakawaK, Ogura H, Fujimi S, Morikawa 2013; 11: 2076-2078. M, Ogawa Y, Mohri T, Nakamori Y, Inoue University Research Institute for Diseases of Old Y, Kuwagata Y, Tanaka H, Hamasaki T, Age Shimazu T: Recombinant human soluble thrombomodulin in sepsis-induced dissemi- 〈Original Articles〉 nated intravascular coagulation: a multicen- 1）Nonomura K, Yamaguchi Y, Hamachi M, ter propensity score analysis. Intensive Care Koike M, Uchiyama Y, Nakazato K, Mochi- Med, 2013; 39: 644-652. zuki A, Sakaue-Sawano A, Miyawaki A, ＊11）Takemoto M, Okamoto K, Oode Y, Sumi Y, Yoshida H, Kuida K, Miura M: Local apopto- Inoue Y, Matsuda S, Tanaka H: Business sis modulates early mammalian brain devel- Impact Analysis to Prioritize Nursing Opera- opment through the elimination of morpho- tions in Intensive Care Unit. Juntendo Medi- gen-producing cells. Dev Cell, 2013; 27: cal Journal, 2013: 59: 65-70. 621-634. 12）Kushimoto S, Endo T, Yamanouchi S, Saka- 2）Abe H, Uchida T, Hara A, Mizukami H, moto T, Ishikura H, Kitazawa Y, Taira Y, Komiya K, Koike M, Shigihara N, Toyofuku Y, Okuchi K, Tagami T, Watanabe A, Yama- Ogihara T, Uchiyama Y, Yagihashi S, Fujitani guchi J, Yoshikawa K, Sugita M, Kase Y, Y, Watada H: Exendin-4 improves beta cell Kanemura T, Takahashi H, Kuroki Y, Izu- function in autophagy-deficient beta cells. mino H, Rinka H, Seo R, Takatori M, Kaneko Endocrinology, 2013; 154: 4512-4524. T, Nakamura T, Irahara T, Saito N; PiCCO ＊ 3）Okura H, Kobayashi T, Koike M, Ohsawa M, Pulmonary Edema Study Group: Relation- Zhang D, Arai H, Uchiyama Y, Hino O: ship between extravascular lung water and Tuberin activates and controls the distribu- severity categories of acute respiratory tion of Rac1 via association with p62 and
456 Juntendo Medical Journal 61(4), 2015
ubiquitin through the mTORC1 signaling Autophagy, 2013; 9: 403-409. pathway. Int J Oncol, 2013; 43: 447-456. 12）Fujiwara Y, Kikuchi H, Aizawa S, Furuta A, 4）AdachiT, Takahara K, Taneo J, Uchiyama Y, Hatanaka Y, Konya C, Uchida K, Wada K, Inaba K: Particle size of latex beads dictates Kabuta T: Direct uptake and degradation of IL-1β production mechanism. PLoS One, DNA by lysosomes. Autophagy, 2013; 9: 2013; 8: e68499. 1167-1171. 5）KoikeM, Tanida I, Nanao T, Tada N, Iwata J, 13）Douet V, Kerever A, Arikawa-Hirasawa E, Ueno T, Kominami E, Uchiyama Y: Enrich- Mercier F: Fractone-heparan sulfates medi- ment of GABARAP relative to LC3 in the ate FGF-2 stimulation of cell proliferation in axonal intial segments of neurons. PLoS One, the adult subventricular zone. Cell Prolif, 2013; 8: e63568. 2013; 46: 137-145. 6）MatsuiH, Sato F, Sato S, Koike M, Taruno Y, 14）Nakazawa N, Miyahara K, Okawada M, Saiki S, Funayama M, Ito H, Taniguchi Y, Yamataka A, Suzuki R, Akazawa C, Tomi- Uemura N, Toyoda A, Sakaki Y, Takeda S, kawa-Ichikawa N, Arikawa-Hirasawa E: Uchiyama Y, Hattori N, Takahashi R: ATP Laminin-1 promotes enteric nervous system 13A2 deficiency induces a decrease in cathe- development in mouse embryo. Pediatr Surg psin D activity, fingerprint-like inclusion Int, 2013; 29: 1205-1208. body formation, and selective degeneration of 15）Ogaki K, Li Y, Takanashi M, Ishikawa K, dopaminergic neurons. FEBS Lett, 2013; 587: Kobayashi T, Nonaka T, Hasegawa M, Kishi 1316-1325. M, Yoshino H, Funayama M, Tsukamoto T, ＊ 7）Ohkouchi S, Shibata M, Sasaki M, Koike M, Shioya K, Yokochi M, Imai H, Sasaki R, Safig P, Peters C, Nagata S, Uchiyama Y: Kokubo Y, Kuzuhara S, Motoi Y, Tomiyama Biogenesis and proteolytic processing of H, Hattori N: Analyses of the MAPT, PGRN, lysosomal DNase II. PLoS One, 2013; 8: and C9orf72 mutations in Japanese patients e59148. with FTLD, PSP, and CBS. Parkinsonism 8）Furuta A, Wakabayashi K, Haratake J, Relat Disord, 2013; 19: 15-20. Kikuchi H, Kabuta T, Mori F, Tokonami F, 16）Itokawa K, Sekine T, Funayama M, Tomi- Katsumi Y, Tanioka F, Uchiyama Y, Nishino I, yama H, Fukui M, Yamamoto T, Tamura N, Wada K: Lysosomal storage and advanced Matsuda H, Hattori N, Araki N: A case of senescence in the brain of LAMP-2-deficient α-synuclein gene duplication presenting with Danon disease. Acta Neuropathol, 2013; 125: head-shaking movements. Mov Disord, 2013; 459-461. 28: 384-387. 9）Koike M, Shibata M, Ezaki J, Peters C, Saftig 17）Riku Y, Ikeuchi T, Yoshino H, Mimuro M, P, Kominami E, Uchiyama Y: Differences in Mano K, Goto Y, Hattori N, Sobue G, Yoshida expression patterns of cathepsin C/dipep- M: Extensive aggregation of α-synuclein and tidyl peptidase I in normal, pathological and tau in juvenile-onset neuroaxonal dystrophy: aged mouse central nervous systems. Eur J an autopsied individual with a novel mutation Neurosci, 2013; 37: 816-830. in the PLA2G6 gene-splicing site. Acta 10）Hayakawa N, Shiozaki M, Shibata M, Koike Neuropathol Commun, 2013; 1: 12. M, Uchiyama Y, Matsuura N, Gotow T: 〈Books〉 Resveratrol affects undifferentiated and dif- 1）Uchiyama Y, Kominami E: Autophagy regu- ferentiated PC12 cells differently, particularly lates lipid droplet formation and adipogenesis. with respect to possible differences in mito- In: Valenzuela R, ed. Lipid Metabolism. chondrial and autophagic functions. Eur J Cell Rijeka, Croatia: InTech, 2013: 149-162. Biol, 2013; 92: 30-43. Department of Cell Biology and Neuroscience 11）Fujiwara Y, Furuta A, Kikuchi H, Aizawa S, Hatanaka Y, Konya C, Uchida K, Yoshimura 〈Original Articles〉 A, Tamai Y, Wada K, Kabuta T: Discovery of 1）Hayakawa N, Shiozaki M, Shibata M, Koike a novel type of autophagy targeting RNA. M, Uchiyama Y, Matsuura N, Gotow T:
457 Publication List, 2013
Resveratrol affects undifferentiated and dif- 621-634. ferentiated PC12 cells differently, particularly 9）MaekawaF, Sakurai M, Yamashita Y, Tanaka with respect to possible differences in mito- K, Haraguchi S, Yamamoto K, Tsutui K, chondrial and autophagic functions. Eur J Cell Yoshioka H, Murakami S, Tadano R, Goto T, Biol, 2013; 92: 30-43. Shiraishi J, Tomonari K, Oka T, Ohara K, 2）Koike M, Shibata M, Ezaki J, Peters C, Saftig Maeda T, Bungo T, Tsudzuki M, Ohki-Hama- P, Kominami E, Uchiyama Y: Differences in zaki H: A genetically female brain is required expression patterns of cathepsin C/dipep- for a regular reproductive cycle in chicken tidyl peptidase I in normal, pathological and brain chimeras. Nat Commun, 2013; 4: 1372. aged mouse central nervous system. Eur J 10）Ichimura Y, Waguri S, Sou YS, Kageyama S, Neurosci, 2013; 37: 816-830 Hasegawa J, Ishimura R, Saito T, Yang Y, 3）Ohkouchi S, Shibata M, Sasaki M, Koike M, Kouno T, Fukutomi T, Hoshii T, Hirao A, Saftig P, Peters C, Nagata S, Uchiyama Y: Takagi K, Mizushima T, Motohashi H, Lee Biogenesis and proteolytic processing of MS, Yoshimori T, Tanaka K, Yamamoto M, lysosomal DNase II. PLoS One, 2013; 8: Komatsu M: Phosphorylation of p62 activates e59148. the Keap1-Nrf2 pathway during selective 4）MatsuiH, Sato F, Sato S, Koike M, Taruno Y, autophagy. Mol Cell, 2013; 51: 618-631. Saiki S, Funayama M, Ito H, Taniguchi Y, Department of Neurology Uemura N, Toyoda A, Sakaki Y, Takeda S, Uchiyama Y, Hattori N, Takahashi R: ATP- 〈Original Articles〉 13A2 deficiency induces a decrease in cathe- 1）FuseA, Yamashiro K, Oji Y, Furuya T, Noda psin D activity, fingerprint-like inclusion K, Hattori N, Okuma Y: Reversible focal body formation, and selective degeneration of cerebral cortical lesions in a patient with heat dopaminergic neurons. FEBS Lett, 2013; 587: stroke. Intern Med, 2013; 52: 377-380. 1316-1325. 2）Hatano T, Kubo S, Niijima-Ishii Y, Hattori N, 5）KoikeM, Tanida I, Nanao T, Tada N, Iwata J, Sugita Y: Levodopa-responsive Parkinson- Ueno T, Kominami E, Uchiyama Y: Enrich- ism following bilateral putaminal hemor- ment of GABARAP relative to LC3 in the rhages. Parkinsonism Relat Disord, 2013; 19: axonal initial segments of neurons. PLoS One, 477-479. 2013; 8: e63568. 3）Heckman MG, Soto-Ortolaza AI, Aasly JO, 6）Okura H, Kobayashi T, Koike M, Ohsawa M, Abahuni N, Annesi G, Bacon JA, Bardien S, Zhang D, Arai H, Uchiyama Y, Hino O: Bozi M, Brice A, Brighina L, Carr J, Chart- Tuberin activates and controls the distribu- ier-Harlin MC, Dardiotis E, Dickson DW, tion of Rac1 via association with p62 and Diehl NN, Elbaz A, Ferrarese C, Fiske B, ubiquitin through the mTORC1 signaling Gibson JM, Gibson R, Hadjigeorgiou GM, pathway. Int J Oncol, 2013; 43: 447-456. Hattori N, Ioannidis JP, Boczarska-Jedynak 7）Abe H, Uchida T, Hara A, Mizukami H, M, Jasinska-Myga B, Jeon BS, Kim YJ, Klein Komiya K, Koike M, Shigihara N, Toyofuku Y, C, Kruger R, Kyratzi E, Lesage S, Lin CH, Ogihara T, Uchiyama Y, Yagihashi S, Fujitani Lynch T, Maraganore DM, Mellick GD, Y, Watada H: Exendin-4 improves beta cell Mutez E, Nilsson C, Opala G, Park SS, Pet- function in autophagy-deficient beta cells. rucci S, Puschmann A, Quattrone A, Sharma Endocrinology, 2013; 154: 4512-4524. M, Silburn PA, Sohn YH, Stefanis L, Tadic V, 8）Nonomura K, Yamaguchi Y, Hamachi M, Theuns J, Tomiyama H, Uitti RJ, Valente EM, Koike M, Uchiyama Y, Nakazato K, Mochi- Van Broeckhoven C, van de Loo S, Vassilatis zuki A, Sakaue-Sawano A, Miyawaki A, DK, Vilariño-Güell C, White LR, Wirdefeldt K, Yoshida H, Kuida K, Miura M: Local apopto- Wszolek ZK, Wu RM, Hentati F, Farrer MJ, sis modulates early mammalian brain devel- Ross OA; on behalf of the Genetic Epidemiol- opment through the elimination of morpho- ogy of Parkinsonʼs Disease (GEO-PD) Con- gen-producing cells. Dev Cell, 2013; 27: sortium: Population-specific frequencies for
458 Juntendo Medical Journal 61(4), 2015
LRRK2 susceptibility variants in the Genetic hallucinations manifested as the initial symp- Epidemiology of Parkinsonʼs Disease (GEO- tom in a patient with neurosyphilis. Psychoso- PD) Consortium. Mov Disord, 2013; 28: matics, 2013; 54: 284-285. 1740-1744. 12）KambeT, Takahashi Y, Furukawa Y: A mild 4）HiranoK, Fukae J, Hieda S, Fujimaki M, Ishii form of adult-onset, opsoclonus-myoclonus H, Tsuboi Y, Kawamura M, Arai H, Hattori N: syndrome associated with antiglutamate Eosinophilic meningitis caused by primary receptor antibodies. JAMA Neurol, 2013; 70: angiitis of the central nervous system. Intern 654-655. Med, 2013; 52: 1393-1396. 13）KumazawaA, Mita N, Hirasawa M, Adachi T, 5）Hiwatani Y, Sakata M, Miwa H: Ultrasonog- Suzuki H, Shafeghat N, Kulkarni AB, Miko- raphy of the diaphragm in amyotrophic shiba K, Inoue T, Ohshima T: Cyclin-depend- lateral sclerosis: clinical significance in as- ent kinase 5 is required for normal cerebellar sessment of respiratory functions. Amyo- development. Mol Cell Neurosci, 2013; 52: troph Lateral Scler Frontotemporal Degener, 97-105. 2013; 14: 127-131. 14）Kuroki T, Ueno Y, Takeda I, Kambe T, 6）Homma H, Yoritaka A, Hattori N, Kobaya- Nishioka K, Shimura H, Itoh M, Hattori N, kawa T, Ikeda K: Clinical application of a Urabe T: Recurrent embolic strokes associ- card-type odor identification test to olfactory ated with vertical atlantoaxial subluxation in assessment in Parkinsonʼs disease. Auris a patient with rheumatoid arthritis: a case Nasus Larynx, 2013; 40: 173-176. report and review of literature. J Stroke 7）Hoshino Y, Ueno Y, Shimura H, Kambe T, Cerebrovasc Dis, 2013; 22: e676-681. Miyamoto N, Watanabe M, Hattori N, Urabe 15）LiY, Sekine T, Funayama M, Li L, Yoshino H, T: Marchiafava-Bignami disease mimics Nishioka K, Tomiyama H, Hattori N: Clinico- motor neuron disease: case report. BMC genetic study of GBA mutations in patients Neurol, 2013; 13: 208. with familial Parkinsonʼ s disease. Neurobiol 8）Itokawa K, Sekine T, Funayama M, Tomi- Aging, 2014; 35: 935. e3-8. yama H, Fukui M, Yamamoto T, Tamura N, 16）MatsuiH, Sato F, Sato S, Koike M, Taruno Y, Matsuda H, Hattori N, Araki N: A case of Saiki S, Funayama M, Ito H, Taniguchi Y, α-synuclein gene duplication presenting with Uemura N, Toyoda A, Sakaki Y, Takeda S, head-shaking movements. Mov Disord, 2013; Uchiyama Y, Hattori N, Takahashi R: ATP- 28: 384-387. 13A2 deficiency induces a decrease in cathe- 9）Kamagata K, Motoi Y, Tomiyama H, Abe O, psin D activity, fingerprint-like inclusion Ito K, Shimoji K, Suzuki M, Hori M, Nakanishi body formation, and selective degeneration of A, Sano T, Kuwatsuru R, Sasai K, Aoki S, dopaminergic neurons. FEBS Lett, 2013; 587: Hattori N: Relationship between cognitive 1316-1325. impairment and white-matter alteration in 17）Mitome-Mishima Y, Miyamoto N, Tanaka R, Parkinsonʼs disease with dementia: tract- Oishi H, Arai H, Hattori N, Urabe T: Differen- based spatial statistics and tract-specific ces in phosphodiesterase 3A and 3B expres- analysis. Eur Radiol, 2013; 23: 1946-1955. sion after ischemic insult. Neurosci Res, 2013; 10）KamagataK, Tomiyama H, Motoi Y, Kano M, 75: 340-348. Abe O, Ito K, Shimoji K, Suzuki M, Hori M, 18）MiyajimaM, Nakajima M, Motoi Y, Moriya M, Nakanishi A, Kuwatsuru R, Sasai K, Aoki S, Sugano H, Ogino I, Nakamura E, Tada N, Hattori N: Diffusional kurtosis imaging of Kunichika M, Arai H: Leucine-rich α2-glyco- cingulate fibers in Parkinson disease: com- protein is a novel biomarker of neurodegener- parison with conventional diffusion tensor ative disease in human cerebrospinal fluid imaging. Magn Reson Imaging, 2013; 31: and causes neurodegeneration in mouse 1501-1506. cerebral cortex. PLoS One, 2013; 8: e74453. 11）Kambe T, Shimura H, Ueno Y, Nishioka K, 19）MiyajimaM, Nakajima M, Ogino I, Miyata H, Tanaka R, Hattori N, Urabe T: Vivid visual Motoi Y, Arai H: Soluble amyloid precursor
459 Publication List, 2013
protein α in the cerebrospinal fluid as a biliary cirrhosis. J Clin Neurosci, 2013; 20: diagnostic and prognostic biomarker for 1799-1801. idiopathic normal pressure hydrocephalus. 28）Murata KY, Miwa H, Kondo T: Myelin-asso- Eur J Neurol, 2013; 20: 236-242. ciated glycoprotein-related neuropathy asso- 20）Miyakawa S, Ogino M, Funabe S, Uchino A, ciated with psoriasis: a case report. J Med Shimo Y, Hattori N, Ichinoe M, Mikami T, Case Rep, 2013; 7: 4. Saegusa M, Nishiyama K, Mori H, Mizuno Y, 29）Nakajima A, Ueno Y, Shimura H, Kambe T, Murayama S, Mochizuki H: Lewy body pa- Nishioka K, Hattori N, Urabe T: Acute thology in a patient with a homozygous transient freezing of gait in a patient with Parkin deletion. Mov Disord, 2013; 28: 388- posterior reversible encephalopathy syn- 391. drome. BMC Neurol, 2013; 13: 79. 21）MiyamotoN, Maki T, Pham LD, Hayakawa K, 30）Nakamura R, Atsuta N, Watanabe H, Hira- Seo JH, Mandeville ET, Mandeville JB, Kim kawa A, Watanabe H, Ito M, Senda J, Katsuno KW, Lo EH, Arai K: Oxidative stress inter- M, Tanaka F, Izumi Y, Morita M, Ogaki K, feres with white matter renewal after pro- Taniguchi A, Aiba I, Mizoguchi K, Okamoto longed cerebral hypoperfusion in mice. K, Hasegawa K, Aoki M, Kawata A, Abe K, Stroke, 2013; 44: 3516-3521. Oda M, Konagaya M, Imai T, Nakagawa M, 22）MiyamotoN, Pham LD, Hayakawa K, Matsu- Tsuji S, Kaji R, Nakano I, Sobue G: Neck zaki T, Seo JH, Magnain C, Ayata C, Kim KW, weakness is a potent prognostic factor in Boas D, Lo EH, Arai K: Age-related decline sporadic amyotrophic lateral sclerosis in oligodendrogenesis retards white matter patients. J Neurol Neurosurg Psychiatry, repair in mice. Stroke, 2013; 44: 2573-2578. 2013; 84: 1365-1371. 23）Miyamoto N, Tanaka Y, Ueno Y, Kawamura 31）Nakayama S, Hatano T, Kubo SI, Mori A, M, Shimada Y, Tanaka R, Hattori N, Urabe T: Hattori N, Yamada Y, Ogasawara M, Tamura Demographic, clinical, and radiologic predic- N, Takasaki Y: Leukoencephalopathy associ- tors of neurologic deterioration in patients ated with low-dose oral methotrexate. Neu- with acute ischemic stroke. J Stroke Cerebro- rology and Clinical Neuroscience, 2013; 1: vasc Dis, 2013; 22: 205-210. 128-129. 24）Mizuno Y, Kondo T; Japanese Istradefylline 32）Nakayama S, Kamagata K, Sano T, Shimada Study Group: Adenosine A2A receptor Y, Tanaka Y, Fukui T, Urabe T, Aoki S, antagonist istradefylline reduces daily OFF Hattori N, Motoi Y: Verbal dysflucency as a time in Parkinsonʼs disease. Mov Disord, 2013; consequence of basal ganglia infarction with 28: 1138-1141. selective involvement of dorsolateral prefron- 25）MizunoY, Nomoto M, Kondo T, Hasegawa K, tal fiber tract. J Neurol, 2013; 260: 2427-2429. Murata M, Takeuchi M, Ikeda J, Tomida T, 33）Nishioka K, Tanaka R, Tsutsumi S, Shimura Hattori N, on behalf of the Rotigotine Trial H, Oji Y, Saeki H, Yasumoto Y, Ito M, Hattori Group: Transdermal rotigotine in early- N, Urabe T: Longitudinally extensive trans- stage Parkinsonʼs disease: A randomized, verse myelitis with intramedullary metasta- double-blind, placebo-controlled trial. Mov sis of small-cell lung carcinoma: an autopsy Disord, 2013; 28: 1447-1450. case report. Case Rep Neurol Med, 2013; 26）MoriA, Hira K, Hatano T, Okuma Y, Kubo S, 2013: 305670. Hirano K, Ohno K, Noda K, Suzuki H, Ohsawa 34）Ogaki K, Li Y, Takanashi M, Ishikawa K, I, Hattori N: Bilateral facial nerve palsy due Kobayashi T, Nonaka T, Hasegawa M, Kishi to otitis media associated with myeloperoxi- M, Yoshino H, Funayama M, Tsukamoto T, dase-antineutrophil cytoplasmic antibody. Shioya K, Yokochi M, Imai H, Sasaki R, Am J Med Sci, 2013; 346: 240-243. Kokubo Y, Kuzuhara S, Motoi Y, Tomiyama 27）Murata KY, Ishiguchi H, Ando R, Miwa H, H, Hattori N: Analyses of the MAPT, PGRN, Kondo T: Chronic inflammatory demyelinat- and C9orf72 mutations in Japanese patients ing polyneuropathy associated with primary with FTLD, PSP, and CBS. Parkinsonism
460 Juntendo Medical Journal 61(4), 2015
Relat Disord, 2013; 19: 15-20. Miyamoto N, Yamashiro K, Tanaka R, Hattori 35）OjiY, Hatano T, Kubo SI, Mori A, Nakazato T, N, Urabe T: Aging, aortic arch calcification, Inui A, Hattori N: Cerebellar ataxia and the and multiple brain infarcts are associated “hot cross bun”signin association with human with aortogenic brain embolism. Cerebrovasc immunodeficiency virus infection. Neurology Dis, 2013; 35: 282-290. and Clinical Neuroscience, 2013; 1: 127. 44）Shiota S, Takekawa H, Matsumoto SE, 36）Oji Y, Noda K, Tokugawa J, Yamashiro K, Takeda K, Nurwidya F, Yoshioka Y, Taka- Hattori N, Okuma Y: Spontaneous spinal sub- hashi F, Hattori N, Tabira T, Mochizuki H, arachnoid hemorrhage after severe cough- Takahashi K: Chronic intermittent hypo- ing: a case report. J Med Case Rep, 2013; 7: xia/reoxygenation facilitate amyloid-β gener- 274. ation in mice. J Alzheimers Dis, 2013; 37: 37）Okuzumi A, Ueno Y, Shimada Y, Tanaka Y, 325-333. Miyamoto N, Yamashiro K, Tanaka R, Hattori 45）SoejimaN, Ohyagi Y, Nakamura N, Himeno E, N, Urabe T: Impact of low-density lipopro- Iinuma KM, Sakae N, Yamasaki R, Tabira T, tein to high-density lipoprotein ratio on aortic Murakami K, Irie K, Kinoshita N, LaFerla FM, arch atherosclerosis in unexplained stroke. J Kiyohara Y, Iwaki T, Kira JI: Intracellular Neurol Sci, 2013; 326: 83-88. accumulation of toxic turn amyloid-β is 38）Riku Y, Ikeuchi T, Yoshino H, Mimuro M, associated with endoplasmic reticulum stress Mano K, Goto Y, Hattori N, Sobue G, Yoshida in Alzheimerʼs disease. Curr Alzheimer Res, M: Extensive aggregation of α-synuclein and 2013; 10: 11-20. tau in juvenile-onset neuroaxonal dystrophy: 46）Takanashi M, Shimo Y, Hatano T, Oyama G, an autopsied individual with a novel mutation Hattori N: Efficacy and safety of a once-daily in the PLA2G6 gene-spicing site. Acta Neuro- extended-release formulation of pramipexole pathol Commun, 2013; 1: 12. switched from an immediate-release formula- 39）Schapira AH, McDermott MP, Barone P, tion in patients with advanced Parkinsonʼs Comella CL, Albrecht S, Hsu HH, Massey DH, disease: results from an open-label study. Mizuno Y, Poewe W, Rascol O, Marek K: Drug Res (Stuttg), 2013; 63: 639-643. Pramipexole in patients with early Parkinsonʼs 47）Tanaka R, Ueno Y, Miyamoto N, Yamashiro disease (PROUD): a randomised delayed- K, Tanaka Y, Shimura H, Hattori N, Urabe T: start trial. Lancet Neurol, 2013; 12: 747-755. Impact of diabetes and prediabetes on the 40）SeoJH, Miyamoto N, Hayakawa K, Pham LD, short-term prognosis in patients with acute Maki T, Ayata C, Kim KW, Lo EH, Arai K: ischemic stroke. J Neurol Sci, 2013; 332: Oligodendrocyte precursors induce early 45-50. blood-brain barrier opening after white mat- 48）Tanaka Y, Ueno Y, Miyamoto N, Shimada Y, ter injury. J Clin Invest, 2013; 123: 782-786. Tanaka R, Hattori N, Urabe T: Patent 41）ShibataN, Motoi Y, Tomiyama H, Ohnuma T, foramen ovale and atrial septal aneurysm can Kuerban B, Tomson K, Komatsu M, Shima- cause ischemic stroke in patients with zaki H, Hattori N, Arai H: Lack of Genetic antiphospholipid syndrome. J Neurol, 2013; Associations of PPAR-γ and PGC-1α with 260: 189-196. Alzheimerʼs Disease and Parkinsonʼs Disease 49）Teramoto S, Shimura H, Tanaka R, Shimada with Dementia. Dement Geriatr Cogn Dis Y, Miyamoto N, Arai H, Urabe T, Hattori N: Extra, 2013; 3: 161-167. Human-derived physiological heat shock 42）Shimada Y, Noda K, Hirayama T, Fukae J, protein 27 complex protects brain after focal Yamashiro K, Furuya T, Hattori N, Okuma Y: cerebral ischemia in mice. PLoS One, 2013; 8: Wernicke encephalopathy developed long e66001. after gastric surgery: report of two cases and 50）Tomimatsu K, Matsumoto SE, Tanaka H, review of the literature. Juntendo Medical Yamashita M, Nakanishi H, Teruya K, Journal, 2013; 59: 194-198. Kazuno S, Kinjo T, Hamasaki T, Kusumoto K, 43）Shimada Y, Ueno Y, Tanaka Y, Okuzumi A, Kabayama S, Katakura Y, Shirahata S: A
461 Publication List, 2013
rapid screening and production method using Hardwick A, Sporrer JM, Zeilman P, Foote a novel mammalian cell display to isolate KD, Bowers D, Ward HE, Sanchez-Ramos J, human monoclonal antibodies. Biochem Bio- Okun MS: Differential and better response to phys Res Commun, 2013; 441: 59-64. deep brain stimulation of chorea compared to 51）Tomiyama H: Intronic C9orf72 mutation dystonia in Huntingtonʼs disease. Stereotact expanding on neurodegenerative disorders Funct Neurosurg, 2013; 91: 129-133. and other diseases (Editorial). J Neurol 60）WadaK, Kano M, Machida Y, Hattori N, Miwa Disord Stroke, 2013; 1: 1009. H: Posterior reversible encephalopathy syn- 52）Tong J, Meyer JH, Furukawa Y, Boileau I, drome induced after blood transfusion for Chang LJ, Wilson AA, Houle S, Kish SJ: severe anemia. Case Report in Clinical Distribution of monoamine oxidase proteins Medicine, 2013; 2: 332-334. in human brain: implications for brain imag- 61）Wu Z, Sawada T, Shiba K, Liu S, Kanao T, ing studies. J Cereb Blood Flow Metab, 2013; Takahashi R, Hattori N, Imai Y, Lu B: 33: 863-871. Tricornered/NDR kinase signaling mediates 53）Ueno Y, Watanabe M, Tanaka Y, Kuroki T, PINK1-directed mitochondrial quality con- Kurita N, Shimura H, Hattori N, Urabe T: trol and tissue maintenance. Genes Dev, 2013; Temporal changes of ulcerative plaques in 27: 157-162. the aortic arch in recurrent stroke patients. J 62）Yamashiro K, Tanaka R, Li Y, Mikasa M, Stroke Cerebrovasc Dis, 2013; 22: e597-601. Hattori N: A TREX1 mutation causing cere- 54）Umemura A, Oka Y, Tsuboi R, Fujii S, bral vasculopathy in a patient with familial Shimizu Y, Horiba M, Okita K, Matsukawa N, chilblain lupus. J Neurol, 2013; 260: 2653- Yamada K: Factors affecting early decline of 2655. executive function after subthalamic nucleus ＊63）YatomiY, Tanaka R, Shimura H, Miyamoto N, stimulation in Parkinsonʼs disease. Advance Yamashiro K, Takanashi M, Urabe T, Hattori in Parkinsonʼs Disease, 2013; 2: 75-80. N: Chronic brain ischemia induces the 55）Umemura A, Oka Y, Yamada K, Oyama G, expression of glial glutamate transporter Shimo Y, Hattori N: Validity of single tract EAAT2 in subcortical white matter. Neuro- microelectrode recording in subthalamic nu- science, 2013; 244: 113-121. cleus stimulation. Neurol Med Chir (Tokyo), 64）YoneyamaM, Mitoma H, Okuma Y: Acceler- 2013; 53: 821-827. ometry-based long-term monitoring of 56）UtsumiH, Okuma Y, Kano O, Suzuki Y, Iijima movement disorders: from diurnal gait be- M, Tomimitsu H, Hashida H, Kubo S, Suzuki havior to nocturnal bed mobility. J Mech Med M, Nanri K, Matsumura M, Murakami H, Biol, 2013; 13: 1350041. Hattori N; Tokyo Parkinsonʼs Disease Study 65）Yoritaka A, Shimo Y, Takanashi M, Fukae J, Group: Evaluation of the efficacy of prami- Hatano T, Nakahara T, Miyamato N, Urabe T, pexole for treating levodopa-induced dyski- Mori H, Hattori N: Motor and non-motor nesia in patients with Parkinsonʼ s disease. symptoms of 1453 patients with Parkinsonʼs Intern Med, 2013; 52: 325-332. disease: prevalence and risks. Parkinsonism 57）VaishnavRA, Liu R, Chapman J, Roberts AM, Relat Disord, 2013; 19: 725-731. Ye H, Rebolledo-Mendez JD, Tabira T, 66）Yoritaka A, Takanashi M, Hirayama M, Fitzpatrick AH, Achiron A, Running MP, Nakahara T, Ohta S, Hattori N: Pilot study of
Friedland RP: Aquaporin 4 molecular mimi- H2 therapy in Parkinsonʼs disease: a random- cry and implications for neuromyelitis optica. ized double-blind placebo-controlled trial. J Neuroimmunol, 2013; 260: 92-98. Mov Disord, 2013; 28: 836-839. 58）van der Bliek AM, Shen Q, Kawajiri S: 67）YoshidaM, Hori M, Yokoyama K, Fukunaga I, Mechanisms of mitochondrial fission and Suzuki M, Kamagata K, Shimoji K, Nakanishi fusion. Cold Spring Harb Perspect Biol, 2013; A, Hattori N, Masutani Y, Aoki S: Diffusional 5: a011072. kurtosis imaging of normal-appearing white 59）Velez-Lago FM, Thompson A, Oyama G, matter in multiple sclerosis: preliminary
462 Juntendo Medical Journal 61(4), 2015
clinical experience. Jpn J Radiol, 2013; 31: 〈Books〉 50-55. 1）FurukawaY, Guttman M, Nakamura S, Kish 68）Chihara N, Aranami T, Oki S, Matsuoka T, SJ: Dopa-responsive dystonia. In: Frucht Nakamura M, Kishida H, Yokoyama K, SJ, ed: Current Clinical Neurology: Move- Kuroiwa Y, Hattori N, Okamoto T, Murata M, ment Disorder Emergencies: Diagnosis and Toda T, Miyake S, Yamamura T: Plasma- Treatment (2nd ed). New York: Springer blasts as migratory IgG-producing cells in (Humana Press), 2013: 319-340. the pathogenesis of neuromyelitis optica. Department of Neurophysiology PLoS One, 2013; 8: e83036. 69）Bernal-Pacheco O, Oyama G, Briton A, 〈Original Articles〉 Singleton AB, Fernandez HH, Rodriguez RL, 1）Hirose S, Watanabe T, Wada H, Imai Y, Malaty IA, Okun MS: A Novel DYT-5 Machida T, Shirouzu I, Miyashita Y, Konishi Mutation with Phenotypic Variability within S: Functional relevance of micromodules in a Colombian Family. Tremor Other Hyperki- the human association cortex delineated with net Mov (N Y), 2013 Oct 10; 3. pii: tre-03- high-resolution FMRI. Cereb Cortex, 2013; 138-4462-2. 23: 2863-2871. 〈Reviews〉 2）Watanabe T, Hirose S, Wada H, Imai Y, 1）Furukawa Y, Kish SJ: Tyrosine hydroxylase Machida T, Shirouzu I, Konishi S, Miyashita deficiency. GeneReviews (National Center for Y, Masuda N: A pairwise maximum entropy Biotechnology Information [Internet: http: model accurately describes resting-state //www.ncbi.nlm.nih.gov/books/NBK1437/], human brain networks. Nat Commun, 2013; NIH). 4: 1370. 2）KuboS, Hatano T, Takanashi M, Hattori N: 3）Hirose S, Kimura HM, Jimura K, Kunimatsu Can parkin be a target for future treatment A, Abe O, Ohtomo K, Miyashita Y, Konishi S: of Parkinsonʼs disease? Expert Opin Ther Dissociable temporo-parietal memory net- Targets, 2013; 17: 1133-1144. works revealed by functional connectivity 3）Kubo S, Hattori N: Neurodegenerative dis- during episodic retrieval. PLoS One, 2013; 8: ease: Can synucleinopathy and tauopathy be e71210. identified during life? Nat Rev Neurol, 2013; 4）KumanoH, Uka T: Responses to random dot 9: 426-427. motion reveal prevalence of pattern-motion 4）Kubo S, Hatano T, Oyama G, Hattori N: selectivity in area MT. J Neurosci, 2013; 33: Standard strategies for diagnosis and treat- 15161-15170. ment of patients newly diagnosed Parkinson 5）Mitani A, Sasaki R, Oizumi M, Uka T: A disease. JAPAN. Neurol Clin Pract, 2013; 3: leaky-integrator model as a control mecha- 469-474. nism underlying flexible decision making 5）Maki T, Liang AC, Miyamoto N, Lo EH, Arai during task switching. PLoS One, 2013; 8: K: Mechanisms of oligodendrocyte regenera- e59670. tion from ventricular-subventricular zone- 6）Yamazaki Y, Uka T, Shimizu H, Miyahira A, derived progenitor cells in white matter Sakai T, Marui E: Japanese medical studentsʼ diseases. Front Cell Neurosci, 2013; 7: 275. interest in basic sciences: a questionnaire 6）Miyamoto N, Pham LD, Seo JH, Kim KW, Lo survey of a medical school in Japan. Tohoku J EH, Arai K: Crosstalk between cerebral Exp Med, 2013; 229: 129-136. endothelium and oligodendrocyte. Cell Mol 7）Shimoji K, Abe O, Uka T, Yasmin H, Life Sci, 2014; 71: 1055-1066. Kamagata K, Asahi K, Hori M, Nakanishi A, 7）OkunMS, Oyama G: Mechanism of action for Tamura Y, Watada H, Kawamori R, Aoki S: deep brain stimulation and electrical neuro- White matter alteration in metabolic syn- network modulation (ENM). Rinsho Shinkei- drome: diffusion tensor analysis. Diabetes gaku, 2013; 53: 691-694. Care, 2013; 36: 696-700. 8）Miyamoto K, Osada T, Adachi Y, Matsui T,
463 Publication List, 2013
Kimura HM, MiyashitaY: Functional differ- 7）Matsui A, Toshida H, Honda R, Seto T, Ohta entiation of memory retrieval network in T, Murakami A: Preoperative and postopera- macaque posterior parietal cortex. Neuron, tive optical coherence tomography findings in 2013; 77: 787-799. patients with rhegmatogenous retinal detach- 9）Nakazato T: Dual modes of extracellular ment involving the macular region. ISRN serotonin changes in the rat ventral striatum Ophthalmol, 2013; 2013: 426867. modulate adaptation to a social stress envi- ＊ 8）Sasaki H, Takano T, Murakami A: Direct ronment, studied with wireless voltammetry. endoscopic probing for congenital lacrimal Exp Brain Res, 2013; 230: 583-596. duct obstruction. Clin Experiment Ophthal- 〈Reviews〉 mol, 2013; 41: 729-734. 1）Kumano H, Uka T: Neuronal mechanisms of 9）Taniuchi S, Hirakata A, Itoh Y, Hirota K, visual perceptual learning. Behav Brain Res, Inoue M: Vitrectomy with or without inter- 2013; 249: 75-80. nal limiting membrane peeling for each stage of myopic traction maculopathy. Retina, 2013; Department of Ophthalmology 33: 2018-2025. 〈Original Articles〉 10）Tano T, Ono K, Hiratsuka Y, Otani K, 1）Hamanaka T, Omata T, Sekimoto S, Sekiguchi M, Konno S, Kikuchi S, Onishi Y, Sugiyama T, Fujikoshi Y: Bleb analysis by Takegami M, Yamada M, Fukuhara S, using anterior segment optical coherence Murakami A: Prevalence of pterygium in a tomography in two different methods of population in Northern Japan: the Locomo- trabeculectomy. Invest Ophthalmol Vis Sci, tive Syndrome and Health Outcome in Aizu 2013; 54: 6536-6541. Cohort Study. Acta Ophthalmol, 2013; 91: ＊ 2）Nakatani S, Murakami A: Descemet strip- e232-236. ping automated endothelial keratoplasty for ＊11）Usui A, Mochizuki Y, Iida A, Miyauchi E, bullous keratopathy after anterior-posterior Satoh S, Sock E, Nakauchi H, Aburatani H, radial keratotomy. Cornea, 2013; 32: 1179- Murakami A, Wegner M, Watanabe S: The 1182. early retinal progenitor-expressed gene 3）Toshida H, Ohta T, Suto C, Murakami A: Sox11 regulates the timing of the differentia- Effect of subconjunctival lacrimal gland tion of retinal cells. Development, 2013; 140: transplantation in a rabbit dry eye model. 740-750. Cornea, 2013; 32 (Suppl 1): S46-51. 12）Usui A, Iwagawa T, Mochizuki Y, Iida A, 4）Toshida H, Honda R, Matsui A, Matsuzaki Y, Wegner M, Murakami A, Watanabe S: Shimizu Y, Seto T, Ohta T, Murakami A: Expression of Sox4 and Sox11 is regulated by Double-glide method using Cathereep ® pro- multiple mechanisms during retinal develop- tective sheet as a substitute in Descemetʼ s ment. FEBS Lett, 2013; 587: 358-363. stripping automated endothelial keratoplasty. 13）Iwamoto S, Asada Y, Ebihara N, Hori K, ISRN Transplantation, 2013; 2013: 713153. Okayama Y, Kashiwakura J, Watanabe Y, 5）HiratsukaY, Yamada M, Akune Y, Murakami Kawasaki S, Yokoi N, Inatomi T, Shinomiya K, A, Okada AA, Yamashita H, Ohashi Y, Murakami A, Matsuda A: Interaction be- Yamagishi N, Tamura H, Fukuhara S, Takura tween conjunctival epithelial cells and mast T; Eye Care Comparative Effectiveness cells induces CCL2 expression and piecemeal Research Team (ECCERT): Cost-utility degranulation in mast cells. Invest Ophthal- analysis of cataract surgery in Japan: a mol Vis Sci, 2013; 54: 2465-2473. probabilistic Markov modeling study. Jpn J 14）Matsuzaki Y, Toshida H, Ohta T, Murakami Ophthalmol, 2013; 57: 391-401. A: A case of atypical mucin balls wearing 6）HondaM, Asai T, Oku N, Araki Y, Tanaka M, extended wear of silicone hydrogel lens for Ebihara N: Liposomes and nanotechnology in therapeutic use. Case Rep Ophthalmol Med, drug development: focus on ocular targets. 2013; 2013: 167854. Int J Nanomedicine, 2013; 8: 495-503. 15）Shimizu Y, Toshida H, Honda R, Matsui A,
464 Juntendo Medical Journal 61(4), 2015
Ohta T, Asada Y, Murakami A: Prevalence of gelatinous drop-like dystrophy. Invest Oph- drug resistance and culture-positive rate thalmol Vis Sci, 2013; 54: 5701-5711. among microorganisms isolated from patients 21）Fukuda K, Ishida W, Tanaka H, Harada Y, with ocular infections over a 4-year period. Matsuda A, Ebihara N, Fukushima A: Alar- Clin Ophthalmol, 2013; 7: 695-702. mins from corneal epithelial cells up-regulate 16）LeeH, Kashiwakura J, Matsuda A, Watanabe CCL11 and VCAM-1 in corneal fibroblasts. Y, Sakamoto-Sasaki T, Matsumoto K, Hashi- Invest Ophthalmol Vis Sci, 2013; 54: 5817- moto N, Saito S, Ohmori K, Nagaoka M, 5823. Tokuhashi Y, Ra C, Okayama Y: Activation 22）Nakashima-Kaneda K, Matsuda A, Mizu- of human synovial mast cells from rheuma- guchi H, Sasaki-Sakamoto T, Saito H, Ra C, toid arthritis or osteoarthritis patients in Okayama Y: Regulation of IgE-dependent response to aggregated IgG through FcγRI zinc release from human mast cells. Int Arch and FcγRII. Arthritis Rheum, 2013; 65: Allergy Immunol, 2013; 161 (Suppl 2): 109-119. 44-51. 17）Kamijo S, Takeda H, Tokura T, Suzuki M, 23）Aung MN, Yuasa M, Lorga T, Moolphate S, Inui K, Hara M, Matsuda H, Matsuda A, Fukuda H, Kitajima T, Yokokawa H, Mine- Oboki K, Ohno T, Saito H, Nakae S, Sudo K, matsu K, Tanimura S, Hiratsuka Y, Ono K, Suto H, Ichikawa S, Ogawa H, Okumura K, Naunboonruang P, Thinuan P, Kawai S, Suya Takai T: IL-33-mediated innate response Y, Chumvicharana S, Marui E: Evidence- and adaptive immune cells contribute to based new service package vs. routine maximum responses of protease allergen- service package for smoking cessation to induced allergic airway inflammation. J prevent high risk patients from cardiovascu- Immunol, 2013; 190: 4489-4499. lar diseases (CVD): study protocol for ran- 18）Nakanishi W, Yamaguchi S, Matsuda A, domized controlled trial. Trials, 2013; 14: 419. Suzukawa M, Shibui A, Nambu A, Kondo K, 24）Kumakawa T, Otsubo K, Hiratsuka Y, Oka- Suto H, Saito H, Matsumoto K,Yamasoba T, moto E: Evaluation of demand for medical Nakae S: IL-33, but not IL-25, is crucial for care services, quality of health care and the development of house dust mite anti- health policy by using electronic claims data. gen-induced allergic rhinitis. PLoS One, 2013; Journal of the National Institute of Public 8: e78099. Health, 2013; 62: 3-12. 19）FukuharaS, Wakita T, Yamada M, Hiratsuka 25）Okamoto E, Hiratsuka Y, Otsubo K, Kuma- Y, Green J, Oki K: Development of a short kawa T: Evaluation of the health check up version of the visual function questionnaire and guidance program through linkage with using item-response theory. PLoS One, 2013; health insurance claims. Journal of the 8: e73084. National Institute of Public Health, 2013; 62: 20）KitazawaK, Kawasaki S, Shinomiya K, Aoi K, 13-30. Matsuda A, Funaki T, Yamasaki K, Nakatsu- 〈Books〉 kasa M, Ebihara N, Murakami A, Hamuro J, 1）Ohta T: Y-fixation technique. In: Agarwal Kinoshita S: Establishment of a human cor- A, ed. Glued IOL. New Delhi: Jaypee Broth- neal epithelial cell line lacking the functional ers Med Pub, 2013: 88-96. TACSTD2 gene as an in vitro model for
465 (Revised July 30, 2015) Instructions to Authors Authors are requested to follow these instructions carefully. Manuscripts not prepared accordingly will not be accepted.
General 3. The Juntendo Medical Journal accepts 1. Juntendo Medical Journal is the official manuscripts over a wide area of medical journal of the Juntendo Medical Society, topics from members of the Juntendo and aims to introduce achievements in the Medical Society as well as other resear- fields of basic and clinical medicine. chers in Japan and around the world Articles contributed are classified into the involved in medical science. following categories: original articles, re- 4. Rules governing the length of papers views, lecture notes, and case reports. including figures and tables are as follows. The articles must be written in English. It Original Articles and lecture notes should is the authorsʼ responsibility to have their not exceed 10 printed pages. Case reports manuscripts checked by a native speaker, should not exceed 4 printed pages. and a certificate of the check should be Review articles should not exceed 12 presented when the manuscript is sub- printed pages. The total number of pages mitted. can be estimated as described below: Authors should respect the privacy of Text, about 600 words/page; References, patients and their families. Identifying about 20/page; Figures, four 7 × 5 cm details should be omitted if they are not figures occupy about 1 page. essential, but patient data should never be 5. With the exception of articles requested altered or falsified in an attempt to attain by the Editorial Committee, publication anonymity. Complete anonymity is diffi- expenses are borne by the author. Au- cult to achieve, and informed consent thors will be notified of the exact sum. should be obtained if there is any doubt. 6. The Juntendo Medical Society retains all 2. To be accepted in Juntendo Medical rights to reproduction, presentation, pub- Journal, Medical research involving hu- lic transmission, transfer, translation, man subjects must conform with the adaptation and derivative works. The WMA (World Medical Association) Dec- purpose is not to restrict the original laration of Helsinki (http: //www. wma. authors, but prior to reuse, an application net/en/30publications/10policies/b3/inde to the Juntendo Medical Society is neces- x.html). In addition, research using anim- sary. A completed“Declaration of Copyr- als must be carried out in accord with the ight Transfer”should be presented at the guidelines of each institution based on time of manuscript submission. applicable government statutes. For 7. Japanese research institutions, the applic- able statute is the Ministry of the Environmentʼs notification“Criteria for the Care and Keeping of Laboratory Submissions should be original and unique; Animals and Alleviation of their Suffer- all submissions to the Juntendo Medical ing.” Journal will be subjected to an automated When a study has undergone evaluation computer search (CrossCheck) for reused by an ethics committee, etc., the result of or plagiarized materials carried out by that examination must be attached when Crossref.org. submitting the manuscript. For research Authors (collaborating authors included) involving humans or animals, make sure must sign and submit a form attesting that the manuscript clearly states that all the submitted experimental results are ethical regulations were observed. unpublished and not under consideration
466 for publication elsewhere. b. Running title (no more than 40 charac- 8. Regarding conflicts of interest, if the ters, including spaces) authors or a commercial entity they help c. Full names of the authors guide or control may benefit financially d. Affiliations of the authors (if the publica- from major or minor results reported in tion originates from several institutes, the the submitted manuscript, this conflict of affiliations of all authors should be clearly interest must be stated in the text. If no indicated) conflict of interest exists, a“Conflict-of- e. Correspondence address, including tele- Interest Statement”signed by all authors phone and fax numbers, and e-mail should be submitted stating so. address.
Submission of manuscripts Abstract Manuscripts should be sent to the follow- The second (and if necessary the third) page ing address (submission by email is also of the manuscript should contain only the allowed). abstract (maximum 250 words) and key words. The abstract must be fully compre- Juntendo Medical Journal Editorial Office hensible without reference to the text. Shinkousha K.K. Abstracts should be divided into sections as 19-2 Sarugakucho, Shibuya-ku, Tokyo, follows: 150-0033 Japan 1. Objective: Tel: +81-3-3462-1182 2. Materials (or“Design”): Email: [email protected] 3. Methods (or“Interventions”): 4. Results: Arrangement of manuscripts 5. Conclusions: Manuscripts (including references, tables, legends, etc.) must be typewritten using Key words double spacing on A4 paper with a 3 cm There should be no more than five key margin and with page numbers indicated on words. (Refer to Medical Subject Headings in the lower right. A cover form (http: //www. MeSH or Index Medicus). juntendo. ac. jp/facility/journal/download. ht ml) providing key information must be Section headings included. Except for standard, widely under- Manuscripts should be divided into the stood abbreviations, each abbreviation following sections and presented in this should be written out in full in its first order: Introduction; Materials and Methods; occurrence, with the abbreviation specified in Results; Discussion; References. parentheses. Manuscripts should be arranged in the References following order: 1 title page; 2 main text; 3 References, including those given in tables tables together with any accompanying and figure legends, should be numbered legends; 4 figure legends; 5 figures; 6 any- sequentially in the order they appear in the thing else. text and listed in numerical order at the end Each of the above items should begin on a of the manuscript under the heading“Refer- separate page. ences”.In the text, citations should be indi- cated as superscript numbers with an end Title page parenthesis character following each citation The first page (title page) of the manuscript number. Three or more consecutive citations should contain only the following: should be indicated as a range using a a. Title of the paper (no abbreviations should hyphen, e.g.“3-5) ”. Any cited URL should be be used in the title) provided in the text, enclosed in parentheses.
467 Journal titles should be abbreviated as shown table they refer to. in Index Medicus and List of Journals Indexed. When there are six or fewer authors, all Figures and legends should be listed; when there are seven or Figures should also be submitted on separate more, include only the first three and add "et pages at the end of the article using a al." Please note the following examples. separate page for each figure. They should be Example citation list entries: (1) from a numbered in order of appearance with journal, (2) from a book Arabic numerals (e.g. Fig. 1, Fig. 2). Author 1) You WC, Blot WJ, Li JY, et al: Precancer- (s) must pay printing costs for color photo- ous gastric lesions in a population at high graphs. Electron micrographs should contain risk of stomach cancer. Cancer Res, 1993; a scale. Individual figures may not exceed the 53: 1317-1321. size of a Journal page. Graphs or drawings 2) Matsumoto A, Arai Y: Hypothalamus. In: containing typewritten characters are un- Matsumoto A, Ishii S, eds. Atlas of acceptable. Numbers, letters and symbols Endocrine Organs. Berlin: Springer-Ver- must be large enough to be legible after lag, 1992: 25-38. reduction. In principle, figures should be suitable for publication, and jpg digital files Tables preferred. Each figure must have an accom- Tables with suitable titles and numbered panying legend, which should be understand- with Arabic numerals should be placed at the able without reference to the text. All figure end of the text on separate sheets (one table legends are to be double spaced, and should per page). They should be understandable be collected together as text page(s), rather without referring to the text. Column head- than being attached to their respective ings should be kept as brief as possible, with figures. units for numerical information included in parentheses. Footnotes should be labeled a), Copyright © The Juntendo Medical Society b), c), etc. and typed on the same page as the
468 Conflict-of-Interest Statement
We, the authors have no financial relationships with 3rd parties (research support or provisioning of other benefits, etc.) whose interests stand to be affected by the research content, conclusions or opinions expressed in the manuscript indicated below, which has been submitted to the Juntendo Medical Journal.
Title of the article
Signatures of all authors Name (printed) Date: (year/month/day)
1．
2．
3．
4．
5．
6．
7．
8．
9．
10．
469 Declaration of Copyright Transfer
The content of this article manuscript, which has been submitted to the Juntendo Medical Journal has not been published elsewhere in part or in full in any academic journal, nor will it be submitted for publication elsewhere in the future. The author(s) agrees that, effective upon acceptance for publication, copyright of the article is transferred to the Juntendo Medical Society, although all responsibility for its content rests with the author(s).
Title of the article
Signatures of all authors Name (printed) Date: (year/month/day)
1．
2．
3．
4．
5．
6．
7．
8．
9．
10．
470 Editorʼs Note The House of Councilors in Japan has passed bills on national security to allow its self-defense forces to resort to military force in regions of conflict overseas, which had long been banned.The passage of the bills without obtaining the support of the public has raised many questions, including the future direction of Japan and consistency with Article 9 of the Constitution.On the other hand, in any age, scientists including myself have the responsibility to conduct medical research, including etiological and pathological studies as well as the development of new diagnostic and treatment methods, to contribute to society.Furthermore, it is significantly important to apply the results of medical research to eradicate diseases and promote health.In recent years, the importance of“Jin-I exist as you exist”,which is the policy of Juntendo University, has attracted more attention than in any other times.We should go back to the basics of medicine. “Whatʼs New?”in the latest issue of Juntendo Medical Journal (JMJ) covers three interesting topics: sleep apnea syndrome, intractable pruritus, and awards.The special topics features“The eradication of tropical diseases and measures against them”.The most common cause of death is still infectious diseases in most countries.In developing Asian and African countries in particular, infectious disease-associated mortality rates are higher than those of cancer, and, therefore, it is important to develop measures, including early diagnosis, the development of treatment methods, and disease prevention.The feature article is full of the latest information on malaria, filarial disease, dengue fever, and Ebola hemorrhagic fever.This issue includes three original papers on: (1) Hemodialysis in Juntendo Tokyo Koto Geriatric Medical Center, (2) Interstitial nephritis due to SLE, and (3) Analyses of the usefulness of multidisciplinary SRE conferences on malignant tumor bone metastasis from the viewpoint of rehabilitation.I am sure that you will be satisfied with the content.The introduction of a variety of courses and laboratories may provide valuable information required for graduate students to make a decision on their major, and I recommend that you read it. Now that the typhoon has passed by, autumn is coming.Autumn is the best season for you to read books and devote yourself to conducting research.I hope that JMJ can publish the findings of studies that contribute to medical advancement for people around the world. Kazuhisa Takahashi Department of Respiratory Medicine
Call for feature article proposals To introduce the latest medical findings, Juntendo Medical Journal features a specific focus area for each issue.We would like to request all our readers to address any suggestions or proposals for suitable focus areas to our editorial office.
471 編集後記 安全保障関連法案が参議院で可決され，いよいよ海外の紛争地での自衛隊の武力行使が可能になりました．国 民の充分な理解が得られる前に法案が通過しこれから日本はどこに向かうのか，憲法第9条との整合性をどう取る のかなど問題は山積みです．しかし，どのような時代になっても，我々はサイエンティストとして粛々と医学研究 を推し進め，病因・病態解明，新規診断や治療法の開発を通じて社会貢献をする責務があります．そして医学研究 の成果はあくまでも人類の疾病克服，健康増進のために還元しなければなりません．順天堂の学是である「仁」が 今ほど求められている時代はありません．もう一度，医の原点に立ち返ってみる必要があります． 今回のJuntendo Medical Journal (JMJ) のWhatʼs Newは睡眠時無呼吸症候群，難治性掻痒症，Award受賞に関 する内容の3本であり，いずれも興味深い話題です．また，特集は「熱帯病の撲滅と対策」です．感染症は人類の 死亡原因として依然として第一位であることは論を待ちません．特にアジアやアフリカなどの発展途上国ではが んではなく感染症が死因のトップであり，それに対する早期診断，治療開発，予防などの対策がきわめて重要です． 今回の特集ではマラリア，フィラリア，デング熱，エボラ出血熱などについての最新情報が満載です．原著は3本 で，順天堂東京江東高齢者医療センターでの血液透析に関する論文，SLEにともなう間質性腎炎，さらに悪性腫瘍 の骨転移に対する多職種による SRE カンファレンスの有用性をリハビリの立場から分析した論文です．読み応え 十分です．各講座・研究室の紹介も大学院生が専攻を決める際の重要な情報になります．是非，目を通してみてく ださい． 台風が過ぎ一気に秋めいてきました．秋は読書の季節であり腰を落ち着け学問ができる季節です．JMJ から世 界に向けて人類の発展に寄与する研究の成果が発信されることを期待しています． 高橋 和久 呼吸器内科学
イラスト作者より 沖縄に魅せられて30年以上経ちますが，何度行っても飽きることがありません．那覇空港に降り立った時のあの ムッとする暑さと，なんともいえない匂い，そして懐かしい音楽，一瞬にして私の心と身体は解きほぐされるので す．今回，初めて美ら海 (ちゅらうみ) 水族館に行って来ました (宮道明子)．
順天堂醫事雑誌の記事については既に明治8年の創刊号から電子化されており，J-STAGE（科学技術情報発信・流通 総合システム）の電子ジャーナル公開システムにおいて閲覧することができます．順天堂大学のホームページからもご 覧いただけますので，ご活用頂ければ幸いです（http://www.juntendo.ac.jp/facility/journal/）．
特集の企画募集 「順天堂醫事雑誌」では，医学界の最新知識を紹介するために，特集として総説を毎号に掲載しています． 読者の皆様には，特集として相応しい企画等がございましたら，編集室宛にご提案下さいますようお願い申し上げます．
編集委員 委員長 長 岡 功 順天堂醫事雑誌 （50音順） UNTENDO EDICAL OURNAL 射場敏明 初田真知子 J M J 第61巻 第4号（通刊897） 落合 匠 平澤恵理 平成27年（2015年）8月31日発行 明治8年（1875年）創刊 加藤俊介 三井田孝 発行人 順天堂医学会 金子和夫 美田敏宏 編集発行責任者 長岡 功 〒113-8421 東京都文京区本郷2-1-1順天堂大学内 桑鶴良平 三宅幸子 順天堂医学会事務局：電話 03-5802-1586 E-mail [email protected] 小西清貴 村上 晶 編集・印刷：株式会社 真 興社 小林弘幸 横山和仁 代表者 福田 真太郎 〒150-0033 東京都渋谷区猿楽町19-2 高橋和久 Robert F Whittier 順天堂醫事雑誌編集室：電話 03-3462-1182 E-mail [email protected] 長岡正範 宮道明子(イラスト) Ⓒ The Juntendo Medical Society 2015 Tokyo Japan 20150831
472 Juntendo Medical Journal ISSN 2187－9737 CODEN：JIZUA2 61（4）350―472（2015）
順天堂醫 事雑誌
August 2015
61－ 4 What’s New from Juntendo University, Tokyo C
urrent Research Topics in Tropical Diseases; Towards Successful Control and Elimination Screening for Sleep Disordered Breathing (SDB) in Truck Drivers in the US Hiroo Wada, et al. Santosh Nigam Memorial “Outstanding Young Scientist” Award Takehiko Yokomizo A Report of the 1st Symposium and the 2nd Workshop on Intractable Itch in Juntendo University Mitsutoshi Tominaga, et al.
Current Topics: Current Research Topics in Tropical Diseases; Towards Successful Control and Elimination Introduction Toshihiro Mita Preclinical Studies on a New Vaccine Formulation of BK―SE36, a Malaria Vaccine Candidate Nirianne Marie Q. Palacpac, et al. Founded Challenging Malaria Control: Do Our New Genetic Tools Pave the Way for Malaria Eradication? in 1875 Makoto Hirai, et al. Elimination of Lymphatic Filariasis: Roles of Research, International Cooperation, and Participation of Endemic Community Making an Unprecedented Global Program to Eliminate the Neglected Disease into a Reality Eisaku Kimura Current Situation of Chagas Disease in Non―Endemic Countries Takeshi Nara, et al. An Overview of Ebola Virus Disease: History, Pathogenesis, and Treatment Norio Yamamoto The Current Situation of Dengue Research Takeshi Kurosu
Original Articles An Overview of Dialysis Treatment in Juntendo Tokyo Koto Geriatric Medical Center During the First Ten Years of Operation: a Comparison with a Nationwide Statistical Survey in Japan at the End of 2012 Kazuhiko Funabiki, et al. Clinical Significance of Renal Interstitial Fibrosis in Patients with Lupus Nephritis Daisuke Honda, et al. Effectiveness of Interdisciplinary Team Conference to Manage Skeletal Related Events in u.21 The Juntendo Medical Society Aug. 2015 Rehabilitation for Patients with Cancer Yasuko Hayashi, et al.
Juntendo Research Profiles Department of Immunology, Department of Pediatrics and Adolescent Medicine, Department of Anesthesiology and Pain Medicine, Department of Clinical Laboratory Medicine, Department of Esophageal & Gastroenterological Surgery, Department of Breast and Endocrine Surgery (Breast Center), Department of Cardiovascular Surgery, Department of General Thoracic Surgery, Department of Urology, Department of Transfusion Medicine and Stem Cell Regulation
Publication List Publications from Juntendo University Graduate School of Medicine, 2013 [2/6]
The Juntendo Medical Society 2－1－1 Hongo Bunkyo-ku, Tokyo, 113－8421 JAPAN Tel：+81－3－5802－1586 E-mail：[email protected] Juntendo Medical Journal Vol. 61 No. 4 p. 350－472 Tokyo 2015. 8 61－4 （897th issue）