1
Verifying the Deletion of Growth Hormone Receptor Using a Quantitative Polymerase
Chain Reaction at the mRNA Level in Tissue-Specific GHR-/- Mice
A thesis presented to
the faculty of
the College of Health Sciences and Professions of Ohio University
In partial fulfillment
of the requirements for the degree
Master of Science
Xinyue Wang
December 2012
©2012 Xinyue Wang. All Rights Reserved.
2
This thesis titled
Verifying the Deletion of Growth Hormone Receptor Using a Quantitative Polymerase
Chain Reaction at the mRNA Level in Tissue-Specific GHR-/- Mice
by
XINYUE WANG
has been approved for
the School of Applied Health Sciences and Wellness
and the College of Health Sciences and Professions by
Darlene E. Berryman
Associate Professor
Randy Leite
Dean, College of Health Sciences and Professions 3
ABSTRACT
WANG, XINYUE, M.S., December 2012, Food and Nutrition Sciences
Verifying the Deletion of Growth Hormone Receptor Using a Quantitative Polymerase
Chain Reaction at the mRNA Level in Tissue-Specific GHR-/- Mice
Director of Thesis: Darlene E. Berryman
Growth Hormone (GH) inhibits insulin action, and high level GH can result
insulin resistance and diabetes in both mice and humans. GH receptor (GHR) gene disrupted mice (GHR-/- mice) have been genetically modified to lack the GHR and GH
action. GHR-/- mice are extremely insulin sensitive and have an extended life span. The
contribution of individual tissues to the phenotype of GHR-/- mice is not known but of
extreme interest in the aging field. Three tissues likely to contribute to the improved insulin sensitivity are liver, adipose tissues, and muscle, as these are insulin and GH
sensitive. To examine the individual contributions of these tissues to the overall insulin
sensitivity and longevity in GHR-/-mice, three tissue-specific GHR-/- mice were created
using a Cre-Lox system. This thesis represents the efforts to verify the deletion of GHR at
the mRNA level only in the specific tissues of these tissue-specific gene-disrupted mouse lines. Collectively, these data show the GHR mRNA levels are reduced only in the tissues targeted with no significant reduction in any other tissue. Thus, we have successfully created mouse lines with GHR deletion specifically in the liver, muscle, or fat tissue.
These mice are now ready for more thorough phenotypic analyses.
4
ACKNOWLEDGMENTS
Foremost, I would like to express my sincere gratitude to my advisor Dr. Darlene
E. Berryman for her continuous support of my study and research; for her patience, motivation, enthusiasm, and immense knowledge. Her guidance helped me throughout my research and writing of this thesis. She is the best advisor a graduate student could wish for.
I would also like to express my thanks to my committee members: Dr. Robert G.
Brannan and Dr. Edward O. List, for their insightful comments, which greatly improved my thesis. I am very grateful to all the professors who have taught me. The knowledge I learned was directly put to use in this thesis.
Last but not least, I need to thank all the members of John Kopchick’s research laboratory. We shared a lot of discussion and fun during these two years, which I will always remember.
5
TABLE OF CONTENTS
Page
Abstract ...... 3
Acknowledgments...... 4
List of Tables ...... 8
List of Figures ...... 9
Chapter 1: Introduction ...... 10
Statement of Problem ...... 13
Research Questions ...... 14
Purpose of the Study ...... 15
Limitations/Delimitations ...... 16
Definition of Terms ...... 17
Chapter 2: Review of Literature ...... 20
Growth Hormone ...... 20
Gene and Protein ...... 20
Secretion and Regulation ...... 21
Receptor ...... 22
Binding Protein ...... 24
Signaling ...... 25
Insulin-Like Growth Factor-1 ...... 25
Growth Hormone and Insulin Resistance ...... 26
Mouse Models with Altered GH/IGF-1 Axis and Aging...... 27
Mouse Models with Tissue-Specific Gene Disruption in Aging and Glucose Homeostasis ...... 28 6
Tissues Effect to GH and Insulin Action ...... 29
Liver ...... 29
Muscle ...... 30
Adipose Tissue ...... 31
Cre/LoxP System ...... 32
LoxP Site ...... 33
Cre Recombinase ...... 34
Types of Cre-Expressing Lines ...... 35
Comparison of Liver, Fat and Muscle-Specific Promoters ...... 36
Advantages/Disadvantages of Tissue-Specific Knockout Animal ...... 39
Tissue-Specific GHR-/- Mice Using Cre/LoxP System ...... 40
Summary ...... 43
Chapter 3: Methods ...... 45
PO1 Project ...... 45
Animals ...... 45
Tissue Collection ...... 49
Use of MIQE Guidelines to Guide qPCR Experiments ...... 50
RNA Isolation ...... 50
Reverse Transcription (from RNA to cDNA) ...... 52
Quantitative Polymerase Chain Reaction (qPCR) ...... 52
Data Analysis ...... 55
Chapter 4: Results ...... 56
Validation of qPCR Method ...... 56 7
GeNorm ...... 57
qPCR for Tissue-Specific GHR-/- Mice ...... 58
Liver-Specific GHR-/- Mice ...... 59
Muscle-Specific GHR-/- Mice ...... 61
Adipose Tissue-Specific GHR-/- Mice ...... 62
Chapter 5: Discussion and Conclusion ...... 65
Liver-Specific GHR-/- Mice ...... 66
Muscle-Specific GHR-/- Mice ...... 67
Adipose Tissue-Specific GHR-/- Mice ...... 70
PO1 Project ...... 72
Summary ...... 73
Further study ...... 73
References ...... 75
Appendix I: MIQE Guideline ...... 93
Appendix II: RNA Isolation Procedure ...... 95
Appendix III: Reverse Transcription Procedure ...... 99
Appendix IV: Quantitative PCR Procedure ...... 102
Appendix V: Data Analysis Using qbase...... 105
Appendix VI: Heart of Muscle-Specific GHR-/- Mice...... 110
Appendix VII: Five Adipose Tissues of Adipose Tissue-Specific GHR-/- Mice ...... 111
Appendix VIII: Permission to Reproduce Figures...... 112
8
LIST OF TABLES
Page
Table 1: Examples of Some Established Tissue/or Cell-Specific Cre-Expressing
Mice ...... 36
Table 2: Examples of Albumin Cre for Liver-Specific Gene Deletion ...... 37
Table 3: Examples of MCK Cre for Muscle-Specific Gene Deletion ...... 38
Table 4: Examples of aP2 Cre for Adipose Tissue-Specific Gene Deletion ...... 39
Table 5: Papers with Tissue-Specific GHR Deletion ...... 41
Table 6: Summary of Experimental and Control Mice ...... 47
Table 7: Optimized Conditions for Homogenization of Various Tissues for RNA
Isolation ...... 51
Table 8: Sequences of Primes for Reference Genes ...... 54
Table 9: Relative Stability of Housekeeping Genes in Various Tissues ...... 58
Table 10: Unpaired t-Test Result for GHR mRNA Expression Level in Liver-
Specific GHR-/- Mice...... 60
Table 11: Unpaired t-Test Result of GHR mRNA Expression Level in Muscle-
Specific GHR-/- Mice ...... 62
Table 12: Unpaired t-Test Result of GHR mRNA Expression Level in Adipose
Tissue-Specific GHR-/- Mice ...... 64
9
LIST OF FIGURES
Page
Figure 1: The human growth hormone-encoded gene ...... 21
Figure 2: Model for the activation of the growth hormone receptor by growth
hormone ...... 24
Figure 3: The Cre/Lox method for tissue-specific GHR knockout ...... 34
Figure 4: mRNA expression level of wild type and EIIa mice ...... 56
Figure 5: mRNA expression level of GHR in liver-specific GHR-/- mice ...... 60
Figure 6: mRNA expression level of GHR in muscle-specific GHR-/- mice ...... 61
Figure 7: mRNA expression level of GHR in adipose tissue-specific GHR-/- mice .....63
10
CHAPTER 1: INTRODUCTION
Growth hormone (GH) has a number of effects on metabolism including its ability
to alter nutrient metabolism and impact insulin sensitivity (Bratusch-Marrain, Smith, &
DeFronzo, 1982). GH inhibits the action of insulin, and can cause insulin resistance
(Bartke, Chandrashekar, Bailey, Zaczek, & Turyn, 2002). Based on the hypothesized
role of insulin sensitivity on lifespan, it is not surprising that GH has been shown to
decrease lifespan in variety of animal models (Bartke et al., 2002). In contrast, repression
of the GH/insulin-like growth factor-1 (IGF-1)/insulin axis has been shown to increase lifespan in both invertebrates and vertebrate animal model systems (Berryman,
Christiansen, Johannsson, Thorner, & Kopchick, 2008).
GH is synthesized and secreted by somatotroph cells in the anterior pituitary gland. GH exerts its action by binding to specific receptors on the surface of target tissues—GH receptor (GHR), which results in activation of the Janus kinase (JAK) II and signal transducer and activator of transcription (STAT5) pathway among other intracellular signaling systems (Kopchick & Andry, 2000). Binding of GH to GHR results in various actions including cell growth and differentiation and alteration of nutrient partitioning and availability (Carter-Su, Schwartz, & Smit, 1996). All body tissues examined to date contain receptors for GH (Kelly, Djiane, Postel-Vinay, & Edery,
1991), suggesting a widespread impact of GH on the body.
One consequence of GH signaling in specific tissues, most notably the liver, is the downstream production of IGF-1. IGF-1, a protein structurally similar to insulin, also has an important overlapping but independent role in the regulation of cellular and tissue 11 function (Cohick & Clemmons, 1993). The combined action of GH and IGF-1 is often referred to as the GH/IGF-1 axis. GH and IGF-1 affect most tissues in the body.
Therefore, the GH/IGF-1 axis can be considered multifaceted and pervasive (Barbieri,
Bonafe, Franceschi, & Paolisso, 2003).
A reduction in insulin and IGF-1-like proteins or their downstream intracellular signaling molecules appears beneficial for aging in several invertebrate models (Kenyon,
2001). More recently, mammalian models with reduced growth hormone (GH) and/or
IGF-1 signaling have been shown to have extended lifespans as compared to control siblings (Berryman et al., 2008). Furthermore, several mouse models with a reduction in the activity of the GH/IGF-1 axis have been shown to exhibit increased lifespan
(Coschigano et al., 2003). For example, the GHR gene disrupted (GHR-/-) mice have no
GHR and are long-lived dwarf mice with elevated circulating GH and markedly reduced
IGF-1 levels (Coschigano et al., 2003). GHR-/- mice, which are relatively obese
(Berryman et al., 2004), have decreased fasting insulin and glucose levels (Coschigano et al., 2003) and do not develop glomerularsclerosis in response to streptozotocin-induced diabetes (Bellush et al., 2000). Overall, many laboratories are seeking to fully understand the actual physiological and phenotypic alterations in GHR-/- mice that contribute to their increased longevity.
Tissue-specific gene disruption in mice has implicated several tissues as key mediators of the extended longevity or altered insulin sensitivity. Specific tissues lacking
GHR, as opposed to the global GHR disruption as in the GHR-/- mice, may be more informative to explain the impact of GH signaling on lifespan. Liver, adipose tissue, and 12
muscle are three tissues that are sensitive to insulin and GH, and thus, are good
candidates for key roles in lifespan extension in GHR-/- mice. Therefore, disrupting GH
action specifically in the liver, adipose tissue, or muscle may provide evidence as to the
tissues mainly responsible for the increased longevity seen in the global GHR gene-
disrupted mice.
Tissue-specific gene deletion in mice is performed by the Cre/LoxP system. The
Cre/LoxP mechanism was discovered during research on a bacteriophage named P1
(Sauer & Henderson, 1988; Sternberg & Hamilton, 1981). The standard method requires two different genetically engineered mouse lines to achieve tissue-specific gene deletion.
The first mouse strain contains a targeted gene flanked by two LoxP sites (“floxed gene”).
The second mouse strain is a conventional transgenic mouse line expressing the Cre
recombinase under the control of a promoter, which is specific for a particular cell or
tissue type. The floxed mouse and the Cre-expressing mouse mate to generate the tissue-
specific gene deletion mice. In the tissue where the Cre recombinase is expressed, the
DNA segment flanked by the LoxP sites will be excised and consequently inactivated.
The targeted gene flanked by LoxP sites remains active in the cells and tissues that do not
express Cre recombinase, resulting in a tissue-specific gene-disrupted mouse. This
Cre/LoxP system is a powerful means to determine the relative importance of specific
tissues for biological processes.
The promoter used is critical to ensure that Cre gene expression is limited to a
specific tissue; therefore, the choice of promoter is essential. Promoters that have been
successfully used for Cre expression within liver, adipose tissue, and muscle are albumin, 13
adipocyte protein 2 (aP2), and muscle creatine kinase (MCK), respectively. While these
promoters work very well, problems are still encountered in terms of the efficiency and
the cell/tissue specificity of the deletion. Thus, it becomes important when using this
Cre/LoxP system to validate that the gene of interest is deleted in only the tissues/cells of
interest. This thesis will use quantitative PCR to validate the tissue-specific (liver,
adipose tissue, and muscle) deletion of GHR in three new mouse lines at the level of
mRNA.
Statement of Problem
Numerous studies have shown that GH possesses anti-insulin action and is a
diabetogenic molecule (Kopchick & Andry, 2000). Therefore, GH would be expected to
generate insulin resistance in tissues, such as adipose, muscle, and liver, which respond to
both GH and insulin. Indeed, liver (Yakar et al., 2005), adipose tissue (Nilsson et al.,
2005), and muscle (Jorgensen et al., 2006) have been shown to be affected by GH to
induce insulin resistance. Zhou and colleagues have previously developed GHR-/-mice
(Zhou et al., 1997), and these mice have been the focus of numerous research studies,
including insulin sensitivity and increased lifespan (List et al., 2011). GHR -/- mice,
which have been genetically modified to lack the GHR and GH action, are extremely
insulin sensitive and have an extended life span. The contribution of individual tissues to
the phenotype of GHR-/- mice is not known. Three insulin and GH sensitive tissues are
liver, white adipose tissue (WAT), and muscle. Tissue-specific gene disrupted mice for each of these tissues were recently generated in our laboratory. Tissue-specific gene disruption should delete the gene only in selected tissues, not all the tissues of the body. 14
However, the tissue specificity of the deletion is not perfect and must be validated.
Therefore, before conclusions can be made about phenotypic consequences of tissue- specific gene disruption, one must verify the efficiency of tissue-specific GHR gene disruption. This thesis will verify messenger RNA (mRNA) absence/presence in selected tissue in these new tissue specific GHR-/- mice.
Research Questions
1. What are the optimal quantitative polymerase chain reaction (qPCR) conditions to
verify GHR gene deletion in various tissues?
Wild type mice and EIIA mice (global Cre expression and so essentially
GHR-/- in all tissues much like the GHR-/- mice) will be utilized to establish
conditions for qPCR in a variety of tissues. The tissues to be used are
subcutaneous, retroperitoneal, mesenteric, and perigonadal white adipose tissue,
brown adipose tissue, liver, and gastrocnemius muscle. The conditions
established for qPCR will then be utilized to test tissue-specific deletion as
described in Research Question #2.
2. Can we confirm that the Cre/Lox system removes GHR at the mRNA level from
only specific tissues in the three new mouse lines (liver GHR-/-, muscle GHR-/-,
fat GHR-/-)?
Tissues from tissue specific GHR-/- mice and floxed controls will be utilized.
Specific tissues include are subcutaneous, retroperitoneal, mesenteric, and
perigonadal white adipose tissue, brown adipose tissue, liver, soleus,
gastrocnemius, heart, lung, kidney, spleen, brain, and ovaries. The qPCR will be 15
used to quantify the level of mRNA in these tissues. We hypothesize that there
will be a reduction of GHR mRNA only in the tissues that we have targeted
(liver, adipose, or muscle) gene disruption and will be present at normal levels in
all other tissues and in controls.
Purpose of the Study
The GHR-/- mice are extremely insulin sensitive comparing with wild-type mice.
This insulin sensitivity may due to the absence of the anti-insulin effects of GH and may also play a major role in extending lifespan. Therefore, insulin-sensitive and GH- responsive tissues, which are liver, muscle, and adipose tissues, may play a critical role in
GH’s ability to influence aging.
Because the GHR-/- mice globally lack GH function, the metabolic consequences of tissue-specific absence of GH function is unknown, including GH’s impact on lifespan.
The lifespan extension seen in the GHR-/- mouse may due to decreased GH action and consequent increased insulin sensitivity in selected insulin-responsive tissues. To test this hypothesis, we selectively disrupted the GHR gene in liver, muscle, and adipose tissues for use in later studies to determine their individual contributions to overall insulin sensitivity and longevity. Before any further research, we plan to confirm that the mRNA absence of GHR is specifically targeted to the tissue of interest in these three new tissue- specific mouse lines. This thesis utilized a qPCR method to validate the mRNA absence of GHR in targeted tissues as well as its presence in all other tissues. 16
Limitations/Delimitations
1. The most common problem for the Cre/Lox system is that the promoter may not
be tissue specific. An unspecific promoter leads to undesired knockout of the
gene in other tissues. This makes it difficult to determine if the phenotype of the
mouse is truly due to the target tissue specific knockout.
2. The Cre/Lox system results in misplacement during integration of Cre. The Cre
recombinase gene must be inserted into the genome, but it cannot perfectly
control the specific location for the integration. It is a chance that the gene will
land right in the middle of another gene and cause disruption of another gene,
which may or may not cause phenotypic alterations.
3. The Cre/Lox system may lead to an incomplete knockout. It means that the GHR
expression would be significantly reduced in the specific tissue, but still be
produced in minute quantity, which may or may not cause alterations on the
mouse phenotype.
4. Another potential problem is related to the qPCR method. Decisions related to
controls and plate template determines the types of analyses that can be
performed. Because our intent was mainly to test for expression in specific
tissues, we did not necessarily set up the plate or run the analyses in a manner that
allowed for comparison among tissues.
17
Definition of Terms
Adipocyte. An adipocyte is the lipid storage cell of adipose tissue. Adipocytes are specialized for storing energy as triglycerides and are the main components of adipose tissue (Unger & Orci, 2002).
Diabetes. Diabetes is a chronic disease in which there are high levels of glucose in the blood. Diabetes can be caused by too little insulin, resistance to insulin, or both.
GHR knockout (GHR-/-) mice. GHR-/- mice were first described by Zhou et al.
(1997). The GHR-/- mice have a deletion of most of the fourth exon and part of the fourth intron of the GHR/BP gene (Zhou et al., 1997). This mouse line provides a model of a human condition known as Laron Syndrome (also called GH Insensitivity Syndrome).
There is no functional GH signaling through the receptor in this type of mouse although
GH is still produced. These mice display low level of IGF-1, glucose, and insulin, as well as high levels of GH. The essential manifestations are high level of insulin sensitivity and extended lifespan (Coschigano et al., 2003).
Insulin resistance. Insulin resistance is a condition in which the body produces insulin but tissues fail to respond to it properly. This pathophysiological condition is associated with type 2 diabetes and excess amount of fat mass in which insulin works less effectively in lowering glucose level in the blood and promoting glucose storage in tissues particularly in fat and muscle tissues. The pancreas must produce more insulin than normal to maintain a normal blood glucose level (Milner et al., 2010; Storlien et al.,
1991). 18
Insulin. A hormone made by the pancreas, which helps the tissues take up glucose
from the blood for or immediate energy or stored energy.
Insulin-like growth factor-1 (IGF-1). IGF-1 is a hormone similar in molecular structure to insulin. It plays an important role in childhood growth and continues to have anabolic effects in adults. IGF-1 belongs to the IGF system (IGF-1 and IGF-2) and is a
major protein produced in response to GH signaling.
Knockout Animals. Gene-disrupted mouse lines greatly contribute in the study of gene function through the phenotype observed and because of the ability to attribute phenotypic changes to a specific gene. Unlike the transgenic model produced by the addition of random exogenous DNA, the gene-disrupted model is obtained by targeted insertion, resulting in loss of function of the target gene. This targeted integration is performed through the mechanism of homologous recombination and has an extremely low success rate (Gama Sosa, De Gasperi, & Elder, 2010).
Quantitative polymerase chain reaction. It is also called real time RT polymerase chain reaction (qPCR/RT-RT-PCR). It is a laboratory technique based on the PCR methodology, which is used to amplify and simultaneously quantify a targeted DNA molecule. For one or more specific sequences in a DNA sample, qPCR enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when normalized to DNA input or additional normalizing genes. The procedure follows the general principle of polymerase chain reaction; its key feature is that the amplified DNA is detected as the reaction progresses in real time. Two common methods for detection of products in qPCR are: (a) non-specific fluorescent dyes that 19
intercalate with any double-stranded DNA (as we use in this thesis), and (b) sequence-
specific DNA probes consisting of oligonucleotides that are labeled with a fluorescent
reporter which permits detection only after hybridization of the probe with its
complementary DNA target. Frequently, qPCR is combined with reverse transcription to
quantify messenger RNA and non-coding RNA in cells or tissues.
Reverse transcription. Reverse transcription polymerase chain reaction (RT-PCR) is a variant of polymerase chain reaction (PCR). It is a laboratory technique commonly used in molecular biology where a RNA strand is reverse transcribed into its DNA complement (complementary DNA or cDNA) using the enzyme reverse transcriptase, and the resulting cDNA is amplified using PCR. Reverse transcription PCR, which is also sometimes abbreviated as RT-PCR, is not to be confused with quantitative polymerase chain reaction or real time reverse transcription PCR (q-PCR/RT-RT-PCR).
Tissue-specific gene disruption mice. Unlike global knockouts, tissue specific gene disruption does not delete the gene in all tissues of the body, but rather only in a single tissue through tissue specific inactivation of a gene of interest. It allows scientists to create mouse models that lack a gene of interest in only one tissue. One possible strategy for tissue specific gene disruption is the use of the conditional deletion system, which involves gene deletion under specific conditions (Mavalli et al., 2010; Schinkel et al., 1994).
20
CHAPTER 2: REVIEW OF LITERATURE
Growth Hormone
GH is a protein hormone, which is also called somatotropin. GH is secreted from the anterior pituitary, a secretion that is regulated by the hypothalamus. GH plays a critical role in somatic growth, as its name implies, as well as in the regulation of body composition and nutrient metabolism in the body.
GH is a member of a hormone family which includes prolactins (PRL), placental lactogens (PL), PRL-like protein-B, among others. The structure, function and regulation of GH are well conserved among species. That is, the protein sequence of GH has approximately 75-77% similarity among humans and rodents (Nicoll, Mayer, & Russell,
1986).
Gene and Protein
Human growth hormone is encoded by a gene called GH-1 gene (Chen et al,
1991). The GH-1 gene has five exons and four introns (see Figure 1). Human GH is heterogeneous and has several isoforms, such as 22-kDa and 20-kDa forms (Baumann,
1991). The predominant form of circulating human GH is 191 amino acids and the 22- kDa form. The 20-kDa form is the second most abundant GH (accounts for 5-7% of circulation GH). In three-dimensional structure, growth hormone has a twist bundle of four α-helixes (Ultsch, Somers, Kossiakoff, & de Vos, 1994), and two independent receptor binding sites are located on opposite surfaces of GH. 21
Figure 1. The human growth hormone encoded gene. It contains five exons (1-5) and four introns (IVS 1-4). Normal human GH is 22-kDa protein, which is encoded by all five exons. Exon 3 is flanked by weak accepter and weak donor splice site by comparing to the strong accepter splice site in exon 4. In this case, human GH is a 20-kDa isoform, which lacks amino acid 32 to 46. From “Genetic Causes and Treatment of Isolated Growth Hormone Deficiency—An Update,” by K. S. Alatzoglou and M. T. Dattani, 2010, Nature Reviews Endocrinology, 6, p. 565. Copyright 2010 by Nature Publishing Group. Reprinted with permission.
Compared to mice, humans appear to have the same number of GH genes, with similar sequence. The 2.5-Gb mouse genome sequence from the C57BL/6J strain reveals about 30,000 genes, with 99% having direct counterparts in humans (Waterston et al.,
2002). For growth hormone, the mouse GH gene consists of five exons and four introns, and its length is about 1.5kb, which is consistent with other mammalian species (Das,
Meyer, Seyfert, Brockmann, & Schwerin, 1996). The second intron in mGH is much smaller than its rat counterpart, thus being similar in size to human, bovine and porcine
GH (Breathnach & Chambon, 1981). Thus, mouse GH and mice have proven to be an excellent laboratory animal for investigation into the regulation of growth, specifically well known by selection experiments (Hastings, Bootland, & Hill, 1993;
Pidduck & Falconer, 1978; Salmon, Berg, Yeh, & Hodgetts, 1988).
Secretion and Regulation
Growth hormone is secreted from the anterior pituitary and regulated by multiple mechanisms. Two main factors, growth hormone releasing hormone (GHRH) and 22
somatostatin (SRIF), regulate neural control of growth hormone secretion through the
hypothalamus (Brazeau et al., 1973; Tannenbaum, 1991; Tannenbaum & Ling, 1984).
GHRH interacts with its receptor, then actives the cAMP and Ca2+-channel pathways and stimulates GH release (Barinaga et al., 1983). SRIF interacts with its receptor, inhibiting cAMP production and Ca2+-channel fluxes, and blocks GH release. GH secretion is
regulated by the interaction of GHRH and SRIF and is released in 10-20 pulses in each
24-h cycle (Roelfsema et al., 2001). IGF-1, which will be more fully discussed later, and
GH itself regulate GH release by a negative feedback loop. IGF-1 inhibits GH secretion
by influencing GHRH reduction in the hypothalamus and by influencing GHRH action in
the pituitary. GH inhibits its own secretion in the hypothalamus.
Besides GHRH and SRIF, the principal physiologic short-term regulation
mechanisms of GH secretion are (a) neural endogenous rhythm, (b) sleep, (c) stress, (d)
exercise, and (e) nutritional and metabolic signals. The highest peaks in plasma GH are
found during slow wave sleep, typically one to two hours after falling asleep. GH pulses
of smaller amplitude occur throughout the day, on average approximately every 2 hours
(Winer, Shaw, & Baumann, 1990).
Receptor
The GH receptor (GHR) is a single chain glycoprotein of 620 amino acids. It has
a single transmembrane domain and an extracellular domain associated with multiple
actions of GH (Leung et al., 1987). The quantity of GHR depends on the tissue and
species. In rodents, a notable high amount of GHR is expressed in liver and adipose
tissue and moderate amount of GHR is found in skeletal muscle (Tiong & Herington, 23
1991). In human, GHR is expressed mainly on the surface of cells of liver and adipose
tissue (Esposito, Paterlini, Kelly, Postel-Vinay, & Finidori, 1994; Sobrier, Duquesnoy,
Duriez, Amselem, & Goossens, 1993; Werther, Haynes, & Waters, 1993).
The gene encoded human GHR is located on the short arm of chromosome 5
(5p13-p14) (Arden, Boutin, Djiane, Kelly, & Cavenee, 1990). The gene includes 10 exons and 9 introns (Godowski et al., 1989), of which exons 2-7 encode the extracellular
domain, exon 8 the transmembrane domain, and exons 9 and 10 the intracellular domain.
The mouse growth hormone receptor/growth hormone-binding protein
(GHR/GHBP) gene contains 11 exons, 9 of which are homologous in size and sequence
to human GHR exons 2-10 (Moffat, Edens, & Talamantes, 1999). The two mouse exons
that do not have homologs in the human gene are designated exons 4B and 8A. Exon 4B,
located between exons 4 and 5, encodes an 8-amino acid segment of the ligand binding
domain that is unique to mouse GHR and GHBP.
GH initiates its signaling cascade by binding to a preformed GHR dimer. GH
binds to the left arm of the GHR on one of its surfaces (see Figure 2), and then followed
by binding to right arm on the other surface of GH (Cunningham et al., 1991). This results in a complex containing two GHRs in association with a single GH. The binding of Janus kinase 2 (JAK2) to a proline rich region (Box1) in the proximal intracellular part of the GHR initiates the intracellular signaling that results in an alteration in expression of a number of genes (Carter-Su & Smit, 1998). 24
Figure 2. Model for the activation of the growth hormone receptor by growth hormone. Blue protein is growth hormone, and the red part is the two extracellular binding sites of GHR (and GHBP) on the surface of the cell. From “The Growth Hormone Receptor: Mechanism of Activation and Clinical Implications,” by A. J. Brooks and M. J. Waters, 2010, Nature Reviews Endocrinology, 6, p. 520. Copyright 2010 by Nature Publishing Group. Reprinted with permission.
Binding Protein
The GH binding protein (GHBP) is the soluble, extracellular domain of the GHR.
It is found in the serum of vertebrates (Hadden & Prout, 1964) and is generated from the
GHR by proteolysis in human (Baumann, Amburn, & Shaw, 1988). However, in rats and mice, GHBP is produced by alternative splicing of the mRNA (Moffat et al., 1999). After secretion, GH binds to GHBP in the circulation, depending on the GHBP level and the
GH concentration. Plasma GHBP levels reflect the GHR abundance in the liver 25
(Hocquette, Postel-Vinay, Djiane, Tar, & Kelly, 1990). The GHBP modulates GH action
through a variety of mechanisms (Baumann et al., 1988). It inhibits GH action by competing with the GHR for ligand binding and by generating unproductive (no signal transduction) heterodimers with the GHR at the cell surface. Further, the GHBP prolongs the half-life of GH in the circulation by binding to GH, which delays its excretion via the
kidneys.
Signaling
GH binding of GHR activates the tyrosine kinase Janus kinase 2 (JAK2), thus initiating a multitude of signaling cascades that result in a variety of biological responses including cellular proliferation, differentiation and migration, prevention of apoptosis, cytoskeletal reorganization and regulation of metabolic pathways (Lanning & Carter-Su,
2006). A number of signaling proteins and pathways activated by GH have been identified, including JAK2, signal transducers and activators of transcription (STAT
protein 1, 3, and 5) (Herrington, Smit, Schwartz, & Carter-Su, 2000), the mitogen
activated protein kinase (MAPK) pathway, and the phosphatidylinositol 3'-kinase (PI3K)
pathway. It is important to appreciate that the predominant signaling pathway will
depend on the tissue as the proportion of the signaling molecules and competing receptor
signaling varies among cell types. Thus, the main signaling pathway(s) will differ
depending on the tissue or cell of interest.
Insulin-Like Growth Factor-1
IGF-1 is produced in many tissues in response to GH signaling. IGF-1 acts locally
as in a paracrine/autocrine fashion and distantly in a hormone-like mode. Like GH, IGF-1 26
has mitogenic and metabolic activities. IGF-1 is a member of a family of insulin-related peptides, such as IGF-1, IGF-2, and insulin (Rinderknecht & Humbel, 1978).
Structurally, IGF-1 is a small peptide that contains 70 amino acids and that has a molecular weight of 7,649 Da.
Growth Hormone and Insulin Resistance
Houssay found that the anterior pituitary lobe extract increases the resistance to insulin in normal and hypophysectomized dogs (Houssay, 1936). This was the first correlation between a pituitary “factor” inducing insulin resistance. Since then, numerous studies have shown that growth hormone (GH) possesses anti-insulin action and is a diabetogenic molecule (Bratusch-Marrain et al., 1982). Therefore, GH would be suspected to generate insulin resistance in tissues, such as adipose, muscle, and liver, which respond to both GH and insulin. Indeed, liver (Yakar et al., 2005), adipose tissue
(Kloting & Bluher, 2005; Nilsson et al., 2005), and muscle (Jorgensen et al., 2006) have been shown to be affected by GH to induce insulin resistance. Accordingly, the long- lived GHR-/- mice, which have no GH signaling, are very insulin sensitive (Liu et al.,
2004). The molecular mechanisms responsible for GH-induced insulin resistance are not completely understood.
The ability of GH to induce insulin resistance, resulting in a hyperinsulimic state, may contribute to poor health during aging. In fact, aging is associated with progressive development of insulin resistance that ultimately affects glucose disposal in peripheral tissues, inhibition of lipolysis in adipose tissue, and removal of insulin’s down regulation of the control of gluconeogenesis by the liver (Picard & Guarente, 2005). Consistent with 27
this notion is the fact that calorie-restricted (CR) rodents that are long lived have low glucose, low insulin, high insulin sensitivity, and increased lifespans (Heilbronn &
Ravussin, 2003). In fact, data from more than 400 healthy individuals with age ranges from 28 to 110 indicated a significant increase in insulin sensitivity in the subjects from
90-100 years old (Paolisso, Barbieri, Bonafe, & Franceschi, 2000). Overall, the ability of
GH to influence insulin signaling is probably an important factor in how this hormone alters aging.
Mouse Models with Altered GH/IGF-1 Axis and Aging
Several mouse models with reduced activity of the GH/IGF-1 axis have shown increased lifespan. For example, Ames and Snell dwarf mice have impaired development and differentiation in the anterior pituitary by genetic mutation, resulting in deficiencies
in thyroid-stimulating hormone, prolactin, and GH. These dwarf mice possess decreased
IGF-1 levels and increased longevity. The reduced activity of the GH/IGF-1 axis may be
one of explanations for the dwarf phenotypes seen in the Ames and Snell mice (Wolf et
al., 1993).
GHR-/- mice are long-lived dwarf mice with elevated circulating GH and
markedly reduced IGF-1 levels (Coschigano et al., 2003). GHR-/- mice also are relatively
obese (Berryman et al., 2004), have decreased fasting insulin and glucose levels
(Coschigano et al., 2003), and do not develop glomerularsclerosis in response to
streptozotocin-induced diabetes (Bellush et al., 2000). GH antagonist (GHA)
competitively blocks or occupies the GHR. GHA mice are dwarf and have relatively low
levels of IGF-1, yet do not have an extended lifespan (Coschigano et al., 2003). Thus, GH 28 action is significantly decreased in the GHA mice, but not completely absent as compared to GHR-/- mice.
Other mouse models offer support for the notion that higher GH or IGF-1 and/or insulin resistance shorten lifespan, while lower levels increase lifespan. Mice that express a bovine GH transgene have a decreased lifespan. These mice have increased body size, elevated circulating IGF-1 levels, insulin resistance, hyperinsulinemia, and premature death from liver, kidney, and heart disease (Doi et al., 1988).
The IGF-1 receptor (IGF-1R-/-) homozygotes mice die at birth. However, IGF-
1R-/- heterozygotes mice have normal growth, metabolic rates and reproduction parameters. The female, but not male, heterozygous mice live about 25% longer than their normal littermates and resist paraquat-induced oxidative stress (Holzenberger et al.,
2003). Mice lacking the IGF-1 receptor substrate p66shc live 30% longer than their normal littermates and better tolerate paraquat-induced oxidative stress (40% increased survival time) (Migliaccio et al., 1999).
Taken together, these studies demonstrate the importance of the GH/IGF-1 axis on longevity by using several mouse models.
Mouse Models with Tissue-Specific Gene Disruption in Aging and Glucose Homeostasis
Tissue-specific gene disruption in mice has also implicated several tissues as key mediators of extended longevity or altered insulin sensitivity. For example, the fat- specific insulin receptor gene-disrupted (FIR-/-) mouse shows a 15-25% decreased body weight and a 50-75% lower fat mass at 3 months old. These lean mice are resistant to the age-related decline in glucose tolerance seen in their littermates control and have 29
increased lifespan (Bluher, Kahn, & Kahn, 2003). In addition, the liver-specific IGF-1
gene disrupted (LIGF-1-/-) mice have normal growth parameters and do not differ from
wild-type litermates when compared by body weight, body length, and femoral length
(Yakar et al., 1999). These lean mice have increased insulin insensitivity mainly observed
in muscle tissue (Yakar et al., 2001). Treatment of these lean mice with either
recombinant human IGF-1 or GH-releasing hormone antagonist reduces circulating GH
levels and increases insulin sensitivity (Yakar et al., 2001). Also, when these lean mice are crossed with GHA mice, insulin resistance disappears (Yakar et al., 2004). Thus, the insulin resistance seen in the lean mice is due to the increased levels of GH.
These data highlight the important contributions of individual tissues on global insulin resistance. Also, these data show that selectively removing the action of GH in three major insulin- and GH-sensitive tissues is crucial for better understanding the extension of lifespan seen in GHR-/- mice.
Tissues Effect to GH and Insulin Action
Insulin sensitivity is a key component to the aging process; that is, as insulin
resistance increases, lifespan decreases. Three insulin-responsive tissues (liver, muscle,
and adipose tissue) are also key players in GH’s functions. Thus, the absence of GH
signaling in these three tissues may be also important in the aging process.
Liver
Liver is a critical player in both insulin and GH function. GH stimulates the production of IGF-1through JAK-STAT signaling pathway (Binder, Neuer, Ranke, &
Wittekindt, 2005). The liver is a major target organ of this GH function and the principal 30
site of IGF-1 production. GHRs are abundant in liver, making the liver highly responsive
to GH action.
Liver may also contribute to aging. In the liver, age-related changes include a
reduction in mass and total blood flow (Wynne et al., 1989). The aging liver is somewhat more susceptible to injury from toxins, oxidative stress, and viruses, and its ability to
regenerate is sluggish (Schmucker, 2005).
How GH or insulin action is related to these age-related changes is unclear.
However, liver-specific GHR-/- mice have been recently generated using the albumin
promoter (Fan et al., 2009). These liver-specific GHR-/- mice have a deletion of the
GHR in liver at more than 90% while GHR levels remain normal in the rest of the body
(Fan et al., 2009). Interestingly, these mice exhibit more than 90% suppression of circulating IGF-1 and total bone density is significantly reduced. Circulating GH is increased four-fold, and these mice display insulin resistance, glucose intolerance, and increased circulating free fatty acids. This study suggested that that hepatic GH signaling is essential to regulate intrahepatic lipid metabolism and may further indicate that the increased longevity seen in GHR-/- mice is not predominantly due to lack of GH signaling in the liver. Of note, longevity has not been reported in these animals.
Muscle
GH is a strong anabolic agent on skeletal muscle and stimulates protein turnover.
It also stimulates amino acid uptake and protein synthesis in muscle and other tissues.
IGF-1 also appears to be the key player in muscle growth, stimulating both the differentiation and proliferation of myoblasts (Florini, Ewton, & Coolican, 1996). 31
Muscle wasting can be an important factor for aging, resulting in decreased
protein synthesis, reduced enzymatic activity, a reduction in energy reserves, increased
oxidative damage, and changes in ion content (Carmeli, Coleman, & Reznick, 2002). GH
regulates substrate metabolism in muscle by antagonizing insulin-stimulated glucose disposal and by increasing lipolysis (Jorgensen et al., 2006). Insulin also has a profound impact on muscle, as skeletal muscle is the principle tissue responsible for insulin- stimulated glucose disposal.
Muscle-specific GHR-/- mice (GHRMD) (MCK-Cre promoter) with high-fat diet feeding (Vijayakumar et al., 2012) was associated with reduced adiposity, improved insulin sensitivity, lower systemic inflammation, decreased muscle and hepatic triglyceride content, and greater energy expenditure compared with control mice. This paper also indicates a possible mechanism whereby GHR signaling in muscle could affect liver and adipose tissue function. However, another group also produced a muscle- specific GHR-/- mice with a different tissue specific promoter (mef2c-Cre promoter). In
this line, muscle-specific GHR-/- mice had higher body weight compared with control
mice by 12 weeks (Mavalli et al., 2010). Quantitative magnetic resonance (qMR)
showed that the increased body weight is due to increased fat mass, especially
peripheral adipocytes tissue. Further, these mice are glucose intolerant and insulin
resistant. Again, aging has not been reported for either cohort of animals.
Adipose Tissue
Adipose tissue is a metabolic and endocrine organ (Ahima & Flier, 2000).
Adipose tissue contains adipocytes, connective tissue matrix, nerve tissue, endothelial 32
cells, and immune cells. Its functions include not only energy storage, but also hormone
secretion (Siiteri, 1987), such as leptin and adiponectin. Therefore, adipose tissue may
play an important role in life span.
GH is known to radically alter adipose tissue mass and function. GH levels have
been shown to influence the secretion of adipokines, such as leptin and adiponectin, that
influence insulin sensitivity (Nilsson et al., 2005). The long-lived male GHR-/- mice have been shown to be relatively obese as compared to control mice with higher adiponectin and leptin levels (Berryman et al., 2004). In addition, GH regulates adipocyte proliferation and differentiation and decreases fat deposition by both inhibiting triglyceride accumulation and increasing lipolysis (Wabitsch et al., 1996).
Tissue-specific deletion of other receptors has shown the importance of adipose tissue in longevity. Briefly, long-lived mice with a fat-specific disruption of the insulin receptor gene (FIRKO) suggest that leanness is the key contributor to extended longevity in mice (Bluher et al., 2003). Adipose specific deletion of GHR in mice, as we are generating for this proposal, has not previously been reported in the literature.
Cre/LoxP System
The Cre/LoxP system is an approach for generating tissue-specific gene knockout
mice (Sauer & Henderson, 1988; Sternberg & Hamilton, 1981). The standard method
requires two different genetically engineered mouse lines to achieve a tissue-specific
gene deletion. In most cases, Cre- and LoxP-containing strains of mice are developed
independently and then crossed to generate offspring with the tissue-specific gene
knockout (see Figure 3). The floxed mouse strain contains a targeted gene (GHR exon 4) 33
flanked by two LoxP sites in a direct orientation. The Cre mouse strain is a conventional transgenic mouse line expressing the Cre recombinase under the control of a promoter that is specific for a particular tissue type. When the floxed mouse and the Cre-expressing mouse are crossed, some offspring will inherit both the floxed gene and the Cre-
expressing transgene. In the tissue where the Cre recombinase is expressed, the DNA
segment (GHR exon 4) flanked by the LoxP sites will be excised. GHR exon 4 will be
inactivated, and GHR mRNA and GHR protein will not be produced. GHR will remain
the same in the tissues without Cre expression.
LoxP Site
A LoxP site is a 34-base pair (bp) DNA sequence that is composed of an 8-bp
core (which determines directionality) flanked on each side by 13 bp of palindromic
(complementary) sequences. Although LoxP sites are prevalent in the genomes of
bacteriophages, this exact 34 bp of sequence is statistically unlikely to occur naturally in
the mouse genome. Multiple LoxP sites can be introduced into the mouse genome by
targeted mutagenesis in embryonic stem (ES) cell lines. Sequences flanked by LoxP sites
are then said to be “floxed.”
34
Figure 3. The Cre/Lox method for tissue specific GHR knockout. Cre recombinase only expressed in certain selected tissue (driven by tissue specific promoters (TSP)) and the floxed strain only has a gene, GHR exon 4 in this case, surrounded by flox sites. When crossed, these alterations will cause GHR exon 4 deletion in only selected tissues. In tissues without Cre expression, GHR will be present.
Cre Recombinase
The bacteriophage P1 encodes the 38-kDa cyclization recombination recombinase enzyme known as Cre (cre-ates recombination) (Sauer & Henderson, 1988; Sternberg &
Hamilton, 1981), which catalyzes recombination between two specific DNA repeats. Cre is a member of the integrase family of recombinases; it recognizes a specific 34-bp 35 nucleotide sequence motif called a LoxP site (“locus of crossover P1”). Cre functions through a transient DNA-protein covalent linkage to bring the two LoxP sites together and mediate site-specific recombination. Depending on the orientation of the paired LoxP sites, the DNA segment between them will be either excised or inverted. When the two direct repeats are in the same orientation, Cre excises the intervening DNA segment, resulting in a single remaining LoxP site. When the repeats are inverted (in opposite orientations), the DNA segment undergoes inversion and the two LoxP sites remain. This can also lead to gene inactivation; however, because the segment can flip back
(reactivate), it is not used in mouse knockout constructs.
Types of Cre-Expressing Lines
Over the past decades many tissue-specific and/or inducible Cre-expressing mouse lines have been developed for the study of gene function. Cre-expressing mouse lines can be searched in the Jackson Laboratory. Table 1 lists several examples of tissue/or cell-specific Cre-expressing mice.
36
Table 1
Examples of Some Established Tissue/or Cell-Specific Cre-Expressing Mice
Promoter Tissue/cell of Cre expression References
Alb Liver Postic et al, 1999
aP2 Adipose tissue He et al, 2003
ApoE Kidney Leheste et al, 2003
Ins2 Pancreatic b-cells Gannon et al, 2000
Lck T cells Gu et al, 1994
LysM Macrophage, neutrophil Takeda et al, 1999
MCK Skeletal muscle Miniou et al, 1999
Tie 1 Endothelial cells Gustafsson et al, 2001
Comparison of Liver, Fat and Muscle-Specific Promoters
The albumin (see Table 2) promoter is commonly used to generate liver-specific- gene deletion. The albumin promoter has been shown to be fairly specific based on studies reported by Jackson Laboratories (stock number: 003574). However, the deletion in the liver of some genes driven by albumin is not 100% (Fan et al., 2009).
37
Table 2
Examples of Albumin Cre for Liver-Specific Gene Deletion
Methods to confirm Cre promoter Gene disrupted gene deletion References
Albumin GHR exon 4 RT-PCR Fan et al., 2009 qPCR Immunohistochemistry
Albumin ACC1 exon 22 PCR Mao et al., 2006 RT-PCR Southern blot Western blot
Albumin Frataxin exon 4 PCR Thierbach et al., RT-PCR 2005 Southern blot
The muscle-specific knockout promoter of creatine kinase (MCK) is commonly used for muscle-specific gene deletion (see Table 3). This promoter is active in skeletal muscle (Bruning et al., 1998; Zong et al., 2009), but also in brain, lung, and macrophages at very low levels (Johnson, Wold, & Hauschka, 1989), but not in adipose tissue (Kumar et al., 2008). However, in a recent paper, the recombination driven by MCK is expressed restrictively only in various muscle groups (quadriceps, extensor digitorum longus, and soleus) and heart of muscle specific GHR-/- mice (Vijayakumar et al., 2012). The mef2c-
Cre promoter successfully generates skeletal muscle-specific knockout mice for two genes-GHR and IGF-1 receptor (Mavalli et al., 2010).
38
Table 3 Examples of MCK Cre for Muscle-Specific Gene Deletion
Methods to confirm Cre promoter Gene disrupted gene deletion References
MCK Insulin receptor PCR Bruning et al., exon 4 Western blot 1998 Northern blot
MCK Rictor exon 3 PCR Kumar et al., RT-PCR 2008 Western blot
MCK GHR gene Semiquantitative PCR Vijayakumar et qPCR al., 2012 Westernblot
MCK β 1 integrin gene PCR Zong et al., Exon 2 Western blot 2008
The aP2 promoter drives Cre recombinase expression (He et al., 2003) in adipose tissue (see Table 4). It is a widely used Cre promoter of targeting adipose tissue for gene deletion (Bluher et al., 2002; Polak et al., 2008). However, the adipose promoter, aP2, is known to be leaky (Martens, Bottelbergs, & Baes, 2010; Urs, Harrington, Liaw, & Small,
2006; Wang, Deng, Wang, Sun, & Scherer, 2010). The efficiency of aP2 promoter is 50-
85% in the adipose tissue, and aP2 promoter also works outside of the adipose tissue with lower deletion efficiency in the liver (Mao et al., 2009). There are other promoter options for fat-specific gene deletion (adiponectin promoters), but they were not commercially available when our mice were generated. 39
Table 4 Examples of aP2 Cre for Adipose Tissue-Specific Gene Deletion
Methods to confirm Cre promoter Gene disrupted gene deletion References
aP2 Insulin receptor Western blot Bluher et al., exon 4 PCR 2002
aP2 Autotaxin exons 6 PCR Dusaulcy et and 7 Western Blot al., 2011 qPCR
aP2 peroxisome Southern blot He et al., 2003 proliferator- activated receptor γ
aP2 Acetyl-CoA RT-PCR Mao et al., carboxylase 1 qPCR 2009 (ACC1) exon 22
aP2 raptor Western blot Polak et al., 2008
Advantages/Disadvantages of Tissue-Specific Knockout Animal
There are several advantages of the Cre/LoxP system. First, Cre-LoxP system is flexible. It can easily to generate global, tissue-specific or cell-specific gene deletion mice based on the floxed target mice line. Second, the Cre-LoxP system can also be utilized to generate time-specific gene deletion mice. An inducible Cre mouse line will be used to breed with the floxed target mouse line. Finally, the Cre-LoxP system has 40
potential for expansion. The target floxed mouse line can be bred with a number of
different tissue-and/or time-specific Cre mouse lines to study the role of the target gene at
a number of sites. Similarly, the Cre-expressing mice can be crossed with a number of different floxed mouse lines to study a number of genes in a tissue of interest.
There are some disadvantages to the Cre/LoxP system. First, a true tissue-specific
promoter is hard to find. For example, the efficiency of aP2 Cre promoter is 50-85%
(Mao et al., 2009), while the efficiency of albumin is more than 90% (Fan et al., 2009).
Cre expression is largely dependent on the site of integration. Second, the LoxP sites can
also have an impact on the expression levels of the target gene in the floxed mice. Finally,
the inducer of inducible Cre models may have a significant impact on the phenotype.
Tamoxifen, a widely used inducer, can also have side effects on estrogen-responsive organs such as the bone, uterus, breast, and liver, independently of target gene deletion.
Tissue-Specific GHR-/- Mice Using Cre/LoxP System
There are five published papers reporting tissue-specific GHR deletion (see Table
5).
41
Table 5 Papers with Tissue-Specific GHR Deletion
Tissue Cre-promoter Methods to confirm References gene deletion
Liver Albumin RT-PCR Fan et al., 2009 qPCR Immunohistology
Muscle MCK Semiquantitative PCR Vijayakumar et qPCR al., 2012 Western blot
Muscle Mef2c qPCR Mavalli et al., 2010
β cell RIP (rat insulin PCR Wu et al., 2011 II promoter) Immunofluorescence qPCR
Macrophage Cell culture PCR Lu, Kumar, RT-qPCR Fan, Sperling, Western blot & Menon, 2010
In the paper of the liver-specific GHR-/- mice (Fan et al., 2009), the gene deletion
was confirmed at the level of mRNA (RT-PCR, result shown in gel; qPCR, result shown as a histogram figure) and protein (immunohistology). Fan et al. reported that the GHR mRNA expression was decreased by 90% in the liver, and the protein is absent in the liver. The details of qPCR method provided in Fan et al.’s paper are the kits used for
RNA isolation, reverse transcription, and qPCR action. However, the details, such as reference genes and plate setup, were not provided. 42
The two manuscripts reporting muscle-specific GHR-/- mice utilized different
promoters, which might have caused disparate findings in these papers (Mavalli et al.,
2010; Vijayakumar et al., 2012). The temporal expression of these promoters is distinct.
Mef2c (myocyte-specific enhancer factor 2C) Cre promoter is expressed maximally in
the postnatal period. Muscle creatine kinase (MCK) gene is activated during the
differentiation from myoblasts to myocytes (Chamberlain, Jaynes, & Hauschka, 1985).
Thus, MCK is expressed earlier than mef2c. With the muscle-specific GHR-/- mice using the MCK-Cre promoter (Vijayakumar et al., 2012), the GHR deletion was confirmed
with DNA (Semiquantitative PCR), mRNA (qPCR), and protein (Immunoblot of the
downstream STAT5 phosphorylation) levels. Vijayakumar et al.’s (2012) paper provided
many details, such as kits, reference genes, and mice number and age. However, Mavalli
et al.’s (2010) paper reported the muscle-specific GHR-/- mice with the Mef2c-Cre
promoter only examined the GHR deletion at the mRNA (qPCR) level. No details are
provided about the procedure except details about the age of the mice used. Because
Mavalli et al. used a different promoter than our laboratory, and because they reported
few details about their methods, it is impossible to compare their results directly to mine.
The final two papers examined different cell types than will be targeted in our
studies, macrophages and beta cells. The paper (Wu et al., 2011) about β cell-specific
GHR-/- mice (RIP-Cre promoter) examined the GHR deletion on DNA (PCR), mRNA
(qPCR) and protein (immunofluorescence) levels. The GHR mRNA expression decreased
95% only in the β cell. Wu et al.’s (2011) paper provided few details about the qPCR
procedure utilized. The deletion of GHR in macrophages focused on culturing of isolated 43
macrophages from these mice (Lu, Kumar, Fan, Sperling, & Menon, 2010). Thus, the
complication of other cell types and expression of GHR in other tissues was not an issue
in Lu et al.’s (2010) study. Thus, the comparison with my work is not necessary.
Collectively, these papers rely heavily and consistently on confirming GHR
deletion at the mRNA level. Unfortunately, few of these papers provided sufficient detail
to directly compare their methods to the methods in the present thesis.
Summary
GH is a diabetogenic molecule that has repeatedly been linked to aging. GHR-/-
mice were developed by Zhou et al. (1997) at the Edison Biotechnology Institute at Ohio
University. These GHR-/- mice lack the GHR in all tissues, which leads to no GH action.
Furthermore, these mice, comparing with wild-type mice, are dwarf, possess low levels
of IGF-1 and insulin, and are extremely insulin sensitive. GHR-/- mice have an extended
life span, making them of interest to aging research. The exact tissues responsible for
advanced longevity in GHR-/- mice are thought to be adipose tissue, muscle, and liver,
which respond to both GH and insulin. To examine the individual contributions of three
tissues to the overall insulin sensitivity and longevity in GHR-/-mice, three tissue-specific
(adipose, muscle and liver) GHR-/- mice have been created using a Cre-Lox system.
Three different tissue specific promoters, albumin, aP2, and MCK, have been used to drive the Cre recombinase expression only in liver, adipose, and muscle tissues, respectively. The phenotype of tissue-specific GHR-/- mice depends on the efficiency of
DNA deletion, the mRNA expression level and encoded peptide expression level. The
mRNA expression level relies on the genotype of mice, and is regulated by many factors 44 in the cell. Therefore, it is important to examine the expression of target mRNA to validate the extent and leakiness of the tissue-specific gene deletion. This thesis attempts to validate the deletion of growth hormone receptor on mRNA level by a qPCR method.
The validation is critical for us if we are to draw future conclusions regarding the phenotype and longevity of these novel mouse lines.
45
CHAPTER 3: METHODS
PO1 Project
This thesis project relates to the NIH funded PO1 Project (AG031736) entitled
“The Somatotropic Axis and Health Aging: A Search for Mechanisms.” This project is a
collaborative effort among five research groups: Mayo Clinic, University of Michigan,
Southern Illinois University, University of Texas San Antonio, and Ohio University. Dr.
John Kopchick is the PI at the Ohio University and is in charge of generating and characterizing the tissue-specific gene disrupted animals for the program grant.
We hypothesize that the lifespan extension seen in the GHR-/- mouse is due to decreased GH action and consequently increased insulin sensitivity in selected insulin- responsive tissues. We had selectively disrupted the GHR gene in liver, adipose and muscle to determine their individual contributions to overall insulin sensitivity and longevity. The goal of this thesis will be to validate that gene disruption of GHR at the level of mRNA using qPCR.
Animals
All mice were housed in a specific animal resource facility located in Edison
Biotechnology Institute (EBI) at Ohio University. Ohio University is registered as a research facility by the USDA (license #31-R-082) and has a letter of assurance on file with the Office for Protection from Research Risks at the National Institutes of Health
(OPRR /NIH). Animals are maintained under veterinarian care and the aide of experienced lab technicians and support staff. All mice were fed ad libitum with standard laboratory rodent chow (ProLab RMH 3000; LabDiet, Richmond,VA, USA) after 46
weaning. All of these procedures are consistent with the recommendations of the
American Veterinary Medical Association and were approved by the Ohio University
Institutional Animal Care and Use Committee (H97-18 & H00-10).
The specific mouse lines used in this study include one global knockout mouse and three tissue-specific GHR-/- mouse lines along with their controls. Table 6 describes all groups of mice used for validation experiments described in this thesis.
47
Table 6 Summary of Experimental and Control Mice
Mice Genotype Description
Controls Wild type ffcc No Cre, No LoxP
EIIa FFCc Cre expressed using a global promoter to knockout GHR in all tissues
Floxed control FFcc Floxed GHR, no Cre
Liver-specific Cre control ffCc Cre gene (albumn promoter), no LoxP
Muscle-specific Cre control ffCc Cre gene (MCK promoter ), no LoxP
Adipose-specific Cre ffCc Cre gene (aP2 control promoter), no LoxP
Experimental Liver-specific knockout FFCc Floxed GHR knockouts Cre expressed using albumin promoter
Muscle-specific knockout FFCc Floxed GHR Cre expressed using MCK promoter
Adipose-specific knockout FFCc Floxed GHR Cre expressed using aP2 promoter Note. “c” represents that the genome is absent of the Cre Recombinase gene “C” represents a present Cre Recombinase gene “f” represents the absence of LoxP sequences, and nothing is floxed “F” represents floxed GHR
48
The following purchased Cre strains were used to generate the global or tissue specific GHR gene disruption:
• Liver. The liver-specific C57BL/6J strain mice are transgenic for the
bacteriophage PI Cre-recombinase gene with expression under the control of
the mouse albumin enhancer/promoter (Postic et al., 1999). This strain
(B6.Cg-Tg(alb-cre)21Mgn/J) is available from the Jackson Laboratory (stock
number: 003574).
• Muscle. The muscle-specific C57BL/6J strain of mice are transgenic for the
bacteriophage PI Cre-recombinase gene with expression under the control of
the MCK promoter (Miniou et al., 1999). This strain (B6.Cg-Tg(ACTA1-
cre)79Jme/J) is available from the Jackson Laboratory (stock number:
006149).
• Adipose. The adipose-specific C57BL/6J strain of mice are transgenic for
the bacteriophage PI Cre-recombinase gene with expression under the
control of the mouse fatty acid binding protein 4 (also called aP2) adipocyte
enhancer/promoter (He et al., 2003). This strain (B6.Cg-Tg(Fabp-cre)1Rev/J)
is available from Jackson Laboratories (stock number: 005069).
• The global knockout mouse (EIIa) was derived from a Cre transgene under
the control of the adenovirus EIIa promoter that targets expression of Cre
recombinase to the early mouse embryo. Cre expression is thought to occur
prior to implantation in the uterine wall. Cre-mediated recombination occurs
in a wide range of tissues, including the germ cells that transmit the genetic 49
alteration to progeny. Note that this is a separate global knockout mouse line
than what was originally created (Zhou et al., 1997) and is used as a control
to validate procedures for qPCR only. This strain (B6.FVB-Tg(EIIa-
cre)C5379Lmgd/J) were purchased from the Jackson Laboratory (stock
number: 003724).
For generation of all mice, breeding and genotyping details are beyond the scope of this thesis. The specific mice used in this study include 5 male (8 months) EIIA mice and five wild-type littermate controlsfor validating qPCR methods. For studies to validate tissue-specific GHR deletion, 6 female mice of 12, 12, and 8 months of age for liver-specific GHR-/-, muscle-specific GHR-/-, and adipose tissue-specific GHR-/-, respectively, were utilized. For each line, littermate floxed control mice were used as negative controls.
Tissue Collection
For wild type and EIIa mice studies, select tissues (subcutaneous, retroperitoneal, mesenteric, and perigonadal white adipose tissue, brown adipose tissue, liver, muscle- gastrocnemius) were dissected (5 mice per group). For tissue specific gene disrupted mice and floxed controls, tissues dissected included subcutaneous, retroperitoneal, mesenteric, and perigonadal white adipose tissue, brown adipose tissue, liver, muscle
(quadriceps and gastrocnemius), heart, lung, kidney, and brain (6 mice per group). For all tissue sample collections, mice were sacrificed using CO2 inhalation. To reduce the chance of cross-contamination of tissues, all dissecting tools were washed with PBS 50
between every tissue sample. All tissues were flash frozen in liquid nitrogen and stored
at -80 °C until further use.
Use of MIQE Guidelines to Guide qPCR Experiments
The Minimum Information for Publication of Quantitative Real-Time PCR
Experiments (MIQE) guidelines were strictly followed in this thesis. MIQE is a set of
guidelines that describe the minimum information necessary for evaluating qPCR
experiments. These guidelines help ensure the integrity of the scientific literature,
promote consistency between laboratories, and increase experimental transparency. The
MIQE checklist followed in this study (see Appendix I) include experimental design,
sample description, process procedure description and other details.
RNA Isolation
Tissue was homogenized using the Precellys® 24-dual (Bertin technologies,
France, Serial No. 010-0118), which requires the use of specifically sized beads (small beads or small/big mixed beads) and setting for each particular tissue (see Table 7). The amount of tissue required to isolate sufficient RNA is also summarized in Table 7. After homogenization, RNA from dissected tissues was purified using Qiagen RNeasy® Mini
Kit (Germantown, Maryland, Cat. No. 74106), according to the manufacturer’s instructions and as thoroughly outlined in Appendix II. Concentration of the mRNA from all samples was measured by the Thermo® NanoDrop 2000c (Serial No. 4399) and
RNA integrity via the Agilent® 2100 Bioanalyzer (Cat. No. G2939AA). All conditions were optimized for each tissue and prior to any qPCR analyses. Store the remaining
RNA samples at -20 °C or -80 °C for following steps. 51
Table 7 Optimized Conditions for Homogenization of Various Tissues for RNA Isolation
Tissues Weight Homogenization time Bead Size
Liver 20mg 1 for 20s Small*
Perigonadal 30mg 1 for 20s Small
Subcutaneous 30mg 1 for 20s Small
Brown Adipose Tissue 10mg 1 for 20s Small
Mesenteric 30mg 1 for 20s Small
Retroperitoneal 30mg 1 for 20s Small
Gastrocnemius 30mg 2 for 20s Mixed**
Quadriceps 30mg 2 for 20s Mixed**
Kidney 20mg 1 for 20s Small
Lung 20mg 1 for 20s Small
Brain 15mg 1 for 20s Small
Heart 20mg 2 for 20s Mixed *Small beads are Precellys® zirconium oxide beads (1.4mm; Cat. No. 03961-1-103). **Mixed beads means small beads plus big beads. Big beads are Precellys® zirconium oxide beads (2.8mm; Cat. No. 03961-1-102).
52
Reverse Transcription (from RNA to cDNA)
Since mRNA is not stable, mRNA needs to be reverse transcribed to cDNA to
conduct quantitative analyses. The cDNA synthesis was performed using Qiagen
QuantiTect® Reverse Transcription Kit (Hilden, Germany, Cat. No. 20513). The protocol is personalized based on manufacturer’s directions and as fully outlined in Appendix III.
It includes two major steps: the genomic DNA elimination reaction (3 min at 42 °C) and reverse-transcription reaction (30 min at 42 °C). Then incubate for 3 min at 95 °C to inactivate Quantiscript Reverse Transcriptase. All cDNA samples were kept on ice when quantitative PCR was performed the same day or stored at –20 °C if qPCR was performed at a later date.
Quantitative Polymerase Chain Reaction (qPCR)
Qiagen QuantiTect® SYBR Green PCR Kit (Hilden, Germany, Cat. No. 204145) is used for quantitative PCR. The protocol details are in appendix IV. This kit uses Sybr
Green technology to monitor DNA synthesis. Sybr Green is a dye which binds to double stranded DNA but not to single stranded DNA so as the cDNA is amplified, more double stranded DNA is made and more fluorescence generated. Using this technology, one can monitor when the amount of fluorescence reaches a certain threshold, which is dependent on the amount of target mRNA originally present in the sample. The BIO-RAD iCycler® Thermal Cycler (Serial No. 584BR 01086) and corresponding software were used to run and monitor the fluorescence during the qPCR run, respectively. The run protocol details are including in Appendix IV. Mix the water, a pair of primers
(20μmol/L), Sybr Green master together in proper portion. Then pipette the liquid in the 53
wells of the PCR plate (18uL per well). Add 2uL cDNA (0.5mg/L) in each well (arranged
by actual runs). Each tissue was tested with a pair of primers for the GHR gene as well as
seven reference genes (primer pairs are listed in Table 8).
In actual runs, the software noted a threshold, which measures cycle number for
each well—Ct value. This threshold is set in the linear part of reaction and close to the
bottom of the curve. More dilute samples will cross at later Ct values.
Every run of qPCR has negative controls (no template control, no reverse
transcription control). These controls will make sure there is no contamination during
every qPCR run (negative control). In order to analyze data, one target gene (GHR) and
seven reference genes are used. The primer names and primer sequences are in the Table
8.
54
Table 8
Sequence of Primers for Reference Genes
Primers Sequences
GHR-Foward 5’-GCCTGGGGACAAGTTCTTCTGGA
GHR-Reverse 5’-TGCAGCTTGTCGTTGGCTTTCCC
EEF2-Foward 5’-TCGGCGCGCTTCCCTGTTCAC
EEF2-Reverse 5’-ATGCCAGCCTTGCACACAAGGG
RPS3-Foward 5’-ATCAGAGAGTTGACCGCAGTT
RPS3-Reverse 5’-AATGAACCGAAGCACACCATA
B2M-Foward 5’CTGGTCTTTCTATATCCTGGCT
B2M-Reverse 5’-CATGTCTCGATCCCAGTAGAC
ACTB-Foward 5’-CAGCTTCTTTGCAGCTCCTT
ACTB-Reverse 5’-CACGATGGAGGGGAATACAG
HPRT-Foward 5’-ATCAGTCAACGGGGGACATA
HPRT-Reverse 5’-AGAGGTCCTTTTCACCAGCA
EIF3F-Foward 5’-TACGAACGCCGCAACGAGGG
EIF3F-Reverse 5’- TGGCACCGAAAAGCAGTTGGTGA
RPL38-Foward 5’-CGCGTCGCCATGCCTCGGAA
RPL38-Reverse 5’-ACTTGGCATCCTTCCGCCGGG
55
Data Analysis
Qbase Plus from Biogazelle will be used to analyze the qPCR results (see
Appendix V). Reference genes are genes known to be consistently expressed in a given tissue. Thus, the relative expression of the genes of interest can be determined by comparing their expression to that of the housekeeping genes. The software translates Ct value into relative expression of messenger RNA. The relative expression levels determined for each tissue-specific knockout mice line—liver-/-, fat-/- and muscle -/-, were compared to the relative expression levels in their floxed controls in select tissues.
This method shows the effect of varying levels of growth hormone on mRNA expression level. Expression data are reported as relative expression values ± SEM. the standard error of the mean (SEM) is also calculated using Qbase Plus.
The statistical significance is also calculated through unpaired t-test in normal distribution using Qbase Plus. No comparison is made among tissues or between tissue- specific knockout mice line. Results were considered significant when p < 0.05. The software also assesses the housekeeping genes’ expression stability via geNorm.
56
CHAPTER 4: RESULTS
Validation of qPCR Method
For studies with wild type and EIIa mice, select tissues (liver, skeletal muscle-
gastrocnemius, retroperitoneal, mesenteric, perigonadal, subcutaneous white adipose
tissue, and brown adipose tissue) were examined for GHR expression. The mRNA
expression level of these tissues in these two mouse groups is shown in Figure 4. Because
mRNA expression methods give relative values, the value of GHR expression for the
wild type mice for every tissue is set as “1.” The relative expression of GHR in the EIIa
group is calculated relative to “1.” No GHR mRNA could be detected in the liver,
muscle-gastrocnemius, retroperitoneal and mesenteric white adipose tissue, and brown
adipose tissue of EIIa mice.
Figure 4. mRNA expression level of GHR in wild type and EIIa mice. Shown are means ± SEM. N=5 for all groups. Wild type represents wild type mice, and EIIa represents global GHR-/- mice. ND means the value is zero or not detectable. Perigonadal, mesenteric, retroperitoneal, and subcutaneous are white adipose tissue.
57
GeNorm
GeNorm is a popular algorithm to determine the most stable housekeeping or reference genes from a set of tested candidate reference genes. From this, a gene expression normalization factor can be calculated for each sample based on the geometric mean of a user-defined number of reference genes.
A valuable dataset generated as a byproduct from determining the expression of
GHR in a variety of tissues was that it provided a hierarchy of the most suitable and stable reference genes for each tissue (see Table 9). This information could be used by others as a reference for housekeeping genes for further mRNA studies that involve a variety of tissues. However, since I always normalized the expression levels to the most stable reference genes and these varied tissue to tissue, it is impossible to compare GHR expression levels across all tissues using the MIQE guidelines employed. However, select reference genes that were relatively stable across tissues could be used to get some sense of tissue levels of expression in control mice (see Appendix VII).
58
Table 9
Relative Stability of Housekeeping Gene in Various Tissues
Tissues Most Stable to Less Stable
Liver eef2 rps3 actb eif3f hprt b2m rpl38
Perigonadal rps3 b2m eef2 eif3f rpl38 actb hprt
Subcutaneous rps3 b2m actb eif3f rpl38 hprt eef2
Mesenteric b2m rps3 rpl38 eef2 eif3f actb hprt
Retroperitoneal rpl38 rps3 b2m eef2 eif3f actb hprt
Brown adipose tissue eif3f rps3 rpl38 hprt b2m eef2 actb
Gastrocnemius rps3 eef2 actb b2m hprt rpl38 eif3f
Quadriceps rpl38 rps3 eef2 eif3f hprt actb b2m
Brain b2m eef2 rpl38 eif3f b2m hprt rps3
Kidney b2m hprt eif3f rps3 actb eef2 rpl38
Lung eif3f hprt eef2 rpl38 b2m rps3 actb
Heart hprt rpl38 rps3 actb b2m eef2 eif3f
qPCR for Tissue-Specific GHR-/- Mice
For tissue specific gene deleted mice and floxed controls, tissues examined included liver, muscle (quadriceps and gastrocnemius), perigonadal, mesenteric, retroperitoneal, and subcutaneous white adipose tissue, brown adipose tissue, lung, brain, 59 kidney, and heart (6 mice per group). The specific tissues used for each of the three mouse lines depended on the DNA results that were generated by another graduate student (Zhang, n.d.). His results showed that the liver and muscle-specific gene disruption was relatively clean at the DNA level, meaning that recombination had only occurred in the expected tissues. Thus, only liver, adipose and muscle were assayed in these lines in order to save on the cost of reagents. However, the adipose tissue-specific
GHR-/- showed recombination in all tissues assayed at the DNA level (Zhang, n.d.).
Thus, all available tissues were assayed in the fat specific GHR-/- line. The GHR mRNA expression level is showed in Figure 5, 6 and 7. In these three figures, mRNA expression level is shown as relative expression. The GHR mRNA expression level for the floxed control group (FFcc) in every tissue is set as “1.” The mRNA expression level of the experimental knockout group (FFCc) is calculated relative to “1” in every tissue.
Liver-Specific GHR-/- Mice
In liver-specific GHR-/- mice (see Figure 5), the GHR mRNA expression level significantly decreased (p=0.000000089) approximately 99% in liver as compared to floxed controls (see Table 10). In quadriceps (muscle) and perigonadal (white adipose tissue), GHR mRNA expression level of FFCc mice is almost identical to the floxed control mice in the same tissues.
60
Figure 5. mRNA expression level of GHR in liver-specific GHR-/- mice. Shown are means ± SEM. N=6 for all groups. FFCc represents liver-specific GHR-/- mice, and FFcc represents control mice. A significant difference was seen for liver; p < 0.01, but not for other tissues. * Significant difference, p < 0.01.
Table 10
Unpaired t-Test Result for GHR mRNA Expression Level in Liver-Specific GHR-/- Mice
Tissues P value FFCc/FFcc ratio
Liver 0.000000089 <0.001
Quadriceps 0.703 1.053
Perigonadal 0.885 1.050
61
Muscle-Specific GHR-/- Mice
In muscle-specific GHR-/- mice (see Figure 6), the mRNA expression level decreased approximately 94% in quadriceps (muscle). A significant difference was seen in quadriceps muscle (see Table 11). In liver and perigonadal white adipose tissue, mRNA expression level of gene deleted in FFCc mice is almost the same as the floxed control mice.
Figure 6. mRNA expression level of GHR in muscle-specific GHR-/- mice. Shown are means ± SEM. N=6 for all groups. FFCc represents muscle-specific GHR-/- mice, and FFcc represents control mice. A significant difference was seen for quadriceps; p < 0.01, but not for other tissues. * Significant difference, p < 0.01.
62
Table 11
Unpaired t-Test Result of GHR mRNA Expression Level in Muscle-Specific GHR-/- Mice
Tissues P value FFCc/FFcc ratio
Liver 0.663 1.046
Quadriceps 0.00003 0.065
Perigonadal 0.488 1.181
Adipose Tissue-Specific GHR-/- Mice
In adipose tissue-specific GHR-/- mice (see Figure 7), the GHR mRNA expression level decreased 89%, 77%, 90%, 62%, and 91% in perigonadal, mesenteric,
retroperitoneal and subcutaneous, and brown adipose tissue, respectively. These
differences were significant for adipose depots (perigonadal, mesenteric, retroperitoneal,
and subcutaneous white adipose tissue, and brown adipose tissue depots) (see Table 12).
In liver and gastrocnemius skeletal muscle, GHR mRNA expression level of gene deleted
mice was identical to that of floxed control mice. While the GHR mRNA expression
level decreased moderately in some tissues (20%, 29%, 5% and 6% in lung, brain,
kidney, and heart, respectively), these decreases were not significant.
63
Figure 7. mRNA expression level of GHR in adipose tissue-specific GHR-/- mice. Shown as means ± SEM. N=6 for all groups. FFCc represents adipose tissue-specific GHR-/- mice, and FFcc represents control mice. A significant difference was seen for perigonadal, mesenteric, retroperitoneal, and subcutaneous white adipose tissue as well as brown adipose tissue; p < 0.05, but not for other tissues. * Significant difference, p < 0.05.
64
Table 12
Unpaired T-Test Result of GHR mRNA Expression Level in Adipose Tissue-Specific
GHR-/- Mice
Tissue P value FFCc/FFcc ratio
Liver 0.792 1.008
Gastrocnemius 0.975 0.985
Perigonadal 0.003 0.116
Mesenteric 0.021 0.231
Retroperitoneal 0.009 0.092
Subcuteaneous 0.042 0.377
Brown adipose tissue 0.006 0.087
Lung 0.190 0.794
Brain 0.151 0.708
Kidney 0.797 0.952
Heart 0.527 0.937
65
CHAPTER 5: DISCUSSION AND CONCLUSION
The purpose of this study is to verify the deletion of GHR using a quantitative polymerase chain reaction at the mRNA level in tissue-specific GHR-/- mouse lines.
According to my results, the mRNA expression level of liver and muscle (quadriceps) decreased 99% and 94% in liver-specific GHR-/- mice and muscle-specific GHR-/- mice, respectively. The decrease was specific to the targeted tissue only. Further, evaluating recombination at the DNA level revealed that only the expected tissues (liver in liver specific GHR-/- mice and muscle in muscle-specific GHR-/- mice) had any detectable band indicative of a recombination event (Zhang, n.d.). Together, these data suggest
GHR deletion has been successfully achieved in the liver of liver-specific GHR-/- mice and in muscle for muscle-specific GHR-/- mice.
In the adipose tissue-specific GHR-/- mice, the mRNA expression level decreased
89%, 77%, 90%, 62%, and 91% in perigonadal, mesenteric, retroperitoneal and subcutaneous white adipose tissue, and in brown adipose tissue, respectively. The reduction in these five depots are all statistical significant although the reduction is more moderate as compared to my data generated in either the liver of liver-specific GHR-/- mice or in muscle of muscle-specific GHR-/- mice. Importantly, evaluating GHR deletion at the DNA level showed that a band indicative of recombination was evident in all tissues, indicating that there may be some aP2-Cre activity in a variety of tissues (Zhang, n.d.). Thus, the results of deletion at the DNA level are not consistent with my mRNA results. However, as my data is quantitative and the DNA method used (Zhang, n.d.) is qualitative. Since theoretically it only takes one molecule of DNA for amplification using 66
the DNA method, mRNA results should better reflect the actual amount of GHR present
in the tissue. Also, as fat cells are present in many different types of tissues, some
detection of recombination at the DNA level in other tissues is not completely
unexpected. Taken together, the aP2 Cre-promoter used for the adipose tissue specific
GHR-/- mice appears to mainly target adipose tissue, but the reduction is not as clean or
as complete as seen with the other two tissue specific promoters.
Therefore, this study confirms that the tissue specific deletion is targeted to the tissue of interest. It is crucial for further study. These mice are now ready for more comprehensive phenotypic analyses.
Liver-Specific GHR-/- Mice
In my study, the GHR mRNA expression level in liver dramatically and
significantly decreased in liver-specific GHR-/- mice. All other tissues assayed (muscle and adipose tissue) have similar GHR mRNA expression levels as compared to the control group.
Many papers have utilized the albumin Cre promotor to generate liver-specific
gene deletion in mice to explore the liver specific effect of certain enzymes or hormones.
Although these previous papers use different methods to validate the absence of the target
gene, the results show that the target gene is significantly and consistently removed in
only the liver at the DNA, RNA, or protein level (Mao et al., 2006; Thierbach et al.,
2010). Thus, my findings that GHR expression is significantly and “cleanly” reduced
only in the liver is consistent with these reports. 67
For another liver-specific GHR-/- mouse using the same albumin-Cre promoter
(Fan et al., 2009), qPCR is reported for liver, fat and muscle to confirm the tissue specific
expression of GHR mRNA expression level as I did in this thesis. No details of qPCR are
mentioned in this paper. For instance, the number of mice, the age of mice and the
housekeeping genes for qPCR are not provided. Therefore, it is difficult to directly
compare our results. They do report that the mRNA expression level decreased
approximately 92% for liver. These authors suggest that the residual GHR mRNA
expression that they detect may due to the endothelial cells within liver (Fan et al., 2009).
The GHR expression in adipose and muscle remain the same level as the control group,
which is consistent with my data. This paper utilized other methods to confirm GHR
deletion in the liver. They utilized a PCR method for DNA analysis and an
immunohistochemical method to verify the deletion of GHR protein in the liver. Zhang
(n.d.) has done a comparable analysis at the DNA level in our mice and will be reporting
this data in his thesis, but he sees a similar pattern as reported by Fan et al. (2009). Our
laboratory is currently doing the protein work as well, but has not successfully found an
antibody that works with immunohistochemistry.
Muscle-Specific GHR-/- Mice
In this study, GHR mRNA expression level within muscle (quadriceps) decreased
94% in the muscle-specific GHR-/- mice (using the MCK-Cre promoter) as compared to
controls, which is a significant difference. The mRNA expression level of liver and
perigonadal white adipose tissue remained the same as the control group. These data suggest that this muscle-specific GHR-/- mice specifically targeted the recombination to 68
the muscle and not to other tissues as expected. Thus, as mentioned before and like the liver specific GHR-/- mice, these mice are ready for more thorough phenotypic analyses.
Muscle-specific gene deletion using the MCK-Cre promoter has been reported in
several papers to explore the effect of various muscle proteins. These papers all report
that the deletion of the target gene at either the mRNA or protein level is fairly specific
with a reduction of approximately 90% in skeletal muscle (Bruning et al., 1998; Kumar et
al., 2008; Zong et al., 2009). Thus, my findings that GHR expression is significantly and
cleanly reduced in the muscle is consistent with these reports. However, other papers also
report that the MCK-Cre promoter is also active in cardiac muscle (Bruning et al., 1998;
Zong et al., 2009). Unfortunately, heart tissue was not included in my analyses but should
be in the future (see Appendix VI).
Two separate laboratories have generated muscle-specific GHR-/- mice using two
different promoters. One of these papers uses the mef2c-Cre promoter, which is different
than the one we used (Mavalli et al., 2010). In this paper, gastrocnemius muscle with
qPCR is used to confirm the GHR mRNA expression level (n=6 for control and GHR-/-
mice). This paper only provides mRNA data to confirm the deletion of GHR mRNA from
skeletal muscle. The GHR mRNA expression level in the gastrocnemius muscle
decreased approximately 75% and 80% in 6 and 16 week old mice, respectively. No other
data is provided to confirm GHR deletion is tissue specific. GHR mRNA expression in
other tissues is also not reported in this paper, making it difficult to determine whether
other tissues were impacted. This result is similar to my data. However, the mice in this
thesis are 12 months old and, since the promoter was distinct, a direct comparison is not 69 likely appropriate. It should be noted that the mef2c (Myocyte-specific enhancer factor
2C) Cre promoter is expressed maximally in the postnatal period, which may result in a very different expression profile of the floxed gene than mice generated with muscle creatine kinase (MCK) promoter, which is activated during the differentiation from myoblasts to myocytes (Chamberlain et al., 1985).
Vijayakumar et al. (2012) report the muscle-specific GHR-/- mice using the same the same promoter that we used, MCK-Cre promoter. This paper also utilized quantitative
PCR analysis of GHR mRNA expression in quadriceps muscle of 16-week-old mice
(n=3-4 for control and GHR-/- mice), again as I did. They report that the mRNA expression level decreased significantly at approximately 85% at 16 weeks. This result is similar to my data (94% GHR mRNA reduction), but I found a greater percent reduction.
The difference may be due to differences in the ages of mice examined, as I examined significantly older mice than shown in this paper (16 weeks vs. 12 months). In addition to qPCR, Vijayakumar et al.’s (2012) paper also used genomic DNA (semiquantitative
PCR) to confirm gene deletion (n = 2–3/group, 7- to 8-week-old control and GHR-/- mice). They report that recombination of GHR is detected only in the various muscle groups (quadriceps, soleus, and extensor digitorum longus) and heart of the GHR-/- mice
(Vijayakumar et al., 2012). As stated previously, the activity of MCK-Cre promoter in cardiac muscle has been reported in other papers (Bruning et al., 1998; Zong et al., 2009).
Although GHR mRNA expression level was not reported for other tissues in this paper, semiquantitative PCR studies include brain, fat, kidney, liver, small intestine, and tail as control tissues (Vijayakumar et al., 2012). Results show the deletion to be specific to 70 muscle. Inmmunoblot analysis of STAT5 phosphorylation is also utilized to examine the deletion of GHR gene in this paper (Vijayakumar et al., 2012). STAT5 phosphorylation means that GH is able to bind to GHR and trigger the intracellular action, suggesting whether functional GHR is present. Vijayakumar et al. (2012) report that no phosphorylated STAT5 is found in muscle of muscle-specific GHR-/- mice yet phosphorylated STAT5 is found in liver. Overall, our results are similar to what is reported for other muscle specific GHR-/- lines although careful analysis of the heart tissue would be important to do in the future to determine if this tissue is impacted.
Adipose Tissue-Specific GHR-/- Mice
In my study, the mRNA expression level of adipose tissue-specific mice (aP2-Cre promoter) significantly decreased in perigonadal, mesenteric, retroperitoneal, and subcutaneous white adipose tissue, as well as brown adipose tissue. The mRNA expression of liver, gastrocnemius muscle, kidney, brain, lung and heart were not significantly different than controls. These data suggest that adipose tissues are specifically targeted by aP2-Cre promoter in the adipose tissue-specific GHR-/- mice although the level of reduction is not as dramatic as seen with the other tissue-specific lines.
No paper has reported any findings in adipose-tissue GHR-/- mice. However, the aP2-Cre promoter has been utilized for two decades with various other genes. Most of these papers utilize PCR (DNA) and western blot (encoded protein) to validate the deletion of the gene of interest (Bluher et al., 2002; Polak et al., 2008). Only a few papers use qPCR to confirm the absence of the gene of interest. Some of these papers have 71
shown the ap2-Cre expression to be highly specific. For example, in mice with an adipose
tissue-specific disruption of autotaxin (FATX-/-) (aP2-Cre promoter) (Dusaulcy et al.,
2011), subcutaneous, perigonadal, retroperitoneal white adipose tissue, brown adipose
tissue, brain and kidney are utilized to verify the deletion of autotaxin by qPCR.
Compared with the control group, FATX-/- mice had a strong reduction of autotaxin in
only fat tissue (70 to 90% depending on fat depot, p < 0.05) in both male and female mice
(Dusaulcy et al., 2011). According to the figure in this paper, brown adipose tissue has
the biggest decrease in autotaxin reduction (90%), which is consistent with my data
(92%). Interestingly, the mRNA of autotaxin has no significant change in the stromal
vascular fraction (SVF) in FATX-/- mice (Dusaulcy et al., 2011), thus the change is
expression seems to be specific to the adipocyte fraction. Adipocytes were not isolated
from the stromal vascular fraction but this may be of interest to do in future studies.
There are more recent reports that show the aP2 Cre promoter is not as clean as
some of the earlier reports. For example, the AP2-Cre promoter is activated in white
adipose tissue and brown adipose tissue but also in brain (Martens et al., 2010). This
paper also shows that the recombination efficiency was lower than 50% in gonadal and
subcutaneous adipose tissue. Other adipocyte specific Cre promoters have been utilized
and compared to the aP2 promoter. For example, adipoQ (or adiponectin) promoters have
been utilized (Scherer, Williams, Fogliano, Baldini, & Lodish, 1995). When comparing
the mRNA of Cre isolated form adiponectin-Cre mice versus aP2-Cre mice (Wang et al.,
2010), the results show Cre expression of aP2-Cre mice is in five adipose tissues and also widespread lightly in heart, lung, liver, kidney, colon, skeletal muscle, spleen, stomach. 72
In contrast, Cre expression of adiponectin-Cre mice is restricted to only five adipose
tissues. Although the results show aP2 driven Cre is widely expressed at the mRNA level,
it does not mean efficient deletion of the floxed gene (Wang et al., 2010). Of note, this
paper utilized a non-quantitative form of PCR (RT-PCR) to assess mRNA levels; thus,
caution has to be used in interpreting the data. Regardless, this collective data does
provide evidence that that aP2 is not 100% tissue-specific.
PO1 Project
GHR-/- mice, which have been genetically modified to lack the GHR and GH action in all tissues, are extremely insulin sensitive, relatively obese, and have an extended life span (Berryman et al., 2004; List et al., 2011). This thesis focuses on tissue specific GHR-/- mice. Validation of GHR deletion in specific tissues in three tissue- specific GHR-/- mice lines is critical for further studies of PO1. By comparing the phenotype of the tissue-specific GHR-/- mice with control mice, one can determine the individual contributions of the target tissue to the overall insulin sensitivity and longevity. For example, tissue specific insulin receptor (IR) deletion mice show a different phenotype depending on the tissue targeted for deletion. That is, the global IR-
/- mice generate diabetic ketoacidosis (Accili et al., 1996; Joshi et al., 1996); liver- specific IR-/- mice possess moderate insulin resistance (Michael et al., 2000); muscle- specific IR-/- mice are dyslipidemic (Bruning et al., 1998); adipocyte-specific IR-/- mice are protected against obesity (Bluher et al., 2002). This PO1 project may provide important findings about GHR -/- like the IR tissue specific studies. 73
Summary
This thesis aimed to validate the deletion of GHR on mRNA level by a qPCR method. According to my data, the mRNA expression level of liver and muscle
(quadriceps) has a strong reduction in liver-specific GHR-/- mice line and muscle- specific GHR-/- mice line. In adipose tissue-specific mice line, the mRNA expression level also has a strong reduction in perigonadal, mesenteric, retroperitoneal, and subcutaneous white adipose tissue, and brown adipose tissue. Therefore, my data confirms that the tissue specific deletion is targeted to the tissue of interest.
Further study
Additional studies related to my project should be considered. These might include the following:
1. The verification of tissue-specific gene deletion should also include analysis of
GHR protein levels. While our laboratory is attempting to do this, some problems
have emerged with specificity of commercially available antibodies. As
performed by Vijayakumar et al. (2012), one could also use an indirect assay of
protein function, such as the STAT5 phosphorylation assay. Ongoing studies in
the laboratory are using western blot analysis but histological analyses could also
be performed.
2. Heart should be examined in muscle-specific GHR-/- mice. The recombination
DNA level of these mice shows a Cre band in heart (Zhang, n.d.). In the paper of
Vijayakumar et al. (2012), DNA results also show heart appears to have some 74
level of a recombination. Thus, the heart needs to be examined in the muscle-
specific GHR-/- line.
3. Although beyond the scope of the current grant, one could attempt to construct the
adipose-tissue specific GHR-/- mice using other available fat-specific promoters,
such as the adipoQ promoter mentioned earlier.
75
REFERENCES
Accili, D., Drago, J., Lee, E. J., Johnson, M. D., Cool, M. H., Salvatore, P., . . . Westphal,
H. (1996). Early neonatal death in mice homozygous for a null allele of the
insulin receptor gene. Nature Genetics, 12(1), 106-109. doi: 10.1038/ng0196-106
Ahima, R. S., & Flier, J. S. (2000). Adipose tissue as an endocrine organ [Review].
Trends in Endocrinology and Metabolism: TEM, 11(8), 327-332.
Arden, K. C., Boutin, J. M., Djiane, J., Kelly, P. A., & Cavenee, W. K. (1990). The
receptors for prolactin and growth hormone are localized in the same region of
human chromosome 5. Cytogenetics and Cell Genetics, 53(2-3), 161-165.
Barbieri, M., Bonafe, M., Franceschi, C., & Paolisso, G. (2003). Insulin/IGF-I-signaling
pathway: An evolutionarily conserved mechanism of longevity from yeast to
humans. American Journal of Physiology-Endocrinology and Metabolism, 285(5),
E1064-1071. doi: 10.1152/ajpendo.00296.2003285/5/E1064 [pii]
Barinaga, M., Yamonoto, G., Rivier, C., Vale, W., Evans, R., & Rosenfeld, M. G. (1983).
Transcriptional regulation of growth hormone gene expression by growth
hormone-releasing factor. Nature, 306(5938), 84-85.
Bartke, A., Chandrashekar, V., Bailey, B., Zaczek, D., & Turyn, D. (2002).
Consequences of growth hormone (GH) overexpression and GH resistance.
Neuropeptides, 36(2-3), 201-208. doi: S0143417902908899
Baumann, G. (1991). Growth hormone heterogeneity: Genes, isohormones, variants, and
binding proteins. Endocrine Reviews, 12(4), 424-449. 76
Baumann, G., Amburn, K., & Shaw, M. A. (1988). The circulating growth hormone
(GH)-binding protein complex: A major constituent of plasma GH in man.
Endocrinology, 122(3), 976-984.
Bellush, L. L., Doublier, S., Holland, A. N., Striker, L. J., Striker, G. E., & Kopchick, J.
J. (2000). Protection against diabetes-induced nephropathy in growth hormone
receptor/binding protein gene-disrupted mice. Endocrinology, 141(1), 163-168.
Berryman, D. E., Christiansen, J. S., Johannsson, G., Thorner, M. O., & Kopchick, J. J.
(2008). Role of the GH/IGF-1 axis in lifespan and healthspan: Lessons from
animal models. Growth Hormone & IGF Research, 18(6), 455-471. doi: S1096-
6374(08)00088-9 [pii]10.1016/j.ghir.2008.05.005
Berryman, D. E., List, E. O., Coschigano, K. T., Behar, K., Kim, J. K., & Kopchick, J. J.
(2004). Comparing adiposity profiles in three mouse models with altered GH
signaling. Growth Hormone & IGF Research, 14(4), 309-318. doi:
10.1016/j.ghir.2004.02.005S1096637404000292 [pii]
Berryman, D. E., List, E. O., Sackmann-Sala, L., Lubbers, E., Munn, R., & Kopchick, J. J.
(2011). Growth hormone and adipose tissue: Beyond the adipocyte. Growth
Hormone & IGF Research, 21(3), 113-123. doi: 10.1016/j.ghir.2011.03.002
Binder, G., Neuer, K., Ranke, M. B., & Wittekindt, N. E. (2005). PTPN11 mutations are
associated with mild growth hormone resistance in individuals with Noonan
syndrome. Journal of Clinical Endocrinology and Metabolism, 90(9), 5377-5381.
doi: 10.1210/jc.2005-0995 77
Bluher, M., Kahn, B. B., & Kahn, C. R. (2003). Extended longevity in mice lacking the
insulin receptor in adipose tissue. Science, 299(5606), 572-574. doi:
10.1126/science.1078223
Bluher, M., Michael, M. D., Peroni, O. D., Ueki, K., Carter, N., Kahn, B. B., & Kahn, C.
R. (2002). Adipose tissue selective insulin receptor knockout protects against
obesity and obesity-related glucose intolerance. Developmental Cell, 3(1), 25-38.
Bratusch-Marrain, P. R., Smith, D., & DeFronzo, R. A. (1982). The effect of growth
hormone on glucose metabolism and insulin secretion in man. Journal of Clinical
Endocrinology & Metabolism, 55(5), 973-982.
Brazeau, P., Vale, W., Burgus, R., Ling, N., Butcher, M., Rivier, J., & Guillemin, R.
(1973). Hypothalamic polypeptide that inhibits the secretion of immunoreactive
pituitary growth hormone. Science, 179(4068), 77-79.
Breathnach, R., & Chambon, P. (1981). Organization and expression of eucaryotic split
genes coding for proteins. Annual Review of Biochemistry, 50, 349-383. doi:
10.1146/annurev.bi.50.070181.002025
Bruning, J. C., Michael, M. D., Winnay, J. N., Hayashi, T., Horsch, D., Accili, D., . . .
Kahn, C. R. (1998). A muscle-specific insulin receptor knockout exhibits features
of the metabolic syndrome of NIDDM without altering glucose tolerance.
Molecular Cell, 2(5), 559-569.
Carmeli, E., Coleman, R., & Reznick, A. Z. (2002). The biochemistry of aging muscle.
Experimental Gerontology, 37(4), 477-489. 78
Carter-Su, C., Schwartz, J., & Smit, L. S. (1996). Molecular mechanism of growth
hormone action. Annual Review of Physiology, 58, 187-207. doi:
10.1146/annurev.ph.58.030196.001155
Carter-Su, C., & Smit, L. S. (1998). Signaling via JAK tyrosine kinases: Growth hormone
receptor as a model system. Recent Progress in Hormone Research, 53, 61-82;
discussion 82-63.
Chamberlain, J. S., Jaynes, J. B., & Hauschka, S. D. (1985). Regulation of creatine kinase
induction in differentiating mouse myoblasts. Molecular and Cellular Biology,
5(3), 484-492.
Cohick, W. S., & Clemmons, D. R. (1993). The insulin-like growth factors. Annual
Review of Physiology, 55, 131-153. doi: 10.1146/annurev.ph.55.030193.001023
Coschigano, K. T., Holland, A. N., Riders, M. E., List, E. O., Flyvbjerg, A., & Kopchick,
J. J. (2003). Deletion, but not antagonism, of the mouse growth hormone receptor
results in severely decreased body weights, insulin, and insulin-like growth factor
I levels and increased life span. Endocrinology, 144(9), 3799-3810.
Cunningham, B. C., Ultsch, M., De Vos, A. M., Mulkerrin, M. G., Clauser, K. R., &
Wells, J. A. (1991). Dimerization of the extracellular domain of the human
growth hormone receptor by a single hormone molecule. Science, 254(5033),
821-825.
Das, P., Meyer, L., Seyfert, H. M., Brockmann, G., & Schwerin, M. (1996). Structure of
the growth hormone-encoding gene and its promoter in mice. Gene, 169(2), 209-
213. doi: 0378111995008152 79
Doi, T., Striker, L. J., Quaife, C., Conti, F. G., Palmiter, R., Behringer, R., . . . Striker, G.
E. (1988). Progressive glomerulosclerosis develops in transgenic mice chronically
expressing growth hormone and growth hormone releasing factor but not in those
expressing insulin like growth factor-1. American Journal of Pathology, 131(3),
398-403.
Dusaulcy, R., Rancoule, C., Gres, S., Wanecq, E., Colom, A., Guigne, C., . . . Saulnier-
Blache, J. S. (2011). Adipose-specific disruption of autotaxin enhances nutritional
fattening and reduces plasma lysophosphatidic acid. Journal of Lipid Research,
52(6), 1247-1255. doi: 10.1194/jlr.M014985
Esposito, N., Paterlini, P., Kelly, P. A., Postel-Vinay, M. C., & Finidori, J. (1994).
Expression of two isoforms of the human growth hormone receptor in normal
liver and hepatocarcinoma. Molecular and Cellular Endocrinology, 103(1-2), 13-
20. doi: 0303-7207(94)90064-7 [pii]
Fan, Y., Menon, R. K., Cohen, P., Hwang, D., Clemens, T., DiGirolamo, D. J., . . .
Sperling, M. A. (2009). Liver-specific deletion of the growth hormone receptor
reveals essential role of growth hormone signaling in hepatic lipid metabolism.
Journal of Biological Chemistry, 284(30), 19937-19944. doi:
10.1074/jbc.M109.014308
Florini, J. R., Ewton, D. Z., & Coolican, S. A. (1996). Growth hormone and the insulin-
like growth factor system in myogenesis. Endocrine Reviews, 17(5), 481-517. 80
Gama Sosa, M. A., De Gasperi, R., & Elder, G. A. (2010). Animal transgenesis: An
overview. Brain Structure & Function, 214(2-3), 91-109. doi: 10.1007/s00429-
009-0230-8
Gannon, M., Shiota, C., Postic, C., Wright, C. V., & Magnuson, M. (2000). Analysis of
the Cre-mediated recombination driven by rat insulin promoter in embryonic and
adult mouse pancreas. Genesis, 26(2), 139-142.
Godowski, P. J., Leung, D. W., Meacham, L. R., Galgani, J. P., Hellmiss, R., Keret, R., . .
. Wood, W. I. (1989). Characterization of the human growth hormone receptor
gene and demonstration of a partial gene deletion in two patients with Laron-type
dwarfism. Proceedings of the National Academy of Sciences of the United States
of America, 86(20), 8083-8087.
Gu, H., Marth, J. D., Orban, P. C., Mossmann, H., & Rajewsky, K. (1994). Deletion of a
DNA polymerase beta gene segment in T cells using cell type-specific gene
targeting. Science, 265(5168), 103-106.
Gustafsson, E., Brakebusch, C., Hietanen, K., & Fassler, R. (2001). Tie-1-directed
expression of Cre recombinase in endothelial cells of embryoid bodies and
transgenic mice. Journal of Cell Science, 114(Pt 4), 671-676.
Hadden, D. R., & Prout, T. E. (1964). A growth hormone binding protein in normal
human serum. Nature, 202, 1342-1343.
Hastings, I. M., Bootland, L. H., & Hill, W. G. (1993). The role of growth hormone in
lines of mice divergently selected on body weight. Genetics Research, 61(2), 101-
106. 81
He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., . . . Evans, R. M. (2003).
Adipose-specific peroxisome proliferator-activated receptor gamma knockout
causes insulin resistance in fat and liver but not in muscle. Proceedings of the
National Academy of Sciences of the United States of America, 100(26), 15712-
15717. doi: 10.1073/pnas.2536828100
Heilbronn, L. K., & Ravussin, E. (2003). Calorie restriction and aging: Review of the
literature and implications for studies in humans. American Journal of Clinical
Nutrition, 78(3), 361-369.
Herrington, J., Smit, L. S., Schwartz, J., & Carter-Su, C. (2000). The role of STAT
proteins in growth hormone signaling. Oncogene, 19(21), 2585-2597. doi:
10.1038/sj.onc.1203526
Hocquette, J. F., Postel-Vinay, M. C., Djiane, J., Tar, A., & Kelly, P. A. (1990). Human
liver growth hormone receptor and plasma binding protein: Characterization and
partial purification. Endocrinology, 127(4), 1665-1672.
Holzenberger, M., Dupont, J., Ducos, B., Leneuve, P., Geloen, A., Even, P. C., . . . Le
Bouc, Y. (2003). IGF-1 receptor regulates lifespan and resistance to oxidative
stress in mice. Nature, 421(6919), 182-187. doi: 10.1038/nature01298
Houssay, B. (1936). The hypothesis and metabolism. New England Journal of Medicine,
214, 961-985.
Johnson, J. E., Wold, B. J., & Hauschka, S. D. (1989). Muscle creatine kinase sequence
elements regulating skeletal and cardiac muscle expression in transgenic mice.
Molecular and Cellular Biology, 9(8), 3393-3399. 82
Jorgensen, J. O., Jessen, N., Pedersen, S. B., Vestergaard, E., Gormsen, L., Lund, S. A.,
& Billestrup, N. (2006). GH receptor signaling in skeletal muscle and adipose
tissue in human subjects following exposure to an intravenous GH bolus.
American Journal of Physiology-Endocrinology and Metabolism, 291(5), E899-
E905. doi: 00024.2006 [pii]10.1152/ajpendo.00024.2006
Joshi, R. L., Lamothe, B., Cordonnier, N., Mesbah, K., Monthioux, E., Jami, J., &
Bucchini, D. (1996). Targeted disruption of the insulin receptor gene in the mouse
results in neonatal lethality. EMBO Journal, 15(7), 1542-1547.
Kelly, P. A., Djiane, J., Postel-Vinay, M. C., & Edery, M. (1991). The prolactin/growth
hormone receptor family. Endocrine Reviews, 12(3), 235-251.
Kenyon, C. (2001). A conserved regulatory system for aging. Cell, 105(2), 165-168. doi:
S0092-8674(01)00306-3
Kloting, N., & Bluher, M. (2005). Extended longevity and insulin signaling in adipose
tissue. Experimental Gerontology, 40(11), 878-883. doi:
10.1016/j.exger.2005.07.004
Kopchick, J. J., & Andry, J. M. (2000). Growth hormone (GH), GH receptor, and signal
transduction. Molecular Genetics and Metabolism, 71(1-2), 293-314. doi:
10.1006/mgme.2000.3068S1096-7192(00)93068-3 [pii]
Kumar, A., Harris, T. E., Keller, S. R., Choi, K. M., Magnuson, M. A., & Lawrence, J.
C., Jr. (2008). Muscle-specific deletion of rictor impairs insulin-stimulated
glucose transport and enhances basal glycogen synthase activity. Molecular and
Cellular Biology, 28(1), 61-70. doi: 10.1128/MCB.01405-07 83
Lanning, N. J., & Carter-Su, C. (2006). Recent advances in growth hormone signaling.
Reviews in Endocrine & Metabolic Disorders, 7(4), 225-235. doi:
10.1007/s11154-007-9025-5
Leheste, J. R., Melsen, F., Wellner, M., Jansen, P., Schlichting, U., Renner-Muller, I., . . .
Willnow, T. E. (2003). Hypocalcemia and osteopathy in mice with kidney-
specific megalin gene defect. FASEB Journal, 17(2), 247-249. doi: 10.1096/fj.02-
0578fje
Leung, D. W., Spencer, S. A., Cachianes, G., Hammonds, R. G., Collins, C., Henzel, W.
J., . . . Wood, W. I. (1987). Growth hormone receptor and serum binding protein:
Purification, cloning and expression. Nature, 330(6148), 537-543. doi:
10.1038/330537a0
List, E. O., Sackmann-Sala, L., Berryman, D. E., Funk, K., Kelder, B., Gosney, E. S., . . .
Kopchick, J. J. (2011). Endocrine parameters and phenotypes of the growth
hormone receptor gene disrupted (GHR-/-) mouse. Endocrine Reviews, 32(3),
356-386. doi: 10.1210/er.2010-0009er.2010-0009
Liu, J. L., Coschigano, K. T., Robertson, K., Lipsett, M., Guo, Y., Kopchick, J. J., . . .
Liu, Y. L. (2004). Disruption of growth hormone receptor gene causes diminished
pancreatic islet size and increased insulin sensitivity in mice. American Journal of
Physiology-Endocrinology and Metabolism, 287(3), E405-E413. doi:
10.1152/ajpendo.00423.2003 84
Lu, C., Kumar, P. A., Fan, Y., Sperling, M. A., & Menon, R. K. (2010). A novel effect of
growth hormone on macrophage modulates macrophage-dependent adipocyte
differentiation. Endocrinology, 151(5), 2189-2199. doi: 10.1210/en.2009-1194
Mao, J., DeMayo, F. J., Li, H., Abu-Elheiga, L., Gu, Z., Shaikenov, T. E., . . . Wakil, S. J.
(2006). Liver-specific deletion of acetyl-CoA carboxylase 1 reduces hepatic
triglyceride accumulation without affecting glucose homeostasis. Proceedings of
the National Academy of Sciences of the United States of America, 103(22), 8552-
8557. doi: 10.1073/pnas.0603115103
Mao, J., Yang, T., Gu, Z., Heird, W. C., Finegold, M. J., Lee, B., & Wakil, S. J. (2009).
aP2-Cre-mediated inactivation of acetyl-CoA carboxylase 1 causes growth
retardation and reduced lipid accumulation in adipose tissues. Proceedings of the
National Academy of Sciences of the United States of America, 106(41), 17576-
17581. doi: 10.1073/pnas.0909055106
Martens, K., Bottelbergs, A., & Baes, M. (2010). Ectopic recombination in the central
and peripheral nervous system by aP2/FABP4-Cre mice: Implications for
metabolism research. FEBS Letters, 584(5), 1054-1058. doi:
10.1016/j.febslet.2010.01.061
Mavalli, M. D., DiGirolamo, D. J., Fan, Y., Riddle, R. C., Campbell, K. S., van Groen,
T., . . . Clemens, T. L. (2010). Distinct growth hormone receptor signaling modes
regulate skeletal muscle development and insulin sensitivity in mice. Journal of
Clinical Investigation, 120(11), 4007-4020. doi: 10.1172/JCI42447 85
Michael, M. D., Kulkarni, R. N., Postic, C., Previs, S. F., Shulman, G. I., Magnuson, M.
A., & Kahn, C. R. (2000). Loss of insulin signaling in hepatocytes leads to severe
insulin resistance and progressive hepatic dysfunction. Molecular Cell, 6(1), 87-
97.
Migliaccio, E., Giorgio, M., Mele, S., Pelicci, G., Reboldi, P., Pandolfi, P. P., . . . Pelicci,
P. G. (1999). The p66shc adaptor protein controls oxidative stress response and
life span in mammals. Nature, 402(6759), 309-313. doi: 10.1038/46311
Milner, K. L., van der Poorten, D., Trenell, M., Jenkins, A. B., Xu, A., Smythe, G., . . .
Chisholm, D. J. (2010). Chronic hepatitis C is associated with peripheral rather
than hepatic insulin resistance. Gastroenterology, 138(3), 932-941 e931-933. doi:
10.1053/j.gastro.2009.11.050
Miniou, P., Tiziano, D., Frugier, T., Roblot, N., Le Meur, M., & Melki, J. (1999). Gene
targeting restricted to mouse striated muscle lineage. Nucleic Acids Research,
27(19), e27.
Moffat, J. G., Edens, A., & Talamantes, F. (1999). Structure and expression of the mouse
growth hormone receptor/growth hormone binding protein gene. Journal of
Molecular Endocrinology, 23(1), 33-44. doi: JME00787
Nicoll, C. S., Mayer, G. L., & Russell, S. M. (1986). Structural features of prolactins and
growth hormones that can be related to their biological properties. Endocrine
Reviews, 7(2), 169-203.
Nilsson, L., Binart, N., Bohlooly, Y. M., Bramnert, M., Egecioglu, E., Kindblom, J., . . .
Billig, H. (2005). Prolactin and growth hormone regulate adiponectin secretion 86
and receptor expression in adipose tissue. Biochemical and Biophysical Research
Communications, 331(4), 1120-1126. doi: S0006-291X(05)00787-4
[pii]10.1016/j.bbrc.2005.04.026
Paolisso, G., Barbieri, M., Bonafe, M., & Franceschi, C. (2000). Metabolic age
modelling: The lesson from centenarians [Review]. European Journal of Clinical
Investigation, 30(10), 888-894.
Picard, F., & Guarente, L. (2005). Molecular links between aging and adipose tissue.
International Journal of Obesity, 29(Suppl 1), S36-39. doi:
10.1038/sj.ijo.0802912
Pidduck, H. G., & Falconer, D. S. (1978). Growth hormone function in strains of mice
selected for large and small size. Genetics Research, 32(2), 195-206.
Polak, P., Cybulski, N., Feige, J. N., Auwerx, J., Ruegg, M. A., & Hall, M. N. (2008).
Adipose-specific knockout of raptor results in lean mice with enhanced
mitochondrial respiration. Cell Metabolism, 8(5), 399-410. doi:
10.1016/j.cmet.2008.09.003
Postic, C., Shiota, M., Niswender, K. D., Jetton, T. L., Chen, Y., Moates, J. M., . . .
Magnuson, M. A. (1999). Dual roles for glucokinase in glucose homeostasis as
determined by liver and pancreatic beta cell-specific gene knock-outs using Cre
recombinase. Journal of Biological Chemistry, 274(1), 305-315.
Rinderknecht, E., & Humbel, R. E. (1978). The amino acid sequence of human insulin-
like growth factor I and its structural homology with proinsulin. Journal of
Biological Chemistry, 253(8), 2769-2776. 87
Roelfsema, F., Biermasz, N. R., Veldman, R. G., Veldhuis, J. D., Frolich, M., Stokvis-
Brantsma, W. H., & Wit, J. M. (2001). Growth hormone (GH) secretion in
patients with an inactivating defect of the GH-releasing hormone (GHRH)
receptor is pulsatile: Evidence for a role for non-GHRH inputs into the generation
of GH pulses. Journal of Clinical Endocrinology & Metabolism, 86(6), 2459-
2464.
Salmon, R. K., Berg, R. T., Yeh, F. C., & Hodgetts, R. B. (1988). Identification of a
variant growth hormone haplotype in mice selected for high body weight.
Genetics Research, 52(1), 7-15.
Sauer, B., & Henderson, N. (1988). Site-specific DNA recombination in mammalian cells
by the Cre recombinase of bacteriophage P1. Proceedings of the National
Academy of Sciences of the United States of America, 85(14), 5166-5170.
Scherer, P. E., Williams, S., Fogliano, M., Baldini, G., & Lodish, H. F. (1995). A novel
serum protein similar to C1q, produced exclusively in adipocytes. Journal of
Biological Chemistry, 270(45), 26746-26749.
Schinkel, A. H., Smit, J. J., van Tellingen, O., Beijnen, J. H., Wagenaar, E., van Deemter,
L., . . . Borst, P. (1994). Disruption of the mouse mdr1a P-glycoprotein gene leads
to a deficiency in the blood-brain barrier and to increased sensitivity to drugs.
Cell, 77(4), 491-502.
Schmucker, D. L. (2005). Age-related changes in liver structure and function:
Implications for disease? [Review]. Experimental Gerontology, 40(8-9), 650-659.
doi: 10.1016/j.exger.2005.06.009 88
Siiteri, P. K. (1987). Adipose tissue as a source of hormones. American Journal of
Clinical Nutrition, 45(1 Suppl), 277-282.
Sobrier, M. L., Duquesnoy, P., Duriez, B., Amselem, S., & Goossens, M. (1993).
Expression and binding properties of two isoforms of the human growth hormone
receptor. FEBS Letters, 319(1-2), 16-20. doi: 0014-5793(93)80028-S
Sternberg, N., & Hamilton, D. (1981). Bacteriophage P1 site-specific recombination. I.
Recombination between loxP sites. Journal of Molecular Biology, 150(4), 467-
486. doi: 0022-2836(81)90375-2
Storlien, L. H., Jenkins, A. B., Chisholm, D. J., Pascoe, W. S., Khouri, S., & Kraegen, E.
W. (1991). Influence of dietary fat composition on development of insulin
resistance in rats. Relationship to muscle triglyceride and omega-3 fatty acids in
muscle phospholipid. Diabetes, 40(2), 280-289.
Takeda, T., Yoshino, K., Adachi, E., Sato, Y., & Yamagata, K. (1999). In vitro
assessment of a chemically synthesized Shiga toxin receptor analog attached to
chromosorb P (Synsorb Pk) as a specific absorbing agent of Shiga toxin 1 and 2.
Microbiology and Immunology, 43(4), 331-337.
Tannenbaum, G. S. (1991). Neuroendocrine control of growth hormone secretion. Acta
Paediatrica Scandinavica, 372(Suppl), 5-16.
Tannenbaum, G. S., & Ling, N. (1984). The interrelationship of growth hormone (GH)-
releasing factor and somatostatin in generation of the ultradian rhythm of GH
secretion. Endocrinology, 115(5), 1952-1957. 89
Thierbach, R., Drewes, G., Fusser, M., Voigt, A., Kuhlow, D., Blume, U., . . . Ristow, M.
(2010). The Friedreich's ataxia protein frataxin modulates DNA base excision
repair in prokaryotes and mammals. Biochemical Journal, 432(1), 165-172. doi:
10.1042/BJ20101116
Tiong, T. S., & Herington, A. C. (1991). Tissue distribution, characterization, and
regulation of messenger ribonucleic acid for growth hormone receptor and serum
binding protein in the rat. Endocrinology, 129(3), 1628-1634.
Ultsch, M. H., Somers, W., Kossiakoff, A. A., & de Vos, A. M. (1994). The crystal
structure of affinity-matured human growth hormone at 2 A resolution. Journal of
Molecular Biology, 236(1), 286-299. doi: S0022-2836(84)71135-1
[pii]10.1006/jmbi.1994.1135
Unger, R. H., & Orci, L. (2002). Lipoapoptosis: Its mechanism and its diseases.
Biochimica et Biophysica Acta, 1585(2-3), 202-212.
Urs, S., Harrington, A., Liaw, L., & Small, D. (2006). Selective expression of an
aP2/fatty acid binding protein 4-Cre transgene in non-adipogenic tissues during
embryonic development. Transgenic Research, 15(5), 647-653. doi:
10.1007/s11248-006-9000-z
Vijayakumar, A., Wu, Y., Sun, H., Li, X., Jeddy, Z., Liu, C., . . . LeRoith, D. (2012).
Targeted loss of GHR signaling in mouse skeletal muscle protects against high-fat
diet-induced metabolic deterioration. Diabetes, 61(1), 94-103. doi: 10.2337/db11-
0814 90
Wabitsch, M., Braun, S., Hauner, H., Heinze, E., Ilondo, M. M., Shymko, R., . . . Teller,
W. M. (1996). Mitogenic and antiadipogenic properties of human growth
hormone in differentiating human adipocyte precursor cells in primary culture.
Pediatric Research, 40(3), 450-456.
Wang, Z. V., Deng, Y., Wang, Q. A., Sun, K., & Scherer, P. E. (2010). Identification and
characterization of a promoter cassette conferring adipocyte-specific gene
expression. Endocrinology, 151(6), 2933-2939. doi: 10.1210/en.2010-0136
Waterston, R. H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P., . . .
Lander, E. S. (2002). Initial sequencing and comparative analysis of the mouse
genome. Nature, 420(6915), 520-562. doi: 10.1038/nature01262
Werther, G. A., Haynes, K., & Waters, M. J. (1993). Growth hormone (GH) receptors are
expressed on human fetal mesenchymal tissues--Identification of messenger
ribonucleic acid and GH-binding protein. Journal of Clinical Endocrinology &
Metabolism, 76(6), 1638-1646.
Winer, L. M., Shaw, M. A., & Baumann, G. (1990). Basal plasma growth hormone levels
in man: New evidence for rhythmicity of growth hormone secretion. Journal of
Clinical Endocrinology & Metabolism, 70(6), 1678-1686.
Wolf, E., Kahnt, E., Ehrlein, J., Hermanns, W., Brem, G., & Wanke, R. (1993). Effects of
long-term elevated serum levels of growth hormone on life expectancy of mice:
Lessons from transgenic animal models. Mechanisms of Ageing and
Development, 68(1-3), 71-87. 91
Wu, Y., Liu, C., Sun, H., Vijayakumar, A., Giglou, P. R., Qiao, R., . . . LeRoith, D.
(2011). Growth hormone receptor regulates beta cell hyperplasia and glucose-
stimulated insulin secretion in obese mice. Journal of Clinical Investigation,
121(6), 2422-2426. doi: 10.1172/JCI45027
Wynne, H. A., Cope, L. H., Mutch, E., Rawlins, M. D., Woodhouse, K. W., & James, O.
F. (1989). The effect of age upon liver volume and apparent liver blood flow in
healthy man. Hepatology, 9(2), 297-301.
Yakar, S., Liu, J. L., Fernandez, A. M., Wu, Y., Schally, A. V., Frystyk, J., . . . Le Roith,
D. (2001). Liver-specific igf-1 gene deletion leads to muscle insulin insensitivity.
Diabetes, 50(5), 1110-1118.
Yakar, S., Liu, J. L., Stannard, B., Butler, A., Accili, D., Sauer, B., & LeRoith, D. (1999).
Normal growth and development in the absence of hepatic insulin-like growth
factor I. Proceedings of the National Academy of Sciences of the United States of
America, 96(13), 7324-7329.
Yakar, S., Pennisi, P., Kim, C. H., Zhao, H., Toyoshima, Y., Gavrilova, O., & LeRoith,
D. (2005). Studies involving the GH-IGF axis: Lessons from IGF-I and IGF-I
receptor gene targeting mouse models. Journal of Endocrinological Investigation,
28(5 Suppl), 19-22.
Yakar, S., Setser, J., Zhao, H., Stannard, B., Haluzik, M., Glatt, V., . . . LeRoith, D.
(2004). Inhibition of growth hormone action improves insulin sensitivity in liver
IGF-1-deficient mice. Journal of Clinical Investigation, 113(1), 96-105. doi:
10.1172/JCI17763 92
Zhang, H. (n.d.). An Optimized Polymerase Chain Reaction to Verify the Absence of the
Growth Hormone Receptor Gene (Unpublished master’s thesis). Ohio University,
Athens, OH. Thesis in preparation.
Zhou, Y., Xu, B. C., Maheshwari, H. G., He, L., Reed, M., Lozykowski, M., . . .
Kopchick, J. J. (1997). A mammalian model for Laron syndrome produced by
targeted disruption of the mouse growth hormone receptor/binding protein gene
(the Laron mouse). Proceedings of the National Academy of Sciences of the
United States of America, 94(24), 13215-13220.
Zong, H., Bastie, C. C., Xu, J., Fassler, R., Campbell, K. P., Kurland, I. J., & Pessin, J. E.
(2009). Insulin resistance in striated muscle-specific integrin receptor beta1-
deficient mice. Journal of Biological Chemistry, 284(7), 4679-4688. doi:
10.1074/jbc.M807408200
93
APPENDIX I: MIQE GUIDELINE
ITEM TO CHECK IMPORTANCE CHECKLIST EXPERIMENTAL DESIGN Definition of experimental and control groups E Number within each group E Assay carried out by core lab or investigator's lab? D Acknowledgement of authors' contributions D SAMPLE Description E Volume/mass of sample processed D Microdissection or macrodissection E Processing procedure E If frozen - how and how quickly? E If fixed - with what, how quickly? E Sample storage conditions and duration (especially for FFPE samples) E NUCLEIC ACID EXTRACTION Precellys Procedure and/or instrumentation E settings RNeasy mini kit from Name of kit and details of any modifications E QIAGEN Source of additional reagents used D none kit components are Details of DNase or RNAse treatment E Rnase free; 94
DNase treatment included in RT kit procedure run no-RT control (also the primers designed span Contamination assessment (DNA or RNA) E introns) Nucleic acid quantification E Instrument and method E NanoDrop Purity (A260/A280) D no cutoff more than Yield D 20ng/µl RNA integrity method/instrument E Bioanalyzer RIN RIN/RQI or Cq of 3' and 5' transcripts E Cutoff is 7 Electrophoresis traces D Cq dilutions (8 serial 1/10 Inhibition testing (Cq dilutions, spike or other) E dils) E= essential; D= desirable
95
APPENDIX II: RNA ISOLATION PROCEDURE
1. Keep in mind RNases are everywhere. Therefore, whatever you use needs to be RNase-free or cleaned to get rid of RNases. Get RNase-free tubes and tips. Clean working surface, gloves and instrumentation. 2. Prepare Precellys tubes with beads of corresponding size for each particular tissue (see table below). 3. Get samples out of -80C freezer and place them in dry ice. 4. Clean working surface, forceps and razor blade free of RNases. 5. For each sample: a) Weigh and cut it to get appropriate amount for RNA extraction (10-30mg depending on the tissue, see Table 7). Samples should be kept in dry ice when cutting and weighing. Do not allow samples to thaw. b) Place sample in tube precellys tube with beads and keep in dry ice. 6. Add 600 ul of buffer RLT to each tube. Buffer RLT is lysis buffers and contains guanidine thiocyanate. 7. Transfer all tubes to ice-water bath. 8. Homogenize with Precellys making sure tubes are balanced. Conditions to use are listed in Table 7. 9. Immediately after homogenization finishes, place the samples back in the ice-water bath. (The Precellys counts down for ~1 min or so after shaking finishes. DO NOT WAIT, just open the lid and take the samples out). 10. Centrifuge the samples at >8,000g for 3 min in the cold room. All following steps should be performed at room temperature. 11. Transfer supernatant to clean (RNase free) 1.5ml tube (not provided with kit). 12. Add 1 volume of 70% ethanol and mix immediately by pipetting. Proceed immediately to next step. 96
13. Transfer up to 700 ul of sample, including any precipitate that may have formed, to an RNeasy spin column placed in a 2ml collection tube (supplied with kit). Close the lid gently and centrifuge for 15 s at >8,000 g. Discard the flow-through. (Reuse the collection tube in the next step. If the sample volume exceeds 700 ul, centrifuge successive aliquots in the same RNeasy spin column. Discard the flow- through after each centrifugation.) 14. Add 700 ul of buffer RW1 to the RNeasy spin column. Close the lid gently, and centrifuge for 15 s at >8,000 g to wash the spin column membrane. Discard the flow- through. (Reuse the collection tube in the next step. Note: After centrifugation, remove the RNeasy spin column from the collection tube so that the column does not contact the flow-through. Be sure to empty the collection tube completely.) Buffer RW1 is washing buffer and contains a small amount of guanidine thiocyanate. 15. Add 500 ul of buffer RPE to the RNeasy spin solumn. Close the lid gently, and centrifuge for 15 s at >8,000 g to wash the spin column membrane. Discard the flow- through. (Reuse the collection tube in the next step. Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to it before use. ) 16. Add 500 ul of buffer RPE to the RNeasy spin solumn. Close the lid gently, and centrifuge for 2 min at >8,000 g to wash the spin column membrane. (After centrifugation, carefully remove the RNeasy spin column from the collection tube so that the column does not contact the flow-through. Otherwise, carryover of ethanol will occur and may interfere with downstream reactions.) 17. Optional: place the RNeasy spin column in a new 2ml collection tube (supplied with kit), and discard the old collection tube with the flow-through. Close the lid gently and centrifuge at full speed for 1 min. (Perform this step to eliminate any possible carryover of buffer RPE, or if residual flow-through remains on the ouside of the RNeasy spin solumn after the previous step). 97
18. Place the RNeasy spin column in a new 1.5 ml collection tube (supplied with kit). Add 30-50 ul of RNase-free water directly to the spin column membrane. Close the lid gently, and centrifuge for 1 min at >8,000 g to elute the RNA. 19. If the expected RNA yield is > 30 ug, repeat the previous step using another 30-50 ul RNase-free water, or using the eluate from the previous step. (If using the eluate from step 18, the RNA yield will be 15-30% less than that obtained using a second volume of RNase-free water, but the final RNA concentration will be higher.) 20. Measure concentration of all samples using the NanoDrop. 21. Aliquot ~5 ul of each sample into a new tube properly labeled and take to genomics facility for quality check using the bioanalyzer (need to fill out a form online also). 22. Store the remaining RNA samples at -20°C or -80°C. In these conditions, no degradation is detectable after 1 year.
RNA isolation procedure for fibrous tissue (skeleton muscle) This protocol is only for skeleton muscle. The steps, which are different from protocol above, are marked with underline. 1. Add 10 μl β-mercaptoethanol (β-ME) per 1 ml Buffer RLT before use. Buffer RLT containing β-ME can be stored at room temperature (15–25°C) for up to 1 month. 2. Heat water bath or heating block to 55 °C. 3. Disrupt and homogenize ≤ 30 mg tissue in 300 μl Buffer RLT. 4. Add 590 μl RNase-free water, then 10 μl proteinase K, mix, and incubate at 55 °C for 10 min. Proteinase K (> 600 mAU/mL, RNase-free water): for protease digestion during DNA or RNA preparation. 5. Centrifuge at 10,000g for 3 min. 6. Transfer supernatant to new tube. Add 0.5 volumes of 96–100% ethanol, and mix. 7. Transfer 700 μl of sample to RNeasy Mini column (in a 2 ml collection tube). Close lid, centrifuge for 15 s at > 8,000 g, and discard flow-through. Repeat step until 98
complete lysate is used. 8. Add 700 μl Buffer RW1 to RNeasy column. Close lid, centrifuge for 15 s at > 8,000 g, and discard flow-through. 9. Add 500 μl Buffer RPE to RNeasy column. Close lid, centrifuge for 15 s at > 8,000 g, and discard flow-through. 10. Add 500 μl Buffer RPE to RNeasy column. Close lid, centrifuge for 2 min at > 8,000 g. Optional: Place RNeasy column in new 2 ml tube, close lid, and centrifuge at full speed for 1 min. 11. Place RNeasy column in new 1.5 ml tube. Add 30–50 μl RNase-free water, close lid, and centrifuge for 1 min at > 8,000 g. Optional: Repeat elution with another volume of water or with RNA eluate.
99
APPENDIX III: REVERSE TRANSCRIPTION PROCEDURE
1. Thaw template RNA on ice. Thaw gDNA Wipeout Buffer, Quantiscript Reverse Transcriptase, Quantiscript RT Buffer, RT Primer Mix, and RNase-free water at room temperature (15–25 °C). a) Mix each solution by flicking the tubes. b) Centrifuge briefly to collect residual liquid from the sides of the tubes, and then store on ice. 2. Prepare the genomic DNA elimination reaction on ice according to Table 13. a) Mix and then store on ice. b) If setting up more than one reaction, prepare a volume of master mix 10% greater than that required for the total number of reactions to be performed. Then distribute the appropriate volume of master mix into individual tubes followed by each RNA sample. Keep the tubes on ice. c) The protocol is for use with 10 pg to 1 µg RNA. If using > 1 µg RNA, scale up the reaction linearly. For example, if using 2 µg RNA, double the volumes of all reaction components for a final 28 µl reaction volume. Table 13. Genomic DNA elimination reaction components
Component Volume/reaction gDNA Wipeout Buffer, 7x 2 µl
Template RNA Variable (up to 1 µg*)
RNase-free water Variable
Total volume 14 µl * This amount corresponds to the entire amount of RNA present, including any rRNA, mRNA, viral RNA, and carrier RNA present, and regardless of the primers used or cDNA analyzed. 3. Incubate for 3 min at 42 °C (water bath). Then place immediately on ice. Do not incubate at 42 °C for longer than 10 min. 100
4. Prepare the reverse-transcription master mix on ice according to Table 14. a) Mix and then store on ice. The reverse-transcription master mix contains all components required for first-strand cDNA synthesis except template RNA. b) If setting up more than one reaction, prepare a volume of master mix 10% greater than that required for the total number of reactions to be performed. c) The protocol is for use with 10 pg to 1 µg RNA. If using >1 µg RNA, scale up the reaction linearly. For example, if using 2 µg RNA, double the volumes of all reaction components for a final 40 µl reaction volume. Table 14. Reverse-transcription reaction components
Component Volume/reaction
Reverse-transcription master mix
Quantiscript Reverse Transcriptase 1 µl
Quantiscript RT Buffer, 5x 4 µl
RT Primer Mix 1 µl
Template RNA
Entire genomic DNA elimination reaction (step 3) 14 µl (add at step 5)
Total volume 20 µl
5. Add template RNA from step 3 (14 µl) to each tube containing reverse-transcription master mix. Mix and then store on ice. 6. Incubate for 30 min at 42 °C. 7. Incubate for 3 min at 95 °C to inactivate Quantiscript Reverse Transcriptase. (Step 6 and 7 are operated on BIO-RAD iCycler® Thermal Cycler). a) Open the machine; b) Choose “resistered user”, then press”enter”; c) Choose “Lucila”, then press “enter”; d) Press “F1”; 101
e) Press “>”, choose “RT”, then press “enter”; f) Choose “run protocal”, then press “enter”; g) Chang the “sample volume” as 20 µl; h) Put the tubes in the machine, close the lid; i) Press “begin run.” 8. Add an aliquot of each finished reverse-transcription reaction to qPCR mix. a) If the template RNA is 1µg, the dilution ratio is 1:99 (reverse-transcription reaction: RNase-free water). b) No reverse transcription control for qPCR: Do not add Reverse Transcriptase in the Reverse-transcription master mix. Or just use diluted RNA (with RNase-free water) as no reverse transcription control. 9. Store reverse-transcription reactions on ice and proceed directly with qPCR, or for long-term storage, store reverse-transcription reactions at –20 °C.
102
APPENDIX IV: QUANTITATIVE PCR PROCEDURE
In QuantiTect SYBR Green PCR kit, 2x QuantiTect SYBR Green PCR Master Mix contains: HotStarTaq®DNA Polymerase; QuantiTect SYBR Green RT-PCR Buffer; dNTP mix, including dUTP; SYBR Green I; ROX™ passive reference dye; 5 mM MgCl2. The reaction setup (see Table 15) and real-time cycler conditions (see Table 16) are list below. 1. Thaw 2x QuantiTect SYBR Green PCR Master Mix (if stored at –20 °C), template DNA or cDNA, primers, and RNase-free water. Mix the individual solutions. 2. Prepare a reaction mix according to Table 15. Due to the hot start, it is not necessary to keep samples on ice during reaction setup or while programming the cycler. Table 15. Reaction setup for qPCR content 1 x 28x
2X PCR master mix 10µl 280µl
Primer Forward 0.3µl 7.4µl
Primer Reverse 0.3 µl 7.4µl
RNase free water 7.4 µl 207.2µl
Total 18 µl 504µl
3. Mix the reaction mix thoroughly, and dispense 18µl into each well on the PCR plate. 4. Add cDNA (2µg/well) to the each well containing the reaction mix. 5. Program the iCycler according to the program outlined in Table 16. Table 16. Real-time cycler conditions
Stage Temperature Duration 103
Initial 95 °C 15min activation
35X Denature 94 °C 15s
Anneal 60 °C 30s
External 72 °C 30s
80X Melting curve Start at 55 °C 10s +0.5 °C↑
6. This plate is run on BIO-RAD iCycler® Thermal Cycler. a) Open the machine, camera and “iCycler” software; b) Press “Yes”; c) Click “view protocol”, choose “Xinyue” folder, choose “Quanti Tect Sybr + Melt.tmo”; d) Click “view plate setup”, choose “Xinyue” folder, choose “Xinyue.pts”; e) Click “run with seleted protocal”; f) Change “sample volume” as 20µl; g) Put plate in the machine and close the lid; h) Press “begin run” and save it.
104
7. Plate setup 1 2 3 4 5 6 7 8 9 10 11 12 A FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 B FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 C FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 D FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 E FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 F FFCc-1 FFCc-2 FFCc-3 FFCc-4 FFCc-5 FFCc-6 FFcc-1 FFcc-2 FFcc-3 FFcc-4 FFcc-5 FFcc-6 G nortFFCc nortFFCc nortFFCc ntc ntc ntc H nortFFcc nortFFcc nortFFcc
a) The qPCR plate is shown above. One color represents GHR or one reference gene. Each plate can run “GHR and 2 reference genes” or 3 reference genes. GHR and 7 reference genes are used in this study. Therefore, 3 plates are run for every tissue. b) Tissue-specific GHR-/- mice (FFCc, n = 6) and floxed control mice (FFcc, n = 6) are used in this study. c) “nortFFCc” represents no reverse transcription for FFCc group. “nortFFcc” represents no reverse transcription for FFcc group. “ntc” represents no template control. It means add RNase-free water as template.
105
APPENDIX V: DATA ANALYSIS USING QBASE
1. Double click.
2. Choose workspace.
3. Setup a new project. FileNewproject Give project a name. e.g. “heart”
106
4. Setup a new experiment under project “heart.” Right click “experiment,” choose “new experiment,” then click “finish.”
5. Import runs. Right click “run,” choose “import run.” Browse import file (excel spreadsheet). File type choose “simple”. Then click “finish.”
6. Double click run. Setup sample name and target for each well in all the import runs. 107
7. Click “analysis,” then double click “result table.” The result will be shown on the right based on sample and target setup in the runs. 8. Click “annotations,” then double click “sample properties.” 108
Click “Add property” (on the bottom). This study has two groups, therefore separate the samples for two groups.
109
9. Click “statistics,” then double click “stat wizard.”
Choose “mean comparison,” click “next.” Choose “property 1,” click “next.” Choose “ghr” as target, click “next.” Choose “log-normal distribution,” “unpaired data” and “two-side significance,” then click finish. P value and ratio of two groups will be shown on the right.
10. Double click “geNorm.”
The geNorm result will be shown on the right. The more stable reference gene has the lower geNorm value.
110
APPENDIX VI: HEART OF MUSCLE-SPECIFIC GHR-/- MICE
In Figure 8, mRNA expression level is shown as relative expression. The GHR mRNA expression level for the floxed control group (FFcc) in every tissue is set as “1.” The mRNA expression level of the experimental knockout group (FFCc) is calculated relative to “1” in every tissue. In this study, GHR mRNA expression level within heart decreased 92% in the muscle- specific GHR-/- mice (using the MCK-Cre promoter) as compared to controls, which is a significant difference (P=7.3*10-10, FFCc/FFcc ratio = 0.072). These data are consistent with other papers report: the MCK-Cre promoter is also active in cardiac muscle (Bruning et al., 1998; Zong et al., 2009).
Figure 8. mRNA expression level of GHR in muscle-specific GHR-/- mice. Shown are means ± SEM. N=6 for all groups. FFCc represents muscle-specific GHR-/- mice, and FFcc represents control mice. A significant difference was seen for quadriceps and heart; p < 0.01, but not for other tissues. * Significant difference, p < 0.01.
111
APPENDIX VII: FIVE ADIPOSE TISSUES OF ADIPOSE TISSUE-SPECIFIC GHR-/- MICE
Reference gene rps3 is relatively stable among five adipose tissues (see Table 9). In Figure 9, GHR mRNA expression level of five adipose tissues in the adipose tissue-specific GHR-/- mice (using aP2-Cre promoter) is shown as relative expression based on reference gene rps3. The GHR mRNA relative expression level of subcutaneous is the lowest among five adipose tissues in the floxed control group and the highest among five tissues in the experimental knockout group. The subcutaneous is different from other adipocytes in location and cell types (Berryman et al., 2011). That may be the reason that GHR mRNA relative expression level of subcutaneous differ from other adipocytes.
Figure 9. GHR mRNA expression level of five adipose tissues in the adipose tissue-specific GHR-/- mice based on reference gene rps3. Shown are means ± SEM. N=6 for all groups. FFCc represents muscle-specific GHR-/- mice, and FFcc represents control mice.
112
APPENDIX VIII: PERMISSION TO REPRODUCE FIGURES
Figure 1
NATURE PUBLISHING GROUP LICENSE TERMS AND CONDITIONS Aug 05, 2012
This is a License Agreement between Xinyue Wang ("You") and Nature Publishing Group ("Nature Publishing Group") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by Nature Publishing Group, and the payment terms and conditions.
All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.
License Number 2946070882868 License date Jul 11, 2012 Licensed content publisher Nature Publishing Group Licensed content publication Nature Reviews Endocrinology Licensed content title Genetic causes and treatment of isolated growth hormone deficiency—an update Licensed content author Kyriaki S. Alatzoglou, Mehul T. Dattani Licensed content date Sep 17, 2010 Volume number 6 Issue number 10 Type of Use reuse in a thesis/dissertation
Requestor type academic/educational Format print and electronic Portion figures/tables/illustrations Number of 1 figures/tables/illustrations High-res required no Figures figure 1 Author of this NPG article no Your reference number 113
Title of your thesis / dissertation verify the deletion of growth hormone receptor using qPCR at mRNA level in tissue specific knockout mice Expected completion date Aug 2012 Estimated size (number of pages) 150 Total 0.00 USD
Terms and Conditions
Terms and Conditions for Permissions
Nature Publishing Group hereby grants you a non-exclusive license to reproduce this material for this purpose, and for no other use, subject to the conditions below:
1. NPG warrants that it has, to the best of its knowledge, the rights to license reuse of this material. However, you should ensure that the material you are requesting is original to Nature Publishing Group and does not carry the copyright of another entity (as credited in the published version). If the credit line on any part of the material you have requested indicates that it was reprinted or adapted by NPG with permission from another source, then you should also seek permission from that source to reuse the material.
2. Permission granted free of charge for material in print is also usually granted for any electronic version of that work, provided that the material is incidental to the work as a whole and that the electronic version is essentially equivalent to, or substitutes for, the print version. Where print permission has been granted for a fee, separate permission must be obtained for any additional, electronic re-use (unless, as in the case of a full paper, this has already been accounted for during your initial request in the calculation of a print run). NB: In all cases, web-based use of full-text articles must be authorized separately through the 'Use on a Web Site' option when requesting permission.
3. Permission granted for a first edition does not apply to second and subsequent editions and for editions in other languages (except for signatories to the STM Permissions Guidelines, or where the first edition permission was granted for free).
4. Nature Publishing Group's permission must be acknowledged next to the figure, table or abstract in print. In electronic form, this acknowledgement must be visible at the same time as the figure/table/abstract, and must be hyperlinked to the journal's homepage.
5. The credit line should read: Reprinted by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication) 114
For AOP papers, the credit line should read: Reprinted by permission from Macmillan Publishers Ltd: [JOURNAL NAME], advance online publication, day month year (doi: 10.1038/sj.[JOURNAL ACRONYM].XXXXX)
Note: For republication from the British Journal of Cancer, the following credit lines apply. Reprinted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of publication) For AOP papers, the credit line should read: Reprinted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME], advance online publication, day month year (doi: 10.1038/sj.[JOURNAL ACRONYM].XXXXX)
6. Adaptations of single figures do not require NPG approval. However, the adaptation should be credited as follows:
Adapted by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication)
Note: For adaptation from the British Journal of Cancer, the following credit line applies. Adapted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of publication)
7. Translations of 401 words up to a whole article require NPG approval. Please visithttp://www.macmillanmedicalcommunications.com for more information. Translations of up to a 400 words do not require NPG approval. The translation should be credited as follows:
Translated by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication).
Note: For translation from the British Journal of Cancer, the following credit line applies. Translated by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of publication)
We are certain that all parties will benefit from this agreement and wish you the best in the use of this material. Thank you. 115
Special Terms: v1.1 If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 48 hours of the license date. Payment should be in the form of a check or money order referencing your account number and this invoice number RLNK500816581. Once you receive your invoice for this order, you may pay your invoice by credit card. Please follow instructions provided at that time.
Make Payment To:
Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006
For suggestions or comments regarding this order, contact RightsLink Customer Support:[email protected] or +1-877-622-5543 (toll free in the US) or +1- 978-646-2777.
Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.
Figure 2
NATURE PUBLISHING GROUP LICENSE TERMS AND CONDITIONS Aug 05, 2012
This is a License Agreement between Xinyue Wang ("You") and Nature Publishing Group ("Nature Publishing Group") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by Nature Publishing Group, and the payment terms and conditions.
All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.
License Number 2946071272049 License date Jul 11, 2012 Licensed content publisher Nature Publishing Group Licensed content publication Nature Reviews Endocrinology Licensed content title The growth hormone receptor: mechanism of activation 116
and clinical implications Licensed content author Andrew J. Brooks, Michael J. Waters Licensed content date Jul 27, 2010 Volume number 6 Issue number 9 Type of Use reuse in a thesis/dissertation
Requestor type academic/educational Format print and electronic Portion figures/tables/illustrations Number of 1 figures/tables/illustrations High-res required no Figures figure 4 Author of this NPG article no Your reference number Title of your thesis / dissertation verify the deletion of growth hormone receptor using qPCR at mRNA level in tissue specific knockout mice Expected completion date Aug 2012 Estimated size (number of pages) 150 Total 0.00 USD
Terms and Conditions
Terms and Conditions for Permissions
Nature Publishing Group hereby grants you a non-exclusive license to reproduce this material for this purpose, and for no other use, subject to the conditions below:
1. NPG warrants that it has, to the best of its knowledge, the rights to license reuse of this material. However, you should ensure that the material you are requesting is original to Nature Publishing Group and does not carry the copyright of another entity (as credited in the published version). If the credit line on any part of the material you have requested indicates that it was reprinted or adapted by NPG with permission from another source, then you should also seek permission from that source to reuse the material.
2. Permission granted free of charge for material in print is also usually granted for any electronic version of that work, provided that the material is incidental to the work as a whole and that the electronic version is essentially equivalent to, or substitutes for, the print version. Where print permission has been granted for a fee, separate permission must be obtained for any additional, electronic re-use (unless, 117
as in the case of a full paper, this has already been accounted for during your initial request in the calculation of a print run). NB: In all cases, web-based use of full-text articles must be authorized separately through the 'Use on a Web Site' option when requesting permission.
3. Permission granted for a first edition does not apply to second and subsequent editions and for editions in other languages (except for signatories to the STM Permissions Guidelines, or where the first edition permission was granted for free).
4. Nature Publishing Group's permission must be acknowledged next to the figure, table or abstract in print. In electronic form, this acknowledgement must be visible at the same time as the figure/table/abstract, and must be hyperlinked to the journal's homepage.
5. The credit line should read: Reprinted by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication) For AOP papers, the credit line should read: Reprinted by permission from Macmillan Publishers Ltd: [JOURNAL NAME], advance online publication, day month year (doi: 10.1038/sj.[JOURNAL ACRONYM].XXXXX)
Note: For republication from the British Journal of Cancer, the following credit lines apply. Reprinted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of publication) For AOP papers, the credit line should read: Reprinted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME], advance online publication, day month year (doi: 10.1038/sj.[JOURNAL ACRONYM].XXXXX)
6. Adaptations of single figures do not require NPG approval. However, the adaptation should be credited as follows:
Adapted by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication)
Note: For adaptation from the British Journal of Cancer, the following credit line applies. Adapted by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of 118
publication)
7. Translations of 401 words up to a whole article require NPG approval. Please visithttp://www.macmillanmedicalcommunications.com for more information. Translations of up to a 400 words do not require NPG approval. The translation should be credited as follows:
Translated by permission from Macmillan Publishers Ltd: [JOURNAL NAME] (reference citation), copyright (year of publication).
Note: For translation from the British Journal of Cancer, the following credit line applies. Translated by permission from Macmillan Publishers Ltd on behalf of Cancer Research UK: [JOURNAL NAME] (reference citation), copyright (year of publication)
We are certain that all parties will benefit from this agreement and wish you the best in the use of this material. Thank you.
Special Terms: v1.1
If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 48 hours of the license date. Payment should be in the form of a check or money order referencing your account number and this invoice number RLNK500816585. Once you receive your invoice for this order, you may pay your invoice by credit card. Please follow instructions provided at that time.
Make Payment To:
Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006
For suggestions or comments regarding this order, contact RightsLink Customer Support:[email protected] or +1-877-622-5543 (toll free in the US) or +1- 978-646-2777.
Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.
! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
Thesis and Dissertation Services ! !