Survivin-3B Potentiates Immune Escape in Cancer but Also Inhibits the Toxicity of Cancer Chemotherapy

Published OnlineFirst July 15, 2013; DOI: 10.1158/0008-5472.CAN-13-0036

Cancer Molecular and Cellular Pathobiology Research

Fred erique Vegran 1,5, Romain Mary1, Anne Gibeaud1,Celine Mirjolet2, Bertrand Collin4,6, Alexandra Oudot4, Celine Charon-Barra3, Laurent Arnould3, Sarab Lizard-Nacol1, and Romain Boidot1

Abstract Dysregulation in patterns of alternative RNA splicing in cancer cells is emerging as a significant factor in cancer pathophysiology. In this study, we investigated the little known alternative splice isoform survivin-3B (S-3B) that is overexpressed in a tumor-specific manner. Ectopic overexpression of S-3B drove tumorigenesis by facilitating immune escape in a manner associated with resistance to immune cell toxicity. This resistance was mediated by interaction of S-3B with procaspase-8, inhibiting death-inducing signaling complex formation in response to Fas/ Fas ligand interaction. We found that S-3B overexpression also mediated resistance to cancer chemotherapy, in this case through interactions with procaspase-6. S-3B binding to procaspase-6 inhibited its activation despite mitochondrial depolarization and caspase-3 activation. When combined with chemotherapy, S-3B targeting in vivo elicited a nearly eradication of tumors. Mechanistic investigations identified a previously unrecognized 7-amino acid region as responsible for the procancerous properties of survivin proteins. Taken together, our results defined S-3B as an important functional actor in tumor formation and treatment resistance. Cancer Res; 73(17); 1–11. 2013 AACR.

Introduction that can induce the expression of five different transcripts with D Alternative splicing is an important mechanism for the different functions: survivin, survivin- Ex3, survivin-2B (5), a generation of the variety of proteins indispensable for cell survivin-3B (S-3B; ref. 6), and survivin-2 (7). Although survivin fi fi functions. In normal cells, it is finely regulated to orchestrate was rst described as a tumor-speci c gene, over the years it cellular processes. During cancer development, myriad has come to light that it is also expressed in normal cells where – defects occur throughout cell transformation. Among these its expression is necessary for cell-cycle progression (8 10). In defects, alternative splicingmisregulationseemstobean the present work, we highlighted that S-3B was a cancer- fi important factor. Misregulation of alternative splicing can speci c isoform. In addition, overexpression of this variant be observed in cancer cells in the absence of genomic induced tumorigenesis through the inhibition of tumor-direct- mutations of the genes concerned (1). In cancer cells, ed immune-cell cytotoxicity by inhibiting death-inducing sig- aberrant alternative splicing can give rise to variants that naling complex (DISC) formation. Moreover, the expression of are specifically expressed in cancer tissues and completely S-3B gave a strong advantage to cancer cells exposed to cancer absent from normal ones (2). treatment by blocking cell death through the inhibition of In vivo Among alternative spliced genes, birc5,orsurvivin, is impor- procaspase-6 activation. , the targeting of S-3B, in tant as its expression is highly deregulated in cancer (3). First association with chemotherapy, greatly improved tumor fi described in 1997 (4), survivin undergoes alternative splicing response to treatment. Finally, we identi ed a C-terminal 7- amino acid domain in S-3B as a new protein domain responsible for protein functions.

Authors' Afﬁliations: Departments of 1Tumor Biology and Pathology, Unit of Molecular Biology, 2Radiotherapy, and 3Tumor Biology and Pathology, Materials and Methods 4 ¸ Unit of Pathology, Preclinical Imaging Platform, Centre Georges-Francois Cell lines Leclerc; 5Institut National de la Sante et de la Recherche Medicale (INSERM) U866; and 6Universite de Bourgogne - UFR Sciences et Tech- All of the cell lines used (A549, BT474, BT474c, BT483, niques ICMUB - UMR CNRS 6302, Dijon, France. Calu-3, CCRF-CEM, HBL100, HCC1419, HCC1569, HCC1954, Note: Supplementary data for this article are available at Cancer Research HCC2218, HCT116, HT29, Hs578T, M113, M125, M44, M6, Online (http://cancerres.aacrjournals.org/). MCF-7, MDA-MB-231, MDA-MB-468, MelC, NCI-H1703, NCI-

S. Lizard-Nacol and R. Boidot contributed equally to this work H1781, NCI-H1975, NCI-H322, NCI-H460, NCI-H520, siHa, SKBr-3, SKOV3, SNB19, SW1116, SW48, SW620, T47D, Corresponding Author: Romain Boidot, Unit of Molecular Biology, Centre Georges Francois¸ Leclerc, 1, rue du Professeur Marion, 21079 Dijon, U373, U87-MG, UACC-812, and Widr) were purchased from France. Phone: 33-3-80-73-75-00, ext. 3185; Fax: 33-3-80-73-77-82; American Type Culture Collection (ATCC) or Oncodesign. E-mail: rboidot@cgﬂ.fr They were routinely grown in accordance with ATCC-recom- doi: 10.1158/0008-5472.CAN-13-0036 mended culture conditions. Sensitive and resistant cell lines 2013 American Association for Cancer Research. were purchased from Oncodesign.

www.aacrjournals.org OF1

Vegran et al.

Human samples Western blot analysis We studied survivin transcript expression by quantitative Westernblotanalyses were conducted as describedpreviously real-time PCR (qRT-PCR) in 103 tumors and their adjacent (12) with the following primary antibodies: b-actin, 1:25,000; normal tissues from the breast, colon, stomach, kidney, uterus, caspase-8, 1:100; caspase-10, 1:100; Bid, 1:2,000; caspase-9, 1:400; ovary, and liver. The study was conducted in accordance with caspase-3, 1:7,500; caspase-6, 1:20,000; caspase-7, 1:1,000; GFP, the Declaration of Helsinki and approved by the ethics com- 1:50,000; Fas-associated protein with death domain (FADD), mittee of the Centre Georges-Francois¸ Leclerc (Dijon, France), 1:1,000; Fas, 1:1,000; survivin 1-12, 1:500; survivin, 1:5,000; S-3B, the Comite Consultatif de Protection des Personnes en 1:5,000; and b-tubulin, 1:1,000. The S-3B antibody was produced Recherche Biomedicale de Bourgogne. Written informed con- on demand by Millegen by using the KIERALLAE peptide as sent was obtained from all patients before enrollment. All epitope. samples were treated as described previously (11). The RNA and proteins of 40 carcinomas and their adjacent normal Immunoprecipitation assays tissues were extracted by TRIzol reagent and protein pellets Immunoprecipitation assays were conducted on total pro- were kept for Western blotting of the survivin isoform. The tein extract with ExactaCruz matrix (Santa Cruz Biotechnol- same protocol was used for the analysis of tumors generated in ogy) or Dynabeads (Invitrogen) according to the manufac- mice. turer's instructions and analyzed by Western blot analysis by using the input extract as the Western blot analysis–positive Reverse transcription, semi-quantitative, and control. quantitative real-time PCR Reverse transcription and qRT-PCR were conducted as Apoptosis, mitochondrial membrane potential described previously (11, 12). The oligonucleotide sequences assessments by FACS, and crystal violet staining for used were: S-3B (forward: CCAGATGACGACCCCATAGAG, cytotoxic and clonogenic tests reverse: CCCTGAATCTGGCTTCCAATT, Probe: CATTCGTCC- Cells were treated with Fas ligand (FasL; 1/20 supernatant), GGTTGCGCTTTCC), mKlrb1c (forward: AAGGTTCACATT- or staurosporine (0.1 mmol/L). Apoptosis was assessed by using GCCAGACA, reverse: CACAGCTGCCATTTTCAGTG), mEOMS the Annexin-V–PE Apoptosis Detection Kit I (BD Pharmingen) (forward: ACATGCAGGGCAATAAGATG, reverse: GTCACTT- according to the manufacturer's instructions. CCACGATGTGCAG), mGranzyme B (forward: ACAAAGGC- Mitochondrial membrane potential was assessed after 6 or AGGGGAGATCAT, reverse: GCCCCCAAAGTGACATTTAT), 24 hours of treatment with FasL or chemotherapy drugs, mPerforin (forward: GTGGGACTTCAGCTTTCCAG, reverse: respectively, by measuring the reduction of MitoTracker Red TAGTCACATCCATGCCTTCC), mFASL (forward: TTAAATG- CM-H2XRos (Invitrogen) according to the manufacturer's GGCCACACTCCTC, reverse: ACTCCGTGAGTTCACCAACC), instructions. and mTRAIL (forward: TGGAGTCCCAGAAATCCTCA, reverse: For cytotoxic tests, 2,500 cells were cultured for 72 hours TCACCAACGAGATGAAGCAG). with increasing doses of chemotherapy drugs [staurosporine, 5-fluorouracil (5-FU), epirubicin, etoposide, cisplatin, doce- S-3B overexpression and downexpression taxel, vinblastine, and vincristine]. The full-length of the S-3B coding sequence was obtained For the natural killer (NK) cell-killing assay, NK cells were using SuperScript One-Step long templates RT-PCR (Invitro- obtained from mouse spleen and selected by using CD49b gen) with 1.25 mg of total RNA. The insert was cloned by using Microbeads (Miltenyi Biotec) and activated for 48 hours with the Vivid Colors pcDNA6.2/CT-YFP-TOPO Mammalian interleukin (IL)-2. Then, MDA-MB-231 cells were seeded and Expression Vector Kit (Invitrogen) as described by the the NK cells were added with an increasing ratio (1 target cell manufacturer. for 0 NK cell, 1/10, 1/50, 1/100, and 1 target cell for 200 NK cells). RNA interference (RNAi) was achieved using S-3B-specific MDA-MB-231 cells were incubated with NK cells for 48 hours. siRNA located in the specific part of the S-3B sequence For clonogenic assays, cells were cultured with staurospor- (forward: AAUUGAGAGAGCUCUGUUAGCAGAA, reverse: UU- ine or docetaxel for 24 hours. The treatment medium was then CUGCUAACAGAGCUCUCUCAAUU). Scramble RNA with the replaced by classical growth medium and the cells were same nucleotide composition was used as the negative control. incubated for 15 days. The short-hairpin RNA (shRNA) directed against S-3B was At the end of these experiments, the cells still attached to the obtained (based on siRNA sequence) after DNA duplex inser- plastic were stained with 0.5% crystal violet solution. For tion into BLOCK-iT Inducible H1 entry Vector (Invitrogen) as cytotoxic tests, crystal violet was dissolved in dimethyl sulf- described by the manufacturer (validation of specificity in oxide (DMSO) and read with a spectrophotometer at 590 nm. Supplementary Fig. S1B and S1C). For clonogenic assays, colonies containing at least 50 cells were Survivin siRNA was provided by Ambion and its target manually counted. All experiments were carried out at least in sequence was located at the junction of exon 3 and 4. This triplicate. siRNA induced the downregulation of survivin, survivin-DEx3, survivin2B, and survivin-2a. S-3B was not influenced by this Determination of X-ray cytotoxicity using clonogenic siRNA. assay Transient and stable transfections were carried out as The radiosensitivity of cell lines was determined by using described previously (13, 14). clonogenic assays according to the method previously described

OF2 Cancer Res; 73(17) September 1, 2013 Cancer Research

Survivin-3B Properties in Cancer Cells

(15). Briefly, 1,000 cells were seeded into 6-well plates. The plates 16 (94%) cell lines (Fig. 1A and Supplementary Fig. S1A). Then, were then irradiated 24 hours later at 0.5, 1, 2, 5, and 10 Gy by its expression was studied in 40 couples of tumors and their a linear photon accelerator (clinac600, Varian). adjacent normal tissues obtained from different organs. What- After 15 days of incubation, the colonies were fixed with ever the organ of origin, S-3B was expressed in the tumor ethanol, stained with crystal violet (0.5% w/v), washed with tap sample and not in adjacent normal tissues (representative water, and counted using a colony counter pen. result in Fig. 1B). To increase the number of patients, we analyzed, at the transcriptional level, 103 couples of tumors Characterization of NK cells and their adjacent normal tissues. The data indicated that At the end of the experiment, MDA-MB-231 tumors were the expression of S-3B was significantly tumor specific (Fig. 1C; harvested and crushed. NK cells were separated from tumor P < 0.0001). cells by Ficoll separation. NK cells were incubated with anti- As S-3B is specifically expressed in tumor tissues and not in CD69, Nkp46, and NK1 antibodies and analyzed by fluores- normal tissues, we analyzed the effect of high S-3B expression cence-activated cell sorting (FACS). on tumorigenesis. For this, we used the nontumorigenic HBL100 mammary cell line, in which we induced high S-3B In vivo experiments expression (Supplementary Fig. S1B). As controls, we also All the mice were maintained in specific pathogen-free analyzed the effect of survivin overexpression and the HBL100 conditions and all experiments followed the guidelines of the growth in absence of NK cells. After subcutaneous injection of Federation of European Animal Science Associations. All ani- these cells into nude mice, tumor growth was monitored for 50 mal experiments were approved by the Ethics Committee of days. Although control cells and survivin-overexpressing cells Universite de Bourgogne (Dijon, France). For the tumorige- did not develop into tumors, cells with a high level of S-3B were nicity assay, 3 106 HBL100 or HBL100-3B cells in serum-free able to generate tumors and promote tumor growth (Fig. 1D culture medium were inoculated subcutaneously into the right and Supplementary Fig. S2A) without increasing cell prolifer- side of 8-week-old nude (nu/nu) BALB/c mice (Charles River ation in vitro (Supplementary Fig. S2B). Moreover, in absence Laboratories; n ¼ 10 with 5 males and 5 females for each set of of NK cells, the nontumorigenic HBL100 cells were able to cells). Afterward, the tumor diameter was evaluated weakly grow (Fig. 2D). In confirmation of these findings, the intratu- using a caliper. moral injection of an anti-S-3B siRNA caused a considerable For the S-3B targeting assay, 5 106 MDA-MB-231 cells in slowdown of tumor growth of highly tumorigenic MDA-MB- serum-free culture medium were inoculated subcutaneously 231 cells (Fig. 1E and Supplementary Fig. S2C) once again into the left side of 8-week-old nude (nu/nu) BALB/c mice. without influencing cell proliferation in vitro (Supplementary Afterward, the tumor diameter was measured weekly using a Fig. S2D). caliper. As soon as the tumor volume reached 8 or 40 mm3, the mice were divided into two groups. The first group (n ¼ 10) S-3B induces resistance of cancer cells to natural killer received intratumoral injections of 300 pmol scRNA, whereas cell cytotoxicity the second (n ¼ 10) received intratumoral injections of 300 As MDA-MB-231 cells are very susceptible to NK cells (16) pmol siRNA. Both RNA were injected with Lipofectamine 2000. and S-3B induced HBL100 cell growth in the presence of NK The tumors were treated twice a week for 4 weeks. cells, we tested the impact of S-3B targeting on tumor growth in For the NK-cell depletion experiments, the same protocol the absence of NK cells. The mice were given intraperitoneal was applied after one injection of 200 mg NK-blocking antibody injections of an NK cell–blocking antibody, and the depletion NK1.1 (BioXcell) per mouse per day for 3 days. NK depletion of NK cells was maintained throughout the experiment. The was maintained by new injections once a week throughout the results obtained in the previous experiment were confirmed as experiments. the treatment of tumors with siRNA induced a substantial Finally, 5 106 Widr or MDA-MB-231 cells in serum-free slowdown of tumor growth in mice treated with the isotype culture medium were inoculated subcutaneously into the left antibody (Fig. 2A; CTRL vs. siRNA). The absence of NK cells did side of 8-week-old nude (nu/nu) BALB/c mice. Afterward, the not significantly influence tumor growth of tumors treated tumor diameter was measured weekly using a caliper. As soon with scramble RNA (Fig. 2A; CTRL vs. Ab). When tumors were as the tumor diameter reached 40 mm3, the mice were divided treated with siRNA in the absence of NK cells, the growth into four groups. Two groups (n ¼ 2 10) received intratu- slowdown induced by siRNA injection was completely lost (Fig. moral injections of 300 pmol scRNA with 2 injections (at J0 and 2A; siRNA vs. siRNAþAb). Besides, siRNA treatment also had J8) of either saline or 5-FU into the peritoneum, and the other no effect on tumor growth in the absence of NK cells (Fig. 2A; two groups (n ¼ 2 10) received intratumoral injections of 300 Ab vs. siRNA þ Ab). These data showed that NK cells were pmol siRNA with 2 injections of either saline or 5-FU into the involved in the slowdown of tumor growth in animals treated peritoneum. The tumors were treated twice a week for 6 weeks. with siRNA. As a comparison, we analyzed the impact of survivin siRNA injection on MDA-MB-231 tumor growth. The Results injection of survivin siRNA decreased tumor growth in the S-3B is specifically expressed in carcinomas and presence of NK cells but this decrease was slightly less efficient promotes tumorigenesis than S-3B siRNA (Supplementary Fig. S2E). The protein expression of S-3B was analyzed by Western blot Then, in nondepleted mice, we assessed the infiltration of analysis in 17 cancer cell lines. Its expression was detectable in NK cells into tumors. For this, we analyzed the Nkp46

www.aacrjournals.org Cancer Res; 73(17) September 1, 2013 OF3

Vegran et al.

A D 12 CTRL:YFPSurvivinS-3B *** 10 A549 BT474 HCC1419HCC1954HCC1569HCC2218Hs578TMCF-7 MDA-MB-231NCI-H1781NCI-H1975SNB19 SW1116SW48 T47D U373 siHa ) 3 S-3B 8 β-Actin *** β -Actin 6 CTRL *** Breast Colon Kidney Liver 4 S-3B *** B TNTNTNTN Tumor volume (mm volume Tumor CTRL + Ab 2 S-3B Survivin ** β-Actin 0 Ovary Stomach Uterus 0 22 30 36 42 50 Days TNTNTN S-3B E 160 CTRL siRNA *** β-Actin 140 S-3B ) 3 120 β-Actin * C *** 100 2.0 * 80 1.5 CTRL 60 1.0 siRNA 40 Tumor volume (mm volume Tumor 0.5 20 0.0 0 Tumors Normal tissues 0 8 16 22 28 Relative S-3B mRNA expression Relative Days

Figure 1. S-3B is specifically expressed in carcinomas and promotes tumorigenesis. A, S-3B was expressed at the protein level in all tested cell lines except SW1116. b-Actin was used as the loading control. B, S-3B was detected in tumors and not in normal tissues. These Western blot analyses were representative of data obtained from the 40 studied couples. b-Actin was used as the loading control. C, we studied S-3B mRNA expression in 103 tumors and their adjacent normal tissues from different origins (breast, colon, stomach, kidney, liver, etc.). S-3B expression was undetectable in normal tissues but was present in tumors. S-3B expression was more than 36 times greater in tumors than in nonmalignant tissues. D, contrary to survivin, the overexpression of S-3B induced the development and growth of nontumorigenic cells injected subcutaneously into nude mice. Although control cells did not form tumors, S-3B–overexpressing cells were able to develop tumors that had grown exponentially 30 days after injection. In NK cell–depleted mice, control cells were able to grow, but slower than S-3B–overexpressing cells. Day 0 corresponds to the cell-injection day. The arrow shows an aspecific band recognized by the antibody (Ab) used. E, MDA-MB-231 cells were subcutaneously injected into nude mice. As soon as the tumor volume reached 8 mm3, anti-S-3B siRNA (or scramble RNA as control) was injected into the tumor every 4 days for 28 days. Compared with control, the siRNA dramatically slowed tumor growth. Day 0 corresponds to the first day of the siRNA injection. , P < 0.05; , P < 0.001; , P < 0.0001.

expression by FACS. The data obtained indicated that NK cells Taken together, these data showed that S-3B made cancer were present in both control and siRNA-treated tumors and cells resistant to the cytotoxic activity of NK cells. that the extinction of S-3B did not influence the infiltration of NK cells (Fig. 2B). This result suggested that tumor behavior in S-3B inhibits cytotoxic cell–induced apoptosis through response to siRNA was not dependent on the infiltration of NK the inhibition of DISC assembly cells into the tumor. Once infiltrated, NK cells are activated. We NK cells induce cell death through two different path- analyzed the transcriptional expression of mouse Granzyme B, ways: death domain receptors (Fas/FasL, Trail) and Gran- EOMS, Perforin, FasL, and Trail in control tumors and siRNA- zyme B. Although the death domain receptor pathway is the treated tumors. We also analyzed the membrane expression of predominant pathway for tumor cell killing by NK cells, CD69 and NK1 by flow cytometry. As shown in Fig. 2C, the especially Fas/FasL (17), Granzyme B did not seem to be activation level of NK cells was the same whatever the tumor necessary for NK cell–mediated tumor rejection (18). We treatment (Fig. 2C). In Fig. 2D, the characterization of NK cells therefore explored apoptosis induced by NK cells through þ þ þ þ indicated that Nkp46 :CD69 and NK1 /CD69 cells were the activation of the death domain receptor Fas. Apoptosis present in the same proportion in tumors. Finally, we con- inducedbyFasLwasinhibitedbyS-3Boverexpression ducted a killing assay by using IL-2–activated NK cells obtained and strongly amplified in cells treated with si/shRNA with- from mice or FasL. In S-3B–overexpressing MDA-MB-231 cells, out influencing the expression of Fas (Fig. 3A). To the NK cells and FasL had a very slight cytotoxic effect compared contrary, the survivin expression variation had no effect with control cells. In contrast, the complete absence of S-3B on cells sensitivity (Supplementary Fig. S3A). Moreover, the strongly sensitized MDA-MB-231 cells to NK cell and FasL analysis of mitochondrion depolarization showed that the cytotoxicity (Fig. 2E and F). inhibition occurred upstream from the mitochondria (Fig.

OF4 Cancer Res; 73(17) September 1, 2013 Cancer Research

Survivin-3B Properties in Cancer Cells

AB 2,500 100 CTRL ) 3 2,000 Ab siRNA 90 1,500 siRNA+Ab

1,000 *** 80 500 Tumor volume (mm volume Tumor

0 70

0 4 8 12 16 20 24 28 32 36 40 cells of Nkp46-positive Percentage CTRL siRNA Days CDCTRL siRNA # 20 # 6 Nkp46+ NK1+

# 15 4

10 # 2 # 5 0 Relative mRNA expression Relative Percentage of CD69-positive cells of CD69-positive Percentage CTRL siRNA CTRL siRNA 0 mEOMS mGZM B mPerforin mFasL mTRAIL EF 110 110 100 *** *** 100 * *** 90 90 80 80 70 70 60 60 50 50 40 40 CTRL CTRL 30 30 20 S-3B 20 S-3B Percentage of living cells Percentage Percentage of living cells Percentage 10 si/shRNA 10 si/shRNA 0 0 1/0 1/1 1/10 1/200 015102050

Figure 2. S-3B induces resistance of cancer cells to NK cell cytotoxicity. A, in mice injected with the isotype antibody, tumors treated with scramble RNA (CTRL) presented exponential growth, whereas the tumors treated with siRNA (siRNA) showed a substantial slowdown of development. In mice injected with NK cell–blocking antibody, the tumors injected with scramble RNA (Ab) showed the same growth as control (CTRL). In the absence of NK cells, the siRNA injection (siRNAþAb) had no effect on tumor growth as the tumor development was the same as for control, Ab, and siRNAþAb subsets. B, the membrane expression of mouse Nkp46 (specific marker of mouse NK cells) was analyzed in MDA-MB-231 tumors extracted from nude mice. Whatever the injection given (control or siRNA), the infiltration of mouse NK cells was the same and not influenced by intratumoral injections. C, the mRNA expression of mouse EOMS, Granzyme B, Perforin, FasL, and TRAIL was analyzed in MDA-MB-231 tumors extracted from nude mice and normalized with mKlrb1c expression. Whatever the injection given (control or siRNA), the expression of these mouse NK cell genes was the same and not influenced by intratumoral injections. þ þ þ þ D, NK cell characterization showed that the proportion of activated NK cells (CD69 /Nkp46 cells and CD69 /NK1 cells) was the same in control- and siRNA-treated tumors. E and F, MDA-MB-231 cells were seeded and incubated for 48 hours with an increasing ratio of NK cells (E; from 1 target cell for 0 NK cell to 1 target cell for 200 NK cells) or an increasing amount of FasL (F; from 1 to 50 ng/mL). Attached cells were quantified by crystal violet staining. Compared with control cells, S-3B–overexpressing cells (S-3B) were resistant to the toxicity of NK cells and FasL. In contrast, anti-S-3B siRNA cells or shRNA stably transfected cells (si/shRNA) showed a strong sensitivity to NK cells and FasL (n ¼ 4–16). , P < 0.01; , P < 0.001; #, nonsignificant.

3B). Western blot analysis experiments indicated that S-3B with procaspase-8 (Fig. 3D) but not with procaspase-10 was able to block the induction of extrinsic apoptosis (Supplementary Fig. S3C). This interaction induced the (inhibition of activation of caspase-8, caspase-10, inhibition sequestration of procaspase-8 and the inhibition of any of cleavage of Bid in tBid, and inhibition of caspase-3 interaction between procaspase-8 and FADD (Fig. 3D). activation) when it was overexpressed, whereas its down- These results indicated that S-3B inhibited the DISC by regulation augmented the effect of FasL treatment on these inhibiting extrinsic pathways. proapoptotic proteins (Fig. 3C and Supplementary Fig. S3B). As the interaction between Fas and FasL induces the S-3B inhibits cancer treatment-induced cell death formation of DISC, we analyzed the involvement of S-3B As shown above, S-3B is able to inhibit extrinsic apoptosis by in the formation of DISC. Using immunoprecipitation directly interacting with procaspase-8 and thus blocking DISC experiments, we highlighted that S-3B was able to interact formation. As S-3B has already shown its ability to inhibit

www.aacrjournals.org Cancer Res; 73(17) September 1, 2013 OF5

Vegran et al.

AB 100 80 *** ***

80 60 *** *** CTRL S-3B shRNA 60 40 Fas β-Actin 40

20 Apoptosis rate (%) Apoptosis rate 20 Depolarized mitochondria (%) 0 0 CTRL S-3B si/shRNA CTRL S-3B si/shRNA Not treated FasL Not treated FasL

C Active caspase-8 Active caspase-10 6 5 D CTRL *** CTRL FasL 5 *** NT S-3B 4 S-3B si/shRNA si/shRNA CTRLS-3B si/shRNA Input 4 *** *** 3 Procaspase-8 3 2 2 S-3B 1 1 IP: FADD Relative band intensity Relative Relative band intensity Relative 0 0 Not treated FasL Not treated FasL Procaspase-8 t-Bid Active caspase-3 12 *** 45 *** FADD CTRL CTRL 40 10 S-3B 35 S-3B IP: S-3B si/shRNA si/shRNA 8 30 *** 25 FADD 6 *** 20 4 15 S-3B 10 2 Relative band intensity Relative Relative band intensity Relative 5 IP: Procaspase-8 0 0 Not treated FasL Not treated FasL

Figure 3. S-3B inhibits cytotoxic cell induced apoptosis through the inhibition of DISC assembly. A, apoptosis assay was conducted by FACS by using Annexin V/7-AAD staining after FasL treatment. Compared with MDA-MB-231 control cells (CTRL), S-3B–overexpressing cells (S-3B) were less sensitive to FasL exposure, whereas S-3B–downexpressing cells (si/shRNA) showed strong sensitivity to FasL. Moreover, the expression variation of S-3B did not inﬂuence Fas protein expression in cells. B, mitochondrial depolarization analysis showed that, unlike control cells, S-3B–expressing cells did not show depolarization of mitochondria, whereas about 90% of cells without S-3B (si/shRNA) presented mitochondrial depolarization (n ¼ 3). C, the activation of caspases-8, -10, and -3 and the cleavage of Bid in tBid in response to FasL were analyzed by Western blotting. The overexpression of S-3B inhibited the activation of caspases-8, -10, and -3, and the appearance of Bid. The extinction of S-3B (si/shRNA) dramatically increased the activation of these proteins. Band density was assessed by using ImageJ software and b-actin was used for loading normalization. Bar graphs represent the mean SD of three different experiments. D, immunoprecipitation experiments after 24-hour FasL exposure showed that S-3B interacted with procaspase-8 to inhibit DISC formation. Thus, procaspase-8 was unable to interact with FADD and therefore could not be activated by proteolytic cleavage. All experiments were repeated at least three times. , P < 0.001. IP, immunoprecipitation.

extrinsic apoptosis, we tested whether S-3B could play a role in clonogenic capacity after staurosporine treatment (Supple- the intrinsic apoptosis pathway triggered by Granzyme B (19) mentary Fig. S4C). or cancer treatments. We used staurosporine, which is known We next tested the influence of S-3B on the mitochondrial to induce intrinsic apoptosis. Although the overexpression depolarization that occurred during treatment with stauros- of S-3B greatly reduced the cytotoxicity of staurosporine, its porine. Surprisingly, it seemed that the inhibition of cell death extinction sensitized cells to the drug (Fig. 4A). Using FACS by S-3B occurred downstream from the mitochondria (Fig. 4C). with Annexin V/7-7-Aminoactinomycin D (AAD) staining At the protein level, treatment with staurosporine was accom- experiments, we confirmed that cell death induced by staur- panied by the activation of caspase-9, -3, and -7 in control, osporine was apoptosis, and that, contrary to survivin (Sup- S-3B–overexpressing, and S-3B–downexpressing cells. How- plementary Fig. S4A), S-3B protected cells from this stress (Fig. ever, it seemed that the activation of procaspase-6 was influ- 4B and Supplementary Fig. S4B). Moreover, S-3B had a real enced by S-3B. Although the overexpression of S-3B reduced protective effect as cells overexpressing S-3B had a strong the cleavage of procaspase-6, the absence of S-3B (siRNA

OF6 Cancer Res; 73(17) September 1, 2013 Cancer Research

Survivin-3B Properties in Cancer Cells

Staurosporine Active caspase-9 Active caspase-3 A D 3 CTRL 3 110 CTRL S-3B 100 S-3B si/shRNA 90 2 si/shRNA 80 2 70 60 50 1 1 40 CTRL

30 band intensity Relative

S-3B band intensity Relative 20 si/shRNA 0 0

Percentage of living cells Percentage 10 Not treated Staurosporine Not treated Staurosporine 0 0 1 5 Procaspase-6 Procaspase-7 10 50 0.1 0.5 100 0.01 0.05 1.5 CTRLS-3B si/shRNA 1.5 B CTRL S-3B si/shRNA 80 CTRL *** 1.0 *** 1.0 S-3B 60 *** si/shRNA *** 0.5 0.5 40 Relative band intensity Relative Relative band intensity Relative 20 0.0 0.0 Apoptosis rate (%) Apoptosis rate Not treated Staurosporine Not treated Staurosporine 2,000 0 F NK-resistant cells (Widr)

Not treated Staurosporine ) E Staurosporine 3 NT 1,500 CTRLS-3B si/shRNA Input CTRL 5-FU C 1,000 siRNA 100 Caspase-3 5-FU+siRNA CTRL *** 80 S-3B S-3B 500 Tumor volume (mm volume Tumor si/shRNA IP: Procaspase-6 60 0 0 4812162024 28 32 36 40 Procaspase-6 40 Days 2,000 S-3B NK-sensitive cells (MDA-MB-231) 20 ) 3 IP: Caspase-3 1,500 Depolarized mitochondria (%) 0 CTRL Not treated Staurosporine Caspase-3 5-FU 1,000 siRNA 5-FU+siRNA Procaspase-6 IP: S-3B 500 Tumor volume (mm volume Tumor *** 0 0 4 8 12 16 20 24 28 32 36 40 Days

Figure 4. S-3B inhibits cancer treatment-induced cell death. A, cytotoxic tests were carried out on MDA-MB-231 cells overexpressing or downexpressing (stably or transiently) S-3B. Cells were exposed to increasing doses of staurosporine (mmol/L) for 48 hours. The percentage of living cells is plotted as mean SD (n ¼ 3–6). Compared with control cells (CTRL), S-3B–overexpressing cells (S-3B) were less sensitive to sturosporine, whereas S-3B–downexpressing cells (si/shRNA) showed strong sensitivity to this drug. B, the apoptosis assay was conducted by FACS by using Annexin V/7-AAD staining after staurosporine treatment. These data showed that, compared with control cells (CTRL), overexpressing cells (S-3B) were more resistant to apoptosis, whereas S-3B–downexpressing cells (si/shRNA) showed a high level of apoptosis. C, mitochondrial depolarization analysis showed that, in response to staurosporine, S-3B did not inﬂuence mitochondrial depolarization whatever its expression level. D, the activation of caspases-9, -3, -6, and -7 in response to staurosporine was analyzed by Western blotting. The overexpression of S-3B (S-3B) inhibited the activation of caspase-6 without inhibiting caspases-9, -3, and -7. The extinction of S-3B (si/shRNA) dramatically increased the cleavage of procaspase-6. Caspase-9, -3, and -7 activation was not inﬂuenced by the downregulation of S-3B in response to staurosporine. E, immunoprecipitation experiments after 48 hours of treatment with staurosporine showed that S-3B interacted with procaspase-6 to inhibit its association with caspase-3 and therefore its activation. Thus, S-3B did not interact with caspase-3. F, Widr (top) and MDA-MB-231 (bottom) cells were subcutaneously injected into nude mice. As soon as tumor volumes reached 40 mm3 (day 0), anti-S-3B siRNA (or scramble RNA as control) was injected into the tumor every 4 days for 40 days. The mice were given two intraperitoneal injections (J0 and J8) of either 5-FU (25 mg/kg) or saline. Top, in mice injected with saline, tumors treated with scramble RNA (CTRL), like the tumors treated siRNA (siRNA), presented exponential growth due to resistance of Widr cells to NK-cell toxicity. In mice injected with 5-FU, for the tumors injected with scramble RNA, the chemotherapeutic treatment induced a slight delay in tumor growth but not a decrease in tumor size. The combination 5-FU treatmentþsiRNA injection (5-FUþsiRNA) induced a strong continuous stabilization of tumor volume throughout the monitored time. Bottom, in mice injected with 5-FU, for the tumors injected with scramble RNA, the chemotherapeutic treatment induced a delay in tumor growth but not a decrease in tumor size. The combination 5-FU treatmentþsiRNA injection (5-FUþsiRNA) induced a stabilization followed by a slight decrease of tumor volume throughout the monitored time. Tumor sizes are plotted as mean SD for 10 mice/group. , P < 0.001. IP, immunoprecipitation. transfection or shRNA expression) accentuated the disappear- showed that the depolarization of mitochondria and the acti- ance of the caspase-6 zymogene (Fig. 4D and Supplementary vation of caspases-9 and -3, which are normally synonymous Fig. S5A). This observation was extremely important as it with apoptosis, were not followed by cell death in the presence

www.aacrjournals.org Cancer Res; 73(17) September 1, 2013 OF7

Vegran et al.

of S-3B, as shown by apoptosis and clonogenic assays (Fig. 4C The C-terminal domain of S-3B is indispensable for its and Supplementary Fig. S4B). protective properties As S-3B inhibited procaspase-6 activation without inhibiting S-3B possesses a complete BIR domain and a specific7- caspase-3 activity in response to staurosporine, we analyzed amino acid sequence (that we named the LEO domain) at the the putative interaction between S-3B and procaspase-6. Using C-terminal: ERALLAE (Fig. 5A). For these experiments, we immunoprecipitation experiments, we showed that S-3B inter- generated cells that stably overexpressed truncated S-3B acted with procaspase-6 and inhibited its interaction with (S-3B without the LEO domain). The truncated S-3B was active caspase-3 (Fig. 4E). These observations showed that unable to protect cells against staurosporine (Fig. 5B and S-3B blocked procaspase-6 activation, and therefore the cleav- SupplementaryFig.S8).Attheproteinlevel,unlikeover- age of its substrates, and finally apoptosis. We also analyzed expression of the full S-3B, overexpression of the truncated whether S-3B was also able to interact with survivin. After form was unable to inhibit the activation of procaspase-6 staurosporine treatment, no interaction between S-3B and (Fig. 5C). This absence of inhibition was explained by the survivin was observed (Supplementary Fig. S5B). The inhibi- lack of any interaction between truncated S-3B and procas- tion of apoptosis by S-3B was also present in response to 5-FU pase-6 (Fig. 5D). For extrinsic apoptosis, the same observa- (by the same mechanism described above; Supplementary Fig. tions were made. Truncated S-3B was unable to inhibit S5C), epirubicin, etoposide, cisplatin, X-rays, docetaxel, and procaspase-8 activation (Fig. 5E and Supplementary Fig. vincristine (Supplementary Fig. S6). S9) due to the deficiency of any interaction between trun- As S-3B played an important role in the protection of cells cated S-3B and procaspase-8 (Fig. 5F). The importance of the against apoptotic stimuli, we analyzed the expression of S- LEO domain was confirmed by cytotoxic tests in response to 3B in six cancer cell lines (A459, HL60, K562, KBV1, MCF-7, X-rays and clonogenic tests in response to staurosporine and RPMI) that were sensitive or resistant to docetaxel, (Supplementary Fig. S10A and S10B, respectively). Taken adriamycin, doxorubicin, or vinblastine. The data obtained together, these results showed that the protection properties indicated that S-3B expression increased with the acquisi- of S-3B involve an unsuspected new protein domain that tion of resistance (Supplementary Fig. S7). As the involve- comprises 7 amino acids (LEO domain). ment of S-3B in cancer cell resistance was confirmed, we tested the impact of S-3B targeting in vitro on the behavior Discussion of different cancer cell lines from different tissues (breast, The deregulation of alternative splicing in cancer can be brain, colon, and cervix) in response to different drugs. S-3B responsible for the tumor-specific expression of protein. The targeting sensitized all tested cell lines to numerous tested appearance of these proteins gives strong advantages to malig- drugs (Supplementary Table S1), and notably to drugs that nant cells for their development and propagation throughout are used in clinics as the reference treatment (5-FU and the organism. Moreover, their tumor-specific expression pro- docetaxel for breast cancer, 5-FU and cisplatin for colon file makes them potential therapeutic targets. Here, we showed cancer, vincristine and vinblastine for brain cancer, and that the alternative splice variant S-3B is specifically expressed cisplatin and docetaxel for cervical cancer). in tumors from various organs (breast, colon, kidney, etc.), and Finally, we carried out in vivo experiments to explore the that its expression can play a role in tumorigenesis. Indeed, its therapeutic effect of targeting S-3B. For this, we used colon overexpression allowed the growth of nontumorigenic cells in cancer NK-resistant Widr cells (20) and the mammary cancer nude mice. We also showed that this tumorigenesis capacity NK-sensitive MDA-MB-231 cells. By using these cell lines, it was was due to the resistance of cancer cells to the toxicity of NK possible to observe the impact of chemotherapy and S-3B cells. We pointed out that this inhibition was due to a specific targeting alone, in the absence of NK-cell toxicity, on tumor interaction of S-3B with procaspase-8. This interaction growth for Widr cells. With MDA-MB-231 cells, we could completely blocked the formation of DISC, which is the first observe a possible synergistic effect between NK cell toxicity step of the extrinsic apoptosis pathway (21). S-3B, like FLIP, is a and chemotherapy treatment. We combined intratumoral new inhibitor of the DISC (22). Consequently, S-3B allowed the injections of siRNA with systemic 5-FU. As expected in Widr immune escape of cells, as tumor cell growth was diminished cells (Fig. 4F, top), the intratumoral injection of siRNA did not by NK cells when S-3B was downregulated. The immune escape affect tumor growth even in the presence of NK cells (CTRL vs. of malignant cells is directly involved in cancer development, siRNA lines). Treatment with 5-FU slightly decreased tumor whatever the tissue of origin, and is now a potential target for growth compared with control (CTRL vs. 5-FU lines). The clinical investigations on the microenvironment and NK cells combination of treatment with 5-FU and injections of siRNA (23). In addition, the targeting of S-3B could be a potential induced a stabilization of tumor volume, showing that siRNA means to sensitize tumor cells to the immune system without had a significant positive effect on tumor sensitivity to che- the risk of modifying exogenous NK cells. Indeed, it seemed motherapy (5-FU vs. 5-FUþsiRNA lines). For MDA-MB-231 that the infiltrating NK cells were identically activated and in cells (Fig. 4F, bottom), 5-FU treatment decreased tumor same proportion in siRNA-treated tumors compared with growth compared with control (CTRL vs. 5-FU lines). The control ones. combination of siRNA and 5-FU resulted in a stabilization Another important aspect of the impact of S-3B on cancer followed by a decrease of tumor volume (5-FUþsiRNA line). cells is its ability to confer resistance to anticancer treatments. These data clearly showed that S-3B could be a promising Up to now, only two studies have reported S-3B as a potential therapeutic target. antiapoptotic protein in response to cisplatin (24) or 5-FU (25).

OF8 Cancer Res; 73(17) September 1, 2013 Cancer Research

Survivin-3B Properties in Cancer Cells

ABStaurosporine LEO domain: 110 ERALLAE 100 90 80 BIR domain 70 60 50 40 30 CTRL 20 S-3B 10 Truncated S-3B Percentage of living cells Percentage 0 0 1 5 0.1 0.5 10 50 0.01 0.05 100 CD Pro-caspase-6 1.5 CTRL S-3B Truncated S-3B

# 1.0 ***

CTRL S-3B Truncated S-3BInput Pro-caspase-6 0.5 IP: GFP Relative band intensity Relative 0.0 GFP Not treated Staurosporine IP: Pro-caspase-6

Active caspase-8 EF6 CTRL # 5 S-3B *** Truncated S-3B 4

CTRL S-3B Truncated S-3BInput 3 Pro-caspase-8 2 IP: GFP 1 Relative band intensity Relative GFP 0 Not treated FasL IP: Pro-caspase-8

Figure 5. The C-terminal domain of S-3B is indispensable for its protective properties. A, the three-dimensional structure showed that S-3B possesses a BIR domain and harbored a specific 7-amino acid domain ERALLAE. B, cytotoxic tests were carried out on MDA-MB-231 cells overexpressing (stably or transiently) YFP (CTRL), S-3B, or S-3B truncated for its specific 7-amino acid domain. Living cells were stained with crystal violet. The percentage of living cells is plotted as mean SD (n ¼ 3–6). S-3B–overexpressing cells (S-3B) were more resistant than control cells (CTRL). In contrast, cells with truncated S-3B showed the same sensitivity as control cells. C, the activation of caspase-6 in response to staurosporine was analyzed by Western blot analysis. After treatment with staurosporine, the overexpression of S-3B (S-3B) inhibited the activation of caspase-6. The truncation of S-3B (truncated S-3B) induced the loss of this inhibitory potential. Band density was assessed by using ImageJ software and b-actin was used for loading normalization. Bar graphs represent the mean SD of three different experiments. D, immunoprecipitation after 48 hours of treatment with staurosporine indicated that S-3B interacted with procaspase-6, whereas truncated S-3B was unable to bind procaspase-6. E, the activation of caspases-8 in response to FasL was analyzed by Western blot analysis. The overexpression of S-3B (S-3B) inhibited the activation of caspases-8. As in control cells (CTRL), the truncation of S-3B (truncated S- 3B) did not inhibit the activation of these proteins. Band density was assessed by using ImageJ software and b-actin was used for loading normalization. Bar graphs represent the mean SD of three different experiments. F, immunoprecipitation after 48 hours of treatment with staurosporine indicated that S-3B interacted with procaspase-8, whereas truncated S-3B was unable to bind this procaspase. All experiments were repeated at least three times. , P < 0.001; #, nonsignificant. IP, immunoprecipitation.

In our work, we showed that S-3B expression dramatically depolarization and caspase-3 activation, cells that overex- increased during the acquisition of resistance to chemother- pressed S-3B did not die as indicated by their high clonogenic apy. It is now accepted that mitochondrial depolarization is a potential. Furthermore, a recent study described the important point-of-no-return of the lethal process (26) and that the role of active caspase-3 in cancer. Caspase-3 activation during presence of active caspase-3 is a marker of apoptosis (27), the apoptotic process stimulates tumor cell repopulation after and therefore cell death. In this study, we showed that in radiotherapy (28). On the basis of this work, we can imagine response to activation of the intrinsic apoptosis pathway, S-3B that, in the presence of a high level of S-3B, the activation of acted downstream from the mitochondria by preventing active caspase-3 in response to radio- or chemotherapy could poten- caspase-3–mediated cleavage of procaspase-6 (at least after tiate the metastatic capacity of tumor cells. As cells did not die, staurosporine and 5-FU treatment). Despite mitochondrial this could amplify the metastasis phenomenon rather than the

www.aacrjournals.org Cancer Res; 73(17) September 1, 2013 OF9

Vegran et al.

FasL

Fas Procaspase-10 Caspase-10 Figure 6. Hypothetical model for the roles of S-3B in the inhibition FADD of apoptosis. S-3B blocks the Bid extrinsic pathway by inhibiting S-3B Caspase-8 DISC formation via direct interaction with procaspase-8. Procaspase-8 Apoptotic t-Bid stimulus S-3B also inhibits intrinsic apoptosis by protecting procaspase-6 from its cleavage S-3B Procaspase-6 by caspase-3 via a direct Cytochrome c Cell death interaction with procaspase-6.

Caspase-3 Apaf-1 Caspase-9

Procaspase-3 Pro-caspase-9 Apoptosome

repopulation of the tumor site. This may explain the previously therapeutic target as targeting S-3B decreased tumor volume, reported poor disease-free and overall survival in patients with and as S-3B expression is tumor specific, suggesting the breast carcinoma expressing a high level of S-3B and treated potential selectivity of malignant tissues; (iv) identified a new with neoadjuvant chemotherapy (29, 30). The roles of S-3B in and unsuspected protein domain (the LEO domain) as a the inhibition of apoptosis are summarized in Fig. 6. potential new protein domain with cytoprotective properties. We showed that S-3B could be a therapeutic target in association with chemotherapy. The extinction of S-3B by Disclosure of Potential Conflicts of Interest fl siRNA combined with treatment with 5-FU clearly decreased No potential con icts of interest were disclosed. tumor volume. These results clearly indicated that targeting S- Authors' Contributions 3B sensitized tumor cells to chemotherapy. Currently, the Conception and design: S. Lizard-Nacol, R. Boidot survivin suppressor YM155 is under clinical development in Development of methodology: R. Boidot phase I/II studies. It has proved to be quite well tolerated but Acquisition of data (provided animals, acquired and managed patients, fi provided facilities, etc.): F. Vegran, R. Mary, A. Gibeaud, C. Mirjolet, B. Collin, A. has relatively low ef cacy (31, 32). Nevertheless, this small Oudot, C. Charon-Barra, L. Arnould, R. Boidot molecule might not be working by survivin suppression alone, Analysis and interpretation of data (e.g., statistical analysis, biostatistics, which could explain its low toxicity and limited efficacy (33). computational analysis): C. Mirjolet, C. Charon-Barra, R. Boidot Writing, review, and/or revision of the manuscript: F. Vegran, S. Lizard- Contrary to survivin, whose expression is necessary for mitotic Nacol, R. Boidot progression in normal cells (10), S-3B is only present in tumors, Administrative, technical, or material support (i.e., reporting or orga- nizing data, constructing databases): L. Arnould, R. Boidot making S-3B a very interesting therapeutic target with poten- Study supervision: S. Lizard-Nacol, R. Boidot tially low levels of side effects. This suggests that the systemic targeting of S-3B could be considered a potentially safe and Acknowledgments effective therapy for clinical trials. The authors thank Florian Mimolle, Sandy Chevrier, and Muriel Cadouot for Finally, unlike other BIR domains, which contain proteins their excellent technical assistance. The authors also thank Philip Bastable (CHU Le Bocage, Dijon, France) for editing the article. that interact with active caspases-3 and -7, but not with caspase-8 (34), S-3B is able to bind procaspase-8 and procas- Grant Support pase-6. Here, we showed that S-3B interacted with procaspase- This work was supported by grants from the Ligue Contre le Cancer de Cote^ 8 and procaspase-6 thanks to its 7-amino acid C-terminal d'Or (R. Boidot), the Ligue Contre le Cancer de l'Yonne (R. Boidot), the Association Pour la Recherche contre le Cancer (F. Vegran), the Ligue Nationale domain, which we named the LEO domain. Contre le Cancer (F. Vegran), and the Conseil Regional de Bourgogne (R. Boidot). In conclusion, this work (i) identified S-3B as an actor of The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in tumor immune escape and tumor resistance to cancer treat- accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ment; (ii) highlighted the fact that despite mitochondrial depolarization and caspase-3 activation, S-3B expressing cells Received January 4, 2013; revised May 8, 2013; accepted June 10, 2013; did not die; (iii) pointed out that S-3B could be a good published OnlineFirst July 15, 2013.

References 1. Dutertre M, Vagner S, Auboeuf D. Alternative splicing and breast 2. Venables JP. Aberrant and alternative splicing in cancer. Cancer Res cancer. RNA Biol 2010;7:403–11. 2004;64:7647–54.

OF10 Cancer Res; 73(17) September 1, 2013 Cancer Research

Survivin-3B Properties in Cancer Cells

3. Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, et al. nantly through a Bcl-2-inhibitable mitochondrial pathway. J Biol Chem Analysis of human transcriptomes. Nat Genet 1999;23:387–8. 2001;276:12060–7. 4. Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, 20. Heidemann SC, Chavez V, Landers CJ, Kucharzik T, Prehn JL, Targan expressed in cancer and lymphoma. Nat Med 1997;3:917–21. SR. TL1A selectively enhances IL-12/IL-18–induced NK cell cytotox- 5. Mahotka C, Wenzel M, Springer E, Gabbert HE, Gerharz CD. Survivin- icity against NK-resistant tumor targets. J Clin Immunol 2010;30: deltaEx3 and survivin-2B: two novel splice variants of the apoptosis 531–8. inhibitor survivin with different antiapoptotic properties. Cancer Res 21. Kischkel FC, Hellbardt S, Behrmann I, Germer M, Pawlita M, Krammer 1999;59:6097–102. PH, et al. Cytotoxicity-dependent APO-1 (Fas/CD95)-associated pro- 6. Badran A, Yoshida A, Ishikawa K, Goi T, Yamaguchi A, Ueda T, et al. teins form a death-inducing signaling complex (DISC) with the recep- Identification of a novel splice variant of the human anti-apoptopsis tor. EMBO J 1995;14:5579–88. gene survivin. Biochem Biophys Res Commun 2004;314:902–7. 22. Scaffidi C, Fulda S, Srinivasan A, Friesen C, Li F, Tomaselli KJ, et al. 7. Caldas H, Honsey LE, Altura RA. Survivin 2alpha: a novel Survivin Two CD95 (APO-1/Fas) signaling pathways. EMBO J 1998;17: splice variant expressed in human malignancies. Mol Cancer 2005; 1675–87. 4:11. 23. Aptsiauri N, Cabrera T, Garcia-Lora A, Garrido F. Cancer immune 8. Fukuda S, Pelus LM. Regulation of the inhibitor-of-apoptosis family escape: implications for immunotherapy, Granada, Spain, October 3– member survivin in normal cord blood and bone marrow CD34(þ) cells 5, 2011. Cancer Immunol Immunother 2012;61:739–45. by hematopoietic growth factors: implication of survivin expression in 24. Knauer SK, Bier C, Schlag P, Fritzmann J, Dietmaier W, Rodel€ F, normal hematopoiesis. Blood 2001;98:2091–100. et al. The survivin isoform survivin-3B is cytoprotective and can 9. Fukuda S, Foster RG, Porter SB, Pelus LM. The antiapoptosis protein function as a chromosomal passenger complex protein. Cell Cycle survivin is associated with cell cycle entry of normal cord blood CD34 2007;6:1502–9. (þ) cells and modulates cell cycle and proliferation of mouse hemato- 25. Sawai K, Goi T, Hirono Y, Katayama K, Yamaguchi A. Survivin-3B gene poietic progenitor cells. Blood 2002;100:2463–71. decreases the invasion-inhibitory effect of colon cancer cells with 5- 10. Jacob NK, Cooley JV, Shirai K, Chakravarti A. Survivin splice variants fluorouracil. Oncol Res 2010;18:541–7. are not essential for mitotic progression or inhibition of apoptosis 26. Zamzami N, Marchetti P, Castedo M, Zanin C, Vayssiere JL, Petit PX, induced by doxorubicin and radiation. Onco Targets Ther 2012;5:7–20. et al. Reduction in mitochondrial potential constitutes an early irre- 11. Vegran F, Boidot R, Oudin C, Riedinger JM, Lizard-Nacol S. Distinct versible step of programmed lymphocyte death in vivo. J Exp Med expression of Survivin splice variants in breast carcinomas. Int J Oncol 1995;181:1661–72. 2005;27:1151–7. 27. Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant 12. Vegran F, Boidot R, Oudin C, Defrain C, Rebucci M, Lizard-Nacol S. M, et al. Identification and inhibition of the ICE/CED-3 protease Association of p53 gene alterations with the expression of antiapop- necessary for mammalian apoptosis. Nature 1995;376:37–43. totic survivin splice variants in breast cancer. Oncogene 2007;26: 28. Huang Q, Li F, Liu X, Li W, Shi W, Liu FF, et al. Caspase 3–mediated 290–7. stimulation of tumor cell repopulation during cancer radiotherapy. Nat 13. Boidot R, Vegran F, Jacob D, Chevrier S, Cadouot M, Feron O, et al. Med 2011;17:860–6. The transcription factor GATA-1 is overexpressed in breast carcino- 29. Boidot R, Vegran F, Lizard-Nacol S. Predictive value of survivin mas and contributes to survivin upregulation via a promoter polymor- alternative transcript expression in locally advanced breast cancer phism. Oncogene 2010;29:2577–84. patients treated with neoadjuvant chemotherapy. Int J Mol Med 14. Vegran F, Boidot R, Solary E, Lizard-Nacol S. A short caspase-3 2009;23:285–91. isoform inhibits chemotherapy-induced apoptosis by blocking apop- 30. Vegran F, Boidot R, Bonnetain F, Cadouot M, Chevrier S, Lizard-Nacol tosome assembly. PLoS ONE 2011;6:e29058. S. Apoptosis gene signature of Survivin and its splice variant expres- 15. Didelot C, Barberi-Heyob M, Bianchi A, Becuwe P, Mirjolet JF, Dauca¸ sion in breast carcinoma. Endocr Relat Cancer 2011;18:783–92. M, et al. Constitutive NF-kappaB activity influences basal apoptosis 31. Cheson BD, Bartlett NL, Vose JM, Lopez-Hernandez A, Seiz AL, and radiosensitivity of head-and-neck carcinoma cell lines. Int J Radiat Keating AT, et al. A phase II study of the survivin suppressant YM155 Oncol Biol Phys 2001;51:1354–1360. in patients with refractory diffuse large B-cell lymphoma. Cancer 16. Kajitani K, Tanaka Y, Arihiro K, Kataoka T, Ohdan H. Mechanistic 2012;118:3128–34. analysis of the antitumor efficacy of human natural killer cells against 32. Tolcher AW, Quinn DI, Ferrari A, Ahmann F, Giaccone G, Drake T, et al. breast cancer cells. Breast Cancer Res Treat 2012;134:139–55. A phase II study of YM155, a novel small-molecule suppressor of 17. Schmaltz C, Alpdogan O, Horndasch KJ, Muriglan SJ, Kappel BJ, survivin, in castration-resistant taxane-pretreated prostate cancer. Teshima T, et al. Differential use of Fas ligand and perforin cytotoxic Ann Oncol 2012;23:968–73. pathways by donor T cells in graft-versus-host disease and graft- 33. Holmes D. Cancer drug's survivin suppression called into question. versus-leukemia effect. Blood 2001;97:2886–95. Nat Med 2012;18:842–3. 18. Trapani JA, Smyth MJ. Functional significance of the perforin/gran- 34. Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, et al. zyme cell death pathway. Nat Rev Immunol 2002;2:735–47. IAP-family protein survivin inhibits caspase activity and apoptosis 19. Pinkoski MJ, Waterhouse NJ, Heibein JA, Wolf BB, Kuwana T, Gold- induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer stein JC, et al. Granzyme B-mediated apoptosis proceeds predomi- Res 1998;58:5315–20.

www.aacrjournals.org Cancer Res; 73(17) September 1, 2013 OF11

Survivin-3B Potentiates Immune Escape in Cancer but Also Inhibits the Toxicity of Cancer Chemotherapy

Frédérique Végran, Romain Mary, Anne Gibeaud, et al.

Cancer Res Published OnlineFirst July 15, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-13-0036

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2013/07/16/0008-5472.CAN-13-0036.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2013/08/12/0008-5472.CAN-13-0036. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.