BASIC RESEARCH www.jasn.org

WT1-Dependent Sulfatase Expression Maintains the Normal Glomerular Filtration Barrier

Vale´rie A. Schumacher,*† Ursula Schlo¨tzer-Schrehardt,‡ S. Ananth Karumanchi,§ ʈ ʈ Xiaofeng Shi, Joseph Zaia, Stefanie Jeruschke,† Dongsheng Zhang,§ Hermann Pavenstädt,¶ Astrid Drenckhan,† Kerstin Amann,** Carrie Ng,* Sunny Hartwig,* Kar-Hui Ng,* Jacqueline Ho,* Jordan A. Kreidberg,* Mary Taglienti,* Brigitte Royer-Pokora,† and Xingbin Ai††

*Department of Medicine, Children’s Hospital Boston and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts; †Institute of Human Genetics, University of Du¨sseldorf, Du¨sseldorf, Germany; ‡Department of Ophthalmology and **Institute for Pathology, University of Erlangen-Nu¨rnberg, Nu¨rnberg, Germany; §Beth Israel ʈ Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts; Department of Biochemistry and ††The Pulmonary Center, Department of Medicine, Boston University School of Medicine, Boston, Massachusetts; and ¶Department of Medicine D, University of Mu¨nster, Mu¨nster, Germany

ABSTRACT Paracrine signaling between podocytes and glomerular endothelial cells through vascular endothelial growth factor A (VEGFA) maintains a functional glomerular filtration barrier. Heparan sulfate proteogly- cans (HSPGs), located on the cell surface or in the extracellular matrix, bind signaling molecules such as VEGFA and affect their local concentrations, but whether modulation of these moieties promotes normal crosstalk between podocytes and endothelial cells is unknown. Here, we found that the transcription factor Wilms’ Tumor 1 (WT1) modulates VEGFA and FGF2 signaling by increasing the expression of the 6-O-endosulfatases Sulf1 and Sulf2, which remodel the heparan sulfate 6-O-sulfation pattern in the extracellular matrix. Mice deficient in both Sulf1 and Sulf2 developed age-dependent proteinuria as a result of ultrastructural abnormalities in podocytes and endothelial cells, a phenotype similar to that ϩ/Ϫ observed in children with WT1 mutations and in Wt1 mice. These kidney defects associated with a decreased distribution of VEGFA in the glomerular basement membrane and on endothelial cells. Collectively, these data suggest that WT1-dependent sulfatase expression plays a critical role in main- taining the glomerular filtration barrier by modulating the bioavailability of growth factors, thereby promoting normal crosstalk between podocytes and endothelial cells.

J Am Soc Nephrol 22: 1286–1296, 2011. doi: 10.1681/ASN.2010080860

Maintenance of an intact glomerular filtration bar- tained is essential to developing improved treat- rier is essential to preserve normal renal function. ments to prevent ESRD. The barrier consists of fenestrated glomerular en- Signaling between podocytes and endothelial dothelial cells, podocytes with their interdigitating foot processes and slit diaphragms, and the glomer- Received August 19, 2010. Accepted March 7, 2011. ular basement membrane (GBM) that separates these two cell types. Defects in any component of Published online ahead of print. Publication date available at www.jasn.org. the glomerular filtration barrier leads to massive Correspondence: Dr. Valerie A. Schumacher, Children’s Hospital proteinuria, a condition referred to as nephrotic Boston, 300 Longwood Avenue, Boston, Massachusetts 02115. syndrome, that if refractory to treatment, results in Phone: 617-919-2086; Fax: 617-730-0129; E-mail: Valerie. end stage renal disease (ESRD).1,2 Thus, a better un- [email protected] derstanding of how the filtration barrier is main- Copyright © 2011 by the American Society of Nephrology

1286 ISSN : 1046-6673/2207-1286 J Am Soc Nephrol 22: 1286–1296, 2011 www.jasn.org BASIC RESEARCH

cells is necessary to maintain the integrity of the glomerular RESULTS filtration barrier.3–5 The most important signal identified thus far is vascular endothelial growth factor A (VEGFA), which is Decreased Expression of Sulf1 in WT1 Heterozygous highly expressed by podocytes, whereas its receptors are pri- Mutant Kidneys marily found on glomerular endothelial cells.6,7 Podocyte-spe- To understand molecular mechanisms of WT1-associated glo- cific haploinsufficiency for VEGFA during development merular disease, we used gene expression microarrays to iden- results in glomerular endothelial lesions similar to pre-eclamp- tify genes that are misregulated in Wt1 heterozygous mouse sia, including loss of fenestrae and endothelial cell swelling.8 glomeruli and in podocytes from humans carrying WT1 mu- Moreover, the soluble form of VEGF receptor-1 (sFlt-1) that tations, as genes misregulated in both human and mouse are neutralizes VEGF is increased in the plasma of individuals more likely to play a major role in WT1-associated glomerular with pre-eclampsia, a condition associated with protein- disease. uria.9 Mice or rats injected with sFlt-1 protein also develop Human primary podocyte cultures were established from endotheliosis and proteinuria.9,10 Additionally, targeted one child as a control and three children with genetically con- mutation of Vegfa in podocytes of adult mice leads to pro- firmed DDS (for WT1 mutations see Supplemental Table S1). found thrombotic glomerular injury, with widening of the In addition, a previously established adult human primary subendothelial space of glomerular capillaries and focal ar- podocyte culture was used as a second control.23 All primary eas of podocyte foot process effacement.11 The requirement cultures expressed podocyte specific markers such as WT1, for VEGFA for the formation and maintenance of endothe- SYNPO, POD-1, NPHS1, NPHS2 ACTN4, and CD2AP (Sup- lial fenestrae is further supported by studies demonstrating plemental Table S1). that in conditionally immortalized human glomerular en- Murine glomeruli were isolated from four 7-month-old dothelial cells fenestration is induced in response to wild-type and four Wt1ϩ/Ϫ mice at the fourth backcross onto a ϩ/Ϫ VEGFA.12 Taken together, these observations indicate that Friend virus B-type (FVB) background. These Wt1 mice proper paracrine signaling by VEGFA is vital to maintain a exhibit proteinuria at 7 months (Figure 1A), several months functional glomerular filtration barrier. earlier than Wt1ϩ/Ϫ mice on a pure 129 Sv/Jae background, The Wilms’ tumor-1 (WT1) transcription factor regu- and demonstrate signs of glomerular disease such as focal areas lates VEGFA expression in embryonic kidneys.13,14 In ma- of podocyte foot process effacement, thickening of the glomer- ture kidneys, WT1 expression is restricted to podocytes, ular basement membrane (Figure 1B), and glomerulosclerosis which also express high levels of VEGFA. Mutations in the (Figure 1C). WT1 gene, associated with Denys-Drash syndrome (DDS), A total of 766 genes were differentially expressed at least ϩ/Ϫ cause a severe early-onset nephrotic syndrome in humans.15 1.5-fold in glomeruli from Wt1 mice as compared with Our previous study provides evidence that WT1 mutations wild-type mice (P Ͻ 0.05) (Supplemental Table S2). Fifty- may alter glomerular VEGFA signaling by reducing the anti- three of these genes also showed differential expression in the angiogenic isoform VEGF165b,16 which has been suggested same direction in DDS podocytes as compared with controls to play a role in glomerular maturation and podocyte pro- (Supplemental Table S2). One hundred seventy-eight differen- tection.17,18 tially expressed genes were not represented on the human mi- The activity of signaling transduction pathways can be croarray. Among the identified genes, Sulf1 showed a 8.5-fold ϩ/Ϫ modulated not only by regulating the expression of genes reduction in Wt1 mice (also noted by Ratelade et al.24 in encoding diffusible signaling molecules but also by altering another Wt1 mouse model) and a 4.4-fold reduction in DDS the bioavailability of these signaling molecules. Heparan podocytes as compared with controls, which was confirmed by sulfate proteoglycans (HSPGs) are highly charged proteins quantitative reverse transcription-polymerase chain reaction located on the cell surface or in the ECM, which are capable (RT-PCR) and immunofluorescence (Figure 1D, Supplemen- of binding signaling molecules such as VEGFA.19 Altera- tal Figure S1). The expression of the closely related Sulf2 gene tions in the level of 6-O-sulfation of the heparan sulfate was less dramatically decreased in both DDS podocytes and (HS) chains within the HSPG can modulate the binding and glomeruli from Wt1ϩ/Ϫ mice (Figure 1D). By immunofluores- release of signaling molecules, profoundly affecting their cence staining no obvious difference in Sulf2 expression was local concentrations.20–22 seen between glomeruli from Wt1 wild-type and heterozygous In this study, we demonstrate that WT1 transcriptionally mice (Supplemental Figure S1). regulates the expression of heparan sulfate 6-O-endosulfa- Sulf1 and Sulf2 selectively remove 6-O sulfate groups from tases, and that these sulfatases are critically involved in the trisulfated disaccharides along HS chains on the cell surface maintenance of the glomerular filtration barrier by modu- and in the extracellular matrix,20–22 and thereby modulate the lating the bioavailability of signaling molecules within the binding of extracellular factors to HS and receptors such as kidney glomerulus. Together, our study provides novel in- VEGFA and FGF2.25–29 That these two signaling molecules are sights for WT1’s role in regulating cell-cell communication involved in glomerulosclerosis3–5,8,11,30–32 prompted us to that is required for functional maintenance of the adult kid- study the roles of WT1 in regulating gene expression and the ney glomerulus. function of Sulf1 and Sulf2 in kidney glomeruli.

J Am Soc Nephrol 22: 1286–1296, 2011 Sulfatases in the Glomerulus 1287 BASIC RESEARCH www.jasn.org

required for their localization at the plasma membrane.22 Interestingly, in this domain there is only 60% sequence homology be- tween Sulf1 and Sulf2 that may account for the differences seen in the subcellular localization in glomerular cells. Although the conditions used to stain Sulf1 and Sulf2 did not permit co-stain- ing with endothelial or mesangial cell markers, the incomplete overlap of each with nephrin suggests that their expression is not restricted to podocyte. Consistent with Sulf expression in vivo, Sulf1 and Sulf2 were both expressed in an immortalized murine podocyte cell line (Figure 2C) that expresses podocyte markers including WT1, ␣-actinin 4, ␣3-integrin, synaptopodin, and nephrin (Supplemental Figure S2). This was confirmed in two additional independently established podocyte cell lines (Supplemental Figure S3).

WT1 Binds the Sulf1 Promoter In Vivo and Regulates the Expression of Sulf1 In Vitro At E18.5, Wt1 is expressed in both progen- itor cells and developing mouse glomeruli. Sulf2 was previously identified as a poten- ϩ/Ϫ Figure 1. Wt1 heterozygous mice (Wt1 ) develop glomerular disease. (A) Urine tial WT1 target in a chromatin immuno- albumin/creatinine ratio. Each symbol represents one animal. (B) Transmission electron precipitation (ChIP)/Chip study using micrograph demonstrating podocyte foot process effacement (arrow) and thickening chromatin from E18.5 kidneys.14 To also ϩ/Ϫ of the glomerular basement membrane (asterisk) in Wt1 mice. Size bars ϭ 500 nm. assess direct interaction of WT1 with the ϩ/Ϫ (C) Trichrome staining reveals sclerotic changes in glomeruli of Wt1 mice (arrow). Sulf1 promoter, we performed ChIP in em- ϩ/Ϫ (D) qRT-PCR for Sulf1 and Sulf2 in glomeruli isolated from Wt1 mice and in bryonic mouse kidneys (E18.5) using podocytes cultures from children with WT1 mutations. Four-week-old mice (wild type primers that flank the transcriptional start [ϩ/ϩ], n ϭ 2: heterozygotes [ϩ/Ϫ], n ϭ 2) and the 12-week-old mice (ϩ/ϩ, n ϭ 4, and site of Sulf1 (Figure 3A) and a cis-element ϩ Ϫ ϭ ϩ ϩ / , n 3) were from the ninth backcross 129 onto FVB; 7.8-month-old mice ( / , cluster, predicted by the program Cister.33 ϭ ϩ Ϫ ϭ n 2, and / , n 2) were from the fourth backcross 129 onto FVB. Error bars: Sulf1 promoter sequences but not exon 1 ϮSEM. sequences were enriched in the WT1 ChIP, demonstrating that WT1 binds specifically Sulf1, Sulf2, and Wt1 Expression Partially Overlaps in the Sulf1 promoter in vivo (Figure 3B). This result is consistent the Kidney with findings from Ratelade et al., who demonstrated binding Both in situ hybridization and immunostaining were per- of WT1 to the Sulf1 promoter in the mesonephric M15 cell formed to test whether Sulf1, Sulf2, and Wt1 are coexpressed in line.24 the kidney. In embryonic (E17) kidneys Sulf1 and Wt1 mRNAs WT1 regulation of Sulf expression specifically in podocytes were coexpressed in the proximal part of the S-shaped body, was further examined by knocking down Wt1 expression in which ultimately gives rise to podocytes in the glomerulus. In murine immortalized podocytes. After Wt1 siRNA transfec- contrast, Sulf2 was not detected in these structures but was tion, Wt1 mRNA levels were reduced by 83% (P Ͻ 0.001), present in the nephron progenitor population that also ex- associated with a 75% reduction of Sulf1 mRNA (P Ͻ 0.001) presses Wt1, as well as in a subset of tubules (Figure 2A). but no statistically significant reduction was found for Sulf2 In adult mouse glomeruli, Sulf1 protein showed overlap- mRNA (Figure 3C). ping localization with nephrin, indicating that Sulf1 localizes Collectively, our data demonstrate that WT1 directly acti- within podocytes to areas adjacent to the GBM (Figure 2B). vates Sulf1 expression in podocytes. In contrast, although WT1 Compared with Sulf1, Sulf2 exhibited a distinct and more dif- binds to the Sulf2 promoter in embryonic kidneys14 and may fuse cytoplasmic staining pattern that also partially overlapped regulate Sulf2 expression both in nephron progenitor and im- with nephrin, suggesting expression in podocytes (Figure 2B). mature podocytes, Sulf2 expression in differentiated podocytes A centrally located hydrophilic domain in Sulf1 and Sulf2 is appears less sensitive to WT1.

1288 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1286–1296, 2011 www.jasn.org BASIC RESEARCH

5 months of age. At 5 to 9 months of age, 5 out of 6 Sulf1Ϫ/Ϫ;Sulf2Ϫ/Ϫ mice and half of Sulf1ϩ/Ϫ;Sulf2Ϫ/Ϫ mice had proteinuria (Figure 4A; Supplemental Table S3) and de- veloped glomerulosclerosis (Figure 4B), whereas age-matched Sulf1Ϫ/Ϫ;Sulf2ϩ/Ϫ, Sulf1ϩ/Ϫ;Sulf2ϩ/Ϫ, and Sulf ϩ/Ϫ;Sulf2ϩ/ϩ control mice appeared normal (Figure 4, A and B). Sulf1Ϫ/Ϫ;Sulf2Ϫ/Ϫ mice had mild to moderate mesangial matrix expansion that in some glomeruli (approximately 10 to 15%) was also segmental with adhesion of the glomerular tuft to Bowman’s capsule (Figure 4B). No intracapillary proliferation or crescents were seen. In the tubulointerstitium, no signifi- cant changes, that is, tubular atrophy, tu- bular dilation, inflammatory infiltrates, or fibrosis, were visible. Intrarenal arter- ies and arterioles showed no pathologic changes. In addition, ultrastructural analysis of Sulf1Ϫ/Ϫ;Sulf2Ϫ/Ϫ mouse kid- neys revealed thickening of the GBM along with marked widening of the sub- endothelial space as well as focal areas of loss of endothelial cell fenestration and podocyte foot process effacement (Figure 4C). WT1, nephrin, collagen IV␣4, and platelet-endothelial cell adhesion mole- cule expression were unchanged in mu- tant mice, indicating that podocytes, en- dothelial cells, and the GBM were grossly intact (Supplemental Figure S4).

Figure 2. Sulf1, Sulf2, and Wt1 partially overlap in the kidney. (A) In situ hybridization Sulfatase Deficiency Alters VEGFA In on embryonic mouse kidneys (E17). Arrows mark immature podocytes in the proximal Vivo part of the S-shaped bodies, asterisks mark podocytes in more mature glomeruli, We postulated that Sulf deficiency may arrowheads mark the nephron progenitor population, and the cross marks a subset of tubuli. (B) Immunofluorescence for Sulf1, Sulf2, and nephrin on glomeruli from adult result in an oversulfation of HS chains on mice. Insets in the upper right: higher magnification of the boxed area; nephrin in red, the podocyte surface, ultimately decreas- Sulf in green. The asterisk marks a blood vessel. (C) Expression of Wt1, Sulf1, and Sulf2 ing the amount of VEGFA released by mRNA in immortalized differentiated murine podocytes detected by RT-PCR. podocytes and available to the endothe- lial cells. To test this hypothesis in vivo, Mice Deficient in Sulf1 and Sulf2 Develop Glomerular immunogold labeling with an antibody against VEGFA was Disease performed on kidney sections from control and Sulf-defi- To further link Wt1-dependent Sulf expression to the mainte- cient mice. The specificity of this antibody is demonstrated nance of intact glomeruli, we investigated kidney phenotypes by immunohistochemistry in podocytes and by Western in Sulf single and double mutant mice. Previous studies had blot analysis (Supplemental Figure S5). In a control kidney, demonstrated that mice genetically deficient in either Sulf1 or VEGFA was detected in podocytes and their foot processes Sulf2 alone exhibit only mild phenotypes.34–36 In contrast, as well as in the GBM and at endothelial cells (Figure 5). most mice deficient in both Sulf1 and Sulf2 show neonatal Although VEGFA was still detected in podocytes of Sulf1Ϫ/ Ϫ Ϫ lethality, suggesting that Sulf1 and Sulf2 play overlapping yet Ϫ;Sulf2 / mice, its distribution in the GBM and in endo- Ϫ Ϫ critical roles in mouse development.34,35,37,38 Surviving Sulf1 / ; thelial cells was significantly diminished in both affected Sulf2Ϫ/Ϫ adults have smaller kidneys but neither renal function and less affected areas within glomeruli (Figure 5), suggest- nor kidney histology appears to be altered by 4 months of age.34 ing a role for sulfatases in regulating the bioavailability of However, in the present study, proteinuria was first detected at VEGFA.

J Am Soc Nephrol 22: 1286–1296, 2011 Sulfatases in the Glomerulus 1289 BASIC RESEARCH www.jasn.org

Figure 3. WT1 binds the Sulf1 gene promoter in vivo and regulates its transcription. (A) Structure of the Sulf1 5ЈUTR and the flanking region upstream of the TSS. Arrows indicate the location of the primers used to amplify chromatin after ChIP. Numbers refer to ENSMUST00000088585 (Ensembl). (B) ChIP on embryonic mouse kidneys (E18.5) and PCR amplification of the promotor region and exon 1 of the Sulf1 gene. WT1-#1 to 3: Samples immunoprecipitated with a WT1 antibody. PolyII: immunoprecipitation with a RNA polymerase II antibody (positive control). Negative controls: immuoprecipitation with a TGF-B antibody or rabbit IgG (RabIgG). Input #1 to 3: nonprecipitated samples. (C) Expression of Wt1, Sulf1, and Sulf2 measured by quantitative RT-PCR 48 hours after transfection of differentiated mouse podocytes with either a scramble siRNA as a control or a siRNA against Wt1. Knockdown experiments were performed independently twice. Columns represent means Ϯ SEM; ***P Ͻ 0.001. Abbreviation: TSS, transcriptional start site.

Knockdown of Sulf1 and Sulf2 In Vitro Affects VEGFA ther Sulf1 or Sulf2 alone had no significant effect on VEGFA and FGF2 Signaling secretion (Figure 6B). In contrast, simultaneous knockdown of To further support our in vivo findings, we tested whether both Sulf1 and Sulf2 resulted in a 35% reduction of VEGFA siRNA-mediated knockdown of Sulf1 and Sulf2 affects podo- secretion (P Ͻ 0.01) (Figure 6B). To exclude the possibility cyte HS sulfation and whether knockdown impairs the release that reduced VEGFA secretion was caused by decreased Vegfa of VEGFA from podocytes in culture. Immortalized podocytes expression, mRNA and protein levels were determined in Sulf expressed predominantly the HS-binding VEGF164 iso- knockdown cells. As demonstrated in Supplemental Figure S8, form19,39–41 and lower levels of mRNAs encoding VEGF120 mRNA levels remained unaltered upon Sulf knockdown. and VEGF188 (Supplemental Figure S6A). siRNAs against However, protein levels were 60% higher in cells in which Sulf1 Sulf1 and Sulf2, when added simultaneously to the cells, re- and Sulf 2 were knocked down. As transcription was not al- duced the Sulf1 mRNA level by 60% and Sulf2 by 63%, com- tered, enhanced protein levels may reflect decreased secretion pared with scrambled siRNA controls (Supplemental Figure rather than increased expression. Consistent with our immu- S6B). Reduced Sulf1 and Sulf2 expression significantly in- nogold staining results, these findings indicate that Sulf1 and creased the abundance of trisulfated disaccharides (the sub- Sulf2 regulate VEGFA binding and release from podocytes, strate of sulfatases) and reciprocally decreased disulfated disac- and consequently alter the availability of VEGFA to glomerular charides (the product of sulfatases), as measured by endothelial cells (Figure 6E). disaccharide analysis using liquid chromatography/tandem In addition to changes in VEGFA-mediated communica- mass spectrometry on HS isolated from podocyte cultures tion between podocytes and endothelial cells, augmented (Figure 6A, left panel; Supplemental Figure S7). Similar in- FGF2 signaling in podocytes has also been suggested to result creases in trisulfated HS disaccharides were also detected in in glomerular disease.31,32 We tested whether knockdown of primary podocytes from DDS patients (Figure 6A, right Sulf1 and Sulf2 would result in increased intracellular FGF2 panel), further demonstrating that the reduced levels of Sulf1 signaling in podocytes. Upon stimulation with FGF2, serum- and Sulf2 in patients with WT1 mutations and in Wt1ϩ/Ϫ mice starved podocytes responded by increasing phosphorylation of (Figure 1D) are functionally relevant. We next compared the Erk (Figure 6C, left panel). Compared with scrambled siRNA- levels of secreted VEGFA in the supernatants of scrambled treated controls, knockdown of either Sulf1 or Sulf2 alone led siRNA- and Sulf siRNA-treated podocytes. Knockdown of ei- to no increased pErk1/2, respectively (Figure 6, C[right panel]

1290 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1286–1296, 2011 www.jasn.org BASIC RESEARCH

Figure 4. Sulf-deficient mice develop glomerular disease. (A) Urine albumin/creatinine ratio. Each symbol represents one animal. Ϫ Ϫ Ϫ Ϫ Different symbols represent different genotypes. (B) PAS staining reveals sclerotic changes (arrow) in Sulf1 / ;Sulf2 / mice (n ϭ 5; GSI: 1.65, 1.84, 1.85, 1.96, 2.28) as compared with controls (n ϭ 5; GSI: 1.15, 1.16, 1.28, 1.48, 1.55). (C) Transmission electron micrograph demonstrating partial foot process effacement (arrow), thickening of the GBM with an expansion of the subendothelial space (asterisk), Ϫ Ϫ Ϫ Ϫ and loss of endothelial cell fenestration (arrowhead) in Sulf1 / ;Sulf2 / mice (n ϭ 2) as compared with a control (n ϭ 1). Right-hand panels are magnifications of the left-hand panels. Size bars ϭ 500 nm.

Figure 5. Sulf-deficient mice demonstrate altered VEGFA distribution. Left panel: Immunogold staining on control (n ϭ 3) and Ϫ Ϫ Ϫ Ϫ Sulf1 / ;Sulf2 / kidneys (n ϭ 3). Arrows mark VEGFA staining. The lower panels are magnifications of the upper panels. Size bars ϭ 500 nm. Right panel: Quantification of gold particles on two control and two Sulf double mutant kidney samples. For the controls a total of 27 pictures were taken with a surface area of 3 ␮m2 and for the mutants 20 pictures were taken from less affected areas and 15 pictures from more affected areas. Three different glomeruli were counted and per glomerulus three different capillary loops. Error bars: ϮSEM. t test (two-tailed two-sample). Abbreviations: PFP, podocyte foot process; GEC, glomerular endothelial cell. and D). In contrast, knockdown of both Sulf1 and Sulf2 re- paracrine VEGFA signaling in endothelial cells and enhanced sulted in 93% increase in pErk1/2 at 72 hours after transfection FGF2 signaling in podocytes may mediate the glomerular phe- (Figure 6D). Therefore, in children with DDS, both reduced notype.

J Am Soc Nephrol 22: 1286–1296, 2011 Sulfatases in the Glomerulus 1291 BASIC RESEARCH www.jasn.org

Figure 6. Knockdown of Sulf1 and Sulf2 in vitro modulates VEGFA and FGF2 signaling. (A) Relative abundance of trisulfated disaccharides within HS chains represented by a ratio between trisulfated and disulfated disaccharides in Sulf siRNA knockdown podocytes (left panel) and primary podocytes from DDS patients (right panel), assayed by SEC LC/MS after heparin lyase depolymerization of HS. Samples were analyzed in triplicate. Error bars: ϮSEM. **P Ͻ 0.01; ***P Ͻ 0.001. (B) Secreted VEGFA measured by ELISA in cell supernatants of differentiated podocytes after using a scramble siRNA (Sc) as a control or after knockdown of either Sulf1 or Sulf2 or both simultaneously. VEGFA concentrations were normalized to the total protein in the seeded cells. Error bars: ϮSEM from three independent experiments. **P Ͻ 0.01. (C, D) Western blot and quantification demonstrating percentage increase in phospho-Erk1/2 (normalized to total Erk1/2), after knockdown of Sulf1 or Sulf2 or both and induction with 5 ng/ml FGF2 for 5 minutes. Columns represent the differences between a scramble siRNA and the Sulf siRNAs. Error bars for FGF2: ϮSEM from two independent experiments. *P Ͻ 0.05. (E) A model of Sulf-regulated VEGF165 and FGF2 signaling. Left side, physiologic condition; right side, decreased Sulf levels.

DISCUSSION embryonic kidneys using a ChIP/chip approach.14 Together with our data, these findings provide evidence that in the kid- The data presented here provide evidence that WT1 regulated ney WT1 regulates Sulf expression in a developmental manner. Sulf expression in podocytes contributes to the maintenance of Thus, Sulf1 expression appears dependent on WT1 in both the glomerular filtration barrier. We identified Sulf1 as poten- undifferentiated progenitor cells and in differentiated podo- tial transcriptional target of WT1. Our data demonstrate that cytes, whereas Sulf2 expression appears to have lost its depen- compared with controls, Sulf1 expression is reduced in glom- dency on WT1 as cells differentiated from progenitors to eruli from Wt1ϩ/Ϫ mice and in primary podocyte cultures podocytes. This may possibly be explained by Sulf2 expression from children with WT1 mutations. In addition, WT1 binds coming under the control of other transcription factors in dif- the Sulf1 promoter in embryonic kidneys and knockdown of ferentiated podocytes, or because expression of Sulf2 becomes Wt1 in differentiated murine podocyte cultures results in de- epigenetically fixed during podocyte differentiation, such that creased levels of Sulf1. Sulf2 expression was also decreased in it is no longer dependent on the presence of WT1. DDS podocytes as well as in isolated glomeruli from Wt1ϩ/Ϫ To investigate whether decreased Sulf expression could di- mice, but its expression was not restricted to podocytes and rectly be involved in glomerular disease, we studied kidney appeared less dependent on WT1. phenotypes in Sulf single and double mutant mice. Sulf1Ϫ/Ϫ; Interestingly, three other groups have recently also identi- Sulf2Ϫ/Ϫ mice presented the most dramatic kidney phenotype fied Sulf1 and Sulf2 as a WT1 target. Langsdorf et al. demon- including thickening of the GBM along with marked widening strate regulation of Sulf1 and Sulf2 expression by WT1 in mu- of the subendothelial space as well as focal areas of loss of rine Sertoli cells.42 Ratelade et al. report decreased Sulf1 endothelial cell fenestration and podocyte foot process efface- expression in glomeruli from mice heterozygous for the most ment. Together with the finding that Sulf1 and Sulf2 are both common WT1 mutation found in individuals with DDS (p. expressed in podocytes, this phenotype indicates that there Arg394Trp), and demonstrate binding of WT1 to the Sulf1 may be functional redundancy for Sulf1 and Sulf2 in podo- ϩ/Ϫ Ϫ Ϫ promoter in a metanephric mesenchymal cell line.24 Addition- cytes. In addition, half of the Sulf1 ;Sulf2 / mice but none ally, Hartwig et al. identified Sulf2 as a potential WT1 target in of the Sulf1Ϫ/Ϫ;Sulf2ϩ/Ϫ mice presented with proteinuria. This

1292 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1286–1296, 2011 www.jasn.org BASIC RESEARCH may be related to the higher expression of Sulf2 than Sulf1 in animal studies were approved by the Institutional Animal Care and mature podocytes, such that a deficiency in Sulf2 causes a Use Committees. greater overall decrease in sulfatase activity at the GBM. Alter- natively, as Sulf2 has a broader expression domain in glomer- Urine Albumin/Creatinine uli, Sulf2 deficiency in other cell types of the glomerulus may The ratio of albumin/creatinine in urine samples from mice was de- also contribute to the phenotype. Interestingly, the glomerular termined using the DCA 2000 Urinanalyzer (Bayer Corporation) ac- changes found in Sulf1Ϫ/Ϫ;Sulf2Ϫ/Ϫ mice were reminiscent of cording to the manufacturer’s instructions. those we described previously in children with DDS,16 suggest- ing a causal link between WT1-regulated Sulf expression in Periodic Acid–Schiff Staining and Glomerulosclerosis podocytes and WT1-associated glomerular disease. Index The observation that Sulf-deficient mice exhibited a similar Kidneys were fixed in 4% paraformaldehyde and embedded in paraf- glomerular phenotype to humans and mice with reduced levels fin. Four-micrometer sections were stained with periodic acid–Schiff of glomerular VEGFA,11 and the fact that sulfatases are in- (PAS) stain to determine the glomerulosclerosis index (GSI) accord- volved in VEGF signaling,25,29 prompted us to investigate ing to reference 45. Briefly, the extent of mesangial matrix expansion whether in Sulf-deficient mice VEGFA signaling is affected. and sclerosis is quantified using a semiquantitative scoring system Mechanistically, our data provide evidence that sulfatases re- proposed by el Nahas et al. and Goumenos et al. 46, 47 With use of light duce the binding of VEGF to HS to promote paracrine VEGF microscopy at a magnification of ϫ400, the score was obtained as a signaling in glomerular endothelial cells. Decreased bioavail- mean of 100 glomeruli in each animal. The severity of matrix expan- ability of VEGFA at endothelial cells may thus ultimately result sion was expressed on an arbitrary scale from 0 to 4 with an individual in widening of the subendothelial space and loss of fenestra- glomeruli score as follows: grade 0, normal glomerulus; grade 1, pres- tion, as has previously been shown in VEGFA conditional ence of mesangial expansion/thickening of the basement membrane; knockout mice.11 It is interesting to note that sulfatases may be grade 2, mild to moderate segmental hyalinosis/sclerosis involving involved in the release of not only the pro-angiogenic isoform less than 50% of the glomerular tuft; grade 3, diffuse glomerular hy- VEGF165a but also the anti-angiogenic isoform VEGF165b. alinosis/sclerosis Ͼ50% of the tuft; and grade 4, diffuse glomerulo- Krilleke et al. have identified the amino acid residues that are sclerosis with total tuft obliteration and/or collapse. critical for binding the mouse VEGF164 to the extracellular matrix: Arg-13, Arg-14, and Arg-49.43 These three amino acids Cell Cultures are also present in the human VEGF165b isoform.44 It is there- Normal control kidneys from children and adults were obtained from fore likely that, in humans, VEGF165b binds to the same HS tumor nephrectomy specimens and from genetically confirmed DDS chains as VEGF165. Consequently, Sulf-regulated sulfation of at the time of nephrectomy, either because of the presence of a Wilms’ HS chains would affect the release of both VEGF165 and tumor or before kidney transplantation at ESRD. The parents of in- VEGF165b. In patients with DDS, VEGF165b signaling may dividuals with DDS gave informed consent regarding the study, and thus be impaired in two ways: (1) because of decreased levels of kidney tissue was used following the guidelines of the local ethics the VEGF165b isoforms (as published earlier by us16); (2) be- committee. Primary cultures of human podocytes were established cause of a decreased release of the VEGF165b isoform from the using the sieve method as described previously by Pavenstaedt et al.23 ECM because of Sulf downregulation. A conditionally immortalized podocyte cell line was generated from a Apart from promoting paracrine VEGFA signaling, our data temperature-sensitive SV40 large T antigen transgenic mouse further suggest a role for sulfatases in repressing FGF2 signaling (Charles River, St. Louis) according to the protocol used by Schiwek et pathways in podocytes. Decreased expression of sulfatases in al.48 Minor changes included the use of the magnetic bead perfusion podocytes could result in enhanced FGF2 signaling, and may in method as described by Takemoto et al. to isolate glomeruli.49 A con- turn cause podocyte damage as proposed previously.30–32 ditionally immortalized metanephric mesenchyme cell line (LB22) In conclusion, our results support the novel concept that was generated from a temperature-sensitive SV40 large T antigen WT1-regulated sulfatases are necessary for the maintenance of transgenic mouse (Charles River, St. Louis). the glomerular filtration barrier, functioning to modulate the bioavailability of critical growth factors involved in the intra- Microarray Analyses glomerular cross-talk between podocytes and endothelial cells. Glomeruli from 7-month-old Wt1ϩ/ϩ (n ϭ 4) and proteinuric Wt1ϩ/Ϫ (n ϭ 4) mice were isolated using the magnetic bead perfusion method.49 Total RNA was prepared with the PicoPure Kit (Arcturus). CONCISE METHODS cDNA was amplified and labeled using an isothermal linear amplifi- cation (Ovation Biotin RNA amplification and labeling system, Nu- Gene Technologies) and applied to Affymetrix Mouse Genome 430 Mice 2.0 microarrays. CEL files were normalized by the “robust multichip Wt1ϩ/Ϫ mice were from the fourth backcross of 129/SvJae onto a FVB average” algorithm in GenePattern (Broad Institute of Harvard Uni- background. Sulf1 and Sulf2 single and Sulf1/2 double mutant mice versity and MIT, Boston). Differential expression was assessed using t were backcrossed for 6 generations onto a C57BL/6 background.37 All test statistics (P Ͻ 0.05) and a 1.95-fold change cutoff was applied. For

J Am Soc Nephrol 22: 1286–1296, 2011 Sulfatases in the Glomerulus 1293 BASIC RESEARCH www.jasn.org human samples, biotin-labeled cRNA was generated using the Enzo HS Disaccharide Analysis BioArray high-yield RNA transcript labeling kit (Enzo Biochem) and Glucosaminoglycans (GAGs) were released from podocytes, purified, hybridized onto Affymetrix Human Genome U133A 2.0 microarrays. depolymerized using bacterial polysaccharide lyases, and analyzed us- Data analysis was performed in the same manner as for the mouse ing size exclusion chromatography/mass spectrometry (SEC LC/Ms) microarrays. as described previously.56,57 Briefly, GAGs were released using 0.5 M NaOH, followed by purification using weak anion exchange chroma- Chromatin Immunoprecipitation tography. Samples were then digested into disaccharides by heparin ChIP followed by site-specific PCR was performed on mouse embry- lyases I, II, and III from Flavobacterium heparinum (Ibex, Montreal, onic kidneys (E18.5) according to a published protocol.14 Protein/ Canada) at 37°C. The resultant disaccharides were analyzed directly chromatin complexes were pulled down using anti-WT1 (WT-C19, using SEC LC/MS. Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-RNA polymer- ase II (Upstate Biotech), and as a negative control anti-rabbit IgG ELISA (Santa Cruz Biotechnology, Inc.). For amplification of the mSulf1 Mouse VEGFA immunoassay (R&D Systems) was performed as pre- promoter region, the forward primer 5Ј-TGCTCCTCCTCTTCTTG- viously published.9 The protein levels were calculated using a stan- GAA-3Ј and reverse primer 5Ј-GATAAAACTGCCCGACCTGA-3Ј dard curve derived from known concentrations of VEGFA recombi- were used. For mSulf1 exon 1, the forward primer 5Ј-CCAATGC- nant protein and normalized to the total protein amount in the seeded CTTTGTGACCACG-3Ј and reverse primer 5Ј-AGGGAGACGAG- cells as determined by Bradford assay (Bio-Rad Laboratories). CAGTTCTCAT-3Ј were used. FGF2 Stimulation Experiments RT-PCR Forty-two hours after transfection with scrambled siRNA or Sulf cDNA was synthesized with random hexamers and Superscript III siRNA, cells were placed in serum-free media for 6 hours and then (Invitrogen). Conventional RT-PCR was performed as described pre- induced with 5 ng/ml FGF2 (Cell Signaling) for 5 minutes at 37°C viously.50 Quantitative RT-PCR reactions were carried in duplicate before lysis in 50 mM Tris-HCl (pH 7.4), 0.1% SDS, 150 mM NaCl, using SYBR green and the results normalized to GAPDH as described 1% NP40, 0.5% Na deoxycholate, 50 mM NaF, 1 mM Na3VO4, and previously.51 Relative gene expression was calculated by the 2Ϫ⌬⌬CT protease inhibitor mixture (Roche Applied Science). Equal protein method. Primer sequences are listed in the Supplemental Material. amounts were analyzed for phosphorylated (pErk1/2) and total Erk1/2 (p44/42 MAPK) amounts on Western blot. Gene Knockdown in Cultured Cells Cells were transfected with either Lipofectamine 2000 (Invitrogen Life Protein Extraction and Western Blot Technology, Inc.) or Hiperfect (Qiagen) according to the manufac- Cells or kidney tissue were lysed in buffer (500 mM NaCl, 50 mM turer’s instructions. Sequences of siRNAs and StealthTM RNAi du- Tris-HCl pH 7.4, 5 mM EDTA, 1 mM EGTA, 25 mM Na pyrophos- plexes are listed in the Supplemental Material. RNA was isolated 48 or phate pH 7.4, 1 mM Na3VO4, 50 mM NaF, 0.1% SDS, 1% NP-40, 72 hours after transfection using the RNeasy kit (Qiagen). 0.5% Na deoxycholate, and protease inhibitor mixture [Roche Ap- plied Science]). Twenty micrograms of total protein was resolved on a In Situ Hybridization and Immunofluorescence Staining 10 or 12% SDS-PAGE and transferred to a PVDF-membrane (Immun Tissue in situ hybridization and immunofluorescence staining on fro- Blot, Bio-Rad Laboratories). Detection of protein bands was per- zen or paraffin embedded sections or cultured podocytes were per- formed using horseradish peroxidase–labeled secondary antibodies formed as described previously.51–54 A riboprobe was generated from and enhanced chemiluminescence reagents (ECL Advanced Western the 3ЈUTR of the Sulf1 mouse gene by PCR amplification using a Blotting Detection Kit, GE Healthcare) and quantification using the forward 5Ј-ACCCTGCATCTGAACAGACC-3Ј and reverse 5Ј-GCT- Molecular Imager ChemiDoc XRS system (Bio-Rad Laboratories) CAGAATGTTGGCAGTCA-3Ј primer and subsequently cloning into and the Quantity One software (Bio-Rad Laboratories). the pCRII-TOPO vector (Invitrogen). Riboprobes for mouse Sulf2 were obtained from Dr. Xingbin Ai (Boston University) and for Statistical Analysis Ϯ mouse Wt1 from Dr. Jordan Kreidberg.13 Negative controls included Data are presented as mean SEM. If not otherwise indicated, two- hybridization of a sense probe. Immunofluorescence staining was tailed paired t test was performed to determine statistically significant performed with the antibodies listed in the Supplemental Material. differences between two groups. P values were adjusted for multiple F-actin was stained with Alexa Fluor 488 phalloidin (Molecular testing correction by the Holm method. A P value of less than 0.05 was Probes). Negative controls included omitting the primary antibody. considered significant. Additional materials and methods are described in the Supple- Immunoelectron Microscopy mental Material. Postembedding immunogold labeling was performed as published previously55 using anti-VEGFA (A-20; Santa Cruz Biotechnology) di- luted 1:10 in TBS-ovalbumin overnight at 4°C, and 10-nm gold-con- ACKNOWLEDGMENTS jugated anti-rabbit antibodies (BioCell, Cardiff, Wales, UK). In neg- ative control samples, the primary antibody was replaced by PBS or We thank Miriam Reutelsho¨fer for technical assistance and Dr. equimolar concentrations of non-immune rabbit IgG. Helmut Rennke, Dr. Jan Becker, and Dr. Rainer Engers for evaluating

1294 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1286–1296, 2011 www.jasn.org BASIC RESEARCH the electron micrographs. We thank Drs. Peter Mundel, Moin Saleem, 12. Satchell SC, Tasman CH, Singh A, Ni L, Geelen J, von Ruhland CJ, and Johannes Schlondorff for providing immortalized podocytes; O’Hare MJ, Saleem MA, van den Heuvel LP, Mathieson PW: Condi- tionally immortalized human glomerular endothelial cells expressing Drs. Lawrence Holzman, Jeffrey Miner, Peter Mundel, and Martin fenestrations in response to VEGF. Kidney Int 69: 1633–1640, 2006 Pollak for primary antibodies and Frank Eitner for the human mes- 13. Gao X, Chen X, Taglienti M, Rumballe B, Little MH, Kreidberg JA: angial cell line CC-2259. We thank Joshua Gould from the Broad Angioblast-mesenchyme induction of early kidney development is Institute of MIT and Harvard, Cambridge, MA, Priyanka Pandey mediated by Wt1 and Vegfa. Development 132: 5437–5449, 2005 from Children’s Hospital Boston, and Manfred Beier, Institute of Hu- 14. Hartwig S, Ho J, Pandey P, Macisaac K, Taglienti M, Xiang M, Altero- vitz G, Ramoni M, Fraenkel E, Kreidberg JA: Genomic characterization man Genetics, University of Du¨sseldorf, Du¨sseldorf, Germany, for of Wilms’ tumor suppressor 1 targets in nephron progenitor cells assistance with statistical analyses. V.A.S. acknowledges support from during kidney development. Development 137: 1189–1203, 2010 the Fritz Thyssen Stiftung, Forschungskommission Du¨sseldorf, and 15. Pelletier J, Bruening W, Kashtan CE, Mauer SM, Manivel JC, Striegel the Heinrich Hertz Foundation. X.A. acknowledges start-up funds JE, Houghton DC, Junien C, Habib R, Fouser L, Fine RN, Silverman BL, from BUSM and a NIH grant (R01AG034939). X.S. and J.Z. acknowl- Haber DA, Housman D: Germline mutations in the Wilms’ tumor suppressor gene are associated with abnormal urogenital develop- edge support from NIH grants P41RR10888 and R01HL098950. K.A. ment in Denys-Drash syndrome. Cell 67: 437–447, 1991 acknowledges support from the Deutsche Forschungsgemeinschaft 16. Schumacher VA, Jeruschke S, Eitner F, Becker JU, Pitschke G, Ince Y, (SFB423, Z2) and the IZKF Erlangen (A11). Miner JH, Leuschner I, Engers R, Everding AS, Bulla M, Royer-Pokora Part of this material was presented in abstract form at Renal Week B: Impaired glomerular maturation and lack of VEGF165b in Denys- 2009, the annual meeting of the American Society of Nephrology; Drash syndrome. J Am Soc Nephrol 18: 719–729, 2007 17. Cui TG, Foster RR, Saleem M, Mathieson PW, Gillatt DA, Bates DO, October 27 through November 1, 2009; San Diego, CA. Harper SJ: Differentiated human podocytes endogenously express an inhibitory isoform of vascular endothelial growth factor (VEGF165b) mRNA and protein. Am J Physiol Renal Physiol 286: F767–F773, 2004 DISCLOSURES 18. Bevan HS, van den Akker NM, Qiu Y, Polman JA, Foster RR, Yem J, Nishikawa A, Satchell SC, Harper SJ, Gittenberger-de Groot AC, Bates None. DO: The alternatively spliced anti-angiogenic family of VEGF isoforms VEGFxxxb in human kidney development. Nephron Physiol 110: 57– 67, 2008 19. Robinson CJ, Mulloy B, Gallagher JT, Stringer SE: VEGF165-binding REFERENCES sites within heparan sulfate encompass two highly sulfated domains and can be liberated by K5 lyase. J Biol Chem 281: 1731–1740, 2006 1. Zenker M, Machuca E, Antignac C: Genetics of nephrotic syndrome: 20. Dhoot GK, Gustafsson MK, Ai X, Sun W, Standiford DM, Emerson CP New insights into molecules acting at the glomerular filtration barrier. Jr.: Regulation of Wnt signaling and embryo patterning by an extra- J Mol Med 87: 849–857, 2009 cellular sulfatase. Science 293: 1663–1666, 2001 2. Hildebrandt F: Genetic kidney diseases. Lancet 375: 1287–1295, 2010 21. Morimoto-Tomita M, Uchimura K, Werb Z, Hemmerich S, Rosen SD: Cloning 3. Schrijvers BF, Flyvbjerg A, De Vriese AS: The role of vascular endo- and characterization of two extracellular heparin-degrading endosulfatases thelial growth factor (VEGF) in renal pathophysiology. Kidney Int 65: in mice and humans. J Biol Chem 277: 49175–49185, 2002 2003–2017, 2004 22. Ai X, Do AT, Kusche-Gullberg M, Lindahl U, Lu K, Emerson CP Jr.: 4. Mathieson PW: How much VEGF do you need? J Am Soc Nephrol 17: Substrate specificity and domain functions of extracellular heparan 602–603, 2006 sulfate 6-O-endosulfatases, QSulf1 and QSulf2. J Biol Chem 281: 5. Foster RR: The importance of cellular VEGF bioactivity in the development of 4969–4976, 2006 glomerular disease. Nephron Exp Nephrol 113: e8–e15, 2009 23. Pavenstaedt H, Spath M, Schlunck G, Nauck M, Fischer R, Wanner C, 6. Brown LF, Berse B, Tognazzi K, Manseau EJ, Van de Water L, Senger Schollmeyer P: Effect of nucleotides on the cytosolic free calcium DR, Dvorak HF, Rosen S: Vascular permeability factor mRNA and activity and inositol phosphate formation in human glomerular epithe- protein expression in human kidney. Kidney Int 42: 1457–1461, 1992 lial cells. Br J Pharmacol 107: 189–195, 1992 7. Robert B, Zhao X, Abrahamson DR: Coexpression of neuropilin-1, 24. Ratelade J, Arrondel C, Hamard G, Garbay S, Harvey S, Biebuyck N, Flk1, and VEGF(164) in developing and mature mouse kidney glom- Schulz H, Hastie N, Pontoglio M, Gubler MC, Antignac C, Heidet L: A eruli. Am J Physiol Renal Physiol 279: F275–F282, 2000 murine model of Denys-Drash syndrome reveals novel transcriptional 8. Eremina V, Sood M, Haigh J, Nagy A, Lajoie G, Ferrara N, Gerber HP, targets of WT1 in podocytes. Hum Mol Genet 19: 1–15, 2010 Kikkawa Y, Miner JH, Quaggin SE: Glomerular-specific alterations of 25. Uchimura K, Morimoto-Tomita M, Bistrup A, Li J, Lyon M, Gallagher J, Werb VEGF-A expression lead to distinct congenital and acquired renal Z, Rosen SD: HSulf-2, an extracellular endoglucosamine-6-sulfatase, selec- diseases. J Clin Invest 111: 707–716, 2003 tively mobilizes heparin-bound growth factors and chemokines: Effects on 9. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann VEGF, FGF-1, and SDF-1. BMC Biochem 7: 2, 2006 TA, Morgan JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, 26. Wang S, Ai X, Freeman SD, Pownall ME, Lu Q, Kessler DS, Emerson Karumanchi SA: Excess placental soluble fms-like tyrosine kinase 1 CP Jr.: QSulf1, a heparan sulfate 6-O-endosulfatase, inhibits fibroblast (sFlt1) may contribute to endothelial dysfunction, hypertension, and growth factor signaling in mesoderm induction and angiogenesis. proteinuria in preeclampsia. J Clin Invest 111: 649–658, 2003 Proc Natl Acad SciUSA101: 4833–4838, 2004 10. Sugimoto H, Hamano Y, Charytan D, Cosgrove D, Kieran M, Sudhakar 27. Lamanna WC, Frese MA, Balleininger M, Dierks T: Sulf loss influences A, Kalluri R: Neutralization of circulating vascular endothelial growth N-, 2-O-, and 6-O-sulfation of multiple heparan sulfate proteoglycans factor (VEGF) by anti-VEGF antibodies and soluble VEGF receptor 1 and modulates fibroblast growth factor signaling. J Biol Chem 283: (sFlt-1) induces proteinuria. J Biol Chem 278: 12605–12608, 2003 27724–27735, 2008 11. Eremina V, Jefferson JA, Kowalewska J, Hochster H, Haas M, Weisstuch J, 28. Lai J, Chien J, Staub J, Avula R, Greene EL, Matthews TA, Smith DI, Richardson C, Kopp JB, Kabir MG, Backx PH, Gerber HP, Ferrara N, Barisoni Kaufmann SH, Roberts LR, Shridhar V: Loss of HSulf-1 up-regulates L, Alpers CE, Quaggin SE: VEGF inhibition and renal thrombotic microangi- heparin-binding growth factor signaling in cancer. J Biol Chem 278: opathy. N Engl J Med 358: 1129–1136, 2008 23107–23117, 2003

J Am Soc Nephrol 22: 1286–1296, 2011 Sulfatases in the Glomerulus 1295 BASIC RESEARCH www.jasn.org

29. Fujita K, Takechi E, Sakamoto N, Sumiyoshi N, Izumi S, Miyamoto T, 44. Bates DO, Cui TG, Doughty JM, Winkler M, Sugiono M, Shields JD, Matsuura S, Tsurugaya T, Akasaka K, Yamamoto T: HpSulf, a heparan Peat D, Gillatt D, Harper SJ: VEGF165b, an inhibitory splice variant of sulfate 6-O-endosulfatase, is involved in the regulation of VEGF sig- vascular endothelial growth factor, is down-regulated in renal cell naling during sea urchin development. Mech Dev 127: 235–245, 2010 carcinoma. Cancer Res 62: 4123–4131, 2002 30. Mazue G, Bertolero F, Garofano L, Brughera M, Carminati P: Experi- 45. Wolf G, Schanze A, Stahl RA, Shankland SJ, Amann K: p27(Kip1) ence with the preclinical assessment of basic fibroblast growth factor knockout mice are protected from diabetic nephropathy: evidence (bFGF). Toxicol Lett 64–65 Spec No: 329–338, 1992 for p27(Kip1) haplotype insufficiency. Kidney Int 68: 1583–1589, 31. Floege J, Kriz W, Schulze M, Susani M, Kerjaschki D, Mooney A, 2005 Couser WG, Koch KM: Basic fibroblast growth factor augments podo- 46. el Nahas AM, Bassett AH, Cope GH, Le Carpentier JE: Role of growth cyte injury and induces glomerulosclerosis in rats with experimental hormone in the development of experimental renal scarring. Kidney membranous nephropathy. J Clin Invest 96: 2809–2819, 1995 Int 40: 29–34, 1991 32. Kriz W, Hahnel B, Rosener S, Elger M: Long-term treatment of rats with 47. Goumenos DS, Brown CB, Shortland J, el Nahas AM: Myofibroblasts, FGF-2 results in focal segmental glomerulosclerosis. Kidney Int 48: predictors of progression of mesangial IgA nephropathy? Nephrol 1435–1450, 1995 Dial Transplant 9: 1418–1425, 1994 33. Frith MC, Hansen U, Weng Z: Detection of cis-element clusters in 48. Schiwek D, Endlich N, Holzman L, Holthofer H, Kriz W, Endlich K: higher eukaryotic DNA. Bioinformatics 17: 878–889, 2001 Stable expression of nephrin and localization to cell-cell contacts in 34. Holst CR, Bou-Reslan H, Gore BB, Wong K, Grant D, Chalasani S, novel murine podocyte cell lines. Kidney Int 66: 91–101, 2004 Carano RA, Frantz GD, Tessier-Lavigne M, Bolon B, French DM, Ash- 49. Takemoto M, Asker N, Gerhardt H, Lundkvist A, Johansson BR, Saito kenazi A: Secreted sulfatases Sulf1 and Sulf2 have overlapping yet Y, Betsholtz C: A new method for large scale isolation of kidney essential roles in mouse neonatal survival. PLoS One 2: e575, 2007 glomeruli from mice. Am J Pathol 161: 799–805, 2002 35. Lamanna WC, Baldwin RJ, Padva M, Kalus I, Ten Dam G, van Kuppe- 50. Schumacher V, Schuhen S, Sonner S, Weirich A, Leuschner I, Harms D, velt TH, Gallagher JT, von Figura K, Dierks T, Merry CL: Heparan Licht J, Roberts S, Royer-Pokora B: Two molecular subgroups of sulfate 6-O-endosulfatases: Discrete in vivo activities and functional Wilms’ tumors with or without WT1 mutations. Clin Cancer Res 9: co-operativity. Biochem J 400: 63–73, 2006 2005–2014, 2003 36. Lum DH, Tan J, Rosen SD, Werb Z: Gene trap disruption of the mouse 51. Liu Y, Chattopadhyay N, Qin S, Szekeres C, Vasylyeva T, Mahoney heparan sulfate 6-O-endosulfatase gene, Sulf2. Mol Cell Biol 27: 678– ZX, Taglienti M, Bates CM, Chapman HA, Miner JH, Kreidberg JA: 688, 2007 Coordinate integrin and c-Met signaling regulate Wnt gene expres- 37. Ai X, Kitazawa T, Do AT, Kusche-Gullberg M, Labosky PA, Emerson CP sion during epithelial morphogenesis. Development 136: 843–853, Jr.: SULF1 and SULF2 regulate heparan sulfate-mediated GDNF sig- 2009 naling for esophageal innervation. Development 134: 3327–3338, 52. Ho J, Ng KH, Rosen S, Dostal A, Gregory RI, Kreidberg JA: Podocyte- 2007 specific loss of functional microRNAs leads to rapid glomerular and 38. Ratzka A, Kalus I, Moser M, Dierks T, Mundlos S, Vortkamp A: Redun- tubular injury. J Am Soc Nephrol 19: 2069–2075, 2008 dant function of the heparan sulfate 6-O-endosulfatases Sulf1 and 53. Mundel P, Reiser J, Kriz W: Induction of differentiation in cultured rat Sulf2 during skeletal development. Dev Dyn 237: 339–353, 2008 and human podocytes. J Am Soc Nephrol 8: 697–705, 1997 39. Park JE, Keller GA, Ferrara N: The vascular endothelial growth factor 54. Haas CS, Campean V, Kuhlmann A, Dimmler A, Reulbach U, Forster C, (VEGF) isoforms: Differential deposition into the subepithelial extra- Aigner T, Acker T, Plate K, Amann K: Analysis of glomerular VEGF cellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol mRNA and protein expression in murine mesangioproliferative glo- Biol Cell 4: 1317–1326, 1993 merulonephritis. Virchows Arch 450: 81–92, 2007 40. Robinson CJ, Stringer SE: The splice variants of vascular endothelial 55. Tiedemann K, Sasaki T, Gustafsson E, Gohring W, Batge B, Notbohm growth factor (VEGF) and their receptors. J Cell Sci 114: 853–865, H, Timpl R, Wedel T, Schlotzer-Schrehardt U, Reinhardt DP: Microfi- 2001 brils at basement membrane zones interact with perlecan via fibrillin-1. 41. Kretzler M, Schroppel B, Merkle M, Huber S, Mundel P, Horster M, J Biol Chem 280: 11404–11412, 2005 Schlondorff D: Detection of multiple vascular endothelial growth fac- 56. Shi X, Zaia J: Organ-specific heparan sulfate structural phenotypes. tor splice isoforms in single glomerular podocytes. Kidney Int Suppl J Biol Chem 284: 11806–11814, 2009 67: S159–S161, 1998 57. Staples GO, Shi X, Zaia J: Extended N-sulfated domains reside at the 42. Langsdorf A, Schumacher V, Shi X, Tran T, Zaia J, Jain S, Taglienti M, nonreducing end of heparan sulfate chains. J Biol Chem 285: 18336– Kreidberg JA, Fine A, Ai X: Expression regulation and function of 18343, 2010 heparan sulfate 6-O-endosulfatases in the spermatogonial stem cell niche. Glycobiology 21: 152–161, 2011 43. Krilleke D, DeErkenez A, Schubert W, Giri I, Robinson GS, Ng YS, Shima DT: Molecular mapping and functional characterization of the VEGF164 heparin-binding domain. J Biol Chem 282: 28045–28056, Supplemental information for this article is available online at http://www. 2007 jasn.org/.

1296 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1286–1296, 2011 Errata

CORRECTION Olson SW, Arbogast CB, Baker TP, Owshalimpur D, Oliver DK, Abbott KC, Yuan CM: Asymptomatic Autoantibodies Associate with Future Anti-glomerular Basement Membrane Disease. JAm Soc Nephrol 22: 1946–1952, 2011. In the original published ver- sion of the article, the following disclaimer was mistakenly omit- ted: “The views expressed in this article are those of the authors and do not reflect the official policy of the U.S. Department of the Army, the U.S. Department of Defense, or the U.S. government.” A corrected version of the article has been posted online.

CORRECTION Schumacher VA, Schlötzer-Schrehardt U, Karumanchi SA, Shi X, Zaia J, Jeruschke S, Zhang D, Pavenstädt H, Drenckhan A, Amann K, Ng C, Hartwig S, Ng K-H, Ho J, Kreidberg JA, Taglienti M, Royer-Pokora B, Ai X: WT1-Dependent Sulfatase Expression Maintains the Normal Glomerular Filtration Barrier. J Am Soc Nephrol 22: 1286–1296, 2011. In the original published version of the article, author name Hermann Pavenstaedt was spelled incor- rectly. The correct spelling is Hermann Pavenstädt. A corrected version of the article has been posted online.

2332 ISSN : 1046-6673/2212-2332 J Am Soc Nephrol 22: 2332, 2011 SUPPLEMENTAL INFORMATION

Material and Methods Primers used for RT-PCRs: mGapdh forward 5’GGTGAAGGTCGGTGTGAA3’, reverse 5’GTGTAGTCACGAAGGCATTGA3’; mNphs1 forward 5’AAAATGTGACCCTTTGCTGC3’, reverse 5’CAATGGCCAAGCATACCAG3’; mSulf1 forward 5’GGACCTTTGCTGTGTATCTCAA3’, reverse 5’CCGAGCCATTCTCGCCATG3’; mSulf2 forward 5’CATCCGGCCCAACATCATCTT3’, reverse 5’GTGTAGTCACGAAGGCATTGA3’; mWt1 forward 5’GAGAGCCAGCCTACCATCC3’; reverse 5’GGGTCCTCGTGTTTGAAGGAA3’; mVegfa forward 5’GAGATGAGGTTCCTACAGCAC3’, reverse 5’CACCGCCTTGGCTTGTCACAT3’; hACTN4 forward 5’GAGGCCCAGAGGATCGCT3’, reverse 5’ACTTGGAGTTGATGATTTGCGG3’; hCD2AP forward 5’GAGGAATGTTCCCTGACAAT3’, reverse 5’GTCCATAGGTGCTTATTCGT3’; hGAPDH forward 5’GGCTCTCCAGAACATCATCCCTGC3’, reverse 5’GGGTGTCGCTGTTGAAGTCAGAGG3’; hNPHS1 forward 5’CAACTGGGAGAGACTGGGAGAA3’, reverse 5’AATCTGACAACAAGACGGAGCA3’; hNPHS2 forward 5’AAGAGTAATTATATTCCGACTGGGACAT3’, reverse 5’TGGTCACGATCTCATGAAAAGG3’; hPOD1 forward 5’ATGCGAGTGCTGAGCAAGGCCTTC3’, reverse 5’ACCATAAAGGGCCACGTCAGGTTG3’; hSynpo forward 5’CCCAAGGTGACCCCGAAT3’, reverse 5’CTGCCGCCGCTTCTCA3’; hWt1 forward 5’CCGGTGCTTCTGGAAACTACCAGGTG3’, reverse 5’GGCTGACCTCGGGAATGTTAGACAAGAT3’.

Antibodies used for immunofluorescence and Western blots: α-Actinin4: Dr. Martin Pollak, Brigham and Women’s Hospital Boston, MA, USA; Collagen IV α4: Dr. Jeffrey Miner, Washington University in St. Louis, MO, USA; α3-Integrin: Dr. Jordan Kreidberg, Children’s Hospital Boston, MA, USA; Nephrin: Dr. Lawrence Holzman, University of Michigan, Ann Arbor, MI, USA and Progen, Heidelberg, Germany; Nidogen: Chemicon; p44/42 MAPK: Cell Signaling Technology, Inc., MA, USA; Phospho-p44/42 MAPK: Cell Signaling Technology, Inc., MA, USA; PECAM: clone MEC 13.3, BD Pharmingen; SULF1 and SULF2: Dr. Xingbin Ai, Boston University, MA, USA; Synaptopodin: Dr. Peter Mundel, University of Miami, Miami, FL, USA; α− Tubulin: clone DM 1A, Sigma, Saint Louis, MO, USA; VEGFA (A-20): Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA; Vimentin: clone LN-6, Sigma, Saint Louis, MO, USA; WT1 (C-19): Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA; Gold- conjugated anti-rabbit (10 µm): BioCell, Cardiff, Wales, UK. siRNAs and StealthTM RNAi: Sulf1-specific siRNA was directed against the sequence

CACAATGTTGGTGGTAAGAAA and Sulf2 against

TGCAACCGGCTTCATAGAATA. As a negative control the “All stars negative control siRNA” (Qiagen) was used. StealthTM RNAi duplexes were synthesized commercially by

Invitrogen Life Technologies, Inc. mWt1 RNAi (5’-

CCCAGCUUGAAUGCAUGACCUGGAA-3’), scramble control RNAi (5’-

CCCUCGUAAGUACGUCAUCGGAGAA-3’).

Figure Legends

Figure S1. Decreased expression of Sulf1 in Wt1 +/- mice. By immunofluorescence staining, Sulf1 protein levels but not Sulf2 protein levels are decreased in Wt1 +/- mice.

Pictures for the Wt1+/+ and Wt1+/- mice were taken with the same exposure time.

Nidogen served as a control to demonstrate the integrity of the tissue.

Figure S2. Characteristics of our newly established murine immortalized podocyte cell line. (A) Morphology of podocytes grown at 33°C or at non-permissive 37°C to induce differentiation. (B) Immunofluorescence on differentiated podocytes using antibodies against WT1, α-Tubulin, Vimentin, α-Actinin4, α3-Integrin, Synaptopodin, Nephrin and

Phalloidin to detect F-actin. (C) Western blot with anti-WT1 antibody. LB22: murine metanephric mesenchymal cell line, HEK293: human embryonic kidney cell line, Podo: our murine immortalized podocyte cell line. (D) RT-PCR to detect Nphs1 mRNA. M: marker, NTC: no template control, P33: podocytes grown at 33°C, P37: podocytes grown at 37°C, +RT: cDNA synthesis in presence of RT, -RT: cDNA synthesis in absence of

RT.

Figure S3. Sulf1 and Sulf2 expression in immortalized podocytes. Expression of Sulf1 and Sulf2 mRNA detected by RT-PCR in immortalized human and mouse podocytes grown at 33ºC or 37ºC for 14 days.

Figure S4. Immunofluorescence for WT1, Nephrin, Collagen IV α4 and PECAM on control kidneys (n=5) and Sulf1-/-;Sulf2-/-mutant kidneys (n=5).

Figure S5. VEGFA expression in glomeruli and in immortalized podocytes. (A) The

VEGF-A antibody used for immunogold staining specifically stains podocytes within the glomerulus and by Western blot (B) detects a single band in total protein extracts.

HUVEC: human endothelial cells as a VEGF-A-positive control and HEK293: human embryonic kidney cells as a cell line with low levels of VEGF-A. Podo33 and Podo37: immortalized podocytes grown at either 33°C or 37°C. E18.5: embryonic mouse kidney

(day E18.5). Figure S6. VEGFA isoforms expressed in podocytes. (A) Immortalized podocytes cultured at 33°C and 37°C express the three alternative VEGF-A mRNA transcripts encoding VEGF120, 164 and 188. (B) Expression of Sulf1 and Sulf2 measured by quantitative RT-PCR 48 hours after transfection of differentiated mouse podocytes with either a scramble siRNA as a control or siRNAs against Sulf1 or Sulf2 or both simultaneously. Knockdown experiments were performed independently twice.

Figure S7. Disaccharide analysis of heparin sulfate extracted from immortalized podocytes transfected with either a scramble siRNA or siRNAs against Sulf1 and Sulf2.

Disaccharides were generated by exhaustive digestion with heparin lyases I, II, and III and subsequently analyzed by SEC LC/MS. Disaccharides were shown in codes adapted from Lawrence et al. (14) and aligned along the X axis by increasing levels of sulfation.

Specifically, D0S6 and D2S0 are N-sulfated disaccharides and contain one additional sulfate group at 6-O- and 2-O-positions of glucosamine, respectively; D2S6 represents the trisulfated disaccharide with N-, 2-O- and 6-O-sulfate groups. All detected ion species that originate from Δ-unsaturated disaccharides were summed. The standard deviation was calculated from the relative percentages of each Δ-unsaturated disaccharides from triplicate SEC LC/MS runs. Due to detection limit, the saturated disaccharides, which reside on the non-reducing end of the HS chain, were not counted.

Figure S8. Vegfa expression in Sulf knockdown podocytes. Top panels: qRT-PCR for

Sulf1 and Sulf 2 after knockdown using siRNA. Lower left panel: qRT-PCR for Vegfa after knockdown of Sulf2 and Sulf2. Lower right panel: VEGFA protein levels measured by Western blot after knockdown of Sulf2 and Sulf2. This experiment was done in duplicates. Error bars: ±SEM. Wt1 +/- Wt1 +/+ Sulf1 Nidogen Sulf2 Nidogen Figure S1 A

Podocytes 33C Podocytes 37C B

WT1 α-Tubulin F-actin

Vimentin α-Actinin4 α3-Integrin

Synaptopodin Nephrin LH Nephrin Progen

+RT -RT

C LB22 HEK293 Podo D 62 kDa 55 kDa 60 kDa

52 kDa

Figure S2 Sulf2 Sulf1 Human Mouse Human Mouse

Figure S3 WT1 Nephrin Coll IVα4 PECAM Control Sulf1/2 ‐/‐

Figure S4 A

VEGFA

B HEK293 E18.5 Podo33 HUVEC kDa Podo37 37 VEGFA

49 β-Actin 37

Figure S5 A P37 P33 NTC M

Vegf188 Vegf164

Vegf120

B Sulf1 expression Sulf2 expression

Figure S6 Figure S7 Figure S8 Table S1: Clinical and mutational data of patients and controls and characteristics of the primary human podocyte cell cultures

DDS1 DDS2 DDS3 Control Control (NS18) (NS21) child adult Age at Nx (mo) 9 21 13 84 n/n Indication DDS DDS DDS Wilms’ tumor Tumor nephrectomy WT1 mutation Arg366His Cys388Arg Arg394Trp ---

RT-PCR WT1 + + + + + Synpo + + + + + POD-1 + + + + + NPHS1 + + + + + NPHS2 + + + + + ACTN4 + + n/a n/a + CD2AP + + n/a n/a + Expression array WT1 + + + + + Synpo + + + + + NPHS1 + + + + + NPHS2 + + + + + ACTN4 + + + + + CD2AP + + + + +

NS18, NS21 refer to the patients described in Schumacher et al, 2007. Nx: nephrectomy; Synpo: Synaptopodin; n/n: not known; n/a: not analyzed because we ran out of material.

Table S2: Genes differentially expressed between Wt1 mutant and control samples

Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1455494_at Col1a1 1.78E-02 5.73 1433715_at Cpne7 1.09E-02 4.00 1435418_at Slc22a8 3.00E-02 3.99 1416342_at Tnc 1.10E-02 3.85 1422789_at Aldh1a2 4.78E-02 3.52 1427883_a_at Col3a1 2.95E-02 3.49 1428572_at Basp1 1.86E-02 3.40 1416271_at Perp 1.45E-02 3.35 1450757_at Cdh11 1.27E-04 3.29 1418866_at Cyp24a1 1.85E-02 3.27 1449494_at Rab3c 6.38E-05 3.11 n/p 1416658_at Frzb 3.70E-03 2.97 1423037_at Aplnr 6.24E-04 2.91 1420992_at Ankrd1 2.78E-02 2.85 1417378_at Cadm1 5.61E-03 2.83 1424525_at Grp 3.35E-02 2.83 1439109_at Ccdc68 3.46E-04 2.73 1456264_at Commd7 1.83E-02 2.73 n/p 1418090_at Plvap 1.58E-04 2.73 1423774_a_at Prc1 2.01E-02 2.71 1450047_at Hs6st2 3.91E-02 2.66 n/p 1450648_s_at H2-Ab1 3.78E-02 2.66 n/p 1449368_at Dcn 2.75E-02 2.65 1448594_at Wisp1 1.99E-03 2.64 1424278_a_at Birc5 5.94E-03 2.59 1440955_at Kcp 3.51E-02 2.53 n/p 1448194_a_at H19 4.40E-02 2.48 n/p 1435792_at Csprs 2.57E-03 2.48 n/p 1435370_a_at Ces3 3.36E-02 2.44 1457058_at Adamts2 2.77E-02 2.41 1454694_a_at Top2a 4.82E-02 2.39 1418726_a_at Tnnt2 4.24E-02 2.31 1427537_at Eppk1 1.68E-02 2.31 1448205_at Ccnb1 1.09E-02 2.29 1456144_at Nav3 7.36E-03 2.27 1453022_at Gpihbp1 3.88E-02 2.27 n/p 1449863_a_at Dlx5 1.76E-02 2.27 1434465_x_at Vldlr 4.16E-02 2.27 209822_s_at 2.79E-02 1.75 1448314_at Cdc2a 2.07E-02 2.26 n/p 1424451_at Acaa1b 4.20E-02 2.23 n/p 1416612_at Cyp1b1 4.88E-03 2.23 1434437_x_at Rrm2 1.13E-04 2.22 1420838_at Ntrk2 2.90E-02 2.21 1449152_at Cdkn2b 5.13E-03 2.18 1424853_s_at Cyp4a10 3.94E-02 2.16 n/p 1426278_at Ifi27l2a 3.50E-02 2.15 n/p 1457266_at Slc38a6 1.71E-02 2.14 1436134_at Scn2b 1.37E-02 2.11 1430130_at Vwce 3.48E-02 2.11 n/p 1415949_at Cpe 2.07E-03 2.11 1449740_s_at Dsg2 3.81E-02 2.11 1459318_at Sema6d 4.78E-02 2.11 1429111_at Tln2 4.55E-02 2.09 1452981_at Cntn1 1.94E-02 2.08 1436920_at Pcdh17 6.23E-03 2.08 1421477_at Cplx2 1.03E-02 2.07 1435290_x_at H2-Aa 3.23E-02 2.07 n/p 1429051_s_at Sox11 1.65E-02 2.06 204914_s_at 3.48E-03 1.57 1449151_at Pctk3 2.25E-02 2.05 1439827_at Adamts12 1.67E-03 2.04 1453102_at Flrt3 3.58E-02 2.03 219250_s_at 2.42E-02 2.06 1457434_s_at Ptpla 1.20E-02 2.03 1421009_at Rsad2 2.81E-05 2.02 1419692_a_at Ltc4s 8.26E-03 2.01 1451453_at Dapk2 3.26E-02 1.99 1444073_at Maf 4.28E-02 1.98 1434728_at Gria3 4.54E-02 1.98 1418294_at Epb4.1l4b 3.34E-02 1.97 n/p Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1426511_at Susd2 7.41E-03 1.96 n/p 1417928_at Pdlim4 4.32E-02 1.96 1421712_at Sele 3.47E-02 1.95 1426642_at Fn1 4.59E-02 1.94 1416321_s_at Prelp 2.13E-02 1.94 1455393_at Cp 1.44E-02 1.94 1454926_at Sphkap 4.84E-02 1.93 n/p 1419675_at Ngf 7.31E-04 1.93 206814_at 2.90E-04 2.28 1450652_at Ctsk 4.43E-02 1.92 1416136_at Mmp2 2.52E-02 1.92 1436236_x_at Cotl1 4.86E-02 1.91 1417130_s_at Angptl4 4.18E-02 1.91 1419518_at Tuba8 2.59E-02 1.90 1452464_a_at Metapl1 1.34E-02 1.90 n/p 1437785_at Adamts9 1.92E-03 1.90 1424882_a_at Nt5dc2 1.11E-02 1.89 218051_s_at 1.82E-02 2.00 1428758_at Tmem86a 4.00E-02 1.88 n/p 1418440_at Col8a1 1.31E-03 1.87 1431057_a_at Prss23 2.57E-02 1.87 1430811_a_at Nuf2 8.10E-03 1.87 n/p 1438009_at Hist1h2ad 2.98E-02 1.85 1460412_at Fbln7 2.51E-02 1.85 n/p 1421032_a_at Dnajb12 3.37E-02 1.85 1416854_at Slc34a2 2.97E-03 1.84 204124_at 1.78E-02 1.54 1416178_a_at Plekhb1 4.90E-02 1.83 1433947_at Rab37 3.74E-02 1.83 n/p 1429014_at Ankzf1 4.18E-02 1.82 1449865_at Sema3a 4.16E-02 1.82 1456137_at Nrxn3 3.81E-03 1.81 1419687_at Macrod1 3.49E-02 1.79 1439049_at Dph5 3.54E-03 1.79 1424671_at Plekhf1 3.54E-02 1.79 1452881_at Gins2 2.23E-02 1.79 1437240_at Pgm2 2.33E-02 1.78 n/p 1429443_at Cpne4 4.48E-02 1.78 n/p 1419393_at Abcg5 3.80E-02 1.77 1430047_at Ankrd32 3.49E-02 1.77 n/p 1449141_at Fblim1 1.01E-03 1.77 n/p 1424051_at Col4a2 8.99E-03 1.76 1436313_at Scyl2 2.05E-02 1.76 1451038_at Apln 4.34E-04 1.76 n/p 1418086_at Ppp1r14a 3.61E-02 1.75 n/p 1434748_at Ckap2 4.73E-02 1.75 1437698_at Myo5b 4.20E-02 1.75 n/p 1416258_at Tk1 3.90E-02 1.74 1455154_at Gli3 5.25E-03 1.74 1429856_at Tspan18 1.13E-02 1.73 n/p 1429171_a_at Ncapg 4.77E-02 1.73 1441315_s_at Slc19a2 3.23E-02 1.72 1436513_at Tanc2 2.01E-02 1.72 1437932_a_at Cldn1 4.10E-02 1.72 1436480_at Dpp7 4.84E-02 1.72 n/p 1450584_at Hoxd11 2.10E-02 1.72 1423748_at Pdk1 1.77E-02 1.72 206686_at 2.52E-02 1.95 1419906_at Hpgd 4.53E-02 1.71 1456475_s_at Prkar2b 5.65E-03 1.71 1417894_at Gpr97 1.78E-02 1.70 1429273_at Bmper 4.92E-03 1.70 n/p 1452035_at Col4a1 1.65E-02 1.70 211981_at 2.73E-02 2.32 1438217_at A2bp1 2.88E-02 1.70 1423557_at Ifngr2 3.48E-02 1.69 201642_at 3.50E-02 1.69 1457433_x_at Zfp120 3.62E-02 1.69 n/p 1422545_at Tbx2 3.27E-02 1.69 1417160_s_at Expi 4.85E-02 1.69 n/p 1423344_at Epor 4.33E-02 1.69 1436617_at Cetn4 2.83E-02 1.69 n/p 1436002_at Scube3 3.54E-02 1.69 1428744_s_at Bri3bp 3.61E-02 1.69 n/p 1419933_at Pdrg1 1.84E-02 1.68 n/p 1434129_s_at Lhfpl2 1.93E-02 1.68 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1444085_at Pdss2 4.63E-02 1.68 1437370_at Sgol2 4.71E-02 1.68 n/p 1416740_at Col5a1 3.14E-02 1.68 1427313_at Ptgir 1.79E-02 1.67 1422527_at H2-DMa 3.42E-02 1.67 n/p 1449125_at Tnfaip8l1 4.10E-02 1.67 n/p 1418359_at Wbscr27 1.95E-02 1.67 n/p 1419149_at Serpine1 1.64E-02 1.67 1424726_at Tmem150 3.51E-02 1.67 n/p 1438010_at Tmem201 1.92E-02 1.67 n/p 1455885_at Amz1 2.22E-02 1.67 n/p 1458054_at Ext1 4.29E-02 1.66 1448378_at Fscn1 3.06E-02 1.66 1437343_x_at Atad3a 1.26E-02 1.65 1418905_at Nubp1 1.19E-02 1.65 1449464_at Kcnq1 1.33E-02 1.65 1419758_at Abcb1a 2.03E-02 1.65 n/p 1418795_at Cds2 5.53E-04 1.65 1416531_at Gsto1 1.63E-02 1.64 1434190_at Sms 4.70E-02 1.64 202043_s_at 1.84E-02 1.61 1459838_s_at Btbd11 2.19E-02 1.64 n/p 1423630_at Cygb 2.89E-02 1.63 n/p 1434575_at Epb4.1l1 1.02E-02 1.63 n/p 1421709_a_at Fmo5 4.77E-02 1.63 1419573_a_at Lgals1 5.53E-03 1.63 1439773_at Ly6e 1.47E-02 1.63 1431079_at C1qtnf2 2.00E-02 1.62 n/p 1425264_s_at Mbp 3.17E-02 1.62 1425601_a_at Rtkn 2.28E-02 1.62 n/p 1441259_s_at Ift122 2.81E-02 1.62 1460719_a_at P2rx1 2.63E-02 1.61 1438244_at Nfib 1.57E-03 1.61 1421679_a_at Cdkn1a 2.97E-02 1.61 1448964_at S100g 3.10E-02 1.61 1449246_at Rundc3a 3.55E-02 1.60 1433781_a_at Cldn12 4.52E-02 1.60 n/p 1434695_at Dtl 1.29E-02 1.60 1419589_at Cd93 4.81E-02 1.60 1449049_at Tlr1 4.23E-02 1.59 1448823_at Cxcl12 8.75E-03 1.59 1434153_at Shb 4.37E-02 1.59 1437886_at Klhl6 2.88E-02 1.58 n/p 1417026_at Pfdn1 1.51E-02 1.58 201507_at 2.43E-03 1.57 1441214_at Exph5 4.47E-03 1.58 1416118_at Trim59 1.84E-02 1.58 n/p 1422524_at Abcb6 2.60E-02 1.58 1442267_at Stxbp4 4.10E-02 1.58 n/p 1455027_at Rufy3 3.20E-02 1.58 1424086_at Oaf 1.23E-02 1.58 n/p 1425484_at Tox 1.09E-02 1.58 1450140_a_at Cdkn2a 8.20E-04 1.58 1418778_at Ccdc109b 1.02E-02 1.58 1417599_at Cd276 2.86E-02 1.58 n/p 1433684_at Chmp6 2.20E-02 1.57 1453067_at Apitd1 1.16E-02 1.57 1439766_x_at Vegfc 1.09E-02 1.57 1449903_at Crtam 3.07E-02 1.57 1417227_at Mccc1 4.85E-02 1.57 1428928_at Cacnb4 4.41E-02 1.57 1456735_x_at Acpl2 8.33E-03 1.56 n/p 1424131_at Col6a3 2.51E-02 1.56 1418606_at Hoxd10 3.81E-02 1.56 1438953_at Figf 1.39E-02 1.56 1438466_at Dnahc7b 1.16E-03 1.56 n/p 1458097_at Cobll1 1.60E-02 1.55 1460227_at Timp1 1.31E-02 1.55 1438319_x_at Fastkd2 6.76E-03 1.55 1450923_at Tgfb2 1.85E-04 1.55 1451978_at Loxl1 4.62E-02 1.55 1456728_x_at Aco1 3.01E-02 1.55 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1429466_s_at Aph1c 1.43E-02 1.54 n/p 1448690_at Kcnk1 2.41E-02 1.54 1417439_at Cd248 2.55E-02 1.54 1418862_at Echdc3 4.15E-02 1.54 219298_at 3.62E-02 1.93 1433436_s_at Thtpa 4.59E-03 1.54 1420715_a_at Pparg 2.17E-02 1.53 208510_s_at 2.29E-03 1.53 1447780_x_at Tufm 4.24E-02 1.53 1449040_a_at Sephs2 4.54E-02 1.53 1449221_a_at Rrbp1 7.48E-03 1.53 1417323_at Psrc1 3.22E-03 1.53 1418076_at St14 2.98E-02 1.53 202005_at 2.16E-02 1.79 1416591_at Rab34 7.36E-03 1.53 n/p 1422084_at Bmx 4.95E-02 1.53 1442623_at Mef2a 3.42E-02 1.53 1415810_at Uhrf1 1.59E-02 1.53 n/p 1451968_at Xrcc5 4.74E-02 1.52 1423551_at Cdh13 3.50E-02 1.52 1419130_at Adat2 4.66E-02 1.52 n/p 1457587_at Kcnq5 2.20E-02 1.52 n/p 1455841_s_at Grwd1 4.84E-02 1.52 1448383_at Mmp14 1.45E-02 1.52 202827_s_at 1.42E-02 1.98 1425182_x_at Klk1b22 1.26E-02 1.52 n/p 1448501_at Tspan6 1.12E-02 1.52 1439550_at Tnrc18 2.36E-02 1.52 n/p 1418186_at Gstt1 1.73E-02 1.52 1424418_at Slc25a38 3.31E-02 1.52 1450718_at Sh2b2 4.03E-02 1.52 1448404_at Scamp2 1.59E-02 1.52 1418796_at Clec11a 2.08E-02 1.52 1417591_at Ptges2 4.88E-03 1.51 1428427_at Fbxl2 5.78E-03 1.51 1435720_at Kcnd3 2.10E-03 1.51 1438517_at Wwox 2.25E-03 1.50 1438060_at Npas3 5.95E-03 1.50 1424542_at S100a4 4.00E-02 1.50 1439155_at Mettl1 2.73E-02 1.50 1457736_at Vps37d 4.58E-02 1.50 n/p 1424059_at Suv420h2 3.16E-03 1.50 n/p 1427387_a_at Itgb4 1.08E-03 1.50 1455396_at Atp8b1 2.09E-02 -1.50 1433623_at Zfp367 2.45E-02 -1.50 n/p 1449337_at Tdo2 4.78E-02 -1.50 1434776_at Sema5a 2.14E-02 -1.50 1455083_at Atp11c 1.32E-02 -1.50 n/p 1435556_at Zfp597 1.64E-02 -1.50 n/p 1448780_at Slc12a2 2.48E-02 -1.50 204404_at 9.60E-03 -2.78 1415728_at Pabpn1 4.67E-02 -1.50 1431066_at Fut11 1.45E-02 -1.50 n/p 1434833_at Map4k2 3.17E-02 -1.50 1424595_at F11r 6.41E-03 -1.50 1450676_at Tceb3 4.22E-02 -1.51 1425376_at Alox8 2.98E-02 -1.51 n/p 1452391_at Cxadr 3.31E-02 -1.51 1425974_a_at Trim25 3.69E-02 -1.51 1450227_at Ankrd6 3.66E-02 -1.51 1427567_a_at Tpm3 4.09E-02 -1.51 1418663_at Mpdz 1.24E-02 -1.51 1426583_at Atf2 2.43E-02 -1.51 1438129_at Wsb2 1.68E-02 -1.51 213734_at 3.27E-03 -1.89 1430205_a_at Cdc37l1 4.30E-02 -1.51 1448309_at Ap3m1 1.73E-02 -1.51 n/p 1437513_a_at Serinc1 3.94E-03 -1.51 1453853_a_at Arhgef12 8.20E-03 -1.51 1434476_at Crtc1 2.43E-02 -1.51 1422792_at Pafah1b2 2.53E-02 -1.51 1435320_at Ctdspl2 4.55E-02 -1.51 n/p 1442007_at Zmym5 1.10E-02 -1.51 1423280_at Stmn2 2.03E-02 -1.51 1423112_at Ube2d3 1.51E-02 -1.52 1425670_at Rfxank 3.33E-02 -1.52 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1441993_at Ap3s2 9.71E-03 -1.52 1423117_at Pum1 2.14E-02 -1.52 1423452_at Stk17b 1.22E-02 -1.52 1455300_at Tet2 4.08E-02 -1.52 n/p 1436405_at Dock4 2.76E-02 -1.52 205003_at 4.78E-02 -2.56 1449029_at Mknk2 2.58E-02 -1.52 1421957_a_at Pcyt1a 6.60E-03 -1.52 1436616_at Inpp4a 2.82E-03 -1.52 1434628_a_at Rhpn2 2.70E-02 -1.52 n/p 1450378_at Tapbp 1.68E-02 -1.52 1452519_a_at Zfp36 1.05E-02 -1.52 1436089_at Ints6 4.83E-02 -1.52 1431760_a_at Sdccag3 2.11E-02 -1.52 1430856_at Pex11c 4.51E-02 -1.52 n/p 1452140_at Tbc1d20 2.73E-02 -1.52 n/p 1453997_a_at Nes 2.50E-02 -1.52 1451010_at Nol11 4.04E-02 -1.52 1451761_at Hoxb4 3.22E-02 -1.52 n/p 1420951_a_at Son 1.05E-02 -1.53 1419101_at Sin3a 2.25E-03 -1.53 n/p 1427969_s_at Zfp654 3.78E-02 -1.53 n/p 1430064_at Ttll11 6.52E-03 -1.53 n/p 1455140_at Pitpnm3 3.72E-02 -1.53 1455764_at Vprbp 1.60E-02 -1.53 1422018_at Hivep2 3.64E-02 -1.53 1417755_at Topors 1.00E-02 -1.53 1429686_at Polr3f 3.32E-03 -1.53 1440022_at Poldip3 5.31E-04 -1.53 1439037_at Ddx17 1.58E-02 -1.54 1426610_a_at Ttf1 4.54E-02 -1.54 1452857_at Crebzf 2.26E-02 -1.54 202978_s_at 3.38E-02 -2.22 1454831_at Foxn2 2.64E-02 -1.54 1418513_at Stk3 1.04E-02 -1.54 1426360_at Zc3h11a 9.77E-03 -1.54 1426349_s_at Tmpo 3.61E-02 -1.54 1419250_a_at Pftk1 1.11E-02 -1.54 1452228_at Tbc1d23 8.45E-03 -1.54 n/p 1420615_at Ash2l 5.87E-03 -1.54 1418114_at Rbpj 1.56E-02 -1.54 1457400_at Snx19 2.12E-02 -1.54 1434602_at Med13l 2.71E-02 -1.54 1442186_at Atxn7 3.99E-02 -1.54 1418246_at Rbm9 1.33E-02 -1.54 1417539_at Slc35a1 4.49E-02 -1.54 1431385_a_at Mbtps1 9.34E-03 -1.54 1453623_a_at Rad23a 1.21E-03 -1.54 1420918_at Sgk3 2.79E-02 -1.54 1415823_at Scd2 6.41E-03 -1.55 n/p 1416201_at Crk 1.12E-03 -1.55 1416292_at Prdx3 2.96E-02 -1.55 1429776_a_at Dnajb6 9.08E-03 -1.55 208810_at 1.04E-02 -1.82 1451494_at Wac 1.29E-02 -1.55 1431746_a_at Uba3 6.74E-03 -1.55 1425497_a_at Prpf4b 8.60E-03 -1.55 1455335_at Xrcc2 3.56E-03 -1.55 1460665_a_at Cnot7 1.63E-02 -1.55 1423174_a_at Pard6b 2.13E-02 -1.55 1419361_at Ss18 3.84E-03 -1.55 1439938_at Stk38 5.93E-03 -1.55 1433632_at Irf2bp2 4.85E-02 -1.55 n/p 1436070_at Glo1 1.80E-02 -1.55 1427367_at Efcab4a 1.31E-02 -1.55 n/p 1452783_at Fndc3b 2.79E-02 -1.55 1431686_a_at Gmfb 1.94E-02 -1.56 1421889_a_at Aplp2 2.22E-02 -1.56 1417261_at Mbtd1 2.09E-02 -1.56 1454951_at Zfp606 4.28E-02 -1.56 n/p 1452766_at Tppp 2.69E-02 -1.56 1426221_at Vwa5a 2.14E-02 -1.56 1416732_at Top2b 7.46E-03 -1.56 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1436354_at Dzip1l 3.49E-02 -1.56 n/p 1421550_a_at Trim34 1.65E-02 -1.56 1455683_a_at Tbc1d8 3.65E-03 -1.56 1418898_at Lin7c 3.68E-02 -1.56 1425845_a_at Shoc2 5.04E-03 -1.56 1425995_s_at Wt1 3.76E-02 -1.56 206067_s_at 5.98E-03 -3.03 1440195_at Serbp1 6.64E-04 -1.56 1428402_at Zcchc3 2.36E-02 -1.56 n/p 1452077_at Ddx3y 1.66E-03 -1.56 1458233_at Fryl 2.90E-02 -1.56 1437477_at Lrrfip1 8.63E-03 -1.56 1428117_x_at Dynlt1 4.55E-02 -1.56 1423054_at Wdr1 2.77E-02 -1.56 1450874_at Matr3 5.86E-03 -1.56 1459951_at Rps6kb1 2.57E-02 -1.56 1424390_at Nupl1 1.85E-02 -1.56 1452449_at Hmbox1 1.70E-02 -1.57 1450396_at Stag2 9.42E-03 -1.57 1450916_at Stau2 3.84E-02 -1.57 1417163_at Dusp10 8.04E-03 -1.57 1419356_at Klf7 1.13E-02 -1.57 1448444_at Rpe 1.98E-02 -1.57 1436982_at Tnrc6b 1.02E-02 -1.57 1449515_at Zfp292 3.04E-02 -1.57 n/p 1425487_at Slu7 1.10E-02 -1.57 n/p 1449999_a_at Cacna2d1 5.00E-03 -1.57 1421139_a_at Zfp386 1.64E-02 -1.57 n/p 1460213_at Golga4 8.30E-03 -1.57 1416123_at Ccnd2 5.71E-03 -1.57 200953_s_at 2.62E-04 -3.03 1443142_at Btrc 3.74E-02 -1.57 1433925_at Dync1li2 2.80E-02 -1.57 1449069_at Zfp148 5.79E-03 -1.58 n/p 1452385_at Usp53 4.98E-03 -1.58 1427489_at Itga8 3.08E-02 -1.58 1436325_at Rora 1.98E-02 -1.58 1440543_at Heatr5a 9.01E-03 -1.58 n/p 1430057_s_at Lrrc57 9.17E-03 -1.58 n/p 1415729_at Pdpk1 2.44E-02 -1.58 1460331_at Tm9sf2 3.23E-02 -1.58 1420479_a_at Nap1l1 6.75E-03 -1.58 1418819_at Arl8b 2.60E-02 -1.58 1439503_at Zfp28 4.83E-02 -1.58 n/p 1427189_at Arih1 2.26E-03 -1.59 1425755_at Mtcp1 2.97E-03 -1.59 1459034_at Wdr19 1.48E-02 -1.59 1430827_a_at Ptk2 1.23E-02 -1.59 1437568_at Mmp16 3.86E-02 -1.59 n/p 1448793_a_at Sdc4 4.46E-02 -1.59 1449414_at Zfp53 3.81E-02 -1.59 n/p 1423994_at Kif1b 3.82E-02 -1.59 209234_at 2.85E-03 -1.51 1460662_at Per3 4.74E-02 -1.59 1456407_a_at Tlk1 2.20E-02 -1.59 1421069_at Phf2 2.65E-02 -1.59 1418258_s_at Dynll2 8.62E-04 -1.59 n/p 1420547_at Galc 2.19E-02 -1.59 1439555_at Rlf 4.31E-02 -1.60 1435152_at Leng8 2.83E-02 -1.60 n/p 1424483_at Mobkl1b 4.17E-03 -1.60 1422321_a_at Sf1 1.33E-02 -1.60 1453413_at Gnas 7.40E-03 -1.60 1437476_at Rrm2b 1.15E-02 -1.60 n/p 1421338_at Elf4 1.16E-02 -1.60 1453160_at Med13 3.81E-02 -1.60 1423490_at Fbxo3 3.29E-02 -1.60 1429655_at Nudcd1 4.27E-02 -1.60 n/p 1417502_at Tspan7 2.41E-02 -1.60 1438397_a_at Rbm39 1.49E-02 -1.60 1448781_at Nab1 1.90E-02 -1.60 209272_at 7.14E-03 -1.54 1450478_a_at Ptpn12 1.97E-02 -1.61 1451800_at Gcc2 1.53E-02 -1.61 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1420990_at Chd1 3.04E-02 -1.61 1424287_at Prkx 2.36E-02 -1.61 204060_s_at 1.05E-02 -1.61 1450207_at Lifr 3.10E-02 -1.61 1429144_at Prei4 7.70E-03 -1.61 n/p 1422901_at Mgea5 4.86E-02 -1.61 1436224_at Kif1c 5.88E-03 -1.61 1430700_a_at Pla2g7 1.04E-02 -1.61 1434395_at Man1a2 2.03E-02 -1.62 1426191_a_at Bcl2l1 4.69E-02 -1.62 1449157_at Nr2c1 1.15E-02 -1.62 1457780_at Stx11 3.23E-02 -1.62 1422938_at Bcl2 2.84E-02 -1.62 1433944_at Hectd2 1.79E-02 -1.62 n/p 1457948_at Gas7 9.03E-03 -1.63 1457359_at Inpp4b 1.48E-02 -1.63 1416986_a_at Sirpa 4.93E-02 -1.63 1417724_at Thoc4 6.61E-03 -1.63 n/p 1425074_at Wrn 4.87E-02 -1.63 1423852_at Shisa2 4.55E-02 -1.63 n/p 1417307_at Dmd 1.87E-02 -1.63 203881_s_at 8.93E-03 -2.38 1452336_at Zfp395 1.36E-02 -1.63 n/p 1427673_a_at Sema3e 1.80E-02 -1.63 1450917_at Myom2 4.80E-02 -1.63 1432155_at Wasl 1.32E-02 -1.63 1453920_a_at Mospd2 8.51E-03 -1.64 1452163_at Ets1 1.07E-02 -1.64 1456088_at Xiap 7.54E-03 -1.64 1438713_at Rassf8 1.86E-02 -1.64 1434957_at Cdon 4.36E-02 -1.64 1450710_at Jarid2 2.50E-03 -1.64 1433491_at Epb4.1l2 2.45E-03 -1.64 n/p 1426622_a_at Qpct 5.53E-03 -1.64 1438306_at Rnf180 1.64E-02 -1.64 n/p 1426849_at Sec24b 4.40E-02 -1.64 1459896_at Pogk 2.52E-02 -1.64 1427831_s_at Zfp260 3.43E-02 -1.65 n/p 1460510_a_at Coq10b 4.43E-03 -1.65 1424568_at Tspan2 2.46E-02 -1.65 1417358_s_at Sorbs1 9.04E-03 -1.65 218087_s_at 2.86E-04 -1.61 1420866_at Zfp161 2.67E-02 -1.65 1428514_at Cpne3 3.27E-02 -1.65 1417570_at Anapc1 3.87E-02 -1.65 1433739_at Nol10 1.68E-02 -1.65 1421545_a_at Syne1 1.30E-02 -1.66 1422974_at Nt5e 3.78E-02 -1.66 203939_at 6.67E-03 -4.17 1436551_at Fgfr1 9.46E-03 -1.66 1448348_at Caprin1 4.00E-04 -1.66 1427122_at Copg2as2 3.17E-02 -1.66 n/p 1443554_at Ssbp3 2.84E-02 -1.66 1458887_at Tcf21 2.51E-02 -1.66 1448851_a_at Dnajc5 3.78E-03 -1.66 n/p 1436067_at Zbtb10 1.56E-03 -1.66 1421121_at Akap10 3.79E-03 -1.66 1456150_at Jhdm1d 1.44E-03 -1.66 1416157_at Vcl 1.49E-03 -1.67 1426571_at Ano1 4.31E-03 -1.67 1433514_at Etnk1 3.27E-03 -1.67 1416318_at Serpinb1a 1.70E-02 -1.67 n/p 1424158_at Ehd2 4.62E-03 -1.67 1427468_at Ppp3cb 6.04E-03 -1.67 1436299_at Gls 3.41E-02 -1.67 203159_at 1.75E-02 -1.61 1456890_at Ddx58 4.35E-02 -1.67 1423364_a_at Aktip 3.06E-02 -1.68 1427562_a_at Prkca 4.04E-02 -1.68 1422551_at Zkscan3 7.49E-03 -1.68 1431592_a_at Sh3kbp1 3.86E-04 -1.68 n/p 1426090_a_at Fert2 7.95E-03 -1.68 n/p 1423599_a_at Pdcl 1.15E-02 -1.68 1453628_s_at Lrrc2 1.80E-02 -1.68 1448219_a_at Ywhaz 4.84E-02 -1.68 200640_at 1.80E-02 1.57 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1439604_at Adamts16 1.54E-02 -1.68 n/p 1455095_at Hist2h2be 3.71E-03 -1.68 1435220_s_at Cdc42se2 5.45E-03 -1.68 n/p 1432411_a_at Fbxw2 3.73E-03 -1.68 1422896_at Vamp4 3.86E-02 -1.68 1421383_at Ccdc82 4.60E-03 -1.68 1421916_at Pdgfra 4.03E-02 -1.69 1416525_at Spop 8.68E-03 -1.69 1436343_at Chd4 3.21E-02 -1.69 1455026_at Sbno1 2.19E-02 -1.69 1435877_at Stk38l 1.59E-02 -1.69 1423387_at Psmd9 3.51E-02 -1.69 1452398_at Plce1 2.16E-02 -1.69 1450379_at Msn 1.41E-02 -1.69 1418632_at Ube2h 4.55E-03 -1.70 1422119_at Rab5b 2.90E-02 -1.70 1424621_at Krcc1 2.75E-03 -1.70 1420931_at Mapk8 9.52E-03 -1.70 1456145_at Dleu2 1.59E-02 -1.70 1417765_a_at Amy1 3.63E-02 -1.70 n/p 1427580_a_at Rian 4.63E-02 -1.70 n/p 1435325_at Usp46 3.99E-02 -1.71 1420980_at Pak1 2.65E-02 -1.71 209615_s_at 1.73E-02 -1.59 1420849_at Crnkl1 1.10E-03 -1.71 1437500_at Noc3l 1.42E-02 -1.71 1452862_at Rreb1 4.75E-02 -1.71 1445521_at Elavl1 9.88E-04 -1.71 1427565_a_at Abcc5 2.61E-02 -1.71 1423861_at Plekhf2 9.68E-03 -1.71 1416034_at Cd24a 5.91E-03 -1.71 n/p 1418823_at Arf6 1.69E-02 -1.71 1437081_at Timp2 5.12E-05 -1.72 1428523_at Lphn3 3.23E-02 -1.72 209867_s_at 3.36E-02 -2.08 1420839_at Plekha3 6.87E-03 -1.72 n/p 1438661_a_at Arf2 3.08E-02 -1.72 n/p 1440489_at Zbtb46 2.14E-03 -1.72 1425181_at Sgip1 3.00E-02 -1.73 n/p 1427963_s_at Rdh9 2.32E-02 -1.73 n/p 1448510_at Efna1 8.23E-03 -1.73 1455886_at Cbl 1.40E-02 -1.73 1433477_at Abr 6.59E-03 -1.73 1438069_a_at Rbm5 3.63E-02 -1.73 1417811_at Slc24a6 2.61E-02 -1.73 1422192_at Gja5 1.96E-03 -1.73 1435249_at Btaf1 1.67E-02 -1.73 1417517_at Plagl2 7.05E-03 -1.73 1453741_x_at Angel2 1.35E-02 -1.74 1426498_at Kdm5c 4.58E-03 -1.74 1419073_at Tmeff2 2.76E-02 -1.74 n/p 1427048_at Smo 2.97E-02 -1.74 1446990_at Nfia 2.43E-02 -1.74 n/p 1441693_at Adamts3 3.95E-02 -1.74 1455412_at Sfmbt1 3.90E-02 -1.74 1421194_at Itga4 1.32E-02 -1.75 1453622_s_at Mllt3 1.50E-03 -1.75 1433956_at Cdh5 4.38E-02 -1.75 204677_at 4.20E-02 -5.88 1449948_at Ero1lb 2.50E-02 -1.75 1425597_a_at Qk 2.76E-02 -1.75 n/p 1441200_at Klf3 4.60E-02 -1.75 1435818_at Klhl15 6.17E-03 -1.75 n/p 1438070_at Phf3 4.52E-03 -1.75 1454631_at Gtf2a1 1.23E-02 -1.76 1417396_at Podxl 1.17E-02 -1.76 201578_at 2.30E-03 -2.70 1420896_at Snap23 2.09E-02 -1.76 1421504_at Sp4 7.79E-03 -1.76 1423675_at Usp1 2.43E-02 -1.76 1424030_at Grhl1 1.55E-02 -1.76 n/p 1425466_at Senp2 1.81E-02 -1.77 1451716_at Mafb 2.19E-02 -1.77 1416211_a_at Ptn 1.26E-02 -1.77 209466_x_at 3.99E-03 -1.64 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1437079_at Slc18a2 4.53E-03 -1.77 1453771_at Gulp1 1.83E-02 -1.77 1425368_a_at Numb 3.44E-02 -1.77 1416702_at Serpini1 1.59E-02 -1.78 1450731_s_at Tnfrsf21 2.21E-02 -1.78 1429649_at Slc35a3 4.20E-02 -1.78 1417430_at Cdr2 8.14E-03 -1.78 1417297_at Itpr3 1.20E-02 -1.78 1435635_at Pcmtd1 4.37E-03 -1.78 n/p 1422135_at Zfp146 1.66E-02 -1.79 n/p 1440009_at Olfr78 1.66E-02 -1.79 n/p 1440681_at Chrna7 1.76E-02 -1.79 1427672_a_at Kdm6a 2.22E-03 -1.79 1434629_at Zbtb26 4.29E-02 -1.79 n/p 1416162_at Rad21 5.93E-03 -1.79 200607_s_at 1.48E-02 -1.54 1435742_at Smek1 4.95E-02 -1.79 1441772_at P2rx4 2.61E-02 -1.79 1445027_at Cdr2l 2.56E-02 -1.80 1451569_at Nr2c2 8.14E-03 -1.80 1460062_at Plekhh2 1.83E-02 -1.80 n/p 1455121_at Lcor 1.90E-02 -1.80 n/p 1430747_at Pqlc1 2.28E-03 -1.80 1452411_at Lrrc1 7.12E-03 -1.80 218816_at 1.73E-02 -2.00 1420909_at Vegfa 2.66E-03 -1.81 1429274_at Lypd6b 4.61E-02 -1.81 n/p 1449551_at Myo1c 5.30E-03 -1.81 1456494_a_at Trim30 1.92E-02 -1.81 n/p 1417595_at Meox1 1.03E-02 -1.81 1450437_a_at Ncam1 4.36E-02 -1.81 212843_at 3.12E-03 -2.22 1449682_s_at Tubb2b 3.21E-02 -1.81 1425008_a_at Ifi203 4.42E-03 -1.81 n/p 1442223_at Enah 1.52E-02 -1.81 1421622_a_at Rapgef4 7.56E-03 -1.82 1456975_at Taok1 5.61E-03 -1.82 1418020_s_at Cpd 4.82E-02 -1.82 1429778_at Optn 2.90E-02 -1.83 202073_at 5.80E-03 -1.75 1426720_at Apbb2 8.84E-03 -1.83 1429233_at Sept11 1.10E-02 -1.83 1424180_a_at Med24 4.85E-02 -1.83 1448375_at Tm9sf3 3.16E-02 -1.83 1421702_at Rdh1 2.91E-03 -1.84 n/p 1422264_s_at Klf9 3.86E-03 -1.84 1427579_at Rhbdl3 1.46E-02 -1.84 n/p 1434178_at Mll3 1.78E-02 -1.84 n/p 1437387_at Susd5 3.13E-02 -1.84 1452492_a_at Slc37a2 4.14E-02 -1.84 n/p 1440065_at Polr2j 4.74E-02 -1.84 1425504_at Mylk 2.15E-02 -1.84 202555_s_at 3.26E-03 -1.89 1426226_at Dyrk1a 1.83E-02 -1.85 1451060_at Gpr146 1.00E-02 -1.85 n/p 1437638_at Srrm2 2.15E-02 -1.85 1417172_at Ube2l6 1.68E-02 -1.85 1418762_at Cd55 4.58E-02 -1.85 1458381_at Clic5 2.45E-03 -1.86 1458870_x_at Mycbp2 2.25E-02 -1.86 1450512_at Ntn4 1.07E-03 -1.86 n/p 1460717_at Tspyl1 1.07E-02 -1.86 1439035_at Zfp322a 4.41E-02 -1.86 n/p 1418471_at Pgf 1.65E-02 -1.87 1444141_at Snx13 3.89E-02 -1.87 1436961_at Hspa12a 1.38E-04 -1.87 1450403_at Stat2 5.60E-03 -1.87 1428799_at Lca5 3.99E-03 -1.87 n/p 1440868_at Gabpb2 2.07E-02 -1.88 n/p 1421333_a_at Mynn 4.64E-04 -1.88 1451691_at Ednra 3.70E-02 -1.88 204464_s_at 4.60E-02 -3.70 1455857_a_at Rab2b 6.42E-03 -1.88 n/p 1427146_at Atpgd1 2.85E-02 -1.88 n/p 1426259_at Pank3 2.75E-02 -1.88 1420906_at Cd2ap 8.85E-03 -1.89 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1424101_at Hnrnpl 1.13E-02 -1.89 1449113_at Gpbp1l1 4.04E-02 -1.89 1453267_at Zfhx3 2.58E-03 -1.90 1438033_at Tef 8.20E-03 -1.90 1426208_x_at Plagl1 5.82E-03 -1.91 1423089_at Tmod3 9.00E-04 -1.92 1420976_at Man1a2 1.74E-02 -1.92 1427933_at Vps33b 1.56E-02 -1.93 1450124_a_at Atp2a3 1.86E-02 -1.93 1424176_a_at Anxa4 4.77E-04 -1.94 201302_at 4.31E-02 -1.72 1424653_at Tspan15 2.02E-02 -1.94 1420944_at Zfp185 2.02E-02 -1.94 n/p 1415944_at Sdc1 4.05E-03 -1.94 1437208_at Sept10 3.95E-02 -1.95 1444075_at Filip1 1.50E-03 -1.95 n/p 1427711_a_at Ceacam1 6.41E-04 -1.95 1455747_at Ggt5 2.38E-02 -1.95 1417014_at Hspb8 5.28E-03 -1.96 1441266_at Strn3 1.54E-02 -1.96 1450224_at Col4a3 8.35E-03 -1.96 222073_at 1.40E-02 -1.67 1420928_at St6gal1 1.83E-02 -1.97 1457209_at Ddhd2 4.63E-02 -1.97 1434407_at Srgap2 1.11E-02 -1.98 1448423_at Tmed4 3.87E-02 -1.98 n/p 1450125_at Gata5 4.52E-02 -1.98 n/p 1452328_s_at Pja2 6.06E-03 -1.99 1426641_at Trib2 2.14E-03 -1.99 202479_s_at 2.93E-02 -1.50 1421271_at Sh3rf1 2.82E-02 -1.99 n/p 1422009_at Atp1b2 1.30E-02 -1.99 1447415_at Bdp1 3.56E-02 -2.00 n/p 1441096_at Tusc5 3.20E-02 -2.00 n/p 1459331_at Surf6 1.56E-02 -2.01 n/p 1431999_at Polr3f 2.19E-03 -2.01 1433756_at S100pbp 6.89E-03 -2.01 1421954_at Crkl 3.91E-02 -2.01 1422975_at Mme 4.76E-02 -2.01 203435_s_at 1.11E-02 -3.22 1435749_at Gda 9.53E-03 -2.02 n/p 1420923_at Usp9x 4.00E-02 -2.02 1448069_at Tm4sf1 1.66E-02 -2.04 215034_s_at 9.82E-04 -2.86 1456721_at Thsd7a 1.64E-02 -2.04 1433828_at Atp8a1 1.02E-03 -2.05 1430177_at Ube2b 6.76E-03 -2.05 1418911_s_at Acsl4 1.04E-03 -2.05 1453721_a_at Slc31a2 2.64E-03 -2.05 1433804_at Jak1 2.51E-02 -2.05 1426960_a_at Fa2h 2.98E-02 -2.06 219429_at 2.74E-02 -1.96 1460509_at B3galt1 3.25E-02 -2.06 1434742_s_at Aifm3 7.32E-04 -2.07 n/p 1422528_a_at Zfp36l1 2.05E-02 -2.07 1420942_s_at Rgs5 1.15E-02 -2.07 209070_s_at 8.10E-04 -4.35 1430291_at Dock5 1.72E-03 -2.07 1427201_at Mustn1 5.15E-04 -2.08 n/p 1448607_at Nampt 7.21E-03 -2.08 1453201_at Rassf10 1.88E-02 -2.09 n/p 1454734_at Lef1 7.23E-03 -2.09 1418643_at Tspan13 1.48E-03 -2.10 1444924_at N4bp2l2 2.75E-02 -2.10 1438327_at Zfp385b 1.87E-02 -2.11 n/p 1456080_a_at Serinc3 1.14E-02 -2.11 1444347_at Mgat4a 1.73E-02 -2.12 1438540_at Col25a1 7.16E-04 -2.14 n/p 1436891_at Usp15 2.42E-02 -2.14 1421845_at Golph3 3.21E-03 -2.15 1436833_x_at Ttll1 2.79E-02 -2.16 1443719_x_at Ddx42 6.12E-03 -2.16 1453760_at Mier1 1.50E-02 -2.17 n/p 1438055_at Rarres1 3.12E-02 -2.17 221872_at 4.63E-04 -2.56 1427328_a_at Clasp2 4.48E-03 -2.17 1429538_a_at Sfrs18 1.57E-02 -2.18 1423554_at Ggcx 2.54E-03 -2.19 Probe Set Gene Symbol p-value Fold change Probe Set p-value Fold change Mouse Array Het/WT Human Array DDS/Control 1425863_a_at Ptpro 1.46E-02 -2.20 1434474_at Abca5 2.65E-03 -2.22 1426314_at Ednrb 4.66E-03 -2.23 1450821_at Kat2b 1.11E-02 -2.24 1419380_at Zfp423 4.51E-03 -2.25 n/p 1416862_at Stam 2.21E-02 -2.25 1438081_at Mcc 1.62E-02 -2.25 1455496_at Pfas 1.41E-02 -2.28 1429105_at Dlgap1 2.22E-02 -2.28 1449310_at Ptger2 1.59E-02 -2.29 1434109_at Sh3bgrl2 5.21E-03 -2.30 n/p 1418753_at Gfpt2 1.73E-03 -2.31 1433707_at Gabra4 2.18E-02 -2.32 1436866_at Efna5 2.93E-03 -2.32 1455188_at Ephb1 1.94E-03 -2.32 1426218_at Glcci1 1.56E-03 -2.33 n/p 1456121_at Cep97 4.02E-02 -2.33 1428820_at Mapre1 3.73E-03 -2.35 1421102_a_at Vamp3 1.15E-02 -2.36 1420695_at Dach1 1.33E-03 -2.37 1421851_at Mtap1b 4.51E-02 -2.38 n/p 1423290_at Hyou1 3.72E-02 -2.39 1435292_at Tbc1d4 1.85E-02 -2.39 1418250_at Arl4d 4.42E-02 -2.40 203586_s_at 3.16E-02 -1.56 1425620_at Tgfbr3 1.22E-02 -2.40 1430463_a_at Sncaip 5.57E-03 -2.41 1451257_at Acsl6 2.14E-02 -2.41 1425329_a_at Cyb5r3 2.87E-02 -2.43 1426296_at Rad52 8.18E-03 -2.44 1422556_at Gna13 2.92E-02 -2.44 1425071_s_at Ntrk3 4.94E-03 -2.45 1423433_at Trove2 3.49E-02 -2.46 1439026_at Trpm3 2.78E-02 -2.47 1420772_a_at Tsc22d3 3.57E-02 -2.47 1423025_a_at Schip1 1.59E-03 -2.47 1450582_at H2-Q5 1.65E-02 -2.50 n/p 1447264_at Rab11fip1 6.59E-03 -2.51 1425208_at Lbh 3.25E-02 -2.53 221011_s_at 3.88E-02 -2.04 1446331_at Ptgfr 2.53E-02 -2.55 1415997_at Txnip 2.79E-02 -2.56 1434469_at Otud4 1.90E-02 -2.58 1436279_at Slc26a7 1.97E-02 -2.61 n/p 1437492_at Mkx 1.49E-02 -2.62 n/p 1437074_at Snx5 1.97E-02 -2.62 1421064_at Mpp5 2.12E-03 -2.63 1428392_at Rassf2 1.30E-02 -2.65 1435998_at Ccnb1ip1 9.29E-04 -2.76 1438884_at Shisa3 2.36E-03 -2.76 n/p 1421344_a_at Jub 2.95E-02 -2.76 n/p 1423495_at Decr2 4.35E-02 -2.79 1448414_at Rad1 4.47E-02 -2.82 1431804_a_at Sp3 2.96E-02 -2.83 1451846_at Nebl 1.00E-02 -2.97 1450309_at Astn2 1.28E-02 -3.00 1453177_at Snx31 3.68E-02 -3.06 n/p 1453524_at Kif5b 4.98E-02 -3.07 1440246_at Lass6 2.08E-04 -3.15 212442_s_at 1.33E-02 -1.96 1435126_at Dusp15 1.52E-02 -3.18 n/p 1428283_at Cyp2s1 1.54E-02 -3.24 n/p 1443002_at Zfr 3.80E-02 -3.27 1453826_at Pard3b 5.28E-05 -3.28 n/p 1439101_at Mylk3 2.16E-02 -3.41 1428759_s_at Ccdc49 2.70E-02 -3.51 1422010_at Tlr7 6.37E-03 -3.52 1454791_a_at Rbbp4 8.51E-03 -4.04 1422837_at Scel 1.15E-02 -5.43 1436319_at Sulf1 5.87E-08 -8.45 212354_at 5.70E-05 -4.35 1436850_at Creg2 1.54E-02 -8.73 n/p n/p: genes not present on human array (HG U133A 2.0); empty cells: genes are not differentially expressed in human samples Table S3: Urine albumin/creatinine ratio in Sulf mutant mice

Genotype Age Alb/Crea (months) (mg/mmol) Sulf1+/-; Sulf2+/+ 9 1.7 Sulf1+/-; Sulf2+/- 2 1.9 7 1.8 7 1.7 7 1.4 7 1.9 Sulf1-/-; Sulf2+/- 5.5 0.9 7 1.2 8 0.8 8 1.2 9 1.5 Sulf1+/-; Sulf2-/- 7 6.0 7 1.9 7 8.4 9 1.8 Sulf1-/-; Sulf2-/- 1 2.4 3 3.3 5 11.5 5.5 14.1 5.5 0.9 7 14.7 7 14.8 7 7.0 9 12.7