Human Decidual Macrophages Expressed by Clostridium Sordellii for Structure, Is the Major Phagocytic Receptor Macrophage Recepto

The Class A Scavenger Receptor, Macrophage Receptor with Collagenous Structure, Is the Major Phagocytic Receptor for Clostridium sordellii Expressed by This information is current as Human Decidual Macrophages of September 26, 2021. Tennille Thelen, Yibai Hao, Alexandra I. Medeiros, Jeffrey L. Curtis, Carlos H. Serezani, Lester Kobzik, Lisa H. Harris and David M. Aronoff J Immunol 2010; 185:4328-4335; Prepublished online 1 Downloaded from September 2010; doi: 10.4049/jimmunol.1000989 http://www.jimmunol.org/content/185/7/4328 http://www.jimmunol.org/

References This article cites 51 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/185/7/4328.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 26, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The Class A Scavenger Receptor, Macrophage Receptor with Collagenous Structure, Is the Major Phagocytic Receptor for Clostridium sordellii Expressed by Human Decidual Macrophages

Tennille Thelen,* Yibai Hao,† Alexandra I. Medeiros,‡ Jeffrey L. Curtis,‡,x,{ Carlos H. Serezani,‡ Lester Kobzik,‖,# Lisa H. Harris,** and David M. Aronoff*,x

Clostridium sordellii is an emerging pathogen associated with highly lethal female reproductive tract infections following childbirth, abortion, or cervical instrumentation. Gaps in our understanding of the pathogenesis of C. sordellii infections present major

challenges to the development of better preventive and therapeutic strategies against this problem. We sought to determine the Downloaded from mechanisms whereby uterine decidual macrophages phagocytose this bacterium and tested the hypothesis that human decidual macrophages use class A scavenger receptors to internalize unopsonized C. sordellii. In vitro phagocytosis assays with human decidual macrophages incubated with pharmacological inhibitors of class A scavenger receptors (fucoidan, polyinosinic acid, and dextran sulfate) revealed a role for these receptors in C. sordellii phagocytosis. Soluble macrophage receptor with collagenous structure (MARCO) receptor prevented C. sordellii internalization, suggesting that MARCO is an important class A scavenger

receptor in decidual macrophage phagocytosis of this microbe. Peritoneal macrophages from MARCO-deﬁcient mice, but not http://www.jimmunol.org/ wild-type or scavenger receptor AI/II–deﬁcient mice, showed impaired C. sordellii phagocytosis. MARCO-null mice were more susceptible to death from C. sordellii uterine infection than wild-type mice and exhibited impaired clearance of this bacterium from the infected uterus. Thus, MARCO is an important phagocytic receptor used by human and mouse macrophages to clear C. sordellii from the infected uterus. The Journal of Immunology, 2010, 185: 4328–4335.

he clostridia are anaerobic, spore-forming bacilli that cause the related Clostridium perfringens (3). An increased number of a diverse array of toxin-mediated infections in humans, in- severe C. sordellii infections has been reported over the past decade, cluding botulism, tetanus, and antibiotic-associated diarrhea. following childbirth and abortion (4–6). Gaps in our understanding

T by guest on September 26, 2021 Clostridium sordellii is an emerging pathogen associated with highly of the pathogenesis of C. sordellii infections present major chal- lethal female reproductive tract infections, bacteremia, and soft tissue lenges to the development of better preventive and therapeutic strate- infections (1). The high mortality of C. sordellii infections is associ- gies against this emerging problem. ated with a stereotypical toxic shock syndrome (2). A recent study Macrophages are important in defending the host against invasive estimated that nearly 1 in 200 deaths in women of reproductive age clostridial infections (7), although the role of uterine macrophages in was associated with clostridial toxic shock, due to C. sordellii and/or innate immune defense against clostridia is undefined. During pregnancy, uterine decidual macrophages (DMs) participate in immunosurveillance, binding, ingesting, and clearing bacteria that ascend *Molecular, Cellular, and Developmental Biology Graduate Program, Eastern Mich- beyond the cervix (8). The receptor-mediated mechanisms by which igan University, Ypsilanti, MI 48197; †Division of Infectious Diseases, ‡Division of DMs recognize and phagocytose unopsonized bacteria, including x Pulmonary and Critical Care Medicine, Department of Internal Medicine, Graduate clostridia, have not been closely analyzed. Program in Immunology, and **Department of Obstetrics and Gynecology, University of Michigan Health System, Ann Arbor, MI 48109; {Pulmonary and Critical Care The macrophage scavenger receptors are a large family of immu- Medicine Section, Medical Service, Department of Veterans Affairs Care System, ‖ nosurveillance receptors used to recognize and internalize unopson- Ann Arbor, MI 48105; Molecular and Integrative Physiological Sciences Program, ized pathogens, apoptotic host cells, and modified lipoproteins (9, 10). Department of Environmental Health, Harvard School of Public Health; and #De- partment of Pathology, Brigham and Women’s Hospital, Boston, MA 02115 They are increasingly recognized to play a critical role in the clear- Received for publication March 26, 2010. Accepted for publication July 20, 2010. ance of unopsonized bacterial and parasitic microorganisms. Scav- This work was supported by National Institutes of Health Grants HD057176 (to D.M.A.), enger receptors are transmembrane proteins belonging to at least ES11008 (to L.K.), and HL056309 (to J.L.C.). Support for nonanimal portions of this eight different subclasses (A–H) based on their tertiary structure (9, work was provided by a Doris Duke Charitable Fund Clinical Scientist Development 10). The class A scavenger receptors (CASRs) are widely expressed Award (to D.M.A.). on macrophages (9) and have been shown to bind Gram-positive Address correspondence and reprint requests to Dr. David M. Aronoff, 4618-C Med- ical Science Building II, 1150 West Medical Center Drive, Ann Arbor, MI 48109- bacteria through the recognition of lipoteichoic acid (11, 12). For 5623. E-mail address: [email protected] example, the CASRs have been implicated in the phagocytosis of Abbreviations used in this paper: AcLDL, acetylated low-density lipoprotein; CASR, Listeria monocytogenes (13), various streptococci (14, 15), and the class A scavenger receptor; CBSR, class B scavenger receptor; ChdSO4, chondroitan clostridial pathogen C. perfringens (16). We therefore speculated that sulfate; DM, decidual macrophage; DxSO4, dextran sulfate; KO, knockout; MARCO, macrophage receptor with collagenous structure; PI, phagocytic index; poly(C), poly- CASRs would be expressed by DMs and capable of internalizing cytidylic acid; poly(I), polyinosinic acid; RFU, relative fluorescence unit; SCARA-5, C. sordellii. scavenger receptor A5; sMARCO, soluble MARCO; SR-AI/II, scavenger receptor AI Two particular CASR subtypes, scavenger receptor AI/II (SR-AI/ and AII; SRCL, scavenger receptor with C-type lectin; WT, wild type. II) and macrophage receptor with collagenous structure (MARCO), Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 participate in macrophage phagocytosis of Gram-positive bacteria. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1000989 The Journal of Immunology 4329

The SR-AI, II, and III isoforms are derived from the same gene Reagents (MSRI) on chromosome 8, with alternative splicing producing the RPMI 1640, penicillin/streptomycin/amphotericin B solution, TRIzol, and different proteins (9). Of these splice variants, only SR-AI and II acetylated low-density lipoprotein (AcLDL) were from Life Technologies- (referred to in this work as SR-AI/II) are phagocytic, whereas Invitrogen (Carlsbad, CA). FBS and charcoal-stripped FBS were from SR-AIII is unable to bind extracellular ligands because it is retained HyClone Laboratories (Waltham, MA). Reinforced clostridial medium, within the endoplasmic reticulum (9). The SR-AI/II receptors have mouse anti-human CD14 IgG (clone MPHIP9), and mAb CD11b (clone D12) were from BD Biosciences (San Jose, CA). Cytochalasin D, hyal- been implicated in the clearance of Gram-positive pathogens (14), uronidase, DNase, Percoll, fucoidan, polyinosinic acid [poly(I)], poly- and SR-AI was reported to bind to C. perfringens in transfected cytidylic acid [poly(C)], dextran sulfate, chondroitin sulfate, mannan, FITC, nonphagocytic cells (16). and trypan blue were from Sigma-Aldrich (St. Louis, MO). Magnetic A separate gene (MARCO) on chromosome 2 encodes the MACS CD14 microbeads (human) were from Miltenyi Biotec (Auburn, CA). Recombinant mouse soluble MARCO (sMARCO) and monoclonal MARCO receptor (9). Emerging data also support a major role anti-human CD163 (clone 215927) were purchased from R&D Systems of the MARCO receptor in macrophage phagocytosis of Gram- (Minneapolis, MN). F4/80 (clone 6A545) monoclonal IgG was from Santa positive bacteria. The transcription and cell surface expression lev- Cruz Biotechnology (Santa Cruz, CA). Mouse monoclonal CD36 IgG els of MARCO are enhanced upon bacterial binding and provide (clone FA6-152) was purchased from Abcam (Cambridge, MA). evidence for its significance in bacterial clearance (9). Studies of Human subjects alveolar macrophages have identified MARCO to be a major receptor for unopsonized bacteria (15, 17). Following appropriate informed consent, human decidual tissue was obtained from healthy adult women aged 18–44 y undergoing elective surgical termi- In this light, we questioned whether human DMs use CASRs to nation of pregnancy during the first trimester. This study was reviewed and bind and internalize unopsonized C. sordellii and further asked approved by the University of Michigan Institutional Review Board. Downloaded from whether SR-AI/II and/or MARCO would be important receptor subtypes in this process. Alternatively, because class B scavenger DM isolation receptors (CBSRs) and the macrophage mannose receptor have This procedure was adapted from a previously described protocol (20). also been reported to be capable of phagocytosis of Gram-positive Decidual tissue was collected from surgical abortions under aseptic con- bacteria (16, 18), we questioned whether these receptors were also ditions. The tissue was weighed and minced into small pieces, then sub- jected to a tissue digest with a solution containing 1 mg/ml collagenase active in the clearance of C. sordellii. from C. histolyticum type I-A (Sigma-Aldrich), 1 mg/ml hyaluronidase http://www.jimmunol.org/ To address these questions, we studied the expression of CASR from bovine testes type I-S (Sigma-Aldrich), and 150 mg/ml DNase I from and CBSR subtypes by human DMs and assessed their functional bovine pancreas type IV (Sigma-Aldrich). A total of 10 ml digestion so- relevance in phagocytosis assays of C. sordellii in vitro. Macro- lution was used per gram of tissue, and the samples were placed on phages derived from mice genetically lacking SR-AI/II or MARCO a shaker at 37˚C for 60 min. Samples were then washed using RPMI 1640 medium containing L-glutamine, which was substituted with 1% antibiotic- receptors were also used to examine the relevance of these recep- antimycotic (Life Technologies-Invitrogen) and centrifuged at 1500 rpm at tors to immune clearance of C. sordellii. Lastly, a mouse model of 4˚C for 10 min. This was followed with serial 280-, 200-, and 100-mm C. sordellii uterine infection was used to define the importance of nylon mesh filtrations to eliminate any remaining particulates. The cells CASR subtypes in host defense. These studies shed new light onto were washed, as previously described, and the filtrate was resuspended in

25% Percoll (Sigma-Aldrich) in RPMI 1640 (same as above) and overlaid by guest on September 26, 2021 the potential importance of CASRs in the innate immune defense onto 50% Percoll, with 2 ml PBS layered above the 25% Percoll. Decidual against highly lethal clostridial infections of the female repro- cells were recovered from the 25/50% interface following a 4˚C centri- ductive tract. fugation for 45 min at 1500 rpm. These cells were washed as above, followed by a RBC lysis using NH4Cl/Tris-HCl. After two washes, the cells were then passed through a 30-mm falcon filter (BD Biosciences). Materials and Methods Using Abs for the typical macrophage markers CD14, F4/80, and CD11b, flow cytometry was employed to verify that macrophages make up ∼10% of Animals human decidual tissue (results not shown) (8). The isolated cells underwent Six- to eight-week-old, female SR-AI/II/II–deficient (SR-AI/II2/2) mice on a positive selection step for macrophages by passing through two successive a 129/SvJ strain background were originally provided as a generous gift of large cell columns (Miltenyi Biotec) using MACS CD14 microbeads (Mil- W. de Villiers (University of Kentucky Medical Center, Lexington, KY). tenyi Biotec). Flow cytometry was used to confirm the purity of the isolation, . + These were bred locally at our facility. Age- and sex-matched 129/SvJ with 94% of cells CD14 (results not shown). wild-type (WT) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Six- to eight-week-old, female mice genetically deficient in Resident peritoneal macrophage isolation 2/2 MARCO (MARCO ) on a BALB/c background were bred as previously Resident peritoneal macrophages from mice were obtained via peritoneal published (19) and used with the generous permission of K. Tryggvason lavage, as previously described (21, 22). A RBC lysis was performed, (Karolinska Institute, Stockholm, Sweden), who initially provided the and cells were resuspended in RPMI 1640 containing 10% FBS and 1% 2/2 MARCO mice. The genotypes of mouse strains were confirmed by penicillin/streptomycin/amphotericin. Cells were plated in 384-well tissue tail-snip DNA PCR analyses performed by Transnetyx (Cordova, TN). culture-treated plates (Costar, Cambridge, MA) at 2 3 105 cells/well and Age- and sex-matched BALB/c WT mice were purchased from The incubated overnight (37˚C with 5% CO2). The following day, cells were Jackson Laboratory. Animals were treated according to National Insti- washed two times with warm medium to remove nonadherent cells. tutes of Health guidelines for the use of experimental animals with the approval of the University of Michigan Committee for the Use and Care RNA extraction, cDNA synthesis of Animals. TRIzol (Life Technologies-Invitrogen) was added to the CD14+ decidual Bacteria cells to perform an RNA extraction. After complete dissociation, chloro- form (Sigma-Aldrich) was added at 200 ml/ml TRIzol. Samples were C. sordellii strain ATCC9714 was obtained from the American Type centrifuged at 13,000 rpm for 15 min at 4˚C, the aqueous phase was saved, Culture Collection (Manassas, VA) and grown anaerobically in broth and an equal volume of isopropanol was added. After 20-min incubation at culture overnight at 37˚C in reinforced clostridial medium. Estimates of 22˚C, samples were centrifuged as before. Pellet was resuspended in 500 ml bacterial concentrations were derived from the OD of bacterial cultures at 80% ethanol and centrifuged as before. Diethylpyrocarbonate-treated water 600 nm (OD600) and a previously determined standard curve of CFU was added to pellet, and RNA concentration was determined by ratiometric versus OD600. Estimated bacterial concentrations were confirmed by serial light absorbance at 260/280 nm. Then 1 mg RNAwas transcribed into cDNA 10-fold dilutions on solid agar composed of reinforced clostridial media using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, containing 1.5% (w/w) agar, incubated anaerobically. For phagocytosis Switzerland), per the manufacturer’s instructions. Samples were run on experiments (below), heat-killed C. sordellii were prepared by heating to a Mastercycler Epgradient S (Life Technologies-Invitrogen) with the fol- 121˚C for 30 min. lowing conditions: 65˚C for 10 min, 50˚C for 60 min, and 85˚C for 5 min. 4330 MACROPHAGE PHAGOCYTOSIS OF C. SORDELLII

Semiquantitative real-time PCR infected with C. sordellii was performed using a Mantel-Cox log-rank test. Experiments were performed on at least three separate occasions, unless Primers and probes were designed using the Roche Universal Probe Library otherwise specified. Unless otherwise noted, data are presented as mean Assay Design Center (www.roche-applied-science.com). All primers (Table values 6 SEM. I) were produced by Integrated DNA Technologies, and all probes were from Roche. Universal ProbeLibrary Reference Gene Assays (Roche) for human and mouse GAPDH were used, as appropriate. To prepare the assay, 2 ml Results cDNA aliquots were used to prepare assays, according to manufacturer’s Fucoidan inhibits the phagocytosis of C. sordellii by human instructions, and run on the LightCycler 480 (Roche) with the following DMs conditions: 95˚C, 10 min (preincubation); 95˚C, 10 s; 60˚C, 30 s; 72˚C, 1 s (amplification, 45 cycles); 95˚C, 10 s; 50˚C, 30 s; 70˚C, 5 min (melting Because C. perfringens was reported to be phagocytosed pre- curve); 40˚C, 30 s (cooling). Analysis was performed using Roche soft- dominately through CASRs in nonreproductive tract macrophages ware; all samples were referenced to the expression of the housekeeping (16), we hypothesized that human DMs used CASRs in phagocy- gene GAPDH. tosing C. sordellii. To test this, DMs were pretreated with fucoidan, Phagocytosis assays an antagonist of CASRs that is not selective for the unique CASR CD14+ cells were cultured overnight (37˚C) in 384-well tissue culture- subtypes (28). A 30-min preincubation with fucoidan at 100 and treated plates with 2 3 105 cells/well. The cells were treated with com- 500 mg/ml dose dependently and significantly inhibited the phago- pounds of interest and incubated for 30 min at 37˚C. Heat-inactivated C. cytosis of FITCC. sordellii by 75.8 6 4.9% and 96.0 6 2.0%, re- sordellii were surfaced labeled with FITC per our previously published FITC spectively (Fig. 1A). Pilot experiments demonstrated that maximal protocol (23). FITC-labeled C. sordellii ( C. sordellii) was applied at m a multiple of infection of 300 bacteria:1 cell and incubated for 3 h at 37˚C. inhibition was obtained using 500 g/ml (data not shown), so this Phagocytosis was quantified according to our published method of measur- concentration was used as a positive, comparative control in other Downloaded from ing intracellular fluorescence as a surrogate marker of bacterial ingestion by phagocytosis assays. macrophages (24). The fluorescence of intracellular FITCC. sordellii was determined using a microplate fluorometer (485ex/535em, SPECTRAMax Human DMs express CASRs GEMINI EM; Molecular Devices, Sunnyvale, CA), according to our pre- Having established a possible role for CASRs in immune recognition viously published method (24). Briefly, fluorescence data were expressed in arbitrary relative fluorescence units (RFU), which were then converted into of C. sordellii, experiments were conducted to determine their ex- a phagocytic index (PI). The PI represented the fluorescence of intracellular pression levels in DMs using semiquantitative real-time PCR. Al- http://www.jimmunol.org/ (phagocytosed) bacteria (RFUi) and was calculated by subtracting the fluo- though a functional mannose receptor has been identified on human rescence of extracellular bacteria (RFUex) from the total fluorescence of the DMs (29), to our knowledge other phagocytic receptors, including well (RFUtotal). The RFUex was estimated by treating some cells with the phagocytosis inhibitor, cytochalasin D (5 mg/ml; EMD Chemicals, Gibbs- the CASRs and CBSRs, have not been well characterized. Thus, FITC town, NJ), for 30 min prior to exposure to C. sordellii (25). The RFUex mRNA was isolated from unstimulated human DMs, and real-time from the cytochalasin-treated wells was subtracted from the RFUtotal.There- PCR was performed for the CASRs SR-AI/II, MARCO, SR with 2 fore, the PI = RFUi =RFUtotal RFUex (24). C-type lectin (SRCL), and scavenger receptor A5 (SCARA-5) (Table Select compounds tested included the nonspecific CASR-blocking agents I). SRCL is an endothelial CASR that has also been identified on fucoidan, poly(I), and dextran sulfate; the negative control compounds chondroitin sulfate and poly(C); the mannose receptor blocker mannan; alveolar macrophages (30). SCARA-5 was recently characterized in sMARCO; and the SR-AI/II–blocking agent AcLDL. CBSR-blocking Abs murine epithelial cells and was found to have similar binding prop- by guest on September 26, 2021 used included the mouse monoclonal anti-human CD163 and CD36 IgGs erties to other CASRs (31). However, functional roles in microbial (26). Phagocytosis assays with mouse macrophages were similarly per- clearance for either SRCL or SCARA-5 receptors have not been formed; however, a multiple of infection of 150:1 was used. In addition, for assays comparing WT cells with either MARCO2/2 or SR-AI/II2/2, identified for human phagocytes. The expression of two CBSRs the results were normalized to total intracellular lactate dehydrogenase ac- implicated in binding bacteria, CD36 and CD163, was also evaluated tivity levels to account for potential differences in cell number or adherence (32, 33). These experiments revealed expression of multiple scav- to tissue culture plates (27). Lactate dehydrogenase activity was determined enger receptors (Fig. 1B). Of the CASRs, the expression of SR-AI/II by a commercially available assay, according to the manufacturer’s instruc- was greatest, being significantly higher than SCARA-5, which was tions (Roche). only minimally expressed. SR-AI/II transcripts were not significantly Intrauterine infection C. sordellii was cultured anaerobically (24 h, 37˚C) in 10 ml liquid- reinforced clostridial medium (Life Technologies-Invitrogen). The bacteria were then centrifuged (2000 rpm 3 10 min), and the pellet was washed three times with sterile PBS and resuspended in 1 ml total volume of PBS. Dilutions were made in PBS to allow the inoculation of ∼1 3 104 CFU directly into one horn of the mouse uterus, according to our previously published protocol (23), in a total volume of 35 ml. The actual inoculum was determined by plating serial 10-fold dilutions of the PBS suspension onto solid reinforced clostridial medium agar and counting individual colonies the next day. For survival experiments, the mortality from infection was monitored for 8 d following inoculation. Bacterial clearance and dissemination studies FIGURE 1. Evidence for functional scavenger receptors in human DMs. For studies of bacterial clearance and dissemination, mice were infected A, Human DMs were pretreated for 30 min with the scavenger receptor 3 3 4 intrauterine as above with 1 10 –10 CFU C. sordellii strain ATCC9714. blocker fucoidan (in mg/ml) and phagocytosis of FITCC. sordellii quanti- The uterus and spleen were harvested 15, 24, or 48 h postinfection and fied, as detailed in Materials and Methods. Data are representative from mechanically homogenized in 1 ml sterile PBS. Then, 50 ml homogenized sample was cultured anaerobically on reinforced clostridial medium agar, three independent experiments performed in octuplet with similar results. ppp , and colonies were enumerated after 24 h. Results were expressed as CFU/ml Results are expressed as a percentage of relative to untreated cells. p homogenate. 0.001 versus untreated cells by ANOVA. B, Semiquantitative real-time PCR performed to measure expression levels of scavenger receptors in Statistical analyses human DMs, relative to GAPDH, described in Materials and Methods. Mean values were compared using a one-way ANOVA, followed by Horizontal lines represent the mean result from 12 separate individuals a Bonferroni correction or a Student t test, as indicated. Differences were (solid circles) performed in triplicate. ppp , 0.01; pppp , 0.001 com- considered significant if p # 0.05. Comparison of survival curves for mice paring CD163 against each of the other receptors (ANOVA). The Journal of Immunology 4331

Table I. Primers and probes

Universal Probe Gene Forward Primer Reverse Primer Library No. MSR1 TCCCACTGGAGAAAGTGGTC CTCCCCGATCACCTTTAAGAC 85 MARCO TGCTGGGTTACTCCAAAGGA CAGCCAGATCTGCCCAGT 24 SCARA-5 TGGGCATCTTCATCTTAGCA CATTCAGCCGGTTCACATT 24 CD36 TGGAACAGAGGCTGACAACTT TTGATTTTGATAGATATGGGATGC 76 CD163 TGGGGAAAGCATAACTGTGA GCTCAGATCTGCTCCCTTTG 67 COLEC12 CAGAGCGTGAAAATGAATGG TGTCCAGCTTTCCAATTTTTG 42 Msr1 (Mus musculus) CTTTACCAGCAATGACAAAAGAGA ATTTCACGGATTCTGAACTGC 89 Marco (Mus musculus) GGCACCAAGGGAGACAAA TCCCTTCATGCCCATGTC 97

greater than mRNA levels of MARCO. We also found a significantly perfringens. However, we found no role for this receptor in the higher expression of the CBSR, CD163, when compared with CD36. phagocytosis of C. sordellii when human DMs were preincubated (30 min) with the antagonist mannan (100 mg/ml; Fig. 2C). We also Multiple pharmacological antagonists of CASRs impair failed to identify a role for mannose receptors in C. sordellii phago- phagocytosis of C. sordellii by human DMs cytosis using resident rat peritoneal macrophages (data not shown). The above data suggested that human DMs express functional Downloaded from CASRs, but these experiments were limited by the use of a single, MARCO is the predominant phagocytic receptor for nonselective CASR antagonist, fucoidan. Thus, phagocytosis assays C. sordellii by human DMs were performed using additional, standard, nonselective CASR- blocking agents. When cells were preincubated with dextran sul- To determine which of the predominant CASRs expressed by hu- fate (100 mg/ml), there was an 87.3 6 6.1% decrease in phagocytic man DMs (SR-AI/II and MARCO) is primarily responsible for internalizing C. sordellii, a previously published pharmacological ability, whereas the negative control (but structurally similar) agent http://www.jimmunol.org/ chondroitan sulfate (100 mg/ml) had no effect (Fig. 2A). Another approach to selectively antagonize these receptors was employed classical CASR antagonist, poly(I), suppressed phagocytosis by (34). Cells were preincubated (30 min) either with recombinant, 48.5 6 6.2% compared with vehicle treatment, whereas the nega- mouse sMARCO or with the SR-AI/II–selective agent AcLDL tive control compound poly(C) had no effect (Fig. 2B). The gen- (34). AcLDL had no effect on C. sordellii phagocytosis, whereas 6 eralizability of these results for other types of macrophages was sMARCO inhibited phagocytosis by 79.5 2.1% (Fig. 3A). These tested by conducting experiments using resident peritoneal macro- data implicated MARCO as the predominant phagocytic receptor phages isolated from female Wistar rats, which yielded similar for C. sordellii on human DMs. results (data not shown). Whereas these observations further im- Because DMs express CBSRs (Fig. 1B) and macrophage CBSRs plicated CASRs in the phagocytosis of C. sordellii by human DMs, have been shown to bind and phagocytose bacteria (18, 32, 33), we by guest on September 26, 2021 they did not differentiate among the various subtypes. preincubated DMs with mAbs against human CD163 and CD36 (50 m A previous study by O’Brien and Melville (16) identified a minor g/ml) before measuring phagocytosis. Consistently, a small, but ∼ role for the mannose receptor in the macrophage phagocytosis of C. statistically significant inhibitory effect ( 30% inhibition) on phagocytosis was observed when cells were treated with anti-CD36 treatment, whereas the CD163 Ab had no effect (Fig. 3B). Thus, CD36 appears to play a minor role in phagocytosing C. sordellii.

MARCO, but not SR-AI/II receptors are critical for mouse macrophage phagocytosis of C. sordellii The above experiments were limited by their pharmacological approach. The availability of CASR-deficient mice allowed an alternative approach to test the importance of these receptors in the phagocytosis of C. sordellii. Resident peritoneal macrophages obtained from SR-AI/II2/2 mice, MARCO2/2 mice, or respective WT animals were challenged with FITCC. sordellii, and their rela- FIGURE 2. Nonselective class A scavenger blockers inhibit phagocytosis of C. sordellii, whereas mannose receptor blockers have no effect. A, tive phagocytic capacity was determined. We observed that mac- 2/2 ∼ 6 Human DMs were pretreated for 30 min with the CASR-blocking agent rophages from SR-AI/II mice exhibited 3.18 0.75-fold , dextran sulfate (DxSO4, 100 mg/ml) or the negative control agent ChdSO4 greater phagocytosis of C. sordellii compared with WT cells (p (100 mg/ml), and the phagocytosis of FITCC. sordellii was quantified by 0.05; Fig. 4A). This phagocytic ability was inhibited .90% using fluorometry after 180 min, as detailed in Materials and Methods. B, Hu- sMARCO (data not shown). Real-time PCR was performed to de- man DMs were pretreated for 30 min with the CASR-blocking agent poly termine whether there were compensatory changes in MARCO (I) (200 mg/ml) or the negative control poly(C) (200 mg/ml), and the expression in the SR-AI/II2/2 macrophages correlating with their FITC phagocytosis of C. sordellii was quantified by fluorometry after 180 enhanced phagocytic capacity. As shown (Fig. 4B), MARCO min, as detailed in Materials and Methods. C, Human DMs were pre- mRNA levels were, on average, 5.3-fold higher in SR-AI/II2/2 treated with fucoidan (500 mg/ml) or the mannose receptor blocker, macrophages versus WT cells (p , 0.05). mannan (100 mg/ml), for 30 min, and the phagocytosis of FITCC. sordellii was quantified by fluorometry after 180 min, as detailed in Materials and These data suggested that in the absence of the SR-AI/II re- Methods. Data are representative from three independent experiments ceptors, MARCO was able to internalize C. sordellii.Totest FITC performed in octuplet with similar results. Results are expressed as a per- this, we compared phagocytosis of unopsonized C. sordellii 2/2 centage of relative to untreated cells. pppp , 0.001 versus control as using WT and MARCO peritoneal macrophages. As shown (Fig. determined by ANOVA. ChdSO4, chondroitan sulfate. 4A), phagocytosis was significantly lower in macrophages lacking 4332 MACROPHAGE PHAGOCYTOSIS OF C. SORDELLII

0.04 by Mantel-Cox log-rank test). In contrast, SR-AI/II2/2 mice were not more susceptible to death from intrauterine C. sordellii infection compared with WT 129/SvJ mice (Fig. 5C). MARCO is important for clearance of bacteria from the infected uterus We questioned whether the increased mortality observed in MARCO2/2 mice correlated with an impaired capacity to eliminate bacteria from the infected uterus or to prevent dissemination to distal organs, such as the spleen. To address this question, mice FIGURE 3. sMARCO and anti-CD36 IgG prevent the phagocytosis of were infected intrauterine with C. sordellii and the bacterial loads C. sordellii by DMs. A, Human DMs were pretreated with sMARCO (100 of the uterus and spleen were determined by anaerobic culture of mg/ml) or the SR-AI/II–binding agent AcLDL (100 mg/ml) for 30 min, and tissue homogenates harvested at 15, 24, and 48 h postinfection. As FITC the phagocytosis of C. sordellii was quantified by fluorometry after illustrated (Fig. 5B), the numbers of bacteria recovered from uterine 180 min, as detailed in Materials and Methods. B, Human DMs were tissues of MARCO2/2 mice were ∼1 log higher than recovered pretreated with mouse anti-human monoclonal IgG directed against CD36 from WT BALB/c mice at each of the three time points, although or CD163 (or an isotype control) at 50 mg/ml for 30 min, and the this only reached statistical significance at 24 h postinfection. No- phagocytosis of FITCC. sordellii was quantified by fluorometry after 180 tably, the WT mice cleared the local infection by 48 h. min, as detailed in Materials and Methods. Fucoidan pretreatment for 30 2/2 min at 500 mg/ml used as positive control for each. Data are representative Bacteria disseminated to the spleen in both WT and MARCO Downloaded from from three independent experiments performed in octuplet with similar mice (Fig. 5B). Although the differences were not statistically 2/2 results. Results are expressed as a percentage of relative to untreated cells. significant, dissemination occurred sooner in the MARCO ppp , 0.01; pppp , 0.001 versus untreated cells. mice (see the 15-h time point). In addition, the splenic bacterial load appeared to peak by 24 h in WT mice, but was continuing to 2/2 MARCO. Real-time PCR (Fig. 4B) did not detect any significant rise by 48 h in the MARCO mice. We have not detected dif- compensatory increase in mRNA expression of SRA-I/II. ferences in local clearance of C. sordellii from the uterus or dis- http://www.jimmunol.org/ semination to the spleen between WT and SR-AI/II2/2 mice (data MARCO-deficient mice have enhanced susceptibility to not shown). C. sordellii infection Because the above in vitro experiments with mouse peritoneal Discussion macrophages and human DMs suggested that MARCO is an im- These studies newly define a potentially important role for MARCO portant immunosurveillance receptor used by female reproductive receptors in the innate host defense against invasive C. sordellii tract macrophages to defend the host against C. sordellii, we tested infections of the female reproductive tract. Infections caused by 2/2 its importance, in this context, in vivo. WT or MARCO mice toxigenic clostridia are emerging as important challenges to human were inoculated intrauterine with the virulent C. sordellii strain health. Whereas the problem of clostridial infections is growing, by guest on September 26, 2021 4 ATCC9714. Using an inoculum of 1 3 10 CFU per mouse, only there has been little research into the mechanisms detailing how the 15% of infected WT BALB/c mice died as a result of infection innate immune system recognizes and attempts to eliminate these 2/2 (Fig. 5A). In contrast, MARCO mice were significantly more potential pathogens. The increase in published reports of highly susceptible to death from infection, with a 3-fold higher mortality lethal C. sordellii gynecological infections in women of child- of 45% by 7 d postinfection (Fig. 5A, n = 20 mice per group, p = bearing age (1, 3, 6) prompted further study of the pathogenesis of C. sordellii infections. To our knowledge, these studies show for the first time the receptors through which human macrophages internalize these toxigenic bacteria. Macrophages are key sentinels of innate immunity that respond to microbial invaders by elaborating immunoregulatory mediators (cytokines, chemokines, and lipids), phagocytosing and killing potential pathogens, and presenting Ags to cells of the adaptive immune system. Recently, the TLRs 2 and 6 were found to participate in the immune response of macrophages to C. sordellii, through the activation of the transcription factor NF-kB (35). However, these studies did not ad- FIGURE 4. MARCO is more important than SR-AI/II in the phagocytosis of C. sordellii. A, Left panel, Peritoneal macrophages from either WT dress how macrophages phagocytose this bacterium. BALB/c mice or MARCO2/2 mice were allowed to phagocytose FITCC. Previous investigations with the related pathogen, C. perfringens, sordellii for 3 h. Right panel, Peritoneal macrophages from either WT 129/ revealed that CASRs, and to a lesser extent the mannose receptor, SvJ mice or SR-AI/II2/2 mice were allowed to phagocytose FITCC. sor- were involved in the macrophage phagocytosis of this pathogen dellii for 3 h. The phagocytosis of FITCC. sordellii was quantified by flu- (16). Phagocytosis of C. perfringens was impaired in those studies orometry, as detailed in Materials and Methods. pp , 0.05 versus WT by t using the nonselective CASR-blocking agent fucoidan (16). How- test. Results are mean 6 SEM of three to five independent experiments ever, that study did not establish the relative roles played by in- performed in octuplet. B, mRNA expression of SR-AI/II or MARCO in dividual CASRs in C. perfringens uptake. Although the authors mouse peritoneal macorphages was determined by semiquantitative real- used Chinese hamster ovarian cells transfected with the mouse time PCR, as detailed in Materials and Methods. Left panel, mRNA levels SR-AI receptor to demonstrate binding of C. perfringens to SR-AI, were compared between WT BALB/c peritoneal macrophages (black bars) and MARCO2/2 cells (gray bars). Right panel, mRNA levels were com- the capacity of SR-AI to mediate the internalization of this bacte- pared between WT 129/SvJ peritoneal macrophages (black bars) and SR- rium was not reported (16). AI/II2/2 cells (striped bars). Data are normalized to GAPDH expression Based largely on the findings of these important studies of and represent the mean 6 SEM of eight mouse samples per assay. pp , C. perfringens, we questioned whether CASRs would also be im- 0.05 versus WT cells by t test. KO, knockout cells. portant for the phagocytosis of C. sordellii by human macrophages. The Journal of Immunology 4333

FIGURE 5. MARCO is important to host defense against intrauterine C. sordellii infection. A, WT or MARCO KO mice (n = 20 per group) were infected by intrauterine injection with C. sordellii ATCC9714 (1 3 104 CFU/mouse), and survival was recorded. pp , 0.05 versus WT survival. B, Clearance of C. sordellii from the uterus and dissemination to the spleen in WT or MARCO KO mice. Mice were inoculated intrauterine with 1 3 104 CFU of C. sordellii ATCC9714. Postinfection, uterine, and splenic tissues were homogenized at the time points shown, and CFUs were determined, as described in Materials and Methods. Data are the mean 6 SEM from ﬁve mice per strain at each time point, except at 24 h (n = 10 mice per strain). pp , 0.05 versus WT by Student t test. C, WT or SR-A KO mice (n = 10 per group) were infected by intrauterine injection with C. sordellii ATCC9714 (1 3 104 CFU/mouse), and survival was recorded. Differences were not signiﬁcant. KO, knockout.

Similar to the approach of O’Brien and Melville (16), we incubated a speciﬁc antagonist of SR-AI/II receptors (34), or sMARCO,

DMs with fucoidan and noted that this broad inhibitor of CASR a specific inhibitor of MARCO-dependent phagocytosis (34, 42). Downloaded from phagocytosis was a potent blocker of C. sordellii internalization. These studies found that phagocytosis could be potently blocked by We then used mRNA expression as a surrogate marker for phago- sMARCO, but not by AcLDL, suggesting that MARCO is the more cytic receptor expression by DMs. Using real-time PCR, we iden- critical receptor for the phagocytosis of C. sordellii. tified transcription of the MSR1 and the MARCO genes, encoding These pharmacological results were confirmed using receptor- SR-AI/II and MARCO, respectively. These studies newly docu- deficient mice. We were surprised to observe a significantly greater 2/2 mented the expression of SRCL on DMs, a receptor expressed phagocytic capacity in SR-AI/II macrophages compared with http://www.jimmunol.org/ primarily on nonhematopoietic cells (e.g., endothelial cells) (30, WT cells (Fig. 4) and speculated that this might be due to enhanced 36). We also investigated whether SCARA-5 was expressed by MARCO expression, which has been observed in SR-AI/II2/2 mice, human DMs, as this receptor has not been well characterized in although on a different genetic background (43). The fact that human cells and tissues (31). However, we did not observe sig- sMARCO inhibited the phagocytic capacity of the SR-AI/II2/2 nificant expression of this receptor. macrophages suggested this might be the case (data not shown). To confirm the results obtained with fucoidan, we used pairs of Indeed, mRNA transcript levels for MARCO were significantly nonselective CASR-blocking agents and structurally matched, neg- greater in SR-AI/II2/2 macrophages compared with WT macro- ative control compounds that do not bind to CASRs [e.g., poly(I)- phages (Fig. 4), providing more evidence that MARCO expression is poly(C) and dextran sulfate-chondroitan sulfate]. Indeed, phago- upregulated in mouse cells lacking SR-AI/II. These data were limited by guest on September 26, 2021 cytosis was inhibited by both dextran sulfate and poly(I), but not by by the fact that mRNA transcripts were quantified, not surface- the negative control agent chondroitan sulfate or poly(C). expressed protein levels. However, a previous study of SR-AI/II2/2 A study by Laskarin et al. (29) suggested the mannose receptor is peritoneal macrophages (on a BALB/c background) showed higher a functional receptor on decidual mononuclear cells. The exact role surface expression of MARCO using an anti-MARCO Ab (43). of the mannose receptor in phagocytosis is uncertain with con- Notably, MARCO2/2 peritoneal macrophages demonstrated an flicting biochemical and genetic studies (37). Due to its decreased impaired capacity to phagocytose C. sordellii. These data supported expression during inflammation (38), it has been suggested the our pharmacological results in the human cell. What is more, we mannose receptor may be more important for tissue homeostasis observed, for the first time, a functional role for MARCO in im- than for host defense (37). However, taking into consideration this mune defense against clostridia in vivo. Importantly, mice lacking information and the previously mentioned studies by O’Brien and functional MARCO receptors demonstrated increased susceptibil- Melville (16), this receptor was also tested to determine its im- ity to lethal infection by C. sordellii and impaired clearance of these portance in the binding and phagocytosis of C. sordellii. We found bacteria from the uterus (Fig. 5A,5B). There was also a non- no major role for the mannose receptor in our experimental design. statistically significant trend toward greater dissemination to the Although controversial, data suggest that TLR2 ligation is in- spleen in the MARCO2/2 mice. As expected, we did not see en- volved in the ingestion of Gram-positive bacteria by phagocytic cells hanced susceptibility to infection in SR-AI/II null mice (Fig. 5C). (39). It was also recently reported that TLR2 plays a role in bac- We have also not observed differences in bacterial clearance from terial phagocytosis by mouse trophoblast giant cells (40). Using the uterus comparing WT and SR-AI/II null mice (data not shown). blocking mAbs against TLR2 on human DMs and rat peritoneal Whereas our mouse uterine infection model data provide novel macrophages, we have not observed an inhibitory effect on the and correlative support for our in vitro results, suggesting that phagocytosis of C. sordellii compared with isotype control Igs (data MARCO is an important component of the innate defense against not shown). These data suggest that TLR2 does not play a signifi- C. sordellii infections, they do not prove that DMs per se are in- cant role in the internalization of C. sordellii. However, alternative volved in host defense in vivo. The complex cellular defense approaches, such as the use of macrophages from TLR2-deficient mechanisms involved in innate immunity against C. sordellii re- mice, or the use of genetic silencing in human cells, could provide main to be fully defined. We previously reported that human b additional evidence in this regard. defensin antimicrobial peptides were rapidly bactericidal against Given the potentially critical role for CASRs in the macrophage C. sordellii (23), suggesting that epithelial cells might be impor- phagocytosis of C. sordellii, we sought to decipher which specific tant in controlling C. sordellii infection within the uterus. Al- subtypes were most important. There is precedent to suggest that though not presented in this work, we have examined whether C. different pathogens may bind unique CASRs with varying efficiency sordellii can invade (or get phagocytosed by) uterine epithelial (41, 34). We initially incubated human DMs with either AcLDL, cells. Histological examination of mouse uterine tissues 48 h 4334 MACROPHAGE PHAGOCYTOSIS OF C. SORDELLII following intrauterine inoculation with C. sordellii did not reveal immunosuppressive (M2) phenotype of DMs contributes to the en- bacteria within uterine epithelial cells in situ, and we have not hanced susceptibility of pregnant women to intrauterine infection. observed significant phagocytosis of C. sordellii by the human In summary, we newly characterize scavenger receptors expressed uterine epithelial RL95-2 cell line in vitro (data not shown). What by human DMs and their relative importance in the recognition and is more, using real-time, RT-PCR, we have found that RL95- internalization of the toxigenic pathogen C. sordellii.Usingacom- 2 cells do not express MARCO or SR-AI/II, although they do bination of in vitro and in vivo experiments, we demonstrate a role express SRCL, suggesting that SRCL is not an efficient phago- for MARCO in reproductive tract innate immunity. These results cytic receptor for C. sordellii on these cells (data not shown). may prove to be important not only for understanding the patho- Our data are in accord with previously published studies of the genesis of invasive clostridial infections, but also for developing role of MARCO in immune defense against bacterial pathogens of better preventive and therapeutic measures against a range of both the lung (44). In a murine model of pneumonia caused by the sexually and nonsexually transmitted infections. Gram-positive pathogen Streptococcus pneumoniae, MARCO- deficient mice displayed an impaired ability to clear bacteria from Disclosures the lungs and significantly diminished survival (44). Our findings im- The authors have no financial conflicts of interest. ply that genetic differences in MARCO expression or function might influence the risk of C. sordellii or other clostridial infections. There are several limitations in our work. The bacteria used in References our studies of phagocytosis were heat-killed, FITC-labeled C. 1. Aldape, M. J., A. E. Bryant, and D. L. Stevens. 2006. Clostridium sordellii infection: epidemiology, clinical findings, and current perspectives on diagnosis sordellii, which would not be found in nature. Thus, these results and treatment. Clin. Infect. Dis. 43: 1436–1446. Downloaded from may be different using live bacteria. In addition, the bacteria used 2. Aronoff, D. M., and J. D. Ballard. 2009. Clostridium sordellii toxic shock syndrome. Lancet Infect. Dis. 9: 725–726. were in a vegetative (nonsporulating) form, which models active 3. Ho, C. S., J. Bhatnagar, A. L. Cohen, J. K. Hacker, S. B. Zane, S. Reagan, invasion with replicating bacteria. However, future studies of the M. Fischer, W. J. Shieh, J. Guarner, S. Ahmad, et al. 2009. Undiagnosed cases of phagocytosis of spore forms will be of interest as well. Our study fatal Clostridium-associated toxic shock in Californian women of childbearing age. Am. J. Obstet. Gynecol. 201: 459.e1-7. was also limited by the fact that we did not differentiate between 4. Fischer, M., J. Bhatnagar, J. Guarner, S. Reagan, J. K. Hacker, S. H. Van Meter, the mRNA expression of SR-AI and SR-AII. These receptors are V. Poukens, D. B. Whiteman, A. Iton, M. Cheung, et al. 2005. Fatal toxic shock http://www.jimmunol.org/ transcribed from the same gene and differ as a result of alternative syndrome associated with Clostridium sordellii after medical abortion. N. Engl. J. Med. 353: 2352–2360. mRNA splicing (45). An additional caveat is that the rodent cells 5. Sinave, C., G. Le Templier, D. Blouin, F. Le´veille´, and E. Deland. 2002. Toxic used for these studies were peritoneal macrophages, which may shock syndrome due to Clostridium sordellii: a dramatic postpartum and post- differ significantly from reproductive tract cells. Thus, direct com- abortion disease. Clin. Infect. Dis. 35: 1441–1443. 6. Hao, Y., T. Senn, J. S. Opp, V. B. Young, T. Thiele, G. Srinivas, S. K. Huang, and parisons with human DMs are difficult. D. M. Aronoff. 2010. Lethal toxin is a critical determinant of rapid mortality in These studies newly described expression of SRCL by human rodent models of Clostridium sordellii endometritis. Anaerobe 16: 155–160. 7. O’Brien, D. K., and S. B. Melville. 2004. Effects of Clostridium perfringens DMs. This receptor, to our knowledge, has not been shown to be alpha-toxin (PLC) and perfringolysin O (PFO) on cytotoxicity to macrophages, a functional phagocytic receptor on macrophages. We did not on escape from the phagosomes of macrophages, and on persistence of C. examine its role in the phagocytosis of C. sordellii, and this will be perfringens in host tissues. Infect. Immun. 72: 5204–5215. by guest on September 26, 2021 8. Singh, U., G. Nicholson, B. C. Urban, I. L. Sargent, U. Kishore, and A. L. Bernal. a subject of future research. We also did not identify a major role 2005. Immunological properties of human decidual macrophages: a possible role in for CBSRs in the phagocytosis of C. sordellii using mAbs to block intrauterine immunity. Reproduction 129: 631–637. CD36 and CD163. This approach has limitations, and future studies 9. Murphy, J. E., P. R. Tedbury, S. Homer-Vanniasinkam, J. H. Walker, and S. Ponnambalam. 2005. Biochemistry and cell biology of mammalian scavenger using genetically deficient, mouse-derived macrophages, or gene- receptors. Atherosclerosis 182: 1–15. silencing approaches would be necessary to confirm our results. It is 10. Peiser, L., and S. Gordon. 2001. The function of scavenger receptors expressed notable that human DMs express relatively high levels of mRNA for by macrophages and their role in the regulation of inflammation. Microbes In- fect. 3: 149–159. the CBSR CD163 [transcripts for CD163 were the highest of all 11. Dunne, D. W., D. Resnick, J. Greenberg, M. Krieger, and K. A. Joiner. 1994. The scavenger receptors that we examined by semiquantitative real-time type I macrophage scavenger receptor binds to Gram-positive bacteria and PCR (Fig. 1B)]. The CD163 receptor is involved primarily in the recognizes lipoteichoic acid. Proc. Natl. Acad. Sci. USA 91: 1863–1867. 12. Greenberg, J. W., W. Fischer, and K. A. Joiner. 1996. Influence of lipoteichoic clearance of hemoglobin–haptoglobin complexes (46). It has been acid structure on recognition by the macrophage scavenger receptor. Infect. implicated in anti-inflammatory responses and is a surface marker Immun. 64: 3318–3325. 13. Suzuki, H., Y. Kurihara, M. Takeya, N. Kamada, M. Kataoka, K. Jishage, of alternative (M2) macrophage activation (46). Thus, our finding of O. Ueda, H. Sakaguchi, T. Higashi, T. Suzuki, et al. 1997. A role for macrophage CD163 expression by human DMs provides further support to other scavenger receptors in atherosclerosis and susceptibility to infection. Nature 386: studies demonstrating that DMs exhibit features of alternative (M2) 292–296. 14. Areschoug, T., J. Waldemarsson, and S. Gordon. 2008. Evasion of macrophage activation (47, 48). The implications of this for bacterial infections scavenger receptor A-mediated recognition by pathogenic streptococci. Eur. J. in the postpartum or postabortion period are unclear. Immunol. 38: 3068–3079. Studies of how DMs interact with pathogenic bacteria contribute 15. Arredouani, M. S., A. Palecanda, H. Koziel, Y. C. Huang, A. Imrich, T. H. Sulahian, Y. Y. Ning, Z. Yang, T. Pikkarainen, M. Sankala, et al. 2005. MARCO is the major to our understanding of these complex phagocytes. Mounting evi- binding receptor for unopsonized particles and bacteria on human alveolar macro- dence suggests that DMs are important in host defense against phages. J. Immunol. 175: 6058–6064. bacterial infections during pregnancy, such as the Gram-positive 16. O’Brien, D. K., and S. B. Melville. 2003. Multiple effects on Clostridium perfringens binding, uptake and trafficking to lysosomes by inhibitors of macro- pathogen Listeria monocytogenes (49). Whereas the clearance of phage phagocytosis receptors. Microbiology 149: 1377–1386. bacteria may prevent overt intrauterine infection, the microbial 17. Palecanda, A., J. Paulauskis, E. Al-Mutairi, A. Imrich, G. Qin, H. Suzuki, activation of DMs can also drive preterm birth by stimulating the T. Kodama, K. Tryggvason, H. Koziel, and L. Kobzik. 1999. Role of the scavenger receptor MARCO in alveolar macrophage binding of unopsonized envi- production of cytokines and PGs that cause uterine contraction and ronmental particles. J. Exp. Med. 189: 1497–1506. cervical dilation (50). In addition, DMs suppress immune responses 18. Stuart, L. M., J. Deng, J. M. Silver, K. Takahashi, A. A. Tseng, E. J. Hennessy, R. A. Ezekowitz, and K. J. Moore. 2005. Response to Staphylococcus aureus at the fetal/maternal interface to induce and maintain maternal requires CD36-mediated phagocytosis triggered by the COOH-terminal cyto- tolerance to the developing fetus (51, 52). Thus, unlike other mac- plasmic domain. J. Cell Biol. 170: 477–485. rophages, DMs defend against microbial invasion while maintaining 19. Arredouani, M. S., F. Franco, A. Imrich, A. Fedulov, X. Lu, D. Perkins, R. Soininen, K. Tryggvason, S. D. Shapiro, and L. Kobzik. 2007. Scavenger receptors SR-AI/II an immunosuppressive phenotype in the context of maternal-fetal and MARCO limit pulmonary dendritic cell migration and allergic airway in- development. Future studies are needed to determine whether the flammation. J. Immunol. 178: 5912–5920. The Journal of Immunology 4335

20. Vince, G. S., P. M. Starkey, M. C. Jackson, I. L. Sargent, and C. W. Redman. specificity in microbial ligand recognition by innate immune receptors. J. Innate 1990. Flow cytometric characterisation of cell populations in human pregnancy Immun. 1: 153–163. decidua and isolation of decidual macrophages. J. Immunol. Methods 132: 181– 35. Aldape, M. J., A. E. Bryant, E. J. Katahira, A. M. Hajjar, S. M. Finegold, Y. Ma, 189. and D. L. Stevens. 2010. Innate immune recognition of, and response to, 21. Bailie, M. B., T. J. Standiford, L. L. Laichalk, M. J. Coffey, R. Strieter, and Clostridium sordellii. Anaerobe 16: 125–130. M. Peters-Golden. 1996. Leukotriene-deficient mice manifest enhanced lethality 36. Areschoug, T., and S. Gordon. 2009. Scavenger receptors: role in innate im- from Klebsiella pneumonia in association with decreased alveolar macrophage munity and microbial pathogenesis. Cell. Microbiol. 11: 1160–1169. phagocytic and bactericidal activities. J. Immunol. 157: 5221–5224. 37. Ernst, J. D., and O. Stendahl, eds. 2006. Phagocytosis of Bacteria and Bacterial 22. Peters-Golden, M., R. W. McNish, R. Hyzy, C. Shelly, and G. B. Toews. 1990. Pathogenicity. Cambridge University Press, New York. Alterations in the pattern of arachidonate metabolism accompany rat macro- 38. Chroneos, Z., and V. L. Shepherd. 1995. Differential regulation of the mannose phage differentiation in the lung. J. Immunol. 144: 263–270. and SP-A receptors on macrophages. Am. J. Physiol. 269: L721–L726. 23. Aronoff, D. M., Y. Hao, J. Chung, N. Coleman, C. Lewis, C. M. Peres, 39. Blander, J. M., and R. Medzhitov. 2004. Regulation of phagosome maturation by C. H. Serezani, G. H. Chen, N. Flamand, T. G. Brock, and M. Peters-Golden. signals from Toll-like receptors. Science 304: 1014–1018. 2008. Misoprostol impairs female reproductive tract innate immunity against 40. Watanabe, K., E. K. Shin, M. Hashino, M. Tachibana, and M. Watarai. 2010. Clostridium sordellii. J. Immunol. 180: 8222–8230. Toll-like receptor 2 and class B scavenger receptor type I are required for bac- 24. Aronoff, D. M., C. Canetti, and M. Peters-Golden. 2004. Prostaglandin E2 terial uptake by trophoblast giant cells. Mol. Immunol. 47: 1989–1996. inhibits alveolar macrophage phagocytosis through an E-prostanoid 2 receptor- 41. Plu¨ddemann, A., S. Mukhopadhyay, and S. Gordon. 2006. The interaction of mediated increase in intracellular cyclic AMP. J. Immunol. 173: 559–565. macrophage receptors with bacterial ligands. Expert Rev. Mol. Med. 8: 1–25. 25. Thiele, L., B. Rothen-Rutishauser, S. Jilek, H. Wunderli-Allenspach, 42. Sankala, M., A. Bra¨nnstro¨m, T. Schulthess, U. Bergmann, E. Morgunova, J. Engel, H. P. Merkle, and E. Walter. 2001. Evaluation of particle uptake in human blood K. Tryggvason, and T. Pikkarainen. 2002. Characterization of recombinant soluble monocyte-derived cells in vitro: does phagocytosis activity of dendritic cells macrophage scavenger receptor MARCO. J. Biol. Chem. 277: 33378–33385. measure up with macrophages? J. Control. Release 76: 59–71. 43. Jo´zefowski, S., M. Arredouani, T. Sulahian, and L. Kobzik. 2005. Disparate reg- 26. Mwaikambo, B. R., F. Sennlaub, H. Ong, S. Chemtob, and P. Hardy. 2006. ulation and function of the class A scavenger receptors SR-AI/II and MARCO. Activation of CD36 inhibits and induces regression of inflammatory corneal J. Immunol. 175: 8032–8041. neovascularization. Invest. Ophthalmol. Vis. Sci. 47: 4356–4364.

44. Arredouani, M., Z. Yang, Y. Ning, G. Qin, R. Soininen, K. Tryggvason, and Downloaded from 27. Ballinger, M. N., R. Paine III, C. H. Serezani, D. M. Aronoff, E. S. Choi, L. Kobzik. 2004. The scavenger receptor MARCO is required for lung defense T. J. Standiford, G. B. Toews, and B. B. Moore. 2006. Role of granulocyte against pneumococcal pneumonia and inhaled particles. J. Exp. Med. 200: 267– macrophage colony-stimulating factor during Gram-negative lung infection with 272. Pseudomonas aeruginosa. Am. J. Respir. Cell Mol. Biol. 34: 766–774. 45. Matsumoto, A., M. Naito, H. Itakura, S. Ikemoto, H. Asaoka, I. Hayakawa, 28. Bermudez, L. E., A. Parker, and J. R. Goodman. 1997. Growth within macro- H. Kanamori, H. Aburatani, F. Takaku, H. Suzuki, et al. 1990. Human macrophages increases the efﬁciency of Mycobacterium avium in invading other phage scavenger receptors: primary structure, expression, and localization in macrophages by a complement receptor-independent pathway. Infect. Immun. 65: 1916–1925. atherosclerotic lesions. Proc. Natl. Acad. Sci. USA 87: 9133–9137. 46. Moestrup, S. K., and H. J. Møller. 2004. CD163: a regulated hemoglobin

29. Laskarin, G., K. Cupurdija, V. S. Tokmadzic, D. Dorcic, J. Dupor, K. Juretic, http://www.jimmunol.org/ N. Strbo, T. B. Crncic, F. Marchezi, P. Allavena, et al. 2005. The presence of scavenger receptor with a role in the anti-inflammatory response. Ann. Med. 36: functional mannose receptor on macrophages at the maternal-fetal interface. 347–354. Hum. Reprod. 20: 1057–1066. 47. Cupurdija, K., D. Azzola, U. Hainz, A. Gratchev, A. Heitger, O. Takikawa, 30. Selman, L., K. Skjodt, O. Nielsen, C. Floridon, U. Holmskov, and S. Hansen. S. Goerdt, R. Wintersteiger, G. Dohr, and P. Sedlmayr. 2004. Macrophages of 2008. Expression and tissue localization of collectin placenta 1 (CL-P1, SRCL) human first trimester decidua express markers associated to alternative activa- in human tissues. Mol. Immunol. 45: 3278–3288. tion. Am. J. Reprod. Immunol. 51: 117–122. 31. Jiang, Y., P. Oliver, K. E. Davies, and N. Platt. 2006. Identification and char- 48. Gustafsson, C., J. Mjo¨sberg, A. Matussek, R. Geffers, L. Matthiesen, G. Berg, acterization of murine SCARA5, a novel class A scavenger receptor that is S. Sharma, J. Buer, and J. Ernerudh. 2008. Gene expression profiling of human expressed by populations of epithelial cells. J. Biol. Chem. 281: 11834–11845. decidual macrophages: evidence for immunosuppressive phenotype. PLoS One 32. Baranova, I. N., R. Kurlander, A. V. Bocharov, T. G. Vishnyakova, Z. Chen, 3: e2078. A. T. Remaley, G. Csako, A. P. Patterson, and T. L. Eggerman. 2008. Role of 49. Qiu, X., L. Zhu, and J. W. Pollard. 2009. Colony-stimulating factor-1-dependent

human CD36 in bacterial recognition, phagocytosis, and pathogen-induced JNK- macrophage functions regulate the maternal decidua immune responses against by guest on September 26, 2021 mediated signaling. J. Immunol. 181: 7147–7156. Listeria monocytogenes infections during early gestation in mice. Infect. Immun. 33. Fabriek, B. O., R. van Bruggen, D. M. Deng, A. J. Ligtenberg, K. Nazmi, 77: 85–97. K. Schornagel, R. P. Vloet, C. D. Dijkstra, and T. K. van den Berg. 2009. The 50. Goldenberg, R. L., J. C. Hauth, and W. W. Andrews. 2000. Intrauterine infection macrophage scavenger receptor CD163 functions as an innate immune sensor for and preterm delivery. N. Engl. J. Med. 342: 1500–1507. bacteria. Blood 113: 887–892. 51. Hunt, J. S. 1990. Current topic: the role of macrophages in the uterine response 34. Plu¨ddemann, A., S. Mukhopadhyay, M. Sankala, S. Savino, M. Pizza, R. Rappuoli, to pregnancy. Placenta 11: 467–475. K. Tryggvason, and S. Gordon. 2009. SR-A, MARCO and TLRs differentially 52. Nagamatsu, T., and D. J. Schust. 2010. The immunomodulatory roles of mac- recognise selected surface proteins from Neisseria meningitidis: an example of ﬁne rophages at the maternal-fetal interface. Reprod. Sci. 17: 209–218.