Contents Page Index

Index

Contents Page Index ...... 1

List of Figure ...... 3

List of Table ...... 3

Acknowledgement ...... 4

Abstract ...... 5

Chapter 1: Introduction ...... 6

Chapter 2: Review of Literature ...... 8

2.1 Poultry sector in Bangladesh ...... 8

2.2 Laying hen management systems ...... 8

2.3 Poultry nematodes and Ascaridia galli ...... 9

2.4 Scientific classification of Ascaridia galli ...... 10

2.5 Epidemiology of Ascaridia galli ...... 10

2.6 Predilection site ...... 11

2.7 Morphology ...... 11

2.8 Life cycle of Ascaridia galli...... 13

2.9 Pathogenesis and clinical symptoms ...... 15

2.10 DNA barcoding and COX1 gene ...... 16

Chapter 3: MATERIALS AND METHODS ...... 18

3.1 Study area ...... 18

3.2 Study period ...... 18

3.3 Study population ...... 18 1

3.4 Collection of sample ...... 18

3.5 DNA extraction ...... 18

3.6 Amplification of Cox-I gene ...... 19

3.7 Gel electrophoresis ...... 20

3.8 Statistical analysis ...... 20

3.9 Phylogenic analysis ...... 20

Chapter 4: Results ...... 22

4.1 Overall prevalence of Ascaridia galli ...... 22

4.2 Effect of rearing system ...... 22

4.3 Gross pathological lesion ...... 23

4.4 PCR results ...... 24

4.5 Phylogenetic Analysis ...... 25

Chapter 5: Discussion ...... 30

Chapter 6: Limitations ...... 34

Chapter 7: Conclusion ...... 35

Chapter 8: References ...... 36

Appendix ...... 43

Appendix-I ...... 43

Appendix-II : DNA sequence of our study sample ...... 44

Brief biography of the author ...... 46

List of Figure Figure Page

Figure 1: Ascaridia galli (Adult worms) 10 Figure 2: Morphology of Ascaridia galli (Bachaya et al., 2015) 12 Figure 3: Life cycle of Ascaridia galli 14 Figure 4: Necropsy of samples (A) and collection of Ascaridia galli (B) 21 Figure 5 : Making PCR product (A) and gel electrophoresis (B) 21 Figure 6: Effect of rearing system in Ascaridia galli prevalence 22 Figure 7: Petecheal hemorrhage in the duodenum 23 Figure 8: PCR results of the mitochondrial DNA of single Ascaridia galli 24 Figure 9: Partial chromatogram after sequencing of the PCR product 25 Figure 10: Snapshots of BLAST search query sequence (A) 26 Figure 11: Snapshots of BLAST search where query sequence (B) 26 Figure 12: Snapshots of BLAST search where query sequence (C) 27 Figure 13: Evolutionary relationships of taxa 28

List of Table Table Page

Table 1: Steps of PCR 20 Table 2: Similarity Matrices cox1 gene of Ascaridia galli of Bangladesh 29 Table 3: List of accession number of previous studies 43

ACKNOWLEDGEMENT

I would like to express the deepest sense of gratitude and all sorts of praises to the Almighty God, The Omnipotent, Omnipresent and Omniscient, whose blessing have enabled the author to complete this thesis.

I would like to express my gratefulness to my Research supervisor, Professor Dr. Sharmin Chowdhury and co supervisor Professor Dr. Mohammad Alamgir Hossain Department of Pathology and Parasitology, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University (CVASU), Chattogram for their sympathetic supervision, inspiration, constructive criticism, valuable suggestion and providing important information throughout the course work and research and towards preparation of the manuscript in time.

I also would like to express my sincere thanks to my respected teacher, Professor Dr. Md. Masuduzzaman and Professor Dr. Tania for providing samples, their valuable advice and inspiration.

I am also grateful to Professor Dr. AMAM Zonaed Siddiki, Assitant Professor DR. Tofazzal Md. Rakib and Dr. Samaranjan Barua, Upazilla Livestock Officer for their help and support during this research work.

Thanks are also to all lab technicians and support staffs of Department of Pathology and Parasitology, CVASU for their help in lab work.

Last but not least, I would like to thanks all my well-wishers, kith and kin for their constant inspiration and blessings throughout the entire period of my academic life.

Abstract

Ascariasis caused by Ascaridia galli (A. galli) is a common parasitic infection in chicken throughout the world. This infection is prevalent in all kind of production systems and cause substantial economic problem in terms of lower feed conversion, reduced weight gain, lower egg production and even death in case of heavy infections. Information about genetic variation is crucial to understand the host parasite relationship as well as to design an effective control measures against this economically important parasite. Therefore, this study was conducted to get updated information on the prevalence of A. galli infections in chickens and to perform molecular characterization of the collected worms to know the most prevailing genotype of A. galli in our country specially in Chattogram district. For this purpose, a total of 108 chickens intestine were collected from different local markets and the gastrointestinal tract of individual chicken was examined for the presence of A. galli infection. Twenty-four chickens out of 108 were found positive to infection giving the prevalence as 22.22% of A. galli infection in chickens of the study area. The prevalence of A. galli in native chickens (38.30%) was higher than in chickens reared in cage (9.84%). The gross pathological signs included obstruction of duodenum, patechial hemorrhage in most cases and necrotic plaque in some cases. The Polymerase Chain Reaction (PCR) on the genomic DNA (cox1 gene) gave positive results at 533 bp. Five samples were subjected to phylogenetic analysis and showed higher similarity to previous findings in China.

Keywords: Ascaridia galli, Chicken, Genotype, Prevalence, Polymerase Chain Reaction, Phylogenetic Analysis

Chapter 1: Introduction

Poultry production has been increasing constantly throughout the world over the last decades and according to FAO (Food and Ser, 2004) around 75% of a total of 15 billion chickens are reared in the developing countries. Bangladesh is one of the most economically vulnerable and densely populated countries in the world with >40% of the people living below the poverty line (Ferdushy et al., 2016). Poultry rearing is very common, but 50% of the households with chickens have no land at all or having <0.5 acres (Saha et al., 2000). Therefore, poultry rearing plays a vital role for the generation of income of these people, as this requires minimum land, little capital and relatively less skills. Besides being feasible for landless farmers, poultry rearing is also used as a tool for poverty alleviation as well as for empowerment of poor women. Thus, poultry meat and eggs contribute with approx. 37% of the total animal protein requirement (Prabakaran, 2003). In Bangladesh, chickens are reared under different conditions, such as backyard, semi-intensive and intensive systems. Backyard/semi-intensive systems are mainly practiced by smallholders in rural areas, whereas intensive systems are much more organized and are largely used for commercial production (Baig et al., 2006). In backyard systems, the birds are free-range during daytime while they are confined at night. Therefore, chickens find most of their food by roaming around the households, where they eat a variety of food items like kitchen waste, leaves, grasses, insects, arthropod, earthworm, ants etc. many of which may act as intermediate or paratenic hosts for parasites (Soulsby and Ballière Tindall, 1982). Moreover, these birds can easily pick up free-living infective stages of parasites without intermediate hosts, while roaming around. For these reasons, backyard poultry maybe heavily exposed to helminth infection. In case of intensive production system for layer birds, these are first reared in deep litter systems followed by cage systems. Thus, these birds may become infected during their early age and the parasites may be present throughout the production. Therefore, different diseases including those caused by the parasites are the major constraints in extensive as well as in commercial intensive poultry production system in Bangladesh. Despite the use of lots of anti- parasitic drugs and disinfectants in confined production systems, poultry within these systems are not protected from parasitic infections, especially not from

those species which have short life cycles and/or direct transmission (Ruff, 1999). Studies have revealed the presence of a wide range of helminth species, the most dominant being Ascaridia galli, Heterakis gallinarum, Capillaria spp., Raillietina spp. and Hymenolepsis spp. 100% of the backyard chicken and 49% of layer birds in Mymensingh district, Bangladesh, were observed infected with gastrointestinal helminthes (Baig et al., 2006).

Chicken heavily infected with Ascaridia galli shows symptom of diarrhea and weight loss, and economic losses are mainly associated with mortality and reduction in feed conversion efficiency and egg production. Moreover, Ascaridia galli is also supposed to act as a vector for Salmonella spp. therefore being of significant importance from a public health point of view (Ramadan and Abouznada, 1992). Furthermore, concomitant infection with other bacteria in parasite primed infection may have great impact on production and economic return to the farmer.

In spite of the large prevalence and the potential economic importance very little research has been carried out on the presence of helminth infections in chickens in different regions of Chattogram region of Bangladesh. Moreover, so far our knowledge no studies have been conducted to detect the genetic variations among these parasites and the effects of genotype on subsequent establishment in their chicken host. However, this information is crucial to understand the host parasite relationship as well as to design an effective control measures against this economically important parasite.

Objectives of the study The present study was undertaken with a number of objectives as below:-

 To get updated information on the prevalence of helminth infections in chickens  To identify gross pathological changes caused by Ascaridia galli  To characterize positive isolates to find out the genotype effect of the parasite on the establishment in the poultry host.

Chapter 2: Review of Literature

2.1 Poultry sector in Bangladesh The poultry sub-sector is an important avenue in fostering agricultural growth and reduce malnutrition for the people in Bangladesh (da Silva and Rankin, 2014). It is an integral part of farming system in Bangladesh and has created direct, indirect employment opportunity including support services for about 6 million people (Ansarey, 2012). This sub-sector has proved as an attractive economic activity, thereby, indicating its’ importance for the entire economy. The sector accounts for 14% of the total value of livestock output and is growing rapidly (Raihan and Mahmud, 2008). It is find out that poultry meat alone contributes 37% of the total meat production in Bangladesh. Poultry contributes about 22-27% of the total animal protein supply in the country (Prabakaran, 2003). It is stated that in Asia, poultry manure is used as feed for fish where poultry are raised on top of the ponds as part of an integrated system for example, fish-cum-duck farming. Development of poultry has generated considerable employment through the production and marketing of poultry and poultry products in Bangladesh (da Silva and Rankin, 2014).

2.2 Laying hen management systems There are clear links between good animal welfare and improved production. Diseases, morbidity and mortality all lead to loss of production, which can be addressed through improvements in welfare (Appleby and Hughes, 1991). Hens in battery cages spend their lives in artificial space designed to maximize production activity (Olsson et al., 2002). The term free-range refers to poultry systems in which the birds have runs or pasture (4 m2/ hen) (Gordon and Charles, 2002). Free-range chickens must not only have access to outdoor runs and day light, but must also have indoor housing at night (Shimmura et al., 2010). Chickens in appropriate free-range farming systems are considered to be healthier, having stronger immune systems and welfare improvement than those in cage systems (Fanatico et al., 2006). But, Ascarid infections were rare in caged flocks, including furnished cages, and were significantly more common in non-cage systems (Nyman et al., 2010). Despite a Swedish study not able to find a significant infectivity difference between the organic, conventional and non-cage systems (Höglund and Jansson, 2011); chickens kept in free-range systems are subjected to an increased risk of some parasites

(Wongrak et al., 2014). The absence of a hygiene barrier at the entrance of the house or unit increased the risk of infection, which suggests that parasite eggs were introduced horizontally to the farms. The risk of infection also increased with the age of equipment used in the barn (Nyman et al., 2010).

2.3 Poultry nematodes and Ascaridia galli Nematodes, endo-parasites, belong to the phylum Nemathelminthes, class Nematoda, the most common helminth species in poultry with a cylindrical and elongated shape. All nematode worms have an alimentary tract with separate sexes. The life cycle may be direct or indirect including an intermediate host (Permin and Hansen, 1998). Species with a direct life cycle are more frequent under intensive farming conditions where constant temperatures and humidity are ideal for larval development. Species with indirect life cycles are particularly abundant in traditional farms with birds kept outdoors, especially in humid and humus-rich soils that are favorable for earthworm development. Thus, Ascarid infections occur in non-caged chickens worldwide (Permin and Hansen, 1998). The body of a nematode has unique characteristics, such as a carbohydrate-rich surface coat (Fetterer and Rhoads, 1993) and by moulting several times throughout their development cycle they change their antigenic and cuticular surface (Blaxter et al., 1992), which plays dominant role that how parasites are perceived by a host’s innate defense system.

2.4 Scientific classification of Ascaridia galli Kingdom: Animalia

Phylum: Nematoda

Class: Secernentea

Order: Ascaridida

Family: Ascarididae

Genus: Ascaridia

Species: A. galli

Binomial name: Ascaridia galli (Schrank, 1788) (Figure 1)

Figure 1: Ascaridia galli (Adult worms) (Source: https://en.wikipedia.org/wiki/Ascaridia_galli)

2.5 Epidemiology of Ascaridia galli Ascaridia galli is a globally occurring parasite found in commercial hens as well as in free-range chickens. Below is given an overview of countries where A. galli has been identified. It may be observed that only few countries have reported the presence of A. galli. However, in reality all chickens seem to be infected, but there

10 is lack of proof of prevalence. The first identification of A. galli was made in Germany by Schrank (Schrank, 1788).

The finding of A. galli reported in Brazil, India, Zanzibar, The Philippines, Democratic Republic of Congo, China, Canada and UK. A. galli has subsequently been described in materials collected from a number of countries in temperate, subtropical and tropical climates and is said to be a worldwide infection in poultry (Ackert, 1931).

In Europe, a recent study in Germany revealed that 7% of the chickens carried A. galli (Dänicke et al., 2009). Zeller examined fecal samples collected from commercial poultry farms in Bavaria, where 13% of the birds were infected with A. galli (Zeller and Flocks., 1990). In Switzerland, the prevalence of A. galli ranged from 24 to 38% in chickens (Jansson et al., 2010). In Danish chickens, 37.5% prevalence was found in backyard chickens (Permin et al., 1999).

A study carried out on 600 village chickens in Tanzania of which A. galli was found in 30% of the chickens. Likewise, A. galli was identified in chickens in Egypt, Morocco, Sudan, Nigeria, Zimbabwe, Western Cameroon and Uganda (A Permin, Esmann, Hoj, Hove, and Mukaratirwa, 2002).

A. galli was the most prevalent nematode in domestic fowl in India with a prevalence of 60%. In Pakistan 12% of the chickens were infected with A. galli (Ramadan and Abouznada, 1992). In Thailand, 22% of the chickens were harbouring A. galli (Ayudhya and Sangvaranond, 1993).

2.6 Predilection site Ascaridia galli occurs worldwide in birds of all ages. The adult worms live in the lumen of the intestine, but are occasionally also found in the crop, gizzard and rarely in the oviduct or body cavity (Ramadan and Abouznada, 1992).

2.7 Morphology Adult worms are yellowish white in color and semitransparent. Cuticle is distinctly striated and the cuticular alae are feebly developed (Ramadan and Abouznada, 1992). The oral opening is surrounded by three prominent trilobed lips. Two conspicuous papillae occur on the dorsal lip and one on each of the subventral lips.

A pair of the so-called neck papillae occurs on the sides of the body near the anterior end (Figure 2) (Freeborn, 1923; Schrank, 1788).

Figure 2: Morphology of Ascaridia galli (Bachaya et al., 2015) a. Head magnified to show bps and cephalic papillae b. Posterior end of male to show caudal papillae c. Tail to female d. Vulvar region in female

Females are longer than males with a length of 72-116 mm and a straight posterior terminal, whereas males are around 51-76 mm and possess a curved posterior terminal (Ashour, 1994). In the anterior end, both sexes have a prominent mouth with three distinct lips, bearing teeth like denticles on their edges (Hassanen et al., 2009). The entire body is covered with a thick cuticle, which is striated transversely throughout the length of the body (Permin et al., 1997). The eggs are oval and surrounded by three layers: the inner permeable layer called the vitelline membrane, a thick resistant shell and a thin albuminous layer (Ackert, 1931; Hansen et al.,

1956). These layers are a key factor for its resistance against desiccation and its long- term persistence in the environment. Larvae do not hatch in the environment; instead, they moult inside the eggs until they become infective (L3).

2.8 Life cycle of Ascaridia galli At optimal temperature and humidity most of the fertile eggs within 24 hours, start dividing into the two-cell stage (Ramadan and Abouznada, 1992). In the next 24 hours, the second division takes place and gives rise to the three-cell stage. The four- cell stage is normally seen within three days in most of the eggs. After 3 days, a morula with blastomeres is formed, which is completed by the end of the fifth day. After 8 days, the so called “tad pole” stage develops and after two additional days a vermiform embryo is developed. Within the next three to four days, this transforms into the coiled and fully mature infective L3 larva (Ramadan and Abouznada, 1992). The whole process may take between 7 to 20 days or longer depending on the temperature and relative humidity (Permin and Hansen, 1998; Reid, 1960).

The life cycle is completed when new hosts ingest the infective eggs. After ingestion, the infective eggs are mechanically transported to the proventiculus and gizzard and further down to the duodenum where they hatch within the first 24 hours. Triggering factors that signal the larvae to hatch are believed to be temperature, carbon dioxide level and pH levels (Dick et al., 1973). Following hatching, the larvae burrow into the mucosal layer of the small intestine to enter the histotrophic phase (Ackert, 1931). The duration of the histotrophic phase is 3 to 54 days before the larvae return to the intestinal lumen where they reach final maturity (Permin and Hansen, 1998). However, this period is dose dependent and probably very much related to the phenomenon of arrested development (Herd and McNaught, 1975; Ikeme, 1971a). After the histotrophic phase, the mature worms settle down in the lumen of duodenum where they live and feed on ingesta and produce huge number of eggs that are passed with the faeces into the external environment where the life cycle continues (Figure 3) (Ramadan and Abouznada, 1992). The pre-patent period varies from 5-8 weeks (Pankavich et al., 1974; Permin and Hansen, 1998).

Figure 3: Life cycle of Ascaridia galli

(Source - http://www.pinsdaddy.com/roundworm-life- cycle_VYhbJAAAF2gP0zWbtm*L07QqfUpVcsuYaKq4%7ChbleYE/)

2.9 Pathogenesis and clinical symptoms Young birds seem to be more susceptible to Ascaridia galli infection than adults and manifest greater degree of damage. Penetration of the parasite into the duodenal or jejunal mucosa may cause hemorrhagic enteritis, anemia often associated with severe diarrhea as well as loss of appetite, weakness, decrease activity, ruffled feathers and dirty cloacal region (Adang et al., 2010; Ikeme, 1971b). Established larvae in some cases cause destruction of the glandular epithelium (Permin et al., 1997). Moreover, adhesion of the mucosal villi may occur due to proliferation of secretary cells. Not only the larvae can cause pathological lesions, also adult worm can cause damage to the epithelium in the form of pressure atrophy upon villi (Ikeme, 1971b).

In addition to reported pathological signs in chicken, a study reported that liver of the infected pigeons had fatty degeneration with coagulation necrosis of the hepatic cells. The authors also found necrotized tissues in the lungs, heart and kidneys of the infested birds (Adang et al., 2010).

What is more, a number of studies have been carried out to investigate the effect of combined infections caused by helminthes, bacteria and virus and their effect on production parameters. Earlier studies on the effect of A. galli on the immune system in chickens led to further investigations studying the influence of A. galli on subsequent E. coli infections. Accordingly it was suggested that combined infections has a significant impact on weight gain and more severe pathological manifestation in group with combined infections (Permin et al., 2006). Following the same theme, the effect of A. galli on subsequent Pasteurella multocida infections was shown to be predominantly on weight gain and egg production (Dahl et al., 2002). These studies indicate that interactions between parasitic, bacterial and viral diseases exist.

In addition, from welfare standpoint, it has been reported that infected birds manifested behavioral changes, for instance, infested chickens showed a higher food intake and lower activity as well as changes in ground pecking and nesting activity during the both prepatent and patent periods (Gauly et al., 2007). A. galli can negatively affect the table egg quality. One such case is when the adult worms is occasionally seen in the chicken`s egg. Parasite can migrate up the oviduct through cloaca and participate in the egg formation process (Höglund and Jansson, 2011;

Khalaf et al., 1982; Wang et al., 2016). Although presence of parasite worm in hen’s egg is not considered as hazard for public health, it can cause potential consumer complaint. However contaminated eggs can be easily identified during candling process.

2.10 DNA barcoding and COX1 gene DNA barcoding employs sequence diversity in short, standardized gene regions to aid species identification and discovery in large assemblages of life. The main concept of this method is that every species has an unique genetic identity. A DNA barcode is a short standardized sequence of DNA which may be used as a genetic maker for species identification (Merget et al., 2012).

DNA barcoding have used the nuclear internal transcribed spacer 2, cytochrome oxidase (cox1), 12S rRNA and nicotinamide adenine dinucleotide dehydrogenase (NADH) as target genes (Webster et al., 2012).

A 648‐ bp region of the cytochrome c oxidase I (COI) gene forms the primary barcode sequence for members of the animal kingdom (Hebert et al., 2003; Savolainen et al., 2005). The early goals of DNA barcoding focus on the assembly of reference libraries of barcode sequences for known species. Current results show that these libraries will be very effective in generating identifications; more than 95% of species in test assemblages of varied animal groups have been shown to possess distinctive COI sequences (Hajibabaei et al., 2006; Hebert et al., 2004; Ward et al., 2008).

Moreover, cases of incomplete resolution involve species that are closely allied. Work on groups with well-studied taxonomy also promises to reveal the levels and the nature of barcode divergences that typically separate species, aiding development of algorithms and the underlying rule sets needed for DNA barcoding to advance species discovery in taxonomically understudied groups (Barber and Boyce, 2006; Malatji1 et al., 2017).

The Consortium for the Barcode of Life (CBOL) was launched in May 2004 and now includes more than 120 organizations from 45 nations. CBOL is fostering development of the international research alliances needed to build, over the next 20 years, a barcode library for all eukaryotic life. It has already initiated the first

16 campaigns with a global sweep; they seek to deliver barcode coverage for all species of birds and fishes by 2012 (Marshall, 2005). Although these two projects will generate some 0.5 million records, a comprehensive barcode library for the animal kingdom will be much larger, c. 100 million records — almost twice the current size of GenBank (more than 162 million sequence records as of February 2013). Key features include the requirement for a persistent linkage between a barcode sequence and its source specimen and a secure environment that stores, organizes and queries these records, accessible to the entire biodiversity community. There is also a need to establish and enforce data standards. To meet these challenges, CBOL initiated dialogue with the major genomics repositories (e.g. National Center for Biotechnology Information (NCBI), biodiversity organizations (e.g. Global Biodiversity Informaion Facility (GBIF), major barcoding centres and the multiple taxonomic communities. These joint consultations have now led to the establishment of formal guidelines that must be met for records to gain barcode designation. Gene sequences must derive from a designated gene region, they must meet quality standards and they must derive from a specimen whose taxonomic assignment can be reviewed, ordinarily through linkage to a specimen that is held in a major collection (Ivanova et al., 2007).

To date, only a few molecular studies on Ascaridia galli have been performed and have been limited to individual genes (Höglund and Jansson, 2011). Hao and He, 2017 identified genetic variation in mitochondrial cox1 and nad4 genes of Ascaridia galli in China. Cerutti et al. (2008) characterized Ascaridia galli with cox1 in Italy. In Denmark, genetic difference in cox1 gene of A. galli was found by Katakam et al. (2010). Cox 1 gene is a useful marker for studying A. galli in village chickens (Malatji et al., 2016).

Chapter 3: MATERIALS AND METHODS

3.1 Study area This study was conducted at Department of Pathology and Parasitology, Chattogram Veterinary and Animal Sciences University (CVASU).

3.2 Study period The proposed study was conducted in May 2017 to December 2018.

3.3 Study population A total of 108 gastrointestinal tracts of the indigenous and commercial layer chickens viscera were collected from different local markets of Chittagong region and were examined for the presence of A. galli for this study. The demographic information about rearing system and deworming history were obtained from the sellers using a structured questionnaire.

3.4 Collection of sample For parasitological examination entire gastrointestinal tract was divided into three main sections e.g. i. duodenum ii. jejuno-ileum (J1, J2, J3, J4) iii. caecum and colon. Each of the intestinal sections was then opened separately in longitudinal direction with scissors, washed thoroughly by dipping 10 times in 0.9% NaCl solution. Thereafter, the washed content was sieved thoroughly to recover the parasite. Larger helminth species was picked up from the sieve with forceps described by Ferdushy et al. (2016) (Figure 4). Subsequently, all the recovered helminths were identified according to Soulsby (Soulsby and Ballière Tindall, 1982) and preserved in 70% ethanol for further molecular study.

3.5 DNA extraction For confirmatory diagnosis and genetic characterization all recovered worm and larvae from the chicken intestine were analyzed by PCR (Polymerase Chain Reaction) procedure. DNA was extracted from the muscles of the anterior part of the worm using the FavorPrep tissue genomic DNA extraction mini kit (Favorgen Biotech Corp, Taiwan) according to manufacturer’s instructions. We kept the samples in open air for air drying to remove the ethanol from the samples. After air drying, we took the muscles of the anterior part of the worm into another new eppendorf tube by the forceps. Then 200µl binding lysis solution was added into the eppendorf tube. After adding binding lysis solution properly, the mixture was

18 vortexed for proper mixing. Then 20µl proteinase-k was added into the eppendorf tube. Again the mixture was properly mixed by pulse vortexing for sometimes. Then the mixture was incubated at 60° C for 15 minutes. After incubating, 200 µl concentrate ethanol (96-100%) was added into the mixture and properly vortexed for mixing. Then a little bit spin was done (centrifuge) for 30 seconds. After spinning, we have transferred it into a spin column and centrifuged at 8000 rpm for 1 minute again. After centrifuging, we discarded the lower part of the mixture (discarded the drops from the inside of the lid). Then 500 µl wash buffer-I was added into the tube. Again the mixture was centrifuged at 8000 rpm for 1 minute. After centrifuging, the lower part was discarded. Then again 500 µl wash buffer-II was added. After adding of wash buffer-II, the mixture was centrifuged at 8000 rpm for 1 minute. After centrifuging, the lower part of the mixture was again discarded. Empty spin column centrifuged at maximum speed at 13000 rpm for 3 minutes for removing of ethanol. Then 100 to 200 µl elution buffer was added. After adding of elution buffer, incubated the mixture at room temperature for 1 minute. Again the mixture was centrifuged at 13000 rpm for 2 minutes and the DNA into a new eppendorf tube. Finally the extracted DNA was stored at -20° C until PCR perform.

3.6 Amplification of Cox-I gene A part of the cox1 gene (mtDNA) was amplified from individual worms by PCR according to published methods (Katakam et al., 2010) using AB system 2620 thermal cycler. The primers used for this procedure were:

Forward (GCox1F4F 5′--ATT ATT ACT GCT CAT GCT ATT TTG ATG--3′) (27bp),

Reverse (GCox14R 5′--CAA AAC AAA TGT TGA TAA ATC AAA GG -3′) (26bp).

The 25μl PCR reaction consisted of 4μl of extracted DNA, 2μl of each primer, 12.5μl master mix (2X) and 4.5μl double distilled water or nuclease free water. PCR cycling conditions were 95⁰ C for 15 min (for initial activation of taq polymerase), 30 cycles consisting of 95⁰ C for 30 sec (denaturation), 40 sec at 55⁰ C (annealing), 1 min at 72⁰ C (extension) and final elongation cycle of 10 min at 72⁰ C. After completing of PCR reaction, it was stored at 4° C.

Steps Sub-steps Temperature Time Cycle Initial activation 95⁰C 15min Cyclic steps Denaturation 95⁰C 30sec 30 Annealing 55⁰C 40sec cycles Extension 72⁰C 1min Final elongation 72⁰C 10min Table 1: Steps of PCR

3.7 Gel electrophoresis A 1.5% agarose gel was used for gel electrophoresis. At first, 0.75 gm agarose powder was taken in the conical flax. Then 50ml 1X TAE buffer (Tris, Acetic acid and EDTA) was added and mixed thoroughly. After mixing, the mixture was heated in the oven for 2 minutes. Then 5μl ethidium bromide was added into the mixture. Ethidium bromide is very much carcinogenic, so it was handled with extra care. Finally, the mixture was poured on gel tray and waiting for half an hour. Then 5-6μl PCR product was added into the gel tray. After adding of PCR product, run the gel electrophoresis and waiting for minimum 40 minutes (Figure 5). After completion of gel electrophoresis, finally the bands were visualized using the gel documentation system (UV illuminator).

3.8 Statistical analysis The questionnaire data were transferred to Microsoft Excel and then analyzed with Stata 13.1.

3.9 Phylogenic analysis Positive PCR product was purified using the FavorPrep Gel/PCR Purification Mini Kit (Favorgen Biotech Corp, Taiwan) according to manufacturer’s instructions and sent to Biotech Concern, Dhaka for gene sequencing. The data were compared with sequences from National Center for Biotechnology Information (NCBI) GenBank database. The sequence of Ascaridia galli was analyzed in comparison with gene sequences of previous studies. The evolutionary history was inferred using the UPGMA method (Sneath and Sokal, 1973). The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004) and are in the units of the

20 number of base substitutions per site. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013).

A B

Figure 4: Necropsy of samples (A) and collection of Ascaridia galli (B)

A B

Figure 5 : Making PCR product (A) and gel electrophoresis (B)

Chapter 4: Results

4.1 Overall prevalence of Ascaridia galli

Initially after sectioning the intestines, helminths were identified grossly. In this study period, we found 24 chickens were infected by Ascaridia galli out of 108 chickens which indicated 22.22% prevalence rate.

4.2 Effect of rearing system

In the present study, Ascaridia galli was harbored in 38.30% (18 out of 47) in native chickens and 9.84% (6 out of 61) in cage reared chickens. It might indicate that birds reared in backyard harbor high infection than in battery cages (Figure 6).

0 Free range Cage reared chickens chickens

Figure 6: Effect of rearing system in Ascaridia galli prevalence

4.3 Gross pathological lesion

During the present study, similar pathological lesions were found in both free range and cage reared chickens. Gross pathological changes included obstruction of small intestine incase high load of parasite. Petechial hemorrhage was found in the duodenum (Figure 7). Probably marked inflammatory reaction in the mucosa of caecum leads to the development of plaque.

Figure 7: Petechial hemorrhage in the duodenum

4.4 PCR results For molecular identification by PCR, total DNA was extracted from all positive samples. Known positive standard was used during each PCR run. All the isolates gave positive bands (Figure 8). Further analysis of the PCR product through sequencing and phylogeny (Figure 13) revealed that the gene fragment has high sequence similarity with that of A. galli (Figure 11).

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M

533bp

M 15 16 17 18 19 20 21 22 23 24 M

Figure 8: PCR results of the mitochondrial DNA of single Ascaridia galli (Lane (1-24) are showing the positive results at 533 bp and M is the size marker (100bp)).

4.5 Phylogenetic Analysis Among 24 positive samples, 5 samples (CVASU1, CVASU6, CVASU11, CVASU16 and CVASU23) were subjected to gene sequencing. The PCR products were sent for DNA sequencing and the sequence data were used to conduct BLAST analysis (in the NCBI website, http://blast.ncbi.nlm.nih.gov/Blast.cgi), to characterize the Ascaridia galli positive isolates. The data of gene sequencing are shown in Appendix-II. The DNA sequence (Figure 9) results were compared with previous studies in different countries such as China, Denmark, South Africa and Italy. Several snapshots of the BLAST search are shown below where the topmost hits were matched with Ascaridia galli.

Figure 9: Partial chromatogram after sequencing of the PCR product (The quality of the sequence was checked manually for each nucleotide.)

The sequences were then used as query sequence for BLAST search (nucleotide – nucleotide BLASTN). The Figure 10 shows the result page after BLAST searching where it was found that the highest similarity with the study in China (Genbank Accession no. KT613902.1, KT613900.1, KT613892.1, KT613894.1, KT613893.1, KT613888.1 and KT613889.1). All the other hits having high p value shows the same species of Ascaridia galli.

Figure 10: Snapshots of BLAST search query sequence (A) (The topmost hit was found to have 100% sequence similarity with that of A. galli)

Figure 11: Snapshots of BLAST search where query sequence (B) (The topmost hit was found to have 100% sequence similarity with that of A. galli)

Figure 12: Snapshots of BLAST search where query sequence (C) (The topmost hit was found to have 100% (266 out of 266) sequence similarity with that of A. galli)

A neighbour-joining phylogenetic tree (Figure 13) was constructed with the same 232 cognate region using Mega 6. The tree separated the selected plant 232 Ascaridia galii into three distinct cluster. CVASU1 and CVASU11 belong to clusterI; CVASU16 and CVASU23 belong to clusterII. CVASU6 cannot be clusterized.

Figure 13: Evolutionary relationships of taxa (The optimal tree with the sum of branch length = 5.23285759 is shown. There were a total of 232 positions in the final dataset.)

A similarity matrix was obtained using Mega 6 and is shown in Table 2. CVASU1 and CVASU11; CVASU16 and CVASU23 are identically similar to each other. CVASU6 shows 98% similarity with CVASU1 and CVASU11 and 97% similarity with CVASU16 and CVASU23.

CVASU6/Himel /Bangladesh 100 CVASU1/Himel /Bangladesh 98 100 CVASU11/Himel/ Bangladesh 98 100 100 CVASU16/Himel/ Bangladesh 97 98 98 100 CVASU23/Himel/ Bangladesh 97 98 98 100 100 KT613902.1/ China 98 100 100 98 98 100 KT613900.1/ China 98 100 100 98 98 100 100 KT613892.1/ China 98 100 100 98 98 100 100 100 KT613894.1/ China 98 99 99 98 98 100 100 100 100 KT613893.1/ China 98 100 100 98 98 100 100 100 100 100 KT613888.1/ China 98 99 99 98 98 100 100 100 99 100 100 KT613889.1/ China 97 99 99 99 99 99 99 99 98 99 98 100 KP982856.1/ China 96 96 96 96 96 96 96 96 95 96 95 96 100 GU138669.1/ Denmark 96 96 96 96 96 96 96 96 95 96 95 96 100 100 GU138668.1/ Denmark 96 96 96 96 96 96 96 96 95 96 95 96 100 100 100 KT388436.1/ South_Africa 97 99 99 99 99 99 99 99 98 99 98 100 96 96 96 100 KT388439.1/ South_Africa 97 98 98 97 97 98 98 98 98 98 98 98 96 96 96 98 100 FM178545.1/ Italy 96 96 96 96 96 96 96 96 95 96 95 96 100 100 100 96 96 100

Table 2: Similarity Matrices cox1 gene of Ascaridia galli of Bangladesh

Chapter 5: Discussion

Ascaridia galli in chickens have been reported in several countries by a number of investigators. The present study reveals that out of 108 indigenous chickens, 24 (22.22%) were infected by Ascaridia galli. Similar to our findings, Ayudhyinvestia and Sangvaranond (1993) reported 22% A. galli infection in Thailand. However, our study result shows lower infection rate than earlier studies in Bangladesh. Rabbi et al. (2006) reported higher prevalence (87.50%) of A. galli infection in indigenous chickens in Mymensingh district. In Narsingdi district of Bangladesh, Ferdushy et al. (2016) identified 70-85% of A. galli infection in chickens. But the prevalence of our study is slightly higher than the findings of Dänicke et al. (2009) in Germany (18%). The range of reported prevalence of gastrointestinal helminth infections from other parts of the world varied from 20-60% (Ackert, 1931; Jansson et al., 2010; Permin et al., 1999; Permin et al., 1997; Wakelin, 1964). The disparities among the result of the present and earlier works in other countries might be due to the variation of the geographical location of the research area, method of detection and sample size.

Considering the rearing type vulnerability, our data showed that cage reared chickens were more vulnerable compared to free range reared chickens. This notion is supported by other recent studies in Bangladesh (Ferdushy et al., 2016; Rabbi et al., 2006). Zeller and Flocks (1990) reported that poultry birds kept in battery cage systems had low prevalence of A. galli compared to free-range hens. In Switzerland, 32 different commercial systems were compared and found that the prevalence of A. galli was 24.3% in the free- range system, 8.5% in deep-litter system and none in battery cage system (Morgenstern and Lobsiger, 1993). Permin et al. (1997) reported high prevalence of A. galli in the free- range or organic (63.8%) compared with battery cage system (5%). In Punjab, Paikstan A. galli was observed in 24% free range system and 2% in cage system farms (Bachaya et al., 2015). Improved hygienic measurements may eliminate the risk of A. galli infections in deep litter systems. The fact that bio-security measures are not strictly applied in free range poultry farming might help to explain establishment of nematodes. Therefore, factors other than wild bird for example farm to farm contamination via vehicle, machine, equipment or people might also have contributed as the source of initial infections, especially for A. galli.

When considering the gross pathological changes, it was revealed in this study that A. galli causes blockage of small intestine, petechial hemorrhage in the duodenum, marked inflammation and increased mucous secretion in small inestine. These pathological conditions are induced by the worms as they grab intestinal tissues after absorbing the digested food stuff. Sometimes, worms try to penetrate into the intestinal epithelium, resulting into necrosis and inflammation. Moreover, this may also be due to the fact that embryonated eggs containing second stage larvae may be ingested and hatched in the intestinal wall, and produce gross pathological lesions, including intestinal hemorrhagic enteritis, necrotic patches and reddish spots on the intestinal wall. Similar types of lesions were recorded by Rabbi et al. (2006) and Adang et al. (2010). The exact mechanism of petechial hemorrhage is still unknown. However, the parasite, probably penetrate deeply into the mucosa. During penetration, large number of parasites might set up petechial hemorrhage. Nectrotic plaque was also found in some cases which is supported by Ferdushy et al. (2016) and Permin et al. (1997). Probably marked inflammatory reaction in the mucosa of caecum leads to the development of plaque.

In our knowledge, this is the first molecular investigation of A. galli in chickens in Bangladesh. The detection of A. galli by PCR based method is more confirmatory than microscopic technique. Though classical approach is less expensive and no highly technical instruments and facility will be required, the sensitivity of the test is compromised and their might be more false positive cases reported. Therefore, modern molecular tools might replace the traditional approach provided all the technical facilities are available.

The availability of different chemicals, enzymes and other consumables are also important for routine DNA based identification and characterization of any pathogens in Bangladesh perspective. For example, the DNA extraction kit is not available in Bangladesh (thus requiring importation from the outside the country).However as an alternative, classical DNA extraction techniques may replace it which is comparatively less sensitive but trustworthy. Considering the time and cost associated with PCR based analysis, one would think microscopic techniques more cost effective than PCR based characterization. However, as mention earlier, several other organisms may give false positive result by

31 microscopic technique, while PCR is more confirmatory and might need few hours to diagnose efficiently each cases.

During the present study single step PCR approach was followed. Earlier study reported PCR approach where 14s cox1 gene was amplified for molecular characterization (Katakam et al., 2010). Further amplipication of other A. galli genessuch as could be more informative in exploring the epidemology of A. galli in Bangladesh.

Among our studied smaples CVASU6 shows much diversity from others. CVASU1 and CVASU11 were identically similar but 98% similar to CVASU16 and CVASU23. Due to lack of history the actual cause for this variation is still unrevealed. Few studies have genotyped A. galli from chickens around the globe. All our studied samples, CVASU6, CVASU16 and CVASU23 showed 98% similarity with study of Hao and He, (2017) in China (Genbank accession no. KT613902.1, KT613892.1, KT613894.1, KT613893.1, KT613892.1, KT613900.1) whereas CVASU1, CVASU11 showed 100% similarity.

Urbanowicz et al. (2018) as conducted to assess the genetic diversity of A. galli isolated from hens in Poland by analyzing the nucleotide sequence of the region ITS1-5.8rRNA-ITS2 and identified its homology with the family Ascaridiidae. Adult A. galli were collected from the intestines of naturally infected hens from two flocks of free-run laying hens from the Wielkopolska region in Poland. From all parasites identical sequences were obtained which was homologus 99% with A. columbae (JQ995321.1) sequence but our study did not show such similarity.

Our studied samples showed 96% similarity compared to the study of Katakam et al. (2010) in Denmark and the study of Cerutti et al. (2008) in Italy although we used same primer as described Katakam et al. (2010). The ecological variation, breed variation and rearing variation of those previous studies cases may cause this diversity. Moreover, different factors related with DNA based approaches like performance of DNA extraction kit, quality of enzymes like Mastermix solution (which was left in the laboratory freezer) was compromised where continouos electricity was unfortunately not available.

Malatji et al. (2016) in South Africa used the 510 bp sequences of cytochrome C oxidase subunit 1(cox 1) gene of the mitochondrial DNA. Fourteen and 12 polymorphic sites were observed for Limpopo and KwaZulu-Natal sequences, respectively and six haplotypes were observed in total. Haplotype diversity was high and ranged from 0.749 for Limpopo province to 0.758 for KwaZulu-Natal province isolates. Our studied samples, CVASU6 showed 97% similarity with the study of Malatji et al. (2016) (Genbank accession no. KT388436.1 and KT388436.1). CVASU1, CVASU11, CVASU16 and CVASU23 showed 99% similarity with KT388436.1. CVASU1 and CVASU11 showed 98% similarity with KT388436.1 whereas CVASU 16 and CVASU23 showed 97%.

Although the PCR technique was successful to identify 24 positive cases during this study, the gene sequencing approach was able to do only five genes (out of these 24 cases). Without considering others, it is hard to understand the actual cause of this dissimilarity among the studied samples. Therefore, this is a weakness of the present study and further sequencing of all positive samples may help to identify genetic diversity among A. galli in Bangladesh.

Chapter 6: Limitations

Low positive case and high price per bird increased the sampling cost and made it difficult to get sufficient number of adult worms to run this experiment properly in due time. Within limited time we were able to conduct only macroscopic post mortem examination. In this study, molecular identification and comparison of Ascaridia galli is done for the first time in Bangladesh. Due to small amount of budget, all identified worms were not subjected to DNA sequencing.

Chapter 7: Conclusion

In our study presence of Ascaridia galli with moderate prevalence (22%) was observed in the chickens which suggest that the environmental condition and the nature of the poultry rearing system are favorable for the transmission and persistence of the parasite species in rural areas of Bangladesh.

The results of this study generated new knowledge on genetic structure of A. galli for the first time in Bangladesh. It can be mentioned that using state of the art molecular diagnostic tools such as ELISA, PCR, Real-time PCR in conjuction with traditional epidemiologic investigation will help to design new strategies for the treatment and control of the most prevailing genotype of A. galli in Bangaldesh. Although this parasite is considered as one of the neglected parasites. This genomic approach will in turn provide hope for the poultry farmers to fight against the devastating helminth infection in their birds. Thus, we can provide better economic returns to them.

Finally, we have found that the molecular technique of PCR approach is highly sensitive but time consuming for confirmatory diagnosis. Again, further sequencing of other polymorphic genes and phylogenetic analysis with available bioinformatics tools can be quite interesting to understand detailed molecular epidemiology of A. galli in Bangladesh.

Chapter 8: References

Ackert, J. E. J. P. (1931). The morphology and life history of the fowl nematode Ascaridia lineata (Schneider). 23(3), 360-379.

Adang, K., Abdu, P., Ajanusi, J., Oniye, S., and Ezealor, A. J. P. J. S. T. (2010). Histopathology of Ascaridia galli infection on the liver, lungs, intestines, heart and kidneys of experimentally infected domestic pigeons (C. l. domestica) in Zaria, Nigeria. 11, 511-515.

Ansarey, F. (2012). Prospects of poultry industry in Bangladesh. Paper presented at the Proceedings of the Seminar and Reception on Animal Husbandry Education and Profession in Bangladesh-A Journey of.

Appleby, M. C., and Hughes, B. O. J. W. s. P. S. J. (1991). Welfare of laying hens in cages and alternative systems: environmental, physical and behavioural aspects. 47(2), 109-128.

Ashour, A. A. J. J. o. t. E. S. o. P. (1994). Scanning electron microscopy of Ascaridia galli (Schrank, 1788), Freeborn, 1923 and A. columbae (Linstow, 1903). 24(2), 349-355.

Ayudhya, C. K. N., and Sangvaranond, A. J. W. K. (1993). Internal parasites of alimentary tracts of adult native chickens in North-Eastern part of Thailand.

Bachaya, H. A., Raza, M. A., Anjum, M. A., Khan, I. A., Aziz, A., Manzoor, Z., and Munawar, S. H. J. T. b. (2015). Prevalence of Ascaridia galli in white leghorn layers and Fayoumi-Rhode Island red crossbred flock at government poultry farm Dina, Punjab, Pakistan. 32(1), 11-16.

Baig, S., Azhar, A., Hassan, H., Baig, J., Kiyani, A., Hameed, U., . . . Din, M. U. J. h. (2006). Spectrum of beta-thalassemia mutations in various regions of Punjab and Islamabad, Pakistan: establishment of prenatal diagnosis. 91(3), ELT02-ELT02.

Barber, P., and Boyce, S. L. J. P. o. t. R. S. B. B. S. (2006). Estimating diversity of Indo-Pacific coral reef stomatopods through DNA barcoding of stomatopod larvae. 273(1597), 2053-2061.

Blaxter, M., Page, A., Rudin, W., and Maizels, R. J. P. T. (1992). Nematode surface coats: actively evading immunity. 8(7), 243-247.

Cerutti, M. C., Vigano, R., Bazzocchi, C., Gaglio, G., and Lanfranchi, P. (2008). Ascaridia compar: morphologic and molecular characterization in alpine galliformes. In Congresso nazionale (Vol. 50, No. 1). Lombardo Editore. da Silva, C. A., and Rankin, M. J. F. I. M. A. (2014). Contract farming for inclusive market access: Synthesis and findings from selected international experiences. 1.

Dahl, C., Permin, A., Christensen, J., Bisgaard, M., Muhairwa, A., Petersen, K. D., . . . Jensen, A. L. J. V. m. (2002). The effect of concurrent infections with Pasteurella multocida and Ascaridia galli on free range chickens. 86(4), 313- 324.

Dänicke, S., Moors, E., Beineke, A., and Gauly, M. J. B. p. s. (2009). Ascaridia galli infection of pullets and intestinal viscosity: consequences for nutrient retention and gut morphology. 50(4), 512-520.

Dick, J. W., Leland Jr, S. E., and Hansen, M. J. T. o. t. A. M. S. (1973). Hatching and in vitro cultivation of the nematode Ascaridia galli to the third-stage larvA. 225-230.

Fanatico, A., Pillai, P., Cavitt, L., Emmert, J., Meullenet, J., and Owens, C. J. P. s. (2006). Evaluation of slower-growing broiler genotypes grown with and without outdoor access: Sensory attributes. 85(2), 337-343.

Ferdushy, T., Hasan, M. T., and Kadir, A. G. J. J. o. P. D. (2016). Cross sectional epidemiological investigation on the prevalence of gastrointestinal helminths in free range chickens in Narsingdi district, Bangladesh. 40(3), 818-822.

Fetterer, R., and Rhoads, M. J. V. p. (1993). Biochemistry of the nematode cuticle: relevance to parasitic nematodes of livestock. 46(1-4), 103-111.

Food, and Ser, A. O. J. W. H. O. T. R. (2004). Human energy requirements. Report of a Joint FAO/WHO/UNU Expert Consultation. 1, 35-50.

Freeborn, S. B. J. S. (1923). Nicotine as a poultry vermifuge. 57(1485), 692-693.

Gauly, M., Duss, C., and Erhardt, G. J. V. p. (2007). Influence of Ascaridia galli infections and anthelmintic treatments on the behaviour and social ranks of laying hens (Gallus gallus domesticus). 146(3-4), 271-280.

Gordon, S. H., and Charles, D. R. (2002). Niche and Organic Chicken Products: their technology and scientific principles: Nottingham University Press.

Hajibabaei, M., Janzen, D. H., Burns, J. M., Hallwachs, W., and Hebert, P. D. J. P. o. t. N. A. o. S. (2006). DNA barcodes distinguish species of tropical Lepidoptera. 103(4), 968-971.

Hansen, M., Terhaar, C., and Turner, D. J. T. J. o. p. (1956). Importance of the egg shell of Ascaridia galli to the infectivity of its larva. 42(2), 122-125.

Hao, G. and He, X (2017). Genetic Variation in Mitochondrial cox1 and nad4 Genes of Ascaridia galli Collected from Xichang City, China .

Hassanen, M., Rahman, E. A., and Khalil, A. (2009). New Scanning Electron Microscopy Look of Ascaridia galli (Schrank, 17SS) Adult Worm and its Biological Control.

Hebert, P. D., Cywinska, A., Ball, S. L., and Dewaard, J. R. J. P. o. t. R. S. o. L. S. B. B. S. (2003). Biological identifications through DNA barcodes. 270(1512), 313-321.

Hebert, P. D., Stoeckle, M. Y., Zemlak, T. S., and Francis, C. M. J. P. b. (2004). Identification of birds through DNA barcodes. 2(10), e312.

Herd, R., and McNaught, D. J. I. j. f. p. (1975). Arrested development and the histotropic phase of Ascaridia galli in the chicken. 5(4), 401-406.

Höglund, J., and Jansson, D. S. J. V. p. (2011). Infection dynamics of Ascaridia galli in non-caged laying hens. 180(3-4), 267-273.

Ikeme, M. J. P. (1971a). Observations on the pathogenicity and pathology of Ascaridia galli. 63(2), 169-179.

Ikeme, M. J. P. (1971b). Weight changes in chickens placed on different levels of nutrition and varying degrees of repeated dosage with Ascaridia galli eggs. 63(2), 251-260.

Ivanova, N. V., Zemlak, T. S., Hanner, R. H., and Hebert, P. D. J. M. E. N. (2007). Universal primer cocktails for fish DNA barcoding. 7(4), 544-548.

Jansson, D. S., Nyman, A., Vågsholm, I., Christensson, D., Göransson, M., Fossum, O., and Höglund, J. J. A. P. (2010). Ascarid infections in laying hens kept in different housing systems. 39(6), 525-532.

Katakam, K. K., Nejsum, P., Kyvsgaard, N. C., Jørgensen, C. B., and Thamsborg, S. M. J. A. p. (2010). Molecular and parasitological tools for the study of Ascaridia galli population dynamics in chickens. 39(2), 81-85.

Khalaf, F., Al-Ghadban, A., Al-Saleh, S., and Al-Omran, L. J. M. G. (1982). Sedimentology and mineralogy of Kuwait bay bottom sediments, Kuwait— Arabian Gulf. 46(1-2), 71-99.

Malatji, D. P., Tsotetsi, A. M., van Marle-Koster, E., and Muchadeyi, F. C. (2016). Population genetic structure of Ascaridia galli of extensively raised chickens of South Africa. Veterinary parasitology, 216, 89-92.

Malatji1, 2, D., van Marle-Köster, E., and Muchadeyi, F. J. S. c. (2017). Transcriptome analysis of the small intestine of village chickens from Ascaridia galli infected environment.

Marshall, E. (2005). Will DNA bar codes breathe life into classification? In: American Association for the Advancement of Science.

Merget, B., Koetschan, C., Hackl, T., Forster, F., Dandekar, T., Muller, T., Schultz, J., Wolf, M. (2012). The ITS2 Database. J Vis Exp. 61:pii: 3806.

Morgenstern, R., and Lobsiger, C. (1993). Health of laying hens in alternative systems in practice. Paper presented at the Proceedings of the 4th Europeen Symposium on Poultry Welfare. Edinburgh.

Nyman, A., Vågsholm, I., Christensson, D., Göransson, M., Fossum, O., and Höglund, J. (2010). Ascarid infections in laying hens kept in different

housing systems AU - Jansson, Désirée S. Avian Pathology, 39(6), 525-532. doi:10.1080/03079457.2010.527923

Olsson, I. A. S., Duncan, I. J., Keeling, L. J., and Widowski, T. M. J. A. A. B. S. (2002). How important is social facilitation for dustbathing in laying hens? , 79(4), 285-297.

Pankavich, J. A., Emro, J. E., Poeschel, G. P., and Richard, G. A. J. T. J. o. p. (1974). Observations on the life history of Ascaridia dissimilis (Perez Vigueras, 1931) and its relationship to Ascaridia galli (Schrank, 1788). 963-971.

Permin, A., Bisgaard, M., Frandsen, F., Pearman, M., Kold, J., and Nansen, P. J. B. p. s. (1999). Prevalence of gastrointestinal helminths in different poultry production systems. 40(4), 439-443.

Permin, A., Christensen, J. P., and Bisgaard, M. J. A. V. S. (2006). Consequences of concurrent Ascaridia galli and Escherichia coli infections in chickens. 47(1), 43.

Permin, A., Esmann, J., Hoj, C., Hove, T., and Mukaratirwa, S. J. P. V. M. (2002). Ecto-, endo-and haemoparasites in free-range chickens in the Goromonzi District in Zimbabwe. 54(3), 213-224.

Permin, A., and Hansen, J. (1998). The¤ epidemiology, diagnosis and control of parasites in poultry.

Permin, A., Magwisha, H., Kassuku, A., Nansen, P., Bisgaard, M., Frandsen, F., and Gibbons, L. J. J. o. H. (1997). A cross-sectional study of helminths in rural scavenging poultry in Tanzania in relation to season and climate. 71(3), 233- 240.

Prabakaran, R. (2003). Good practices in planning and management of integrated commercial poultry production in South Asia: Food and Agriculture Org.

Rabbi, A., Islam, A., Majumder, S., Anisuzzaman, A., and Rahman, M. J. B. J. o. V. M. (2006). Gastrointestinal helminths infection in different types of poultry. 4(1), 13-18.

Raihan, S., and Mahmud, N. J. A. A. w. c.-c. o. p. T.-B. (2008). Trade and poverty linkages: A case study of the poultry industry in Bangladesh. 1.

Ramadan, H. H., and Abouznada, N. Y. J. S. (1992). Morphology and life history of Ascaridia galli in the domestic fowl that are raised in Jeddah. 4(1).

Reid, W. M. J. T. J. o. P. (1960). Effects of temperature on the development of the eggs of Ascaridia galli. 46(1), 63-67.

Ruff, M. D. J. V. p. (1999). Important parasites in poultry production systems. 84(3- 4), 337-347.

Saha, P., Saleque, M., Panaullah, G., and Bhuiyan, N. J. B. J. o. A. (2000). Fertilizer Management for Rice Based Cropping Systems Productivity. 25(4), 555- 560.

Savolainen, V., Cowan, R. S., Vogler, A. P., Roderick, G. K., and Lane, R. J. P. T. o. t. R. S. B. B. S. (2005). Towards writing the encyclopaedia of life: an introduction to DNA barcoding. 360(1462), 1805-1811.

Schrank, F. v. P. (1788). Verzeichniss der bisher hinlänglich bekannted Eingeweidewürmer.

Shimmura, T., Hirahara, S., Azuma, T., Suzuki, T., Eguchi, Y., Uetake, K., and Tanaka, T. J. B. p. s. (2010). Multi-factorial investigation of various housing systems for laying hens. 51(1), 31-42.

Sneath, P. H., and Sokal, R. R. (1973). Numerical taxonomy. The principles and practice of numerical classification.

Soulsby, E. J. T. E. L. B. S., and Ballière Tindall, L. (1982). Helminths, arthropods and protozoa of domesticated animals. 1982. 809, 521-531.

Tamura, K., Nei, M., and Kumar, S. J. P. o. t. N. A. o. S. (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. 101(30), 11030-11035.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. J. M. b., and evolution. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. 30(12), 2725-2729.

Urbanowicz, J., Gaweł, A., & Bobrek, K. (2018). Ascaridia galli isolates with ITS1- 5.8 rRNA-ITS2 fragment homologous to Ascaridia columbae. Acta parasitologica, 63(3), 640-644.

Wakelin, D. J. J. o. h. (1964). A survey of the intestinal helminths parasitic in British domestic fowl. 38(1-2), 191-200.

Wang, H., Naghavi, M., Allen, C., Barber, R. M., Bhutta, Z. A., Carter, A., . . . Coates, M. M. J. T. l. (2016). Global, regional, and national life expectancy, all-cause mortality, and cause-specific mortality for 249 causes of death, 1980–2015: a systematic analysis for the Global Burden of Disease Study 2015. 388(10053), 1459-1544.

Ward, R. D., Holmes, B. H., White, W. T., Last, P. R. J. M., and Research, F. (2008). DNA barcoding Australasian chondrichthyans: results and potential uses in conservation. 59(1), 57-71.

Webster, B. L., Emery, A. M., Webster, J. P., Gouvras, A., Garba, A., Diaw, O., ... and Lange, C. (2012). Genetic diversity within Schistosoma haematobium: DNA barcoding reveals two distinct groups. PLoS neglected tropical diseases, 6(10), e1882.

Wongrak, K., Das, G., Moors, E., Sohnrey, B., and Gauly, M. J. B. M. T. W. (2014). Establishment of gastro-intestinal helminth infections in free-range chickens: a longitudinal on farm study. 127, 314-321.

Zeller, B. J. C. s. o. t. e. o. d. f. i. c., and flocks., f. b. (1990). Comparative studies on the endoparasites of domestic fowls (Gallus gallus var. domesticus L.) in commercial and fancy breed flocks.

Appendix

Appendix-I

KT613902.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613900.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613892.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613894.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613893.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613888.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KT613889.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

KP982856.1 Ascaridia_galli/_cox1_gene China Hao et al. (2017)

GU138669.1 Ascaridia_galli/_cox1_gene Denmark Katakam et al. (2010)

GU138668.1 Ascaridia_galli/_cox1_gene Denmark Katakam et al. (2010)

KT388436.1 Ascaridia_galli/_cox1_gene South Africa Malatji et al. (2016)

KT388439.1 Ascaridia_galli/_cox1_gene South Africa Malatji et al. (2016)

FM178545.1 Ascaridia_galli/_cox1_gene Italy Cerutti et al. (2008)

Table 3: List of accession number of previous studies

Appendix-II : DNA sequence of our study sample

>CVASU1/Himel/Ascaridia_galli/_cox1_gene/Bangladesh

TTACCTTTGCTGTTAGGTGCTCCGGATATAAGGTTTCCGCGTTTGAATAATTTGAGTTTTT GGTTATTACCTACTGCTATAATTTTGATTTTGGGTTCTACTTTGGTTGATAGTGGCTGTGG TACTAGTTGGACTGTTTATCCTCCTTTGAGAACTAGTGGACATCCTGGTAGGAGAGTGG ATTTGGCTATTTTTAGTCTTCATTGTGCTGGTATTAGTTCTATTTTGGGTGGTATTAATTTT ATGACTACTACTAAGAATCTACG

>CVASU6/Himel/Ascaridia_galli/_cox1_gene/Bangladesh

TTACCTTTGTTGTTGGGTGCTCCGGATATAAGGTTTCCGCGTTTGAATAATTTGAGTTTTT GGTTATTGCCTACTGCTATAATTTTGATTTTGGGTTCTACTTTGGTTGATAGTGGTTGTGG TACTAGTTGGACTGTTTATCCTCCTTTGAGAACTAGTGGACATCCTGGTAGGAGTGTGGA TTTGGCTATTTTTAGTCTTCATTGTGCTGGTATTAGTTCTATTTTGGGAGGTATTAATTTTA TGACTACTACTAAGAATCTACG

>CVASU11/Himel/Ascaridia_galli/_cox1_gene/Bangladesh

>CVASU16/Himel/Ascaridia_galli/_cox1_gene/Bangladesh

TTACCTTTGTTGTTAGGTGCTCCGGATATAAGGTTTCCGCGTTTGAATAATTTGAGTTTTT GGTTATTACCTACTGCTATGATTTTGATTTTGGGTTCTACTTTGGTTGATAGTGGCTGTGG TACTAGTTGGACTGTTTATCCTCCTTTGAGAACTAGTGGGCATCCTGGTAGGAGAGTGG ATTTGGCTATTTTTAGTCTTCATTGTGCTGGTATTAGTTCTATTTTAGGTGGTATTAATTTT ATGACTACTACTAAGAATCTACG

>CVASU23/Himel/Ascaridia_galli/_cox1_gene/Bangladesh

Brief biography of the author

Sudipta Nag Himel passed the Secondary School Certificate Examination from Bindubasini Goverment High School, Tangail in 2008 with GPA 5.00 followed by Higher Secondary Certificate Examination from Major General Mahamudul Hasan Ideal College, Tangail in 2010 with GPA 5.00. He completed his graduation degree on Doctor of Veterinary Medicine (DVM) from Chittagong Veterinary and Animal Sciences University (CVASU), Bangladesh. As an intern student he received clinical training from Madras Veterinary College and Veterinary College and Research Institute, Namakkal, Tamilnadu, India. Now, he is a Candidate for the degree of MS in Pathology, Dept. of Pathology and Parasitology, Faculty of Veterinary Medicine, CVASU.