Abstract Characterization of the Mlr19 Transgenic

ABSTRACT

CHARACTERIZATION OF THE MLR19 TRANSGENIC MOUSE LINE AND THE ROLE OF MYOCARDIN IN THE BLADDER

By Kevin David Wright

Obstructive uropathy is the leading cause of the end-stage renal failure in children, yet there remain few genetic animal models to study this disorder. The MLR19 megabladder mice are a transgene-induced insertional mutant mouse line that fails to develop the smooth muscle surrounding the urinary bladder, creating an obstructive uropathy. The aim of this project is to further characterize the MLR19 mutants to determine what gene is being affected to cause the phenotype. Complementation studies suggest that myocardin is the relevant gene in the MLR19 megabladder phenotype, even though the transgene insertion is 335kb upstream from myocardin. Morphometric analysis of MLR19 heterozygotes and myocardin heterozygotes suggests that even mild reductions in myocardin have a significant effect on thickness of the bladder smooth muscle. Together, these data support the conclusion that myocardin is a critical gene involved in the development of the urinary bladder smooth muscle.

CHARACTERIZATION OF THE MLR19 TRANSGENIC MOUSE LINE AND THE ROLE OF MYOCARDIN IN THE BLADDER

A Thesis

Submitted to the Faculty of Miami University In partial fulfillment of The requirements for the degree of Master of Science Department of Zoology by

Kevin David Wright Miami University Oxford, Ohio 2009

Advisor ______Dr. Michael L. Robinson

Reader ______Dr. Joyce Fernandes

Reader ______Dr. Paul Schaeffer

Reader ______Dr. Yoshinori Tomoyasu TABLE OF CONTENTS

TITLE PAGE i TABLE OF CONTENTS ii LIST OF FIGURES AND TABLES iii ACKNOWLEDGEMENTS iiii CHAPTERS 1. Introduction 1 2. Targeted knock-out Construct for 24kb region on chromosome 11 14 2.1. Introduction 14 2.2. Materials and Methods 15 2.3. Results and Discussion 18 3. Complementation study to determine myocardin’s role in MLR19 phenotype 32 3.1. Introduction 32 3.2. Materials and Methods 32 3.3. Results and Discussion 34 4. Morphometric analysis of urinary bladder smooth muscle 43 4.1. Introduction 43 4.2. Materials and Methods 43 4.3. Results and Discussion 44 6. Conclusions 50 APPENDIX 53 REFERENCES 55

LIST OF TABLES

Tables page 2.1 Primers to amplify the 5’ and 3’ homology arm for knockout construct 22 3.1 Primers used to genotype the MLR19 and Myocardin mutants 37 3.2 Ureter lumen area of MLR19-/myocd- and wild type animals 38 4.1 Mean thickness of the bladder smooth muscle in WT, MLR19+/-, and Myocd+/- 47

iii LIST OF FIGURES

Figures page 1.1 Urinary bladder development 11 1.2 WT and MLR19-/- bladders and map of MLR19 mutation 12 1.3 Map of myocardin cardiac and smooth muscle isoforms 13 2.1 Diagram showing location of the homology arm primers 23 2.2 Maps of plasmids PL451 and PL253 24 2.3 Restriction digests showing successful ligation of 5’ homology arm into pl451 25 2.4 Restriction digests showing successful ligation of 3’ homology arm into pl451+5’ arm 26 2.5 Restriction digests showing successful ligation of TK gene into pl451+homology arms 27 2.6 Sequences of ligation junctions in the completed knockout construct 29 2.7 Diagram summarizing Southern blot strategy for screening ES cells 31 3.1 Diagram of MLR19-/myocd- breeding plan with chromosome 11 39 3.2 PCR and gross histology of MLR19-/myocd- compound heterozygotes 40 3.3 Hemotoxylin and Eosin staining of MLR19-/Myocd- compound heterozygotes 41 3.4 Immuhistochemistry of smooth muscle actin in newborn urinary bladders 42 4.1 Comparison of wild type, MLR19+/-, Myocd+/- bladder smooth muscle thickness 48 4.2 Comparison in lumen area between wild type, MLR19+/-, and Myocd+/- animals 49 Appendix A. Myocardin western blot analysis 56

iv ACKNOWLEDGEMENTS

I thank Dr. Michael Robinson for his guidance, patience and support throughout my work in his lab.

I thank Dr. Joyce Fernandes, Dr. Paul Schaeffer, and Dr. Yoshinori Tomoyasu for sitting on my committee as well as for their valuable input on the project.

I thank Brad Wagner for all his help in the lab, without him our lab would not function as well as it does. I would also like to thank other members of the Robinson lab for their companionship and insight into the project. Thanks for making the lab a great place to work.

I thank Kristen Lucia and Dr. Robert Schaefer for their help running the statistics, and Dr. John Hawes for his help and insight with the protein analysis aspect of the project.

I would like to thank everyone in the Department of Zoology, for creating a great work environment and providing assistance when needed.

I would especially like to thank my parents, family and friends, without them I would not be the person I am today. Your constant support and love are truly appreciated.

CHAPTER 1. Introduction Obstructive uropathy Obstructive uropathy (OU) is any urinary tract abnormality caused by an obstruction at any level of the urinary tract (Roth et al. 2002, Becker and Baum 2006). There are many different disorders that cause obstructions, including: kidney stones, ureterocele, urethral valve blockages, and prune belly syndrome. If left untreated, these disorders often result in mild to severe kidney damage from hydronephrosis. Hydronephrosis is a condition caused by the buildup of hydrostatic pressure proximal to the obstruction. The urinary back pressure causes dilation of the ureters and ultimately dilation of the kidneys (hydronephrosis) (Peters 1995, Roth et al. 2002). In many of the severe conditions, the urinary tract is obstructed for long periods of time causing irreversible damage to the kidneys leading to end-stage renal disease (ESRD) a condition where the kidneys are unable to maintain organismal homeostasis. This leads many patients with ESRD to a lifelong dependency on dialysis or the need for renal transplant. The most severe cases can even lead to death. In children needing renal transplants, obstructive uropathies are the leading cause accounting for approximately 22% of children with renal insufficiency and leading to 1,538 transplants from 1987 to 2008 in North America alone (Benfield et al. 2003, Warady and Chadha 2006, Morris and Kilby 2008). For children with urinary tract obstructions, without intervention, surgical or otherwise, the condition can be lethal shortly after birth. Congenital uropathies are often due to structural deformities that lead to blockage during the development of the urinary system in the fetus. While the blockage can be surgically removed and normal urinary system function restored many children still develop ESRD. Because of this, there remains a need to understand what is happening to the renal and urinary systems at the cellular and biochemical level during and post obstruction to better understand kidney function and the potential long term implications of the blockage. Even at the state-of-the-art strategic planning workshop hosted by the American Society of Pediatric Nephrology and NIH, this need was listed as the first major aim for future research goals (Chevalier and Peters 2003).

Animal Models to Study the Cause and Pathology of Obstructive Uropathies

To date there are few spontaneous animal models where obstructive uropathies, that occur during renal development, can be studied (Peters 1997, Peters 2001, Bascands and

1 Shanstra 2005). One such model is the Congenital progressive hydronephrosis (cph) mouse strain that develops a progressive hydronephrosis (Horton et al. 1988) from overproduction of urine. However, the cph mice do not have an obstruction prior to the urine accumulation; it is the inability to void the large amounts of urine that produces the obstruction (McDill et al. 2006). Since, many of the cases of OU in children are not due to overproduction of urine, but by obstruction, the cph mice are an insufficient model to study the progression to ESRD due to obstruction. As an alternative to spontaneous (genetic) models of obstructive uropathy, researchers have created surgical models in which different portions of the urinary tract are artificially ligated to form an obstruction. This method has been performed in a wide array of animal models including sheep, pig, canine, and opossum (reviewed in Peters 2001). This method of creating urinary obstructions has several advantages, such as having the option to choose which level of the urinary tract to obstruct and the predictability in which the specimens develop pathological symptoms. Yet, with these advantages, there are also drawbacks - the surgeries are extremely invasive and some models, such as rabbits, are sensitive to the anesthesia and have a high mortality rate with surgery (Peters 2001). Also, larger animals that are more amendable to surgical obstruction are often extremely costly to keep and maintain. Sheep have been the favored animal model for induced obstructive uropathies for many years, as the size of the sheep, both adult and fetal, are convenient for surgery. This model has provided great insight into the effects of obstruction on the kidneys (reviewed in Peters 1997). However, one of the drawbacks of this model is that females only have one or two offspring each pregnancy, after a relatively lengthy gestation period, making sheep an inconvenient model for large scale studies using multiple fetal specimens. Disadvantages like this, and the time cost of performing the surgeries have led to a desire for genetic models of functional obstructive uropathies in smaller animal models such as mice. One of the other main advantages of using mice as a model system includes the wealth of genetic information and the ease of manipulating the mouse genome to create mutants that will help give a better understanding the genes/molecules required for normal urinary system function. Currently, there are very few genetic mouse models where the animals develop obstructive uropathies without having severe developmental defects that affect multiple organ systems. Loss of sonic hedgehog (shh) and its downstream signals Gli1, 2, and 3 (genes critical for normal development-Weed et al. 1997) in the cloaca and surrounding tissues during

2 development lead to the failure of smooth muscle to develop in the urinary bladder, as well, there are severe malformations of the urethra, and external genitalia (Haraguchi et al. 2006). These malformations would cause a functional form of obstruction, preventing the regular flow of urine out of the body. Another model for hydronephrosis is the angiotensin receptor type 2 (Agtr2) knockout mouse strain. Agtr2 is an integral membrane protein that has been implicated in development of many organ systems, and has many different functions (Carey 2005). The Agtr2 knockouts develop obstructive uropathy and hydronephrosis due to a complex trait that is dependent on the genetic background (Nishimura et al. 1999). It is also interesting to note that while these mutants develop hydronephrosis, there is no evidence to indicate that there is a hydrostatic obstruction causing the hydronephrosis phenotype. It is possible that the renal impairments are the primary disorder and the hydrostatic obstruction is secondary. This possibility makes using this model to understand how obstructions affect kidney development insufficient. Other models are similar to the shh and Agtr2 mutants, such as knockouts of BMP4 (Miyazaki et al. 2000), ret-k, and GDNF (Schuchardt et al. 1996, Pichel et al. 1996, Moore et al. 1996). These mice all develop phenotypes with defects in the kidneys similar to what is seen following obstruction, however, there is no hydrostatic obstruction. There are few genetic models in which an obstruction of the urinary system causes the hydronephrosis. One such model is the MLR19 megabladder transgenic mouse line created by a transgene-induced insertional mutation. Homozygous MLR19 (MLR19 -/-) trangenic mice fail to develop normal smooth muscle in the urinary bladder creating a functional obstruction that leads to secondary hydroureteronephrosis and death (Singh et al. 2007). The mechanism in which the bladder fails to develop smooth muscle remains unknown and is the major focus of this body of work.

Urinary bladder development The urinary bladder collects urine produced by the kidneys via the ureters and as the holding capacity of the bladder is reached, urine is expelled from the bladder, and ultimately out of the body, through the urethra. The urinary bladder composed of four layers: the outermost serosal layer (tunica serosa, which lines the body wall cavity and organs in the body) the detrusor smooth muscle (outer layer), the lamina propria (connective tissue, middle layer), and the innermost urothelium layer. While the bladder is filling the smooth muscle cells relax allowing the bladder to expand and fill with urine. When the bladder is full, the parasympathetic nervous

3 system sends afferent signals to the brain causing a cascade of events including contraction of the smooth muscle cells in the bladder decreasing the size of the bladder as well as opening of sphincter muscles all of which expel urine out of the body. Therefore, the smooth muscle cells in the bladder are a critical component of proper bladder function and loss of this tissue has lethal consequences for the mice. The MLR19-/- fail to develop this layer, which is histologically evident as early as embryonic day 15, the day after the muscle differentiates. During development, the bladder originates from the superior region of the urogenital sinus and allantois following partitioning of the cloaca by the urorectal septum (Fig. 1.2). This begins around embryonic day 10-12 (E10-12) (Baskin et al. 1996 and Staack et al. 2003). While the superior region of the urogenital sinus develops into the bladder, the intermediate and lower portions develop into the urethra and vagina (in females). The bladder originates from endodermally derived epithelial cells (later called the urothelium) and lateral plate mesoderm derived mesenchyme, termed peri-cloacal mesenchyme (indicated in red in Fig. 1.1). From E10- E13 the peri-cloacal mesenchyme proliferates and migrates ultimately giving rise to the genital tubercle and the urinary bladder (Haraguchi et al. 2007). In the presumptive bladder, just prior to differentiation, the mesenchymal cells on the periphery compact and start to express genes involved in differentiation such as serum response factor (SRF) and transforming growth factor β (TGFβ) (Li et al. 2006). At E14 the cells differentiate into smooth muscle while the mesenchyme adjacent to the urothelium eventually differentiates to connective tissue called the lamina propria (McHugh 1995). One of the first genes expressed that indicates that the mesenchymal cells are differentiated into smooth muscle is smooth muscle alpha actin. The bladder is unique from all other smooth muscle tissues in the manner in which the smooth muscle differentiates (McHugh 1995). In the gastrointestinal tract, a single layer of mesenchymal cells near the periphery differentiate, followed by a second layer of cells between the existing smooth muscle and the serosa layer. In the vasculature and the respiratory system the smooth muscle differentiates in a single layer just next to the epithelium. In the presumptive bladder, the condensed mesenchyme along the periphery differentiates “en masse” in multiple cell layers to smooth muscle. This suggests that there may be differential regulation and signaling in the bladder that leads to the differentiation of multiple layers of cells. The signaling involved in the differentiation process in the bladder is highly complex and involves many different factors and receptors signaling not only in the mesenchymal cells, but

4 also from the urothelium to the mesenchyme (Baskin et al. 1996a, Baskin et al. 1996b, Baskin et al. 1997, Liu et al. 2000, Baskin et al. 2001, Li et al. 2006). Some of the signals that have been shown to be involved in the epithelial-mesenchymal signaling in both rat and mouse bladders are TGFβ 2 and 3 (Baskin et al. 1997, Barendrecht et al. 2007). TGFβ 2 and 3 are signaling proteins that have been shown to be involved in many processes and are critical for proper development (Clark and Coker 1998). Studies have shown that bladder mesenchymal cultures and explants require signals from the epithelial cells in order for the mesenchymal cells to differentiate into smooth muscle cells. Undifferentiated mesenchymal cells when transplanted between the lamina propria and the smooth muscle cell layer of adult hosts are able to differentiate into smooth muscle as well, indicating that the complex signaling needed for differentiation is present at all times, perhaps as a mechanism for damage repair and maintenance of the smooth muscle cells. (Baskin et al. 2001). Sonic hedgehog (Shh) and its downstream signaling component Gli, as well as Bone morphogenetic protein 4 (BMP4) are also critical in proper bladder and smooth muscle development (Winnier et al. 1995, Haraguchi et al. 2007, Shiroyanagi et al. 2007). Li and colleagues (2006) performed microarray analysis on intact developing bladders as well as isolated urothelium and mesenchyme/smooth muscle cells independently and identified genes that were up and down regulated during bladder development in each tissue. They found that TGFβ, as well as many other factors includigng Fibroblast growth factor receptor 1 (FGFR1), BMP1, Wingless-type MMTV integration site family, member 2 (WNT-2) were upregulated in the mesenchymal cells. The role of these genes in the bladder is not completely understood. As expected, one of the genes, SRF, required for transcription of most of the smooth muscle genes is also upregulated in the mesenchyme/smooth muscle.

SRF is a ubiquitously expressed factor that binds to CArG box elements [CC(A/T)6GG] within the promoter regions of genes (Miano et al. 2003). However, SRF needs other cofactors, like myocardin, for its strong and specific transactivation ability. The large upregulation in SRF expression in the bladder mesenchymal cells (Li et al. 2006) suggests that the SRF/myocardin pathway is critical for bladder smooth muscle development as it is in vascular smooth muscle development (Wang et al. 2002, Li et al. 2003, Miano 2003, McDonald et al. 2006). Interestingly, the binding partner for SRF in that pathway, Myocardin (Myocd), was not seen to

5 be upregulated in the Li et al. (2006) study, even though myocd mRNA is known to be highly expressed in the bladder (Wang et al. 2002, Du et al. 2003).

MLR19 megabladder transgenic line MLR19 transgenic mice were created by transgensis of DNA coding the bovine sodium myoinositol co-transporter (Slc5a3) gene under the regulatory control of a chimeric promoter consisting of elements from both the αA and αB-crystallin promoters (Singh et al. 2007). The original goal of these transgenic mice was to force expression of the Slc5a3 gene in the ocular lens. Transgene expression is low in the lenses of the transgenic mice, but mice homozygous for the transgene (MLR19-/-) also fail to develop smooth muscle surrounding the urinary bladder (Fig. 1.2), whereas heterozygous (MLR19+/-) mice appear phenotypically normal. Without the smooth muscle, the bladder of homozygous mice cannot contract, preventing the animals from completely emptying their urinary bladders. This presents as a functional form of obstructive uropathy that leads to hydrouteronephrosis and ultimately death by renal failure (Singh et al. 2007). In the homozygous MLR19 megabladder mice, the urinary bladder appears to be the only tissue to be affected; smooth muscle in the ureters, colon, and vasculature develop normally (Singh et al. 2007). It is interesting to note that males tend to be more severely affected than the females and often die before they are three weeks old. The females can live longer and can even give birth to multiple litters of pups before they ultimately succumb to renal failure. It is possible that females have a longer lifespan because their urethra is much shorter than that of males and therefore can trickle more urine out of the bladder than the males, prolonging the time it takes to develop renal disorders. As with most transgenic mice generated by microinjection, the Slc5q3 transgene integrated randomly into the genome of the founder. To assess where the transgene inserted and to characterize the genetic event that gives the megabladder phenotype a bacterial artificial chromosome (BAC) library was made from MLR19 transgenic mice. With a BAC clone positive for the transgene as a probe, fluorescent in-situ hybridization (FISH) and karyotype analysis were performed on nuclei of wild type, MLR19+/- and MLR19-/- mice to determine where the transgene inserted into the MLR19 mutant genome. Singh and colleagues (2007) found that not only did the transgene insert into chromosome 16, but a fragment of chromosome 16 had

6 duplicated and translocated to chromosome 11. MLR19+/- mice have three copies of the duplicated fragment of chromosome 16, and MLR19-/- megabladder mice have four copies (Singh et al. 2007). It is important to note that the transgene is only located on the translocated fragment of chromosome 16 that is located on chromosome 11, and not on the actual chromosome 16. Comparative Genomic Hybridization (CGH) fine tiling array analysis was also performed on MLR19-/- mice to map out exactly how much of chromosome 16 translocated to chromosome 11 (Singh et al. 2008). Approximately one megabase (1Mb) of chromosome 16 was significantly over-represented, indicating that this is the region that duplicated and translocated to chromosome 11. Also, FISH analysis of BAC clones separated by approximately 1 Mb from chromosome 16 was used to map the tranlocated region on chromosome 11. The 1Mb of chromosome 16 that is translocated to chromosome 11 includes four genes: osteocrin (Ostn), urotensin II-related peptide (Urp), coiled-coil domain containing 50 (Ccdc50), and DNA segment, chromosome 16, Brigham & Women’s Genetics 1543 expressed sequence (Bwg1543). The CGH analysis indicated that there was also a 24kb fragment of chromosome 11 (from 65,421,462 to 65,446,140) that was significantly under-represented compared to the wild type, indicating that this region was deleted in the MLR19-/- animals. This deleted region is located 335.3 kb upstream of the myocardin gene and 58.3 kb downstream of the Map2k4 gene. A PCR strategy was designed to confirm the deletion, using primers located within the deleted region. For animals that are wild type or MLR19+/- a PCR product was generated, while MLR19-/- did not produce a PCR product (unpublished data). This strategy also allows for differentiating the MLR19+/- from the MLR19-/- animals using PCR-based genotyping instead of the more complicated FISH analysis. A map of the mutant chromosome 11 is shown in Fig. 1.2, with distances from nearby genes as well as direction of transcription of those genes. The complicated translocation/deletion somehow causes a lack of smooth muscle development only in the bladder. There are several possibilities as to how this translocation/deletion can cause a phenotype. While the 24kb deleted region does not contain any known genes, a critical element, such as a distal enhancer needed for a nearby gene, could have been deleted. This possibility will be addressed in chapter 2 of this thesis. Another possibility is that the insertion of the 1Mb in place of the 24kb has moved and separates a distal element even further from the target to the point where the element cannot “reach.” The chromatin structure of the mutant chromosome may also be altered by the 1Mb insertion so that

7 the gene or element responsible for the bladder smooth muscle is no longer accessible for transcription. Another possible cause of the phenotype is overexpression of the duplicated genes from chromosome 16. One gene of the four chromosome 16 genes duplicated on chromosome 11 is preferentially overexpressed in the bladder, and that gene is urotensin II related peptide (Urp) (Singh et al. 2008). Urp is a cyclic neuropeptide that acts as a vasoconstrictor and is the ligand for urotensin II receptor (UIIr), also known as orphan receptor GPR14 (Ames et al. 1999 and Sugo et al. 2003). UIIr is present in bladder smooth muscle cells (Liu et al. 1999) and the increase in its ligand, as seen in the MLR19-/- bladders, may allow for aberrant interactions between the two, preventing the differentiation of the mesenchymal cells to smooth muscle cells. Cell culture work has shown that, when overexpressed, Urp causes the maintenance of high levels of SRF (a critical activator for smooth muscle development) during and after differentiation as well as alterations in smooth muscle cell proliferation and differentiation (Singh et al. 2008). This observation makes Urp a potential candidate as to the cause of the MLR19 megabladder phenotype. However, one indication comes from the T30H mice created in the 1960s that it is the alterations in chromosome 11 that are causing the MLR19 megabladder phenotype (Searle et al. 1979, Cattanach and Kirk 1985). These mice contain a reciprocal translocation of chromosome 2 and 11. Mice homozygous for this translocation exhibit a megabladder phenotype (unpublished data), and like the MLR19-/- mice, do not develop smooth muscle surrounding the urinary bladder. The translocation site has been roughly mapped to the same region as the translocation/deletion site in the MLR19 mutation in chromosome 11 (unpublished data). This is strong evidence to suggest that the candidate gene being affected in the MLR19 insertional mutants is on chromosome 11, and not due to duplication of chromosome 16. The most likely candidate of chromosome 11 is myocardin, which, as mentioned previously, is within close proximity to the site of insertion/deletion in the MLR19 mutation and is at the top of the critical SRF/Myocardin pathway for smooth muscle development. It was this pathway that was seen to be affected in the MLR19 mice (Singh et al. 2008). Myocardin is a critical coactivator required for smooth muscle and cardiac smooth muscle development (Wang et al. 2001, Du et al. 2003, Li et al. 2003, Ueyama et al. 2003, Yoshida et al. 2003, Long et al. 2008). It is the founding member of a family of transcription

8 factors that must bind SRF for its transactivation properties (reviewed in Pipes et al. 2006). There are two published isoforms of Myocardin (Fig. 1.3), the cardiac specific and smooth muscle specific forms (Creemers et al. 2006a). The smooth muscle isoform arises from the splicing in of an alternative exon, 2a. This alternative exon introduces a premature stop codon terminating translation that started in exon 1 (where the cardiac isoform starts translation) of the mRNA, and promoting translation from an ATG in exon 4, thus giving rise to a slightly truncated protein containing the majority of the protein. A knockout of myocardin in which the SAP domain that binds to SRF is deleted is embryonic lethal by E9.5-10.5 from cardiac and vascular smooth muscle insufficiency (Li et al. 2003). Much work has been done characterizing Myocardin function and regulation in cardiac tissue and vascular smooth muscle cells (e.g., Wang et al. 2001, Li et al. 2003, Huang et al. 2008). A 10kb cardiac specific promoter was identified as well as several transcription factors that bind that promoter (Creemers et al. 2006), it was also seen that Nkx2.5 regulates myocardin transcription in cardiac cells (Ueyama et al. 2003). Myocardin has been examined extensively in both cell culture (Milyavsky et al. 2007, Shats et al. 2007) as well as smooth muscle cancer cell lines (Long et al. 2007, Tang et al. 2008) looking at the transforming potency and transcriptional regulation. These studies showed that Myocardin is capable of inhibiting cell proliferation by preventing the transcription factor NF-κB(p65) from binding to DNA. Thus Myocardin can act as an SRF independent transcriptional repressor (Tang et al. 2008). Myocardin is also down regulated in smooth muscle cell cancer lines, leading to the differentiation defects seen in the cancer cells. Because myocardin inhibits cell proliferation, it is possible that the decrease in Myocardin levels in the cancer cells leads to the promotion of cellular proliferation in these same cells. Chromatin remodeling proteins were also found to interact with the myocardin protein, allowing myocardin to act to promote or repress transcription of target genes (Cao et al. 2005). The acetylase p300, known to “open” chromatin structure for transcription was found to bind to the transactivation domain (TAD) of Myocardin, while the, deacetylase HDAC5 known to “close” chromatin from transcription, interacts with the Q domain of the protein (Cao et al. 2005). While the roles of myocardin in the heart and vascular smooth muscle have been studied greatly, the involvement of myocardin in the urinary bladder smooth muscle remains elusive. The proximity of the mutation in the MLR19 megabladder mice to the myocardin gene makes

9 myocardin a good candidate gene for being affected by the mutation. Also, if myocardin is the gene being affected by the MLR19 mutation, how is it acting in a bladder specific manner? All of the work done on myocardin expression in vivo has been done with mRNA probes made to the known myocardin. It is possible that there is alternative regulation or isoforms unique to the bladder that have not been identified. In this thesis, I report on a knockout construct that would mimic the 24kb deletion seen in the MLR19 mice. This construct, when targeted in mice, may answer the question, what aspect of the deletion/insertion of the mutation is responsible for the MLR19 megabladder phenotype. Also, I address the possibility that myocardin is a gene being affected in the MLR19 insertional mutants. I also report on previously unrecognized phenotypes in both the MLR19+/- and myocd+/- bladders.

10 E10.5 E11.5 E13.5 E14.5

BSM A PCM UC C

R UP R

Fig. 1.1 Schematic diagram of urinary bladder development. The urinary bladder is derived from two tissues, embryonic endoderm and peri-cloacal mesenchyme (PCM) to form the urothelium and smooth muscle/connective tissue respectively. The peri-cloacal mesechymal cells (indicated in red) start to proliferate starting around embryonic day 10.5 (E10.5) and surrounds the presumptive bladder epithelium (the PCM also gives rise to the urethral plate). At E14.5 the mesechymal cells that surround the bladder epithelium differentiate en mass to form the bladder smooth muscle (maroon) and the connective tissue (lamina propria). A, allantois; BSM, bladder smooth muscle; C, cloaca; GT, genital tubercle; PCM, peri-cloacal mesenchyme; R, rectum; U, urethra; UC, umbilical cord. (Drawn from histology work from Haraguchi et al. 2006).

Fig. 1.2 Immunohistochemistry of MLR19-/- (mgb-/-) (A and C) bladders comparied to wild type (B and D) littermates (images modified from Singh et al. 2007). The mgb-/- lack smooth muscle (stained brown) the surround the urinary bladder . Smooth muscle is stained with alpha actin smooth muscle antibody. Male megabladder mice appear to be more severely affected than female, and many die before weaning, whereas females often live long enough to reproduce. (E) Schematic diagram of the mutation on chromosome 11 that gives rise to the megabladder phenotype. 1Mb of chromosome 16 is translocated to chromosome 11,that includes four genes osteocrin (Ostn), urotensin II-related peptide (Urp), coiled-coil domain containing 50 (Ccdc50), and DNA segment, chromosome 16, Brigham & Women’s Genetics 1543 expressed sequenece (Bwg1543). 24kb of chromosome 11 is also deleted in this mutation. The mutation lies 58.3kb downstream of the Map2K4 gene and 335.3kb upstream of the Myocardin gene.

Fig. 1.3 Diagram of the two published myocardin isoforms. The smooth muscle isoforms arises from an alternatively spliced exon between exons 2 and 3 (termed 2a) that introduces a premature stop codon. Translation for the smooth muscle isoforms begins again in exon 4. Arrows indicates the ATG where translation in both isoforms begin. The SAP domain is where myocardin binds to SRF. NTD, N- Terminal Domain; ++, basic region; Q, glutamine-rich region; SAP, SAF-A/B, Acinus, PIAS Domain; LZ, Leucine Zipper domain; TAD, Transactivation Domain.

13 CHAPTER 2. Targeted knock-out Construct for 24kb region on chromosome 11

Introduction The MLR19 transgenic mutant has approximately 1Mb of chromosome 16 translocated to chromosome 11 with a subsequent deletion of 24kb of chromosome 11 at the translocation site (Fig. 1.1E). It is possible that a critical element that is required for bladder specific smooth muscle differentiation is within the 24kb deleted region. A sequence comparison of the 24kb region reveals an approximately 5kb region within that 24kb that is extremely well conserved in all mammals, suggesting that there may be a element within the 24 kb that may be important to mammalian development. Other possibilities include: the insertion of 1Mb (instead of the 24kb) moved a critical element too far away for the element to function properly, or the addition of the 1MB to chromosome 11 altered the chromatin structure so that the relevant gene is no longer functional. One candidate gene that may be affected by this lesion is the gene myocardin. In order to determine which aspect of the mutation, the 1Mb insertion or the 24kb deletion, is the cause of the phenotype one needs to separate the two aspects to see if the phenotype can be duplicated. To this end, I designed a gene targeting construct to delete the same 24kb that was deleted during the MLR19 transgene insertion (see Fig. 2.1 for a schematic diagram). If a critical element is within the 24 kb deleted region, this knockout should have the same megabladder phenotype. To delete the 24kb region, the homology arms flanking the region to be deleted were subcloned into a plasmid vector for targeting in embryonic stem (ES) cells. Target specific knock-out technology enables researchers to selectively delete specific regions of DNA including: genes, promoters, and/or enhancers using homologous recombination in ES cells (for review see Shastry 1995). The region to be deleted is often replaced with a positive selectable marker, or gene that will allow the cells to survive only if the marker is incorporated into the ES cell genome during recombination. In the case of the 24kb knock-out construct that was made, the neomycin phosphotransferase (Neo) cassette from plasmid PL451 (Liu et al. 2003) was used as the positive selectable marker (see Fig. 2.2A for a map of the plasmid). The Neo makes the cells resistant to G418, an aminoglycosidic antibiotic that prohibits protein synthesis (Nagy et al. 2003). Only cells that have incorporated the Neo gene will survive when treated with G418.

14 To enrich the selection for cells that have undergone correct homologous recombination, a negative selectable marker is also engineered into the knock-out construct outside the region of homology. This way if homologous recombination did not occur as desired, integration of the marker into the genome is lethal to the ES cells. The negative marker used for this construct was the herpes simplex virus-1 thymidine kinase (HSV-tk) gene from the plasmid PL253 (Liu et al. 2003) (see Fig. 2.2B for a map of the plasmid). HSV-tk causes lethality of the cells when treated with Ganciclovir by causing premature termination of DNA synthesis (Nagy et al. 2003). The combination of the positive selectable Neo resistance gene and the negative selectable marker HSV-tk gene into the knock-out construct and subsequent selection with G418 and Ganciclovir, respectively, should greatly enhance the chances of isolating successfully targeted ES cells.

Materials and Methods Making the knock-out construct Both 5’ and 3’ homology arms (2.17 kb and 4.04 kb respectively) flanking the 24 kb region to be deleted were PCR amplified from BAC RP23-340L19 (a BAC from a C57BL/6J Female that spans the 24kb region to be deleted) using a high fidelity TripleMaster® PRC System (Eppendorf, #954140261). Each PCR reaction contains 400nM of the appropriate primers (Table2.1), approximately 500ng BAC DNA, Tuning buffer with 2.5 mM Mg2+, 500μM dNTP mix, and 0.04U/μl TripleMaster Polymerase mix for a total reaction volume of 50 μl. For each homology arm four reactions were run, for a combined total of 200μl. The conditions for the PCR reaction are as follows: 3 min at 94oC, 36x (15 sec 94oC, 30 sec 53oC [R 3o/s + 0.0/s, G2.0], 6 min 68oC), 10 min 68oC and hold at 4oC. The PCR products were electrophoresed on a 1% agarose gel and the correct fragments, 2.17 kb and 4.04 kb (5’ arm and 3’ arm, respectively) were excised and purified using the QIAquick gel extraction kit (Qiagen). The homology arms were designed with artificial restriction sites NotI and SacII (3’ homology arm), and EcoRI and KpnI (5’ homology arm) that result in “sticky ends” when digested with the appropriate restriction enzymes. The 5’ homology arm was sequentially digested with KpnI and EcoRI, ethanol precipitated to remove enzymes and dissolved in 35 μl 10mM Tris/1mM EDTA (TE) buffer, pH 8.0. 168ng of the digested homology arm was ligated into KpnI/EcoRI-digested PL451 (Liu et al. 2003) (2.5:1 molar ratio of homology arm to 150ng PL451) using T4 DNA Ligase (Promega) in a total volume of 10μl. Ligations were carried out

15 for 1hour 30 minutes at room temperature and heat inactivated for 20 minutes at 65oC using the a

1x concentration of the supplied ligase buffer (50mM Tris-HCl, 10mM MgCl2, 1mM ATP, 10mM Dithiothreitol) (Promega) in the reaction mix. For each reaction, 1.5 μl of ligation mix was added to 25μl C2989K NEB 5-alpha electrocompetent cells and electroporated at 1.7kV, 200 Omega, and 25μF (New England Biolabs). Colonies were grown and selected on LB agar plates with 100μg/ml ampicillin (as the construct also contains an ampicillin resistance gene) and then screened for the proper insert by restriction digest and sequencing of the ligation junctions. Once colonies positive for the 5’ homology arm insert were identified, they were grown and the PL451+5’ arm plasmids were isolated using the QIAquick Midiprep kit (Qiagen). The 3’ homology arm was sequentially digested with SacII and NotI, respectively, ethanol precipitated, and dissolved in TE as described before. The digested arm (216ng) was ligated into the SacII/NotI digested PL451+5’arm plasmid (150ng), in a total reaction volume of 10 μl, and transformed the same way as described above. Positive colonies were selected and screened by restriction digest and sequencing as mentioned. Colonies that were positive for the insert of the 3’ homology were then isolated, grown, and plasmids isolated. Plasmid PL253 (Liu et al. 2003) contains the thymidine kinase (TK) gene used for negative selection during the embryonic stem cell targeting. PL253 was singly digested with SacII and electrophoresed in a 1% agarose gel. The 2.1kb fragment, containing the TK gene, was excised and gel purified as before. The PL451+homology arms were also digested with SacII, and phosphatase treated with Antarctic Phosphatase (New England Biolabs) for 30 minutes at 37oC, then heat inactivated at 65oC for 5 minutes. The 2.1kb PL253 fragement and the phosphatase treated PL451+homology arms were then ligated in a 2.5:1 molar ratio, 161ng and 150ng respectively, overnight at room temperature. The ligation was transformed into NEB 5-alpha cells as before. Colonies that were positive for the insert of the 2.1kb fragment were selected on LB agar plates with ampicillin and screened by restriction digest and sequencing of the ligation junctions.

Restriction Digestion of plasmids Plasmids were digested with different restriction enzymes to establish whether the homology arms inserted into the plasmids correctly. Digests were carried out at 37oC for approximately 1 hour. The buffer conditions for each digest varied as each enzyme required a

16 unique restriction buffer which was provided (New England Biolabs). Each reaction was carried out using a total concentration of 1x of the appropriate buffer. Enzymes and buffers in parentheses that were used in the restriction digests are as follows: EcoRI (EcoRI buffer), BamHI (3), BglI (3), BglII (3), SacI (1), PvuII(2). Conditions for each of the buffers are the

following: EcoRI buffer (50mM NaCl, 100mM Tris-HCl, 10mM MgCl2, 0.025% Tritonx-100);

Buffer 3 (100mM NaCl, 50mM Tris-HCl, 10mM MgCl2, 1mM Dithiothreitol); Buffer 1 (10mM

Bis-Tris-Propane-HCl, 10mM MgCl2, 1mM Dithiothreitol), Buffer 2 ( 50mM NaCl, 10mM Tris-

HCl, 10mM MgCl2, 1mM Dithiothreitol).

Sequencing of the ligation junctions Plasmid construct ligation junctions were sequenced by fluorescently labeling dideoxnucleotides using the BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, #4337455). Constructs to be sequenced were purified using the QIAquick Midiprep kit (Qiagen). For each reaction, 650ng of construct DNA was mixed with 3.2pmol of sequencing primer, 3μl 5x sequencing buffer , and 2μl BigDye ready reaction mix, and nuclease- free water was used to bring the final reaction volume to 20μl. The sequencing reaction cycle conditions were as follows: 1min 96oC, 25x (10 sec 96oC, 5 sec 50oC, 4 min 60oC) and held at 4oC until purification.

To purify the labeled construct, 2μl of 1.5M Na acetate/0.25M Na2EDTA and 80μl of 95% ethanol were added to the labeling mix and centrifuged for 15min at 12,000 xg. The supernatant was removed and the pellet washed with 100μl of 70% ethanol and spun again for 5min. The supernatant was removed, the pellet was allowed to dry and then frozen at –20oC until right before sequencing. For sequencing, the dried pellet was resuspended in 20ml of a proprietary Hi-Di formamide (Applied Biosystems, #4311320) and loaded onto the ABI Prism 310 Genetic Analyzer (PE Biosystems). Results of the sequencing were analyzed using the DNAstar software SeqBuilder (Lasergene).

Southern Blot Screening for KO Probes for screening targeted ES colonies were PCR amplified with the TaKaRa Ex Taq kit (TaKaRa) using the following PCR program [2:30min at 94oC (10sec 94oC, 30sec 55oC, 1min 72oC)x30 and 7min at 72oC] and held at 4oC until removed from thermocycler. The conditions

17 for the PCR reaction were 1.25 units of TaKaRa Ex Taq, 1x concentration of Ex Taq buffer (Takara Bio Inc., #RR001A/B/C), 250ng ES cell Template DNA, appropriate primers (Table 2.1)

at 0.5μM, 500μM dNTP mix, and ddH2O to a final volume of 50μl. The PCR products were cleaned using a gel extraction kit (Qiagen). The probes were then 32P radio-labeled using the DECAprime II Kit (Ambion, #AM1455) under the following conditions: 25ng probe DNA, 1x decamer solution, 1x dCTP reaction buffer, 50μCi [α-32P]dCTP, water to 24μl, and 1μl of Exo- Klenow. The reaction was incubated for 10 minutes at 37oC, and then 1μl of 0.5M EDTA was added to stop the reaction. Radio labeled probe is cleaned using ProbeQuant G-50 microcolumns (GE Healthcare). DNA from targeted ES cell colonies were independently digested with AvrII and BamHI restriction enzymes, run on a 0.8% TAE gel and transferred to an immobilon-NY+ nylon membrane (Millipore) using the Whatman Turboblotter neutral transfer system (Fisher Scientific, #09-301-180) The Denaturing buffer contained 0.5M NaOH, 1.5 M NaCl, the transfer buffer 3M Nacl, 0.3M Na citrate adjusted to pH 7.0, and the neutralizing buffer contains 0.5 M Tris-HCl pH 7.0, 1.M NaCl. The membranes were pre-hybridized in ULTRAhyb (Ambion, #AM8670) for 30 min. at 42oC. The membranes with the AvrII digested DNA is then hybridized with the synthesized 5’ Southern probe overnight at 42oC. For each probe, the entire 25μl of the probe was used for the labeling reaction. Additionally, the membranes with the BamHI digested DNA was hybridized with the 3’ Southern probe under the same conditions. All blots were washed 2 times for 5 minutes in 15ml 2xSSC/0.1% SDS and then 2 times for 15 minutes in 15 ml 0.1xSSC/0.1%SDS all at 42oC. The blots exposed overnight on a phosphorimager screen and analyzed the next morning.

Results and Discussion

Insertion of the 5’ homology arm was performed by PCR amplifying the homology arm from BAC RP23-340L19, and digestion with KpnI and EcoRI (respectively) to produce a 2.17kb fragment with artificial sticky ends that would ligate into the corresponding sites of the digested PL451 plasmid (Fig. 2.1A). Once ligated, the plasmids were electroporated into electrocompetent cells and grown on selection medium for ampicillin resistance. Colonies that grew were isolated and plasmid extracted to see whether the homology arm inserted correctly.

18 Plasmids were digested with EcoRI and EcoRI & BamHI (Fig. 2.3) to see if the expected fragments were present. Of approximately 50 colonies that were screened for this particular ligation, only three ligations were positive for the insertion of the 5’ homology arm, with one digest indicating a mixed population of vector with and without the homology arm insert. Six representative plasmid digests are shown in Fig. 2.3A, including the three positive plasmids. Since the homology arms were designed with different restriction sites at either end of the arm, they should not be able to ligate into the plasmid in the reverse orientation, however this was still verified. The plasmids were double digested with EcoRI and BamHI and Fig. 2.3B shows the results of the digest, with a chart giving the predicted size of the fragments if the homology arm ligated correctly. A restriction map of the correct ligation product is given in Fig. 2.3C. The digests indicate that the three positive plasmids (as indicated in Fig. 2.3A) were ligated into the plasmid vector in the correct direction. When a plasmid positive for the insertion of the 5’ homology arm was identified, the plasmid was digested with SacII and NotI restriction enzymes to match the enzymes engineered into the 3’ homology arm ends (see Fig. 2.1A). Similar to the 5’ homology arm, the 3’ arm contained sticky ends that prevent the homology arm from ligating into the PL451+5’ in the incorrect direction. Out of approximately 40 colonies that grew on the ampicillin selection plates, only one of the extracted plasmids was positive for the ligation of the 3’ homology arm (Fig. 2.4). To test whether the homology arm inserted, the plasmids were digested with BglII, an enzyme that would only cut the plasmid if the homology arm inserted, giving two separate fragments (indicated with +, Fig. 2.4A). To further confirm the ligation of the homology arm into the construct, SacI and BglI digests were performed (Fig. 2.4B). The result from those digests indicated that the 3’ homology arm did insert into the PL451+5’ homology arm plasmid construct. Fig. 2.4C shows a map of all the restriction sites of the enzymes used for these digestions on the construct if the 3’ homology arm had inserted correctly. Because the HSV-tk gene was inserted at only the SacII restriction site, it is possible that the fragment could insert in either the forward or reverse direction. This possibility had to be taken into account while screening for positive plasmids. The plasmid construct (PL451+homology arms) was treated with the Antarctic Phosphatase, which cleaves phosphates from the overhangs preventing re-circularization of the plasmid. The only colonies that should be growing on the plate are those that ligated the HSV-tk gene into the construct. Twenty-four

19 colonies were screened by restriction digest using BamHI (Fig. 2.5A), and only one colony was positive for ligation of the HSV-tk insert. The fragment pattern of the positive plasmid (indicated by the +) showed that the fragment ligated into the construct in the reverse orientation. Further restriction digest of the positive construct with BglI, BglII, and PvuII (Fig. 2.5B) confirmed that the HSV-tk gene did ligate into the plasmid construct in the reverse orientation. However, the orientation of the HSV-tk gene is not crucial as the gene contains its own promoter and polyadenlyation site and functions independently of the homology arms flaking the positive selection marker Neo. Sequencing of the ligation junctions was performed after the complete construct was made to confirm the ligation of the proper insert (the 5’ and 3’ homology arms and HSV-tk respectively) at the site. Sequence data indicate that the homology arms and HSV-tk did ligate properly and in the orientation shown by the restriction digests (Fig. 2.6). Overall, the construct was made with the 2.17bp 5’ and 4.04bp 3’ homology flanking the Neomycin gene, with the HSV-tk gene ligated 3’ of the 3’ homology arm, as can be seen in Fig. 2.2. The completed 24kb KO construct, linearized with KpnI, is being used for targeting in the G4 ES cells, these cells are a 129S6B6F1 hybrid derived from the mating of a 129S6/SvEvTac female with a C57BL/6Ncr male. The cells are being cultured in the Robinson lab by Mr. Brad Wagner. After electroporation of the construct into the ES cells, the cells are grown and cultured in ES cell medium and supplemented with G418 and Ganciclovir. After the ES cells are targeted, cells are picked and grown for screening by southern blot. The southern blot strategy for screening the ES cells uses the change in size of the fragment of DNA that the southern blot probes bind, based on the deletion or insertion of enzyme restriction sites within the targeted region of chromosome 11 (Fig. 2.7). To screen for homologous recombination of the 3’ homology arm, the restriction enzyme BamHI will be used to digest the DNA. If the correct recombination occurs, the fragment of DNA that the 3’ probe binds should shift from 10.0kb to 5.7kb. This shift occurs because the Neomycin cassette that is replacing the 24kb region of chromosome 11 contains a BamHI restriction site much closer to the probe than the wild type 24kb region. If homologous recombination occurs properly in the 5’homology arm there should be a shift from 8.2kb to 13.5kb when using the restriction enzyme AvrII. Figure 2.7 shows southern blots indicating the wild type bands, while the red bands

20 indicate where the targeted knock-out (KO) bands should be located when the ES cell targeting is complete. In this chapter, I have reported the creation of a knock-out construct that, when targeted in mice, should mimic the deletion of 24kb from chromosome of the MLR19 transgenic line. If there is a critical element in the 24kb region that is required for urinary bladder specific differentiation of smooth muscle, mice homozygous for this deletion, should fail to develop the bladder smooth muscle. If this knock out does not recapitulate the MLR19 megabladder phenotype, it would suggest the critical element required for bladder smooth muscle differentiation is most likely upstream of the 24kb deletion, or that the 1Mb insertion of chromosome 16 onto chromosome 11 has altered the chromatin structure of chromosome 11 so that the affected gene is no longer accessible for transcription, or even that there could be an additive effect between the deletion and the 1Mb insertion.

21 Table 2.1 Primers used to PCR amplify the 5’ and 3’ homology and primers used to amplify the Southern blot probes for screening the ES cells.

5’TAACTGGTACCTTGAATGTCCGAGAAGC 3’ 5’ homology arm sense KpnI 2174 bp 5’ homology arm anti 5’TTCATGAATTCGCCATGCCTGTGTCCTG 3’ sense EcoRI

5’CATATGCGGCCGCTCAAGAGATGGTGCTGGGAAAAC 3’ 3’ homology arm sense NotI 4039 bp 3’ homology arm anti 5’ATTAACCGCGGGGCAACAAATGGCTGAAGAAGTAT 3’ sense SacII

5’ CAGAGTGCACCCTTGAT 3’ 5’ Southern probe sense 428 bp 5’ Southern probe anit- 5’ TATTGTGATTTTTACTTCTTTTT 3’ sense

3’ Southern probe sense 5’ GGCCGCCACCTGTCTCT 3’ 468 bp 3’ Southern probe anti- 5’ TCCCTGTGATTTTTCTGA 3’ sesnse

The size of the amplified fragment is indicated for each primer pair. The underlined portion of the sequence indicates the restriction enzyme used to ligate the amplified homology arm into the plasmid pl451 for the knockout out construct.

Fig. 2.1 Schematic diagram of how the knock-out construct was made. (A) Regions flanking the 24kb fragment to be deleted were PCR amplified from BAC RP23-340L19. The homology arms contain artificial “sticky ends” that when digested with the appropriate enzymes ligate into the PL451 vector flanking the neomycin resistance (Neo) gene. (B) Ligation of the homology arms to the plasmid creates regions of homology between the vector and the normal wild-type chromosome 11 segment. (C) A thymidine kinase (TK) gene was ligated into the vector utilizing the SacII restrictions sites. This allows for negative selection, to make sure the correct homologous recombination has occurred in the embryonic stem (ES) cells.

Fig. 2.2 Schematic diagrams of the plasmids used in making the knock-out construct. (A) Plasmid PL451 contains the neomycin (Neo) resistance gene. The 5’ homology arm is engineered to be inserted between the KpnI and EcoRI sites, while the 3’ homology arm is inserted between the NotI and SacII restriction sites. (B) PL253 contains the HSV-tk gene that is used as a negative selectable marker. The HSV-tk gene will be excised from the plasmid by digesting the plasmid with SacII, the fragment will then be placed in the PL451 plasmid that contains the homology arms at the SacII site.

Fig. 2.3 Restriction digests to show ligation of the 5’ homology arm into PL451. Plasmids isolated from selected colonies were digested with either (A) EcoRI or (B) EcoRI/BamHI to see if the correct fragments are produced. (A) If the homology arm inserted into the plasmid vector, there should be a shift in size from 4,832bp to 6,962bp. Plasmids positive (+), and those negative (–) are indicated. Note, the third positive fragment is a mixed population of positive and negative plasmids as both the fragments, with and without insert are present. (B) The plasmids were double digested with EcoRI and BamHI to confirm correct ligation of the 5’ homology arm. The three positive plasmids contain the fragments of the correct size, indicating that the homology arm inserted in the correct orientation. (C) Restriction map showing the BamHI and EcoRI restriction sites on PL451 if the 5’ homology arm inserted properly.

Fig. 2.4 Restriction digest showing proper ligation of the 3’ homology arm into the PL451+5’arm plasmid. Plasmids were digested with (A) BglII and (B) SacI or BglI to see if correct fragment sizes are produced. (A) Plasmids were digested with BglII, if the 3’ homology arm inserted into the plasmid construct, there should be two fragments produced (9547bp and 1450bp), whereas if the arm did not insert, the plasmid should not be fragmented. A plasmid positive for the insertion of the 3’ arm is indicated (+). (B) The positive plasmid from (A) is digested with SacI and BglI to confirm proper insertion of the homology arm. Calculated fragment sizes indicated on the right of the figure. Note, the 2760bp and 2669bp fragments from the SacI digests are present as one fragment on the image. (C) Restriction map showing the location of the restriction sites (BglI, BglII and SacI) for the enzymes used.

Fig. 2.5 Restriction digest of insertion of the HSV-tk gene into the PL451+homology arms plasmid. The plasmids were digested with (A) BamHI or (B) BglI, BglII, or PvuII to see if the correct fragment sizes are obtained. (A) As the HSV-tk gene was inserted at the SacII site, the fragment can ligate in either the forward or reverse orientation. The potential forward or reverse orientations are indicated in the chart on

27 the right (and in the maps C and D). The (+) indicates a plasmid in which the HSV-tk fragment ligated into the plasmid in the reverse orientation. (B) BglI, BglII, and PvuII digests further confirm that the HSV-tk gene inserted into the positive plasmid (indicated in A). (C) Restriction map of the plasmid showing BamHI restriction sites if the HSV-tk fragment had ligated in the forward orientation. (D) Restriction map showing BamHI restriction sites if the HSV-tk fragment ligated in the reverse orientation. (E) Restriction map showing BglI, BglII, and PvuII restriction sites of the plasmid with the HSV-tk fragment in the reverse orientation.

28 A.

29 D

Fig. 2.6 Sequences of the ligation junctions of the completed knockout construct. (A) Sequence of the 5’ end of the 5’ homology arm, showing the KpnI site where the homology arm ligated into PL451. (B) Sequence of the 3’ end of the 5’ homology arm, showing EcoRI site where the fragment ligated into PL451. (C) Sequence 5’ end of the 3’ homology arm ligating into the PL451 plasmid. (D) Sequence showing ligation of the 3’ end of the 3’ homology arm ligated into the HSV-tk gene at the SacII site. (E) Sequence showing ligation of the HSV-tk gene into the PL451 plasmid vector. All sequences that were obtained from the completed construct were correct according to the strategy used to create the construct. This further confirms that the knockout construct was made properly, and that it is ready to be used to target ES cells.

Wild Type

AvrII BamHI AvrII BamHI 5’ probe 3’ probe

Left arm 24kb region Right arm 8.2 kb 10.0 kb

Targeted: AvrII AvrII BamHI 5’ probe BamHI 3’ probe

Left arm Neo res. gene Right arm 5.7 kb 13.5 kb

Fig. 2.7 Southern blot strategy for screening targeted ES cells. (A.) Schematic diagram showing approximate location of restriction enzyme sites. If the ES cells are successfully targeted, an AvrII site should be deleted and the fragment of DNA that the 5’ probe binds should change in size from 8.2kb in the wild type to 13.5kb in the targeted ES cells. There should be an inclusion of a BamHI site within the Neo cassette inserted in place of the 24kb, and there should be a shift in size of the fragment of DNA that the 3’ probe binds from 10.0kb in the wild type to 5.7kb in the targeted cells. (B.) Southern blot of wild type BAC DNA for both AvrII and BamHI digests. The location of the targeted fragments for each are indicated in red.

CHAPTER 3. Complementation study to determine the role myocardin has in the mgb phenotype

Introduction In the previous chapter, I described the construction of a knock-out construct to mimic the 24kb deletion present in the MLR19 transgenic mice without the 1 Mb duplication. This construct will determine whether the 24kb region is essential for bladder smooth muscle development. Evidence outlined in the introduction suggests that myocd is a candidate gene being affected by the MLR19 transgene insertional mutation, as it is a critical co-transcription factor required for smooth muscle differentiation and is in close proximity to the transgene insertion. A myocd knockout was created by Li et al. (2003), in which exons 8 and 9 are deleted. As exons 8 and 9 code for the domain that binds with SRF, this knockout would abrogate all myocardin function through SRF, and all known isoforms of myocardin contain this domain. Homozygous myocd knockouts are embryonic lethal by E10.5, before the bladder develops. While there is a myocardin conditional knockout, there is not bladder specific Cre recombinase mouse line to delete myocardin in the just the bladder. Also, there are no reports of smooth muscle deficiency in any tissue (including the bladder) in the myocd knockout heterozygotes. In order to determine if myocardin is the relevant gene being affected by the MLR19 mutation, myocd+/- mice were bred with MLR19+/- mice to produce compound heterozygotes (MLR19-/myocd-) that have one myocd- KO chromosome 11 and one MLR19- mutant chromosome 11 (fig. 3.1). Assuming myocd is the relevant gene, the only functional copy of myocd is on the MLR19 transgenic chromosome and would be subject to MLR19 transgene insertion affects. If myocd is the relevant gene, the compound heterozygotes should produce a similar phenotype as the MLR19-/- mice. If myocd is not the only gene responsible for the MLR19 homozygous phenotype, then the compound heterozygote should not have a megabladder phenotype as the animal would be heterozygous for two separate genes.

Materials and Methods Mice used in the studies MLR19 “megabladder” transgenic mice were created by transgenesis of a DNA construct to drive the expression of the bovine sodium myoinositol co-transporter gene to the lens as previously described (Singh et al. 2007). The myocardin knock-out mice were a generous gift

32 from Eric Olson. In this strain exons 8 and 9 are knocked out, replaced with a Neomycin cassette and LacZ reporter (Li et al. 2003). All mice were maintained as a colony at Miami University. Mice used for histology and immunohistochemistry were sacrificed at embryonic day 15 (E15) and Postnatal day 0 (P0 or newborn).

Genotyping Mice Polymerase Chain Reaction (PCR) was used to genotype all mice in the colony using the appropriate PCR primers for the genotype (table 3.1). The following PCR conditions were used: MLR19 transgene [5min 94oC, 35x (30sec 94oC, 50sec 57oC, 1min 72oC), 7min at 72oC], CH11 deletion [5min 94oC, 31x (1min 94oC, 45sec 50oC, 1min 70oC), 7min at 70oC] and Myocd KO [5min 95oC, 31x (30sec 95oC, 40sec 57oC, 1min 65oC), 7min at 65oC].

Histology

Animals were humanely euthanized by CO2 gas, and dissected leaving only the trunk of the animal with the bladder and intestines intact. The tissues were fixed in 10% neutral buffer formalin overnight and transferred to 70% ethanol until they were loaded into the tissue processor. The tissues were processed in a TP1020 tissue processor (Leica Microsystems ) using the following treatments: 30min 70% ethanol, 30min 80% ethanol, 30min 95% ethanol, 3x 30min 100% ethanol, 1hr xylene, 2x 30min xylene, 1hr molten paraffin (62oC), 1hr molten paraffin and hold in paraffin until samples were removed. Specimens were embedded in paraffin , cut into 5μm sections and placed on Superfrost Plus slides (Fisher Scientific). The slides were de-paraffinized and stained with hematoxylin and eosin (H&E) by 2x 4min in xylene, 2x 1min

100%ethanol, 1min 95% ethanol, 2min H2O, 3min hematoxylin, 2min H2O, 15sec acid alcohol

(1% HCl in 70% ethanol), 1min H2O, 1min bluing reagent (0.1% NaHCO3), 1min H2O, 1min 70% ethanol, 1min eosin, 2x 30sec 95% ethanol,, 3x 1 min 100% ethanol and 2x 1min xylene.

Immunohistochemistry Slides were first de-paraffinized and re-hydrated in 2x 5min xylene, 2min 100% ethanol,

2min 95% ethanol, 2min 70% ethanol, 2min 50% ethanol, and 2min H2O washes respectively. The slides were placed in a slide holder with 25ml (enough to cover entire slide) 0.01M sodium citrate buffer pH 6.0 and boiled for 30min. The slides were immunoblotted with the Mouse to

33 Mouse HRP (AEC) staining system kit (Scytek Laboratories, #MTM002) using the following

protocol: slides were then washed with distilled H2O 15min, and then incubated in H2O2 15min, washed in PBS 15min, blocked with Avidin/biotin 5min (SkcTek), washed in PBS 15min, blocked in Mouse to Mouse Block (ScyTek) for 45min, washed in PBS 15min, incubated with Mouse Monoclonal Anti-Human Smooth Muscle Actin (Clone 1A4) (Dako) in a 1:100 dilution in PBS for 1hr, washed with PBS 15min, incubated with Ultra Tek Anti-Polyvalent (ScyTek) for 20min at room temperature, washed in PBS 15min, incubated with Ultra Tek HRP for 20min at room temperature, and washed 15min in PBS, incubated in AEC (3-Amino-9-Ethylcarbazole) for approximately 5min (until desired color development). The slides were then counterstained in hematoxylin 1min, and bluing reagent (0.1% NaHCO3) 15sec. Crystal mount was applied to the wet tissue and coverslipped for microscope analysis. The slides were aqueous mounted, as the AEC is soluble in xylene, used for nonaqueous mounting.

Results and Discussion In the first litter from an MLR19+/- X myocd+/- breeding, two of eight newborn (P0) pups genotyped positive for both the MLR19 transgene and the myocd knockout (compound heterozygotes) (Fig 3.2A), while the other pups were either wild type, MLR19+/-, or myocd+/-. The two MLR19-/myocd- pups and all subsequent compound heterozygotes from other litters exhibited the enlarged megabladder phenotype, indicating that myocardin is the gene being affected by the mutation in MLR19 line. Histological analysis of P0 compound heterozygotes (n=5) indicates that the smooth muscle layer appears to be severely reduced from the urinary bladder (Fig. 3.3), in a manner similar to the MLR19-/- mutation (see Fig.1.1). Pups born with either MLR19+/-,myocd+/- or wild type genotypes had normal appearing bladders, a wild type bladder can be seen in Fig. 3.3A,B. Based on this complementation study, collaborators looked at bladder mRNA levels of the MLR19-/- megabladder mice and observed an 82% reduction in myocardin levels, further confirming that myocardin was severely affected by the transgene insertion/deletion event (unpublished data, McHugh et al) and that it is the relevant gene causing the bladder phenotype. Immunohistochemistry for smooth muscle α actin (Fig.3.4), one of the first markers for smooth muscle development (McHugh et al. 1995), indicated that in the compound heterozygotes there was some smooth muscle in parts of the bladder, but that smooth muscle layer was very thin (Fig. 3.4D). There were other parts of the same bladder where the smooth

34 muscle was missing altogether (Fig. 3.4E). This suggests there was some smooth muscle differentiation during development, but the amount of smooth muscle was severely reduced. Interestingly, the vasculature (arrowhead) around the bladder (Fig. 3.4C) did not appear to be affected in the compound heterozygotes even though they were very close to the bladder, and may have been receiving many of the same signals from surrounding tissues (particularly the bladder urothelium). Note also, the ureters (arrows) in both the wild type animal and the MLR19-/myocd- animal, and the colon (dot) in the MLR19-/myocd- animal that the alpha smooth muscle actin expression appeared to be unaffected by the mutation. This evidence also suggests that the alteration in myocardin expression is predominately affecting the urinary bladder smooth muscle and that there may be differential regulation of myocardin in the bladder. One of the secondary effects of the MLR19 megabladder phenotype, and other bladder outlet obstructions after blockage of urinary output, is the subsequent dilation of the ureters and kidneys (hydroureteronephrosis) due to urine back pressure, followed by kidney failure and death (Singh et al. 2007). The newborn compound heterozygous pups also suffered from a dilation of at least one ureter (Table 3.2, Fig. 3.3 arrow). The severity of the dilation varied, but all pups examined seemed to exhibit at least some degree of hydroureter. The severity of the phenotype leads to postnatal lethality to the MLR19-/myocd- compound heterozygotes. This is the first direct evidence that myocardin is a critical transcription factor needed for bladder smooth muscle development. Previous work has shown that myocardin is expressed in high levels in the bladder (Du et al. 2003, Wang et al. 2002). It has also been shown that SRF, the co-factor that myocardin binds to for its transactivating function, is upregulated in the urinary bladder at E14 prior to smooth muscle differenitation (Li et al. 2006). But, this is the first study to show that a reduction in myocardin expression has a negative effect on bladder development, in the form of a lack of smooth muscle differentiation. In the MLR19-/- mice there is an 82% reduction in myocardin mRNA levels at E15 in the bladder, just following bladder smooth muscle differentiation (McHugh, unpublished data). While this reduction is significant, myocardin levels were also significantly reduced in smooth muscle and cardiac tissues (unpublished data), such as the stomach (59%), lung (32%), and heart (46%). Myocardin levels were also increased in skeletal muscle (57%) (McHugh, unpublished data). Interestingly in the MLR19-/- mice, there was no apparent phenotype in any of these other tissues where reductions were seen. This finding, along with the data presented in this chapter suggest that myocardin is

35 uniquely regulated in the pericloacal mesenchyme and the subsequent bladder smooth muscle, and that the mutation in the MLR19 transgenic line is affecting this regulation.

36 Table 3.1 Primers used for PCR genotyping the MLR19 and myocardin mutants MLR19 transgene Pr4 5’GCATTCCAGCTGCTGACGGT3’ AntiBSMIT 5’CGCCCCGCCAAGAAGTATCCA3’ Chromosome 11 Deletion Ch11del1f1 5’TGGGAGCAGATGGGTAAG3’ Ch11del1r1 5’TTTTTGTTTTTCTAAGGCTGAT3’ Myocardin KO LacZf1 5’CCGACGGCACGCTGATTGAAG3’ LacZr1 5’CATACTGCACCGGGCGGGAAGGAT3’

37 Table 3.2 Morphometric analysis of ureter lumen area of MLR19-/myocd- (n=4) compound heterozygotes and wild type animals (n=5), measured in μm2.

MLR19-/myocd- Wild type Ureter 1 Ureter 2 Ureter 1 Ureter 2 4431.98 4074.65 530.73 2410.05 19610.67 1829.47 581.59 701.40 898.78 1493.22 970.02 573.80

690.71 4844.99 649.08 748.62 1004.69 645.23

38 A

MLR19+/- X myocd+/-

MLR19+/myocd+ , MLR19+/myocd- , MLR19-/myocd- , MLR19-/myocd+ (Wild Type) (myocd het.) (compound het.) (MLR19 het)

Expected Frequency 25% 25% 25% 25% Actual Frequency 14.3% (7) 22.4% (11) 30.6% (15) 32.6% (16)

Fig. 3.1 (A)Breeding scheme in order to obtain the MLR19-/myocd- compound heterozygotes. The expected frequency of each genotype is included along with the actual frequency of P0 pups obtained from the breedings. (B)Diagram of the myocardin KO and the MLR19 mutant chromosome 11s. In an animal that contains both chromosomes, all genes besides myocardin are present in the regular compliment, while myocardin only has one functional copy (the copy present on the MLR19- chromosome). If myocardin is the gene being acted on by MLR19 the mutation, the animal should recapitulate the MLR19-/- phenotype.

A B

Fig. 3.2 PCR (A) results and gross histology (B) from the first MLR19+/- X myocd+/- breeding to create MLR19-/myocd- compound heterozygotes. (A) In the first litter, two pups (indicated with *) were positive for both the MLR19 transgene and the myocardin KO. Both pups exhibited the megabladder phenotype, while the rest had no obvious phenotype. (B) Newborn MLR19-/myocd- pup with megabladder (circled). All compound heterozygous pups exhibit this phenotype.

40 A P0 Wild Type C P0 MLR19-/myocd- compound heterozygote D

B LP U

E B E

LP U

SM LP

Fig. 3.3 H&E staining comparing wild type (A and B) and MLR19-/myocd- compound heterozygous (C, D, E) newborn pups at low magnification (A and C), scale bar is 500μm; and at higher magnification, (B, D, and E) scale bar is 100μm. In wild type bladders, the smooth muscle layer, SM, is evident, whereas in the MLR19-/myocd- compound heterozygous bladders, the smooth muscle later appears to be severely reduced. In the MLR19-/myocd- bladders the urothelium and lamina propria, U, is severely distended making the bladder much larger than the wild type. Figures B, D, and E show higher magnification of the bladder wall, note the apparent lack of the smooth muscle in the MLR19-/myocd-. This data indicates that myocardin is the gene being affected by the MLR19 transgene insertional mutation. LP, lamina propria; SM, smooth muscle; U, urothelium. Arrow in panel C shows a dilated ureter.

A P0 Wild Type C MLR19‐/myocd‐ D

U SM

D B *

B E

U SM U * E

SM *

Fig. 3.4 Immunohistochemistry of smooth muscle alpha actin (brown color) in the P0 bladder of wild type (A and B) and MLR19-/myocd- compound heterozygotes (C,D, E) low magnification (A and C), scale bar is 500μm; and high magnification (B, D, E), scale bar is 100μm. The smooth muscle, SM, layer in the wild type is clearly evident, while the compound heterozygote (C) appears to lack most of the smooth muscle. High magnification of the compound heterozygote shows that in places there is a thin layer (possibly single cell thick) such as seen in D. In other places the smooth muscle is lacking altogether, E. In both the wild type and compound heterozygote, smooth muscle alpha actin is present in the lamina propria (*) next to the urothelium. Note, the alpha actin staining in the ureters (arrow) appears similar in the wild type and MLR19-/myocd- animals, and there is strong alpha actin expression in the colon (dot) of the compound heterozygote as well. Smooth muscle, SM; urothelium, U. Scale bar is 500μm.

42 CHAPTER 4. Morphometric analysis of urinary bladder smooth muscle in between genotypes Introduction As determined in the previous chapter, using the MLR19-/myocardin- compound heterozyogotes, myocardin (myocd) is the gene responsible for the MLR19-/- megabladder phenotype. Work from collaborators (McHugh, unpublished data) has shown that myocardin mRNA levels in the MLR19-/- (homozygous) bladders at embryonic day 15 (E15) are reduced by 82%. They have also shown that levels of myocardin mRNA were also reduced in the MLR19+/- and myocd+/- bladders by 40% and 50% respectively. However, these genotypes have not been closely evaluated to determine if there are any phenotypes associated with this reduction, as the bladders look relatively normal from a gross anatomical standpoint. While, there is some evidence to suggest that male MLR19+/- mice have altered blood serum chemistry levels (Singh et al. 2007), there is no evidence to suggest an alteration in smooth muscle development in either the male or MLR19+/- mice, and no report of any smooth muscle deficiencies in the myocd+/- mice. This chapter looks at the morphology of newborn (P0) bladders from MLR19+/-, myocd+/-, and wild type mice to see if the moderate reduction of myocardin mRNA levels had an effect on the thickness of bladder smooth muscle layer.

Materials and Methods

Histology

43 30min 100% ethanol, 1hr xylene, 2x 30min xylene, 1hr molten paraffin (62oC), 1hr molten paraffin and hold in paraffin until samples were removed. Specimens were embedded in paraffin , cut into 5μm sections and placed on Superfrost Plus slides (Fisher Scientific). The slides were de-paraffinized and stained with hematoxylin and eosin (H&E) by 2x 4min in xylene, 2x 1min

100%ethanol, 1min 95% ethanol, 2min H2O, 3min hematoxylin, 2min H2O, 15sec acid alcohol

(1% HCl in 70% ethanol), 1min H2O, 1min bluing reagent (0.1% NaHCO3), 1min H2O, 1min 70% ethanol, 1min eosin, 2x 30sec 95% ethanol,, 3x 1 min 100% ethanol and 2x 1min xylene.

Morphometric analysis Morphometric analysis of the bladder smooth muscle layer and lumen area were performed on sectioned bladder tissue from MLR19+/-, myocd+/-, and wild type newborn (P0) pups with the aid of the NIS-Elements Advanced Research imaging software (Nikon). Thickness of the smooth muscle was measured at 12 random points around an entire bladder section. These measurements were performed on three different sections of the bladder from each individual in order to attain an average thickness of the smooth muscle for that individual. Repeated measure analysis of variance was performed using SAS 9.1 to assess difference between the MLR19+/-, myocd+/-, and wild type muscle thicknesses. Variation in the smooth muscle thickness within individuals was included as a random effect within the model. Mean thickness of the muscle are reported with standard error. The lumen areas of the bladders were also measured on the three sections where the smooth muscle thickness was measured. The average of the three sections was taken to provide an average lumen area for the individual. Linear regression analysis was performed using SAS 9.1 to determine whether there is a relationship between lumen area and the thickness of the smooth muscle layer in the individuals examined.

Results and Discussion

While there is no reported alterations in bladder smooth muscle that develops for either the MLR19 or myocardin knockout heterozygous mice, the genotypes have a 40% and 50% reduction in myocardin mRNA levels at E15, respectively (McHugh, unpublished data). This is the day after the pericloacal mesenchyme differentiates into smooth muscle. At E15 one would not expect to see a large difference between the genotypes as the programming of the

44 mesenchymal cells to smooth muscle cell has just finished and whatever cells did not differentiate could still be present. However, when looking at the bladder smooth muscle layer of newborn mice, one would expect to see a difference in the bladder smooth muscle layer, if there is a phenotype in the MLR19+/- and myocd+/- mice. This was in fact the case; there was a significant difference in the thickness of the smooth muscle layer in both the MLR19+/- and myocd+/- genotypes when compared to the wild type animals (Fig 4.1), even though all three bladders look similar from a gross histological standpoint. The mean smooth muscle layer thickness of the wild type genotype, 195.58 ± 11.96μm, was significantly thicker than the mean smooth muscle layer thickness of both the MLR19+/- genotype, 145.42 ± 10.69μm, and the myocd+/- genotype, 139.48 ± 10.69μm, (p=0.0051 and p=0.0014, respectively). The urinary bladder is a dynamic organ that expands and contracts depending on the amount of urine in the bladder. When a bladder is filling with urine, the bladder smooth muscle relaxes, the bladder expands and all layers of the bladder appear thinner as the bladder gets larger. When the bladder empties, the muscle contracts and all layers appear thicker. To exclude the possibility that the observed differences in muscle thicknesses between the three genotypes was caused by the degree of bladder expansion, the lumen size of all individuals were measured and compared to the thickness of the smooth muscle layer (fig. 4.2). The lumen areas of the bladders were all relatively similar, and there was not one genotype (either the MLR19+/-, myocd+/-, or wild type) that had a larger lumen area than any of the others. Linear regression analysis supports the conclusion that smooth muscle thickness was not a significant predictor of lumen area (p=0.32) in the bladders analyzed, suggesting that the bladders were all contracted to roughly the same size. Furthermore, genotype was not a significant predictor of lumen area (p=0.49). These findings indicate that the differences seen in the thickness of the smooth muscle layer of the bladder are due to the differences in the genotypes (MLR19+/-, myocd+/-, or wild type) and not due to differences in size or contractedness of the bladder. These data indicate that moderate reductions in myocd, affect the differentiation of the smooth muscle cells in the bladder. While a 50% reduction of myocd mRNA, as seen in the myocardin heterozygous animals, is a significant reduction, enough myocardin remains for sufficient bladder smooth muscle development to maintain seemingly normal bladder function. However, an 82% reduction is not sufficient and bladder function is impaired (as seen in the MLR19-/- animals). One hypothesis that remains to be tested based on these results, is that there

45 could be a critical amount of myocardin expression needed in the bladder to get sufficient smooth muscle, and that the level of myocardin needed is between 50 and 18% of the normal myocardin levels. A second possibility for these findings is that there could be an isoform of myocardin that has yet to be described that is necessary for urinary bladder smooth muscle, and that the MLR19 mutation is somehow affecting this isoform. This would explain how the bladder is severely affected in the MLR19-/- and MLR19-/myocd- mice.

46 Table 4.1 Mean thickness of the smooth muscle layer in the MLR19+/- (n=10), Wild type (n=8), and Myocd+/- (n=10) newborn bladders in μm and includes standard error.

Genotype # MLR19+/‐ Wild type myocd+/‐ 1 148.96 ±3.88 200.09 ±6.52 265.74 ±8.57 2 196.67 ±5.33 182.50 ±4.36 133.97 ±6.76 3 157.57 ±6.03 232.57 ±8.85 120.74 ±4.66 4 154.98 ±6.05 187.58 ±6.67 107.01 ±4.71 5 144.42 ±4.35 157.40 ±6.26 122.38 ±4.40 6 128.21 ±7.44 207.88 ±5.41 105.82 ±6.97 7 122.68 ±5.28 180.20 ±4.47 137.81 ±3.97 8 120.23 ±6.37 216.66 ±6.87 115.82 ±4.10 9 155.36 ±5.95 157.11 ±7.11 10 125.20 ±6.03 128.34 ±3.30 Mean 145.42 ±10.69 195.58 ±11.96 139.48 ±10.69

A B C

MLR19+/- WT Myocd+/-

D 500

450 * 400

350

300 * min

250 med

200 max

150 Mean

100

0 MLR19 +/‐ Wild Type Myocd +/‐

Fig. 4.1 H&E staining of MLR19+/- (A), wild type (B), and Myocd +/- (C) newborn (P0) bladders. There is no gross anatomical or physiological difference in the urinary bladder in either the MLR19+/- (A) or myocd +/- (C) compared to the Wild type bladder (B). Scale bar is 500 μm. (D) A box plot showing the difference of the bladder smooth muscle between the three genotypes. Both the MLR19+/- (n=10) and Myocd+/- (n=10) genotype bladder muscle layers are significantly thinner than the wild type genotype (n=8) (P=0.0051 and P=0.0014 respectively). There is no significant difference between the MLR19 +/- and the Myocd +/- smooth muscle layers (P=0.92).In the Myocd +/- samples, there was one bladder that was considerably thicker than the rest, as indicated by the large max value on the plot.

Fig. 4.2. Smooth muscle (SM) thickness as a function of lumen area and genotype. In the individuals analyzed, the lumen area of the bladders were all relatively similar, with no genotype having a larger lumen area than the other two. Linear regression analysis supported the conclusion that the thickness of the smooth muscle for was not a significant predictor of lumen area (p=0.32) for any of the animals, indicating the bladders were all contracted to the same approximate size. Furthermore, the genotype of the individual, either MLR19 heterozygous, myocardin heterozygous, or wild type, was not a significant predictor of lumen area (p=0.49).

49 CHAPTER 6. Conclusion

Obstructive uropathies are any condition in which there is blockage of urine flow in the urinary tract. These blockages can be at any level of the urinary system (Roth et al. 2002, Becker and Baum 2006) and include: kidney stones, ureterocoele, urethral valve blockages, and conditions like prune belly syndrome where there is severe distention of the urinary bladder. Without treatment to fix or remove the obstruction, side effects such as dilation of the ureters (hydroureter) or kidneys (hydronephrosis) may occur leading to end stage renal disease (ESRD) and death (Peters 1995, Roth et al. 2002). Obstructive uropathies are the leading cause of ESRD in children in North America accounting for nearly 22% of the cases (Benfield et al. 2003, Warady and Chadha 2006). To date, there are very few natural or genetic animal models that consistently develop hydronephrosis as a result of a functional hydrostatic obstruction. It was recently reported that a transgenic mouse line, MLR19 megabladder mice develop hydroureteronephrosis when homozygous for the transgene insertion due to the lack of smooth muscle development in the urinary bladder (Singh et al. 2007). Thus these mice provide an excellent model in which to study obstructive uropathies. In this study I analyze the MLR19 transgenic mice to determine why these mice fail to develop smooth muscle in the bladder and what gene is responsible for this phenotype. As seen in the Singh et al. (2008) findings, the MLR19-/- mice have significant reductions in genes along the SRF/myocardin pathway, suggesting that whatever gene being affected is near the top of this pathway. The SRF/myocardin pathway is critical for the transcription of many smooth muscle contractile proteins in smooth muscle tissues (McDonald etl al. 2006, Huang et al. 2008, Long et al. 2008). The transgene insertional mutation in the MLR19 mice is fairly close to the myocardin gene on chromosome 11, making myocardin a promissing candidate gene that could be affected by the MLR19 mutation. To determine if myocardin was a relevant gene, MLR19+/- mice were bred with myocd+/- to produce MLR19-/myocd- offspring. In these compound MLR19-/myocd- heterozygote pups, the mice should phenocopy the megabladder phenotype if myocardin is the relevant gene. The compound heterozygous animals did phenocopy the MLR19-/- megabladder phenotype, which indicated that myocardin was the relevant gene being affected in the MLR19 transgenics. Immunostaining for Smooth muscle alpha actin indicated that very little smooth muscle differentiation is taking place. Smooth muscle development along the bladder ranged from

50 portions where only a single layer of smooth muscle developed, to places along the same bladder that do not have any smooth muscle cells at all. RT-PCR analysis (McHugh, unpublished data) indicated that myocardin was significantly reduced (82%) in the bladder, which may explain the small amounts of smooth muscle cells that were observed. While others have shown that myocardin is highly expressed in the bladder (Wang et al. 2002, Du et al. 2003), this is the first report that reductions in myocardin expression in the bladder have a significant impact on the amount of smooth muscle that ultimately forms. The reduction of myocardin in the bladder and the subsequent lack of smooth muscle in the MLR19-/- mice prompted me to look at both MLR19+/- and myocd+/- bladders, where there are known reductions of myocardin mRNA (40% and 50%, respectively -McHugh, unpublished data), to see if there were any alterations in the bladder smooth muscle. To confirm that any differences observed in the thickness of the smooth muscle was a factor of the genotype (and reduction of myocardin levels) and not a factor of how expanded or contracted the bladder were, the lumen areas of the bladders were also measured. In the animals that were analyzed, the lumens were the same approximate size, indicating the bladder were all the same size. However there were significant reductions in the thickness of the smooth muscle layer in both the MLR19+/- and the myocd+/- bladders when compared to wild type animals. This is the first reported bladder phenotype in the myocd+/- and MLR19+/- mice. While there was a significant reduction in thickness of the smooth muscle layer to coincide with the reduction of myocardin levels, the amount of smooth muscle present in the MLR19+/- and myocd+/- bladders was sufficient for normal bladder function. It is clear, however, that in the bladder, any reduction of myocardin expression will have an impact on the amount of smooth muscle that differentiates. Future work needs to be done to determine what aspect of the MLR19 insertional mutation, either the insertion of the 1Mb from chromosome 16 or the deletion of the 24kb from chromosome 11 (or both) causes the megabladder phenotype. To this end, the knockout construct for the 24kb region is the first step. If the mice homozygous for the deletion also lack smooth muscle in the bladder, we will know there is an element within the 24kb region that is critical for the smooth muscle development in the bladder. If there is no phenotype in the homozygous knockouts, the results would suggest that some aspect of the insertion of the 1MB of chromosome 16 may be responsible for the phenotype. With this information the MLR19 mutant mice will be a powerful tool to not only study the progression of disease state in

51 hydroureteronephrosis, but also provide valuable information on the process and signaling required for urinary bladder smooth muscle development.

52 Appendix A

Western blots analysis using 200 μg of total protein in (A) embryonic day 15 (E15) (B) newborn, (C) adult wild type tissues for myocardin revealed a unique protein band in the urinary bladder. The E15 tissues (A) are blotted with the myocardin M-16 myocardin antibody (Santa Cruz Biotechnology), a goat synthetic peptide polyclonal antibody consisting of approximately 20 amino acids located between amino acids 881-931 of the mouse myocardin, and mapping to the C-terminus. The newborn and adult tissues (B and C) are blotted with H-300 myocardin antibody (Santa Cruz Biotechnology), a rabbit polyclonal antibody raised against recombinant myocardin amino acids 639-938 located at the C-terminus of human myocardin. In heart tissue from all ages (first lane in A,B, and C) both the cardiac (101kDa) and smooth muscle (92kDa) isoforms of myocardin are present, but can be most clearly distinguished in B (arrows indicate the smooth muscle isoform, and the arrowhead indicates the cardiac isoform). The published smooth muscle isoform is also present in the intestine and also present in low quantities in the lung. In the bladder at the three time points analyzed the smooth muscle isoform is present, as expected, along with a protein band at approximately 135kDa (indicated with a red circle). This protein band is not present in any of the other tissues analyzed (some can be seen in liver in Fig. A and B, but this is due to overflow of protein from the bladder lane). This approximately 135kDa protein band is present even after immunoprecipitation using the myocardin H-300 antibody and blotting with both the H-300 and M-16 myocardin antibodies (data not shown). This preliminary data may suggest that there is a unique isoform of myocardin in the urinary bladder. Further work must be done to confirm the identity of this protein and determine whether this protein plays a role in the MLR19-/- megabladder phenotype.

A E15 total Protein

B Newborn (P0) total protein

C Adult total protein

54 LITERATURE CITED

Ames, R., Sarau, H., Chambers, J., Willette, R., Alyar, N., Romanic, A., Louden, C., Foley, J., Sauermelch, C., Coatney, R., Ao, Z., Disa, J., Holmes, S., Stadel, J., Martin, J., Lui, W., Glover, G., Wilson, S., Mcnulty, E., Ellis, C., Elshourbagy, N., Shabon, U., Trill, J., Hay, D., Ohlstin, E., Bergsma, D., Douglas, S. (1999). Human urotensin-II is a potent vasoconstrictor and agonist for the orphan GPR14. Nature. 401, 282-286.

Barendrecht, M.M., Mulders, A.C.M., van der Poel, H., van den Hoff, M.J.B., Schmidt, M., Michel M.C. (2007). Role of transforming growth factor b in rad bladder smooth muscle cell proliferation. J. Pharmacol. Exp. Ther. 322, 117-122.

Bascands, J.P., and Schanstra, J.P. (2005). Obstructive nephropathy: Insights from genetically engineered animals. Kidney Int. 68, 925-937.

Baskin, L.S., Hayward, S.W., Young, P., Cunha, G.R. (1996a). Role of Mesenchymal-epithelial interactions in normal bladder development. J. Urol. 156, 1820-1827.

Baskin, L.S., Sutherland, R.S., Thomson, A.A., Hayward, S.W., Cunha, G.R. (1996b). Growth factors and receptors in bladder development and obstruction. Lab Investigation. 75, 157-166.

Baskin L.S., Hayward, S.W., Sutherland, R.A., DiSandro, M.S., Thomson, A.A., Cunha, G.R. (1997). Cellular signaling in the bladder. Front Biosci. 2, 592-595.

Baskin L., DiSandro, M., Li, Y., Li, W., Hayward, S., Cunha, G. (2001). Mesenchymal- epithelial interactions in bladder smooth muscle development: Effects of the loval tissue environment. J. Urol. 165, 1283-1288.

Becker, A., Baum, M. (2006). Obstructive uropathy. J Earl Hum Dev. 82, 15-22.

Benfield, M.R., McDonald, R.A., Bartosh, S., Ho, P.L., Harmon, W. (2003). Changing trends in pediatric transplantation: 2001 annual report of the north American pediatric renal transplant cooperative study. Pediatr. Transplant. 7, 321-335.

Cao, D., Wang, Z., Zhang, C.L., Oh, J., Xing, W., Li, S., Richardson, J.A., Wang, D.Z., Olson, E.N. (2005). Modulation of smooth muscle gene expression by association of histon acetlytransferases and deacetylases with myocardin. Mol. Cell. Biol. 25, 364-376.

Carey, R.M. (2005). Cardiovascular and renal regulation by the angiotensin type 2 receptor: The AT2 receptor comes of age. Hypertension. 45, 840-844.

Cattanach, B.M., Kirk, M. (1985). Differential activity of maternally and paternally derived chromosome regions in mice.

55 Chevalier, R.L., Peters, C.A., (2003). Congenital urinary tract obstruction: Proceedings of the State-Of-The-Art Strategic Planning Workshop- National Institute of Health, Bethesda, Maryland, USA, 11-12 March 2002. Pediatr Neprol. 18, 576-606.

Clark D.A., Coker, R. (1998). Transforming growth factor-beta (TGF-beta). Int. J. Biochem. Cell. Biol. 30, 293-298.

Creemers, E.E., Sutherland, L.B., Oh, J., Barbosa, A.C., Olson, E.N. (2006a). Coactivation of MEF2 by the SAP domain proteins of myocardin and MASTR. Mol. Cell. 23, 83-96.

Creemers, E.E., Sutherland, L.B., McAnally, J., Richardson, J.A., Olson, E.N. (2006b). Myocardin is a direct transcriptional target of Mef2, Tead, and Foxo proteins during cardiovascular development. Development. 133, 4245-4256.

Du, K.L., Chen, M., Li, J., Lepore, J.J., Mericko, P., Parmacek, M.S. (2004). Megakaryoblastic leukemia factor-1 transduces cytoskeletal signals and induces smooth muscle cell differentiation from undifferentiated embryonic stem cells. J. Biol. Chem. 279, 17578-17586.

Du, K.L., Ip, H.S., Li, J., Chen, M., Dandre, F., Yu, W., Lu, M.M., Owens, G.K., Parmaceck, M.S., (2003). Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol. Cell. Bio. 23, 2425-2437.

Haraguchi, R., Motoyama, J., Sasaki, H., Satoh, Y., Miyagawa, S., Nakagata, N., Moon, A., Yamada, G. (2007). Molecular analysis of coordinated bladder and urogenital organ formation by hedgehog signaling. Development. 134, 525-533.

Horton Jr., C.E., Davisson, M.T., Jacobs, J.B., Bernstein, G.T., Retik, A.B., Mandaell, J. (1988). Congenital progressive hydronephrosis in mice: A new recessive mutation. J. Urol. 140, 1310- 1315.

Huang, J., Cheng, L., Li, J., Chen, M., Zhou, D., Lu, M.M., Proweller, A., Epstein, J.A., Parmacek, M.S. (2008). Myocardin regulates expression of contractile genes in smooth muscle cells and is required for closure of the ductus arteriosus in mice. J. Clin. Invest. 118, 515-525.

Li , J., Shiroyanagi, Y., Lin, G., Haqq, C., Lin, C.S., Lue T.F., Willingham, E., Baskin, L.S. (2006). Serum response factor, its cofactors, and epithelial-mesenchymal signaling in urinary bladder smooth muscle formation. Differentiation. 74, 30-39.

Li, S., Wang, D., Wang, Z., Richardson, J.A., and Olson, E.N. (2003). The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci USA. 100, 9366-9370.

Liu, P., Jenkins, N.A., Copeland, N.G. (2003). A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res. 13, 476-484.

56 Liu, Q., Pong, S., Zeng, Z., Zhang, Q., Howard, A., Williams, D., Davidoff, M., Wang, R., Austin, C., McDonald, T., Bai, C., George, S., Evans, J., Caskey, C. (1999). Identification of urotensin II as the endogenous ligan for the orphan G-protein coupled receptor GPR14. Biochem Biophys. Res. Comm. 266, 174-178.

Long, X., Creemers, E.E., Wang, D.Z., Olson, E.N., Miano, J.M. (2007). Myocardin is a bifunctional switch for smooth versus skeletal muscle differentiation. Proc Natl Acad Sci USA. 42, 16570-16575.

Long, X., Bell, R.D., Gerthoffer, W.T., Zlokovic, B.V., Miano, J.M. (2008). Myocardin is sufficient for a smooth muscle-like contractile phenotype. Arterioscler. Thromb. Vasc. Biol. 28, 1505-1510.

McDill, B.W., Li, S.Z., Kovach, P.A., Ding, L., Chen, F. (2006). Congenital progressive hydronephrosis (cph) is caused by an S256L mutation in aquaporin-2 that affects its phosphorylation and apical membrane accumulation. Proc Natl Acad Sci USA. 103, 6952-6957.

McDonald, O.G., Wamhoff, B.R., Hootnagle., M.H., Owens, G.K. (2006). Control of SRF biding to CArG box chromatin regulates smooth muscle gene expression in vivo. J. Clin. Invest. 116, 36-48.

McHugh, K.M. (1995). Molecular analysis of smooth muscle development in the mouse. Dev. Dyn. 204, 2778-290.

Miano J.M. (2003). Serum response factor: Toggling between disparate programs of gene expression. J. Mol. Cell. Cardiol. 35, 577-593.

Milyavsky, M., Shats, I., Cholostoy, A., Brosh, R., Buganim, Y., Weisz, L., Kogan, I., Cohen, M., Shatz, M., Madar, S., Kalo, E., Goldfinger, N., Yuan, J., Ron, S., MacKenzie, K., Eden, A., Rotter, V. (2007). Inactivation of myocardin and p16 during malignant transformation contributes to a differentiation defect. Cancer Cell. 11, 133-146.

Miyazaki, Y., Oshima, K., Fogo, A., Hogan, B.L., Ichikawa, I. (2000). Bone morphogenetic protein 4 regulates the budding site and elongation of the mouse ureter. J. Clin. Invest. 105, 863-873.

Moore, M.W., Klein, R.D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L.F., Ryan, A.M., Carver-Moore, K., Rosenthal, A. (1996). Renal and neuronal abnormalities in mice lacking GDNF. Nature. 382, 76-79.

Morris, R.K., Kilby, M.D. (2008). Congenital urinary tract obstruction. Best Pract. Res. Clin. Obstet. Gynaecol. 22, 97-122.

Nagy,A., Gertsenstein, M., Vintersten, K., Behringer, R. (2003). Manipulating the mouse embryo: A laboratory manual. (3rd ed.), Cold Spring Harbor Laboratory Press.

57 Nishimura, H., Yerkes, E., Hohenfellner, K., Miyazaki, Y., Ma, J., Hunley, T.E., Yoshida, H., Ichiki, T., Threadqill, D., Phillips, J.A. 3rd, Hogan, B.M., Fogo, A., Brock, J.W. 3rd, Inagami, T., Ichikawa, I. (1999). Role of the angiotensin type 2 receptor gene in congenital anomalies of the kidney and urinary tract, CAKUT, of mice and men. Mol. Cell. 3, 1-10.

Peters, C.A. (1995). Urinary tract obstruction in children. J. Urol. 154, 1874-1884.

Peters, C.A. (1997). Obstruction of the fetal urinary tract. J. Am. Soc. Nephrol. 8, 653-663.

Peters, C.A. (2001). Animal models of fetal renal disease. Prenat Diagn. 21, 917-923.

Pichel, J.G., Shen, L., Sheng, H.Z., Granholm, A.C., Drago, J., Grinberg, A., Lee, E.J., Huang, S.P., Saarma, M., Hoffer, B.J., Sariola, H., Westphal, H. (1996). Defects in enteric innervations and kidney development in mice lacking GDNF. Nature. 382, 73-76.

Pipes, G.C., Creemers, E.E., Oslon, E.N. (2006). The myocardin family of transcriptional coactivators: Versatile regulators of cell growth, migration, and myogenesis. Genes Dev. 20, 1545-1556.

Roth, K.S., Koo, H.P., Spottswood, S.E., Chan, J.C.M. (2002). Obstructive uropathy: An important cause of chronic renal failure in children. Clin. Ped (Phila). 41,309-314.

Schuchardt, A., D’Agati, V., Pachnis, V., Constantini, F. (1996). Renal agenesis and hypodysplasia in ret-k- mutant mice result from defects in ureteric bud development. Devlopment. 122, 1919-1929.

Searle, A.G., Beechey, C.V., Eicher, E.M., Nesbitt, M.N., Washburn, L.I. (1979). Colinearity in the mouse genome: A study of chromosome 2. Cytogenet. Cell Genet. 23, 255-263.

Shastry, B.S. (1995). Genetic knockouts in mice: an update. Experientia. 51, 1028-1039.

Shats, I., Milyavsky, M., Cholostoy, A., Brosh, R., Rotter, V. (2007). Myocardin in tumor suppression and myofibroblast differentiation. Cell Cycle. 6, 1141-1146.

Shiroyanagi, Y., Liu, B., Cao, M., Agras, K,. Li, J., Hsieh, M.H., Willingham, E.J., Baskin, L.S. (2007). Urothelial sonic hedgehog signaling plays in important role in bladder smooth muscle formation. Differentiation. 75, 968-977.

Singh, S., Robinson M., Nahi F., Coley B., Robinson M.L., Bates C.M., Kornacker K., and McHugh K.M. (2007). Identification of a unique transgenic mouse line that develops megabladder, obstructive uropathy, and renal dysfunction. J Am Soc Nephrol. 18, 461-471.

Singh, S., Robinson, M., Ismail, I., Saha, M., Auer, H., Kornacker K., Robinson, M.L., Bates, C.M., McHugh, K.M. (2008). Transcriptional profiling of the megabladder mouse: A unique model of bladder dysmorphogenesis. Dev. Dyn. 237, 170-186.

58 Staack, A., Danjacour, A.A., Brody, J., Cunha, G.R., Carroll, P. (2003). Mouse urogenital development: A practical approach. Differentiation. 71, 402-413.

Sugo, T., Murakami, Y., Shimomura, Y., Harada, M., Abe, M., Ishibashi, Y., Kitada, C., Miyajima, N., Suzuki, N., Mori, M., Fujino, M. (2003). Identification of urotensin II-related peptide as the urotensin II-immunoreactive molecule in the rat brain. Biochem Biophys. Res Comm. 310, 860-868.

Tang, R.H., Zheng, X.L., Callis, T.E., Stansfield, W.E., He, J., Baldwin, A.S., Wang, D.Z., Selzman, C.H. (2008). Myocardin inhibits cellular proliferation by inhibiting NF-κΒ(p65)- dependent cell cycle progression. Proc Natl Acad Sci USA. 105, 3362-3367.

Ueyama, T., Kasahara, H., Ishiwata, T., Nie, Q., Izumo, S. (2003). Myocardin expression is regulated by nkx2.5, and its function is required for cardiomyogenesis. Mol. Cell. Biol. 23, 9222-9232.

Wang, D.Z., Chang, P.S., Wang, Z., Sutherland, L., Richardson, J.A., Small, E., Krieg, P.A., Olson, E.N. (2001). Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell. 105, 851-862.

Warady, B.A., Chadha, V. (2007). Chronic kidney disease in children: The global perspective. Pediatr. Nephrol. 22, 1999-2009.

Weed, M., Mundlos, S., Olsen, B.R. (1997). The role of sonic hedgehog in vertebrate development. Matrix Biol. 16, 53-58.

Winnier, G., Blessing, M., Labosky, P., Hogan, B. (1995). Bone morphgenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 9, 2105-2116.

Yoshida, T., Sinha, S., Dandre, F., Wamhoff, B.R., Hoofnagle, M.H., Kremer, B.E., Wang, D.Z., Olson, E.N., Owens, G.K. (2003). Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ. Res. 92, 856-864.