BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Survival transcriptome in coenzyme Q10 deficiency syndrome is acquired by epigenetic modifications: a modelling study for human coenzyme Q10 deficiencies.
For peer review only Journal: BMJ Open
Manuscript ID: bmjopen-2012-002524
Article Type: Research
Date Submitted by the Author: 20-Dec-2012
Complete List of Authors: Fernández-Ayala, Daniel; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Guerra, Ignacio; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Jiménez-Gancedo, Sandra; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Cascajo, Maria; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Gavilán, Ángela; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III,
DiMauro, Salvatore; Columbia University Medical Center, Department of http://bmjopen.bmj.com/ Neurology Hirano, Michio; Columbia University Medical Center, Department of Neurology Briones, Paz; Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, ; CIBERER, Instituto de Salud Carlos III, Artuch, Rafael; Hospital Sant Joan de Déu, Department of Clinical Biochemistry; CIBERER, Instituto de Salud Carlos III, deCabo, Rafael; National Institute on Aging, NIH, Laboratory of Experimental Gerontology Salviati, Leonardo; University of Padova, Clinical Genetics Unit, Department on September 28, 2021 by guest. Protected copyright. of Woman and Child Health Navas, Placido; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III,
Primary Subject Genetics and genomics Heading:
Secondary Subject Heading: Genetics and genomics, Diagnostics
Keywords: Neuromuscular disease < NEUROLOGY, BASIC SCIENCES, GENETICS
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 1 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 2 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 3 4 modifications: a modelling study for human coenzyme Q10 deficiencies. 5 6 7 8 Daniel J. M. Fernández Ayala1,5, Ignacio Guerra1,5, Sandra Jiménez Gancedo1,5, Maria V. Cascajo1,5, 9 10 1,5 2 2 3,5 4,5 11 Angela Gavilán , Salvatore DiMauro , Michio Hirano , Paz Briones , Rafael Artuch , Rafael de 12 6 7,8 1,5,8 13 Cabo , Leonardo Salviati and Plácido Navas 14 15 For peer review only 16 17 1Centro Andaluz de Biología del Desarrollo (CABD CSIC), Universidad Pablo Olavide, Seville, Spain 18 19 2 20 Department of Neurology, Columbia University Medical Center, New York, NY, USA
21 3 22 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 23 24 4Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain 25 26 5CIBERER, Instituto de Salud Carlos III, Spain 27 28 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 21224, 29 30 31 USA 32 7 33 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy http://bmjopen.bmj.com/ 34 35 8 Senior authorship is shared by LS and PN 36 37 38 39 40 Corresponding authors 41 42 Plácido Navas and Leonardo Salviati on September 28, 2021 by guest. Protected copyright. 43 44 Tel (+34)954349381 and (+39) 3471207364 45 46 e mail: [email protected] and [email protected] 47 48 49 50 51 52 53 Word count (abstract): 285 54 Word count (summary) 295 55 Word count (introduction, methods, results and discussion): 2947 56 Tables and Illustrations: 4 57 References: 34 58 59 60 1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 3 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ABSTRACT 3 4 5 6 Objectives 7 Coenzyme Q10 (CoQ10) deficiency syndrome is a rare condition that causes a mitochondrial 8 dysfunction and includes a variety of clinical presentations, as encephalomyopathy, ataxia and renal 9 10 failure. We sought to set up what all have in common and to investigate why CoQ10 supplementation 11 reverses the bioenergetics alterations in cultured cells but not all the cellular phenotypes. 12 13 Design: modelling study 14 This work models the transcriptome of human CoQ10 deficiency syndrome in primary fibroblast from 15 patients and studyFor the genetic peer response to CoQreview10 treatment in these only cells. 16 17 Setting 18 Four hospitals and medical centres from Spain, Italy and USA, and two research laboratories from 19 20 Spain and USA. 21 22 Participants 23 Primary cells were collected from patients in the above centres. 24 25 Measurements 26 We characterized by microarray analysis the expression profile of fibroblasts from seven CoQ10 27 deficient patients (three had primary deficiency, four had a secondary form) and aged matched 28 controls, before and after CoQ supplementation. Results were validated by Q RT PCR. The profile 29 10 30 of DNA (CpG) methylation was evaluated for a subset of gene with displayed altered expression. 31 32 Results 33 CoQ10 deficient fibroblasts (independently from the etiology) showed a common transcriptomic profile http://bmjopen.bmj.com/ 34 that promotes cell survival by activating cell cycle and growth, cell stress responses, and inhibiting cell 35 death and immune responses. Energy production was supported mainly by glycolysis while CoQ10 36 supplementation restored oxidative phosphorylation. Expression of genes involved in cell death 37 pathways was partially restored by treatment, while genes involved in differentiation, cell cycle and 38 growth were not affected. Stably demethylated genes were unaffected by treatment whereas we 39 40 observed restored gene expression in either non methylated genes or those with an unchanged 41 methylation patterns. 42 on September 28, 2021 by guest. Protected copyright. 43 Conclusions 44 CoQ10 deficiency induces a specific transcriptomic profile that promotes cell survival, which is only 45 partially rescued by CoQ10 supplementation. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 4 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 SUMMARY 3 4 5 Article Focus 6 • To analyse the common gene expression profile in primary cell cultures of dermal fibroblasts 7 from patients suffering any of the clinical presentation of the human syndrome of coenzyme 8 Q (CoQ ) deficiency (primary or secondary CoQ deficiency). 9 10 10 10
10 • To exanimate why CoQ10 treatment, the current therapy for all forms of CoQ10 deficiency, 11 restored respiration but not all the clinical phenotypes. 12 • To investigate the stable genetic cause responsible for the survival adaptation to mitochondrial 13 dysfunction due to CoQ10 deficiency. 14 15 For peer review only 16 Key Messages 17 18 • The mitochondrial dysfunction due to CoQ10 deficiency induces a stable survival adaptation of 19 somatic cells in patients at early or postnatal development by epigenetic modifications of 20 chromatin. Deficient cells unable to maintain this survival state during differentiation would 21 death contributing to the pathological phenotype. 22 • Supplementation with CoQ10 restores respiration through enhanced sugar rather than lipid 23 metabolism; partially restores stress response, immunity, cell death and apoptotic pathways; 24 and does not affect cell cycle, cell growth, and differentiation and development pathways. 25 26 • Unaffected genes by CoQ10 treatment corresponded to DNA demethylated genes, whereas 27 those responsive to CoQ10 corresponded to genes with unchanged DNA methylation pattern. 28 These results would approach to explain the incomplete recovery of clinical symptoms after 29 CoQ10 treatment, at least in some patients. 30 31 32 Strengths and Limitations 33 • Human CoQ10 deficiencies are considered rare diseases with low prevalence, which limits the http://bmjopen.bmj.com/ 34 sample size. 35 36 • The genetic heterogeneity of this disease is due to mutations in any of the 11 genes directly 37 involved in the synthesis of CoQ10 inside mitochondria, or other mutations altering somehow 38 the mitochondria and its metabolism, affecting their inner CoQ10 synthesis as a side effect, will 39 course with CoQ10 deficiency. 40 • Among this genetic heterogeneity, all cells showed a common transcriptomic profile that 41
justified their pathological phenotype, responded equally to CoQ10 treatment, and presented the on September 28, 2021 by guest. Protected copyright. 42 same DNA methylation pattern. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 5 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 KEY WORDS 3 4 Coenzyme Q, CoQ10 deficiency, transcriptome, epigenetic, human fibroblast 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 4 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 6 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 INTRODUCTION 3 4 Coenzyme Q10 (CoQ10) is a small electron carrier which is an essential cofactor for several 5 6 mitochondrial biochemical pathways such as oxidative phosphorylation (OXPHOS), beta oxidation, 7 8 and pyrimidine nucleotide biosynthesis. CoQ biosynthesis depends on a multi enzyme complex1 that 9 10 10 11 involves at least ten proteins encoded by COQ genes. Mutations in any of these genes cause primary 12 2 13 CoQ10 deficiencies, which are clinically heterogeneous mitochondrial diseases . Clinical presentations 14 15 include encephalomyopathyFor peerwith lipid storage review myopathy and myoglobinuria only3; ataxia and cerebellar 16 17 atrophy4; severe infantile encephalomyopathy with renal failure5; isolated myopathy6; and nephrotic 18 19 7 8 20 syndrome . Secondary CoQ10 deficiency has also been associated with diverse mitochondrial diseases
21 13 14 15 22 . In all of these conditions, CoQ10 supplementation partially improves symptoms and usually 23 8 16 17 24 induces a return to normal growth and respiration in CoQ10 deficient fibroblasts . Adaptation of 25 26 somatic cells to CoQ10 deficiecny may affect both onset and course of the disease. Here, we document 27 28 common transcriptomic profile alterations in somatic cells of CoQ deficienct patients, their response to 29 30 31 CoQ10 supplementation, and the relationship with the DNA methylation status of specific genes. 32 33 http://bmjopen.bmj.com/ 34 35 36 37 MATERIALS AND METHODS 38 39 40 41 42 Cells on September 28, 2021 by guest. Protected copyright. 43 44 Primary skin fibroblasts from CoQ10 deficient patients and from aged matched controls, at similar 45 46 culture passage, were cultured at 37°C using DMEM 1 g/L Glucose, L Glutamine, Pyruvate 47 48 (Invitrogen, Prat de Llobregat, Barcelona) supplemented with an antibiotic/antimycotic solution 49 50 51 (Sigma Chemical Co., St. Louis, Missouri) and 20% fetal bovine serum (FBS, Linus). When required, 52 53 CoQ10 pre diluted in FBS was added to the plates at a final concentration of 30 M (Coenzyme Q10, 54 55 Synthetic Minimun 98%, HPLC, Sigma). We studied five patients with primary CoQ10 deficiency: two 56 57 siblings harbored a homozygous p.Y297C mutation in the COQ2 gene5, two others with a pathogenic 58 59 60 5 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 7 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 mutation (c.483G>C) in the COQ4 gene (this paper), and another one with haploinsufficiency of 3 18 4 COQ4 . Patients with secondary CoQ10 deficiency included: a MELAS patient harboring the 5 6 m.3243A>G in the mitochondrial tRNALeu(UUR) with 43% heteroplasmy level8; a patient with mtDNA 7 8 12 4 9 depletion syndrome , and a third patient with ataxia of unknown origin . Table 1 summarizes the 10 11 clinical phenotype and biochemical studies of these patients. 12 13 14 15 TranscriptomeFor analysis peer review only 16 17 RNA extraction, probe synthesis and hybridization with two independent expression arrays 18 19 20 (GeneChip® Human Genome U133 Plus 2.0 and GeneChip® Human Gene 1.0 ST, Affymetrix) were 21 19 22 used as described . Gene expression was validated by the MyiQ™ Single Color Real Time PCR 23 24 Detection System (Biorad). See supplementary methods for full description. 25 26 Data had been deposited with the NCBI GEO database, at http://www.ncbi.nlm.nih.gov/geo/, 27 28 29 accession number GSE33941 (this SuperSeries is composed of two subset Series, see supplementary 30 31 table 7 for an explanation). 32 33 Statistical analyses were performed comparing each signal of patient’s fibroblasts RNA with the http://bmjopen.bmj.com/ 34 35 corresponding signal of control RNA by two different approaches. The main statistical analysis for 36 37 both GeneChip® Human Genome U133 Plus 2.0 Array and GeneChip® Human Gene 1.0 ST Array was 38 39 19 40 achieved as previously described , which selects the most significant genes commonly and equally 41 42 regulated in all samples using very stringent parameters. In a few special cases, other unselected but on September 28, 2021 by guest. Protected copyright. 43 44 regulated genes were studied because of their role in specific processes and pathways. They were 45 46 equally described in table 2. The second statistical analysis approach for the Gene Ontology study was 47 48 20 49 done as previously described and analyzes the most altered biological processes and pathways using 50 51 a lower stringency analysis, which permits to select the hundred most altered Gene Ontologies (GO) in 52 53 different functional categories (supplementary table 4) and the hundred more distorted pathways 54 55 (supplementary table 5) that had been regulated in CoQ10 deficient cells. GO regulated in both 56 57 independent analysis of primary and secondary CoQ deficiency (supplementary table 3), and those 58 10 59 60 6 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 8 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 regulated by CoQ10 supplementation (supplementary table 9) were studied using the GORILLA 3 4 software (Gene Ontology enrichment analysis and visualization tool), at http://cbl 5 6 gorilla.cs.technion.ac.il/21. Full description of statistical analysis be found in the supplementary 7 8 material. 9 10 11 12 13 Epigenetic analysis 14 15 DNA (CpG) methylationFor analysis peer was perform review using a base specific only cleavage reaction with bisulphite 16 17 combined with mass spectrometric analysis (MassCLEAVE™). For the statistical analysis, the CpGs’ 18 19 20 methylation degree for each gene was analyzed with the MultiExperiment Viewer software developed
21 22 22 by Saeed . See supplementary methods for full description. 23 24 25 26 27 28 RESULTS 29 30 31 32 33 Transcriptome analysis http://bmjopen.bmj.com/ 34 35 We studied skin fibroblasts from four patients with primary CoQ10 deficiency and three patients with 36 37 secondary CoQ10 deficiency (Table1). We analyzed the transcriptomic profiles and compared them 38 39 40 with those of cells from age matched control idividuals, and evaluated and modifications induced by 41
8 16 17 on September 28, 2021 by guest. Protected copyright. 42 supplementation with 30 µM CoQ10 for one week to allow recovery of ATP levels . A very 43 44 stringent analysis selected the most significant genes displaying a common and equally altered 45 46 expression in all samples (summarized in Table 2 and shown with full details in supplementary table 47 48 49 1). Other genes unselected by this analysis, but still abnormally expressed were also included in the 50 51 study because of their role in specific processes and pathways, such as NADH mobilization, cell cycle 52 53 and immunity (supplementary table 1), and energetic metabolism (supplementary table 2). Gene 54 55 ontology (GO) classification of these genes showed similar profiles when comparing independently 56 57 primary and secondary deficient fibroblasts (supplementary table 3). A lower stringency analysis 58 59 60 7 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 9 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 showing the most altered biological processes and pathways selected the one hundred most altered GO 3 4 in different functional categories (supplementary table 4 online) and the one hundred more distorted 5
6 pathways (supplementary table 5 online) in CoQ10 deficient cells. See supplementary data for 7 8 description of statistical analyses. 9 10 11 CoQ10 treatment modified the specific transcriptomic profile displayed by CoQ10 deficient fibroblasts 12 13 (supplementary tables 6 and 7 online). We classified genes into 5 groups according to the consequence 14 15 of CoQ10 treatmentFor on gene expressionpeer (supplementary review table 8 online only and supplementary figure 1 for a 16 17 graphical view). About 54% of probes with altered expression were unaffected by CoQ10 18 19 20 supplementation. 36% of probes showed partial or complete normalization of expression and 2% 21 22 showed inverse regulation. Approximately 5% of probes were specifically altered after treatment in 23 24 both deficient and non deficient cells and 3% showed small or non specific changes (these were not 25 26 considered for further analysis). After statistical analysis, we obtained 70 altered GO with a significant 27 28 P value (<0.001) and an enrichment value that represents the most altered GO within each group 29 30 31 (supplementary table 9). 32 33 Data have been deposited with the NCBI GEO database, at http://www.ncbi.nlm.nih.gov/geo/, http://bmjopen.bmj.com/ 34 35 accession number GSE33941 (see supplementary table 10 for an explanation). The functional 36 37 description of each gene was updated from the GeneCard of The Human Gene Compendium 38 39 40 (Weizmann Institute of Science), http://www.genecards.org/. See supplementary data for a full 41 42 description of genes, biological process and pathways regulated in CoQ10 deficiency. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 CoQ10-deficient fibroblasts readapt the energetic metabolism and CoQ10-treatment restores 47 48 In CoQ deficient fibroblasts, mitochondrial functions, including respiratory chain and tricarboxylic 49 10 50 51 acid (TCA) cycle, were repressed, whereas 9 of 10 steps in glycolysis and pyruvate metabolism were 52 53 activated, including lactate and pyruvate dehydrogenases (supplementary tables 2 and 4). Accordingly, 54 55 genes involved in the negative regulation of glycolysis were down regulated, whereas those involved 56 57 in its activation were up regulated (supplementary table 2). Furthermore, genes involved in cytosolic 58 59 60 8 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 10 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 NADH oxidation (cytochrome b5 and several oxidoreductases) were slightly repressed (Table 2). The 3 4 expression of genes involved in cholesterol and fatty acid metabolism was down regulated (Table 2), 5 6 as well all the GO related with lipid metabolism (supplementary table 5). 7 8 CoQ supplementation normalized the expression (either partially or completely) of genes involved in 9 10 10 11 the glycolytic pathway and activated the expression of repressed respiratory chain genes, whereas the 12 13 TCA cycle remained unaffected (supplementary table 2). Most of the repressed enzymes of lipid 14 15 metabolism andFor fatty acid ß oxidationpeer remained review down regulated (tableonly 2), whereas several other 16 17 pathways, such as monocarboxylic acid transport and the insulin response, were normalized 18 19 20 (supplementary table 9). These results are in agreement with the recovery of aerobic metabolism
21 8 16 17 22 observed in CoQ10 deficient fibroblasts after CoQ10 supplementation . 23 24 25 26 CoQ10 deficiency induces specific adaptations of cells to promote survival 27 28 The major novel finding of transcriptome profiling in CoQ deficient fibroblasts was the altered 29 10 30 31 expression of genes concerned with cell cycle and development and with resistance to stress and cell 32 33 death (table 2). This suggests both a remodeling of differentiation and growth maintenance and an http://bmjopen.bmj.com/ 34 35 increase of cell survival mechanisms. Specifically, genes involved in cell cycle activation and 36 37 maintenance were up regulated, and genes involved in cell cycle regulation increased or decreased 38 39 40 their expression depending of their activating or repressing roles. This proliferative response was also 41 42 enhanced by the repression of cellular attachment factors and by the activation of extracellular matrix on September 28, 2021 by guest. Protected copyright. 43 44 proteins that reduce cell attachment and favor cell division. In parallel, GO clusters favoring cell cycle 45 46 and cell division were activated, and those inhibiting cell growth were repressed (supplementary table 47 48 4). The differentiation of these cells was compromised because many required factors, transducers, 49 50 51 antigens, and structural proteins appeared down regulated, whereas repressors of differentiation during 52 53 development were overexpressed (table 2). See supplementary material for a full description of genes, 54 55 biological processes and related pathways. 56 57 58 59 60 9 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 11 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Cell cycle activation was supported by the up regulation of CDK6 (Table 2), a cyclin dependent 3 4 kinase that induces entry into the S phase, and by a robust repression (more than 9 fold) of 5 6 p21/CDKN1A, an inhibitor of cyclin dependent kinase that blocks cell cycle at the G1/S check point to 7 8 stimulate cell differentiation. Moreover, subsequent pathways inactivated by p2123 were enhanced in 9 10 11 CoQ10 deficient cells (supplementary table 5), as well as both transcription factors E2F7 and E2F8 12 24 13 (table 2), which push the progression of the cell cycle, activate cell survival and inhibit apoptosis . 14 15 Cell survival in ForCoQ10 deficient peer cells was improvedreview by the induction only of DNA repairing mechanisms, 16 17 and by the establishment of pathways that regulate Jun kinases and activate NAD(P)H CoQ 18 19 20 oxidoreductase, which are involved in stress responses (Tables 2 and S4). Components of apoptosis 21 22 and cell death pathways were systematically repressed (Table 2), including tumor suppressor genes, 23 24 antigens, intracellular mediators, and effectors of cell death. Also, cell surface receptors and 25 26 modulators that inhibit apoptosis were greatly activated. 27 28 Interestingly, CoQ treatment did not alter the newly acquired resistance to cell death in CoQ 29 10 10 30 31 deficient fibroblasts, kept cell growth activated, and allowed a higher degree of differentiation (Tables 32 33 2 and S8). However, genes controlling stress resistance pathways and cortical cytoskeleton were http://bmjopen.bmj.com/ 34 35 completely restored, as indicated by the shifts in gene expression listed in Table 2. However, treated 36 37 fibroblasts kept the DNA repair mechanism activated. 38 39 40 Signaling related genes and pathways were differentially affected by CoQ10 deficiency, but most of 41 42 immunity related genes showed a general down regulation of (Table 2). Pathways and biological on September 28, 2021 by guest. Protected copyright. 43 44 processes involved in immunity regulation were restored by CoQ10 supplementation (Tables 2 and S5). 45 46 47 48 A stable DNA methylation profile is responsible for the specific gene expression profile in CoQ 49 10 50 51 deficiency 52 53 CoQ10 supplementation modified the expression of 43% of genes that were abnormally expressed in 54 55 CoQ10 deficient fibroblasts (supplementary table 8). In the majority of these cases, expression levels 56 57 were restored to those of control fibroblasts (20%), but few showed inverse regulation (2%) and others 58 59 60 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 12 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 were specifically altered after CoQ10 treatment in both deficient and non deficient cells (5%). The 3 4 remaining 16% corresponded to partially restored genes, which slightly alter their expression level 5
6 without changing the CoQ10 deficient pattern. These genes along with the unaffected (54%) constitute 7 8 72% of regulated genes in CoQ deficiency, which were not significantly altered after CoQ 9 10 10 10 11 supplementation. 12 13 To explain this differential response to respiratory dysfunction, we analyzed the DNA methylation 14 15 profile of 20 amongFor the most peer altered genes listedreview in table 2. These onlygenes encompass the main 16 17 biological processes and pathways affected by CoQ10 deficiency (table 3). Up regulated genes, which 18 19 20 were unaffected by CoQ10 supplementation, had less defined DNA methylation sites in their promoter 21 22 regions. 23 24 Genes with partial restoration of their expression after CoQ10 supplementation showed precise 25 26 methylation and demethylation profiles that may explain their altered expression during CoQ10 27 28 deficiency. The methylation degree of these genes changed after treatment, and may be responsible for 29 30 31 the modulation of expression (Table 3). The patterns of methylation of activated and repressed genes 32 33 in CoQ10 deficiency that could be normalized by CoQ10 supplementation, were either unaffected or http://bmjopen.bmj.com/ 34 35 only slightly affected by the treatment, and we did not detect new methylation sites after CoQ10 36 37 supplementation. 38 39 40 However, a few genes showed significant differences in the methylation degree after the treatment, 41 42 which correspond to the partially restored genes that maintain the specific expression pattern of on September 28, 2021 by guest. Protected copyright. 43 44 untreated CoQ10 deficient cells at a lower level. 45 46 Finally, reviewing the biological processes and molecular functions of regulated genes in CoQ10 47 48 deficiency, the main adaptation for cell survival activated genes by DNA demethylation, which 49 50 51 increased the expression of genes involved in cell cycle activation, apoptosis inhibition, and cell stress 52 53 resistance, meanwhile the undifferenciated state could be due to gene repression by DNA methylation, 54 55 which decreased the expression of genes involved in cell differentiation. CoQ10 treatment did not alter 56 57 the methylation degree of these genes and subsequently the expression level was maintained. 58 59 60 11 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 13 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 DISCUSSION 5 6 7 8 CoQ -deficient fibroblasts readapt the energetic metabolism and CoQ -treatment restores 9 10 10 10 1 11 CoQ10 is an essential component of the mitochondrial respiratory chain , therefore dysfunctional 12 3 7 8 13 13 mitochondria are a common finging in both primary CoQ10 deficiencies and secondary forms . 14 15 Although each formFor presents peer a specific clinical review phenotype, all these only conditions display a substantial 16 17 reduction of cellular CoQ10 content and deficit in the mitochondrial enzymatic activities of respiratory 18 19 20 chain (table 1). Accordingly to these results, we have shown here that fibroblasts from patients with 21 22 CoQ10 deficiency have reorganized their genetic resources to cope with this mitochondrial dysfunction. 23 24 Bioenergetics was supported mainly by glycolysis, while lipid metabolism and the respiratory chain 25 26 were repressed, consistent with the role of CoQ10 in these two metabolic pathways. These findings, 27 28 together with the mild repression of the cytosolic enzymes that oxidize NADH (cytochrome b and 29 5 30 31 several other oxidoreductases) could indicate that NADH is mainly used for biosynthetic purposes 32 33 rather than for energy production. http://bmjopen.bmj.com/ 34 35 Supplementation with CoQ10, the current therapy for all forms of CoQ10 deficiency, restored 36 37 respiration through enhanced sugar utilization, but did not stimulate lipid metabolism. We showed that 38 39 40 CoQ10 treatment normalized partially or completely the expression of genes involved in the glycolytic 41 42 pathway and activated the repressed genes involved in the biosynthesis of the respiratory chain , on September 28, 2021 by guest. Protected copyright. 43 44 whereas the TCA cycle remained unaffected. These results are in agreement with the recovery of 45 46 8 16 17 aerobic metabolism observed in CoQ10 deficient fibroblasts after CoQ10 supplementation . 47 48 49 50 51 CoQ10 deficiency induces a stable survival adaptation of cells 52 53 CoQ10 deficienct fibroblasts adapted several physiological processes to acquire a cellular resistance 54 55 state for survival under the conditons of mitochondrial dysfunction induced by CoQ10 deficiency. The 56 57 new genetic pattern increases cell survival by activating cell cycle and growth, maintaining an 58 59 60 12 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 14 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 undifferentiated phenotype, up regulating stress induced proteins, and inhibiting apoptosis and cell 3 4 death pathways. These results recapitulate a survival network that can be observed in nutritional stress 5 6 such as when cells are grown in galactose enriched media25. 7 8 The survival adaptation shown by CoQ deficient cells included a global resistance mechanism that is 9 10 10 11 observed also during the initial phase of tumorigenesis. In fact, the CoQ10 deficient expression profile 12 26 27 13 was very similar to that described during myeloid cells transformation and breast tumors . 14 15 Moreover, someFor of the regulated peer genes in CoQreview10 deficiency (listed only in table 2 as underlined bold letter) 16 17 are used as biomarkers in several types of cancer28. In addition, cellular senescence, a defining feature 18 19 29 20 of pre malignant tumors , is characterized by a gene expression pattern similar to that of CoQ10 21 22 deficient fibroblasts (supplementary table 5). 23 24 Supplementation with CoQ10 enhanced both stress response and immunity pathways. Although the 25 26 pathway of cell death was partially restored, cell cycle and growth, and the mechanisms to prevent 27 28 differentiation and development were not. These results indicate that the mitochondrial dysfunction 29 30 31 due to CoQ10 deficiency induces a stable survival adaptation of somatic cells in patients at early or 32 33 postnatal development, and we speculate that cells unable to institute, or to maintain, this survival http://bmjopen.bmj.com/ 34 35 mechanism during differentiation will die, contributing to the pathological phenotype. 36 37 38 39 40 A stable DNA methylation profile is responsible of specific gene expression in CoQ10 deficiency 41 42 The cellular adaptation to CoQ10 deficiency enhanced DNA demethylation of genes that regulate cell on September 28, 2021 by guest. Protected copyright. 43 44 cycle activation, apoptosis inhibition, and cell stress resistance as part of an adaptation survival 45 46 mechanism. Comparable results were observed in several models of epigenetic regulation by 47 48 demethylation (Table S5), whereas DNA methylation inhibits activation of genes related to 49 50 30 51 tumorogenesis and apoptosis . 52 53 Pathways unaffected by CoQ10 treatment corresponded to stably demethylated genes, whereas those 54 55 that responded to CoQ10 supplementation were controlled by genes with unchanged methylation 56 57 patterns. 58 59 60 13 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 15 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 We did not find changes in the methylation degree of all genes affected by CoQ10 deficiency, 3 4 suggesting that other modalities of gene regulation are be responsible, including epigenetic 5 6 mechanisms such as histone modifications by methylation and acetylation, or even DNA methylation 7 8 in CpG islands other than those studied here. Interestingly, it has been reported that CoQ regulates 9 10 10 31 11 lipid metabolism in liver mice without effect on the DNA methylation profile , indicating that 12 13 supplemented CoQ10 by itself may not alter the DNA methylation pattern that cells acquired during the 14 15 survival adaptationFor to CoQ 10peer deficiency. review only 16 17 Mechanisms unaffected by therapy corresponded to stably DNA demethylated genes, which were 18 19 20 responsible for the acquisition of the undifferentiated state for survival and resistance that cells obtain 21 22 during the adaptation to CoQ10 deficiency, whereas the responsive to CoQ10 supplementation were 23 24 controlled by genes with unchanged methylation patterns and correspond mainly to metabolic genes 25 26 and those related with the restoration of mitochondrial function. 27 28 We propose that these epigenetic changes may be established as early as during the fetal life32 in order 29 30 31 to cope with CoQ10 deficiency; these cells then maintain this adaptive response throughout their life. 32 33 We speculate that cells unable to maintain this survival mechanism during differentiation would die http://bmjopen.bmj.com/ 34 35 contributing to the pathological phenotype. 36 37 Our model has some limits: we treated cells only for one week and in principle we cannot rule out that 38 39 40 prolonged exposure to CoQ10 could restore also some of the other unaffected pathways. Alternatively, 41 42 incomplete recovery of the gene expression profiles could be explained by the fact that exogenous on September 28, 2021 by guest. Protected copyright. 43 44 CoQ10 can rescues the bioenergetic defect, but not all other functions of CoQ10 in these cells, as it has 45 46 been observed in other organisms33. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 14 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 16 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ACKNOWLEDGEMENTS 3 4 We appreciate the generous cooperation of the families. 5 6 7 8 FUNDING STATEMENT 9 10 11 This work was supported by the following funders: Spanish Ministerio de Sanidad (FIS) grant numbers 12 13 PI11/00078 and PI11/02350; National Institutes of Health (NIH, USA) grant number 1R01HD057543; 14 15 Junta de AndalucíaFor (Spanish peer Regional Government) review grant number onlyCTS 3988; Telethon (Italy) grant 16 17 number GGP09207; and from a grant from Fondazione CARIPARO. 18 19 20 21 22 AUTHOR CONTRIBUTION STATEMENT 23 24 DJMFA and PN designed the experiments and drafted the manuscript; DJMFA, IG, SJG, MVC and 25 26 AG performed the experiments and made the statistical analyses; PB, RA and LS provided cells and 27 28 patient’s clinical information; DJMFA, PB, RA, PN, SDM, MH, RC and LS analyzed the data and 29 30 31 edited the manuscript. 32 33 http://bmjopen.bmj.com/ 34 35 COMPETING INTERESTS STATEMENT 36 37 There is no competing interest. 38 39 40 41 42 DATA SHARING STATEMENT on September 28, 2021 by guest. Protected copyright. 43 44 There are not additional data available. 45 46 47 48 Dryad Package Identifier 49 50 51 doi:10.5061/dryad.gr2gp 52 53 54 55 56 57 58 59 60 15 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 17 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 REFERENCES 3 4 1. Bentinger M, Tekle M, Dallner G. Coenzyme Q biosynthesis and functions. Biochem Biophys Res 5 Commun 2010;396(1):74 9. 6 7 2. Trevisson E, Dimauro S, Navas P, et al. Coenzyme Q deficiency in muscle. Curr Opin Neurol 8 2011;24(5):449 56. 9 10 3. Sobreira C, Hirano M, Shanske S, et al. Mitochondrial encephalomyopathy with coenzyme Q10 11 deficiency. Neurology 1997;48(5):1238 43. 12 13 14 4. Artuch R, Brea Calvo G, Briones P, et al. Cerebellar ataxia with coenzyme Q10 deficiency: 15 diagnosis Forand follow up peer after coenzyme review Q10 supplementation. only J Neurol Sci 2006;246(1 2):153 16 8. 17 18 5. Salviati L, Sacconi S, Murer L, et al. Infantile encephalomyopathy and nephropathy with CoQ10 19 deficiency: a CoQ10 responsive condition. Neurology 2005;65(4):606 8. 20 21 6. Horvath R, Schneiderat P, Schoser BG, et al. Coenzyme Q10 deficiency and isolated myopathy. 22 Neurology 2006;66(2):253 5. 23 24 7. Heeringa SF, Chernin G, Chaki M, et al. COQ6 mutations in human patients produce nephrotic 25 syndrome with sensorineural deafness. J Clin Invest 2011;121(5):2013 24. 26 27 8. Cotan D, Cordero MD, Garrido Maraver J, et al. Secondary coenzyme Q10 deficiency triggers 28 29 mitochondria degradation by mitophagy in MELAS fibroblasts. Faseb J 2011;25(8):2669 87. 30 31 9. Gempel K, Topaloglu H, Talim B, et al. The myopathic form of coenzyme Q10 deficiency is caused 32 by mutations in the electron transferring flavoprotein dehydrogenase (ETFDH) gene. Brain 33 2007;130(Pt 8):2037 44. http://bmjopen.bmj.com/ 34 35 10. Haas D, Niklowitz P, Horster F, et al. Coenzyme Q(10) is decreased in fibroblasts of patients with 36 methylmalonic aciduria but not in mevalonic aciduria. J Inherit Metab Dis 2009;32(4):570 5. 37 38 11. Miles MV, Putnam PE, Miles L, et al. Acquired coenzyme Q10 deficiency in children with 39 recurrent food intolerance and allergies. Mitochondrion 2011;11(1):127 35. 40 41
12. Montero R, Sánchez Alcázar JA, Briones P, et al. Analysis of Coenzyme Q10 in muscle and on September 28, 2021 by guest. Protected copyright. 42 fibroblasts for the diagnosis of CoQ10 deficiency syndromes. Clinical Biochemistry 43 44 2008;41(9):697 700. 45 46 13. Quinzii CM, Kattah AG, Naini A, et al. Coenzyme Q deficiency and cerebellar ataxia associated 47 with an aprataxin mutation. Neurology 2005;64(3):539 41. 48 49 14. Montini G, Malaventura C, Salviati L. Early coenzyme Q10 supplementation in primary coenzyme 50 Q10 deficiency. N Engl J Med 2008;358(26):2849 50. 51 52 15. Pineda M, Montero R, Aracil A, et al. Coenzyme Q(10) responsive ataxia: 2 year treatment 53 follow up. Mov Disord 2010;25(9):1262 8. 54 55 16. Lopez LC, Quinzii CM, Area E, et al. Treatment of CoQ(10) deficient fibroblasts with ubiquinone, 56 CoQ analogs, and vitamin C: time and compound dependent effects. PLoS One 57 2010;5(7):e11897. 58 59 60 16 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 18 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 17. Lopez Martin JM, Salviati L, Trevisson E, et al. Missense mutation of the COQ2 gene causes 3 defects of bioenergetics and de novo pyrimidine synthesis, 2007:1091 97. 4 5 18. Salviati L, Trevisson E, Rodriguez Hernandez MA, et al. Haploinsufficiency of COQ4 causes 6 coenzyme Q10 deficiency. J Med Genet 2012;49(3):187 91. 7 8 19. Fernández Ayala D, Chen S, Kemppainen E, et al. Gene Expression in a Drosophila Model of 9 Mitochondrial Disease. PLoS ONE 2010;5(1):e8549. 10 11 20. Baur JA, Pearson KJ, Price NL, et al. Resveratrol improves health and survival of mice on a high 12 calorie diet. Nature 2006;444(7117):337 42. 13 14 21. Eden E, Navon R, Steinfeld I, et al. GOrilla: a tool for discovery and visualization of enriched GO 15 For peer review only 16 terms in ranked gene lists. BMC Bioinformatics 2009;10(1):48. 17 18 22. Saeed AI, Bhagabati NK, Braisted JC, et al. TM4 microarray software suite. Methods in 19 enzymology 2006;411:134 93. 20 21 23. Gartel AL, Radhakrishnan SK. Lost in transcription: p21 repression, mechanisms, and 22 consequences. Cancer Res 2005;65(10):3980 5. 23 24 24. Li J, Ran C, Li E, et al. Synergistic Function of E2F7 and E2F8 Is Essential for Cell Survival and 25 Embryonic Development. Developmental Cell 2008;14(1):62 75. 26 27 25. Quinzii CM, Hirano M. Coenzyme Q and mitochondrial disease. Dev Disabil Res Rev 28 2010;16(2):183 8. 29 30 26. Zhan F, Huang Y, Colla S, et al. The molecular classification of multiple myeloma. Blood 31 32 2006;108(6):2020 8. 33 http://bmjopen.bmj.com/ 34 27. van 't Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome 35 of breast cancer. Nature 2002;415(6871):530 36. 36 37 28. Yoo SM, Choi JH, Lee SY, et al. Applications of DNA microarray in disease diagnostics. J 38 Microbiol Biotechnol 2009;19(7):635 46. 39 40 29. Collado M, Gil J, Efeyan A, et al. Tumour biology: senescence in premalignant tumours. Nature 41 2005;436(7051):642. 42 on September 28, 2021 by guest. Protected copyright. 43 30. Fan H, Zhao Z, Quan Y, et al. DNA methyltransferase 1 knockdown induces silenced CDH1 gene 44 reexpression by demethylation of methylated CpG in hepatocellular carcinoma cell line SMMC 45 7721. Eur J Gastroenterol Hepatol 2007;19(11):952 61. 46 47 48 31. Schmelzer C, Kitano M, Hosoe K, et al. Ubiquinol affects the expression of genes involved in 49 PPARalpha signalling and lipid metabolism without changes in methylation of CpG promoter 50 islands in the liver of mice. Journal of clinical biochemistry and nutrition 2012;50(2):119 26. 51 52 32. Smith ZD, Chan MM, Mikkelsen TS, et al. A unique regulatory phase of DNA methylation in the 53 early mammalian embryo. Nature 2012;484(7394):339 44. 54 55 33. Gomez F, Saiki R, Chin R, et al. Restoring de novo coenzyme Q biosynthesis in Caenorhabditis 56 elegans coq 3 mutants yields profound rescue compared to exogenous coenzyme Q 57 supplementation. Gene 2012;506(1):106 16. 58 59 60 17 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 19 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 34. Montero R, Sanchez Alcazar JA, Briones P, et al. Coenzyme Q10 deficiency associated with a 3 mitochondrial DNA depletion syndrome: a case report. Clin Biochem 2009;42(7 8):742 5. 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 18 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 20 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 FIGURE LEGEND 4 5 6 Figure 1. Cluster of genes differentially expressed in CoQ10 deficiency and after CoQ10 7 8 supplementation. Four arrays of 2 representative fibroblasts from patients with Q deficiency were 9 10 11 plotted with 2 arrays of control fibroblasts and 9 arrays of 5 patient’s fibroblasts with CoQ10 deficiency 12 13 treated with 30 M CoQ10. Activated genes were colored in red and repressed ones in green. Between 14 15 parentheses, groupFor classification peer of genes afterreview CoQ10 supplementation only (Table S3). 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 19 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
#5 #5 #3 #3 #4 #1 #2 #2 #GIO #ELO #HDF #control #ELO+Q #MEL+Q Array and epigenetic code
8 5 4 18 34 17 17 12 , case 4 , 4 case , case 3 , 3 case 12 12 Reference as cited in cited the as text
RC.
10
Reference values Effect of CoQ Improvementin muscle Improvement of 41% andtone strength. Heto andbegan speak Recovery Recovery of mt complex II+III (cells). Recovery of cell growth. Recovery Recovery of ATP Improvement of neurological assessment. done. supplementation Improvement of 25% complex II+III (cells). Recovery of cell growth. Improvement of neurologic not but the renal dysfunction. Recovery of cell growth. Improvement of 35% complex II+III (cells). production. ROS No production No biochemicalNo studies deficiency. 10
20
BMJ Open
http://bmjopen.bmj.com/ in fibroblast in in muscle in in fibroblast in in muscle in
biosynthesis rate fibroblastin in fibroblastin biosynthesis rate musclein fibroblastin biosynthesis rate in fibroblastin biosynthesis rate 10 10 10 10 10 10 10 10 10 10 10 10 10 Biochemical studies Biochemical to (% mean referencerespect values) Reference values 29% CoQ 29% 23% CoQ 23% 40% CoQ 40% 20% CoQ 20% CoQ 44% 58% CoQ 58% mt RC complex 32% (muscle)I+III mt RC complex 19% II+III (muscle) CoQ 15% 35% mt RC complex 35% (cells)I mt RC complex 41% II+III (cells) mt RC complex 12% (cells) IV mt Ψ 60% mitochondrial 70% mass ROS (>2 fold)production autophagosomedefective elimination 17% CoQ 17% 31% mt RC complex 31% (muscle) I+III mt RC complex 46% II+III (muscle) CoQ 22% 64% mt RC complex 64% (cells) I+III 85% mt RC complex 85% II+III (cells) 15% CoQ 15% mt RC complex 60% II+III (cells) 19% mt RC complex 19% (muscle) I+III mt RC complex 32% II+III (muscle) CoQ 17% CoQ 10% mt RC complex 57% II+III (cells) 24% CoQ 24% ROS (3 fold)production on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency deficiency deficiency deficiency deficiency 10 10 10 deficiency deficiency 10 For peer review10 only corticosteroid resistant nephropaty COQ2 mutationgene (c.890A>G) corticosteroid resistant nephropaty COQ2 mutationgene (c.890A>G) Healthy volunteersHealthy Dysmorphic Dysmorphic features, ventricular septal ventricular defect, weakness, and hypotonia hyporeactivity. mtDNA depletion mtDNA syndrome encephalopathy neonatal CoQ secondary MELAS (A3243G MELAS mutation) CoQ secondary ataxia and cerebellarataxia atrophy CoQ secondary primary CoQ primary progressive encephalomyopathy progressive CoQ primary phenotype Clinical
a old girl old old boyold
year day 3 year old 3 year old boy 10 Boy 9 month old girl brother (her above) 33 month old 33 month old boy sister bellow)(his 12 Human Human dermal skin fibroblast Patient / Patient Cells
Table Table 1 Q with Coenzyme patients in done biochemical studies and phenotype Clinical Page 21 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 22 of 84 #epi #epi #epi #epi #SIL+Q #SOF+Q
, 1 case 12 this this paper
P Recovery Recovery of both complex complex activity I+III and growth fibroblastsof Improvement AT of synthesis , Synthetic Synthetic , Minimun Sigma).98%, HPLC, 10
21
BMJ Open http://bmjopen.bmj.com/ in fibroblast in
in fibroblastin 10 10 18% CoQ 18% 58% mt RC complex 58% II+III (cells) walk. 38% CoQ 38% on September 28, 2021 by guest. Protected copyright. For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency 10 deficiency. deficiency 10 10 For peer review only
COQ4 gene COQ4 mutation gene (c.483G>C) rabdomyolisis Ataxia CoQ secondary Moderate retardation.mentalModerate COQ4 deletion.gene CoQ Primary primary CoQ primary pre diluted in in pre diluted FBS to added was platesthe ata final concentration M of 30 (Coenzyme Q 10
CoQ cultured at cultured DMEM 37°C Glucose,using 1 g/L L Glutamine, (Invitrogen)Pyruvate plus antibiotic/antimycotic solution (Sigma) fetal and 20% bovine serum (Linus). Girl Girl a b
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(f) 10
fold 3 – CoQ
(e) –20%
+2 fold –5 fold –2 fold
1,3 4,8 8,0 4,3 238,2 Q-RT-PCR Q-RT-PCR
(d)
10
R R R R O O O U U O U pR pR pR CoQ
U R
R R pR R U O pR U U pR
(c) nc nc nc nc nc nc 1,6 4,3 2,9 3,2 2,5 1,7 1,6 1,6 1,7 1,5 2,3 1,4) 1,6 1,5 1,8 1,9 1,6 (1,5) (1,4) ( 153,9 FC FC
nc
nc U nc U nc
(b) 3,6 2,9 5,3 3,4 2,4 5,4 7,6 6,8 2,5 3,3 2,5 2,0 1,4) 1,3) 1,3) 1,4) 2,5 2,3 2,1 2,6 3,0 2,1
66,1 73,8 75,5 10,8 10,0 19,5 ( ( ( ( ( 1,3) ( 1,4) FC FC 22 BMJ Open http://bmjopen.bmj.com/
desaturase) 9 on September 28, 2021 by guest. Protected copyright.
deficiency deficiency 10
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
A hydroxylase
For peer review only adenosyl methioninecontaining domain 2
CoA (deltadesaturase
low density lipoprotein low density receptor carboxypeptidase Ecarboxypeptidase Gene Title Gene semaphorin 5A,semaphorin receptor for cell growth protein AE binding 1 quinolinate phosphoribosyltransferasequinolinate classtype I, ATPase, 8B, member 1 scinderin cholesterol 25cholesterol S radical epoxidasesqualene stearoyl cytochrome cytochrome b5 reductase 3 cytochrome b5 reductase 4 cytochrome cytochrome b561 cytochrome b5 chromosome chromosome reading frame7 open 55 cytochrome cytochrome b5 reductase 1 chromosome chromosome reading 10 open frame 58 cytochrome cytochrome b5 reductase 2 cysteine and glycine richcysteine protein 2 farnesyl diphosphate farnesyltransferasefarnesyl diphosphate 1 isopentenyl diphosphatedelta isomerase 1 insulin inducedinsulin 1 gene periostin, periostin, specific osteoblast factor proprotein convertase proprotein subtilisin/kexin type 2 brain protein brain 44 vascular vascular endothelial growth factor A phosphorylase, phosphorylase, glycogen;liver pregnancy associated plasma pappalysin protein A,
(a)
SEMA5A AEBP1 QPRT ATP8B1 PCSK2 SCIN CH25H RSAD2 SQLE SCD CYB5R3 CYB5R4 CYB561 CYB5A C7orf55 Gene Symbol POSTN
CSRP2
PYGL cycleCell CPE Other metabolism FDFT1 INSIG1 metabolismInsulin CYB5R1 Lipid metabolism BRP44 Mitochondrial metabolism 2 Table Differentially genesCoenzyme in expressed Q PAPPA NADH NADH mobilization SLC40A1 carrier solute family transporter)40 (iron regulated LDLR
CYB5R2 VEGFA IDI1 C10orf58 Page 23 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 24 of 84
60% – +10% +10%
5,7 4,6 10,9
- R R R R R R R R R U U U U U U U U U U O U U U U pR pR pR pR pR pR pR
R U O nc nc nc nc nc nc nc nc nc nc nc nc nc nc 2,4 7,6 2,1 1,3 2,7 1,6 1,6 1,6 4,4 1,3) 2,0 1,5 1,5 3,0 3,7 (1,3) ( ( 1,4) ( 1,5) ( 1,4) 1,7 1,8
nc nc 6,5 4,3 2,5 4,4 2,8 5,3 2,9 2,8 2,0 6,5 3,0 1,9 3,0 9,2 2,6 2,0 (1,4) 3,9 3,5 9,2) 2,6) 1,3) 1,8 8,3 2,7 4,8 5,2 6,7 4,5 6,1 3,8
13,2 2,2 (3,6) (1,4) 2,9 (1,9) 2,7 (2,2) (2,6) 1,4 93,0 10,1 ( ( 263,6 ( ( 1,9) ( 1,8) ( 1,4) 23 BMJ Open
http://bmjopen.bmj.com/
on September 28, 2021 by guest. Protected copyright. protein protein coupled, 5
7
stimulated genes For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
CDK
For peer review only
releasing releasing peptide
derived neurotrophic derived factor related transcription factor (aml1 oncogene) 1 forkhead Q1forkhead box A11 homeobox nuclearbody proteinSP110 zinc fingerteashirt homeobox 1 34keratin (alpha)tropomyosin 1 E2F transcriptionE2F factor gastrin G1netrin C9homeobox homeobox LIM 9 10tetraspanin stromalEpithelial interaction 1 versican component of SWI/SNF chromatincomlplex, memberA1 component of SWI/SNF chromatincomlplex, memberA4 Cyclin dependent kinase 6, in overexpressed tumor inhibitor of CDK, overexpressed cancer in cells antigensurface cell retinoblastoma protein transcriptionE2F factor 8 follistatin decorin fibulin likeEGF containing extracellular matrix 1protein docking protein docking 5 E1A 1 repressor of runt 1 endothelin 2 matrilin adhesion cell melanoma molecule interferon interferon induced transmembrane (9 27) protein 1 midline 1 (Opitz/BBB 1 midline syndrome) purinergic receptor P2Y,purinergic G p21, inhibitor p21, of inhibitor p57, CDK of brain (neurite pleiotrophin growth promotingfactor 1) plakophilin plakophilin 4 pregnancy specific pregnancy beta 1 glycoprotein 6
FOXQ1 HOXA11 SP110 P2RY5 TSHZ1 CDKN1A CDKN1C E2F7 BDNF GRP KRT34 SMARCA1 DCN VCAN DOK5 CREG1 RUNX1 EDN1 MATN2 MCAM EFEMP1 TPM1 NTNG1 HOXC9 TSPAN10 SMARCA4 CDKN3 E2F8
PKP4 MID1 BHLHB5 helix loop helix basic containing,domain class 5 B, PSG6 IFITM1 CHURC1 containing churchill domain 1 MKX mohawk homeobox
PTN LHX9 EPSTI1 CDK6 CD31 RB1 FST and Developmentdifferentiation 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
fold 2 +20% – –5 fold –5 fold
7,0 11,8 15,1
R R R R R R R R R R R R R R O O U U U U U U O O O U U O O U U p pR
nc nc nc nc nc nc nc nc nc nc nc nc nc 2,5 2,3 2,5 1,6 1,6 1,5) 1,3) 1,9 1,9 1,8 1,6 4,9 (1,4) (1,5) ( ( 1,3) ( 1,4) ( ( 1,5) ( 1,4) ( 1,3)
(1,4)
5,9 9,8 3,3 4,2 1,7 3,1 8,7 3,8 4,2 1,7 2,4 2,4 2,6 1,7 4,9 1,9 3,4 3,6 4,5 4,5 (1,5) 2,2 2,0 2,3 3,8 3,8 2,8 4,7 4,5 2,0 7,4 8,5 3,0 4,5 6,4 5,0 2,3 8,3
17,3 13,8 2,0 11,7 12,2 15,0 67,3 24 BMJ Open http://bmjopen.bmj.com/
inase inase 1
on September 28, 2021 by guest. Protected copyright.
like like 4C
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml inducible protein 27 inducible protein 6 related protein 1
containing 55containing ribose) ribose) polymerase member family, 14 For peer review only induced protein 44 osylation factor osylation rSixepithelialto antigen prostate of rib protein, 2 gamma B cell RAG B associated protein necrosis tumor factor superfamily, member 4 alphainterferon, interferon G small effector CDC42 2 antigen lymphocyte complex, 6 locus K tripartite motif containing14 interferon induced protein 44 like secreted frizzled secreted ADP specific ubiquitin peptidase53 acidgamma aminobutyric (GABA)receptor, B 2 nucleotide channelcyclic gated alpha 3 domain RLD hect and 6 melanophilin tumor necrosis tumor factor receptor superfamily 10D melanoma antigen melanoma family D, 1 tripartite motif alphainterferon, XIAP associated factor 1 simila transmembrane protein 49 /// microRNA 21 serum/glucocorticoid regulated k suppressor of cytokine signaling 3 melanomain absent 1 polyposisadenomatosis coli down regulated 1 antigen melanoma family D, 4/ 4B bindingsmall GTP protein (rho Rac2family) cytochrome P450, cytochrome family 1B, polypeptide 1 RAD23 (S.homolog cerevisiae)B interacting thioredoxin protein gene ras homolog member family,U forkhead P1forkhead box LIM and cysteine richLIM 1domains NCK adaptorNCK protein 2 (ADP poly (A2/A3)butyrophilin3
6ST
AGED1 GALNAC4S TNFSF4 IFI27 IFI44 GNG2 PARP14 SFRP1 ARL4C M TRIM55 IFI6 MGC87042 TMEM49 SGK1 SOCS3 FOXP1 XAF1 CYP1B1 TNFRSF10D NCK2
CDC42SE2 TRIM14 IFI44L USP53 HERC6 Immunity Signaling
AIM1 / MAGED4 4B RAD23B RHOU
LMCD1 LY6K BTN3(A2/A3) GABBR2 CNGA3 MLPH
APCDD1 RAC2 TXNIP Apoptosis Cell resistance to resistance Cell to stress Page 25 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
10 Page 26 of 84
supplementation (S). supplementation Genes non affected by CoQ 10
R R R R R R R U U pR pR pR treatment (U); thetreatment that restored genes either expression partial (pR) 10
nc nc nc 1,8 1,6 1,3) 1,7 3,0 4,9 2,6 ( . See the text text for See. the information.more 28
5,3 6,4 7,4 6,2 3,6 3,5 2,7 6,1 1,8
( 5,1) ( 3,1) 25 BMJ Open http://bmjopen.bmj.com/
deficiency: deficiency: unaffected by CoQ genes 10 peats 1)
deficiency (O);and specificalydeficiency regulated after genes only CoQ 10 on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml like like modifier
induced induced protein (tetratricopeptide re For peer review only oligoadenylate oligoadenylate synthetase 69/71kDa 2, oligoadenylate synthetase 100kDa 3, 5' 5' supplementation on on expressionsupplementation gene in CoQ 10 interferon ubiquitin ISG15 myxovirus resistance 1 2' 2' interferon induced interferon induced protein (tetratricopeptide repeats 3) binding guanylate protein interferon inducible1, myxovirus resistance 2 2',5' oligoadenylate synthetase 40/46kDa1, 2' 5' oligoadenylate synthetase like proteasome subunit, proteasome beta type,9 supplementation on levelssupplementationmRNA on analyzed by Q RT PCR. Positive values, increase expression;gene on negative values, decrease on expression.gene 10
IFIT1 ISG15 MX1 OAS2 OAS3 Full change (FC)thein comparative Full analysis with GeneChip®Affymetrix ran Human PlusU133 Genome 2.0 Array. represent the Values (mean) for FC each correspodinggene to coenzyme CoQ of Effect In letter,In bold usedbiomarkers several types in cancer as of described Yoo collaboratorsby and change in Full comparativethe analysis with ran Affymetrix Gene Chip®Human Gene ST Array.1.0 In parenthesis, FC non significant of genes by statistical the threshold used. change in Full expression gene analyzed by (Q RT PCR).quantitative PCR real time See supplementary material forand S11 table primer sequence. Effect CoQ of specific specific and processes pathways (see textthe full for details).casethe In of different probes selected for one gene, thevalues represent for mean of (see each FC probe supplementary fortable full 1 details). a b c d e f IFIT3 MX2 OASL Genes with change Genes (nc).no or completely (R);or with genes regulation in opposite than CoQ diferent sample's diferent analysis;(SAM patient R=1.5; FDR=0%). parenthesis, In of FC non significant the by statistical genes threshold which used,were selected becausetheir inrole supplementation ( ).supplementation textthe and See supplementary tablefull for details. 8 GBP1 OAS1 PSMB9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(g) BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
+2 fold Q-effect
(f)
(P) close together close (P) deficiency 10 CpGs' location
(e) (P).
10 28% / 35% 28% treatment (U); treatment thatrestored genes the 10 (C/P) degree methylations inmethylations CoQ
deficiency (O). deficiency (d)
10
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 (50%) 6 7 (2 fold) 7 / 37% 27% scattered groups 3 (3 fold) 3 / 19% 5% dispersed 8 (4 fold) 8 / 20% 5% together close (P) –3 fold CpGs
(f)
(I) (I) scattered groups supplementation than insupplementation CoQ deficiency 10 deficient Non significantfibroblasts. deficient in changesmethylation ( ). 10
10 CpGs' location 26
(e) BMJ Open
deficiency. Positivedeficiency. an increase methylationthevalues, in degree; negative values, demethylations. http://bmjopen.bmj.com/ 10 53% 53% / 35%
(C/P) degree demethylations in CoQ demethylations in (d)
deficient deficient fibroblast. Significance determined t test by In (p<0.01). parenthesis, fold change in methylation degree
fold) 10 0 0 0 0 0 0 deficiency (more information deficiency in S8):Table unaffected CoQgenes by 10 20 (220 supplemented and supplemented untreated CoQ 10 on September 28, 2021 by guest. Protected copyright. supplementation CoQ in supplementation
10 CpGs (c)
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 32 (P)32 (P,E,I) 73 CpGs (b)
For peer review only
O O
Q-effect 4,2 pR (P,E,I) 63 (90%) 5 52% / 28% scattered groups (60%) 9 / 28% 16% scattered groups +7% (a) 4,7 R (P) 24 2,8 U (P,E,I) 58 5 (2 fold) / 12% 7% scattered groups (90%) 3 / 17% 9% dispersed (I) 2,3 U (I) 85 (2 fold) 11 57% / 32% scattered groups (3 fold) 2 / 19% 7% together close deficiency (SAManalysis; deficiency R=1.5; ran with FDR=0%) Affymetrix GeneChip® Human GenomePlusU133 2.0 Array.details table in Full 2.
5,9 R (P,E) 34 0 3,0 U (P) 25 8,5 R 8 (P) 2,5 R (P,E,I) 84 8 (2 fold) / 12% 6% together close (E) (3 fold) 1 / 13% 4% 3,1 U (P) 29 7,7 R (P,E,I) 74 0 3,0 R (P,E,I) 25 0 11,6 pR (P,I) 26 3 (4 fold) / 20% 6% dispersed 94,3 66,1 R (P,E,I) 80 (25%) 8 76% / 61% scattered groups (3 fold) 8 / 27% 10% dispered widely 73,8 U 5 (P) (16 fold) 2 / 50% 3% together close (P) 0 10 263,6
supplementation expression supplementation gene in CoQon 10
Effect of CoQ of Effect methylated CpGs Significant controleach in gene andfor CoQ Significant in changes CpG methylation to due CoQ Full change in Full CoQ Number of islands CpGanalyzed. In parenthesis, locationgene islands:GpC of promoter (P);(E); first first intron exon (I). Methylation degree (mean CpG). of significant Values represent the % of CpG's methylation of both (C) control and deficient inpatient CoQ Location of Location of significant CpGs. parenthesis, In location:gene (P);promoter(E); firstfirst(I). intron exon PCSK2 GRP MLPH MCAM EPSTI1 XAF1 XAF1 PYGL CHURC1 3,5 R (P,E,I) 20 (50%) 1 / 11% 7% CYP1B1 AEBP1 HOXA11 4,3 pR (P) 17 ARL4C CPE CPE PARP14 END1 FOXP1 TNFRSF10D 2,4 U (P,E,I) 59 (2 fold) 27 60% / 25% scattered (P)groups 0 VCAN VCAN GABBR2 13,8 U 101 (P,I) (40%) 5 47% / 37% together close (P) (6 fold) 14 / 22% 10% together close (P) –15% POSTN Gene symbolGene FC
a b c d e f g Table 3 Table Epigenetic inmodifications deficiencyCoQ10 to dueDNA (CpG) / demethylationmethylation (small changes,%).(small in Non significant changes in ( ).methylation expression eitherpartialexpression (pR) completely (R); or regulationand genes with opposite after CoQ Significance determinedSignificance t test(p<0.01)by CoQ between Page 27 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open Page 28 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 254x254mm (72 x 72 DPI) 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 29 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 SUPPLEMENTARY DOCUMENT 3 4 5 6 7 8 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 9 10 11 modifications: a modelling study for human coenzyme Q10 deficiencies. 12 13 14 15 Daniel J. M. Fernández AyalaFor peer1,5, Ignacio Guerra review1,5, Sandra Jiménez Gancedo only1,5, Maria V. 16 17 Cascajo1,5, Angela Gavilán1,5, Salvatore DiMauro2, Michio Hirano2, Paz Briones3,5, Rafael 18 19 4,5 6 7,8 1,5,8 20 Artuch , Rafael de Cabo , Leonardo Salviati and Plácido Navas 21 22 23 24 1Centro Andaluz de Biología del Desarrollo (CABD CSIC), Universidad Pablo Olavide, Seville, 25 26 Spain 27 28 2Department of Neurology, Columbia University Medical Center, New York, NY, USA 29 30 3 31 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 32 4 33 Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain http://bmjopen.bmj.com/ 34 35 5CIBERER, Instituto de Salud Carlos III, Spain 36 37 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 38 39 40 21224, USA 41 7 42 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy on September 28, 2021 by guest. Protected copyright. 43 44 8 Senior authorship is shared by LS and PN 45 46 47 48 49 50 51 Corresponding author 52 53 Plácido Navas 54 55 Tel (+34)954349381; Fax (+34)954349376 56 57 e mail: [email protected] 58 59 60 1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 30 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 SUPPLEMENTARY DATA 5 6 7 8 Identification of genes, biological process and pathways regulated in CoQ deficiency. 9 10 10 11 Data analysis for each gene in the array compared the signal of each patient’s fibroblast mRNA 12 13 with the signal of each control fibroblast mRNA, over which the statistical analyses were 14 15 performed. MAS5For algorithm peer and SAM software review were performed inonly order to select those probe sets 16 17 with significant differences in gene expression. Approximately from 6% to 11% of the probe sets 18 19 20 present in the array were picked with a significant fold change higher than 1.5, while the false 21 22 discovery rate (FDR) was maintained lower than 5%, the maximum value to consider changes as 23 24 significant [1]. Even more, we reduced the FDR to cero by increasing the stringency of the 25 26 statistical analysis via extension of the cut off threshold ( value). After such filtering, from 842 to 27 28 1672 probe sets were identified as showing significant differences in expression between CoQ 29 10 30 31 deficient fibroblasts and control cells, representing approximately 2% to 3% of the array 32 33 (supplementary table 9 online). Later on, we compared the regulated probes in each comparative http://bmjopen.bmj.com/ 34 35 analysis in order to get a list of genes that were regulated simultaneously in all patient’s fibroblasts 36 37 at the same time (supplementary tables 10 and 11 online). We found 136 probes whose expression 38 39 40 was regulated similarly in all samples, including 47 UP regulated probes and 89 DOWN regulated 41 42 ones. Most of the other probes that were selected as significant in only one sample were no selected on September 28, 2021 by guest. Protected copyright. 43 44 in other (2575 probes were regulated similarly in 3 or less of the 4 samples), and 174 probes 45 46 appeared UP regulated in some samples and DOWN regulated in others. Taking in mind that an 47 48 Affymetrix GeneChip® Human Genome U133 Plus 2.0 Array contains 54675 probes, the 49 50 51 probability of the 136 selected probes to be randomly selected in one comparative analysis is 52 53 0.0025, which represents the 136 over the total amount of probes present in the array. This 54 55 probability is reduced to 0.00000625 (less that one probe per array) if we consider two analyses to 56 57 select randomly the 136 probes, and it is reduced to almost zero if we consider the four comparative 58 59 60 2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 31 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 analyses over which we ran the statistical analysis. This result gave us the security that the changes 3 4 in the gene expression were due to the mitochondrial of CoQ10 deficiency syndrome and not to a 5 6 random selection of probes. Then, the probes were grouped in a list to define the most altered genes 7 8 as biological markers in the mitochondrial of CoQ deficiency syndrome. We found that many of 9 10 10 11 them represented the same gene, so that the 136 probes correspond to 116 regulated genes (Table 12 13 2). These were validated in selected representative cases by quantitative real time PCR (Table 2 and 14 15 supplementary tableFor 1 online). peer To corroborate review the altered gene expression, only we considered to re 16 17 hybridize the same samples with another oligonucleotide array, the Affymetrix Gene Chip® Human 18 19 20 Gene 1.0 ST Array. The analysis was performed as follows: PLIER algorithm and SAM software 21 22 were performed in order to select those probe sets with significant differences in gene expression 23 24 (s0=50; R=1.5; cut off threshold of delta value so that FDR=0%). The regulation on gene 25 26 expression is listed in parallel to the main analysis in table 2 and supplementary table 1 online. 27 28 Finally, we called such genes as genes regulated in the mitochondrial CoQ deficiency syndrome. 29 10 30 31 32 33 CoQ10 supplementation partially restores the altered gene expression of CoQ10 deficient http://bmjopen.bmj.com/ 34 35 fibroblasts. 36 37 We extracted total RNA from 5 different cultures of CoQ10 deficient fibroblast treated for 48 hours 38 39 40 with 30 M of CoQ10 and duplicate hybridizations were performed with the Affymetrix Gene 41 42 Chip® Human Gene 1.0 ST Array. The statistical analysis was performed as follow, using PLIER on September 28, 2021 by guest. Protected copyright. 43 44 algorithm and SAM software to select those probe sets with t test<0.05 and establishing three 45 46 different thresholds of minimum fold change (R=1.5; R=2.0; and R=3.0) to select a probe as 47 48 significant. After that we made a comparative analysis between the three types of fibroblasts: 49 50 51 control (C), fibroblasts from CoQ10 deficient patients (P), and CoQ10 supplemented fibroblasts from 52 53 CoQ10 deficient patients (PQ). Finally, we obtained three different comparative analyses: treated 54 55 versus non treated fibroblasts (PQ P), treated versus control fibroblasts (PQ C), and non treated 56 57 58 59 60 3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 32 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 versus control fibroblasts (P C) that represented the previous analysis done between CoQ10 3 4 deficient fibroblasts and control ones. 5 6 Independently of the minimum full change threshold that we used, around a half of the probes 7 8 selected with the comparative analyses between CoQ deficient and control fibroblasts (both P C 9 10 10 11 and PQ C) were selected in the analysis between treated and non treated fibroblasts (supplementary 12 13 table 3 online), indicating that CoQ10 supplementation altered the expression of around 50% of the 14 15 regulated genesFor by CoQ10 deficiency.peer Also, reviewby increasing the minimum only full change threshold, the 16 17 number of selected probes as significant was halved in each comparative analysis. 18 19 20 Considering that a regulated probe, either being up regulated or down regulated, in a comparative 21 22 analysis can be regulated or not in the others comparative analyses, 27 possibilities can be achieve 23 24 for a probe to be or not to be regulated in one, two or in all the comparative analyses 25 26 (supplementary table 4 online and figure S1 for a graphical view). Because of the objective of these 27 28 analyses is to study how the altered gene expression in CoQ deficiency was regulated with the 29 10 30 31 supplementation of CoQ10, we decided to not consider those probes regulated only in one 32 33 comparative analysis, as it happened using a threshold of twice for the minimum full change http://bmjopen.bmj.com/ 34 35 (R=2.0), since those genes were slightly modified with a lower R value (R=1.5) and became 36 37 unselected and no significant by increasing the minimum full change threshold (i.e. R=2.0). 38 39 40 After that, we established 5 groups of classification for a probe to be regulated after CoQ10 41 42 supplementation (supplementary figure 1 online for a graphical interpretation and supplementary on September 28, 2021 by guest. Protected copyright. 43 44 table 2 online for full details). Around half of the regulated probes in CoQ10 deficiency were 45 46 unaffected after the treatment with CoQ10, whereas most of the 50% that changed the gene 47 48 expression did not affect the relative pattern respect control fibroblasts. Only the 20% restored 49 50 51 completely the gene expression after CoQ10 supplementation and the 3% shift their expression 52 53 showing an opposite regulation than in CoQ10 deficiency. The 72% of the probes in CoQ10 54 55 deficiency kept a similar gene expression pattern in the presence of CoQ10 respect to control 56 57 fibroblasts. 58 59 60 4 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 33 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Also, we looked the highly regulated genes in the CoQ10 deficiency listed in table 1 to see if the 3 4 supplementation with CoQ10 modify, restore or even alter more their expression. Almost all the 5 6 genes were regulated in one patient or treatment, although only 73% of the known genes listed in 7 8 table 2 were regulated according to the previously described groups of classification (75 classified 9 10 11 out of 103 known genes). The 54% of the classified genes restored the control expression level after 12 13 the treatment either partially (19%, 14 out of 75) or completely (35%, 26 of the 75), whereas the 14 15 27% kept their regulationFor as peer it happened in CoQreview10 deficiency (20 outonly of 75). The 13% of the genes 16 17 (10 out of 75) presented an opposite regulation in the presence of CoQ10 respect to that in CoQ10 18 19 20 deficiency, and the 5% of them (4 out of 75) amplified the altered gene expression showed by the 21 22 patient fibroblasts, whereas only 1% of the regulated in CoQ10 deficiency (1 out of 75) were CoQ10 23 24 specific regulated after the treatment. Such changes had been next discussed in the main text. 25 26 To get a biological meaning of such changes, we decided to study the gene ontologies (GO) 27 28 regulated by CoQ supplementation in CoQ deficient fibroblasts within each group of 29 10 10 30 31 classification, using the GORILLA software (Gene Ontology enrichment analysis and visualization 32 33 tool) [2]. After the statistical analysis we got 70 regulated GO with a significant P value<0.001 and http://bmjopen.bmj.com/ 34 35 a given enrichment value that represents the more altered GO within each group of classification 36 37 (supplementary table 5 online). A positive enrichment value signified that CoQ10 supplementation 38 39 40 kept activated the expression of the gene included within the selected GO, whereas a negative value 41 42 meant that the expression was kept down. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 Full description of genes, biological process and pathways regulated in CoQ10 deficiency. 47 48 Related to energy production: 49 50 51 Three mitochondrial genes were included within the most altered listed in table 2. One of 52 53 these,C7orf55, is directly involved in the formation of complex I and was down regulated, in 54 55 agreement with the general repression of mitochondrial respiration. The other two mitochondrial 56 57 58 59 60 5 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 34 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 targeted genes, BRP44 and C10orf58, also showed altered expression but their functions are still 3 4 unknown. 5 6 Related to lipid metabolism: 7 8 Cholesterol metabolism was highly repressed in CoQ deficient fibroblasts and multiple enzymes 9 10 10 11 were affected, including enzymes involved directly in cholesterol biosynthesis (FTFT1, IDI1), their 12 13 regulators (CH25H, RSAD2), regulators of cholesterol concentration inside the cell (INSIG1, 14 15 LDLR), and enzymesFor that catalyzepeer the rate limiting review step in the biosynthetic only pathway of both sterols 16 17 (SQLE) and unsaturated fatty acids (SCD). Overall, ß oxidation of fatty acids was unaffected, but 18 19 20 genes acting on its regulation decreased by 50%. The repressed enzymes of lipid metabolism and 21 22 fatty acids ß oxidation remained down regulated after CoQ10 supplementation (table 2), although 23 24 the repressed key regulator proteins (CH25H and the insulin inducible gene INSIG1) that control 25 26 cholesterol concentration inside the cell inverted their expression levels and appeared highly up 27 28 regulated by treatment. 29 30 31 Related to insulin metabolism: 32 33 Two peptidases involved in the processing of both proinsulin and other prohormones (CPE, selected http://bmjopen.bmj.com/ 34 35 twice in the array with two different probes) and in the cleavage of insulin like growth factor 36 37 binding proteins (PAPPA) were highly activated, whereas a convertase (PCSK2, also selected 38 39 40 twice) involved in the regulation of insulin biosynthesis was highly repressed (Table 2). Also, a 41 42 liver specific glycogen phosphorylase (PYGL), responsible for glucose mobilization, was on September 28, 2021 by guest. Protected copyright. 43 44 repressed. These two latter genes shift their expression to either up regulation or to control levels 45 46 after CoQ10 supplementation. 47 48 Related to cell cycle: 49 50 51 Specifically, genes involved in cell cycle activation and maintenance were up regulated, including 52 53 mitogen, growth factors and receptors (VEGFA, POSTN, SEMA5A), intracellular activators for 54 55 MAP kinase pathway that enhances cell proliferation and reduces differentiation (AEBP1, CSRP2, 56 57 DOK5, MID1), and transcriptional activators that mediate growth factor activity and inhibit 58 59 60 6 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 35 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 differentiation (CHURC1, CREG1, RUNX1). In contrast, genes involved in cell cycle regulation 3 4 increased or decreased their expression depending of their activating or repressing roles (Table 2). 5 6 Furthermore, both a mediator of anti proliferative signals (IFITM1) and a transcriptional repressor 7 8 of cell division (BHLHB5) were down regulated. This proliferative transcriptome is also facilitated 9 10 11 by the repression of cellular attachment factors (EDN1, MATN2, MCAM, MKX) and by the up 12 13 regulation of extracellular matrix proteins that reduce cell attachment (PSG6, DCN, PKP4) and 14 15 favor cell divisionFor (EFEMP1, peer VCAN). review only 16 17 GO clusters favoring cell cycle and cell division were activated and those inhibiting cell growth 18 19 20 were repressed (Table 3). Thus, there was activation of DNA replication, mitosis, meiosis, synthesis 21 22 of microtubule components involved in cell division, such as spindle pole, segregation of 23 24 chromosomes, and the positive growth regulation. On the other hand, there was a general down 25 26 regulation of biological processes related with nucleosome assembly, and chromosome organization 27 28 and biogenesis. This trend could be explained by the repression of Swi/Snf chromatin remodeling 29 30 31 apparatus, in which SMARCA1 and SMARCA4 components were specifically down regulated in 32 33 all CoQ10 deficient fibroblasts (Table 2), thus preventing the cell cycle arrest that is induced by the http://bmjopen.bmj.com/ 34 35 activation of p21 pathway by BRG1/SMARCA4 [3]. 36 37 Related to differentiation: 38 39 40 Differentiation of these cells was compromised because of the down regulation of factors necessary 41 42 for differentiation (BDNF, GRP, NTNG1, PTN), transcription factors expressed during on September 28, 2021 by guest. Protected copyright. 43 44 development and morphogenesis (FOXQ1, HOXA11, HOXC9, LHX9, SP110), intracellular 45 46 transducers of development and morphogenesis (P2RY5, TSPAN10), antigens expressed on the 47 48 surface of differentiated cells (TSHZ1, EPSTI1), and structural proteins of cytoskeleton expressed 49 50 51 at the end of differentiation, such as keratin (KRT34) and tropomyosin (TPM1) (Tables 2). 52 53 Conversely, repressors of differentiation during development (FOXP1, LMCD1) were activated. 54 55 Follicle stimulating hormone (FSH) stimulates the differentiation of germ cells [4] through the 56 57 activation of genes that are significantly down regulated in CoQ10 deficient cells. Accordingly, the 58 59 60 7 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 36 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 FSH suppressing hormone follistatin (FST) was increased in the same cells. FST inhibits both 3 4 development and morphogenic proteins function [5]. Finally, the maintenance of cell division is 5 6 supported by the fact that 47 of the 51 genes encoding for proteins involved in both DNA 7 8 replication and cell cycle progression behaved similarly to those genes regulated after the addition 9 10 11 of serum or growth factors to fibroblasts [6, 7]. 12 13 The gene expression profile of CoQ10 deficient fibroblasts was similar to that shown by different 14 15 cell models (supplementaryFor peertable 5 online). reviewCoQ10 deficient cells repressedonly CD31 and presented 16 17 similar gene expression profile than cells lacking CD31 [8], which maintains the non differentiated 18 19 20 phenotype and stemness properties. Similarly, CoQ10 deficient cells showed the same pattern of 21 22 gene expression than (1) undifferentiated tumor cells compared to well differentiated cancer cells 23 24 [9], (2) embryonic stem cells compared to differentiated brain and bone marrow cells [10], and (3) 25 26 immature lymphocytes compared to both mature CD4(+) T cells [11] and B cells [12]. Also CoQ10 27 28 deficient cells were regulated as hematopoietic stem cells, activating the mechanism to avoid the 29 30 31 replicative stress and bypass the senescence program [13]. 32 33 Related to cell survival and cell resistance: http://bmjopen.bmj.com/ 34 35 Within the most regulated genes classified under these altered biological processes (Table 3), we 36 37 note that several oxidoreductases that take part in xenobiotic and drug metabolism (CYP1B1, 38 39 40 MGC87042), a stress induced protein (TMEM49), and a gene involved in the nucleotide excision 41 42 repair (RAD23B) were induced. Intracellular stress was controlled by activation of thioredoxin on September 28, 2021 by guest. Protected copyright. 43 44 regulator (TXNIP) and of a kinase that activates the JAK/STAT pathway (SGK1), whereas an 45 46 inhibitor of this pathway (SOCS3) and Rho GTPase (RHOU) that induces the dissolution of stress 47 48 fibers through the JNK pathway were repressed. In parallel, tumor suppressor genes (AIM1 and 49 50 51 APCDD1), cell surface antigens that facilitate apoptosis in tumor cells (MAGED1, MAGED4/4B), 52 53 and Rho GTPase (RAC2) that activates the intracellular signaling to induce apoptosis appeared 54 55 down regulated. CoQ10 deficient fibroblasts also showed activation of a cell surface receptor that 56 57 inhibits apoptosis (TNFRSF10D) and of a modulator of Wnt signaling pathway that sends anti 58 59 60 8 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 37 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 apoptotic and pro proliferative paracrine signals to adjacent cells (SFRP1). Furthermore, these cells 3 4 also showed repression of some effectors of cell death involved in cytoskeleton reassembly during 5 6 apoptosis (TRIM55) and of the interferon induced genes that activate apoptosis (IFI6, and XAF1). 7 8 Gene expression pattern showed that CoQ deficient fibroblasts had a higher survival and stress 9 10 10 11 resistance, a phenomenon similar to the up regulation of the drug resistant gene profile in cancer 12 13 cells compared to chemo sensitive cell lines [5], and to the down regulated and repressed pathways 14 15 in oxidative stressFor induced inpeer epithelium cells review [14]. Furthermore, CoQonly10 deficient fibroblasts 16 17 showed a gene expression pattern that was opposite to that of fibroblasts treated with either 18 19 20 transforming growth factor ß (TGF ß) [15] or with the antitumor drug trabectedin [16, 17]. 21 22 Related to signalling: 23 24 Signaling pathways were also affected by CoQ10 deficiency (Table 2) through the activation of 25 26 genes, each selected three times in the statistical analysis, including a GTP binding protein 27 28 (ARL4C) involved in transferrin recycling from early endosomes, a ubiquitin specific peptidase 29 30 31 with no peptidase activity (USP53), and a G protein receptor (GABBR2) that inhibits adenilil 32 33 cyclase and activates phospholipase A2. A set of signaling genes were down regulated including a http://bmjopen.bmj.com/ 34 35 G protein (GNG2) and a guanine exchange factor for G proteins (HERC6), a finding that agrees 36 37 with the repression of GTPase activity and G protein signaling showed in table 2. There was also 38 39 40 repression of a Rab effector (MLPH) involved in vesicular transport, an adaptor of cell surface 41 42 receptors to Tyrosine kinase (NCK2) that also interact with T cell surface glycoproteins, and an on September 28, 2021 by guest. Protected copyright. 43 44 effector protein (PARP14) induced by STAT6 during IL4 signaling in immune cells. However, the 45 46 molecular activator of Rho GTPase appeared activated, which could be related to the activation of 47 48 cytoskeleton for contraction as shown above. 49 50 51 Related to immunity: 52 53 CoQ10 deficient fibroblasts also showed a general inhibition of most immunity related genes (Table 54 55 2), and of pathways and biological processes involved in immunity regulation (Table 3). Repressed 56 57 genes include cell surface antigens (CDC42SE2, LY6K), receptors and cytokines for immune 58 59 60 9 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 38 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 activation (GALNAC4S 6ST, TNFSF4, TRIM14), butyrophilin 3, an immunoglobulin associated to 3 4 milk fat droplets (BTN3A2, BTN3A3), several interferon inducible genes of unknown function 5 6 (IFI27, IFI44L, IFIT1, IFIT3), and other genes whose products bind microtubules (IFI44), take part 7 8 in the immunoproteasome (PSMB9), activate immune cells during immune response (GBP1, 9 10 11 ISG15, MX1 and MX2), or control differentiation and induce apoptosis (OAS2 and OAS3). Both 12 13 OAS1 and OASL genes were also repressed but to a lesser extent. Other interferon inducible 14 15 proteins markedlyFor repressed peer in CoQ10 deficient review fibroblast were described only above and include the two 16 17 regulators of apoptosis (IFI6 and XAF1), the regulator of development (EPSTI1) and the inhibitor 18 19 20 of cell proliferation (IFITM1). Taken together, these findings support the concept that immune 21 22 response was generally repressed in CoQ10 deficient cells (Table 3), such as the response to virus 23 24 and lymphocyte T functions, including proliferation and activation. 25 26 CoQ10 supplementation restored the gene expression of almost all interferon inducible genes to 27 28 control levels. This restoration mainly affects stress and immune responses and can be attributed to 29 30 31 the anti inflammatory properties of CoQ10 [18, 19]. Treatment of fibroblasts with interleukin 6 [20] 32 33 or treatment of endothelial cells with interferon [21] induced a transcriptomic profile opposite to http://bmjopen.bmj.com/ 34 35 that described for CoQ10 deficient fibroblasts because activated pathways with interleukin or 36 37 interferon were repressed in CoQ10 deficiency. 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 39 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 SUPPLEMENTARY METHODS 5 6 7 8 RNA extraction 9 10 11 Three groups of cells were cultured independently from each type of fibroblast prior to RNA 12 13 extraction. Each group of cells was then homogenized in 1 ml of Tripure Isolation Reagent (Roche) 14 15 and RNA was extractedFor with peer chloroform and review precipitated with 2 propanol only by centrifugation at 16 17 12000 g for 10 min at 4ºC. After washing with 75% EtOH, RNA was resuspended in DEPC treated 18 19 20 water and treated with deoxyribonuclease I (Sigma) for removal of possible DNA contamination. 21 22 RNA was cleaned with the RNeasy® MinElute™ Cleanup kit (Qiagen), its concentration and purity 23 24 were checked spectrophotometrically, and its quality was verified electrophoretically. RNA was 25 26 stored at –20 ºC in RNase free water. 27 28 29 30 31 Probe synthesis and hybridization with expression Arrays 32 33 A cRNA probe was synthesized and fragmented from each RNA sample using Affymetrix® http://bmjopen.bmj.com/ 34 35 protocols and kits provided by Qiagen. Each cRNA probe was then hybridized to independent 36 37 GeneChip® Human Genome U133 Plus 2.0 Array (Affymetrix), an expression array that covers 38 39 40 mainly at the 3’ end over 47000 transcripts and variants, representing around 39000 of the best 41 42 characterized human genes, plus another 9921 probes sets representing an extra 6500 new genes, all on September 28, 2021 by guest. Protected copyright. 43 44 of them covered by 11 probes pairs per array. 45 46 Hybridization and high quality scan of the arrays was performed with specific protocols and 47 48 equipment provided by Affymetrix as described previously[22]. To corroborate the previous results, 49 50 51 the same cDNA probes synthesized from both the control fibroblast and one of the patient samples 52 ® 53 were re hybridizing with the GeneChip Human Gene 1.0 ST Array (Affymetrix), an exon 54 55 expression arrays that offers whole transcript coverage from each of the 28869 genes represented 56 57 on the array, each of them covered by approximately 26 probes spread across the full length of the 58 59 60 11 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 40 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 gene. For CoQ10 supplementation analyses, cDNA probes from treated and not supplemented 3 4 patient’s fibroblast were hybridized with the GeneChip® Human Gene 1.0 ST Array (Affymetrix). 5 6 Data had been deposited with the NCBI GEO database, at http://www.ncbi.nlm.nih.gov/geo/, 7 8 accession number GSE33941 (this SuperSeries is composed of two subset Series, see 9 10 11 supplementary table 10 online for an explanation). 12 13 14 15 Q RT PCR For peer review only 16 17 One g of RNA was reverse transcribed using the iScript cDNA Synthesis Kit (Biorad). Real Time 18 19 20 PCR was performed in triplicate in a MyiQ™ Single Color Real Time PCR Detection System 21 22 (Biorad) coupled to a Biorad conventional thermocycler. Primers for selected genes and the 23 24 housekeeping gene were designed with the Primer Premier 5 software (see supplementary table 11 25 26 online for primer sequences). Amplification was carried on with iQ SYBR Green supermix (Biorad) 27 28 with the following thermal conditions: 30 s at 95°C and 45 cycles of 30 s at 94°C, 30 s at 60°C and 29 30 31 30 s at 72°C. All the results were normalized to the levels of 18S rRNA. The raw fluorescence data 32 33 were extracted using Light Cycler data collection software version 3.5 (Roche) and analyzed http://bmjopen.bmj.com/ 34 35 according to manufacturer’s instructions for baseline adjustment and noise reduction. 36 37 38 39 40 Epigenetic analysis 41 42 DNA (CpG) methylation analysis is based on a base specific cleavage reaction combined with mass on September 28, 2021 by guest. Protected copyright. 43 44 spectrometric analysis (MassCLEAVE™). In brief, the method employs a T7 promoter tagged 45 46 PCR amplification of bisulphite converted DNA, followed by generation of a single stranded RNA 47 48 molecule and subsequent base specific cleavage (3′ to either rUTP or rCTP) by RNase A. The 49 50 51 mixture of cleavage products differing in length and mass are analyzed by MALDI TOF MS. 52 53 Differences in template DNA methylation profile will result in changes in nucleotide sequence after 54 55 bisulphite treatment, which in turn will yield different fragment masses in the assay. The abundance 56 57 58 59 60 12 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 41 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 of each fragment (signal/noise level in the spectrum) is indicative of the amount of DNA 3 4 methylation in the interrogated sequence. 5 6 The previous Bisulfite treatment was done as follow. Genomic DNA sodium bisulfite conversion 7 8 was performed with 1 g of genomic DNA by using EZ 96 DNA methylation kit (Zymo Research) 9 10 11 manufacturer's protocol. 12 13 The methylation assay was done as follow. Sequenom's MassARRAY platform was used to 14 15 perform quantitativeFor methylation peer analysis. Thisreview system utilizes MALDI TOF only mass spectrometry in 16 17 combination with RNA base specific cleavage (MassCLEAVE). A detectable pattern is then 18 19 20 analyzed for methylation status. PCR primers for amplification of different regions of the genes 21 22 listed in table 2 were designed by using Epidesigner (Sequenom). When feasible, amplicons were 23 24 designed to cover CGIs in the same region as the 5′ UTR. For each reverse primer, an additional T7 25 26 promoter tag for in vivo transcription was added, as well as a 10 mer tag on the forward primer to 27 28 adjust for melting temperature differences. 29 30 31 The PCRs were carried out in a 5 l format with10 ng/ml bisulfite treated DNA, 0.2 units of 32 33 TaqDNA polymerase (Sequenom), 1x supplied Taq buffer, and 200 mM PCR primers. http://bmjopen.bmj.com/ 34 35 Amplification for the PCR was as follows: pre activation of 95°C for 15 min, 45 cycles of 95°C 36 37 denaturation for 20 s, 56°C annealing for 30 s, and 72°C extension for 30 s, finishing with a 72°C 38 39 40 incubation for 4 min. Dephosphorylation of unincorporated dNTPs was performed by adding 1.7 ml 41 42 of H2O and 0.3 units of shrimp alkaline phosphatase (Sequenom), incubating at 37°C for 20 min, on September 28, 2021 by guest. Protected copyright. 43 44 then for 10 min at 85°C to deactivate the enzyme. 45 46 The MassCLEAVE biochemistry was performed as follows. Next, in vivo transcription and RNA 47 48 cleavage was achieved by adding 2 l of PCR product to 5 l of transcription/cleavage reaction and 49 50 51 incubating at 37°C for 3 h. The transcription/cleavage reaction contains 27 units of T7 R&DNA 52 53 polymerase (Sequenom), 0.64x of T7 R&DNA polymerase buffer, 0.22 l T Cleavage Mix 54 55 (Sequenom), 3.14 mM DTT, 3.21 l H2O, and 0.09 mg/ml RNase A (Sequenom). The reactions 56 57 58 59 60 13 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 42 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 will be additionally diluted with 20 ml of H2O and conditioned with 6 mg of CLEAN Resin 3 4 (Sequenom) for optimal mass spectra analysis. 5 6 For the statistical analysis, amplicons covering the same gene were pooled together and the CpGs’ 7 8 methylation degree were analyzed with the MultiExperiment Viewer software developed by 9 10 11 Saeed[23]. ANOVA test was performed as follows: 3 groups (control, untreated CoQ10 deficient, 12 13 and CoQ10 deficient supplemented with CoQ10); alpha (overall threshold p value) = 0.05; 14 15 significance determinedFor by alphapeer with standard review Bonferroni correction; only and Pearson correlation for 16 17 clustering of samples and CpGs. 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 14 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 43 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 SUPPLEMENTARY FIGURE LEGEND 5 6 7 8 9 10 11 12 13 Supplementary figure 1. Graphical view of gene regulation by CoQ10 supplementation in 14 15 CoQ10 deficiency.For peer review only 16 17 The comparative analysis between CoQ10 deficient and control fibroblasts (P Q), between untreated 18 19 20 and CoQ10 supplemented fibroblasts from patient with CoQ10 deficiency (PQ P), and between 21 22 CoQ10 deficient cells treated with CoQ10 and control fibroblasts (PQ P) gave 27 possibilities for a 23 24 probe to be or not to be regulated in one, two or in all the three comparative analyses, considering 25 26 that a regulated probe in a comparative analysis, being the probe activated or repressed, can be 27 28 regulated or not in the other comparative analyses. The 5 different groups of classification, 29 30 31 depending on effect of CoQ10 supplementation on gene expression in fibroblasts of patients 32 33 suffering CoQ10 deficiency, are listed in parallel and numbered between parentheses. For a table http://bmjopen.bmj.com/ 34 35 with full details in number of genes in each category see supplementary table 8 online. The genes 36 37 that were not classified into any of these groups were those that either slightly regulated the gene 38 39 40 expression in only one comparative analysis or even did not change the expression in any of them. 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 Supplementary Figure 2. Regulated genes in CoQ deficiency. 49 10 50 51 Functional representation of regulated genes in the syndrome of CoQ10 deficiency. Represented are 52 53 listed in table 1 and fully described in the text. Left schema represents a cell where are located all 54 55 the up regulated genes, whereas all the repressed genes are located in the right schema. In red are 56 57 shown all the genes that both kept up their activation after CoQ10 supplementation and those 58 59 60 15 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 44 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 repressed in CoQ10 deficiency that CoQ10 activated so that they were up regulated respect the 3 4 control; in green are shown all the genes that kept down their repression after CoQ10 5
6 supplementation and those activated in CoQ10 deficiency that were repressed after the treatment 7 8 with CoQ , being repressed now respect to the control; in blue are shown the regulated genes that 9 10 10 11 completely restored the expression to control level after the CoQ10 supplementation. 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 16 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 45 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 SUPPLEMENTARY REFERENCES 3 4 5 6 1. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation 7 response. Proc Natl Acad Sci USA. 2001;98(9):5116 21. 8 2. Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z. GOrilla: a tool for discovery and visualization of enriched 9 GO terms in ranked gene lists. BMC Bioinformatics. 2009;10(1):48. 10 3. Hendricks KB, Shanahan F, Lees E. Role for BRG1 in Cell Cycle Control and Tumor Suppression. Mol Cell 11 Biol. 2004;24(1):362 76. 4. Ji Q, Liu PI, Chen PK, Aoyama C. Follicle stimulating hormone induced growth promotion and gene 12 expression profiles on ovarian surface epithelial cells. International Journal of Cancer. 2004;112(5):803 14. 13 5. Sidis Y, Mukherjee A, Keutmann H, Delbaere A, Sadatsuki M, Schneyer A. Biological Activity of Follistatin 14 Isoforms and Follistatin Like 3 Is Dependent on Differential Cell Surface Binding and Specificity for Activin, 15 Myostatin, and BoneFor Morphogenetic peer Proteins. Endocrinology. review 2006;147(7):3586 97. only 16 6. Kang H, Kim I, Park J, Shin Y, Ku J, Jung M, et al. Identification of genes with differential expression in 17 acquired drug resistant gastric cancer cells using high density oligonucleotide microarrays. Clin Cancer Res. 18 2004;1(10):272 84. 19 7. Weston GC, Haviv I, Rogers PAW. Microarray analysis of VEGF responsive genes in myometrial endothelial 20 cells. Molecular Human Reproduction. 2002;8(9):855 63. 21 8. Boquest A, Shahdadfar A, Frønsdal K, Sigurjonsson O, Tunheim S, Collas P, et al. Isolation and transcription 22 profiling of purified uncultured human stromal stem cells: alteration of gene expression after in vitro cell culture. Mol 23 Biol Cell. 2005;16(3):1131 41. 9. Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, et al. Large scale meta analysis of 24 cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. 25 Proceedings of the National Academy of Sciences of the United States of America. 2004;101(25):9309 14. 26 10. Ramalho Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. "Stemness": Transcriptional Profiling of 27 Embryonic and Adult Stem Cells. Science. 2002;298(5593):597 600. 28 11. Lee MS, Hanspers K, Barker CS, Korn AP, McCune JM. Gene expression profiles during human CD4+ T cell 29 differentiation. International Immunology. 2004;16(8):1109 24. 30 12. Hoffmann R, Seidl T, Neeb M, Rolink A, Melchers F. Changes in gene expression profiles in developing B 31 cells of murine bone marrow. Genome Res. 2002;12(1):98 111. 32 13. Kamminga LM, Bystrykh LV, de Boer A, Houwer S, Douma J, Weersing E, et al. The Polycomb group gene 33 Ezh2 prevents hematopoietic stem cell exhaustion. Blood. 2006;107(5):2170 9. http://bmjopen.bmj.com/ 34 14. Weigel AL, Handa JT, Hjelmeland LM. Microarray analysis of H2O2 , HNE , or tBH treated ARPE 19 cells. 35 Free Radic Biol Med. 2002;33(10):1419 32. 36 15. Verrecchia F, Chu M L, Mauviel A. Identification of Novel TGF β/Smad Gene Targets in Dermal Fibroblasts using a Combined cDNA Microarray/Promoter Transactivation Approach. Journal of Biological Chemistry. 37 2001;276(20):17058 62. 38 16. Martínez N, Sánchez Beato M, Carnero A, Moneo V, Tercero JC, Fernández I, et al. Transcriptional signature 39 of Ecteinascidin 743 (Yondelis, Trabectedin) in human sarcoma cells explanted from chemo naÃ‾ve patients. 40 Molecular Cancer Therapeutics. 2005;4(5):814 23. 41 17. Wesolowski R, Budd GT. Use of chemotherapy for patients with bone and soft tissue sarcomas. Cleve Clin J 42 Med. 2010;77(Suppl 1):S23 S6. on September 28, 2021 by guest. Protected copyright. 43 18. Schmelzer C, Lorenz G, Lindner I, Rimbach G, Niklowitz P, Menke T, et al. Effects of Coenzyme Q_10 on 44 TNF α secretion in human and murine monocytic cell lines. BioFactors. 2007;31(1):35 41. 45 19. Turunen M, Wehlin L, Sjoberg M, Lundahl J, Dallner G, Brismar K, et al. beta2 Integrin and lipid 46 modifications indicate a non antioxidant mechanism for the anti atherogenic effect of dietary coenzyme Q10. Biochem 47 Biophys Res Commun. 2002;296(2):255 60. 48 20. Dasu MR, Hawkins HK, Barrow RE, Xue H, Herndon DN. Gene expression profiles from hypertrophic scar 49 fibroblasts before and after IL 6 stimulation. The Journal of Pathology. 2004;202(4):476 85. 21. Sana TR, Janatpour MJ, Sathe M, McEvoy LM, McClanahan TK. Microarray analysis of primary endothelial 50 cells challenged with different inflammatory and immune cytokines. Cytokine. 2005;29(6):256 69. 51 22. Fernández Ayala D, Chen S, Kemppainen E, O'Dell K, Jacobs H. Gene Expression in a Drosophila Model of 52 Mitochondrial Disease. PLoS ONE. 2010;5(1):e8549. 53 23. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, et al. TM4 microarray software suite. 54 Methods in enzymology. 2006;411:134 93. Epub 2006/08/31. 55 56 57 58 59 60 17 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 46 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 SUPPLEMANTARY TABLES ONLINE 5 6 Table 1 Regulated probes in the mitochondrial syndrome of CoQ10 deficiency 7 8 Table 2 Regulation of energetic metabolism in CoQ10 deficiency 9 10 Table 3 Regulated genes in either primary (3A) or secondary (3B) deficiency classified into Gene Ontologies 11 12 Table 4 GO classification of regulated genes common to primary and secondary CoQ10 deficiency 13 14 Table 5 Regulated pathways in CoQ10 deficiency 15 For peer review only 16 Table 6 Regulated probes in CoQ10 deficient fibroblast treated with 30 M
17 Table 7 Regulated probes in CoQ10 deficient fibroblast treated with 30 M (expanded table) 18 19 Table 8 Classification groups of gene expression after CoQ10 supplementation 20 21 Table 9 GO classification of regulated genes in CoQ10 deficient fibroblasts supplemented with CoQ10 22 23 Table 10 Sample description during submission to NCBI GEO (SuperSeries GSE33941) 24 25 Table 11 Primers used for Q RT PCR 26 27 Table 12 Selection of probes during filtering and statistical analysis in CoQ10 deficient fibroblast 28 29 Table 13 Coherence of changes in gene expression after the comparative analysis
30 Table 14 Coherence of changes in gene expression after the comparative analysis (expanded table) 31 32 Table 15 Pathology's gene expression similar to CoQ10 deficiency 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 18 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(f) 10
fold fold fold 2 2 3 – – +
CoQ
(e) 8,3 9,1 0,1
8,0 4,3 1,3
Q RT PCR (d)
10
R R U O U U U U U U U O O O U U pR pR pR pR CoQ
(c) nc nc 1,5 1,9 1,6 1,6
1,6 1,6 1,5 1,5 3,2 1,8 nc nc nc nc nc 2,3 1,7 1,7 (1,4)
FC
0,4 0,3 0,2 0,2 0,1 0,2 0,3 0,1 0,1 0,4 0,0 0,3 0,1 0,2 0,1 (b) 0,4 15,0 14,7 0,2 0,3 0,2 0,2 10,7 6,0 1,1 0,9 1,1 0,6 1,4 0,4
2,0 2,4 2,2 2,2 2,0 6,8 2,8 2,4 3,0 2,5 3,3 2,1 1,4 1,3 1,2 1,2 1,3 1,5 1,5 1,3 1,3 1,3 1,2 1,4 1,3 1,5 1,3 20,7 18,2 10,8
mean FC
(a) at
Probe ID Probe 202427_s_at 224435_at 228155_at 209163_at 207986_x_at 209164_s_at 210816_s_at 217200_x_at 209366_x_at 207843_x_at 215726_s_at 217021_at 202263_at 1560043_at 220230_s_at 201885_s_at 1554574_a_at 219079_at 210950_s_at 208647_at 204615_x_at 208881_x_at 206932_at 242625_at 201627_s_at 201626_ 202068_s_at 209218_at 200832_s_at 226780_s_at
19 BMJ Open http://bmjopen.bmj.com/
deficiency
10
desaturase)
9 on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
A hydroxylase diphosphate delta diphosphate isomerase 1 For peer review only adenosyl methionine containingdomain 2 diphosphate farnesyltransferasediphosphate 1 CoA CoA (deltadesaturase chromosome 10 reading open frame 58 cytochrome b561 cytochrome b5 cytochrome b5 reductase 1 cytochrome b5 reductase 2 cytochrome b5 reductase 3 cytochrome b5 reductase 4 farnesyl isopentenyl cholesterol 25 S radical inducedinsulin 1 gene low lipoprotein density receptor squalene epoxidase stearoyl chromosome frame7 open reading 55 brain brain protein 44
5R2
IDI1 SCD SQLE LDLR BRP44 FDFT1 CH25H RSAD2 INSIG1 CYB5A C7orf55 CYB561 CYB5R1 CYB CYB5R3 CYB5R4 C10orf58 Gene Symbol Gene Title
Regulated probesRegulated the in mitochondrial syndrome of Q Coenzyme Supplementary 1 Table
NADH (unselectedmobilization but regulated genes studiedbecause role their in specific pathways) and processes Lipid metabolism Insulin metabolism Mitochondrial Mitochondrial metabolism
Page 47 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
fold Page 48 of 84 10% 10% 20% 5 – + + –
3,1 378,5 8,4 3,8
4,8 4,6
10,9 238,2
R R R R R R R R R O O O U U U O O U U U pR pR pR pR pR pR pR
nc 6
1,4) 1,4) 1,5) 4,3 4,3 1,6 3,7 3,7 3,0 3,0 nc nc nc nc nc nc nc nc 2,5 2,5 1,7 2,9 1,6 1,6 4,4 1, 2,2 2,2 2,7 1,6 (1,5) (1,3) (1,4) ( ( ( 153,9
0,1 5,1 6,7 0,7 48,8 107,8 3,6 0,3 6,4 1,3 0,5 35,8 1,8 1,2 1,1 38,4 1,2 1,6 2,0 1,7 0,4 0,8 0,4 3,2 1,8 1,6 1,4 1,7 5,2 2,5 2,7 0,6 0,4 0,2 18,1 10,8 1,0
8,4 2,5 5,4 2,5 7,6 3,4 2,4 2,9 3,7 3,4 4,8 5,6 6,5 3,9 3,5 3,0 1,9 6,1 3,9 3,6 3,0 9,2 7,7 5,6 4,5 2,6 2,0 2,0 2,8 1,3 11,6 56,6 94,3 73,8 66,1 15,2 11,2
3_s_at 3636_at 18995_s_at 201116_s_at 201117_s_at 224941_at 204869_at 204870_s_at 1552365_at 202990_at 223044_at 242414_at 226302_at 210809_s_at 210512_s_at 205405_at 213169_at 201792_at 207030_s_at 211126_s_at 214844_s_at 20 226736_at 201200_at 209360_s_at 228636_at 214022_s_at 201601_x_at 2 202350_s_at 210869_s_at 211340_s_at 241902_at 209738_x_at 209335_at 201928_at 20184 201842_s_at 204620_s_at 203875_at 20 BMJ Open
http://bmjopen.bmj.com/
27)
type type 2
on September 28, 2021 by guest. Protected copyright.
regulated transporter)regulated glycoprotein glycoprotein 6 1 like like extracellular matrix protein 1 rich protein2
stimulated genes
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
helix domain helix domain classcontaining, B, 5
loop associated associated plasma A, pappalysinprotein er family er (ironfamily 40
For peer review only
nt SWI/SNF of chromatin comlplex, member A1
containing fibulin related transcriptionfactor 1 (aml1 oncogene) binding binding protein 1 ostin, osteoblast specificosteoblast ostin, factor carboxypeptidase E scinderin carrisolute quinolinate phosphoribosyltransferase ATPase, class type I, 8B, member 1 vascularendothelial growth factor A semaphorin 5A AE cysteine and glycine docking protein 5 midline(Opitz/BBB 1 syndrome) churchill containingdomain 1 repressor E1A 1 of runt interferoninducedtransmembrane protein (9 1 endothelin 1 2 matrilin cellmelanoma adhesion molecule mohawk homeobox decorin EGF versican compone pregnancy convertaseproprotein subtilisin/kexin phosphorylase, glycogen; liver peri basic helix specificpregnancy beta plakophilin4
CPE DCN SCIN MKX PSG6 PKP4 MID1 QPRT EDN1 PYGL DOK5 VCAN CSRP2 PCSK2 AEBP1 PAPPA POSTN CREG1 MCAM IFITM1 VEGFA RUNX1 MATN2 ATP8B1 EFEMP1 BHLHB5 CHURC1 SEMA5A SLC40A1 SMARCA1
Other metabolism cycleCell cycleCell (unselectedgenesbut regulated studied becausespecific role theirin and processes pathways)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
R R R U U U U U O U pR pR
nc nc nc nc 2,9 2,1 1,3 2,7 1,5 1,4
nc nc nc R 1,8 1,8
,0 0,1 0,1 0,1 1,1 0,6 0,2 0,2 0,2 0,1 0,2 0,0 0,0 0,1 0,4 0,1 2,8 1,4 1,0 1,9 0,9 1,0 0,5 0,5 0,6 0,6 0,3 0,5 0,4 3,1 0,4 1,0 2,2 1 22,2 1,0 396,6 5,8 1,3
2,9 8,3 2,7 1,3 1,2 1,2 3,8 1,9 1,6 1,4 1,4 1,3 1,3 1,3 1,2 3,4 3,1 2,9 2,8 2,2 2,2 2,2 1,7 1,5 1,5 1,3 1,3 1,5 1,4 1,8 1,9 3,6 2,2 2,3 3,2 2,4 15,0 263,6
204948_s_at 211737_x_at 236088_at 203873_at 203874_s_at 215294_s_at 214360_at 213719_s_at 1569073_x_at 215714_s_at 212520_s_at 208794_s_at 213720_s_at 214728_x_at 208793_x_at 224851_at 224847_at 243000_at 202284_s_at 1555186_at 213183_s_at 213182_x_at 213348_at 219534_x_at 216894_x_at 209714_s_at 1555758_a_at 208982_at 208983_s_at 1559921_at 211540_s_at 203132_at 228033_at 219990_at 226847_at 207345_at 206382_s_at 206326_at 21 BMJ Open
http://bmjopen.bmj.com/
s s
on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml For peer review only
releasing releasing peptide dependent dependent 6,kinase overexpressed in tumor derived derived neurotrophicfactor component component SWI/SNFchromatin of comlplex, member A4 Cyclin inhibitor CDK, of overexpressedcancer in cell cell antigensurface retinoblastoma protein E2F transcription factor 7 E2F transcription factor 8 follistatin gastrin p21, inhibitorp21, CDK of inhibitorp57, CDK of brain
FST RB1 GRP E2F7 E2F8 CD31 CDK6 BDNF CDKN3 CDKN1C CDKN1A SMARCA4
Development and differentiaton NTNG1 PTN G1 netrin pleiotrophin (neurite growth promoting factor 1)
Page 49 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
fold fold Page 50 of 84 20% 60% 5 2 – + – –
4,3 5,6 15,1 7,4
5,7 7,0
15,1 11,8
R R R R R R R R R R U U U U O O O U U U U U U pR pR pR pR
)
1,3) 1,4) 1,4) 1,4 1,3) 1,3) 1,5) 2,4 2,0 1,5 7,6 4,9 1,8 1,6 1,6 nc nc nc nc nc nc nc nc nc nc nc nc 1,7 2,6 2,5 1,6 1,6 (1,5) (1,5) (1,5) (1,5) ( ( ( ( ( ( (
1,6 1,8 2,1 106,2 0,4 1,5 4,9 5,6 4,3 1,2 0,9 3,5 0,1 0,3 1,6 1,8 1,6 2,4 4,9 0,2 0,4 0,5 1,2 1,2 6,5 3,2 4,5 0,1 3,2 0,5 1,2 1,3 1,2 0,4 4,3 1,3 1,1
6,5 4,3 4,8 2,5 4,4 5,9 4,4 3,0 2,5 5,3 1,8 2,3 3,8 4,0 3,7 4,7 1,9 2,2 2,0 3,4 3,6 8,3 4,5 6,4 1,7 5,0 2,3 4,9 3,0 2,4 8,7 3,6 3,6
93,0 10,1 12,2 11,7
2736_at
227475_at 213823_at 231936_at 156 223980_s_at 218589_at 223795_at 235276_at 227609_at 223283_s_at 223282_at 206969_at 206117_at 224837_at 218574_s_at 202436_s_at 202437_s_at 202435_s_at 217553_at 220990_s_at 201223_s_at 201010_s_at 201739_at 227697_at 223168_at 212543_at 225016_at 209014_at 223313_s_at 213603_s_at 236175_at 204415_at 228617_at 227345_at 202037_s_at 202208_s_at 202206_at 22 BMJ Open http://bmjopen.bmj.com/
e 1
regulated regulated 1
on September 28, 2021 by guest. Protected copyright.
protein protein coupled, 5
like like 4C 1
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml rich domains 1
inducible protein6 related protein1
containing 55
For peere P450, 1B, family polypeptide 1 review only
GTP binding GTP binding protein (rho Rac2 family) ribosylation factor ribosylation
smembraneprotein 49 /// microRNA 21 pithelial pithelial interactionstromal 1 forkhead box Q1 homeobox A11 homeobox C9 LIM homeobox 9 SP110 nuclear body protein tetraspanin 10 E zinc teashirt finger homeobox 1 keratin 34 tropomyosin (alpha)1 forkhead box P1 cysteineLIM and cytochrom similar Six epithelialto antigen prostate of tran RAD23 homolog B (S. cerevisiae) thioredoxin interacting protein serum/glucocorticoid regulated kinas suppressor cytokine of signaling 3 ras homolog geneU member family, in absent melanoma 1 adenomatosis colipolyposis down antigenmelanoma family D, 1 antigenmelanoma family D, 4 4B / small tripartite motif interferon, alpha XIAPassociated factor tumor necrosis factor receptor superfamily 10D secreted frizzled ADP purinergic purinergic receptor P2Y, G
IFI6 RL4C AIM1 SGK1 XAF1 LHX9 TPM1 RAC2 SP110 RHOU SFRP1 P2RY5 TXNIP TSHZ1 KRT34 SOCS3 FOXP1 EPSTI1 A FOXQ1 HOXC9 LMCD1 TRIM55 CYP1B1 RAD23B HOXA11 APCDD1 TMEM49 TSPAN10 MAGED1 MGC87042 TNFRSF10D MAGED4 /MAGED4 4B
Cell resistance Cell to stress Apoptosis Signalling
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
R R R R R R R R R R R U O O U pR pR pR pR
4,9 2,6
1,4) 1,5) 1,3) 1,3) 1,9 2,5 2,3 1,9 1,7 1,8 3,0 1,6 nc nc nc nc nc nc nc nc nc 1,6 1,7 1,7 1,7 2,0 (1,4) (1,4) ( ( ( (
2,8 2,2 0,8 0,8 1,2 0,6 1,0 1,0 10,1 73,8 2,3 3,5 7,2 0,1 0,3 0,3 2,4 9,6 5,1 2,2 0,6 10,1 1,0 12,5 2,6 1,0 0,2 3,5 5,5 2,3 1,7 1,1 0,2 1,1 1,0 0,6 1,0
4,2 3,6 4,5 4,8 4,2 7,4 8,5 1,7 3,1 2,8 4,7 5,9 4,5 2,0 9,8 3,3 5,3 3,5 2,7 6,4 7,4 6,1 6,2 3,6 1,8 5,2 4,8 2,7 2,5 5,5 4,7 3,4 2,8 13,8 67,3 17,3 15,0
t 05483_s_at 202207_at 237465_at 230083_at 231817_a 209990_s_at 207261_at 224964_s_at 219352_at 218211_s_at 203315_at 224701_at 229026_at 223687_s_at 203066_at 207426_s_at 203148_s_at 204820_s_at 202411_at 214453_s_at 204439_at 203153_at 204747_at 242907_at 2 202086_at 204994_at 204972_at 218400_at 204279_at 202869_at 205552_s_at 205660_at 210797_s_at 1567575_at 244503_at 230175_s_at 228049_x_at 23 BMJ Open http://bmjopen.bmj.com/
1)
inducible
like on September 28, 2021 by guest. Protected copyright.
like
le le protein27
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml inducib like modifier containing 14
ribose) ribose) polymerase family, member 14 For peer review induced protein 44 induced protein 44 induced protein (tetratricopeptide repeats induced protein (tetratricopeptide repeats3) only adenylate 100kDa3,synthetase aminobutyric acid(GABA) receptor, B 2 oligoadenylate oligoadenylate synthetase69/71kDa2, oligo oligoadenylate synthetase oligoadenylate oligoadenylate synthetase 40/46kDa 1, protein, gamma 2 protein, gamma 5' 5' 5' 5' ubiquitin ubiquitin specific peptidase 53 gamma nucleotidecyclic channel gated alpha 3 G hect anddomain RLD 6 melanophilin CDC42 small effector 2 lymphocyte antigen 6 complex, K locus RAGB cellassociated protein tumor necrosis factor superfamily, member 4 tripartite motif interferon, alpha interferon interferon interferon interferon guanylate binding protein interferon 1, ISG15 ubiquitin myxovirus resistance 1 myxovirus resistance 2 2' 2' 2', 2' Unknown gene Unknown gene Unknown gene Unknown gene NCK adaptorprotein 2 (ADP poly butyrophilin3 (A2/A3) proteasome subunit, type,beta 9
6ST
F4
RC6 MX1 MX2 IFI27 IFI44 IFIT1 IFIT3 GBP1 OAS2 OAS3 OAS1 LY6K ISG15 OASL NCK2 GNG2 MLPH USP53 IFI44L HE PSMB9 CNGA3 PARP14 TNFS TRIM14 GABBR2 CDC42SE2 BTN3(A2/A3) GALNAC4S
Immunity Immunity (unselected genesbut studiedregulated because role their in specific pathways) and processes Genes ofunknown function
Page 51 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 52 of 84
10
treatment (U); treatment genes
10
U
2,9 nc nc (1,5)
2,2 0,4 0,5 3,0 9,2 12,3 0,1 0,5 17,3 0,2 0,5
3,2 2,2 2,5 4,7 1,7 2,8 1,9 2,0 12,5 27,9 19,3 deficiency (O); and specificaly regulatedspecificaly(O);deficiency and after CoQ genes only 10
at
235274_at 228728_at 227443_at 227410_at 1556641_ 239153_at 212942_s_at 226682_at 239624_at 218930_s_at 226529_at 24
BMJ Open http://bmjopen.bmj.com/ PCR. RT deficiency (more deficiency in text):andinformation table in3 the genes unaffected CoQ by
10
on September 28, 2021 by guest. Protected copyright.
supplementation ( ). supplementation 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only osome frame7 open osome reading 58 supplementation supplementation on expressiongene in CoQ
10 supplementation on levelson supplementation mRNA analyzedQ by
Unknown gene chrom chromosome frame9 open reading 150 family with sequencesimilarity member43, A Unknown gene hypothetical supported gene AK123741 by KIAA1199 Unknown gene Unknown gene transmembraneprotein 106B transmembraneprotein 106B 10
respondingto the values FC eachsampleof of analysis;(SAM R=1,5; FDR=0%)
sd cor sd
C7orf58 C9orf150 FAM43A FLJ37228 FLJ41747 KIAA1199 LOC283666 LOC730259 TMEM106B TMEM106B mean +/ mean Effect of coenzyme CoQ of Effect Effectcoenzyme Q of
Probe ID Probe inID Affymetrix GeneChip® Human Genome PlusU133 2.0 Array change Full comparative in the analysis with ranAffymetrix Gene Array. Chip® Human Gene ST 1.0 In parenthesis, of FC non significat non selected/ Geneswith genes. no changeFull in expression gene analyzed by quantitative PCRreal time (Q RT PCR).
change change (nc) (b) (c) (d) (e) (f) (a) thethat restored expression either (pR) partial completely or (R);with regulationopposite genes than CoQ in
supplementation (S). Genes non afected by CoQ
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 53 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Supplementary table 2 3 4 Regulation of energetic metabolism in CoQ10 deficiency 5
6 (a) (b) (c) 7 Gene Ontology / Description mean FC # genes Q effect 8 Glycolysis 9 glycolysis, overall 10 catalitic steps 1,5 27 (34) pR 10 glycolysis, step 1 HK 1,4 6 (6) pR glycolysis, step 2 GPI 11 1,2 1 (1) U glycolysis, step 3 PFK 1,3 3 (3) U 12 glycolysis, step 4 ALDOLASE 1,7 3 (4) pR 13 glycolysis, step 5 TPI 1,4 1 (1) pR 14 glycolysis, step 6 GAPDH 1,6 2 (2) pR 15 glycolysis,For step 7 PGK peer review1,5 only 2 (2) pR 16 glycolysis, step 8 PGAM 1,2 3 (6) pR 17 glycolysis, step 9 ENOLASE 2,3 4 (7) pR 18 glycolysis, step 10 PK 1,3 2 (2) pR 19 Lactate dehydrogenase 1,7 5 (5) R 20 Pyruvate dehydrogenase 2,2 4 (4) pR 21 negative regulation of glycolysis 1,3 1 (1) U 22 positive regulation of glycolysis 2,3 4 (4) pR 23 TCA cycle 24 TCA cycle, overall no change 29 (32) U 25 cytosolic isoenzymes of TCA no change 3 (3) U 26 mitochondrial isoenzymes of TCA 1,3 3 (3) pR 27 Fatty acid beta oxidation 28 fatty acid beta oxidation no change 28 (28) U 29 fatty acid beta oxidation, regulation 1,5 10 (10) pR 30 OXPHOS 31 Respiratory chain complex I 1,7 46 (64) O 32 Respiratory chain complex II 1,2 4 (13) pR 33 Respiratory chain complex III 1,3 7 (14) O http://bmjopen.bmj.com/ 34 Respiratory chain complex IV 1,5 3 (45) O 35 ATP synthase complex V 1,4 (64) O 36 37 a mean of Full Change corresponding to the values of each probe included in the Affymetrix Gene Chip® Human Gene 1.0 38 ST Array 39 40 b Number of genes analysed within each gene ontology. In parenthesis, number of probes. 41 42 on September 28, 2021 by guest. Protected copyright. c 43 Effect of coenzyme CoQ10 supplementation on gene expression in CoQ10 deficiency: unaffected genes by CoQ10 treatment 44 (U); genes that restored the expression either partial (pR) or completely (R); and genes with opposite regulation after CoQ10 45 supplementation than in CoQ10 deficiency (O). 46
47
48 49 50 51 52 53 54 55 56 57 58 59 60 25 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 54 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2 3 Supplementary table 3A
4 Regulated genes clasified in Gene Ontologies in primary CoQ10 deficiency 5
6 7 Gene Ontology Term P value # genes (1) # selected (2) Enrichment (3) 8 Immunity related GO represed in primary CoQ deficiency 9 10 10 (*) GO:0001730 2' 5' oligoadenylate synthetase activity 5,03E 07 3 3 124,8 11 (interferón inducible) 12 GO:0035457 cellular response to interferon alpha 9,36E 04 6 2 41,6 13 (*) GO:0045071 negative regulation of viral genome replication 4,30E 07 20 5 31,2 14 15 (*) GO:0048525 Fornegative regulation peer of viral reproduction review 4,30E 07 only 20 5 31,2 16 (*) GO:0060337 type I interferon mediated signaling pathway 5,14E 20 65 16 30,7 17 18 (*) GO:0071357 cellular response to type I interferon 5,14E 20 65 16 30,7 19 (*) GO:0034340 response to type I interferon 6,74E 20 66 16 30,3 20 (*) GO:0045069 regulation of viral genome replication 3,11E 06 29 5 21,5 21 22 (*) GO:0009615 response to virus 2,76E 14 199 18 11,3 23 (*) GO:0060333 interferon gamma mediated signaling pathway 1,85E 04 66 5 9,5 24 25 (*) GO:0071346 cellular response to interferon gamma 4,29E 04 79 5 7,9 26 GO:0050792 regulation of viral reproduction 7,41E 04 89 5 7,0 27 28 (*) GO:0019221 cytokine mediated signaling pathway 1,46E 09 291 16 6,9 29 (*) GO:0071345 cellular response to cytokine stimulus 4,53E 09 361 17 5,9 30 31 (*) GO:0034097 response to cytokine stimulus 2,24E 08 454 18 5,0 32 GO:0002252 immune effector process 9,60E 04 194 7 4,5 33 GO:0002376 immune system process 7,36E 04 1141 20 2,2 http://bmjopen.bmj.com/ 34
35 Development related GO represed in primary CoQ10 deficiency 36 (*) GO:0042474 middle ear morphogenesis 4,44E 04 19 3 19,7 37 38 GO:0048598 embryonic morphogenesis 4,60E 04 283 9 4,0 39 GO:0044087 regulation of cellular component biogenesis 6,50E 04 297 9 3,8 40 41 (*) GO:0009653 anatomical structure morphogenesis 8,50E 07 1056 25 3,0 on September 28, 2021 by guest. Protected copyright. 42 (*) GO:0045595 regulation of cell differentiation 6,21E 05 869 19 2,7 43 44 (*) GO:0050793 regulation of developmental process 3,51E 04 1246 22 2,2
45 Cell response related GO represed in primary CoQ10 deficiency 46 47 GO:2000242 negative regulation of reproductive process 4,39E 05 49 5 12,7 48 (*) GO:0051707 response to other organism 1,24E 10 327 18 6,9 49 (*) GO:0009607 response to biotic stimulus 5,00E 10 502 21 5,2 50 51 (*) GO:0051704 multi organism process 3,56E 08 763 23 3,8 52 (*) GO:0044419 interspecies interaction between organisms 8,61E 04 374 10 3,3 53 54 (*) GO:0071310 cellular response to organic substance 1,16E 05 989 22 2,8 55 (*) GO:0070887 cellular response to chemical stimulus 3,57E 05 1225 24 2,4 56 57 (*) GO:0010033 response to organic substance 1,25E 04 1588 27 2,1 58 (*) GO:0007166 cell surface receptor signaling pathway 5,90E 05 1875 31 2,1 59 60 26 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 55 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 (*) GO:0042221 response to chemical stimulus 1,00E 05 2345 38 2,0
3 Metabolism related GO represed in primary CoQ10 deficiency 4 GO:0060700 regulation of ribonuclease activity 1,90E 04 3 2 83,2 5 6 GO:0070566 adenylyltransferase activity 4,44E 04 19 3 19,7 7 (*) GO:0016126 sterol biosynthetic process 6,19E 07 39 6 19,2 8 9 (*) GO:0006695 cholesterol biosynthetic process 6,06E 06 33 5 18,9 10 GO:0008299 isoprenoid biosynthetic process 5,19E 04 20 3 18,7 11 12 GO:0003725 double stranded RNA binding 2,88E 04 40 4 12,5 13 (*) GO:0008203 cholesterol metabolic process 1,06E 07 100 9 11,2 14 15 (*) GO:0016125 Forsterol metabolic peer process review1,90E 07only 107 9 10,5 16 (*) GO:0006694 steroid biosynthetic process 2,01E 05 104 7 8,4 17 18 GO:0008202 steroid metabolic process 9,21E 05 228 9 4,9 19 GO:0006066 alcohol metabolic process 1,12E 04 234 9 4,8 20 GO:0016053 organic acid biosynthetic process 5,47E 04 231 8 4,3 21 22 GO:0046394 carboxylic acid biosynthetic process 5,47E 04 231 8 4,3 23 GO:0008610 lipid biosynthetic process 7,04E 05 390 12 3,8 24 25 Cellular location related GO represed in primary CoQ10 deficiency 26 (*) GO:0005829 cytosol 2,71E 05 2165 35 2,0 27 28 Development related GO activated in primary CoQ10 deficiency 29 GO:0060343 trabecula formation 5,07E 06 20 4 34,0 30 31 GO:0048640 negative regulation of developmental growth 2,80E 04 22 3 23,2 32 GO:0001837 epithelial to mesenchymal transition 7,90E 05 39 4 17,4 33 http://bmjopen.bmj.com/ 34 GO:0002053 positive regulation of mesenchymal cell 9,48E 04 33 3 15,5 proliferation 35 GO:0060688 regulation of morphogenesis of a branching 1,39E 04 45 4 15,1 36 structure 37 GO:0045766 positive regulation of angiogenesis 8,43E 05 76 5 11,2 38 39 (*) GO:0045765 regulation of angiogenesis 1,94E 05 141 7 8,4 40 (*) GO:0001871 pattern binding 1,41E 06 185 9 8,3 41 42 (*) GO:1901342 regulation of vasculature development 3,15E 05 152 7 7,8 on September 28, 2021 by guest. Protected copyright. 43 GO:2000027 regulation of organ morphogenesis 4,97E 04 111 5 7,7 44 GO:0007389 pattern specification process 1,43E 04 331 9 4,6 45 46 GO:0051093 negative regulation of developmental process 3,29E 04 453 10 3,8 47 (*) GO:0022603 regulation of anatomical structure morphogenesis 2,20E 04 516 11 3,6 48 49 GO:0009888 tissue development 6,37E 04 493 10 3,5 50 (*) GO:0009653 anatomical structure morphogenesis 1,28E 04 1056 17 2,7 51 52 (*) GO:2000026 regulation of multicellular organismal 4,37E 04 955 15 2,7 53 development 54 Cell response related GO activated in primary CoQ10 deficiency 55 GO:0009629 response to gravity 2,30E 05 10 3 51,0 56 GO:0034695 response to prostaglandin E stimulus 8,53E 05 15 3 34,0 57 58 GO:0034694 response to prostaglandin stimulus 2,09E 04 20 3 25,5 59 60 27 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 56 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 GO:0005109 frizzled binding 3,21E 04 23 3 22,2 3 GO:0007565 female pregnancy 2,10E 07 72 7 16,5 4 GO:0032874 positive regulation of stress activated MAPK 2,45E 04 52 4 13,1 5 cascade 6 GO:0070304 positive regulation of stress activated protein 2,64E 04 53 4 12,8 7 kinase signaling cascade 8 (*) GO:0008201 heparin binding 9,32E 06 126 7 9,4 9 10 (*) GO:0005539 glycosaminoglycan binding 5,99E 07 167 9 9,2 11 (*) GO:0030247 polysaccharide binding 1,41E 06 185 9 8,3 12 13 GO:0070482 response to oxygen levels 8,80E 07 227 10 7,5 14 GO:0001666 response to hypoxia 3,66E 05 213 8 6,4 15 GO:0036293 Forresponse to decreasedpeer oxygen levelsreview 3,91E 05only 215 8 6,3 16 17 GO:0030246 carbohydrate binding 3,48E 04 373 9 4,1 18 GO:0016477 cell migration 1,68E 04 500 11 3,7 19 20 GO:0009628 response to abiotic stimulus 1,59E 05 710 15 3,6 21 GO:0040011 locomotion 5,70E 05 889 16 3,1 22 23 GO:0022414 reproductive process 4,57E 04 959 15 2,7 24 (*) GO:0048523 negative regulation of cellular process 1,90E 05 2476 31 2,1 25 26 (*) GO:0048519 negative regulation of biological process 1,54E 05 2704 33 2,1
27 Metabolism related GO activated in primary CoQ10 deficiency 28 29 GO:0004720 protein lysine 6 oxidase activity 2,04E 04 4 2 85,0 30 GO:0043627 response to estrogen stimulus 2,47E 04 149 6 6,8 31 GO:0045934 negative regulation of nucleobase containing 8,75E 04 808 13 2,7 32 compound metabolic process 33 GO:0051172 negative regulation of nitrogen compound 9,79E 04 818 13 2,7 http://bmjopen.bmj.com/ 34 metabolic process 35 Cellular location related GO activated in primary CoQ10 deficiency 36 37 GO:0030199 collagen fibril organization 8,65E 04 32 3 15,9 38 GO:0005604 basement membrane 6,14E 04 66 4 10,3 39 (*) GO:0031012 extracellular matrix 1,51E 07 294 12 6,9 40 41 (*) GO:0005578 proteinaceous extracellular matrix 2,17E 05 198 8 6,9 on September 28, 2021 by guest. Protected copyright. 42 GO:0044420 extracellular matrix part 4,85E 04 169 6 6,0 43 44 GO:0005615 extracellular space 8,51E 06 761 16 3,6 45 GO:0048870 cell motility 3,74E 04 549 11 3,4 46 47 (*) GO:0044421 extracellular region part 6,38E 06 926 18 3,3 48 (*) GO:0007155 cell adhesion 2,91E 04 719 13 3,1 49 50 (*) GO:0022610 biological adhesion 2,91E 04 719 13 3,1 51 GO:0005576 extracellular region 8,03E 05 1226 19 2,6 52 53 Cell signalling related GO activated in primary CoQ10 deficiency 54 GO:0005114 type II transforming growth factor beta receptor 6,79E 06 7 3 72,8 55 binding 56 GO:0090036 regulation of protein kinase C signaling cascade 7,06E 04 7 2 48,5 57 GO:0090037 positive regulation of protein kinase C signaling 7,06E 04 7 2 48,5 58 cascade 59 60 28 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 57 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 GO:0005160 transforming growth factor beta receptor binding 1,51E 04 18 3 28,3 3 GO:0030514 negative regulation of BMP signaling pathway 5,81E 04 28 3 18,2 4 GO:0071560 cellular response to transforming growth factor 5,81E 04 28 3 18,2 5 beta stimulus 6 GO:0071559 response to transforming growth factor beta 8,65E 04 32 3 15,9 7 stimulus 8 GO:0007179 transforming growth factor beta receptor 5,30E 05 69 5 12,3 9 signaling pathway 10 GO:0090101 negative regulation of transmembrane receptor 4,84E 04 62 4 11,0 11 protein serine/threonine kinase signaling pathway 12 GO:0007178 transmembrane receptor protein serine/threonine 4,58E 04 109 5 7,8 13 kinase signaling pathway 14 (*) GO:0090092 regulation of transmembrane receptor protein 9,16E 04 127 5 6,7 15 Forserine/threonine peer kinase signaling review pathway only
16 (*) 17 GO regulated simultaniusly in primary and secondary CoQ10 deficiency 18 (1) number of human genes within each gene ontology 19 20 (2) number of significantly regulated genes included within each gene ontology 21 (3) Gene Ontology Enrichment represents the selection of genes associated with a specific GO. It is calculated by GORILLA as 22 follows: E=(b/n)/(B/N), being "N" the total number of genes, "B" the total number of genes associated with a particular GO, "n" 23 the number of regulated genes for each analysis and "b" the number of regulated genes associated with a particular GO. 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 29 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 58 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2
3 Suplementary table 3B 4 5 Regulated genes clasified in Gene Ontologies in secondary CoQ deficiency 6
7 8 Gene Ontology Term P value # genes (1) # selected (2) Enrichment (3) 9 Immunity related GO represed in secondary CoQ deficiency 10 10 11 (*) GO:0001730 2' 5' oligoadenylate synthetase activity 2,68E 04 3 2 70,05 12 (interferon inducible) 13 GO:0019060 intracellular transport of viral proteins in host cell 8,83E 04 5 2 42,03 14 GO:0051708 intracellular protein transport in other organism 8,83E 04 5 2 42,03 15 Forinvolved in symbioticpeer interaction review only 16 (*) GO:0060337 type I interferon mediated signaling pathway 1,09E 15 65 14 22,63 17 (*) GO:0071357 cellular response to type I interferon 1,09E 15 65 14 22,63 18 19 (*) GO:0034340 response to type I interferon 1,38E 15 66 14 22,29 20 (*) GO:0045071 negative regulation of viral genome replication 3,39E 05 20 4 21,01 21 22 (*) GO:0048525 negative regulation of viral reproduction 3,39E 05 20 4 21,01 23 (*) GO:0045069 regulation of viral genome replication 1,56E 04 29 4 14,49 24 25 (*) GO:0071346 cellular response to interferon gamma 1,06E 04 79 6 7,98 26 (*) GO:0060333 interferon gamma mediated signaling pathway 4,09E 04 66 5 7,96 27 28 (*) GO:0009615 response to virus 5,67E 08 199 13 6,86 29 GO:0034341 response to interferon gamma 3,08E 04 96 6 6,57 30 (*) GO:0071345 cellular response to cytokine stimulus 6,17E 08 361 17 4,95 31 32 (*) GO:0034097 response to cytokine stimulus 6,39E 08 454 19 4,4 33 Development related GO represed in secondary CoQ deficiency http://bmjopen.bmj.com/ 34 10 35 GO:2000648 positive regulation of stem cell proliferation 8,83E 04 5 2 42,03 36 (*) GO:0042474 middle ear morphogenesis 7,32E 04 19 3 16,59 37 38 (*) GO:0051704 multi organism process 1,14E 05 763 21 2,89 39 GO:0045597 positive regulation of cell differentiation 9,75E 04 437 12 2,89 40 41 GO:0051094 positive regulation of developmental process 5,39E 04 593 15 2,66 42 (*) GO:0045595 regulation of cell differentiation 2,20E 04 869 20 2,42 on September 28, 2021 by guest. Protected copyright. 43 (*) GO:0009653 anatomical structure morphogenesis 1,62E 04 1056 23 2,29 44 45 (*) GO:2000026 regulation of multicellular organismal 7,36E 04 955 20 2,2 46 development 47 (*) GO:0050793 regulation of developmental process 7,00E 04 1246 24 2,02 48 GO:0051239 regulation of multicellular organismal process 7,89E 04 1567 28 1,88 49 50 Cell response related GO represed in secondary CoQ10 deficiency 51 GO:0030581 symbiont intracellular protein transport in host 8,83E 04 5 2 42,03 52 53 GO:0071503 response to heparin 8,83E 04 5 2 42,03 54 GO:0071504 cellular response to heparin 8,83E 04 5 2 42,03 55 (*) GO:0051707 response to other organism 2,95E 06 327 14 4,5 56 57 (*) GO:0009607 response to biotic stimulus 1,39E 06 502 18 3,77 58 (*) GO:0044419 interspecies interaction between organisms 2,45E 04 374 12 3,37 59 60 30 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 59 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 (*) GO:0071310 cellular response to organic substance 6,06E 05 989 23 2,44 3 GO:0042981 regulation of apoptotic process 3,94E 05 1098 25 2,39 4 GO:0043067 regulation of programmed cell death 4,51E 05 1107 25 2,37 5 6 GO:0010941 regulation of cell death 6,76E 05 1135 25 2,31 7 (*) GO:0070887 cellular response to chemical stimulus 8,76E 05 1225 26 2,23 8 9 (*) GO:0010033 response to organic substance 8,00E 05 1588 31 2,05 10 (*) GO:0042221 response to chemical stimulus 5,60E 05 2345 41 1,84 11 12 Metabolism related GO represed in secondary CoQ10 deficiency 13 (*) GO:0016126 sterol biosynthetic process 1,69E 06 39 6 16,16 14 15 (*) GO:0006695 Forcholesterol biosyntheticpeer process review1,40E 05only 33 5 15,92 16 GO:0071396 cellular response to lipid 2,30E 04 32 4 13,13 17 18 (*) GO:0008203 cholesterol metabolic process 4,97E 06 100 8 8,41 19 (*) GO:0016125 sterol metabolic process 8,23E 06 107 8 7,86 20 (*) GO:0006694 steroid biosynthetic process 4,74E 04 104 6 6,06 21 22 (*) GO:0019221 cytokine mediated signaling pathway 1,21E 07 291 15 5,42 23 Cellular location related GO represed in primary CoQ deficiency 24 10 25 (*) GO:0005829 cytosol 9,97E 04 2165 35 1,7 26 Cellular location related GO represed in secondary CoQ10 deficiency 27 28 GO:0003924 GTPase activity 3,30E 05 210 10 5 29 GO:0019001 guanyl nucleotide binding 5,04E 04 348 11 3,32 30 31 GO:0032561 guanyl ribonucleotide binding 5,04E 04 348 11 3,32 32 (*) GO:0007166 cell surface receptor signaling pathway 6,95E 04 1875 32 1,79 33 http://bmjopen.bmj.com/ 34 Development related GO activated in primary CoQ10 deficiency 35 GO:0072017 distal tubule development 3,68E 04 3 2 59,82 36 GO:0048569 post embryonic organ development 7,30E 04 4 2 44,86 37 38 GO:0003206 cardiac chamber morphogenesis 8,25E 04 17 3 15,83 39 GO:0033688 regulation of osteoblast proliferation 8,25E 04 17 3 15,83 40 41 GO:0001944 vasculature development 5,96E 04 35 4 10,25 on September 28, 2021 by guest. Protected copyright. 42 GO:0008406 gonad development 9,33E 07 93 9 8,68 43 44 GO:0008584 male gonad development 1,09E 04 68 6 7,92 45 GO:0048608 reproductive structure development 1,41E 05 129 9 6,26 46 47 GO:0061138 morphogenesis of a branching epithelium 4,94E 05 117 8 6,14 48 (*) GO:0045765 regulation of angiogenesis 1,83E 04 141 8 5,09 49 GO:0001763 morphogenesis of a branching structure 1,92E 04 142 8 5,05 50 51 (*) GO:1901342 regulation of vasculature development 3,05E 04 152 8 4,72 52 GO:0001701 in utero embryonic development 3,79E 04 157 8 4,57 53 54 GO:0043009 chordate embryonic development 4,31E 04 160 8 4,49 55 GO:0009792 embryo development ending in birth or egg 5,28E 04 165 8 4,35 56 hatching 57 GO:0002009 morphogenesis of an epithelium 4,94E 04 205 9 3,94 58 59 GO:0048729 tissue morphogenesis 1,99E 04 266 11 3,71 60 31 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 60 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 GO:0009790 embryo development 6,44E 04 258 10 3,48 3 GO:0048513 organ development 1,77E 06 831 26 2,81 4 (*) GO:0022603 regulation of anatomical structure morphogenesis 6,76E 04 516 15 2,61 5 6 GO:0048731 system development 1,95E 04 619 18 2,61 7 GO:0050878 regulation of body fluid levels 8,87E 04 530 15 2,54 8 9 GO:0051094 positive regulation of developmental process 9,93E 04 593 16 2,42 10 GO:0045595 regulation of cell differentiation 1,01E 04 869 23 2,37 11 12 GO:2000026 regulation of multicellular organismal 3,98E 04 955 23 2,16 13 development 14 (*) GO:0009653 anatomical structure morphogenesis 2,83E 04 1056 25 2,12 15 GO:0042127 Forregulation of cellpeer proliferation review6,43E 04 only 1052 24 2,05 16
17 Cell response related GO activated in secondary CoQ10 deficiency 18 GO:0071481 cellular response to X ray 3,68E 04 3 2 59,82 19 GO:0046882 negative regulation of follicle stimulating 7,30E 04 4 2 44,86 20 hormone secretion 21 GO:0004364 glutathione transferase activity 9,82E 04 18 3 14,95 22 23 GO:0017147 Wnt protein binding 1,57E 04 25 4 14,36 24 GO:0036294 cellular response to decreased oxygen levels 1,29E 05 47 6 11,45 25 26 GO:0071456 cellular response to hypoxia 1,29E 05 47 6 11,45 27 GO:0071453 cellular response to oxygen levels 2,09E 05 51 6 10,56 28 29 Metabolism related GO activated in secondary CoQ10 deficiency 30 GO:0007026 negative regulation of microtubule 9,82E 04 18 3 14,95 31 depolymerization 32 GO:0010951 negative regulation of endopeptidase activity 4,12E 04 121 7 5,19 33 GO:0010466 negative regulation of peptidase activity 4,78E 04 124 7 5,07 http://bmjopen.bmj.com/ 34 35 Cellular location related GO activated in secondary CoQ10 deficiency 36 GO:0001569 patterning of blood vessels 2,48E 04 28 4 12,82 37 38 GO:0010811 positive regulation of cell substrate adhesion 1,54E 04 46 5 9,75 39 GO:0010810 regulation of cell substrate adhesion 6,51E 05 90 7 6,98 40 41 (*) GO:0005539 glycosaminoglycan binding 1,80E 05 167 10 5,37 42 GO:0031012 extracellular matrix 3,25E 08 294 17 5,19 on September 28, 2021 by guest. Protected copyright. 43 (*) GO:0005578 proteinaceous extracellular matrix 1,38E 05 198 11 4,98 44 45 (*) GO:0008201 heparin binding 5,26E 04 126 7 4,98 46 (*) GO:0001871 pattern binding 4,33E 05 185 10 4,85 47 48 (*) GO:0030247 polysaccharide binding 4,33E 05 185 10 4,85 49 GO:0030155 regulation of cell adhesion 4,04E 04 243 10 3,69 50 51 (*) GO:0007155 cell adhesion 5,23E 05 719 21 2,62 52 (*) GO:0022610 biological adhesion 5,23E 05 719 21 2,62 53 54 (*) GO:0044421 extracellular region part 9,79E 05 926 24 2,33
55 Cell signalling related GO activated in primary CoQ10 deficiency 56 (*) GO:0090092 regulation of transmembrane receptor protein 5,52E 04 127 7 4,95 57 serine/threonine kinase signaling pathway 58 59 (*) GO regulated simultaniusly in primary and secondary CoQ10 deficiency 60 32 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 61 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 (1) number of human genes within each gene ontology 3 4 (2) number of significantly regulated genes included within each gene ontology 5 6 (3) Gene Ontology Enrichment represents the selection of genes associated with a specific GO. It is calculated by GORILLA as 7 follows: E=(b/n)/(B/N), being "N" the total number of genes, "B" the total number of genes associated with a particular GO, "n" 8 the number of regulated genes for each analysis and "b" the number of regulated genes associated with a particular GO. 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 33 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 62 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2 3 Supplementary table 4
4 GO classification of regulated genes common to primary and secondary CoQ deficiency 5 10
6 Gene Ontology Term genes (a) significant (b) Z_Score 7 Mitochondrial metabolism 8 GO0009055 electron carrier activity 344 79 2,2 9 GO0004777 succinate semialdehyde dehydrogenase activity 2 2 2,1 10 GO0005739 mitochondrion 1132 625 2,0 11 GO0006818 hydrogen transport 78 10 1,7 12 GO0008137 NADH dehydrogenase (ubiquinone) activity 51 33 1,7 13 GO0005746 mitochondrial respiratory chain 83 12 1,6 14 GO0006099 tricarboxylic acid cycle 29 20 1,3 15 GO0003954 NADHFor dehydrogenase peer activity review only44 14 1,3 16 GO0042593 glucose homeostasis 52 19 1,2 17 GO0005758 mitochondrial intermembrane space 34 5 0,6 18 GO0031304 intrinsic to mitochondrial inner membrane 5 1 0,6 19 GO0042720 mitochondrial inner membrane peptidase C 1 1 1,0 20 Lipid metabolism 21 GO0008395 steroid hydroxylase activity 17 1 9,5 22 GO0016126 sterol biosynthetic process 26 18 5,7 23 GO0006695 cholesterol biosynthetic process 32 19 4,7 24 GO0006694 steroid biosynthetic process 71 34 4,1 25 GO0004506 squalene monooxygenase activity 1 1 3,1 26 GO0047598 7 dehydrocholesterol reductase activity 1 1 3,1 27 GO0004312 fatty acid synthase activity 8 1 2,6 28 GO0004313 acyl carrier protein s acetyltransferase 1 1 2,6 29 GO0004314 acyl carrier protein s malonyltransferase 2 1 2,6 30 GO0004315 3 oxoacyl acyl carrier protein synthase 2 1 2,6 31 GO0004317 3 hydroxypalmitoyl acyl carrier protein 1 1 2,6 32 GO0004319 enoyl acyl carrier protein reductase 1 1 2,6 33 GO0004320 oleoyl acyl carrier protein hydrolase 2 1 2,6 http://bmjopen.bmj.com/ 34 GO0010281 acyl acp thioesterase activity 2 1 2,6 35 GO0004420 hydroxymethylglutaryl CoA reductase 1 1 2,5 GO0001619 lysosphingolipid and lysophosphatidic acid receptor 15 10 2,2 36 GO0030549 acetylcholine receptor activator activity 1 1 2,2 37 GO0006636 unsaturated fatty acid biosynthetic process 39 1 2,1 38 GO0016213 linoleoyl coa desaturase activity 1 1 2,1 39 GO0006656 phosphatidylcholine biosynthetic process 14 6 2,1 40 GO0006650 glycerophospholipid metabolic process 127 1 1,9 41 GO0006678 glucosylceramide metabolic process 4 1 1,9 on September 28, 2021 by guest. Protected copyright. 42 GO0006681 galactosylceramide metabolic process 4 1 1,9 43 GO0046459 short chain fatty acid metabolic process 5 1 1,9 44 GO0030169 low density lipoprotein binding 21 1 1,9 45 GO0030229 very low density lipoprotein receptor activity 4 1 1,9 46 GO0008299 isoprenoid biosynthetic process 22 10 1,9 47 GO0047012 sterol 4 alpha carboxylate 3 dehydrogenase 1 1 1,7 48 Cell cycle 49 GO0030308 negative regulation of cell growth 81 9 1,2 50 GO0005720 nuclear heterochromatin 33 10 1,4 51 GO0006310 DNA recombination 77 28 1,5 52 GO0000793 condensed chromosome 28 15 1,7 53 GO0008094 dna dependent atpase activity 30 15 1,9 54 GO0005816 spindle pole body 2 1 1,5 55 GO0000922 spindle pole 23 7 1,9 56 GO0008608 attachment of spindle microtubules to kinetochore 8 1 2,0 57 GO0042393 histone binding 62 7 2,0 58 GO0007098 centrosome cycle 25 3 2,0 59 GO0007059 chromosome segregation 40 19 2,2 60 34 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 63 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 GO0000070 mitotic sister chromatid segregation 38 5 2,3 3 GO0007140 male meiosis 22 5 2,5 4 GO0005874 microtubule 266 119 2,6 5 GO0006270 dna replication initiation 25 10 2,7 GO0000776 kinetochore 31 10 2,8 6 GO0007067 mitosis 199 103 3,2 7 GO0007126 meiosis 120 29 3,4 8 GO0051301 cell division 250 157 3,6 9 GO0000775 chromosome pericentric region 61 30 4,2 10 GO0006260 DNA replication 154 88 4,2 11 GO0007049 cell cycle 516 318 4,2 12 GO0045743 positive regulation of fibroblast growth 6 1 4,9 13 GO0045741 positive regulation of epidermal growth 6 1 6,5 14 Nucleosome and chromosome 15 GO0000786 nucleosomeFor peer review only120 62 4,0 16 GO0007001 chromosome organization and biogenesis 93 57 4,0 17 GO0006334 nucleosome assembly 142 67 3,4 18 GO0005694 chromosome 222 113 2,4 19 GO0016514 swi or snf complex 11 6 1,3 20 Development and differentiation 21 GO0021768 nucleus accumbens development 1 1 5,5 22 GO0060166 olfactory pit development 2 1 5,5 23 GO0048535 lymph node development 18 16 3,4 24 GO0001886 endothelial cell morphogenesis 4 1 2,9 25 GO0060014 granulosa cell differentiation 4 1 2,2 26 GO0048389 intermediate mesoderm development 2 1 2,0 27 GO0031017 exocrine pancreas development 6 1 2,0 28 GO0045651 positive regulation of macrophage differentiation 6 2 1,9 29 GO0030879 mammary gland development 8 14 1,3 30 GO0045617 negative regulation of keratinocyte differentiation 3 1 2,3 31 GO0048706 embryonic skeletal development 85 1 4,9 32 Cell resistance and stress response 33 GO0006281 DNA repair 319 137 3,1 http://bmjopen.bmj.com/ 34 GO0003960 NADPH quinone reductase activity 4 2 1,9 GO0006974 response to DNA damage stimulus 201 133 2,3 35 GO0008630 DNA damage response signal transduction 23 10 2,3 36 GO0007256 activation of JNKK activity 5 3 3,2 37 GO0043506 regulation of JNK activity 51 1 2,1 38 Apoptosis and cell death 39 GO0043065 positive regulation of apoptosis 114 39 3,4 40 GO0043071 positive regulation of cell death (non apoptotic) 2 1 2,8 41 GO0005164 tumor necrosis factor receptor binding 93 15 2,5 on September 28, 2021 by guest. Protected copyright. 42 GO0008219 cell death 60 8 1,6 43 GO0008629 induction of apoptosis by intracellular signals 22 8 1,6 44 Immune response 45 GO0009615 response to virus 98 27 6,4 46 GO0006955 immune response 825 197 5,5 47 GO0042098 T cell proliferation 27 8 2,3 48 GO0019028 viral capsid 23 5 1,3 49 GO0042130 negative regulation of T cell proliferation 20 10 1,2 50 GO0045190 isotype switching 25 6 1,5 51 Citosolic protein metabolism 52 GO0004298 threonine endopeptidase activity 36 18 2,5 53 GO0005839 proteasome core complex 35 18 2,5 54 GO0004298 threonine endopeptidase activity 21 18 2,5 55 GO0004175 endopeptidase activity 47 31 2,0 56 GO0015198 oligopeptide transporter activity 7 6 2,0 57 GO0003756 protein disulfide isomerase activity 9 7 1,8 58 GO0043234 protein complex 419 63 1,7 59 GO0016567 protein ubiquitination 72 21 1,2 60 35 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 64 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 GO0006461 protein complex assembly 171 44 1,2 3 GO0008320 protein carrier activity 16 6 1,1 4 GO0016023 cytoplasmic membrane bounded vesicle 71 35 2,5 5 GO0045921 positive regulation of exocytosis 15 1 2,1 GO0006888 ER to golgi vesicle mediated transport 41 44 1,8 6 GO0030126 COPI vesicle coat 11 7 1,4 7 GO0019894 kinesin binding 10 7 1,1 8 GO0016939 kinesin II complex 1 1 1,5 9 GO0006893 golgi to plasma membrane transport 10 3 2,9 10 Cytoskeleton metabolism 11 GO0008092 cytoskeletal protein binding 79 22 1,8 12 GO0005862 muscle thin filament tropomyosin 4 3 1,7 13 GO0030863 cortical cytoskeleton 38 5 1,3 14 GO0031430 M line 11 1 0,7 15 GO0005863 striatedFor muscle thick peer filament review only3 16 1,2 16 GO0006941 striated muscle contraction 45 24 1,7 17 GO0060052 neurofilament cytoskeleton organization 10 8 1,9 18 GO0031674 I band 60 4 2,2 19 GO0030017 sarcomere 101 11 2,3 20 Iron metabolism 21 GO0006826 iron ion transport 32 18 2,5 22 Other metabolism 23 GO0006164 purine nucleotide biosynthetic process 23 12 1,3 24 GO0008033 tRNA processing 68 29 1,4 25 GO0000049 tRNA binding 24 9 1,7 26 Intracellular signaling 27 GO0008589 regulation of smoothened signaling pathway 24 1 5,1 28 GO0003924 GTPase activity 248 106 3,2 29 GO0005886 plasma membrane 2727 391 3,1 30 GO0031583 G protein signaling phospholipase D activation 1 1 2,6 31 GO0000186 activation of MAPKK activity 31 7 1,9 32 GO0016324 apical plasma membrane 130 41 1,6 33 GO0005100 rho GTPase activator activity 31 8 1,5 http://bmjopen.bmj.com/ 34 GO0005149 interleukin 1 receptor binding 12 12 2,9
35 Sexual determination GO0019101 female somatic sex determination 1 1 2,2 36 GO0019100 male germ line sex determination 1 1 2,4 37 GO0006702 androgen biosynthetic process 7 2 2,4 38 GO0030238 male sex determination 10 8 3,6 39
40 a number of human genes included within each gene ontology 41 b number of significantly regulated genes by CoQ deficiency included within each gene ontology 10 on September 28, 2021 by guest. Protected copyright. 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 36 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
ase inhibitor)
model description model dependent dependent kin ded in thein ded biosynthesis of s s expressed inliver mouse cholesterol terpenoids genes inclu genes expressed inliver mouse gene genes expressed in fetal liver E2A lack (transcription factor of that induce E2F transcriptionfactor pushes the cyclin by CMV overexpression infection deregulation of pRB pathway is hallmark a Swi/Snf chromatin remodeling apparatus arrest cycle, induction cell apoptosisof of genes theincludedin reactome DNA for growth factors activatepathwaysthat induce serum activate pathways thatinduce cell steroids cellinhibits cycle stimulateand cell differentiation activates CDK tumorogenesisof arrests cell cycle repressionand both of mitogen activated sicklecell in disease. replication cell cycle cycle
pathwaysand cell growth and proliferation p21 p21 (cyclin p21) no p21) inhibition no p21 progressioncell cycleof
(d)
r
genes theincludedin biosynthesis of genes theincludedin biosynthesis of simila similar similar similar similar oppotite oppotite opposite opposite opposite opposite opposite opposite opposite opposite opposite analysis (c)
up up up up up up up up up up up up down down down down down down down deficiency 10 COQ
(b)
down down 37 up up up up up up up up up up down down down down down down BMJ Open model http://bmjopen.bmj.com/ (a)
PMID 12663442 16006652 12138103 12138103 12138103 12138103 15310760 11313881 11867723 12923195 14673169 15031206 16127159 15374877 12200464 14737219
3,9 4,3 3,7 3,2 3,3 3,3 4,5 5,5 3,5 4,0 4,8 5,0 3,7 3,8 3,3 3,3 5,0 6,1 6,9 5,3 Z_Score
on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only
deficiency deficiency
10
BIOSYNTHESIS_OF_STEROIDS ICHIBA_GVHD CPR_LOW_LIVER_UP FETAL_LIVER_enriched_transcription_factors P21_P53_MIDDLE_DN P21_ANY_DN P21_P53_EARLY_DN P21_P53_ANY_DN GREENBAUM_E2A_UP E2F1_DNA_UP CMV_IE86_UP VERNELL_PRB_CLSTR1 BRG1_ALAB_UP JISON_SICKLECELL_DIFF LAL_KO_3MO_UP MANALO_HYPOXIA_DN DNA_REPLICATION_REACTOME VEGF_MMMEC_6HRS_UP SERUM_FIBROBLAST_CELLCYCLE
Pathway
Supplementary 5 table
CHOLESTEROL_BIOSYNTHESIS cycleCell and cellactivation differentiation inhibition Lipid and Lipid liver metabolism pathwaysRegulated in CoQ TERPENOID_BIOSYNTHESIS 3,0
Page 65 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 66 of 84
fferentiation of multiple structures (lost of undifferentiation) neutrophils insulin insulin during tumorogenesis adenocarcinoma absent of absent of CD31 marker maintains stemness gene undifferentiatedpattern tumoral of differentiation myeloid cells by stem of anddevelopment differentiation of fetal anddevelopment di for no for no differentiation cells retinoic acid structures myeloid cellscomparedto undifferentiated lymphocyctesin bone marrow
similar similar gene embryonicpattern celsstem of similar similar gene immaturepattern CD4(+)of T cells gene immaturepattern B cellsof similar differentiation fibroblast to of by adipocytes similar differentiation fibroblast to of by adipocytes similar and adaptation resistance myeloid cellsof similar similar activated markers for tumorbreast similar lost of APC similar similar similar similar gene immaturepattern cellsScwann of similar repressedmarkers for pancreatic opposite opposite opposite opposite opposite gene mature pattern CD4(+) of T cells opposite differentiation to myeloid cells stem of opposite gene senescencepattern of T cells
up up up up up up up up up up up up up down down down down down down
38 up up up up up up up up up up up up up up up up up up down down down up opposite and development differentiation of fetal down down down down down up up up opposite FSH stimulatesmaturation of cells germ opposite opposite gene middleagepattern humans on gene pattern oldage humans on down BMJ Open http://bmjopen.bmj.com/
15635089 15184677 12228720 15210650 15210650 11779835 15695336 11468144 16140955 12057921 16611997 11861292 15827134 12137940 15033539 16728703 11823860 11823860 15199222 15198980 15386376 10741968 10741968 15741219
2,9 6,2 4,1 3,4 3,1 4,7 3,2 3,0 4,8 5,1 3,5 3,5 6,4 3,7 5,4 4,1 4,3 2,9 3,8 2,8 9,6 2,9 3,2 3,7
on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peerDN review only
UNDIFFERENTIATED_META_UP MIDDLEAGE_DN BOQUEST_CD31PLUS_VS_CD31MINUS_UP CANCER_ XU_ATRA_PLUSNSC_UP LI_FETAL_VS_WT_KIDNEY_ ZHAN_MULTIPLE_MYELOMA_UP MOREAUX_TACI_HI_VS_LOW_UP OLDAGE_DN
Maintenance Maintenance ofcellular state ofdifferentiationno LEE_TCELLS3_UP Aging
ADIP_DIFF_CLUSTER4 ZHAN_MM_CD138_PR_VS_REST FSH_OVARY_MCV152_UP IDX_TSA_UP_CLUSTER3 transformationCell during tumorogenesis BRCA_PROGNOSIS_NEG LEE_TCELLS4_UP HOFFMANN_BIVSBII_BI_TABLE2 LE_MYELIN_DN VANTVEER_BREAST_OUTCOME AGUIRRE_PANCREAS_CHR19 Development SANSOM_APC_LOSS4_UP LIAN_MYELOID_DIFF_TF ROTH_HTERT_UP STEMCELL_EMBRYONIC_UP GAY_YY1_DN
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
induced induced 743) induce 743) cell arrest cycle alpha, beta, and beta, alpha, and gamma) iducible cytomegalovirusand alpha inducible genes primary in on apoptosis hippocampus and stress senescence oxidative stress DNAresponse induced in not deficiency of trabectedin (ET DNA inhibition methylation of prevents regulationgene by demethylation of DNA histone deacethylase inhibition arrests cell interferon( interferon interfer nucleotide excisionnucleotide repair after UV treatment apoptosisand initial tumorogenesisphase of cycle,induce apoptosis genes fibrosarcomain cells treated with any interferon with all or at samethe time atand different time points induced in genes fibroblasts hepatocytes
te
similar similar similar chemoterapy resistanceto in cancer cells aged mediated immflamatory in response similar hematopoietic cellsstem replicative avoid similar similar resistanceto glutamine starvation similar repression gene epitheliumin by cells opposite opposite opposite opposite opposite opposite opposite opposi opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite TGF beta arrests cyclecell and induce
up up up up up down down down down down down down down down down down down down down down down down down down down down down down down
39 up up up up up up up up up up up up up up up up up up up up up up up up up up up up down down down down down BMJ Open http://bmjopen.bmj.com/
9861020 9861020 9861020 9861020 9861020 9861020 9861020 9861020 15608684 15608684 12101249 14734480 15960800 16293602 12419474 11279127 15897246 15897246 15897246 11861364 11861364 11992124 15452378 11711622 11711622 11711622 11910354 11910354 11910354 11910354
3,1 2,8 3,6 3,1 3,2 8,4 7,7 4,5 3,2 9,0 8,2 8,0 7,1 6,9 5,1 4,1 4,1 9,8 9,7 9,6 9,2 7,9 6,4 4,6 4,7 3,5 3,2 3,2 11,7 11,2
on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only
CMV_COMMON_HCMV_6HRS_UP UVC_TTD_4HR_UP UVC_TTD_ALL_UP ET743_SARCOMA_UP ET743_SARCOMA_DN ET743_SARCOMA_6HRS_UP DAC_BLADDER_UP DAC_IFN_BLADDER_UP TSADAC_RKOEXP_UP TSA_HEPATOMA_CANCER_UP DER_IFNA_UP DER_IFNB_UP IFN_ALPHA_UP IFN_ANY_UP IFN_BETA_UP DER_IFNG_UP IFN_GAMMA_UP IFN_ALL_UP IFNA_UV CMV_HCMV_TIMECOURSE_12HRS_UP IFNA_HCMV_6HRS_UP RADAEVA_IFNA_UP IFNALPHA_NL_UP IFNALPHA_NL_HCC_UP IFNALPHA_HCC_UP TGFBETA_C2_UP Cell resistanceCell AGED_MOUSE_HIPPOCAMPUS_ANY_UP DOX_RESIST_GASTRIC_UP
PENG_GLUTAMINE_DN regulationEpigenetic of gene expression
KAMMINGA_EZH2_TARGETS OXSTRESS_RPETHREE_DN Apoptosis and cell Apoptosis cycleand arrest Interferoninducedgenes
Page 67 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 68 of 84 alpha iducible alpha inducible in genes
induced genes in gamma and gamma TNF iducible by iducible by ectopic NF90 iduciblein cells genes toresistant iduciblein genes myelodysplastic inducible genes DNAdamage by beta beta inducible in genes glioma 6 inducicble 6 genes normalin skin cell lines lines lines IL 6 starved cell lines interferonalphaand beta) interferon interferon interferon interferon interferon cytomegalovirus interferon IL genes activated lupus(anin autoimmune Jurkat Jurkat cells expression without viral infection tamoxifen therapy genes endothelialin cells syndromes in and acute myeloidleukaemia after treatmentcisplatin fibroblasts at 48 hours cells at 48 hours fibroblasts disease) papilomavirus
ite
similar similar inducicble genes in multiple cell myeloma similar similar oppos opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite opposite inducicble IL 6 genes multiplein myeloma opposite opposite hepatocytes infected with hepatitis B virus keratinocytes infected with human opposite opposite fibroblasts infectd with cytomegalovirus opposite
up up up up down down down down down down down down down down down down down down down down down down down down
40 up up up up up up up up up up up up up up up up up up up up up up up down up opposite repressed IL 6 in genes multiple myeloma down down BMJ Open http://bmjopen.bmj.com/
9826724 9826724 9826724 11991981 11991981 12036489 15657362 15749026 15749026 16818636 16818636 16818636 16818636 14737109 11711622 16140920 15095275 12969979 12969979 12791645 12791645 15100412 10756030 12642603
3,0 9,2 6,3 3,8 7,1 8,9 8,6 8,4 7,8 7,2 5,8 4,8 3,0 5,1 4,3 5,8 6,4 4,8 4,0 3,4 3,4 5,0 13,2 12,2
on September 28, 2021 by guest. Protected copyright.
1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only
GRANDVAUX_IFN_NOT_IRF3_UP GRANDVAUX_IRF3_UP BECKER_IFN_INDUCIBLE_SUBSET_ SANA_IFNG_ENDOTHELIAL_UP SANA_TNFA_ENDOTHELIAL_UP TAKEDA_NUP8_HOXA9_3D_UP TAKEDA_NUP8_HOXA9_10D_UP TAKEDA_NUP8_HOXA9_8D_UP TAKEDA_NUP8_HOXA9_16D_UP CIS_RESIST_LUNG_UP CMV_HCMV_TIMECOURSE_48HRS_UP IFN_BETA_GLIOMA_DN IL6_FIBRO_UP BENNETT_SLE_UP SLRPPATHWAY NF90_DN
CMV_8HRS_UP KRETZSCHMAR_IL6_DIFF CROONQUIST_IL6_RAS_DN HPV31_DN Immunity CMV_ALL_UP CMV_24HRS_UP WIELAND_HEPATITIS_B_INDUCED
CROONQUIST_IL6_STARVE_UP 5,0 Interferon induced and virus induced genes at 48 hours Interleukin induced genes BROCKE_IL6 Other markers
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
41 BMJ Open http://bmjopen.bmj.com/
on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency
10 For peer review only deficiency comparativeanalysis deficiency
10 Regulation of expressioninRegulation thegene model described vs.CoQ Model Reference listed as PubMedIdentity number Regulation of the genessame in CoQ (a) (a) (b) (c) (d)
Page 69 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 70 of 84
)
(b
2% 2% 5% 5% 7% 7% 6% 6% % 32% 12% 18% 10% 22% (P C)
Control vs.
750 750 1655 2405 1962 3868 5830 3442 7238 10680 probes probes
) (b treated No
2% 2% 5% 5% 7% 7% 4% 4% 8% 8% % 10% 14% 15% 22%
(PQ C) Control vs.
707 707 1597 2304 1498 3326 4824 4927 2521 7448 probes probes
42
) Treated (b
3% 3% 1% 1% 4% 4% 5% 5% 4% 4% 9% 9% 7% 7% 11% 18% BMJ Open http://bmjopen.bmj.com/
(PQ P)
No treated No
vs. 838 838 479 479 1317 1789 1257 3046 3602 2441 6043 probes probes % Treated Treated on September 28, 2021 by guest. Protected copyright.
) (a
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
UP regulated UP regulated UP regulated deficient fibroblasttreated deficient with M 30 10 regulated probes regulated probes Forregulated probes peer review only DOWN regulated DOWN regulated DOWN regulated test<0.05
R = 3.0R= R = 2.0R= R = 1.5R= ITERPLIER algorithms; t An Affymetrix GeneChip®An Gene Human arrayST 1.0 contains setsprobe33297
minimum minimum FC comparative analysis (a) (b)
Supplementary 6 table Regulated probesRegulated in coenzyme Q
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 71 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2 3 Supplementary table 7
4 Regulated probes in coenzyme Q deficient fibroblast treated with 30 M (expanded table) (a) 5 10
6 (b) (c) 7 significant probes (t test<0.05) % vs. all regulated probes (d) 8 PQ P PQ C P C R = 1.5 R = 2 R = 3 R = 1.5 R = 2 R = 3 # 9 UP 190 151 112 1,4% 2,4% 4,5% U 10 UP DOWN 51 48 34 0,4% 0,8% 1,4% O 11 401 156 23 3,0% 2,5% 0,9% S 12 UP 13 UP DOWN DOWN 273 273 211 2,1% 4,4% 8,5% pR 14 15 For peer review only 16 UP 17 DOWN 1075 621 99 8,1% 10,0% 4,0% R 18 451 8 0 3,4% 0,1% 19 UP 791 741 525 6,0% 11,9% 21,1% pR 20 UP DOWN 21 22 UP 50 50 33 0,4% 0,8% 1,3% 23 O 24 DOWN DOWN DOWN 165 165 141 1,2% 2,7% 5,7% U 25 505 183 57 3,8% 2,9% 2,3% S 26 UP 1516 636 82 11,4% 10,2% 3,3% R 27 DOWN 28 575 14 0 4,3% 0,2% 29 UP 3156 2218 903 23,7% 35,7% 36,3% U 30 UP DOWN 31 32 338 12 0 2,5% 0,2% 33 UP http://bmjopen.bmj.com/ 34 DOWN DOWN 1187 812 265 8,9% 13,1% 10,7% U 35 341 15 0 2,6% 0,2% 36 UP 1535 72 0 11,5% 1,2% 37 DOWN 691 43 0 5,2% 0,7% 38 20006 26979 30812 39
40 (a) 41 for a graphical view, see figure S1 (b) 42 ITERPLIER algorithms; t test<0.05 on September 28, 2021 by guest. Protected copyright. 43 (c) The percentaje is calculated on the total number of probes regulated at least in one comparative analysis, being: 13291 for 44 R=1.5; 6218 for R=2.0; and 2485 for R=3.0 (d) 45 Effect of coenzyme CoQ10 supplementation on gene expression in CoQ10 deficiency (more information in Supplementary 46 Table 4 and in the text): unaffected genes by CoQ10 treatment (U); genes that restored the expression either partial (pR) or 47 completely (R); genes with opposite regulation than in CoQ10 deficiency (O); and specificaly regulated genes only after 48 CoQ10 supplementation (S). Genes non afected by CoQ10 supplementation ( ). 49 50 51 52 53 54 55 56 57 58 59 60 43 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 72 of 84
0% 3% 3% 7% (b)
30% 57% R R = 3
(d) 3% 5% 2%
20% 16% 54% R = 2 2 R=
7% 1% 8% 30% 19% 35% R =1.5 R
0 80 67 181 736
1421 R = 3 R % regulated probes vs. all (a)
44
BMJ Open (d) 98 164 339 http://bmjopen.bmj.com/ 1257 1014 3346 R = 2 2 R =
a graphical representation) 906 101 significant probes 3931
1064 4698 2591 R =1.5 R
supplementation 10 on September 28, 2021 by guest. Protected copyright. (see figure for S1
the text
deficiency deficiency For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
10 in (c)
10 supplementation 10
For peer groups review only 10
10 classification Classificationgroup
Partial restored by Partialby CoQ restored Completely restored Completely by CoQ Unaffected Unaffected by CoQ Opposite regulation Opposite regulation inthan CoQ Regulated only Regulatedafter only CoQ small small changes (non specific) escription the of D ( S ( ) S The percentage percentage iscalculated The total thenumber on probes at leastof inregulated comparative analysis,one being: 13291 for full change A minimum 2 fold (R=2)of furtherconsidereda was analysisfor (see comment text)thein
ITERPLIER algorithms; t test<0.05 ( R ) ( U ) ( ( ) O ( pR ) ( pR Supplementary 8 table
R=1.5; 6218 for R=1.5; (in R=2.0 bold letter);and 2485 for R=3.0 Classification groups ofgeneexpression after coenzyme Q (b) (c) (a) (d)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(c)
1,9 3,3 2,1 9,5 1,2 4,6 37,6 43,9 14,1 22,6 37,6 37,6 18,8
Enrichment (b)
2 2 4 4 2 2 3 3 3 2 2 2 3 3 6 6 10 10 21 21 15 15 selected # (a)
0 1
P value genes # 3,42E 04 6 5,13E 04 2 6,99E 04 2 6,99E 04 2 9,16E 04 1008 60 6,58E 04 10 5,80E 04 18 3,46E 04 74 6,69E 04 61 6,91E 04 8,86E 04 99 4,21E 04 7,37E 05 1081 1,34E 05 176 8,17E 05 109 2,43E 05 25 92 1,76E 04 70 64 1,32E 04 71 98 1,32E 04 49 67 7,76E 05 45 4,22E 07 60 46 2,54E 04 43 46 7,51E 04 48 65 2,0 34 32 1,2 1,47E 04 32 594 4,91E 04 32 1,3 2,69E 04 33 1,4 20 8,45E 04 48 491 1,5 9,20E 04 24 23 28 1,5 17 1,6 1,74E 04 8 1,6 17 23 1,6 5 1,6 6,99E 04 5 1,7 4 1,7 2 1,7 1,8 2,0 2,1 8,2 8,8
45 BMJ Open http://bmjopen.bmj.com/ deficiency deficiency 10 on September 28, 2021 by guest. Protected copyright. treatment treatment 10 deficient fibroblasts deficientsupplemented with CoQ 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml For peer review only
Gene OntologyGene Term
Supplementary 9 table GO:0043506 JUN regulation of activitykinase GO:0070302 stress activated regulation of protein cascadesignalingkinase GO:0010627 intracellular regulation of protein kinase cascade GO:0019899 enzyme binding GO:0050789 3,21E 04 regulation biological of process GO:0065007 regulation biological GO:0044428 nuclear part GO:0022402 23 cellprocess cycle GO:0007049 cell cycle GO:0044427 chromosomal part GO:0022403 cellphase cycle GO:0007017 microtubule based process GO:0000280 nuclear division GO:0007067 mitosis GO:0048285 fission organelle GO:0051301 cell division GO:0006281 DNA repair GO:0005634 nucleus GO:0000777 condensed chromosome kinetochore GO:0000776 kinetochore GO:0003677 DNA binding GO:0071156 cell regulation cycle arrestof GO:0007059 chromosome segregation GO:0000910 cytokinesis GO:0009954 proximal/distal pattern formation GO:0030199 fibril collagen organization GO:0033599 regulation mammary glandof epithelial cell proliferation GO:0035264 multicellular organism growth GO:0005095 inhibitor GTPase activity Classification (O):group thanopposite in regulation CoQ GO:0010997 anaphase promotingcomplex binding GO:0051240 regulation positive of multicellular processorganismal Classification (U):group unaffectedby genes CoQ GO classification GO of classification genes in CoQregulated
Page 73 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 74 of 84
2,1 9,0 8,9 3,3 9,9 6,8 15,0 31,2 24,9 24,9 20,8 11,5 41,6 62,3 83,1 31,7 11,5 14,4 18,7 124,7 124,7
3 3 4 4 2 2 3 3 3 3 3 3 3 3 4 4 2 2 2 2 3 5 4 4 2 2 9 9 3 3 4 4 3 3 4 4 21 21
7,21E 04 341 6,25E 04 143 5,00E 05 4 3,27E 04 3 2,29E 04 9 2,29E 04 9 9,19E 04 25 5,42E 04 17 6,14E 05 2 9,41E 05 12 1,92E 04 15 1,92E 04 15 3,38E 04 18 1,92E 04 15 9,04E 04 3,65E 04 1,83E 04 6 4 3 3 3,05E 04 8,52E 04 5 5,42E 04 19 4,22E 04 17 24,9 16 4 9,62E 04 9,73E 04 4 424 4 21 3,01E 05 6,87E 04 11 29 8,9 5,67E 04 5 144 3,46E 04 9,9 7,14E 05 142 10,6 5 21 21 8 1,8 21 7 6,2 1,8 2,1 2,1 4,8 8,52E 04 19 6,14E 05 2 deficiency 46 10 deficiency deficiency 10 BMJ Open treatment http://bmjopen.bmj.com/ 10 deficiencyCoQ to due on September 28, 2021 by guest. Protected copyright. 10 supplementation included within eachsupplementation ontology gene 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review thealtered CoQrestoredexpression partialy in only completely restored the completely restored altered expression of CoQ 10 10
GO:0060674 placenta blood development vessel Number of of regulated significantly Number by CoQ genes Number of Number of human genes within analyzed each ontologygene Ontology EnrichmentGene the represents selection of genes associated with specifica GO. is calculated by GORILLAIt as follows: software
GO:0048856 anatomical developmentstructure E=(b/n)/(B/N), being "N"E=(b/n)/(B/N), totalbeing the number "B" the of genes, total associated number of genes a with particular the GO, "n" number inof genes each (b) (c) (a) GO:0032269 regulation negative cellular of metabolicprotein process GO:0031400 regulation negative protein of processmodification GO:0010563 regulation negative phosphorus of metabolic process GO:0042326 regulation negative phosphorylationof GO:0045936 regulation negative phosphateof metabolic process GO:0001933 regulation negative protein of phosphorylation GO:0001569 patterning blood of vessels GO:0031258 lamellipodium membrane GO:0031527 filopodium membrane GO:0031952 regulation protein autophosphorylationof Classification (S):group specific in CoQ GO:0031953 regulation regulation negative protein of autophosphorylation GO:0005523 tropomyosin binding GO:0034728 nucleosome organization GO:0071824 complex protein DNA subunit organization GO:0006334 nucleosome assembly GO:0065004 complex protein DNA assembly GO:0032993 complex protein DNA Classification (pR):group CoQ GO:0009898 internal plasmaside of membrane GO:0060665 regulation involvedbranching of in salivary gland morphogenesis GO:0005576 extracellular region GO:0032868 8,68E 04 insulin response to stimulus GO:0015718 monocarboxylic transport acid GO:0005520 insulin like growth factor binding 5 Classification (R):group CoQ GO:0048666 neuron development GO:0010941 cell regulation deathof GO:0043067 regulation programmed of cell death GO:0042981 apoptosis regulation of GO:0045121 membrane raft GO:0046777 protein autophosphorylation group group of classification and "b"number genes the associatedof a to particulareach within GO classification.group of
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 75 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Supplementary table 10 3 Sample description during submission to NCBI GEO (SuperSeries GSE33941) 4
5 6 SubSeries Sample Sample description # (a) 7 GSM833438 fibroblast_patient_1_A P 8 GSM833441 fibroblast_patient_1_B P 9 GSM833444 fibroblast_patient_1_C P 10 GSM833478 control_fibroblast_A C 11 Series GSE33769 GSM833479 control_fibroblast_B C 12 GSM833480 control_fibroblast_C C
13 GSM833490 fibroblast_patient_3_A P
14 GSM833491 fibroblast_patient_3_B P Platform GPL570 15 GSM833492 fibroblast_patient_3_C P For peer review only 16 [HG U133_Plus_2] GSM833493 fibroblast_patient_5_A P 17 Affymetrix Human Genome U133 Plus 2.0 Array GSM833494 fibroblast_patient_5_B P 18 GSM833495 fibroblast_patient_5_C P 19 GSM833502 fibroblast_patient_4_A P 20 GSM833503 fibroblast_patient_4_B P 21 GSM833504 fibroblast_patient_4_C P 22 GSM839154 fibroblast_patient_ELO_1_1 P 23 GSM839155 fibroblast_patient_ELO_1_2 P 24 GSM839156 fibroblast_patient_ELO_2_1 P 25 GSM839157 fibroblast_patient_ELO_2_2 P 26 GSM839158 fibroblast_patient_GIO_1_1 P 27 GSM839159 fibroblast_patient_GIO_1_2 P Series GSE33940 GSM839160 fibroblast_patient_GIO_2_1 P 28 29 GSM839161 fibroblast_patient_GIO_2_2 P GSM839162 control_fibroblast_2c C 30 GSM839163 control_fibroblast_4a C 31 Platform GPL6244 GSM839164 control_fibroblast_4b C 32 GSM839165 fibroblast_patient_SOF_Q treated_1 P+Q 33 [HuGene 1_0 st] GSM839166 fibroblast_patient_SOF_Q treated_2 P+Q http://bmjopen.bmj.com/ 34 Affymetrix Human Gene 1.0 ST Array (transcript gene version) GSM839167 fibroblast_patient_SIL_Q treated_1 P+Q 35 GSM839168 fibroblast_patient_SIL_Q treated_2 P+Q 36 GSM839169 fibroblast_patient_MSI_Q treated_1 P+Q 37 GSM839170 fibroblast_patient_MSI_Q treated_2 P+Q 38 GSM839171 fibroblast_patient_ELO_Q P+Q 39 GSM839172 fibroblast_patient_ELO_Q P+Q 40 GSM839173 fibroblast_patient_MEL_Q P+Q 41 42 on September 28, 2021 by guest. Protected copyright. (a) 43 human dermal fibroblast from healthy volunteers (C), fibroblasts from CoQ10 deficient patients (P), and fibroblasts 44 from CoQ10 deficient patients treated with 30 M CoQ10 for 48 hours (PQ) as described in the text. 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 47 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 76 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 supplementary table 11
4 Primers used for Q RT PCR 5 6 7 Gene Forward Reverse 8 BRP44 5' GATAAAGTGGAGCTGATGC 3' 5' TTGGAGCCCAGAAGAAAA 3' 9 CH25H 5' CCCTTGGTCCACTCACAG 3' 5' GCAGCGTTCCCAGTATTT 3' 10 CYP1B1 1 5' AGGCAAAGGTCCCAGTTC 3' 5' GATGGACAGCGGGTTTAG 3' 11 CYP1B1 2 5' AGTGCAGGCAGAATTGGA 3' 5' GAGGTGTTGGCAGTGGTG 3' 12 EFNB2 5' ACCAAATCCAGGTTCTA 3' 5' CTCCTCCGGTACTTCA 3' 13 FDFT1 5' ACTTTGGCTGCCTGTTAT 3' 5' CATCCATCATCAGGGTCA 3' 14 KRT34 5' GGGAAGTGGAGCAATG 3' 5' AGAGTCTCGCAGGTTGT 3' 15 MCAM 1 For5' GTGTAGGGAGGAACGG peer 3'review 5' CTGGGACGACTGAATGTonly 3' 16 MCAM 2 5' AGTCAGGACGAGACCATC 3' 5' CTTCAGCCTTCCGAGTA 3' 17 PAPPA 5' TGGGTCATAACTATTTCAGG 3' 5' TATTCATGTCGTCGCATT 3' 5' TTAAGTTTGTTCGTGGTAG 3' 5' TGTGGGTCCTTCAGTTTT 3' 18 POSTN 1 5' CCGAGCCTTGTATGTATG 3' 5' TTACCAGTAAACCCACTC 3' 19 POSTN 2 5' GCTGGAGCACGAGACCA 3' 5' AGCGAGCAGAGGAAGACC 3' 20 SFRP1 5' GTTCGTCGTCTTCATCG 3' 5' CCTCTGTTGCTGTGGG 3' 21 TNFRSF10D 5' GATGAAACCTCGTTATGAA 3' 5' CTAAGCACCGGATAGTTG 3' 22 VCAN 23
24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 48 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(a)
6% % 51% 1.9% 2.2% 0.6% 0.9% MELAS
353 489 1056 1207 3077 28130 Probes Sample 4 4 Sample 0,82 (3,2%) 0,82
(a)
6% % 51% 2.6% 2.4% 1.0% 1.3% ataxia
537 703 1410 1287 3425 27893 Probes Sample 1 1 Sample 0,83 (3,3%) (0,9%) 1,2 (0,97%) 1,3
(0%) 2,7 (0%) 3,3 (a)
% 50% 1.1% 0.9% 0.4% 0.5%
207 255 479 479 0.9% 1240 2% 842 2% 628 515 1217 2.2% 2697 5% 2263 4% 27042 Probes Secondary deficiency
(a)
6% % 51% 2.3% 2.3% 0.7% 1.0% deficient fibroblasts deficient 10 COQ2
49 371 544 1253 1244 3200 27711 Probes BMJ Open Sample 5 5 Sample 0,81 (3,6%) 0,81 http://bmjopen.bmj.com/
(a)
% 11% 52% 3.6% 3.9% 1.5% 1.6% COQ2
823 849 1982 2145 5940 28407 Probes Sample 3 3 Sample 0,73 (4,2%) 0,73 on September 28, 2021 by guest. Protected copyright. (0%) 3,1 (0%) 3,2 (0,7%) 1,3 (0,8%) 1,2
(a)
% 49% 0.9% 0.7% 0.3% 0.2% For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only 175 139 387 0.7% 1672 3% 915 2% 517 397 1162 2.1% 4127 8% 2497 5% 26783 Probes Primary deficiency
FDR = 0 = FDR lue<0.05 FDR < 1% FDR FDR < 5% FDR UP regulated UP regulated (2)
UP regulated UP regulated va (b) (b)
value (FDR) value value (FDR) value value value (FDR) DOWN regulated DOWN regulated MAS5 and and RMA algorithms;MAS5 two class (unloggedunpaired data); s0=50; R=1.5 An AffymetrixAn GeneChip® Genome Human PlusU133 containsarray 2.0 54675 probe sets (a) (b) SAM analysisSAM SAM SAM analysis Probes with Probes p SAM analysis
Supplementary 12 table duringofSelection probes filtering and statistical analysis in primarysecondaryand CoQ
Page 77 of 84 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 78 of 84
) (b 0,16% 0,06% 0,09% 0,03% 3,16% 4,07% 1,02% 1,27% 0,70% 0,62% 0,43% 0,25%
% ) (a FDR < 1%FDR 85 85 34 34 47 47 18 18 560 695 383 337 237 137 1726 2224
50 selectedprobes ) (b
BMJ Open 0,17% 252 0,46% 0,05% 105 0,19% 0,05% 0,02% 0,02% 0,01% 1,31% 1,92% 0,37% 0,61% 0,23% 0,27% 0,16% 0,09% http://bmjopen.bmj.com/ % ) (a FDR = 0%FDR
9 7 47 47 94 94 28 28 28 28 12 12 89 89 334 334 149 149 714 714 203 203 124 124 1051 selected probes selected probes on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
1 DOWN 1 2 DOWN 2 1 DOWN 1 3 DOWN 3 1 DOWN 1 2 DOWN 2 UP UP UP UP UP + + + + + + DOWN DOWN DOWN DOWN DOWN DOWN ForDOWN peer review only 1 UP 1 1 UP 1 2 UP 2 1 UP 1 3 UP 3 2 UP 2
simultaneous change in
1 sample1 2 samples2 3 samples3 4 samples4 2 samples2 3 samples3 4 samples 4 An Affymetrix GeneChip®Affymetrix An Genome PlusU133Human contains 2.0 array 54675 probe sets SAManalysis (R=1,5) )
Coherence of in gene changes afterexpression the comparative analysis
(b (a) Supplementary13 table
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 79 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2 3 Supplementary table 14
4 Coherence of changes in gene expression after the comparative analysis 5 (expanded data) 6 (a) # probes 7 sample 1 sample 3 sample 4 sample 5 FDR<1% FDR=0% 8 UP 137 47 9 UP DOWN 8 2 10 59 32 11 UP 2 1 12 UP DOWN DOWN 2 1 13 6 1 14 UP 77 28 15 For peer DOWN review6 2only 16 129 74 17 UP 20 8 18 UP DOWN 4 2 19 17 6 20 UP 3 1 21 UP DOWN DOWN DOWN 6 1 22 8 2 23 UP 17 3 24 DOWN 7 2 25 26 16 26 27 UP 148 75 28 UP DOWN 5 1 29 117 82 30 UP 2 0 31 DOWN DOWN 5 0 32 6 3 33 UP 128 71 http://bmjopen.bmj.com/ 34 DOWN 8 7 35 335 235 36 UP 4 1 37 UP DOWN 4 0 38 4 2 39 UP 3 0 40 UP DOWN DOWN 27 5 41 11 3 42 UP 13 8 on September 28, 2021 by guest. Protected copyright. 43 DOWN 33 6 44 41 18 45 UP 2 3 46 UP DOWN 5 0 2 1 47 DOWN 48 UP 9 3 49 DOWN DOWN DOWN 237 89 50 76 39 51 UP 4 4 52 DOWN 110 36 53 118 58 54 UP 3 0 55 UP DOWN 3 0 7 0 56 57 UP 8 3 58 DOWN DOWN 157 33 59 100 32 60 51 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 80 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 UP 8 3 3 DOWN 120 47 4 301 143 5 UP 53 14 6 UP DOWN 3 2 7 115 32 8 UP 4 1 9 UP DOWN DOWN 18 4 10 29 10 11 UP 103 41 12 DOWN 39 13 13 1216 501 14 UP 5 2 15 For UPpeer DOWN review1 1only 16 25 7 17 UP 5 2 18 DOWN DOWN DOWN 40 16 19 58 26 20 UP 44 14 21 DOWN 107 25 22 1026 456 23 UP 103 34 24 UP DOWN 9 1 25 344 134 26 UP 10 2 27 DOWN DOWN 57 15 28 167 60 29 UP 329 181 30 DOWN 232 55 31 32 33 (a) selected probes by SAM analysis (R=1.5) http://bmjopen.bmj.com/ 34 35
36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 52 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 81 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1
2
3 Supplementary table 15 4
5 Pathology's gene expression similar to CoQ deficiency 6 10
7 MeshTerm (a) # genes (b) # significant (c) Z_Score (d) 8 Digestive 9 COLITIS, ULCERATIVE 48 43 2,2 10 CELIAC DISEASE 19 18 1,9 11 DIARRHEA 9 6 1,8 12 Embryo 13 FETAL MEMBRANES (PREMATURE RUPTURE) 12 12 2,7 14 Heart 15 CAROTIDFor ARTERY DISEASES peer review34 only34 3,6 16 CORONARY RESTENOSIS 11 11 3,2 17 CORONARY DISEASE 104 100 3,2 18 VENTRICULAR DYSFUNCTION 9 9 2,4 19 VENTRICULAR HYPERTROPHY 20 20 1,9 20 Immune 21 CHLAMYDIA INFECTIONS 8 8 3,2 22 Kidney 23 KIDNEY FAILURE 38 37 2,5 24 Liver 25 HEPATITIS C 18 17 4,5 26 LIVER CIRRHOSIS 30 29 2,5 27 Neuronal 28 PHOBIC DISORDERS 3 3 1,7 29 SLEEP DISORDERS 3 3 1,7 30 BRAIN INFARCTION 9 9 1,8 31 PANIC DISORDER 11 11 1,8 32 MOOD DISORDERS 18 18 2,4 33 Weight and Insulin related http://bmjopen.bmj.com/ 34 WEIGHT LOSS 13 13 2,4 DIABETES MELLITUS (TYPE 1) 100 98 1,7 35 Lung 36 PULMONARY DISEASE 33 32 2,8 37 BRONCHIAL HYPERREACTIVITY 11 11 2,5 38 LUNG DISEASES (OBSTRUCTIVE) 3 3 1,7 39 Epithelium 40 HYPERSENSITIVITY 32 32 2,5 41 RHINITIS 7 7 2,5 on September 28, 2021 by guest. Protected copyright. 42 NASAL POLYPS 4 4 1,8 43 PSORIASIS 39 36 1,7 44 Tumor 45 NEOPLASM INVASIVENESS 22 21 4,3 46 CARCINOMA (TRANSITIONAL CELL) 13 13 2,2 47 NEOPLASMS (SQUAMOUS CELL) 7 7 1,9 48 UTERINE CERVICAL NEOPLASMS 21 21 1,8 49 MELANOMA 23 22 1,7 50 51 (a) MeshTerm (MeSH) is the vocabulary of the National Library of Medicine used for indexing articles for 52 MEDLINE/PubMed. MeSH terminology provides a consistent way to retrieve information. 53 (b) number of genes regulated / specific markers of a disease given. 54 (c) number of genes regulated similarly in CoQ deficiency. 55 10 56 (d) Here are listed the 32th MeshTerm with Z score higher than 1.5 57 58 59 60 53 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 82 of 84
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 C P PQ 7 Unaffected genes by CoQ10 (U) 8 UP UP UP 9 CoQ10 maintain up-regulated at higher levels 10 P 11 C ForPQ peer reviewOpposite only regulation (O) 12 UP UP DOWN 13 CoQ10 activates the repressed genes in CoQ10 deficiency 14 15 P C PQ Regulated only after CoQ treatment (S) 16 UP UP - 10 http://bmjopen.bmj.com/ 17 Genes specifically activated by CoQ10 supplementation 18 19 20 UP DOWN UP --- NOT POSSIBLE --- 21 22 23 P PQ C 24 Partial restored genes by CoQ10 (pR)
UP DOWN DOWN on September 28, 2021 by guest. Protected copyright. 25 CoQ activates the repressed without reach control level 26 10 27 28 29 UP DOWN - --- NOT POSSIBLE --- 30 31 32 33 UP - UP --- NOT POSSIBLE --- 34 35 36 P PQ C CoQ restores completely (R) 37 UP - DOWN 10 38 CoQ10 activates the repressed to reach control level 39 40 P C PQ 41 UP - - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 42 43 44 Fernández-Ayala et al. – Figure S1a 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 83 of 84 BMJ Open
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 PQ P 7 C Partial restored genes by CoQ10 (pR) 8 DOWN UP UP CoQ represses the activated without reach control 9 10 10 level 11 For peer review only 12 13 DOWN UP DOWN --- NOT POSSIBLE --- 14 15 16 17 DOWN UP - --- NOT POSSIBLE --- http://bmjopen.bmj.com/ 18 19 PQ C P 20 Opposite regulation (O) 21 DOWN DOWN UP 22 CoQ10 represses the activated genes more than control 23 PQ P C 24
Unaffected genes on September 28, 2021 by guest. Protected copyright. by CoQ (U) 25 DOWN DOWN DOWN 10 26 CoQ maintain down-regulated at higher levels 27 10 28 PQ P C 29 Regulated only after CoQ10 treatment (S) 30 DOWN DOWN - 31 Genes specifically repressed by CoQ10 supplementation 32 PQ C P 33 CoQ10 restores completely (R) 34 DOWN - UP 35 CoQ10 represses the activated to reach control level 36 37 38 DOWN - DOWN --- NOT POSSIBLE --- 39 40 41 PQ C P 42 DOWN - - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 43 44 Fernández-Ayala et al. – Figure S1b 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 84 of 84
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 C PQ P 7 Unaffected genes by CoQ10 (U) 8 - UP UP 9 CoQ10 maintain up-regulated 10 11 For peer review only 12 - UP DOWN --- NOT POSSIBLE --- 13 14 15 C P PQ 16 --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) ---
- UP - http://bmjopen.bmj.com/ 17 18 19 20 - DOWN UP --- NOT POSSIBLE --- 21 22 23 PQ P C 24 Unaffected genes by CoQ10 (U)
- DOWN DOWN on September 28, 2021 by guest. Protected copyright. 25 CoQ maintain down-regulated 26 10 27 28 PQ P C 29 - DOWN - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 30 31 32 C PQ P 33 - - UP --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 34 35 36 P PQ C 37 - - DOWN --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 38 39 40 41 --- NOT SELECTED FOR EXPRESSION ANALYSIS --- 42 - - - 43 44 Fernández-Ayala et al. – Figure S1c 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 85 of 84 BMJ Open
VEGFA CDC42SE2 BDNF 1 POSTN mitogens 2 LY6K GRP 3 G ALNAC4S-6ST NTNG1 4 T RI M14 PT N 5 SEMA5A TNFSF4 6 TNFRSF10D MAGED1 7 ARL4C G ABBR2 P2RY5 MAGED4 8 AEBP1 T XNI P T SPAN10 I F I T M1 9 CSRP2 CNGA3 10 SG K1 BHLHB5 MID1 SMARCA1 CNG2 11 For peer review only SG K1 HERC6 12 MLPH SMARCA4 RHOU 13 MAPKKK NCK2 14 JNK cell RAC2 15 CDK3 CDKN1A division F O XQ 1 16 CDKN1C
http://bmjopen.bmj.com/ + + HO XC9 17 activates CHURC1 AI M1 represses 18 HO XA11 effectors CREG 1 APC(DD1) effectors 19 RUNX1 LHX9 20 SP110 21 ANTI-APOPTOSIS APOPTOSIS 22 F O XP1 SF RP1 ARL4C T RI M55 PCSK2 INF 23 FDFT1 KRT 34 USP53 LMCD1 IFI6 C7orf 55 24 CYP1B1 IDI1 T PM1
XAF 1 on September 28, 2021 by guest. Protected copyright. 25 MG C87042 PYG L O ASs CH25H 26 CPE T MEM49 Q PRT MXs RSAD2 27 PAPPA IFIs RAD23B PARP14 I SNI G 1 28 BRP44 PSMB9 29 LDLR C10orf 58 BT N3A2/ 3 30 SLC40a1 VCAN SQ LE 31 AT P8B1 G BP1 EPST I 1 EF EMP1 SCD 32 I SG 15 T SHZ 1
33 34 Fe PSG 6 EDN1 35 DCN MAT N2 36 PKP4 37 MCAM 38 MKX 39 40 41 42 g en e acti vati o n i n Co Q10 d efi ci en cy gene repression in CoQ10 d efi ci en cy 43 44 Fernández-Ayala et al. – Figure S2 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Survival transcriptome in coenzyme Q10 deficiency syndrome is acquired by epigenetic modifications: a modelling study for human coenzyme Q10 deficiencies.
For peer review only Journal: BMJ Open
Manuscript ID: bmjopen-2012-002524.R1
Article Type: Research
Date Submitted by the Author: 28-Jan-2013
Complete List of Authors: Fernández-Ayala, Daniel; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Guerra, Ignacio; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Jiménez-Gancedo, Sandra; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Cascajo, Maria; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Gavilán, Ángela; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III,
DiMauro, Salvatore; Columbia University Medical Center, Department of http://bmjopen.bmj.com/ Neurology Hirano, Michio; Columbia University Medical Center, Department of Neurology Briones, Paz; Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, ; CIBERER, Instituto de Salud Carlos III, Artuch, Rafael; Hospital Sant Joan de Déu, Department of Clinical Biochemistry; CIBERER, Instituto de Salud Carlos III, deCabo, Rafael; National Institute on Aging, NIH, Laboratory of Experimental Gerontology Salviati, Leonardo; University of Padova, Clinical Genetics Unit, Department on September 28, 2021 by guest. Protected copyright. of Woman and Child Health Navas, Placido; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III,
Primary Subject Genetics and genomics Heading:
Secondary Subject Heading: Genetics and genomics, Diagnostics
Keywords: Neuromuscular disease < NEUROLOGY, BASIC SCIENCES, GENETICS
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 1 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 2 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 3 4 modifications: a modelling study for human coenzyme Q10 deficiencies. 5 6 7 8 Daniel J. M. Fernández Ayala1,5, Ignacio Guerra1,5, Sandra Jiménez Gancedo1,5, Maria V. Cascajo1,5, 9 10 1,5 2 2 3,5 4,5 11 Angela Gavilán , Salvatore DiMauro , Michio Hirano , Paz Briones , Rafael Artuch , Rafael de 12 6 7,8 1,5,8 13 Cabo , Leonardo Salviati and Plácido Navas 14 15 For peer review only 16 17 1Centro Andaluz de Biología del Desarrollo (CABD CSIC), Universidad Pablo Olavide, Seville, Spain 18 19 2 20 Department of Neurology, Columbia University Medical Center, New York, NY, USA
21 3 22 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 23 24 4Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain 25 26 5CIBERER, Instituto de Salud Carlos III, Spain 27 28 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 21224, 29 30 31 USA 32 7 33 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy http://bmjopen.bmj.com/ 34 35 8 Senior authorship is shared by LS and PN 36 37 38 39 40 Corresponding authors 41 42 Plácido Navas and Leonardo Salviati on September 28, 2021 by guest. Protected copyright. 43 44 Tel (+34)954349381 and (+39) 3471207364 45 46 e mail: [email protected] and [email protected] 47 48 49 50 51 52 53 Word count (abstract): 285 54 Word count (summary) 295 55 Word count (introduction, methods, results and discussion): 2947 56 Tables and Illustrations: 4 57 References: 34 58 59 60 1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 3 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ABSTRACT 3 4 5 6 Objectives 7 Coenzyme Q10 (CoQ10) deficiency syndrome is a rare condition that causes a mitochondrial 8 dysfunction and includes a variety of clinical presentations, as encephalomyopathy, ataxia and renal 9 10 failure. First, we sought to set up what all have in common, and then investigate why CoQ10 11 supplementation reverses the bioenergetics alterations in cultured cells but not all the cellular 12 phenotypes. 13 14 Design: modelling study 15 This work modelsFor the transcriptome peer of human review CoQ10 deficiency syndromeonly in primary fibroblast from 16 patients and study the genetic response to CoQ10 treatment in these cells. 17 18 Setting 19 20 Four hospitals and medical centres from Spain, Italy and USA, and two research laboratories from 21 Spain and USA. 22 23 Participants 24 Primary cells were collected from patients in the above centres. 25 26 Measurements 27 We characterized by microarray analysis the expression profile of fibroblasts from seven CoQ10 28 deficient patients (three had primary deficiency, four had a secondary form) and aged matched 29 30 controls, before and after CoQ10 supplementation. Results were validated by Q RT PCR. The profile 31 of DNA (CpG) methylation was evaluated for a subset of gene with displayed altered expression. 32 33 Results http://bmjopen.bmj.com/ 34 CoQ10 deficient fibroblasts (independently from the etiology) showed a common transcriptomic profile 35 that promotes cell survival by activating cell cycle and growth, cell stress responses, and inhibiting cell 36 death and immune responses. Energy production was supported mainly by glycolysis while CoQ10 37 supplementation restored oxidative phosphorylation. Expression of genes involved in cell death 38 pathways was partially restored by treatment, while genes involved in differentiation, cell cycle and 39 40 growth were not affected. Stably demethylated genes were unaffected by treatment whereas we 41 observed restored gene expression in either non methylated genes or those with an unchanged 42 methylation patterns. on September 28, 2021 by guest. Protected copyright. 43 44 Conclusions 45 CoQ10 deficiency induces a specific transcriptomic profile that promotes cell survival, which is only 46 partially rescued by CoQ10 supplementation. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 4 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 SUMMARY 3 4 5 Article Focus 6 • To analyse the common gene expression profile in primary cell cultures of dermal fibroblasts 7 from patients suffering any of the clinical presentation of the human syndrome of coenzyme 8 Q (CoQ ) deficiency (primary or secondary CoQ deficiency). 9 10 10 10
10 • To determine why CoQ10 treatment, the current therapy for all forms of CoQ10 deficiency, 11 restored respiration but not all the clinical phenotypes. 12 • To investigate the stable genetic cause responsible for the survival adaptation to mitochondrial 13 dysfunction due to CoQ10 deficiency. 14 15 For peer review only 16 Key Messages 17 18 • The mitochondrial dysfunction due to CoQ10 deficiency induces a stable survival adaptation of 19 somatic cells in patients at early or postnatal development by epigenetic modifications of 20 chromatin. Deficient cells unable to maintain this survival state during differentiation would 21 death contributing to the pathological phenotype. 22 • Supplementation with CoQ10 restores respiration through enhanced sugar rather than lipid 23 metabolism; partially restores stress response, immunity, cell death and apoptotic pathways; 24 and does not affect cell cycle, cell growth, and differentiation and development pathways. 25 26 • Survival transcriptome in the CoQ10 deficiency syndrome is acquired by epigenetic 27 modifications of DNA: DNA demethylated genes corresponded to unaffected genes by CoQ10 28 treatment, whereas those with unchanged DNA methylation pattern corresponded to genes with 29 responsive expression to CoQ10 supplementation. These results would approach to explain the 30 incomplete recovery of clinical symptoms after CoQ10 treatment, at least in some patients. 31 32 33 Strengths and Limitations http://bmjopen.bmj.com/ 34 • Human CoQ deficiencies are considered rare diseases with low prevalence, which limits the 35 10 36 sample size. 37 • The genetic heterogeneity of this disease is due to mutations in any of the 11 genes directly 38 involved in the synthesis of CoQ10 inside mitochondria, or other mutations altering somehow 39 the mitochondria and its metabolism, affecting their inner CoQ10 synthesis as a side effect, will 40 course with CoQ10 deficiency. 41
• Among this genetic heterogeneity, all cells showed a common transcriptomic profile that on September 28, 2021 by guest. Protected copyright. 42 justified their pathological phenotype, responded equally to CoQ treatment, and presented the 43 10 44 same DNA methylation pattern. 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 5 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 KEY WORDS 3 4 Coenzyme Q, CoQ10 deficiency, transcriptome, epigenetic, human fibroblast 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 4 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 6 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 INTRODUCTION 3 4 Coenzyme Q10 (CoQ10) is a small electron carrier which is an essential cofactor for several 5 6 mitochondrial biochemical pathways such as oxidative phosphorylation (OXPHOS), beta oxidation, 7 8 and pyrimidine nucleotide biosynthesis. CoQ biosynthesis depends on a multi enzyme complex1 that 9 10 10 11 involves at least ten proteins encoded by COQ genes. Mutations in any of these genes cause primary 12 2 13 CoQ10 deficiencies, which are clinically heterogeneous mitochondrial diseases . Clinical presentations 14 15 include encephalomyopathyFor peerwith lipid storage review myopathy and myoglobinuria only3; ataxia and cerebellar 16 17 atrophy4; severe infantile encephalomyopathy with renal failure5; isolated myopathy6; and nephrotic 18 19 7 8 20 syndrome . Secondary CoQ10 deficiency has also been associated with diverse mitochondrial diseases
21 13 14 15 22 . In all of these conditions, CoQ10 supplementation partially improves symptoms and usually 23 8 16 17 24 induces a return to normal growth and respiration in CoQ10 deficient fibroblasts . Adaptation of 25 26 somatic cells to CoQ10 deficiecny may affect both onset and course of the disease. Here, we document 27 28 common transcriptomic profile alterations in somatic cells of CoQ deficienct patients, their response to 29 30 31 CoQ10 supplementation, and the relationship with the DNA methylation status of specific genes. 32 33 http://bmjopen.bmj.com/ 34 35 36 37 MATERIALS AND METHODS 38 39 40 41 42 Cells on September 28, 2021 by guest. Protected copyright. 43 44 Primary skin fibroblasts from CoQ10 deficient patients and from aged matched controls, at similar 45 46 culture passage, were cultured at 37°C using DMEM 1 g/L Glucose, L Glutamine, Pyruvate 47 48 (Invitrogen, Prat de Llobregat, Barcelona) supplemented with an antibiotic/antimycotic solution 49 50 51 (Sigma Chemical Co., St. Louis, Missouri) and 20% fetal bovine serum (FBS, Linus). When required, 52 53 CoQ10 pre diluted in FBS was added to the plates at a final concentration of 30 M (Coenzyme Q10, 54 55 Synthetic Minimun 98%, HPLC, Sigma). We studied five patients with primary CoQ10 deficiency: two 56 57 siblings harbored a homozygous p.Y297C mutation in the COQ2 gene5, two others with a pathogenic 58 59 60 5 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 7 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 mutation (c.483G>C) in the COQ4 gene (this paper), and another one with haploinsufficiency of 3 18 4 COQ4 . Patients with secondary CoQ10 deficiency included: a MELAS patient harboring the 5 6 m.3243A>G in the mitochondrial tRNALeu(UUR) with 43% heteroplasmy level8; a patient with mtDNA 7 8 12 4 9 depletion syndrome , and a third patient with ataxia of unknown origin . Table 1 summarizes the 10 11 clinical phenotype and biochemical studies of these patients. 12 13 14 15 TranscriptomeFor analysis peer review only 16 17 RNA extraction, probe synthesis and hybridization with two independent expression arrays 18 19 20 (GeneChip® Human Genome U133 Plus 2.0 and GeneChip® Human Gene 1.0 ST, Affymetrix) were 21 19 22 used as described . Gene expression was validated by the MyiQ™ Single Color Real Time PCR 23 24 Detection System (Biorad). See supplementary methods for full description. 25 26 Data had been deposited with the NCBI GEO database, at http://www.ncbi.nlm.nih.gov/geo/, 27 28 29 accession number GSE33941 (this SuperSeries is composed of two subset Series, see supplementary 30 31 table 7 for an explanation). 32 33 Statistical analyses were performed comparing each signal of patient’s fibroblasts RNA with the http://bmjopen.bmj.com/ 34 35 corresponding signal of control RNA by two different approaches. The main statistical analysis for 36 37 both GeneChip® Human Genome U133 Plus 2.0 Array and GeneChip® Human Gene 1.0 ST Array was 38 39 19 40 achieved as previously described , which selects the most significant genes commonly and equally 41 42 regulated in all samples using very stringent parameters. In a few special cases, other unselected but on September 28, 2021 by guest. Protected copyright. 43 44 regulated genes were studied because of their role in specific processes and pathways. They were 45 46 equally described in table 2. The second statistical analysis approach for the Gene Ontology study was 47 48 20 49 done as previously described and analyzes the most altered biological processes and pathways using 50 51 a lower stringency analysis, which permits to select the hundred most altered Gene Ontologies (GO) in 52 53 different functional categories (supplementary table 4) and the hundred more distorted pathways 54 55 (supplementary table 5) that had been regulated in CoQ10 deficient cells. GO regulated in both 56 57 independent analysis of primary and secondary CoQ deficiency (supplementary table 3), and those 58 10 59 60 6 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 8 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 regulated by CoQ10 supplementation (supplementary table 9) were studied using the GORILLA 3 4 software (Gene Ontology enrichment analysis and visualization tool), at http://cbl 5 6 gorilla.cs.technion.ac.il/21. Full description of statistical analysis be found in the supplementary 7 8 material. 9 10 11 12 13 Epigenetic analysis 14 15 DNA (CpG) methylationFor analysis peer was perform review using a base specific only cleavage reaction with bisulphite 16 17 combined with mass spectrometric analysis (MassCLEAVE™). For the statistical analysis, the CpGs’ 18 19 20 methylation degree for each gene was analyzed with the MultiExperiment Viewer software developed
21 22 22 by Saeed . See supplementary methods for full description. 23 24 25 26 27 28 RESULTS 29 30 31 32 33 Transcriptome analysis http://bmjopen.bmj.com/ 34 35 We studied skin fibroblasts from four patients with primary CoQ10 deficiency and three patients with 36 37 secondary CoQ10 deficiency (Table1). We analyzed the transcriptomic profiles and compared them 38 39 40 with those of cells from age matched control idividuals, and evaluated and modifications induced by 41
8 16 17 on September 28, 2021 by guest. Protected copyright. 42 supplementation with 30 µM CoQ10 for one week to allow recovery of ATP levels . A very 43 44 stringent analysis selected the most significant genes displaying a common and equally altered 45 46 expression in all samples (summarized in Table 2 and shown with full details in supplementary table 47 48 49 1). Other genes unselected by this analysis, but still abnormally expressed were also included in the 50 51 study because of their role in specific processes and pathways, such as NADH mobilization, cell cycle 52 53 and immunity (supplementary table 1), and energetic metabolism (supplementary table 2). Gene 54 55 ontology (GO) classification of these genes showed similar profiles when comparing independently 56 57 primary and secondary deficient fibroblasts (supplementary table 3). A lower stringency analysis 58 59 60 7 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 9 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 showing the most altered biological processes and pathways selected the one hundred most altered GO 3 4 in different functional categories (supplementary table 4 online) and the one hundred more distorted 5
6 pathways (supplementary table 5 online) in CoQ10 deficient cells. See supplementary data for 7 8 description of statistical analyses. 9 10 11 CoQ10 treatment modified the specific transcriptomic profile displayed by CoQ10 deficient fibroblasts 12 13 (supplementary tables 6 and 7 online). We classified genes into 5 groups according to the consequence 14 15 of CoQ10 treatmentFor on gene expressionpeer (supplementary review table 8 online only and supplementary figure 1 for a 16 17 graphical view). About 54% of probes with altered expression were unaffected by CoQ10 18 19 20 supplementation. 36% of probes showed partial or complete normalization of expression and 2% 21 22 showed inverse regulation. Approximately 5% of probes were specifically altered after treatment in 23 24 both deficient and non deficient cells and 3% showed small or non specific changes (these were not 25 26 considered for further analysis). After statistical analysis, we obtained 70 altered GO with a significant 27 28 P value (<0.001) and an enrichment value that represents the most altered GO within each group 29 30 31 (supplementary table 9). 32 33 Data have been deposited with the NCBI GEO database, at http://www.ncbi.nlm.nih.gov/geo/, http://bmjopen.bmj.com/ 34 35 accession number GSE33941 (see supplementary table 10 for an explanation). The functional 36 37 description of each gene was updated from the GeneCard of The Human Gene Compendium 38 39 40 (Weizmann Institute of Science), http://www.genecards.org/. See supplementary data for a full 41 42 description of genes, biological process and pathways regulated in CoQ10 deficiency. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 CoQ10-deficient fibroblasts readapt the energetic metabolism and CoQ10-treatment restores 47 48 In CoQ deficient fibroblasts, mitochondrial functions, including respiratory chain and tricarboxylic 49 10 50 51 acid (TCA) cycle, were repressed, whereas 9 of 10 steps in glycolysis and pyruvate metabolism were 52 53 activated, including lactate and pyruvate dehydrogenases (supplementary tables 2 and 4). Accordingly, 54 55 genes involved in the negative regulation of glycolysis were down regulated, whereas those involved 56 57 in its activation were up regulated (supplementary table 2). Furthermore, genes involved in cytosolic 58 59 60 8 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 10 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 NADH oxidation (cytochrome b5 and several oxidoreductases) were slightly repressed (Table 2). The 3 4 expression of genes involved in cholesterol and fatty acid metabolism was down regulated (Table 2), 5 6 as well all the GO related with lipid metabolism (supplementary table 5). 7 8 CoQ supplementation normalized the expression (either partially or completely) of genes involved in 9 10 10 11 the glycolytic pathway and activated the expression of repressed respiratory chain genes, whereas the 12 13 TCA cycle remained unaffected (supplementary table 2). Most of the repressed enzymes of lipid 14 15 metabolism andFor fatty acid ß oxidationpeer remained review down regulated (tableonly 2), whereas several other 16 17 pathways, such as monocarboxylic acid transport and the insulin response, were normalized 18 19 20 (supplementary table 9). These results are in agreement with the recovery of aerobic metabolism
21 8 16 17 22 observed in CoQ10 deficient fibroblasts after CoQ10 supplementation . 23 24 25 26 CoQ10 deficiency induces specific adaptations of cells to promote survival 27 28 The major novel finding of transcriptome profiling in CoQ deficient fibroblasts was the altered 29 10 30 31 expression of genes concerned with cell cycle and development and with resistance to stress and cell 32 33 death (table 2). This suggests both a remodeling of differentiation and growth maintenance and an http://bmjopen.bmj.com/ 34 35 increase of cell survival mechanisms. Specifically, genes involved in cell cycle activation and 36 37 maintenance were up regulated, and genes involved in cell cycle regulation increased or decreased 38 39 40 their expression depending of their activating or repressing roles. This proliferative response was also 41 42 enhanced by the repression of cellular attachment factors and by the activation of extracellular matrix on September 28, 2021 by guest. Protected copyright. 43 44 proteins that reduce cell attachment and favor cell division. In parallel, GO clusters favoring cell cycle 45 46 and cell division were activated, and those inhibiting cell growth were repressed (supplementary table 47 48 4). The differentiation of these cells was compromised because many required factors, transducers, 49 50 51 antigens, and structural proteins appeared down regulated, whereas repressors of differentiation during 52 53 development were overexpressed (table 2). See supplementary material for a full description of genes, 54 55 biological processes and related pathways. 56 57 58 59 60 9 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 11 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Cell cycle activation was supported by the up regulation of CDK6 (Table 2), a cyclin dependent 3 4 kinase that induces entry into the S phase, and by a robust repression (more than 9 fold) of 5 6 p21/CDKN1A, an inhibitor of cyclin dependent kinase that blocks cell cycle at the G1/S check point to 7 8 stimulate cell differentiation. Moreover, subsequent pathways inactivated by p2123 were enhanced in 9 10 11 CoQ10 deficient cells (supplementary table 5), as well as both transcription factors E2F7 and E2F8 12 24 13 (table 2), which push the progression of the cell cycle, activate cell survival and inhibit apoptosis . 14 15 Cell survival in ForCoQ10 deficient peer cells was improvedreview by the induction only of DNA repairing mechanisms, 16 17 and by the establishment of pathways that regulate Jun kinases and activate NAD(P)H CoQ 18 19 20 oxidoreductase, which are involved in stress responses (Tables 2 and S4). Components of apoptosis 21 22 and cell death pathways were systematically repressed (Table 2), including tumor suppressor genes, 23 24 antigens, intracellular mediators, and effectors of cell death. Also, cell surface receptors and 25 26 modulators that inhibit apoptosis were greatly activated. 27 28 Interestingly, CoQ treatment did not alter the newly acquired resistance to cell death in CoQ 29 10 10 30 31 deficient fibroblasts, kept cell growth activated, and allowed a higher degree of differentiation (Tables 32 33 2 and S8). However, genes controlling stress resistance pathways and cortical cytoskeleton were http://bmjopen.bmj.com/ 34 35 completely restored, as indicated by the shifts in gene expression listed in Table 2. However, treated 36 37 fibroblasts kept the DNA repair mechanism activated. 38 39 40 Signaling related genes and pathways were differentially affected by CoQ10 deficiency, but most of 41 42 immunity related genes showed a general down regulation (Table 2). Pathways and biological on September 28, 2021 by guest. Protected copyright. 43 44 processes involved in immunity regulation were restored by CoQ10 supplementation (Tables 2 and S5). 45 46 47 48 A stable DNA methylation profile is responsible for the specific gene expression profile in CoQ 49 10 50 51 deficiency 52 53 CoQ10 supplementation modified the expression of 43% of genes that were abnormally expressed in 54 55 CoQ10 deficient fibroblasts (supplementary table 8). In the majority of these cases, expression levels 56 57 were restored to those of control fibroblasts (20%), but few showed inverse regulation (2%) and others 58 59 60 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 12 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 were specifically altered after CoQ10 treatment in both deficient and non deficient cells (5%). The 3 4 remaining 16% corresponded to partially restored genes, which slightly alter their expression level 5
6 without changing the CoQ10 deficient pattern. These genes along with the unaffected (54%) constitute 7 8 72% of regulated genes in CoQ deficiency, which were not significantly altered after CoQ 9 10 10 10 11 supplementation. 12 13 To explain this differential response to respiratory dysfunction, we analyzed the DNA methylation 14 15 profile of 20 amongFor the most peer altered genes listedreview in table 2. These onlygenes encompass the main 16 17 biological processes and pathways affected by CoQ10 deficiency (table 3). Up regulated genes, which 18 19 20 were unaffected by CoQ10 supplementation, had less defined DNA methylation sites in their promoter 21 22 regions. 23 24 Genes with partial restoration of their expression after CoQ10 supplementation showed precise 25 26 methylation and demethylation profiles that may explain their altered expression during CoQ10 27 28 deficiency. The methylation degree of these genes changed after treatment, and may be responsible for 29 30 31 the modulation of expression (Table 3). The patterns of methylation of activated and repressed genes 32 33 in CoQ10 deficiency that could be normalized by CoQ10 supplementation, were either unaffected or http://bmjopen.bmj.com/ 34 35 only slightly affected by the treatment, and we did not detect new methylation sites after CoQ10 36 37 supplementation. 38 39 40 However, a few genes showed significant differences in the methylation degree after the treatment, 41 42 which correspond to the partially restored genes that maintain the specific expression pattern of on September 28, 2021 by guest. Protected copyright. 43 44 untreated CoQ10 deficient cells at a lower level. 45 46 Finally, reviewing the biological processes and molecular functions of regulated genes in CoQ10 47 48 deficiency, the main adaptation for cell survival activated genes by DNA demethylation, which 49 50 51 increased the expression of genes involved in cell cycle activation, apoptosis inhibition, and cell stress 52 53 resistance, meanwhile the undifferenciated state could be due to gene repression by DNA methylation, 54 55 which decreased the expression of genes involved in cell differentiation. CoQ10 treatment did not alter 56 57 the methylation degree of these genes and subsequently the expression level was maintained. 58 59 60 11 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 13 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 DISCUSSION 5 6 7 8 CoQ -deficient fibroblasts readapt the energetic metabolism and CoQ -treatment restores 9 10 10 10 1 11 CoQ10 is an essential component of the mitochondrial respiratory chain , therefore dysfunctional 12 3 7 8 13 13 mitochondria are a common finging in both primary CoQ10 deficiencies and secondary forms . 14 15 Although each formFor presents peer a specific clinical review phenotype, all these only conditions display a substantial 16 17 reduction of cellular CoQ10 content and deficit in the mitochondrial enzymatic activities of respiratory 18 19 20 chain (table 1). Accordingly to these results, we have shown here that fibroblasts from patients with 21 22 CoQ10 deficiency have reorganized their genetic resources to cope with this mitochondrial dysfunction. 23 24 Consistent with the role of CoQ10 in bioenergetics, the lack of CoQ10 would force the cell to support it 25 26 mainly by glycolysis, whereas both mitochondrial lipid metabolism and respiratory chain were 27 28 repressed (supplementary tables 2 and 4). These findings, together with the mild repression of 29 30 31 cytosolic enzymes that oxidize NADH (cytochrome b5 and its oxidoreductases listed in table 2) could 32 33 indicate that NADH is mainly used for biosynthetic purposes rather than for energy production. http://bmjopen.bmj.com/ 34 35 Supplementation with CoQ10, the current therapy for all forms of CoQ10 deficiency, restored 36 37 respiration through enhanced sugar utilization, but did not stimulate lipid metabolism. The expression 38 39 40 of genes involved in the glycolytic pathway was partially or completely normalized after CoQ10 41 42 treatment, whereas the repressed genes involved in the respiratory chain were activated. The TCA on September 28, 2021 by guest. Protected copyright. 43 44 cycle remained unaffected (supplementary table 2). These results are in agreement with the recovery of 45 46 8 16 17 aerobic metabolism observed in CoQ10 deficient fibroblasts after CoQ10 supplementation . 47 48 49 50 51 CoQ10 deficiency induces a stable survival adaptation of cells 52 53 CoQ10 deficienct fibroblasts adapted several physiological processes to acquire a cellular resistance 54 55 state for survival under the conditons of mitochondrial dysfunction induced by CoQ10 deficiency. The 56 57 new genetic pattern increases cell survival by activating cell cycle and growth, maintaining an 58 59 60 12 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 14 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 undifferentiated phenotype, up regulating stress induced proteins, and inhibiting apoptosis and cell 3 4 death pathways. These results recapitulate a survival network that can be observed in nutritional stress 5 6 such as when cells are grown in galactose enriched media25. 7 8 The survival adaptation shown by CoQ deficient cells included a global resistance mechanism that is 9 10 10 11 observed also during the initial phase of tumorigenesis. In fact, the CoQ10 deficient expression profile 12 26 27 13 was very similar to that described during myeloid cells transformation and breast tumors . 14 15 Moreover, someFor of the regulated peer genes in CoQreview10 deficiency (listed only in table 2 as underlined bold letter) 16 17 are used as biomarkers in several types of cancer28, like KRT34, the cell cycle related POSTN, 18 19 20 MCAM, EFEMP1 and VCAN, and the apoptotic and cell resistance related CYP1B1, XAF1 and 21 22 TNFRSF10D. Although these biomarkers behaved in CoQ10 deficiency (increased or decreased) as 23 24 described by Yoo and collaborators28, there is no sign of tumor formation reported in the patients so 25 26 far. In addition, cellular senescence, a defining feature of pre malignant tumors29, is characterized by a 27 28 gene expression pattern similar to that of CoQ deficient fibroblasts (supplementary table 5). 29 10 30 31 Supplementation with CoQ10 enhanced both stress response and immunity pathways. Although the 32 33 pathway of cell death was partially restored, cell cycle and growth, and the mechanisms to prevent http://bmjopen.bmj.com/ 34 35 differentiation and development were not. These results indicate that the mitochondrial dysfunction 36 37 due to CoQ10 deficiency induces a stable survival adaptation of somatic cells in patients at early or 38 39 40 postnatal development, and we speculate that cells unable to institute, or to maintain, this survival 41 42 mechanism during differentiation will die, contributing to the pathological phenotype. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 A stable DNA methylation profile is responsible of specific gene expression in CoQ10 deficiency 47 48 The cellular adaptation to CoQ deficiency enhanced DNA demethylation of genes that regulate cell 49 10 50 51 cycle activation, apoptosis inhibition, and cell stress resistance as part of an adaptation survival 52 53 mechanism. Comparable results were observed in several models of epigenetic regulation by 54 55 demethylation (Table S5), whereas DNA methylation inhibits activation of genes related to 56 57 tumorogenesis and apoptosis 30. 58 59 60 13 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 15 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Pathways unaffected by CoQ10 treatment corresponded to stably demethylated genes, whereas those 3 4 that responded to CoQ10 supplementation were controlled by genes with unchanged methylation 5 6 patterns. 7 8 We did not find changes in the methylation degree of all genes affected by CoQ deficiency, 9 10 10 11 suggesting that other modalities of gene regulation are responsible, including epigenetic mechanisms 12 13 such as histone modifications by methylation and acetylation, or even DNA methylation in CpG 14 15 islands other thanFor those studied peer here. Interestingly, review it has been reported only that CoQ10 regulates lipid 16 17 metabolism in mice liver without effect on the DNA methylation profile31, indicating that 18 19 20 supplemented CoQ10 by itself may not alter the DNA methylation pattern that cells acquired during the 21 22 survival adaptation to CoQ10 deficiency. 23 24 Mechanisms unaffected by therapy corresponded to stably DNA demethylated genes, which were 25 26 responsible for the acquisition of the undifferentiated state for survival and resistance that cells obtain 27 28 during the adaptation to CoQ deficiency, whereas the responsive to CoQ supplementation were 29 10 10 30 31 controlled by genes with unchanged methylation patterns and correspond mainly to metabolic genes 32 33 and those related with the restoration of mitochondrial function. http://bmjopen.bmj.com/ 34 35 We propose that these epigenetic changes may be established as early as during the fetal life32 in order 36 37 to cope with CoQ10 deficiency; these cells then maintain this adaptive response throughout their life. 38 39 40 We speculate that cells unable to maintain this survival mechanism during differentiation would die 41 42 contributing to the pathological phenotype. on September 28, 2021 by guest. Protected copyright. 43 44 Our model has some limits: we treated cells only for one week and in principle we cannot rule out that 45 46 prolonged exposure to CoQ10 could restore also some of the other unaffected pathways. Alternatively, 47 48 incomplete recovery of the gene expression profiles could be explained by the fact that exogenous 49 50 51 CoQ10 can rescues the bioenergetic defect, but not all other functions of CoQ10 in these cells, as it has 52 33 53 been observed in other organisms . 54 55 56 57 58 59 60 14 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 16 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ACKNOWLEDGEMENTS 3 4 We appreciate the generous cooperation of the families. 5 6 7 8 FUNDING STATEMENT 9 10 11 This work was supported by the following funders: Spanish Ministerio de Sanidad (FIS) grant numbers 12 13 PI11/00078 and PI11/02350; National Institutes of Health (NIH, USA) grant number 1R01HD057543; 14 15 Junta de AndalucíaFor (Spanish peer Regional Government) review grant number onlyCTS 3988; Telethon (Italy) grant 16 17 number GGP09207; and from a grant from Fondazione CARIPARO. 18 19 20 21 22 AUTHOR CONTRIBUTION STATEMENT 23 24 DJMFA and PN designed the experiments and drafted the manuscript; DJMFA, IG, SJG, MVC and 25 26 AG performed the experiments and made the statistical analyses; PB, RA and LS provided cells and 27 28 patient’s clinical information; DJMFA, PB, RA, PN, SDM, MH, RC and LS analyzed the data and 29 30 31 edited the manuscript. 32 33 http://bmjopen.bmj.com/ 34 35 COMPETING INTERESTS STATEMENT 36 37 There is no competing interest. 38 39 40 41 42 DATA SHARING STATEMENT on September 28, 2021 by guest. Protected copyright. 43 44 There are not additional data available. 45 46 47 48 Dryad Package Identifier 49 50 51 doi:10.5061/dryad.gr2gp 52 53 54 55 56 57 58 59 60 15 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 17 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 REFERENCES 3 4 1. Bentinger M, Tekle M, Dallner G. Coenzyme Q biosynthesis and functions. Biochem Biophys Res 5 Commun 2010;396(1):74 9. 6 7 2. Trevisson E, Dimauro S, Navas P, et al. Coenzyme Q deficiency in muscle. Curr Opin Neurol 8 2011;24(5):449 56. 9 10 3. Sobreira C, Hirano M, Shanske S, et al. Mitochondrial encephalomyopathy with coenzyme Q10 11 deficiency. Neurology 1997;48(5):1238 43. 12 13 14 4. Artuch R, Brea Calvo G, Briones P, et al. Cerebellar ataxia with coenzyme Q10 deficiency: 15 diagnosis Forand follow up peer after coenzyme review Q10 supplementation. only J Neurol Sci 2006;246(1 2):153 16 8. 17 18 5. Salviati L, Sacconi S, Murer L, et al. Infantile encephalomyopathy and nephropathy with CoQ10 19 deficiency: a CoQ10 responsive condition. Neurology 2005;65(4):606 8. 20 21 6. Horvath R, Schneiderat P, Schoser BG, et al. Coenzyme Q10 deficiency and isolated myopathy. 22 Neurology 2006;66(2):253 5. 23 24 7. Heeringa SF, Chernin G, Chaki M, et al. COQ6 mutations in human patients produce nephrotic 25 syndrome with sensorineural deafness. J Clin Invest 2011;121(5):2013 24. 26 27 8. Cotan D, Cordero MD, Garrido Maraver J, et al. Secondary coenzyme Q10 deficiency triggers 28 29 mitochondria degradation by mitophagy in MELAS fibroblasts. Faseb J 2011;25(8):2669 87. 30 31 9. Gempel K, Topaloglu H, Talim B, et al. The myopathic form of coenzyme Q10 deficiency is caused 32 by mutations in the electron transferring flavoprotein dehydrogenase (ETFDH) gene. Brain 33 2007;130(Pt 8):2037 44. http://bmjopen.bmj.com/ 34 35 10. Haas D, Niklowitz P, Horster F, et al. Coenzyme Q(10) is decreased in fibroblasts of patients with 36 methylmalonic aciduria but not in mevalonic aciduria. J Inherit Metab Dis 2009;32(4):570 5. 37 38 11. Miles MV, Putnam PE, Miles L, et al. Acquired coenzyme Q10 deficiency in children with 39 recurrent food intolerance and allergies. Mitochondrion 2011;11(1):127 35. 40 41
12. Montero R, Sánchez Alcázar JA, Briones P, et al. Analysis of Coenzyme Q10 in muscle and on September 28, 2021 by guest. Protected copyright. 42 fibroblasts for the diagnosis of CoQ10 deficiency syndromes. Clinical Biochemistry 43 44 2008;41(9):697 700. 45 46 13. Quinzii CM, Kattah AG, Naini A, et al. Coenzyme Q deficiency and cerebellar ataxia associated 47 with an aprataxin mutation. Neurology 2005;64(3):539 41. 48 49 14. Montini G, Malaventura C, Salviati L. Early coenzyme Q10 supplementation in primary coenzyme 50 Q10 deficiency. N Engl J Med 2008;358(26):2849 50. 51 52 15. Pineda M, Montero R, Aracil A, et al. Coenzyme Q(10) responsive ataxia: 2 year treatment 53 follow up. Mov Disord 2010;25(9):1262 8. 54 55 16. Lopez LC, Quinzii CM, Area E, et al. Treatment of CoQ(10) deficient fibroblasts with ubiquinone, 56 CoQ analogs, and vitamin C: time and compound dependent effects. PLoS One 57 2010;5(7):e11897. 58 59 60 16 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 18 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 17. Lopez Martin JM, Salviati L, Trevisson E, et al. Missense mutation of the COQ2 gene causes 3 defects of bioenergetics and de novo pyrimidine synthesis, 2007:1091 97. 4 5 18. Salviati L, Trevisson E, Rodriguez Hernandez MA, et al. Haploinsufficiency of COQ4 causes 6 coenzyme Q10 deficiency. J Med Genet 2012;49(3):187 91. 7 8 19. Fernández Ayala D, Chen S, Kemppainen E, et al. Gene Expression in a Drosophila Model of 9 Mitochondrial Disease. PLoS ONE 2010;5(1):e8549. 10 11 20. Baur JA, Pearson KJ, Price NL, et al. Resveratrol improves health and survival of mice on a high 12 calorie diet. Nature 2006;444(7117):337 42. 13 14 21. Eden E, Navon R, Steinfeld I, et al. GOrilla: a tool for discovery and visualization of enriched GO 15 For peer review only 16 terms in ranked gene lists. BMC Bioinformatics 2009;10(1):48. 17 18 22. Saeed AI, Bhagabati NK, Braisted JC, et al. TM4 microarray software suite. Methods in 19 enzymology 2006;411:134 93. 20 21 23. Gartel AL, Radhakrishnan SK. Lost in transcription: p21 repression, mechanisms, and 22 consequences. Cancer Res 2005;65(10):3980 5. 23 24 24. Li J, Ran C, Li E, et al. Synergistic Function of E2F7 and E2F8 Is Essential for Cell Survival and 25 Embryonic Development. Developmental Cell 2008;14(1):62 75. 26 27 25. Quinzii CM, Hirano M. Coenzyme Q and mitochondrial disease. Dev Disabil Res Rev 28 2010;16(2):183 8. 29 30 26. Zhan F, Huang Y, Colla S, et al. The molecular classification of multiple myeloma. Blood 31 32 2006;108(6):2020 8. 33 http://bmjopen.bmj.com/ 34 27. van 't Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome 35 of breast cancer. Nature 2002;415(6871):530 36. 36 37 28. Yoo SM, Choi JH, Lee SY, et al. Applications of DNA microarray in disease diagnostics. J 38 Microbiol Biotechnol 2009;19(7):635 46. 39 40 29. Collado M, Gil J, Efeyan A, et al. Tumour biology: senescence in premalignant tumours. Nature 41 2005;436(7051):642. 42 on September 28, 2021 by guest. Protected copyright. 43 30. Fan H, Zhao Z, Quan Y, et al. DNA methyltransferase 1 knockdown induces silenced CDH1 gene 44 reexpression by demethylation of methylated CpG in hepatocellular carcinoma cell line SMMC 45 7721. Eur J Gastroenterol Hepatol 2007;19(11):952 61. 46 47 48 31. Schmelzer C, Kitano M, Hosoe K, et al. Ubiquinol affects the expression of genes involved in 49 PPARalpha signalling and lipid metabolism without changes in methylation of CpG promoter 50 islands in the liver of mice. Journal of clinical biochemistry and nutrition 2012;50(2):119 26. 51 52 32. Smith ZD, Chan MM, Mikkelsen TS, et al. A unique regulatory phase of DNA methylation in the 53 early mammalian embryo. Nature 2012;484(7394):339 44. 54 55 33. Gomez F, Saiki R, Chin R, et al. Restoring de novo coenzyme Q biosynthesis in Caenorhabditis 56 elegans coq 3 mutants yields profound rescue compared to exogenous coenzyme Q 57 supplementation. Gene 2012;506(1):106 16. 58 59 60 17 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 19 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 34. Montero R, Sanchez Alcazar JA, Briones P, et al. Coenzyme Q10 deficiency associated with a 3 mitochondrial DNA depletion syndrome: a case report. Clin Biochem 2009;42(7 8):742 5. 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 18 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 20 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 FIGURE LEGEND 4 5 6 Figure 1. Cluster of genes differentially expressed in CoQ10 deficiency and after CoQ10 7 8 supplementation. Four arrays of 2 representative fibroblasts from patients with Q deficiency were 9 10 11 plotted with 2 arrays of control fibroblasts and 9 arrays of 5 patient’s fibroblasts with CoQ10 deficiency 12 13 treated with 30 M CoQ10. Activated genes were colored in red and repressed ones in green. Between 14 15 parentheses, groupFor classification peer of genes afterreview CoQ10 supplementation only (Table S3). 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 19 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
#5 #5 #3 #3 #4 #1 #2 #2 #GIO #ELO #HDF #control #ELO+Q #MEL+Q Array and epigenetic code
8 5 4 18 34 17 17 12 , case 4 , 4 case , case 3 , 3 case 12 12 Reference as cited in cited the as text
RC.
10
Reference values Effect of CoQ Improvementin muscle Improvement of 41% andtone strength. Heto andbegan speak Recovery Recovery of mt complex II+III (cells). Recovery of cell growth. Recovery Recovery of ATP Improvement of neurological assessment. done. supplementation Improvement of 25% complex II+III (cells). Recovery of cell growth. Improvement of neurologic not but the renal dysfunction. Recovery of cell growth. Improvement of 35% complex II+III (cells). production. ROS No production No biochemicalNo studies deficiency. 10
20
BMJ Open
http://bmjopen.bmj.com/ in fibroblast in in muscle in in fibroblast in in muscle in
biosynthesis rate fibroblastin in fibroblastin biosynthesis rate musclein fibroblastin biosynthesis rate in fibroblastin biosynthesis rate 10 10 10 10 10 10 10 10 10 10 10 10 10 Biochemical studies Biochemical to (% mean referencerespect values) Reference values 29% CoQ 29% 23% CoQ 23% 40% CoQ 40% 20% CoQ 20% CoQ 44% 58% CoQ 58% mt RC complex 32% (muscle) I+III mt RC complex 19% II+III (muscle) CoQ 15% 35% mt RC complex 35% (cells)I mt RC complex 41% II+III (cells) mt RC complex 12% (cells) IV mt Ψ 60% mitochondrial 70% mass ROS (>2 fold)production autophagosomedefective elimination 17% CoQ 17% 31% mt RC complex 31% (muscle) I+III mt RC complex 46% II+III (muscle) CoQ 22% 64% mt RC complex 64% (cells) I+III 85% mt RC complex 85% II+III (cells) 15% CoQ 15% mt RC complex 60% II+III (cells) 19% mt RC complex 19% (muscle) I+III mt RC complex 32% II+III (muscle) CoQ 17% CoQ 10% mt RC complex 57% II+III (cells) 24% CoQ 24% ROS (3 fold)production on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency deficiency deficiency deficiency deficiency 10 10 10 deficiency deficiency 10 For peer review10 only corticosteroid resistant nephropaty COQ2 mutationgene (c.890A>G) corticosteroid resistant nephropaty COQ2 mutationgene (c.890A>G) Healthy volunteersHealthy Dysmorphic Dysmorphic features, ventricular septal ventricular defect, weakness, and hypotonia hyporeactivity. mtDNA depletion mtDNA syndrome encephalopathy neonatal CoQ secondary MELAS (A3243G MELAS mutation) CoQ secondary ataxia and cerebellarataxia atrophy CoQ secondary primary CoQ primary progressive encephalomyopathy progressive CoQ primary phenotype Clinical
a d d girl ol old boyold
year day 3 year old 3 year old boy 10 Boy 9 month old girl brother (her above) 33 month old 33 month old boy sister bellow)(his 12 Human Human dermal skin fibroblast Patient / Patient Cells
Table Table 1 Q with Coenzyme patients in done biochemical studies and phenotype Clinical Page 21 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 22 of 110 #epi #epi #epi #epi #SIL+Q #SOF+Q
, 1 case 12 this this paper
Recovery Recovery of both complex complex activity I+III and growth fibroblastsof Improvement ATP of synthesis , Synthetic Synthetic , Minimun Sigma).98%, HPLC, 10
21
BMJ Open http://bmjopen.bmj.com/ in fibroblast in
in fibroblastin 10 10 18% CoQ 18% 58% mt RC complex 58% II+III (cells) walk. 38% CoQ 38% on September 28, 2021 by guest. Protected copyright. For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency 10 deficiency. deficiency 10 10 For peer review only
COQ4 gene COQ4 mutation gene (c.483G>C) rabdomyolisis Ataxia CoQ secondary Moderate retardation.mentalModerate COQ4 deletion.gene CoQ Primary primary CoQ primary pre diluted in in pre diluted FBS to added was platesthe ata final concentration M of 30 (Coenzyme Q 10
CoQ cultured at cultured DMEM 37°C Glucose,using 1 g/L L Glutamine, (Invitrogen)Pyruvate antibiotic/antimycotic plus solution (Sigma) fetal and 20% bovine serum (Linus). Girl Girl a b
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(f) 10
fold 3 – CoQ
(e)
1,3 4,8 –5 fold 8,0 –2 fold 4,3 +2 fold Q-RT-PCR Q-RT-PCR
(d)
10
R R R R O O O U U O U pR pR pR CoQ
(c) nc nc nc nc nc nc 1,6 4,3 3,2 1,6 1,6 1,5 1,4) (1,4) ( FC FC
(b) 5,3 5,3 (1,5) R 2,9 2,9 nc 7,6 7,6 2,9 R 2,5 2,5 1,7 R 2,0 2,0 2,3 U 3,6 3,4 2,4 5,4 6,8 2,5 3,3 1,4) 1,3) 1,3) 1,4) 2,1 nc U 3,0 1,8 pR 2,3 1,5 U 2,5 1,6 R 2,6 1,7 O 2,1 nc
73,8 153,9 U 238,2 –20% 10,0 2,5 pR 66,1 75,5 10,8 19,5 1,6 pR ( 1,4) 1,9 U ( 1,3) nc U ( ( ( ( FC FC 22 BMJ Open http://bmjopen.bmj.com/
desaturase) 9 on September 28, 2021 by guest. Protected copyright. isin/kexin type isin/kexin type 2
deficiency deficiency 10
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
A hydroxylase idase
For peer review only adenosyl methioninecontaining domain 2
CoA (deltadesaturase
low density lipoprotein low density receptor carboxypeptidase Ecarboxypeptidase chromosome chromosome reading 10 open frame 58 Gene Title Gene semaphorin 5A,semaphorin receptor for cell growth protein AE binding 1 quinolinate phosphoribosyltransferasequinolinate classtype I, ATPase, 8B, member 1 scinderin cholesterol 25cholesterol S radical epoxsqualene stearoyl cytochrome cytochrome b5 reductase 3 cytochrome b5 reductase 4 cytochrome cytochrome b561 cytochrome b5 chromosome chromosome reading frame7 open 55 cytochrome cytochrome b5 reductase 2 cytochrome cytochrome b5 reductase 1 isopentenyl diphosphatedelta isomerase 1 cysteine and glycine richcysteine protein 2 farnesyl diphosphate farnesyltransferasefarnesyl diphosphate 1 insulin inducedinsulin 1 gene periostin, periostin, specific osteoblast factor proprotein convertase proprotein subtil vascular vascular endothelial growth factor A brain protein brain 44 phosphorylase, phosphorylase, glycogen;liver pregnancy associated plasma pappalysin protein A,
(a)
SEMA5A AEBP1 QPRT ATP8B1 PCSK2 SCIN CH25H RSAD2 SQLE SCD CYB5R3 CYB5R4 CYB561 CYB5A C7orf55 Gene Symbol POSTN CYB5R2
CSRP2
PYGL cycleCell CPE Other metabolism PAPPA LDLR FDFT1 INSIG1 metabolismInsulin IDI1 CYB5R1 Lipid metabolism C10orf58 BRP44 Mitochondrial metabolism 2 Table Differentially genesCoenzyme in expressed Q SLC40A1 carrier solute family transporter)40 (iron regulated NADH NADH mobilization
VEGFA Page 23 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 24 of 110
60% – +10%
5,7 4,6
- R R R R U U U U U U pR pR pR pR
nc nc nc nc nc nc nc nc nc 2,4 7,6 2,1 1,3 2,7 1,6 1,6 1,6 1,3) (1,3) (
0 2,6 2,6 nc 3,5 3,5 nc 3,9 3,9 4,4 U 2,0 2,0 (1,4) U 6,5 4,3 2,5 4,4 2,8 5,3 2,9 2,8 2, 6,5 3,0 1,9 3,0 9,2 9,2) 2,6) 1,3) 6,7 3,0 R 10,9 +10% 5,2 ( 1,4) R 2,7 nc R 3,8 3,7 O 1,8 1,7 8,3 1,8 4,8 U 2,0 U 4,5 ( 1,5) 6,1 ( 1,4)
(1,4) 2,9 U (1,9) 2,7 U (2,2) nc U (2,6) 1,4 O (3,6) 93,0 1,5 10,1 U nc ( 1,8) ( 1,4) 1,5 nc R R ( ( 263,6 ( 23 BMJ Open
http://bmjopen.bmj.com/
on September 28, 2021 by guest. Protected copyright. protein protein coupled, 5
stimulated genes For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only
releasing releasing peptide
derived neurotrophic derived factor related transcription factor (aml1 oncogene) 1 forkhead Q1forkhead box A11 homeobox nuclearbody proteinSP110 zinc fingerteashirt homeobox 1 34keratin (alpha)tropomyosin 1 E2F transcriptionE2F factor 7 gastrin G1netrin C9homeobox homeobox LIM 9 10tetraspanin stromalEpithelial interaction 1 versican component of SWI/SNF chromatincomlplex, memberA1 component of SWI/SNF chromatincomlplex, memberA4 Cyclin dependent kinase 6, in overexpressed tumor ( 1,9) inhibitor of CDK, overexpressed cancer in cells antigensurface nc cell retinoblastoma protein pR transcriptionE2F factor 8 follistatin decorin fibulin likeEGF containing extracellular matrix 1protein 13,2 2,2 pR docking protein docking 5 E1A 1 repressor of runt 1 endothelin 2 matrilin adhesion cell melanoma molecule interferon interferon induced transmembrane (9 27) protein 1 midline 1 (Opitz/BBB 1 midline syndrome) mohawk mohawk homeobox purinergic receptor P2Y,purinergic G p21, inhibitor p21, CDK of inhibitor p57, CDK of brain (neurite pleiotrophin growth promotingfactor 1) plakophilin plakophilin 4 pregnancy specific pregnancy beta 1 glycoprotein 6
FOXQ1 HOXA11 SP110 P2RY5 TSHZ1 CDKN1A CDKN1C E2F7 BDNF GRP KRT34 SMARCA1 DCN VCAN DOK5 CREG1 RUNX1 EDN1 MATN2 MCAM EFEMP1 TPM1 NTNG1 HOXC9 TSPAN10 SMARCA4 CDKN3 E2F8
PKP4 MID1 BHLHB5 helix loop helix basic containing,domain class 5 B, IFITM1 CHURC1 containing churchill domain 1 RB1 EPSTI1 PTN LHX9 CD31 FST MKX PSG6 CDK6 Development and and Developmentdifferentiation
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
fold 2 –
7,0 –5 fold 11,8 15,1 +20%
R R R R O O U U U pR pR
nc nc nc nc nc nc nc 2,5 2,3 2,5 1,6 1,6 1,5) 1,3) (1,4) (1,5) ( (
2,0 2,0 4,9 4,5 4,5 (1,5) 2,4 2,4 2,6 U 4,2 4,2 1,7 3,8 3,8 nc U 2,2 2,2 nc R 5,9 9,8 3,3 4,2 1,7 3,1 8,7 3,8 1,7 4,9 1,9 3,4 3,6 2,3 4,5 nc 5,0 1,6 U 4,7 (1,4) 2,3 ( 1,3) U 6,4 1,8 O 8,3 nc O 2,8 nc 7,4 8,5 ( 1,4) 1,9 R R 3,0 ( 1,5) R 4,5 ( 1,4) O 2,0 ( 1,3) R
13,8 2,0 U 17,3 11,7 12,2 67,3 nc 15,0 1,9 R 24 BMJ Open http://bmjopen.bmj.com/
1
on September 28, 2021 by guest. Protected copyright.
in like like 4C
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml inducible protein 27 inducible protein 6 related protein 1
containing 55containing ribose) ribose) polymerase member family, 14 induced induced protein 44 For peer review onlytor protein 2 ribosylation factor ribosylation protein, 2 gamma terferon B cell RAG B associated prote necrosis tumor factor superfamily, member 4 alphainterferon, in G small effector CDC42 2 antigen lymphocyte complex, 6 locus K tripartite motif containing14 interferon induced protein 44 like secreted frizzled secreted ADP specific ubiquitin peptidase53 acidgamma aminobutyric (GABA)receptor, B 2 nucleotide channelcyclic gated alpha 3 domain RLD hect and 6 melanophilin tumor necrosis tumor factor receptor superfamily 10D melanoma antigen melanoma family D, 1 tripartite motif alphainterferon, XIAP associated factor 1 similar to Sixepithelialto similar antigen prostate of transmembrane protein 49 /// microRNA 2 serum/glucocorticoid regulated 1 kinase suppressor of cytokine signaling 3 melanomain absent 1 polyposisadenomatosis coli down regulated 1 antigen melanoma family D, 4/ 4B bindingsmall GTP protein (rho Rac2family) cytochrome P450, cytochrome family 1B, polypeptide 1 RAD23 (S.homolog cerevisiae)B interacting thioredoxin protein gene ras homolog member family,U forkhead P1forkhead box LIM and cysteine richLIM 1domains NCK adap NCK (ADP poly (A2/A3)butyrophilin3
6ST
GALNAC4S TNFSF4 IFI27 IFI44 GNG2 PARP14 SFRP1 ARL4C MAGED1 TRIM55 IFI6 MGC87042 TMEM49 SGK1 SOCS3 FOXP1 XAF1 CYP1B1 TNFRSF10D NCK2
CDC42SE2 TRIM14 IFI44L USP53 HERC6 Immunity Signaling
AIM1 / MAGED4 4B RAD23B RHOU
LMCD1 BTN3(A2/A3) LY6K CNGA3 RAC2 GABBR2 MLPH
APCDD1 Apoptosis TXNIP Cell resistance to resistance Cell to stress Page 25 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
10 Page 26 of 110
supplementation (S). supplementation Genes non affected by CoQ 10
R R R pR treatment (U); thetreatment that restored genes either expression partial (pR) 10
nc nc 1,8 1,6 1,3) ( . See the text text for See. the information.more 28
5,3 6,4 7,4 6,2 3,6 2,7 1,8 nc U 6,1 3,0 pR
( 3,1) 2,6 R ( 5,1) 4,9 R 25 BMJ Open http://bmjopen.bmj.com/
deficiency: deficiency: unaffected by CoQ genes 10
deficiency (O);and specificalydeficiency regulated after genes only CoQ 10 on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml like like modifier
induced induced protein (tetratricopeptide repeats 1) For peer review only oligoadenylate oligoadenylate synthetase 69/71kDa 2, oligoadenylate synthetase 100kDa 3, 5' 5' supplementation on on expressionsupplementation gene in CoQ 10 interferon ubiquitin ISG15 myxovirus resistance 1 2' 2' interferon induced interferon induced protein (tetratricopeptide repeats 3) binding guanylate protein interferon inducible1, myxovirus resistance 2 3,5 2',5' oligoadenylate synthetase 40/46kDa1, 1,7 2' 5' oligoadenylate synthetase like R proteasome subunit, proteasome beta type,9 supplementation on levelssupplementationmRNA on analyzed by Q RT PCR. Positive values, increase expression;gene on negative values, decrease on expression.gene 10
IFIT1 ISG15 MX1 OAS2 OAS3 Full change (FC)thein comparative Full analysis with GeneChip®Affymetrix ran Human PlusU133 Genome 2.0 Array. represent the Values (mean) for FC each correspodinggene to coenzyme CoQ of Effect In letter,In bold usedbiomarkers several types in cancer as of described Yoo collaboratorsby and change in Full comparativethe analysis with ran Affymetrix Gene Chip®Human Gene ST Array.1.0 In parenthesis, FC non significant of genes by statistical the threshold used. change in Full expression gene analyzed by (Q RT PCR).quantitative PCR real time See supplementary material forand S11 table primer sequence. Effect CoQ of specific specific and processes pathways (see textthe full for details).casethe In of different probes selected for one gene, thevalues represent for mean of (see each FC probe supplementary fortable full 1 details). diferent sample's diferent analysis;(SAM patient R=1.5; FDR=0%). parenthesis, In of FC non significant the by statistical genes threshold which used,were selected becausetheir inrole a b c d e f IFIT3 MX2 OASL Genes with change Genes (nc).no or completely (R);or with genes regulation in opposite than CoQ PSMB9 GBP1 OAS1 supplementation ( ).supplementation textthe and See supplementary tablefull for details. 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(g) BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
+2 fold Q-effect
(f)
(P) e togethere (P) clos deficiency 10 CpGs' location
(e) (P).
10 28% / 35% 28% treatment (U); treatment thatrestored genes the 10 (C/P) degree methylations inmethylations CoQ
deficiency (O). deficiency (d)
10
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 (50%) 6 7 (2 fold) 7 / 37% 27% scattered groups 3 (3 fold) 3 / 19% 5% dispersed 8 (4 fold) 8 / 20% 5% together close (P) –3 fold CpGs
(f)
(I) (I) scattered groups supplementation than insupplementation CoQ deficiency 10 deficient Non significantfibroblasts. deficient in changesmethylation ( ). 10
10 CpGs' location 26
(e) BMJ Open
deficiency. Positivedeficiency. an increase methylationthevalues, in degree; negative values, demethylations. http://bmjopen.bmj.com/ 10 53% 53% / 35%
(C/P) degree demethylations in CoQ demethylations in (d)
deficient deficient fibroblast. Significance determined t test by In (p<0.01). parenthesis, fold change in methylation degree
fold) 10 0 0 0 0 0 0 deficiency (more information deficiency in S8):Table unaffected CoQgenes by 10 20 (220 supplemented and supplemented untreated CoQ 10 on September 28, 2021 by guest. Protected copyright. supplementation CoQ in supplementation
10 CpGs (c)
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 32 (P)32 (P,E,I) 73 CpGs (b)
For peer review only
O O
Q-effect 4,2 pR (P,E,I) 63 (90%) 5 52% / 28% scattered groups (60%) 9 / 28% 16% scattered groups +7% (a) 4,7 R (P) 24 2,8 U (P,E,I) 58 5 (2 fold) / 12% 7% scattered groups (90%) 3 / 17% 9% dispersed (I) 2,3 U (I) 85 (2 fold) 11 57% / 32% scattered groups (3 fold) 2 / 19% 7% together close deficiency (SAManalysis; deficiency R=1.5; ran with FDR=0%) Affymetrix GeneChip® Human GenomePlusU133 2.0 Array.details table in Full 2.
5,9 R (P,E) 34 0 3,0 U (P) 25 8,5 R 8 (P) 2,5 R (P,E,I) 84 8 (2 fold) / 12% 6% together close (E) (3 fold) 1 / 13% 4% 3,1 U (P) 29 7,7 R (P,E,I) 74 0 3,0 R (P,E,I) 25 0 11,6 pR (P,I) 26 3 (4 fold) / 20% 6% dispersed 94,3 66,1 R (P,E,I) 80 (25%) 8 76% / 61% scattered groups (3 fold) 8 / 27% 10% dispered widely 73,8 U 5 (P) (16 fold) 2 / 50% 3% together close (P) 0 10 263,6
supplementation expression supplementation gene in CoQon 10
Effect of CoQ of Effect methylated CpGs Significant controleach in gene andfor CoQ Significant in changes CpG methylation to due CoQ Full change in Full CoQ Number of islands CpGanalyzed. In parenthesis, locationgene islands:GpC of promoter (P);(E); first first intron exon (I). Methylation degree (mean CpG). of significant Values represent the % of CpG's methylation of both (C) control and deficient inpatient CoQ Location of Location of significant CpGs. parenthesis, In location:gene (P);promoter(E); firstfirst(I). intron exon PCSK2 GRP MLPH MCAM EPSTI1 XAF1 XAF1 PYGL CHURC1 3,5 R (P,E,I) 20 (50%) 1 / 11% 7% CYP1B1 AEBP1 HOXA11 4,3 pR (P) 17 ARL4C CPE CPE PARP14 END1 FOXP1 TNFRSF10D 2,4 U (P,E,I) 59 (2 fold) 27 60% / 25% scattered (P)groups 0 VCAN VCAN GABBR2 13,8 U 101 (P,I) (40%) 5 47% / 37% together close (P) (6 fold) 14 / 22% 10% together close (P) –15% POSTN Gene symbolGene FC
a b c d e f g Table 3 Table Epigenetic inmodifications deficiencyCoQ10 to dueDNA (CpG) / demethylationmethylation (small changes,%).(small in Non significant changes in ( ).methylation expression eitherpartialexpression (pR) completely (R); or regulationand genes with opposite afterCoQ Significance determinedSignificance t test(p<0.01)by CoQ between Page 27 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open Page 28 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 3 4 modifications: a modelling study for human coenzyme Q10 deficiencies. 5 6 7 8 Daniel J. M. Fernández-Ayala1,5, Ignacio Guerra1,5, Sandra Jiménez-Gancedo1,5, Maria V. Cascajo1,5, 9 10 1,5 2 2 3,5 4,5 11 Angela Gavilán , Salvatore DiMauro , Michio Hirano , Paz Briones , Rafael Artuch , Rafael de 12 6 7,8 1,5,8 13 Cabo , Leonardo Salviati and Plácido Navas 14 15 For peer review only 16 17 1Centro Andaluz de Biología del Desarrollo (CABD-CSIC), Universidad Pablo Olavide, Seville, Spain 18 19 2 20 Department of Neurology, Columbia University Medical Center, New York, NY, USA
21 3 22 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 23 24 4Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain 25 26 5CIBERER, Instituto de Salud Carlos III, Spain 27 28 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 21224, 29 30 31 USA 32 7 33 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy http://bmjopen.bmj.com/ 34 35 8 Senior authorship is shared by LS and PN 36 37 38 39 40 Corresponding authors 41 42 Plácido Navas and Leonardo Salviati on September 28, 2021 by guest. Protected copyright. 43 44 Tel (+34)954349381 and (+39) 3471207364 45 46 e-mail: [email protected] and [email protected] 47 48 49 50 51 52 53 Word count (abstract): 285 54 Word count (summary) 295 55 Word count (introduction, methods, results and discussion): 2947 56 Tables and Illustrations: 4 57 References: 34 58 59 60 1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 29 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ABSTRACT 3 4 5 6 Objectives 7 Coenzyme Q10 (CoQ10) deficiency syndrome is a rare condition that causes a mitochondrial 8 dysfunction and includes a variety of clinical presentations, as encephalomyopathy, ataxia and renal 9 10 failure. First, we sought to set up what all have in common, and then investigate why CoQ10 11 supplementation reverses the bioenergetics alterations in cultured cells but not all the cellular 12 phenotypes. 13 14 Design: modelling study 15 This work modelsFor the transcriptome peer of human review CoQ10 deficiency syndromeonly in primary fibroblast from 16 patients and study the genetic response to CoQ10 treatment in these cells. 17 18 Setting 19 20 Four hospitals and medical centres from Spain, Italy and USA, and two research laboratories from 21 Spain and USA. 22 23 Participants 24 Primary cells were collected from patients in the above centres. 25 26 Measurements 27 We characterized by microarray analysis the expression profile of fibroblasts from seven CoQ10- 28 deficient patients (three had primary deficiency, four had a secondary form) and aged-matched 29 30 controls, before and after CoQ10 supplementation. Results were validated by Q-RT-PCR. The profile 31 of DNA (CpG) methylation was evaluated for a subset of gene with displayed altered expression. 32 33 Results http://bmjopen.bmj.com/ 34 CoQ10 deficient fibroblasts (independently from the etiology) showed a common transcriptomic profile 35 that promotes cell survival by activating cell cycle and growth, cell stress responses, and inhibiting cell 36 death and immune responses. Energy production was supported mainly by glycolysis while CoQ10 37 supplementation restored oxidative phosphorylation. Expression of genes involved in cell death 38 pathways was partially restored by treatment, while genes involved in differentiation, cell cycle and 39 40 growth were not affected. Stably demethylated genes were unaffected by treatment whereas we 41 observed restored gene expression in either non-methylated genes or those with an unchanged 42 methylation patterns. on September 28, 2021 by guest. Protected copyright. 43 44 Conclusions 45 CoQ10 deficiency induces a specific transcriptomic profile that promotes cell survival, which is only 46 partially rescued by CoQ10 supplementation. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 30 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 SUMMARY 3 4 5 Article Focus 6 • To analyse the common gene expression profile in primary cell cultures of dermal fibroblasts 7 from patients suffering any of the clinical presentation of the human syndrome of coenzyme 8 Q (CoQ ) deficiency (primary or secondary CoQ deficiency). 9 10 10 10
10 • To determine why CoQ10 treatment, the current therapy for all forms of CoQ10 deficiency, 11 restored respiration but not all the clinical phenotypes. 12 • To investigate the stable genetic cause responsible for the survival adaptation to mitochondrial 13 dysfunction due to CoQ10 deficiency. 14 15 For peer review only 16 Key Messages 17 18 • The mitochondrial dysfunction due to CoQ10 deficiency induces a stable survival adaptation of 19 somatic cells in patients at early or postnatal development by epigenetic modifications of 20 chromatin. Deficient cells unable to maintain this survival state during differentiation would 21 death contributing to the pathological phenotype. 22 • Supplementation with CoQ10 restores respiration through enhanced sugar rather than lipid 23 metabolism; partially restores stress response, immunity, cell death and apoptotic pathways; 24 and does not affect cell cycle, cell growth, and differentiation and development pathways. 25 26 • Survival transcriptome in the CoQ10 deficiency syndrome is acquired by epigenetic 27 modifications of DNA: DNA-demethylated genes corresponded to unaffected genes by CoQ10 28 treatment, whereas those with unchanged DNA-methylation pattern corresponded to genes with 29 responsive expression to CoQ10 supplementation. These results would approach to explain the 30 incomplete recovery of clinical symptoms after CoQ10 treatment, at least in some patients. 31 32 33 Strengths and Limitations http://bmjopen.bmj.com/ 34 • Human CoQ deficiencies are considered rare diseases with low prevalence, which limits the 35 10 36 sample size. 37 • The genetic heterogeneity of this disease is due to mutations in any of the 11 genes directly 38 involved in the synthesis of CoQ10 inside mitochondria, or other mutations altering somehow 39 the mitochondria and its metabolism, affecting their inner CoQ10 synthesis as a side effect, will 40 course with CoQ10 deficiency. 41
• Among this genetic heterogeneity, all cells showed a common transcriptomic profile that on September 28, 2021 by guest. Protected copyright. 42 justified their pathological phenotype, responded equally to CoQ treatment, and presented the 43 10 44 same DNA methylation pattern. 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 31 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 KEY WORDS 3 4 Coenzyme Q, CoQ10-deficiency, transcriptome, epigenetic, human fibroblast 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 4 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 32 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 INTRODUCTION 3 4 Coenzyme Q10 (CoQ10) is a small electron carrier which is an essential cofactor for several 5 6 mitochondrial biochemical pathways such as oxidative phosphorylation (OXPHOS), beta-oxidation, 7 8 and pyrimidine nucleotide biosynthesis. CoQ biosynthesis depends on a multi-enzyme complex1 that 9 10 10 11 involves at least ten proteins encoded by COQ genes. Mutations in any of these genes cause primary 12 2 13 CoQ10 deficiencies, which are clinically heterogeneous mitochondrial diseases . Clinical presentations 14 15 include encephalomyopathyFor peerwith lipid storage review myopathy and myoglobinuria only3; ataxia and cerebellar 16 17 atrophy4; severe infantile encephalomyopathy with renal failure5; isolated myopathy6; and nephrotic 18 19 7 8- 20 syndrome . Secondary CoQ10 deficiency has also been associated with diverse mitochondrial diseases
21 13 14 15 22 . In all of these conditions, CoQ10 supplementation partially improves symptoms and usually 23 8 16 17 24 induces a return to normal growth and respiration in CoQ10-deficient fibroblasts . Adaptation of 25 26 somatic cells to CoQ10 deficiecny may affect both onset and course of the disease. Here, we document 27 28 common transcriptomic profile alterations in somatic cells of CoQ-deficienct patients, their response to 29 30 31 CoQ10 supplementation, and the relationship with the DNA methylation status of specific genes. 32 33 http://bmjopen.bmj.com/ 34 35 36 37 MATERIALS AND METHODS 38 39 40 41 42 Cells on September 28, 2021 by guest. Protected copyright. 43 44 Primary skin fibroblasts from CoQ10-deficient patients and from aged-matched controls, at similar 45 46 culture passage, were cultured at 37°C using DMEM 1 g/L Glucose, L-Glutamine, Pyruvate 47 48 (Invitrogen, Prat de Llobregat, Barcelona) supplemented with an antibiotic/antimycotic solution 49 50 51 (Sigma Chemical Co., St. Louis, Missouri) and 20% fetal bovine serum (FBS, Linus). When required, 52 53 CoQ10 pre-diluted in FBS was added to the plates at a final concentration of 30 µM (Coenzyme Q10, 54 55 Synthetic Minimun 98%, HPLC, Sigma). We studied five patients with primary CoQ10 deficiency: two 56 57 siblings harbored a homozygous p.Y297C mutation in the COQ2 gene5, two others with a pathogenic 58 59 60 5 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 33 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 mutation (c.483G>C) in the COQ4 gene (this paper), and another one with haploinsufficiency of 3 18 4 COQ4 . Patients with secondary CoQ10 deficiency included: a MELAS patient harboring the 5 6 m.3243A>G in the mitochondrial tRNALeu(UUR) with 43% heteroplasmy level8; a patient with mtDNA 7 8 12 4 9 depletion syndrome , and a third patient with ataxia of unknown origin . Table 1 summarizes the 10 11 clinical phenotype and biochemical studies of these patients. 12 13 14 15 TranscriptomeFor analysis peer review only 16 17 RNA extraction, probe synthesis and hybridization with two independent expression arrays 18 19 20 (GeneChip® Human Genome U133 Plus 2.0 and GeneChip® Human Gene 1.0 ST, Affymetrix) were 21 19 22 used as described . Gene expression was validated by the MyiQ™ Single Color Real Time PCR 23 24 Detection System (Biorad). See supplementary methods for full description. 25 26 Data had been deposited with the NCBI-GEO database, at http://www.ncbi.nlm.nih.gov/geo/, 27 28 29 accession number GSE33941 (this SuperSeries is composed of two subset Series, see supplementary 30 31 table 7 for an explanation). 32 33 Statistical analyses were performed comparing each signal of patient’s fibroblasts RNA with the http://bmjopen.bmj.com/ 34 35 corresponding signal of control RNA by two different approaches. The main statistical analysis for 36 37 both GeneChip® Human Genome U133 Plus 2.0 Array and GeneChip® Human Gene 1.0 ST Array was 38 39 19 40 achieved as previously described , which selects the most significant genes commonly and equally 41 42 regulated in all samples using very stringent parameters. In a few special cases, other unselected but on September 28, 2021 by guest. Protected copyright. 43 44 regulated genes were studied because of their role in specific processes and pathways. They were 45 46 equally described in table 2. The second statistical analysis approach for the Gene Ontology study was 47 48 20 49 done as previously described and analyzes the most altered biological processes and pathways using 50 51 a lower stringency analysis, which permits to select the hundred most altered Gene Ontologies (GO) in 52 53 different functional categories (supplementary table 4) and the hundred more distorted pathways 54 55 (supplementary table 5) that had been regulated in CoQ10 deficient cells. GO regulated in both 56 57 independent analysis of primary and secondary CoQ deficiency (supplementary table 3), and those 58 10 59 60 6 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 34 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 regulated by CoQ10 supplementation (supplementary table 9) were studied using the GORILLA 3 4 software (Gene Ontology enrichment analysis and visualization tool), at http://cbl- 5 6 gorilla.cs.technion.ac.il/21. Full description of statistical analysis be found in the supplementary 7 8 material. 9 10 11 12 13 Epigenetic analysis 14 15 DNA (CpG) methylationFor analysis peer was perform review using a base-specific only cleavage reaction with bisulphite 16 17 combined with mass spectrometric analysis (MassCLEAVE™). For the statistical analysis, the CpGs’ 18 19 20 methylation degree for each gene was analyzed with the MultiExperiment Viewer software developed
21 22 22 by Saeed . See supplementary methods for full description. 23 24 25 26 27 28 RESULTS 29 30 31 32 33 Transcriptome analysis http://bmjopen.bmj.com/ 34 35 We studied skin fibroblasts from four patients with primary CoQ10 deficiency and three patients with 36 37 secondary CoQ10 deficiency (Table1). We analyzed the transcriptomic profiles and compared them 38 39 40 with those of cells from age-matched control idividuals, and evaluated and modifications induced by 41
8 16 17 on September 28, 2021 by guest. Protected copyright. 42 supplementation with 30 µM CoQ10 for one week to allow recovery of ATP levels . A very 43 44 stringent analysis selected the most significant genes displaying a common and equally altered 45 46 expression in all samples (summarized in Table 2 and shown with full details in supplementary table 47 48 49 1). Other genes unselected by this analysis, but still abnormally expressed were also included in the 50 51 study because of their role in specific processes and pathways, such as NADH mobilization, cell cycle 52 53 and immunity (supplementary table 1), and energetic metabolism (supplementary table 2). Gene 54 55 ontology (GO) classification of these genes showed similar profiles when comparing independently 56 57 primary and secondary deficient fibroblasts (supplementary table 3). A lower stringency analysis 58 59 60 7 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 35 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 showing the most altered biological processes and pathways selected the one hundred most altered GO 3 4 in different functional categories (supplementary table 4 online) and the one hundred more distorted 5
6 pathways (supplementary table 5 online) in CoQ10 deficient cells. See supplementary data for 7 8 description of statistical analyses. 9 10 11 CoQ10 treatment modified the specific transcriptomic profile displayed by CoQ10-deficient fibroblasts 12 13 (supplementary tables 6 and 7 online). We classified genes into 5 groups according to the consequence 14 15 of CoQ10 treatmentFor on gene expressionpeer (supplementary review table 8 online only and supplementary figure 1 for a 16 17 graphical view). About 54% of probes with altered expression were unaffected by CoQ10 18 19 20 supplementation. 36% of probes showed partial or complete normalization of expression and 2% 21 22 showed inverse regulation. Approximately 5% of probes were specifically altered after treatment in 23 24 both deficient and non-deficient cells and 3% showed small or non-specific changes (these were not 25 26 considered for further analysis). After statistical analysis, we obtained 70 altered GO with a significant 27 28 P-value (<0.001) and an enrichment value that represents the most altered GO within each group 29 30 31 (supplementary table 9). 32 33 Data have been deposited with the NCBI-GEO database, at http://www.ncbi.nlm.nih.gov/geo/, http://bmjopen.bmj.com/ 34 35 accession number GSE33941 (see supplementary table 10 for an explanation). The functional 36 37 description of each gene was updated from the GeneCard of The Human Gene Compendium 38 39 40 (Weizmann Institute of Science), http://www.genecards.org/. See supplementary data for a full 41 42 description of genes, biological process and pathways regulated in CoQ10 deficiency. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 CoQ10-deficient fibroblasts readapt the energetic metabolism and CoQ10-treatment restores 47 48 In CoQ -deficient fibroblasts, mitochondrial functions, including respiratory chain and tricarboxylic 49 10 50 51 acid (TCA) cycle, were repressed, whereas 9 of 10 steps in glycolysis and pyruvate metabolism were 52 53 activated, including lactate and pyruvate dehydrogenases (supplementary tables 2 and 4). Accordingly, 54 55 genes involved in the negative regulation of glycolysis were down-regulated, whereas those involved 56 57 in its activation were up-regulated (supplementary table 2). Furthermore, genes involved in cytosolic 58 59 60 8 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 36 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 NADH oxidation (cytochrome b5 and several oxidoreductases) were slightly repressed (Table 2). The 3 4 expression of genes involved in cholesterol and fatty acid metabolism was down-regulated (Table 2), 5 6 as well all the GO related with lipid metabolism (supplementary table 5). 7 8 CoQ supplementation normalized the expression (either partially or completely) of genes involved in 9 10 10 11 the glycolytic pathway and activated the expression of repressed respiratory chain genes, whereas the 12 13 TCA cycle remained unaffected (supplementary table 2). Most of the repressed enzymes of lipid 14 15 metabolism andFor fatty acid ß-oxidationpeer remained review down-regulated (tableonly 2), whereas several other 16 17 pathways, such as monocarboxylic acid transport and the insulin response, were normalized 18 19 20 (supplementary table 9). These results are in agreement with the recovery of aerobic metabolism
21 8 16 17 22 observed in CoQ10-deficient fibroblasts after CoQ10 supplementation . 23 24 25 26 CoQ10 deficiency induces specific adaptations of cells to promote survival 27 28 The major novel finding of transcriptome profiling in CoQ -deficient fibroblasts was the altered 29 10 30 31 expression of genes concerned with cell cycle and development and with resistance to stress and cell 32 33 death (table 2). This suggests both a remodeling of differentiation and growth maintenance and an http://bmjopen.bmj.com/ 34 35 increase of cell survival mechanisms. Specifically, genes involved in cell cycle activation and 36 37 maintenance were up-regulated, and genes involved in cell cycle regulation increased or decreased 38 39 40 their expression depending of their activating or repressing roles. This proliferative response was also 41 42 enhanced by the repression of cellular attachment factors and by the activation of extracellular matrix on September 28, 2021 by guest. Protected copyright. 43 44 proteins that reduce cell attachment and favor cell division. In parallel, GO clusters favoring cell cycle 45 46 and cell division were activated, and those inhibiting cell growth were repressed (supplementary table 47 48 4). The differentiation of these cells was compromised because many required factors, transducers, 49 50 51 antigens, and structural proteins appeared down-regulated, whereas repressors of differentiation during 52 53 development were overexpressed (table 2). See supplementary material for a full description of genes, 54 55 biological processes and related pathways. 56 57 58 59 60 9 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 37 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Cell cycle activation was supported by the up-regulation of CDK6 (Table 2), a cyclin-dependent 3 4 kinase that induces entry into the S-phase, and by a robust repression (more than 9-fold) of 5 6 p21/CDKN1A, an inhibitor of cyclin-dependent kinase that blocks cell cycle at the G1/S check point to 7 8 stimulate cell differentiation. Moreover, subsequent pathways inactivated by p2123 were enhanced in 9 10 11 CoQ10-deficient cells (supplementary table 5), as well as both transcription factors E2F7 and E2F8 12 24 13 (table 2), which push the progression of the cell cycle, activate cell survival and inhibit apoptosis . 14 15 Cell survival in ForCoQ10-deficient peer cells was improvedreview by the induction only of DNA-repairing mechanisms, 16 17 and by the establishment of pathways that regulate Jun-kinases and activate NAD(P)H-CoQ 18 19 20 oxidoreductase, which are involved in stress responses (Tables 2 and S4). Components of apoptosis 21 22 and cell death pathways were systematically repressed (Table 2), including tumor suppressor genes, 23 24 antigens, intracellular mediators, and effectors of cell death. Also, cell surface receptors and 25 26 modulators that inhibit apoptosis were greatly activated. 27 28 Interestingly, CoQ treatment did not alter the newly acquired resistance to cell death in CoQ - 29 10 10 30 31 deficient fibroblasts, kept cell growth activated, and allowed a higher degree of differentiation (Tables 32 33 2 and S8). However, genes controlling stress resistance pathways and cortical cytoskeleton were http://bmjopen.bmj.com/ 34 35 completely restored, as indicated by the shifts in gene expression listed in Table 2. However, treated 36 37 fibroblasts kept the DNA repair mechanism activated. 38 39 40 Signaling-related genes and pathways were differentially affected by CoQ10-deficiency, but most of 41 42 immunity-related genes showed a general down-regulation (Table 2). Pathways and biological on September 28, 2021 by guest. Protected copyright. 43 44 processes involved in immunity regulation were restored by CoQ10 supplementation (Tables 2 and S5). 45 46 47 48 A stable DNA methylation profile is responsible for the specific gene expression profile in CoQ 49 10 50 51 deficiency 52 53 CoQ10 supplementation modified the expression of 43% of genes that were abnormally expressed in 54 55 CoQ10-deficient fibroblasts (supplementary table 8). In the majority of these cases, expression levels 56 57 were restored to those of control fibroblasts (20%), but few showed inverse regulation (2%) and others 58 59 60 10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 38 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 were specifically altered after CoQ10 treatment in both deficient and non-deficient cells (5%). The 3 4 remaining 16% corresponded to partially restored genes, which slightly alter their expression level 5
6 without changing the CoQ10-deficient pattern. These genes along with the unaffected (54%) constitute 7 8 72% of regulated genes in CoQ deficiency, which were not significantly altered after CoQ 9 10 10 10 11 supplementation. 12 13 To explain this differential response to respiratory dysfunction, we analyzed the DNA-methylation 14 15 profile of 20 amongFor the most peer altered genes listedreview in table 2. These onlygenes encompass the main 16 17 biological processes and pathways affected by CoQ10 deficiency (table 3). Up-regulated genes, which 18 19 20 were unaffected by CoQ10 supplementation, had less defined DNA methylation sites in their promoter 21 22 regions. 23 24 Genes with partial restoration of their expression after CoQ10 supplementation showed precise 25 26 methylation and demethylation profiles that may explain their altered expression during CoQ10 27 28 deficiency. The methylation degree of these genes changed after treatment, and may be responsible for 29 30 31 the modulation of expression (Table 3). The patterns of methylation of activated and repressed genes 32 33 in CoQ10 deficiency that could be normalized by CoQ10 supplementation, were either unaffected or http://bmjopen.bmj.com/ 34 35 only slightly affected by the treatment, and we did not detect new methylation sites after CoQ10 36 37 supplementation. 38 39 40 However, a few genes showed significant differences in the methylation degree after the treatment, 41 42 which correspond to the partially restored genes that maintain the specific expression pattern of on September 28, 2021 by guest. Protected copyright. 43 44 untreated CoQ10 deficient cells at a lower level. 45 46 Finally, reviewing the biological processes and molecular functions of regulated genes in CoQ10 47 48 deficiency, the main adaptation for cell survival activated genes by DNA demethylation, which 49 50 51 increased the expression of genes involved in cell cycle activation, apoptosis inhibition, and cell stress 52 53 resistance, meanwhile the undifferenciated state could be due to gene repression by DNA methylation, 54 55 which decreased the expression of genes involved in cell differentiation. CoQ10 treatment did not alter 56 57 the methylation degree of these genes and subsequently the expression level was maintained. 58 59 60 11 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 39 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 DISCUSSION 5 6 7 8 CoQ -deficient fibroblasts readapt the energetic metabolism and CoQ -treatment restores 9 10 10 10 1 11 CoQ10 is an essential component of the mitochondrial respiratory chain , therefore dysfunctional 12 3-7 8-13 13 mitochondria are a common finging in both primary CoQ10 deficiencies and secondary forms . 14 15 Although each formFor presents peer a specific clinical review phenotype, all these only conditions display a substantial 16 17 reduction of cellular CoQ10 content and deficit in the mitochondrial enzymatic activities of respiratory 18 19 20 chain (table 1). Accordingly to these results, we have shown here that fibroblasts from patients with 21 22 CoQ10 deficiency have reorganized their genetic resources to cope with this mitochondrial dysfunction. 23 24 Consistent with the role of CoQ10 in bioenergetics, the lack of CoQ10 would force the cell to support it 25 26 mainly by glycolysis, whereas both mitochondrial lipid metabolism and respiratory chain were 27 28 repressed (supplementary tables 2 and 4). These findings, together with the mild repression of 29 30 31 cytosolic enzymes that oxidize NADH (cytochrome b5 and its oxidoreductases listed in table 2) could 32 33 indicate that NADH is mainly used for biosynthetic purposes rather than for energy production. http://bmjopen.bmj.com/ 34 35 Supplementation with CoQ10, the current therapy for all forms of CoQ10 deficiency, restored 36 37 respiration through enhanced sugar utilization, but did not stimulate lipid metabolism. The expression 38 39 40 of genes involved in the glycolytic pathway was partially or completely normalized after CoQ10 41 42 treatment, whereas the repressed genes involved in the respiratory chain were activated. The TCA on September 28, 2021 by guest. Protected copyright. 43 44 cycle remained unaffected (supplementary table 2). These results are in agreement with the recovery of 45 46 8 16 17 aerobic metabolism observed in CoQ10-deficient fibroblasts after CoQ10 supplementation . 47 48 49 50 51 CoQ10 deficiency induces a stable survival adaptation of cells 52 53 CoQ10-deficienct fibroblasts adapted several physiological processes to acquire a cellular-resistance 54 55 state for survival under the conditons of mitochondrial dysfunction induced by CoQ10-deficiency. The 56 57 new genetic pattern increases cell survival by activating cell cycle and growth, maintaining an 58 59 60 12 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 40 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 undifferentiated phenotype, up-regulating stress-induced proteins, and inhibiting apoptosis and cell 3 4 death pathways. These results recapitulate a survival network that can be observed in nutritional stress 5 6 such as when cells are grown in galactose-enriched media25. 7 8 The survival adaptation shown by CoQ -deficient cells included a global resistance mechanism that is 9 10 10 11 observed also during the initial phase of tumorigenesis. In fact, the CoQ10-deficient expression profile 12 26 27 13 was very similar to that described during myeloid cells transformation and breast tumors . 14 15 Moreover, someFor of the regulated peer genes in CoQreview10 deficiency (listed only in table 2 as underlined bold letter) 16 17 are used as biomarkers in several types of cancer28, like KRT34, the cell cycle-related POSTN, 18 19 20 MCAM, EFEMP1 and VCAN, and the apoptotic and cell resistance-related CYP1B1, XAF1 and 21 22 TNFRSF10D. Although these biomarkers behaved in CoQ10 deficiency (increased or decreased) as 23 24 described by Yoo and collaborators28, there is no sign of tumor formation reported in the patients so 25 26 far. In addition, cellular senescence, a defining feature of pre-malignant tumors29, is characterized by a 27 28 gene expression pattern similar to that of CoQ -deficient fibroblasts (supplementary table 5). 29 10 30 31 Supplementation with CoQ10 enhanced both stress response and immunity pathways. Although the 32 33 pathway of cell death was partially restored, cell cycle and growth, and the mechanisms to prevent http://bmjopen.bmj.com/ 34 35 differentiation and development were not. These results indicate that the mitochondrial dysfunction 36 37 due to CoQ10 deficiency induces a stable survival adaptation of somatic cells in patients at early or 38 39 40 postnatal development, and we speculate that cells unable to institute, or to maintain, this survival 41 42 mechanism during differentiation will die, contributing to the pathological phenotype. on September 28, 2021 by guest. Protected copyright. 43 44 45 46 A stable DNA methylation profile is responsible of specific gene expression in CoQ10 deficiency 47 48 The cellular adaptation to CoQ deficiency enhanced DNA demethylation of genes that regulate cell 49 10 50 51 cycle activation, apoptosis inhibition, and cell stress resistance as part of an adaptation survival 52 53 mechanism. Comparable results were observed in several models of epigenetic regulation by 54 55 demethylation (Table S5), whereas DNA methylation inhibits activation of genes related to 56 57 tumorogenesis and apoptosis 30. 58 59 60 13 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 41 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 Pathways unaffected by CoQ10 treatment corresponded to stably demethylated genes, whereas those 3 4 that responded to CoQ10 supplementation were controlled by genes with unchanged methylation 5 6 patterns. 7 8 We did not find changes in the methylation degree of all genes affected by CoQ deficiency, 9 10 10 11 suggesting that other modalities of gene regulation are responsible, including epigenetic mechanisms 12 13 such as histone modifications by methylation and acetylation, or even DNA methylation in CpG 14 15 islands other thanFor those studied peer here. Interestingly, review it has been reported only that CoQ10 regulates lipid 16 17 metabolism in mice liver without effect on the DNA methylation profile31, indicating that 18 19 20 supplemented CoQ10 by itself may not alter the DNA methylation pattern that cells acquired during the 21 22 survival adaptation to CoQ10 deficiency. 23 24 Mechanisms unaffected by therapy corresponded to stably DNA demethylated genes, which were 25 26 responsible for the acquisition of the undifferentiated state for survival and resistance that cells obtain 27 28 during the adaptation to CoQ deficiency, whereas the responsive to CoQ supplementation were 29 10 10 30 31 controlled by genes with unchanged methylation patterns and correspond mainly to metabolic genes 32 33 and those related with the restoration of mitochondrial function. http://bmjopen.bmj.com/ 34 35 We propose that these epigenetic changes may be established as early as during the fetal life32 in order 36 37 to cope with CoQ10 deficiency; these cells then maintain this adaptive response throughout their life. 38 39 40 We speculate that cells unable to maintain this survival mechanism during differentiation would die 41 42 contributing to the pathological phenotype. on September 28, 2021 by guest. Protected copyright. 43 44 Our model has some limits: we treated cells only for one week and in principle we cannot rule out that 45 46 prolonged exposure to CoQ10 could restore also some of the other unaffected pathways. Alternatively, 47 48 incomplete recovery of the gene expression profiles could be explained by the fact that exogenous 49 50 51 CoQ10 can rescues the bioenergetic defect, but not all other functions of CoQ10 in these cells, as it has 52 33 53 been observed in other organisms . 54 55 56 57 58 59 60 14 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 42 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 ACKNOWLEDGEMENTS 3 4 We appreciate the generous cooperation of the families. 5 6 7 8 FUNDING STATEMENT 9 10 11 This work was supported by the following funders: Spanish Ministerio de Sanidad (FIS) grant numbers 12 13 PI11/00078 and PI11/02350; National Institutes of Health (NIH, USA) grant number 1R01HD057543; 14 15 Junta de AndalucíaFor (Spanish peer Regional Government) review grant number onlyCTS-3988; Telethon (Italy) grant 16 17 number GGP09207; and from a grant from Fondazione CARIPARO. 18 19 20 21 22 AUTHOR CONTRIBUTION STATEMENT 23 24 DJMFA and PN designed the experiments and drafted the manuscript; DJMFA, IG, SJG, MVC and 25 26 AG performed the experiments and made the statistical analyses; PB, RA and LS provided cells and 27 28 patient’s clinical information; DJMFA, PB, RA, PN, SDM, MH, RC and LS analyzed the data and 29 30 31 edited the manuscript. 32 33 http://bmjopen.bmj.com/ 34 35 COMPETING INTERESTS STATEMENT 36 37 There is no competing interest. 38 39 40 41 42 DATA SHARING STATEMENT on September 28, 2021 by guest. Protected copyright. 43 44 There are not additional data available. 45 46 47 48 Dryad Package Identifier 49 50 51 doi:10.5061/dryad.gr2gp 52 53 54 55 56 57 58 59 60 15 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 43 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 REFERENCES 3 4 1. Bentinger M, Tekle M, Dallner G. Coenzyme Q biosynthesis and functions. Biochem Biophys Res 5 Commun 2010;396(1):74-9. 6 7 2. Trevisson E, Dimauro S, Navas P, et al. Coenzyme Q deficiency in muscle. Curr Opin Neurol 8 2011;24(5):449-56. 9 10 3. Sobreira C, Hirano M, Shanske S, et al. Mitochondrial encephalomyopathy with coenzyme Q10 11 deficiency. Neurology 1997;48(5):1238-43. 12 13 14 4. Artuch R, Brea-Calvo G, Briones P, et al. Cerebellar ataxia with coenzyme Q10 deficiency: 15 diagnosis Forand follow-up peer after coenzyme review Q10 supplementation. only J Neurol Sci 2006;246(1-2):153- 16 8. 17 18 5. Salviati L, Sacconi S, Murer L, et al. Infantile encephalomyopathy and nephropathy with CoQ10 19 deficiency: a CoQ10-responsive condition. Neurology 2005;65(4):606-8. 20 21 6. Horvath R, Schneiderat P, Schoser BG, et al. Coenzyme Q10 deficiency and isolated myopathy. 22 Neurology 2006;66(2):253-5. 23 24 7. Heeringa SF, Chernin G, Chaki M, et al. COQ6 mutations in human patients produce nephrotic 25 syndrome with sensorineural deafness. J Clin Invest 2011;121(5):2013-24. 26 27 8. Cotan D, Cordero MD, Garrido-Maraver J, et al. Secondary coenzyme Q10 deficiency triggers 28 29 mitochondria degradation by mitophagy in MELAS fibroblasts. Faseb J 2011;25(8):2669-87. 30 31 9. Gempel K, Topaloglu H, Talim B, et al. The myopathic form of coenzyme Q10 deficiency is caused 32 by mutations in the electron-transferring-flavoprotein dehydrogenase (ETFDH) gene. Brain 33 2007;130(Pt 8):2037-44. http://bmjopen.bmj.com/ 34 35 10. Haas D, Niklowitz P, Horster F, et al. Coenzyme Q(10) is decreased in fibroblasts of patients with 36 methylmalonic aciduria but not in mevalonic aciduria. J Inherit Metab Dis 2009;32(4):570-5. 37 38 11. Miles MV, Putnam PE, Miles L, et al. Acquired coenzyme Q10 deficiency in children with 39 recurrent food intolerance and allergies. Mitochondrion 2011;11(1):127-35. 40 41
12. Montero R, Sánchez-Alcázar JA, Briones P, et al. Analysis of Coenzyme Q10 in muscle and on September 28, 2021 by guest. Protected copyright. 42 fibroblasts for the diagnosis of CoQ10 deficiency syndromes. Clinical Biochemistry 43 44 2008;41(9):697-700. 45 46 13. Quinzii CM, Kattah AG, Naini A, et al. Coenzyme Q deficiency and cerebellar ataxia associated 47 with an aprataxin mutation. Neurology 2005;64(3):539-41. 48 49 14. Montini G, Malaventura C, Salviati L. Early coenzyme Q10 supplementation in primary coenzyme 50 Q10 deficiency. N Engl J Med 2008;358(26):2849-50. 51 52 15. Pineda M, Montero R, Aracil A, et al. Coenzyme Q(10)-responsive ataxia: 2-year-treatment 53 follow-up. Mov Disord 2010;25(9):1262-8. 54 55 16. Lopez LC, Quinzii CM, Area E, et al. Treatment of CoQ(10) deficient fibroblasts with ubiquinone, 56 CoQ analogs, and vitamin C: time- and compound-dependent effects. PLoS One 57 2010;5(7):e11897. 58 59 60 16 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 44 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 17. Lopez-Martin JM, Salviati L, Trevisson E, et al. Missense mutation of the COQ2 gene causes 3 defects of bioenergetics and de novo pyrimidine synthesis, 2007:1091-97. 4 5 18. Salviati L, Trevisson E, Rodriguez Hernandez MA, et al. Haploinsufficiency of COQ4 causes 6 coenzyme Q10 deficiency. J Med Genet 2012;49(3):187-91. 7 8 19. Fernández-Ayala D, Chen S, Kemppainen E, et al. Gene Expression in a Drosophila Model of 9 Mitochondrial Disease. PLoS ONE 2010;5(1):e8549. 10 11 20. Baur JA, Pearson KJ, Price NL, et al. Resveratrol improves health and survival of mice on a high- 12 calorie diet. Nature 2006;444(7117):337-42. 13 14 21. Eden E, Navon R, Steinfeld I, et al. GOrilla: a tool for discovery and visualization of enriched GO 15 For peer review only 16 terms in ranked gene lists. BMC Bioinformatics 2009;10(1):48. 17 18 22. Saeed AI, Bhagabati NK, Braisted JC, et al. TM4 microarray software suite. Methods in 19 enzymology 2006;411:134-93. 20 21 23. Gartel AL, Radhakrishnan SK. Lost in transcription: p21 repression, mechanisms, and 22 consequences. Cancer Res 2005;65(10):3980-5. 23 24 24. Li J, Ran C, Li E, et al. Synergistic Function of E2F7 and E2F8 Is Essential for Cell Survival and 25 Embryonic Development. Developmental Cell 2008;14(1):62-75. 26 27 25. Quinzii CM, Hirano M. Coenzyme Q and mitochondrial disease. Dev Disabil Res Rev 28 2010;16(2):183-8. 29 30 26. Zhan F, Huang Y, Colla S, et al. The molecular classification of multiple myeloma. Blood 31 32 2006;108(6):2020-8. 33 http://bmjopen.bmj.com/ 34 27. van 't Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome 35 of breast cancer. Nature 2002;415(6871):530-36. 36 37 28. Yoo SM, Choi JH, Lee SY, et al. Applications of DNA microarray in disease diagnostics. J 38 Microbiol Biotechnol 2009;19(7):635-46. 39 40 29. Collado M, Gil J, Efeyan A, et al. Tumour biology: senescence in premalignant tumours. Nature 41 2005;436(7051):642. 42 on September 28, 2021 by guest. Protected copyright. 43 30. Fan H, Zhao Z, Quan Y, et al. DNA methyltransferase 1 knockdown induces silenced CDH1 gene 44 reexpression by demethylation of methylated CpG in hepatocellular carcinoma cell line SMMC- 45 7721. Eur J Gastroenterol Hepatol 2007;19(11):952-61. 46 47 48 31. Schmelzer C, Kitano M, Hosoe K, et al. Ubiquinol affects the expression of genes involved in 49 PPARalpha signalling and lipid metabolism without changes in methylation of CpG promoter 50 islands in the liver of mice. Journal of clinical biochemistry and nutrition 2012;50(2):119-26. 51 52 32. Smith ZD, Chan MM, Mikkelsen TS, et al. A unique regulatory phase of DNA methylation in the 53 early mammalian embryo. Nature 2012;484(7394):339-44. 54 55 33. Gomez F, Saiki R, Chin R, et al. Restoring de novo coenzyme Q biosynthesis in Caenorhabditis 56 elegans coq-3 mutants yields profound rescue compared to exogenous coenzyme Q 57 supplementation. Gene 2012;506(1):106-16. 58 59 60 17 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 45 of 110 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 34. Montero R, Sanchez-Alcazar JA, Briones P, et al. Coenzyme Q10 deficiency associated with a 3 mitochondrial DNA depletion syndrome: a case report. Clin Biochem 2009;42(7-8):742-5. 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 18 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 46 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 FIGURE LEGEND 4 5 6 Figure 1. Cluster of genes differentially expressed in CoQ10 deficiency and after CoQ10 7 8 supplementation. Four arrays of 2 representative fibroblasts from patients with Q-deficiency were 9 10 11 plotted with 2 arrays of control fibroblasts and 9 arrays of 5 patient’s fibroblasts with CoQ10 deficiency 12 13 treated with 30 µM CoQ10. Activated genes were colored in red and repressed ones in green. Between 14 15 parentheses, groupFor classification peer of genes afterreview CoQ10 supplementation only (Table S3). 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 19 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
#5 #5 #3 #3 #4 #1 #2 #2 #GIO #ELO #HDF #control #ELO+Q #MEL+Q Array and epigenetic code
8 5 4 18 34 17 17 12 , case 4 , 4 case , case 3 , 3 case 12 12 Reference as cited in cited the as text
RC.
- 10
ntation Reference values Effect of CoQ Improvementin muscle Improvement of 41% and tone strength. Heto andbegan speak Recovery Recovery of mt complex II+III (cells). Recovery of cell growth. Recovery Recovery of ATP production. ROS No production Improvement of neurological assessment. biochemicalNo studies done. suppleme Improvement of 25% complex II+III (cells). Recovery of cell growth. Improvement of neurologic not but the renal dysfunction. Recovery of cell growth. Improvement of 35% complex II+III (cells). deficiency. 10
20
BMJ Open
scle http://bmjopen.bmj.com/ in fibroblast in in muscle in in fibroblast in in mu in
biosynthesis-rate fibroblastin in fibroblastin biosynthesis-rate musclein fibroblastin biosynthesis-rate in fibroblastin biosynthesis-rate 10 10 10 10 10 10 10 10 10 10 10 10 10 Biochemical studies Biochemical to (% mean referencerespect values) Reference values 29% CoQ 29% 23% CoQ 23% 40% CoQ 40% 20% CoQ 20% CoQ 44% 58% CoQ 58% mt-RC complex 32% (muscle) I+III mt-RC complex 19% II+III (muscle) CoQ 15% 35% mt-RC complex 35% (cells)I mt-RC complex 41% II+III (cells) mt-RC complex 12% (cells) IV mt- Ψ 60% mitochondrial 70% mass ROS (>2-fold)production autophagosomedefective elimination 17% CoQ 17% 31% mt-RC complex 31% (muscle) I+III mt-RC complex 46% II+III (muscle) CoQ 22% 64% mt-RC complex 64% (cells) I+III 85% mt-RC complex 85% II+III (cells) 15% CoQ 15% mt-RC complex 60% II+III (cells) 19% mt-RC complex 19% (muscle) I+III mt-RC complex 32% II+III (muscle) CoQ 17% CoQ 10% mt-RC complex 57% II+III (cells) 24% CoQ 24% ROS (3-fold)production on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency deficiency deficiency deficiency deficiency 10 10 10 deficiency deficiency 10 For peer review10 only corticosteroid-resistant nephropaty COQ2 mutation gene (c.890A>G) CoQ primary corticosteroid-resistant nephropaty encephalomyopathy progressive COQ2 mutation gene (c.890A>G) CoQ primary Healthy volunteersHealthy Dysmorphic features,Dysmorphic ventricular septal ventricular weakness,defect, and hypotonia hyporeactivity. mtDNA depletion mtDNA syndrome encephalopathy neonatal CoQ secondary MELAS (A3243G MELAS mutation) CoQ secondary ataxia and cerebellarataxia atrophy CoQ secondary phenotype Clinical
a old girl old old boyold - -
year day - - 3-year-old 3-year-old boy 10 Boy 9-month-old girl brother (her above) 33-month-old 33-month-old boy sister bellow)(his 12 Human Human dermal skin fibroblast Patient / Patient Cells
Table Table 1 Q with Coenzyme patients in done biochemical studies and phenotype Clinical Page 47 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 48 of 110 #epi #epi #epi #epi #SIL+Q #SOF+Q
, 1 case 12 this this paper
complex complex activity I+III and growth fibroblastsof Recovery Recovery of both Improvement ATP of synthesis , Synthetic Synthetic , Minimun Sigma).98%, HPLC, 10
21
BMJ Open http://bmjopen.bmj.com/ in fibroblast in
in fibroblastin 10 10 18% CoQ 18% 58% mt-RC complex 58% II+III (cells) walk. 38% CoQ 38% on September 28, 2021 by guest. Protected copyright. For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml deficiency deficiency 10 deficiency. deficiency 10 10 For peer review only
rabdomyolisis CoQ primary COQ4 gene COQ4 mutation gene (c.483G>C) Ataxia CoQ secondary Moderate retardation.mentalModerate COQ4 deletion.gene CoQ Primary pre-diluted in in pre-diluted FBS to added was platesthe ata final concentration µM of 30 (Coenzyme Q 10
rl CoQ cultured at cultured DMEM 37°C Glucose,using 1 g/L L-Glutamine, (Invitrogen)Pyruvate plus antibiotic/antimycotic solution (Sigma) fetal and 20% bovine serum (Linus). Gi Girl a b
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
(f) 10
fold - 3 – CoQ
(e) –20%
+2-fold –5-fold –2-fold
1,3 4,8 8,0 - -4,3 238,2 Q-RT-PCR Q-RT-PCR
(d)
10
- R R R R O O O U U O U pR pR pR CoQ
U R
R R pR R U O pR U U pR
(c) nc nc nc nc nc nc 1,6 4,3 2,9 3,2 2,5 1,7 1,6 1,6 1,7 1,5 2,3 1,4) - -1,6 - - - -1,5 -1,8 - -1,9 -1,6 - (1,5) (1,4) ( 153,9 FC FC
nc -
nc U nc U nc
) (b 3,6 2,9 5,3 3,4 2,4 5,4 7,6 6,8 2,5 3,3 2,5 2,0 1,4) 1,3) 1,3) 1,4) - - -2,5 - - - -2,3 -2,1 -2,6 -3,0 -2,1
66,1 73,8 75,5 10,8 10,0 ------19,5 ( ( ( ( (-1,3) (-1,4) FC FC 22 BMJ Open http://bmjopen.bmj.com/
desaturase) - 9 - on September 28, 2021 by guest. Protected copyright.
deficiency deficiency 10
tase 4
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
A hydroxylase - -
For peer review only adenosyl methionine containing domain 2
- CoA (deltadesaturase -
phosphorylase, phosphorylase, glycogen;liver carboxypeptidase E carboxypeptidase cytochrome cytochrome b5 reductase 1 cysteine and glycine-richcysteine protein 2 insulin inducedinsulin 1 gene brain protein brain 44 farnesyl-diphosphate farnesyltransferasefarnesyl-diphosphate 1 Gene Title Gene semaphorin 5A,semaphorin receptor for cell growth protein AE binding 1 periostin, periostin, specific osteoblast factor quinolinate phosphoribosyltransferasequinolinate classtype I, ATPase, 8B, member 1 proprotein convertase proprotein subtilisin/kexin type 2 scinderin cholesterol 25 cholesterol S radical epoxidasesqualene stearoyl cytochrome cytochrome b5 reductase 3 cytochrome b5 reduc cytochrome cytochrome b561 cytochrome b5 chromosome chromosome reading frame7 open 55 low density lipoprotein low density receptor pregnancy-associated plasma pappalysin protein A, cytochrome cytochrome b5 reductase 2 vascular vascular endothelial growth factor A chromosome chromosome reading 10 open frame 58
(a)
SEMA5A AEBP1 QPRT ATP8B1 PCSK2 SCIN CH25H RSAD2 SQLE SCD CYB5R3 CYB5R4 CYB561 CYB5A C7orf55 Gene Symbol POSTN
CSRP2
PYGL cycleCell CPE Other metabolism FDFT1 INSIG1 metabolismInsulin CYB5R1 Lipid metabolism BRP44 Mitochondrial metabolism 2 Table Differentially genesCoenzyme in expressed Q LDLR SLC40A1 carrier solute family transporter)40 (iron-regulated PAPPA NADH NADH mobilization
VEGFA CYB5R2 IDI1 isopentenyl-diphosphatedeltaisomerase 1 C10orf58 Page 49 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Page 50 of 110
60% – +10% +10%
5,7 4,6 - -10,9
R ------R R R R R R R R R U U U U U U U U U U O U U U U pR pR p pR pR pR pR
R - U - O nc nc nc nc nc nc nc nc nc nc nc nc nc nc 2,4 7,6 2,1 1,3 2,7 1,6 1,6 1,6 4,4 1,3) - - - - -2,0 -1,5 -1,5 - -3,0 -3,7 - (1,3) ( (-1,4) (-1,5) (-1,4) 1,7 1,8
nc - nc - 6,5 4,3 2,5 4,4 2,8 5,3 2,9 2,8 2,0 6,5 3,0 1,9 3,0 9,2 2,6 2,0 (1,4) 3,9 3,5 9,2) 2,6) 1,3) ------1,8 - -8,3 -2,7 -4,8 -5,2 - - -6,7 -4,5 -6,1 -3,8
13,2 2,2 - - - (3,6) (1,4) 2,9 (1,9) 2,7 (2,2) (2,6) 1,4 -93,0 -10,1 ( ( 263,6 ( (-1,9) (-1,8) (-1,4) - 23 BMJ Open
http://bmjopen.bmj.com/
on September 28, 2021 by guest. Protected copyright. protein protein coupled, 5
-
stimulated genes iption factor (aml1 oncogene) 1 - For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml
For peer review only
releasing releasing peptide
- derived neurotrophic derived factor - related transcr - midline 1 (Opitz/BBB 1 midline syndrome) plakophilin plakophilin 4 forkhead Q1forkhead box A11 homeobox nuclearbody protein SP110 receptor P2Y,purinergic G zinc finger teashirt homeobox 1 34keratin (alpha)tropomyosin 1 p21, inhibitor p21, CDK of inhibitor p57, CDK of transcriptionE2F factor 7 brain gastrin G1netrin (neurite pleiotrophin growth-promotingfactor 1) C9 homeobox homeobox LIM 9 10 tetraspanin stromal Epithelial interaction 1 versican component of SWI/SNF chromatincomlplex, memberA1 component of SWI/SNF chromatincomlplex, memberA4 Cyclin-dependent kinase 6, in tumoroverexpressed inhibitor of CDK, canceroverexpressed in cells antigensurface cell retinoblastoma protein transcriptionE2F factor 8 follistatin decorin fibulin-likeEGF-containing extracellular matrix protein1 docking protein docking 5 E1A 1 repressor of runt 1 endothelin 2 matrilin adhesion cell melanoma molecule pregnancy specific pregnancy 6beta-1-glycoprotein interferon induced interferon transmembraneinduced (9-27) protein 1
1
FOXQ1 HOXA11 SP110 P2RY5 TSHZ CDKN1A CDKN1C E2F7 BDNF GRP KRT34 SMARCA1 DCN VCAN DOK5 CREG1 RUNX1 EDN1 MATN2 MCAM EFEMP1 TPM1 NTNG1 HOXC9 TSPAN10 SMARCA4 CDKN3 E2F8
PKP4 MID1 BHLHB5 helix-loop-helix basic containing,domain class 5 B, CHURC1 containing churchill domain 1 PSG6 IFITM1 MKX mohawk homeobox
PTN LHX9 EPSTI1 CDK6 CD31 RB1 FST and Developmentdifferentiation 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
fold - 2 +20% – –5-fold –5-fold
7,0 11,8 15,1
------R R R R R R R R R R R R R O O U U U U U U O O O U U O O U U pR pR
- nc nc nc nc nc nc nc nc nc nc nc nc nc 2,5 2,3 2,5 1,6 1,6 1,5) 1,3) - - -1,9 -1,9 - -1,8 -1,6 -4,9 - - (1,4) (1,5) ( (-1,3) (-1,4) ( (-1,5) (-1,4) (-1,3)
(1,4)
5,9 9,8 3,3 4,2 1,7 3,1 8,7 3,8 4,2 1,7 2,4 2,4 2,6 1,7 4,9 1,9 3,4 3,6 4,5 4,5 (1,5) 2,2 2,0 2,3 3,8 3,8 ------2,8 -4,7 -4,5 -2,0 -7,4 -8,5 - - -3,0 - -4,5 -6,4 -5,0 -2,3 -8,3
17,3 13,8 2,0 11,7 12,2 - -15,0 -67,3 - 24 BMJ Open http://bmjopen.bmj.com/
14
on September 28, 2021 by guest. Protected copyright.
like like 4C -
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml inducible protein 27 inducible protein 6 related protein 1
- - - containing 55 containing - ribose) ribose) polymerase member family, - For peer review only induced protein 44 - d frizzled d ribosylation factor ribosylation - protein, 2 gamma - B cell RAG B associated protein necrosis tumor factor superfamily, member 4 alphainterferon, interferon G adaptorNCK protein 2 (ADP poly small effector CDC42 2 antigen lymphocyte complex, 6 locus K tripartite motif-containing14 (A2/A3)butyrophilin3 interferon-induced protein 44-like secrete ADP specific ubiquitin peptidase53 acid gamma-aminobutyric (GABA)receptor, B 2 nucleotide channelcyclic gated alpha 3 domain RLD hect and 6 melanophilin tumor necrosis tumor factor receptor superfamily 10D melanoma antigen melanoma family D, 1 tripartite motif alphainterferon, XIAP associated factor-1 similar to Sixepithelialto similar antigen prostate of transmembrane protein 49 /// microRNA 21 serum/glucocorticoid regulated 1 kinase suppressor of cytokine signaling 3 melanomain absent 1 polyposisadenomatosis coli down-regulated 1 antigen melanoma family D, 4/ 4B binding small GTP protein (rho Rac2family) cytochrome P450, cytochrome family 1B, polypeptide 1 RAD23 (S.homolog cerevisiae)B interacting thioredoxin protein gene ras homolog member family,U forkhead P1forkhead box LIM and cysteine-richLIM 1domains
6ST -
GALNAC4S TNFSF4 IFI27 IFI44 GNG2 NCK2 PARP14 SFRP1 ARL4C MAGED1 TRIM55 IFI6 MGC87042 TMEM49 SGK1 SOCS3 FOXP1 XAF1 CYP1B1 TNFRSF10D
CDC42SE2 TRIM14 IFI44L USP53 HERC6 Immunity Signaling
AIM1 / MAGED4 4B RAD23B RHOU
LMCD1 LY6K BTN3(A2/A3) GABBR2 CNGA3 MLPH
APCDD1 RAC2 TXNIP Apoptosis Cell resistance to resistance Cell to stress Page 51 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
10 Page 52 of 110
supplementation (S). supplementation Genes non-affected by CoQ 10
- - - R R R R R R R U U pR pR pR treatment (U); thethat treatment restored genes either expression partial (pR) 10
- nc nc nc 1,8 1,6 1,3) - - -1,7 -3,0 -4,9 -2,6 - ( . See the text text for See . the information.more 28
5,3 6,4 7,4 6,2 3,6 ------3,5 -2,7 -6,1 -1,8
(-5,1) (-3,1) 25 BMJ Open http://bmjopen.bmj.com/
deficiency: deficiency: unaffected by CoQ genes 10
deficiency (O);and specificalydeficiency regulated after genes only CoQ 10 on September 28, 2021 by guest. Protected copyright.
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml like like modifier -
induced induced protein (tetratricopeptide repeats 1) For peer review only - oligoadenylate oligoadenylate synthetase 69/71kDa 2, oligoadenylate synthetase 100kDa 3, - - 5' 5' supplementation on on expressiongenesupplementation in CoQ G15ubiquitin - - 10 interferon IS myxovirus resistance 1 2' 2' interferon-induced interferon-induced protein (tetratricopeptide repeats 3) binding guanylate protein interferon-inducible1, myxovirus resistance 2 2',5'-oligoadenylate synthetase 40/46kDa1, 2'-5'-oligoadenylate synthetase-like subunit, proteasome beta type,9 supplementation on levelsmRNAsupplementation on analyzed by Q-RT-PCR. Positive values, increase expression;gene on negative values, decrease on expression.gene 10
IFIT1 ISG15 MX1 OAS2 OAS3 Full change (FC)thein comparative analysisFull with GeneChip®ran Affymetrix Human PlusU133 Genome 2.0 Array. therepresent Values (mean) for FC each correspodinggene to coenzyme CoQof Effect In letter,In bold usedbiomarkers several types in cancer as of described Yoo collaboratorsby and changein Full comparativethe analysis with ran Affymetrix Gene Chip®Human Gene ST Array.1.0 In parenthesis, FC non-significant of genes by statistical the threshold used. changein Full expression gene analyzed by (Q-RT-PCR). quantitative PCR real time See supplementary material forandS11 table primer sequence. Effect CoQ of specific specific and processes pathways (see textthefull for details).casethe In of different probes selected for one gene, thevalues represent for mean of (see FC each probe supplementary fortable full 1 details). diferent sample's diferent (SAM analysis;patient R=1.5; FDR=0%). parenthesis, In of FC non-significant the by statistical genes threshold which used,were selected becausetheir inrole a b c d e f IFIT3 MX2 OASL Genes with change (nc).Genes no or completely (R); or with genes regulation inopposite than CoQ supplementation (-).supplementation text the and See supplementary tablefull for details. 8 GBP1 OAS1 PSMB9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(g) BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
------+2-fold Q-effect
(f)
------(P) close together close (P) deficiency 10 CpGs' location
(e) (P).
------10 28% / 35% 28% treatment (U); thattreatment restored genes the 10 (C/P) degree methylations inmethylations CoQ
deficiency (O). deficiency (d)
10
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 (50%) 6 7 (2-fold) 7 / 37% 27% scattered groups - 8 (4-fold) 8 / 20% 5% together close (P) –3-fold 3 (3-fold) 3 / 19% 5% dispersed CpGs
(f)
------(I) (I) scattered groups supplementation than insupplementation CoQ deficiency 10 -deficient Non-significantfibroblasts.-deficient in changes methylation (-). 10
10 CpGs' location 26
(e) BMJ Open
deficiency. Positivedeficiency. an increase methylationthevalues, in degree; negative values, demethylations. ------http://bmjopen.bmj.com/ 10 53% 53% / 35%
(C/P) degree demethylations in CoQ demethylations in (d)
deficient fibroblast. deficient Significance determined t-test by In (p<0.01). parenthesis, fold-change in methylation degree
fold) 10 - 0 0 0 0 0 0 deficiency (more information deficiency in S8):Table unaffected CoQgenes by 10 20 (220 -supplemented and -supplemented untreated CoQ 10 on September 28, 2021 by guest. Protected copyright. supplementation CoQ in supplementation
10 CpGs (c)
For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 32 (P)32 (P,E,I) 73 CpGs (b)
For peer review only
O O
Q-effect 4,2 pR (P,E,I) 63 (90%) 5 52% / 28% scattered groups (60%) 9 / 28% 16% scattered groups +7% 2,8 U (P,E,I) 58 5 (2-fold) / 12% 7% scattered groups (90%) 3 / 17% 9% dispersed (I) - 4,7 R (P) 24 2,3 U (I) 85 (2-fold) 11 57% / 32% scattered groups (3-fold) 2 / 19% 7% together close - (a) deficiency (SAManalysis; deficiency R=1.5; ran with FDR=0%) Affymetrix GeneChip® Human GenomePlusU133 2.0 Array.details table in 2.Full
-3,0 R (P,E,I) 25 0 -2,5 R (P,E,I) 84 8 (2-fold) / 12% 6% together close (E) (3-fold) 1 / 13% 4% -8,5 R 8 (P) -7,7 R (P,E,I) 74 0 -5,9 R (P,E) 34 0 -3,1 U (P) 29 -3,0 U (P) 25 73,8 U 5 (P) (16-fold) 2 / 50% 3% together close (P) 0 11,6 pR (P,I) 26 3 (4-fold) / 20% 6% dispersed 66,1 R (P,E,I) 80 (25%) 8 76% / 61% scattered groups (3-fold) 8 / 27% 10% dispered widely - 94,3 10 - 263,6 -
supplementation expression gene insupplementation CoQon 10
Effect of CoQ of Effect methylated CpGs controlSignificant each in gene for and CoQ Significant in changes CpG methylation to due CoQ Full changein Full CoQ Number of islands CpG analyzed. In parenthesis, locationgene islands:GpC of promoter (P);(E); firstfirst intron exon (I). Methylation degree (mean CpG). of significant Values therepresent % of CpG's methylation of both control (C) and indeficient patient CoQ Location of Location of significant CpGs. parenthesis, In location:gene (P);promoter(E); firstfirst (I).intron exon PCSK2 GRP MLPH MCAM EPSTI1 XAF1 XAF1 PYGL CHURC1 3,5 R (P,E,I) 20 (50%) 1 / 11% 7% CYP1B1 AEBP1 HOXA11 -4,3 pR (P) 17 ARL4C CPE CPE PARP14 END1 FOXP1 TNFRSF10D 2,4 U (P,E,I) 59 (2-fold) 27 60% / 25% scattered (P)groups 0 VCAN VCAN GABBR2 13,8 U 101 (P,I) (40%) 5 47% / 37% together close (P) (6-fold) 14 / 22% 10% together close (P) –15% POSTN Gene symbolGene FC
a b c d e f g Table 3 Table Epigenetic inmodifications deficiencyCoQ10 to dueDNA (CpG) / demethylationmethylation (small changes,%).(small in Non-significant changes in (-).methylation expression eitherpartialexpression (pR) completely (R); or and regulation genes with opposite afterCoQ Significance determinedSignificance t-test(p<0.01) by between CoQ Page 53 of 110 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open Page 54 of 110 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 90x90mm (300 x 300 DPI) 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 55 of 110 BMJ Open
1 2 SUPPLEMENTARY DOCUMENT 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 6 7 8 9 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 10 11 12 modifications: a modelling study for human coenzyme Q10 deficiencies. 13 14 15 16 Daniel J. M. Fernández-Ayala1,5, Ignacio Guerra1,5, Sandra Jiménez-Gancedo1,5, Maria V. 17 For peer review only 18 1,5 1,5 2 2 3,5 19 Cascajo , Angela Gavilán , Salvatore DiMauro , Michio Hirano , Paz Briones , Rafael 20 21 Artuch4,5, Rafael de Cabo6, Leonardo Salviati7,8 and Plácido Navas1,5,8 22 23 24 25 1 26 Centro Andaluz de Biología del Desarrollo (CABD-CSIC), Universidad Pablo Olavide, Seville, 27 28 Spain 29 30 2 31 Department of Neurology, Columbia University Medical Center, New York, NY, USA 32 3 33 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 34 35 4Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain 36 37 5 38 CIBERER, Instituto de Salud Carlos III, Spain http://bmjopen.bmj.com/ 39 40 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 41 42 21224, USA 43 44 7 45 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy
46 on September 28, 2021 by guest. Protected copyright. 47 8 Senior authorship is shared by LS and PN 48 49 50 51 52 53 54 Corresponding author 55 56 57 Plácido Navas 58 59 Tel (+34)954349381; Fax (+34)954349376 60 e-mail: [email protected]
1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 56 of 110
1 2 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 SUPPLEMENTARY DATA 5 6 7 8 9 Identification of genes, biological process and pathways regulated in CoQ10 deficiency. 10 11 12 Data analysis for each gene in the array compared the signal of each patient’s fibroblast mRNA 13 14 with the signal of each control fibroblast mRNA, over which the statistical analyses were 15 16 performed. MAS5 algorithm and SAM software were performed in order to select those probe sets 17 For peer review only 18 19 with significant differences in gene expression. Approximately from 6% to 11% of the probe sets 20 21 present in the array were picked with a significant fold change higher than 1.5, while the false 22 23 discovery rate (FDR) was maintained lower than 5%, the maximum value to consider changes as 24 25 26 significant [1]. Even more, we reduced the FDR to cero by increasing the stringency of the 27 28 statistical analysis via extension of the cut off threshold (Δ-value). After such filtering, from 842 to 29 30 31 1672 probe sets were identified as showing significant differences in expression between CoQ10- 32 33 deficient fibroblasts and control cells, representing approximately 2% to 3% of the array 34 35 (supplementary table 9 online). Later on, we compared the regulated probes in each comparative 36 37 38 analysis in order to get a list of genes that were regulated simultaneously in all patient’s fibroblasts http://bmjopen.bmj.com/ 39 40 at the same time (supplementary tables 10 and 11 online). We found 136 probes whose expression 41 42 was regulated similarly in all samples, including 47 UP-regulated probes and 89 DOWN-regulated 43 44 45 ones. Most of the other probes that were selected as significant in only one sample were no selected
46 on September 28, 2021 by guest. Protected copyright. 47 in other (2575 probes were regulated similarly in 3 or less of the 4 samples), and 174 probes 48 49 appeared UP-regulated in some samples and DOWN-regulated in others. Taking in mind that an 50 51 52 Affymetrix GeneChip® Human Genome U133 Plus 2.0 Array contains 54675 probes, the 53 54 probability of the 136 selected probes to be randomly selected in one comparative analysis is 55 56 57 0.0025, which represents the 136 over the total amount of probes present in the array. This 58 59 probability is reduced to 0.00000625 (less that one probe per array) if we consider two analyses to 60 select randomly the 136 probes, and it is reduced to almost zero if we consider the four comparative
2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 57 of 110 BMJ Open
1 2 analyses over which we ran the statistical analysis. This result gave us the security that the changes 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 in the gene expression were due to the mitochondrial of CoQ deficiency syndrome and not to a 5 10 6 7 random selection of probes. Then, the probes were grouped in a list to define the most altered genes 8 9 as biological markers in the mitochondrial of CoQ10 deficiency syndrome. We found that many of 10 11 12 them represented the same gene, so that the 136 probes correspond to 116 regulated genes (Table 13 14 2). These were validated in selected representative cases by quantitative real-time PCR (Table 2 and 15 16 supplementary table 1 online). To corroborate the altered gene expression, we considered to re- 17 For peer review only 18 19 hybridize the same samples with another oligonucleotide array, the Affymetrix Gene Chip® Human 20 21 Gene 1.0 ST Array. The analysis was performed as follows: PLIER algorithm and SAM software 22 23 were performed in order to select those probe sets with significant differences in gene expression 24 25 26 (s0=50; R=1.5; cut off threshold of delta-value so that FDR=0%). The regulation on gene 27 28 expression is listed in parallel to the main analysis in table 2 and supplementary table 1 online. 29 30 31 Finally, we called such genes as genes regulated in the mitochondrial CoQ10-deficiency syndrome. 32 33 34 35 CoQ10 supplementation partially restores the altered gene expression of CoQ10-deficient 36 37 38 fibroblasts. http://bmjopen.bmj.com/ 39 40 We extracted total RNA from 5 different cultures of CoQ10-deficient fibroblast treated for 48 hours 41 42 with 30 µM of CoQ10 and duplicate hybridizations were performed with the Affymetrix Gene 43 44 45 Chip® Human Gene 1.0 ST Array. The statistical analysis was performed as follow, using PLIER
46 on September 28, 2021 by guest. Protected copyright. 47 algorithm and SAM software to select those probe sets with t-test<0.05 and establishing three 48 49 different thresholds of minimum fold change (R=1.5; R=2.0; and R=3.0) to select a probe as 50 51 52 significant. After that we made a comparative analysis between the three types of fibroblasts: 53 54 control (C), fibroblasts from CoQ10 deficient patients (P), and CoQ10 supplemented fibroblasts from 55 56 57 CoQ10-deficient patients (PQ). Finally, we obtained three different comparative analyses: treated 58 59 versus non-treated fibroblasts (PQ-P), treated versus control fibroblasts (PQ-C), and non-treated 60
3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 58 of 110
1 2 versus control fibroblasts (P-C) that represented the previous analysis done between CoQ10 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 deficient fibroblasts and control ones. 5 6 7 Independently of the minimum full change threshold that we used, around a half of the probes 8 9 selected with the comparative analyses between CoQ10 deficient and control fibroblasts (both P-C 10 11 12 and PQ-C) were selected in the analysis between treated and non-treated fibroblasts (supplementary 13 14 table 3 online), indicating that CoQ10 supplementation altered the expression of around 50% of the 15 16 regulated genes by CoQ10 deficiency. Also, by increasing the minimum full change threshold, the 17 For peer review only 18 19 number of selected probes as significant was halved in each comparative analysis. 20 21 Considering that a regulated probe, either being up-regulated or down-regulated, in a comparative 22 23 analysis can be regulated or not in the others comparative analyses, 27 possibilities can be achieve 24 25 26 for a probe to be or not to be regulated in one, two or in all the comparative analyses 27 28 (supplementary table 4 online and figure S1 for a graphical view). Because of the objective of these 29 30 31 analyses is to study how the altered gene expression in CoQ10 deficiency was regulated with the 32 33 supplementation of CoQ10, we decided to not consider those probes regulated only in one 34 35 comparative analysis, as it happened using a threshold of twice for the minimum full change 36 37 38 (R=2.0), since those genes were slightly modified with a lower R-value (R=1.5) and became http://bmjopen.bmj.com/ 39 40 unselected and no significant by increasing the minimum full change threshold (i.e. R=2.0). 41 42 After that, we established 5 groups of classification for a probe to be regulated after CoQ10 43 44 45 supplementation (supplementary figure 1 online for a graphical interpretation and supplementary
46 on September 28, 2021 by guest. Protected copyright. 47 table 2 online for full details). Around half of the regulated probes in CoQ10-deficiency were 48 49 unaffected after the treatment with CoQ , whereas most of the 50% that changed the gene 50 10 51 52 expression did not affect the relative pattern respect control fibroblasts. Only the 20% restored 53 54 completely the gene expression after CoQ10 supplementation and the 3% shift their expression 55 56 57 showing an opposite regulation than in CoQ10-deficiency. The 72% of the probes in CoQ10 58 59 deficiency kept a similar gene expression pattern in the presence of CoQ10 respect to control 60 fibroblasts.
4 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 59 of 110 BMJ Open
1 2 Also, we looked the highly regulated genes in the CoQ10-deficiency listed in table 1 to see if the 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 supplementation with CoQ modify, restore or even alter more their expression. Almost all the 5 10 6 7 genes were regulated in one patient or treatment, although only 73% of the known genes listed in 8 9 table 2 were regulated according to the previously described groups of classification (75 classified 10 11 12 out of 103 known genes). The 54% of the classified genes restored the control expression level after 13 14 the treatment either partially (19%, 14 out of 75) or completely (35%, 26 of the 75), whereas the 15 16 27% kept their regulation as it happened in CoQ10-deficiency (20 out of 75). The 13% of the genes 17 For peer review only 18 19 (10 out of 75) presented an opposite regulation in the presence of CoQ10 respect to that in CoQ10- 20 21 deficiency, and the 5% of them (4 out of 75) amplified the altered gene expression showed by the 22 23 patient fibroblasts, whereas only 1% of the regulated in CoQ -deficiency (1 out of 75) were CoQ - 24 10 10 25 26 specific regulated after the treatment. Such changes had been next discussed in the main text. 27 28 To get a biological meaning of such changes, we decided to study the gene ontologies (GO) 29 30 31 regulated by CoQ10 supplementation in CoQ10 deficient fibroblasts within each group of 32 33 classification, using the GORILLA software (Gene Ontology enrichment analysis and visualization 34 35 tool) [2]. After the statistical analysis we got 70 regulated GO with a significant P-value<0.001 and 36 37 38 a given enrichment value that represents the more altered GO within each group of classification http://bmjopen.bmj.com/ 39 40 (supplementary table 5 online). A positive enrichment value signified that CoQ10 supplementation 41 42 kept activated the expression of the gene included within the selected GO, whereas a negative value 43 44 45 meant that the expression was kept down.
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 Full description of genes, biological process and pathways regulated in CoQ deficiency. 50 10 51 52 Related to energy production: 53 54 Three mitochondrial genes were included within the most altered listed in table 2. One of 55 56 57 these,C7orf55, is directly involved in the formation of complex I and was down-regulated, in 58 59 agreement with the general repression of mitochondrial respiration. The other two mitochondrial- 60
5 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 60 of 110
1 2 targeted genes, BRP44 and C10orf58, also showed altered expression but their functions are still 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 unknown. 5 6 7 Related to lipid metabolism: 8 9 Cholesterol metabolism was highly repressed in CoQ10-deficient fibroblasts and multiple enzymes 10 11 12 were affected, including enzymes involved directly in cholesterol biosynthesis (FTFT1, IDI1), their 13 14 regulators (CH25H, RSAD2), regulators of cholesterol concentration inside the cell (INSIG1, 15 16 LDLR), and enzymes that catalyze the rate-limiting step in the biosynthetic pathway of both sterols 17 For peer review only 18 19 (SQLE) and unsaturated fatty acids (SCD). Overall, ß-oxidation of fatty acids was unaffected, but 20 21 genes acting on its regulation decreased by 50%. The repressed enzymes of lipid metabolism and 22 23 fatty acids ß-oxidation remained down-regulated after CoQ supplementation (table 2), although 24 10 25 26 the repressed key regulator proteins (CH25H and the insulin-inducible gene INSIG1) that control 27 28 cholesterol concentration inside the cell inverted their expression levels and appeared highly up- 29 30 31 regulated by treatment. 32 33 Related to insulin metabolism: 34 35 Two peptidases involved in the processing of both proinsulin and other prohormones (CPE, selected 36 37 38 twice in the array with two different probes) and in the cleavage of insulin-like growth factor http://bmjopen.bmj.com/ 39 40 binding proteins (PAPPA) were highly activated, whereas a convertase (PCSK2, also selected 41 42 twice) involved in the regulation of insulin biosynthesis was highly repressed (Table 2). Also, a 43 44 45 liver-specific glycogen phosphorylase (PYGL), responsible for glucose mobilization, was
46 on September 28, 2021 by guest. Protected copyright. 47 repressed. These two latter genes shift their expression to either up-regulation or to control levels 48 49 after CoQ supplementation. 50 10 51 52 Related to cell cycle: 53 54 Specifically, genes involved in cell cycle activation and maintenance were up-regulated, including 55 56 57 mitogen, growth factors and receptors (VEGFA, POSTN, SEMA5A), intracellular activators for 58 59 MAP-kinase pathway that enhances cell proliferation and reduces differentiation (AEBP1, CSRP2, 60 DOK5, MID1), and transcriptional activators that mediate growth factor activity and inhibit
6 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 61 of 110 BMJ Open
1 2 differentiation (CHURC1, CREG1, RUNX1). In contrast, genes involved in cell cycle regulation 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 increased or decreased their expression depending of their activating or repressing roles (Table 2). 5 6 7 Furthermore, both a mediator of anti-proliferative signals (IFITM1) and a transcriptional repressor 8 9 of cell division (BHLHB5) were down-regulated. This proliferative transcriptome is also facilitated 10 11 12 by the repression of cellular attachment factors (EDN1, MATN2, MCAM, MKX) and by the up- 13 14 regulation of extracellular matrix proteins that reduce cell attachment (PSG6, DCN, PKP4) and 15 16 favor cell division (EFEMP1, VCAN). 17 For peer review only 18 19 GO clusters favoring cell cycle and cell division were activated and those inhibiting cell growth 20 21 were repressed (Table 3). Thus, there was activation of DNA replication, mitosis, meiosis, synthesis 22 23 of microtubule components involved in cell division, such as spindle pole, segregation of 24 25 26 chromosomes, and the positive growth regulation. On the other hand, there was a general down- 27 28 regulation of biological processes related with nucleosome assembly, and chromosome organization 29 30 31 and biogenesis. This trend could be explained by the repression of Swi/Snf chromatin remodeling 32 33 apparatus, in which SMARCA1 and SMARCA4 components were specifically down-regulated in 34 35 all CoQ10-deficient fibroblasts (Table 2), thus preventing the cell cycle arrest that is induced by the 36 37 38 activation of p21 pathway by BRG1/SMARCA4 [3]. http://bmjopen.bmj.com/ 39 40 Related to differentiation: 41 42 Differentiation of these cells was compromised because of the down-regulation of factors necessary 43 44 45 for differentiation (BDNF, GRP, NTNG1, PTN), transcription factors expressed during
46 on September 28, 2021 by guest. Protected copyright. 47 development and morphogenesis (FOXQ1, HOXA11, HOXC9, LHX9, SP110), intracellular 48 49 transducers of development and morphogenesis (P2RY5, TSPAN10), antigens expressed on the 50 51 52 surface of differentiated cells (TSHZ1, EPSTI1), and structural proteins of cytoskeleton expressed 53 54 at the end of differentiation, such as keratin (KRT34) and tropomyosin (TPM1) (Tables 2). 55 56 57 Conversely, repressors of differentiation during development (FOXP1, LMCD1) were activated. 58 59 Follicle-stimulating hormone (FSH) stimulates the differentiation of germ cells [4] through the 60
activation of genes that are significantly down-regulated in CoQ10-deficient cells. Accordingly, the
7 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 62 of 110
1 2 FSH-suppressing hormone follistatin (FST) was increased in the same cells. FST inhibits both 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 development and morphogenic proteins function [5]. Finally, the maintenance of cell division is 5 6 7 supported by the fact that 47 of the 51 genes encoding for proteins involved in both DNA 8 9 replication and cell cycle progression behaved similarly to those genes regulated after the addition 10 11 12 of serum or growth factors to fibroblasts [6, 7]. 13 14 The gene expression profile of CoQ10-deficient fibroblasts was similar to that shown by different 15 16 cell models (supplementary table 5 online). CoQ10-deficient cells repressed CD31 and presented 17 For peer review only 18 19 similar gene expression profile than cells lacking CD31 [8], which maintains the non-differentiated 20 21 phenotype and stemness properties. Similarly, CoQ10-deficient cells showed the same pattern of 22 23 gene expression than (1) undifferentiated tumor cells compared to well-differentiated cancer cells 24 25 26 [9], (2) embryonic stem cells compared to differentiated brain and bone marrow cells [10], and (3) 27 28 immature lymphocytes compared to both mature CD4(+) T cells [11] and B-cells [12]. Also CoQ10- 29 30 31 deficient cells were regulated as hematopoietic stem cells, activating the mechanism to avoid the 32 33 replicative stress and bypass the senescence program [13]. 34 35 Related to cell survival and cell resistance: 36 37 38 Within the most regulated genes classified under these altered biological processes (Table 3), we http://bmjopen.bmj.com/ 39 40 note that several oxidoreductases that take part in xenobiotic and drug metabolism (CYP1B1, 41 42 MGC87042), a stress-induced protein (TMEM49), and a gene involved in the nucleotide excision 43 44 45 repair (RAD23B) were induced. Intracellular stress was controlled by activation of thioredoxin
46 on September 28, 2021 by guest. Protected copyright. 47 regulator (TXNIP) and of a kinase that activates the JAK/STAT pathway (SGK1), whereas an 48 49 inhibitor of this pathway (SOCS3) and Rho GTPase (RHOU) that induces the dissolution of stress 50 51 52 fibers through the JNK pathway were repressed. In parallel, tumor suppressor genes (AIM1 and 53 54 APCDD1), cell-surface antigens that facilitate apoptosis in tumor cells (MAGED1, MAGED4/4B), 55 56 57 and Rho GTPase (RAC2) that activates the intracellular signaling to induce apoptosis appeared 58 59 down-regulated. CoQ10-deficient fibroblasts also showed activation of a cell surface receptor that 60 inhibits apoptosis (TNFRSF10D) and of a modulator of Wnt signaling pathway that sends anti-
8 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 63 of 110 BMJ Open
1 2 apoptotic and pro-proliferative paracrine signals to adjacent cells (SFRP1). Furthermore, these cells 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 also showed repression of some effectors of cell death involved in cytoskeleton reassembly during 5 6 7 apoptosis (TRIM55) and of the interferon-induced genes that activate apoptosis (IFI6, and XAF1). 8 9 Gene expression pattern showed that CoQ10-deficient fibroblasts had a higher survival and stress 10 11 12 resistance, a phenomenon similar to the up-regulation of the drug-resistant gene profile in cancer 13 14 cells compared to chemo-sensitive cell lines [5], and to the down regulated and repressed pathways 15 16 in oxidative stress induced in epithelium cells [14]. Furthermore, CoQ10-deficient fibroblasts 17 For peer review only 18 19 showed a gene expression pattern that was opposite to that of fibroblasts treated with either 20 21 transforming growth factor-ß (TGF-ß) [15] or with the antitumor drug trabectedin [16, 17]. 22 23 Related to signalling: 24 25 26 Signaling pathways were also affected by CoQ10-deficiency (Table 2) through the activation of 27 28 genes, each selected three times in the statistical analysis, including a GTP-binding protein 29 30 31 (ARL4C) involved in transferrin recycling from early endosomes, a ubiquitin specific peptidase 32 33 with no peptidase activity (USP53), and a G-protein receptor (GABBR2) that inhibits adenilil 34 35 cyclase and activates phospholipase A2. A set of signaling genes were down regulated including a 36 37 38 G-protein (GNG2) and a guanine exchange factor for G-proteins (HERC6), a finding that agrees http://bmjopen.bmj.com/ 39 40 with the repression of GTPase activity and G-protein signaling showed in table 2. There was also 41 42 repression of a Rab effector (MLPH) involved in vesicular transport, an adaptor of cell surface 43 44 45 receptors to Tyrosine kinase (NCK2) that also interact with T-cell surface glycoproteins, and an
46 on September 28, 2021 by guest. Protected copyright. 47 effector protein (PARP14) induced by STAT6 during IL4 signaling in immune cells. However, the 48 49 molecular activator of Rho GTPase appeared activated, which could be related to the activation of 50 51 52 cytoskeleton for contraction as shown above. 53 54 Related to immunity: 55 56 57 CoQ10-deficient fibroblasts also showed a general inhibition of most immunity-related genes (Table 58 59 2), and of pathways and biological processes involved in immunity regulation (Table 3). Repressed 60 genes include cell surface antigens (CDC42SE2, LY6K), receptors and cytokines for immune
9 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 64 of 110
1 2 activation (GALNAC4S-6ST, TNFSF4, TRIM14), butyrophilin 3, an immunoglobulin associated to 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 milk fat droplets (BTN3A2, BTN3A3), several interferon-inducible genes of unknown function 5 6 7 (IFI27, IFI44L, IFIT1, IFIT3), and other genes whose products bind microtubules (IFI44), take part 8 9 in the immunoproteasome (PSMB9), activate immune cells during immune response (GBP1, 10 11 12 ISG15, MX1 and MX2), or control differentiation and induce apoptosis (OAS2 and OAS3). Both 13 14 OAS1 and OASL genes were also repressed but to a lesser extent. Other interferon-inducible 15 16 proteins markedly repressed in CoQ10-deficient fibroblast were described above and include the two 17 For peer review only 18 19 regulators of apoptosis (IFI6 and XAF1), the regulator of development (EPSTI1) and the inhibitor 20 21 of cell proliferation (IFITM1). Taken together, these findings support the concept that immune 22 23 response was generally repressed in CoQ -deficient cells (Table 3), such as the response to virus 24 10 25 26 and lymphocyte-T functions, including proliferation and activation. 27 28 CoQ10 supplementation restored the gene expression of almost all interferon-inducible genes to 29 30 31 control levels. This restoration mainly affects stress and immune responses and can be attributed to 32 33 the anti-inflammatory properties of CoQ10 [18, 19]. Treatment of fibroblasts with interleukin-6 [20] 34 35 or treatment of endothelial cells with interferon [21] induced a transcriptomic profile opposite to 36 37 38 that described for CoQ10-deficient fibroblasts because activated pathways with interleukin or http://bmjopen.bmj.com/ 39 40 interferon were repressed in CoQ10 deficiency. 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
10 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 65 of 110 BMJ Open
1 2 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 SUPPLEMENTARY METHODS 5 6 7 8 9 RNA extraction 10 11 12 Three groups of cells were cultured independently from each type of fibroblast prior to RNA 13 14 extraction. Each group of cells was then homogenized in 1 ml of Tripure Isolation Reagent (Roche) 15 16 and RNA was extracted with chloroform and precipitated with 2-propanol by centrifugation at 17 For peer review only 18 19 12000 g for 10 min at 4ºC. After washing with 75% EtOH, RNA was resuspended in DEPC-treated 20 21 water and treated with deoxyribonuclease I (Sigma) for removal of possible DNA contamination. 22 23 RNA was cleaned with the RNeasy® MinElute™ Cleanup kit (Qiagen), its concentration and purity 24 25 26 were checked spectrophotometrically, and its quality was verified electrophoretically. RNA was 27 28 stored at –20 ºC in RNase-free water. 29 30 31 32 33 Probe synthesis and hybridization with expression Arrays 34 35 A cRNA probe was synthesized and fragmented from each RNA sample using Affymetrix® 36 37 38 protocols and kits provided by Qiagen. Each cRNA probe was then hybridized to independent http://bmjopen.bmj.com/ 39 40 GeneChip® Human Genome U133 Plus 2.0 Array (Affymetrix), an expression array that covers 41 42 mainly at the 3’-end over 47000 transcripts and variants, representing around 39000 of the best 43 44 45 characterized human genes, plus another 9921 probes sets representing an extra 6500 new genes, all
46 on September 28, 2021 by guest. Protected copyright. 47 of them covered by 11 probes pairs per array. 48 49 Hybridization and high-quality scan of the arrays was performed with specific protocols and 50 51 52 equipment provided by Affymetrix as described previously[22]. To corroborate the previous results, 53 54 the same cDNA probes synthesized from both the control fibroblast and one of the patient samples 55 56 ® 57 were re-hybridizing with the GeneChip Human Gene 1.0 ST Array (Affymetrix), an exon- 58 59 expression arrays that offers whole-transcript coverage from each of the 28869 genes represented 60 on the array, each of them covered by approximately 26 probes spread across the full length of the
11 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 66 of 110
1 2 gene. For CoQ10 supplementation analyses, cDNA probes from treated and not supplemented 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 patient’s fibroblast were hybridized with the GeneChip® Human Gene 1.0 ST Array (Affymetrix). 5 6 7 Data had been deposited with the NCBI-GEO database, at http://www.ncbi.nlm.nih.gov/geo/, 8 9 accession number GSE33941 (this SuperSeries is composed of two subset Series, see 10 11 12 supplementary table 10 online for an explanation). 13 14 15 16 Q-RT-PCR 17 For peer review only 18 19 One μg of RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Biorad). Real Time 20 21 PCR was performed in triplicate in a MyiQ™ Single Color Real Time PCR Detection System 22 23 (Biorad) coupled to a Biorad conventional thermocycler. Primers for selected genes and the 24 25 26 housekeeping gene were designed with the Primer Premier 5 software (see supplementary table 11 27 28 online for primer sequences). Amplification was carried on with iQ SYBR Green supermix (Biorad) 29 30 31 with the following thermal conditions: 30 s at 95°C and 45 cycles of 30 s at 94°C, 30 s at 60°C and 32 33 30 s at 72°C. All the results were normalized to the levels of 18S rRNA. The raw fluorescence data 34 35 were extracted using Light Cycler data collection software version 3.5 (Roche) and analyzed 36 37 38 according to manufacturer’s instructions for baseline adjustment and noise reduction. http://bmjopen.bmj.com/ 39 40 41 42 Epigenetic analysis 43 44 45 DNA (CpG) methylation analysis is based on a base-specific cleavage reaction combined with mass
46 on September 28, 2021 by guest. Protected copyright. 47 spectrometric analysis (MassCLEAVE™). In brief, the method employs a T7-promoter-tagged 48 49 PCR amplification of bisulphite-converted DNA, followed by generation of a single-stranded RNA 50 51 52 molecule and subsequent base-specific cleavage (3′ to either rUTP or rCTP) by RNase A. The 53 54 mixture of cleavage products differing in length and mass are analyzed by MALDI-TOF-MS. 55 56 57 Differences in template DNA methylation profile will result in changes in nucleotide sequence after 58 59 bisulphite treatment, which in turn will yield different fragment masses in the assay. The abundance 60
12 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 67 of 110 BMJ Open
1 2 of each fragment (signal/noise level in the spectrum) is indicative of the amount of DNA 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 methylation in the interrogated sequence. 5 6 7 The previous Bisulfite treatment was done as follow. Genomic DNA sodium bisulfite conversion 8 9 was performed with 1 μg of genomic DNA by using EZ-96 DNA methylation kit (Zymo Research) 10 11 12 manufacturer's protocol. 13 14 The methylation assay was done as follow. Sequenom's MassARRAY platform was used to 15 16 perform quantitative methylation analysis. This system utilizes MALDI-TOF mass spectrometry in 17 For peer review only 18 19 combination with RNA base specific cleavage (MassCLEAVE). A detectable pattern is then 20 21 analyzed for methylation status. PCR primers for amplification of different regions of the genes 22 23 listed in table 2 were designed by using Epidesigner (Sequenom). When feasible, amplicons were 24 25 26 designed to cover CGIs in the same region as the 5′ UTR. For each reverse primer, an additional T7 27 28 promoter tag for in vivo transcription was added, as well as a 10-mer tag on the forward primer to 29 30 31 adjust for melting-temperature differences. 32 33 The PCRs were carried out in a 5 μl format with10 ng/ml bisulfite-treated DNA, 0.2 units of 34 35 TaqDNA polymerase (Sequenom), 1x supplied Taq buffer, and 200 mM PCR primers. 36 37 38 Amplification for the PCR was as follows: pre-activation of 95°C for 15 min, 45 cycles of 95°C http://bmjopen.bmj.com/ 39 40 denaturation for 20 s, 56°C annealing for 30 s, and 72°C extension for 30 s, finishing with a 72°C 41 42 incubation for 4 min. Dephosphorylation of unincorporated dNTPs was performed by adding 1.7 ml 43 44 45 of H2O and 0.3 units of shrimp alkaline phosphatase (Sequenom), incubating at 37°C for 20 min,
46 on September 28, 2021 by guest. Protected copyright. 47 then for 10 min at 85°C to deactivate the enzyme. 48 49 The MassCLEAVE biochemistry was performed as follows. Next, in vivo transcription and RNA 50 51 52 cleavage was achieved by adding 2 μl of PCR product to 5 μl of transcription/cleavage reaction and 53 54 incubating at 37°C for 3 h. The transcription/cleavage reaction contains 27 units of T7 R&DNA 55 56 57 polymerase (Sequenom), 0.64x of T7 R&DNA polymerase buffer, 0.22 μl T Cleavage Mix 58 59 (Sequenom), 3.14 mM DTT, 3.21 μl H2O, and 0.09 mg/ml RNase A (Sequenom). The reactions 60
13 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 68 of 110
1 2 will be additionally diluted with 20 ml of H2O and conditioned with 6 mg of CLEAN Resin 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 (Sequenom) for optimal mass-spectra analysis. 5 6 7 For the statistical analysis, amplicons covering the same gene were pooled together and the CpGs’ 8 9 methylation degree were analyzed with the MultiExperiment Viewer software developed by 10 11 12 Saeed[23]. ANOVA test was performed as follows: 3 groups (control, untreated CoQ10 deficient, 13 14 and CoQ10 deficient supplemented with CoQ10); alpha (overall threshold p-value) = 0.05; 15 16 significance determined by alpha with standard Bonferroni correction; and Pearson correlation for 17 For peer review only 18 19 clustering of samples and CpGs. 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
14 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 69 of 110 BMJ Open
1 2 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 SUPPLEMENTARY FIGURE LEGEND 5 6 7 8 9 10 11 12 13 14 Supplementary figure 1. Graphical view of gene regulation by CoQ10 supplementation in 15 16 CoQ10 deficiency. 17 For peer review only 18 19 The comparative analysis between CoQ10 deficient and control fibroblasts (P-Q), between untreated 20 21 and CoQ10 supplemented fibroblasts from patient with CoQ10 deficiency (PQ-P), and between 22 23 CoQ deficient cells treated with CoQ and control fibroblasts (PQ-P) gave 27 possibilities for a 24 10 10 25 26 probe to be or not to be regulated in one, two or in all the three comparative analyses, considering 27 28 that a regulated probe in a comparative analysis, being the probe activated or repressed, can be 29 30 31 regulated or not in the other comparative analyses. The 5 different groups of classification, 32 33 depending on effect of CoQ10 supplementation on gene expression in fibroblasts of patients 34 35 suffering CoQ10 deficiency, are listed in parallel and numbered between parentheses. For a table 36 37 38 with full details in number of genes in each category see supplementary table 8 online. The genes http://bmjopen.bmj.com/ 39 40 that were not classified into any of these groups were those that either slightly regulated the gene 41 42 expression in only one comparative analysis or even did not change the expression in any of them. 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 Supplementary Figure 2. Regulated genes in CoQ10 deficiency. 53 54 Functional representation of regulated genes in the syndrome of CoQ10 deficiency. Represented are 55 56 57 listed in table 1 and fully described in the text. Left schema represents a cell where are located all 58 59 the up-regulated genes, whereas all the repressed genes are located in the right schema. In red are 60
shown all the genes that both kept up their activation after CoQ10 supplementation and those
15 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 70 of 110
1 2 repressed in CoQ10 deficiency that CoQ10 activated so that they were up-regulated respect the 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 control; in green are shown all the genes that kept down their repression after CoQ 5 10 6 7 supplementation and those activated in CoQ10 deficiency that were repressed after the treatment 8 9 with CoQ10, being repressed now respect to the control; in blue are shown the regulated genes that 10 11 12 completely restored the expression to control level after the CoQ10 supplementation. 13 14 15 16 17 For peer review only 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
16 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 71 of 110 BMJ Open
1 2 SUPPLEMENTARY REFERENCES 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 6 1. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation 7 response. Proc Natl Acad Sci USA. 2001;98(9):5116-21. 8 2. Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z. GOrilla: a tool for discovery and visualization of enriched 9 GO terms in ranked gene lists. BMC Bioinformatics. 2009;10(1):48. 10 3. Hendricks KB, Shanahan F, Lees E. Role for BRG1 in Cell Cycle Control and Tumor Suppression. Mol Cell 11 Biol. 2004;24(1):362-76. 12 4. Ji Q, Liu PI, Chen PK, Aoyama C. Follicle stimulating hormone-induced growth promotion and gene 13 expression profiles on ovarian surface epithelial cells. International Journal of Cancer. 2004;112(5):803-14. 14 5. Sidis Y, Mukherjee A, Keutmann H, Delbaere A, Sadatsuki M, Schneyer A. Biological Activity of Follistatin 15 Isoforms and Follistatin-Like-3 Is Dependent on Differential Cell Surface Binding and Specificity for Activin, 16 Myostatin, and Bone MorphogeneticFor peer Proteins. Endocrinology. review 2006;147(7):3586- only97. 17 6. Kang H, Kim I, Park J, Shin Y, Ku J, Jung M, et al. Identification of genes with differential expression in 18 acquired drug-resistant gastric cancer cells using high-density oligonucleotide microarrays. Clin Cancer Res. 19 2004;1(10):272-84. 20 7. Weston GC, Haviv I, Rogers PAW. Microarray analysis of VEGF-responsive genes in myometrial endothelial 21 cells. Molecular Human Reproduction. 2002;8(9):855-63. 22 8. Boquest A, Shahdadfar A, Frønsdal K, Sigurjonsson O, Tunheim S, Collas P, et al. Isolation and transcription 23 profiling of purified uncultured human stromal stem cells: alteration of gene expression after in vitro cell culture. Mol 24 Biol Cell. 2005;16(3):1131-41. 25 9. Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, et al. Large-scale meta-analysis of 26 cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. 27 Proceedings of the National Academy of Sciences of the United States of America. 2004;101(25):9309-14. 28 10. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. "Stemness": Transcriptional Profiling of 29 Embryonic and Adult Stem Cells. Science. 2002;298(5593):597-600. 30 11. Lee MS, Hanspers K, Barker CS, Korn AP, McCune JM. Gene expression profiles during human CD4+ T cell 31 differentiation. International Immunology. 2004;16(8):1109-24. 32 12. Hoffmann R, Seidl T, Neeb M, Rolink A, Melchers F. Changes in gene expression profiles in developing B 33 cells of murine bone marrow. Genome Res. 2002;12(1):98-111. 34 13. Kamminga LM, Bystrykh LV, de Boer A, Houwer S, Douma J, Weersing E, et al. The Polycomb group gene 35 Ezh2 prevents hematopoietic stem cell exhaustion. Blood. 2006;107(5):2170-9. 36 14. Weigel AL, Handa JT, Hjelmeland LM. Microarray analysis of H2O2-, HNE-, or tBH-treated ARPE-19 cells. 37 Free Radic Biol Med. 2002;33(10):1419-32. 38 15. Verrecchia F, Chu M-L, Mauviel A. Identification of Novel TGF-β/Smad Gene Targets in Dermal Fibroblasts http://bmjopen.bmj.com/ 39 using a Combined cDNA Microarray/Promoter Transactivation Approach. Journal of Biological Chemistry. 40 2001;276(20):17058-62. 41 16. Martínez N, Sánchez-Beato M, Carnero A, Moneo V, Tercero JC, Fernández I, et al. Transcriptional signature 42 of Ecteinascidin 743 (Yondelis, Trabectedin) in human sarcoma cells explanted from chemo-naïve patients. 43 Molecular Cancer Therapeutics. 2005;4(5):814-23. 44 17. Wesolowski R, Budd GT. Use of chemotherapy for patients with bone and soft-tissue sarcomas. Cleve Clin J 45 Med. 2010;77(Suppl 1):S23-S6.
46 18. Schmelzer C, Lorenz G, Lindner I, Rimbach G, Niklowitz P, Menke T, et al. Effects of Coenzyme Q_10 on on September 28, 2021 by guest. Protected copyright. 47 TNF-α secretion in human and murine monocytic cell lines. BioFactors. 2007;31(1):35-41. 48 19. Turunen M, Wehlin L, Sjoberg M, Lundahl J, Dallner G, Brismar K, et al. beta2-Integrin and lipid 49 modifications indicate a non-antioxidant mechanism for the anti-atherogenic effect of dietary coenzyme Q10. Biochem 50 Biophys Res Commun. 2002;296(2):255-60. 51 20. Dasu MR, Hawkins HK, Barrow RE, Xue H, Herndon DN. Gene expression profiles from hypertrophic scar 52 fibroblasts before and after IL-6 stimulation. The Journal of Pathology. 2004;202(4):476-85. 53 21. Sana TR, Janatpour MJ, Sathe M, McEvoy LM, McClanahan TK. Microarray analysis of primary endothelial 54 cells challenged with different inflammatory and immune cytokines. Cytokine. 2005;29(6):256-69. 55 22. Fernández-Ayala D, Chen S, Kemppainen E, O'Dell K, Jacobs H. Gene Expression in a Drosophila Model of 56 Mitochondrial Disease. PLoS ONE. 2010;5(1):e8549. 57 23. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, et al. TM4 microarray software suite. 58 Methods in enzymology. 2006;411:134-93. Epub 2006/08/31. 59 60
17 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 72 of 110
1 2 3 4 SUPPLEMANTARY TABLES ONLINE BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 6 Table 1 Regulated probes in the mitochondrial syndrome of CoQ deficiency 7 10 8 9 Table 2 Regulation of energetic metabolism in CoQ10 deficiency 10 11 Table 3 Regulated genes in either primary (3A) or secondary (3B) deficiency classified into Gene Ontologies 12 13 Table 4 GO classification of regulated genes common to primary and secondary CoQ10 deficiency 14 15 Table 5 Regulated pathways in CoQ10 deficiency 16 17 Table 6 Regulated probesFor in CoQ10 -peerdeficient fibroblast review treated with 30 μM only 18 19 Table 7 Regulated probes in CoQ10-deficient fibroblast treated with 30 μM (expanded table) 20 21 Table 8 Classification groups of gene expression after CoQ10 supplementation 22 23 Table 9 GO classification of regulated genes in CoQ10-deficient fibroblasts supplemented with CoQ10 24 25 Table 10 Sample description during submission to NCBI-GEO (SuperSeries GSE33941) 26 27 Table 11 Primers used for Q-RT-PCR 28 29 Table 12 Selection of probes during filtering and statistical analysis in CoQ10 deficient fibroblast 30 31 Table 13 Coherence of changes in gene expression after the comparative analysis 32 33 Table 14 Coherence of changes in gene expression after the comparative analysis (expanded table) 34 Table 15 Pathology's gene expression similar to CoQ deficiency 35 10 36
37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
18 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 73 of 110 BMJ Open
1 2 Supplementary Table 1 3 4 Regulated probes in the mitochondrial syndrome of Coenzyme Q10 deficiency 5 6 (a) (b) (c) (d) (e) (f) Gene Symbol Gene Title Probe ID mean FC FC CoQ10 Q-RT-PCR CoQ10 7 Mitochondrial metabolism 8 C7orf55 chromosome 7 open reading frame 55 226780_s_at -2,1 0,4 nc - 9 BRP44 brain protein 44 202427_s_at 2,0 0,4 2,3 U 8,0 8,3 –2-fold 10 C10orf58 chromosome 10 open reading frame 58 224435_at -20,7 15,0 -1,6 pR 11 For peer review only 228155_at -18,2 14,7 -1,6 pR 12 NADH mobilization (unselected but regulated genes studied because their role in specific processes and pathways) 13 CYB561 cytochrome b561 209163_at -1,4 0,4 nc O 14 207986_x_at -1,3 0,3 15 209164_s_at -1,2 0,2 16 210816_s_at -1,2 0,2 http://bmjopen.bmj.com/ 17 18 217200_x_at -1,3 0,1 19 CYB5A cytochrome b5-A 209366_x_at -1,5 0,2 -1,5 U 20 207843_x_at -1,5 0,3 21 215726_s_at -1,3 0,1 22 217021_at -1,3 0,1 23 CYB5R1 cytochrome b5 reductase 1 202263_at -1,3 0,4 nc U 24 1560043_at -1,2 0,0 25 CYB5R2 cytochrome b5 reductase 2 220230_s_at -1,4 0,3 -1,9 on September 28, 2021 by guest. Protected copyright. U 26 CYB5R3 cytochrome b5 reductase 3 201885_s_at -1,3 0,1 -1,6 R 27 1554574_a_at -1,5 0,2 28 CYB5R4 cytochrome b5 reductase 4 219079_at -1,3 0,1 -1,6 R 29 Lipid metabolism 30 FDFT1 farnesyl-diphosphate farnesyltransferase 1 210950_s_at -2,4 0,2 -1,5 U -4,3 9,1 +2-fold 31 208647_at -2,2 0,3 -1,5 U 32 IDI1 isopentenyl-diphosphate delta isomerase 1 204615_x_at -2,2 0,2 nc U 33 208881_x_at -2,0 0,2 nc U 34 CH25H cholesterol 25-hydroxylase 206932_at -10,8 10,7 -3,2 O -1,3 0,1 –3-fold 35 RSAD2 radical S-adenosyl methionine domain containing 2 242625_at -6,8 6,0 (1,4) pR 36 INSIG1 insulin induced gene 1 201627_s_at -2,8 1,1 1,7 O 37 201626_at -2,4 0,9 1,7 O 38 LDLR low density lipoprotein receptor 202068_s_at -3,0 1,1 -1,8 pR 39 SQLE squalene epoxidase 209218_at -2,5 0,6 nc U 40 SCD stearoyl-CoA desaturase (delta-9-desaturase) 200832_s_at -3,3 1,4 nc U 41 Insulin metabolism 42 43 44 19 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 74 of 110
1 2 CPE carboxypeptidase E 201116_s_at 8,4 5,1 2,5 pR 3 201117_s_at 11,6 6,7 2,5 pR 4 PAPPA pregnancy-associated plasma protein A, pappalysin 224941_at 2,5 0,7 1,7 R 4,8 3,1 –5-fold 5 PCSK2 proprotein convertase subtilisin/kexin type 2 204869_at -56,6 48,8 -4,3 O 6 204870_s_at -94,3 107,8 -4,3 O 7 Other metabolism 8 SCIN scinderin 1552365_at -5,4 3,6 (-1,4) O 9 PYGL phosphorylase, glycogen; liver 202990_at -2,5 0,3 -1,6 R 10 SLC40A1 solute carrier family 40 (iron-regulated transporter) 223044_at 7,6 6,4 2,9 R 11 QPRT quinolinate phosphoribosyltransferaseFor peer review242414_at -3,4only 1,3 nc R 12 ATP8B1 ATPase, class I, type 8B, member 1 226302_at 2,4 0,5 nc pR 13 Cell cycle 14 POSTN periostin, osteoblast specific factor 210809_s_at 73,8 35,8 153,9 U 238,2 378,5 –20% 15 VEGFA vascular endothelial growth factor A 210512_s_at 2,9 1,8 nc - 16
SEMA5A semaphorin 5A 205405_at 3,7 1,2 1,6http://bmjopen.bmj.com/ pR 17 213169_at 3,4 1,1 18 AEBP1 AE binding protein 1 201792_at 66,1 38,4 nc R 19 CSRP2 cysteine and glycine-rich protein 2 207030_s_at 4,8 1,2 (1,5) R 20 211126_s_at 5,6 1,6 21 DOK5 docking protein 5 214844_s_at 6,5 2,0 1,6 U 22 MID1 midline 1 (Opitz/BBB syndrome) 203636_at 3,9 1,7 4,4 U 23 24 CHURC1 churchill domain containing 1 226736_at 3,5 0,4 nc - 25 CREG1 repressor 1 of E1A-stimulated genes 201200_at 3,0 0,8 (1,3) on September 28, 2021 by guest. Protected copyright. R 26 RUNX1 runt-related transcription factor 1 (aml1 oncogene) 209360_s_at 1,9 0,4 1,6 - 27 BHLHB5 basic helix-loop-helix domain containing, class B, 5 228636_at -6,1 3,2 (-1,4) - 28 IFITM1 interferon induced transmembrane protein 1 (9-27) 214022_s_at -3,9 1,8 -3,7 O 29 201601_x_at -3,6 1,6 -3,7 O 30 EDN1 endothelin 1 218995_s_at -3,0 1,4 nc U 31 MATN2 matrilin 2 202350_s_at -9,2 1,7 nc U 32 MCAM melanoma cell adhesion molecule 210869_s_at -7,7 5,2 -3,0 R -10,9 8,4 +10% 33 211340_s_at -5,6 2,5 -3,0 R 34 MKX mohawk homeobox 241902_at -4,5 2,7 (-1,5) - 35 PSG6 pregnancy specific beta-1-glycoprotein 6 209738_x_at 2,6 0,6 nc - 36 DCN decorin 209335_at 2,0 0,4 -1,6 - 37 PKP4 plakophilin 4 201928_at 2,0 0,2 (1,4) U 38 EFEMP1 EGF-containing fibulin-like extracellular matrix protein 1 201843_s_at 15,2 18,1 2,2 pR 39 201842_s_at 11,2 10,8 2,2 pR 40 VCAN versican 204620_s_at 2,8 1,0 2,7 - 4,6 3,8 +10% 41 Cell cycle (unselected but regulated genes studied because their role in specific processes and pathways) 42 SMARCA1 component of SWI/SNF chromatin comlplex, member A1 203875_at -1,3 0,1 nc pR 43 44 20 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 75 of 110 BMJ Open
1 2 203873_at -1,3 0,1 3 203874_s_at -1,2 0,1 4 215294_s_at -1,2 0,1 5 SMARCA4 component of SWI/SNF chromatin comlplex, member A4 214360_at -3,8 1,1 nc pR 6 213719_s_at -1,9 0,6 7 1569073_x_at -1,6 0,2 8 215714_s_at -1,4 0,2 9 212520_s_at -1,4 0,2 10 208794_s_at -1,3 0,1 11 For peer review213720_s_at - 1,3only 0,2 12 214728_x_at -1,3 0,0 13 208793_x_at -1,2 0,0 14 CDK6 Cyclin-dependent kinase 6, overexpressed in tumor 224851_at 1,3 0,1 2,9 U 15 224847_at 1,5 0,4 16
243000_at 1,4 0,1 http://bmjopen.bmj.com/ 17 CDKN1A p21, inhibitor of CDK 202284_s_at -15,0 22,2 -2,1 U 18 1555186_at -3,4 2,8 19 CDKN1C p57, inhibitor of CDK 213183_s_at -3,1 1,4 -1,3 R 20 213182_x_at -2,9 1,0 21 213348_at -2,8 1,9 22 219534_x_at -2,2 0,9 23 24 216894_x_at -2,2 1,0 25 CDKN3 inhibitor of CDK, overexpressed in cancer cells 209714_s_at 1,8 0,5 2,7 on September 28, 2021 by guest. Protected copyright. U 26 1555758_a_at 1,9 0,5 27 CD31 cell surface antigen 208982_at -2,2 0,6 -1,5 R 28 208983_s_at -1,7 0,6 29 1559921_at -1,5 0,3 30 RB1 retinoblastoma protein 211540_s_at -1,5 0,5 nc R 31 203132_at -1,3 0,4 32 E2F7 E2F transcription factor 7 228033_at 3,6 3,1 nc U 33 E2F8 E2F transcription factor 8 219990_at 2,2 0,4 nc U 34 FST follistatin 226847_at 2,3 1,0 1,4 O 35 207345_at 3,2 2,2 36 204948_s_at 2,4 1,0 37 Development and differentiaton 38 BDNF brain-derived neurotrophic factor 206382_s_at -2,9 1,0 nc pR 39 GRP gastrin-releasing peptide 206326_at - 396,6 nc - 40 263,6 41 NTNG1 netrin G1 236088_at -8,3 5,8 1,8 U 42 PTN pleiotrophin (neurite growth-promoting factor 1) 211737_x_at -2,7 1,3 nc R 43 44 21 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 76 of 110
1 2 FOXQ1 forkhead box Q1 227475_at -6,5 1,6 nc - 3 HOXA11 homeobox A11 213823_at -4,3 1,8 -2,4 U 4 HOXC9 homeobox C9 231936_at -4,8 2,1 -2,0 U 5 LHX9 LIM homeobox 9 1562736_at -93,0 106,2 -1,5 U 6 SP110 SP110 nuclear body protein 223980_s_at -2,5 0,4 nc pR 7 P2RY5 purinergic receptor P2Y, G-protein coupled, 5 218589_at -4,4 1,5 (-1,3) pR 8 TSPAN10 tetraspanin 10 223795_at -10,1 4,9 nc - 9 EPSTI1 Epithelial stromal interaction 1 235276_at -5,9 5,6 (-1,4) R 10 227609_at -4,4 4,3 (-1,4) R 11 TSHZ1 teashirt zinc fingerFor homeobox 1 peer review223283_s_at -3,0only 1,2 nc R 12 223282_at -2,5 0,9 nc R 13 KRT34 keratin 34 206969_at -5,3 3,5 -7,6 R -5,7 4,3 –60% 14 TPM1 tropomyosin 1 (alpha) 206117_at -1,8 0,1 1,7 - 15 FOXP1 forkhead box P1 224837_at 2,3 0,3 nc - 16
LMCD1 LIM and cysteine-rich domains 1 218574_s_at 3,8 1,6 nchttp://bmjopen.bmj.com/ U 17 Cell resistance to stress 18 CYP1B1 cytochrome P450, family 1B, polypeptide 1 202436_s_at 4,0 1,8 (1,5) - 7,0 5,6 –5-fold 19 202437_s_at 3,7 1,6 (1,5) - 20 202435_s_at 4,7 2,4 (1,5) - 21 MGC87042 similar to Six epithelial antigen of prostate 217553_at 12,2 4,9 - R 22 TMEM49 transmembrane protein 49 /// microRNA 21 220990_s_at 1,9 0,2 nc - 23 24 RAD23B RAD23 homolog B (S. cerevisiae) 201223_s_at 2,2 0,4 nc R 25 TXNIP thioredoxin interacting protein 201010_s_at 2,0 0,5 -4,9 on September 28, 2021 by guest. Protected copyright. - 26 SGK1 serum/glucocorticoid regulated kinase 1 201739_at 3,4 1,2 (1,5) - 27 SOCS3 suppressor of cytokine signaling 3 227697_at -3,6 1,2 nc R 28 RHOU ras homolog gene family, member U 223168_at -8,3 6,5 nc O 29 Apoptosis 30 AIM1 absent in melanoma 1 212543_at -4,5 3,2 (-1,4) O 31 APCDD1 adenomatosis polyposis coli down-regulated 1 225016_at -6,4 4,5 -1,8 O 32 MAGED1 melanoma antigen family D, 1 209014_at -1,7 0,1 nc U 33 MAGED4 / 4B melanoma antigen family D, 4 / 4B 223313_s_at -5,0 3,2 -1,6 U 34 RAC2 small GTP binding protein Rac2 (rho family) 213603_s_at -2,3 0,5 (-1,3) U 35 TRIM55 tripartite motif-containing 55 236175_at -11,7 1,2 -1,6 U 36 IFI6 interferon, alpha-inducible protein 6 204415_at -4,9 1,3 (-1,3) R 37 XAF1 XIAP associated factor-1 228617_at -3,0 1,2 (-1,5) R 38 TNFRSF10D tumor necrosis factor receptor superfamily 10D 227345_at 2,4 0,4 2,6 U 15,1 15,1 +20% 39 SFRP1 secreted frizzled-related protein 1 202037_s_at 8,7 4,3 2,5 U 11,8 7,4 –2-fold 40 Signalling 41 ARL4C ADP-ribosylation factor-like 4C 202208_s_at 3,6 1,3 1,6 pR 42 202206_at 3,6 1,1 1,6 pR 43 44 22 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 77 of 110 BMJ Open
1 2 202207_at 4,2 1,2 1,6 pR 3 USP53 ubiquitin specific peptidase 53 237465_at 3,6 0,6 1,7 - 4 230083_at 4,5 1,0 1,7 - 5 231817_at 4,8 1,0 1,7 - 6 GABBR2 gamma-aminobutyric acid (GABA) B receptor, 2 209990_s_at 13,8 10,1 2,0 U 7 CNGA3 cyclic nucleotide gated channel alpha 3 207261_at -67,3 73,8 nc - 8 GNG2 G-protein, gamma 2 224964_s_at -4,2 2,3 (1,4) pR 9 HERC6 hect domain and RLD 6 219352_at -7,4 3,5 (-1,4) R 10 MLPH melanophilin 218211_s_at -8,5 7,2 -1,9 R 11 NCK2 NCK adaptor Forprotein 2 peer review203315_at -1,7only 0,1 nc - 12 PARP14 poly (ADP-ribose) polymerase family, member 14 224701_at -3,1 0,3 (-1,5) - 13 Immunity 14 CDC42SE2 CDC42 small effector 2 229026_at -2,8 0,3 nc - 15 LY6K lymphocyte antigen 6 complex, locus K 223687_s_at -4,7 2,4 (1,4) - 16
GALNAC4S-6ST B cell RAG associated protein 203066_at -17,3 9,6 -2,5http://bmjopen.bmj.com/ O 17 TNFSF4 tumor necrosis factor superfamily, member 4 207426_s_at -5,9 5,1 nc - 18 TRIM14 tripartite motif-containing 14 203148_s_at -4,5 2,2 nc - 19 BTN3(A2/A3) butyrophilin3 (A2/A3) 204820_s_at -2,0 0,6 (-1,3) R 20 IFI27 interferon, alpha-inducible protein 27 202411_at -9,8 10,1 nc O 21 IFI44 interferon-induced protein 44 214453_s_at -3,3 1,0 -2,3 R 22 IFI44L interferon-induced protein 44-like 204439_at -15,0 12,5 -1,9 R 23 24 IFIT1 interferon-induced protein (tetratricopeptide repeats 1) 203153_at -5,3 2,6 nc - 25 IFIT3 interferon-induced protein (tetratricopeptide repeats 3) 204747_at -3,5 1,0 -1,7 on September 28, 2021 by guest. Protected copyright. R 26 GBP1 guanylate binding protein 1, interferon-inducible 242907_at -2,7 0,2 - - 27 ISG15 ISG15 ubiquitin-like modifier 205483_s_at -6,4 3,5 nc R 28 MX1 myxovirus resistance 1 202086_at -7,4 5,5 -1,8 pR 29 MX2 myxovirus resistance 2 204994_at -6,1 2,3 -3,0 pR 30 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa 204972_at -6,2 1,7 -1,6 R 31 OAS3 2'-5'-oligoadenylate synthetase 3, 100kDa 218400_at -3,6 1,1 (-1,3) R 32 PSMB9 proteasome subunit, beta type, 9 204279_at -1,8 0,2 nc U 33 Immunity (unselected but regulated genes studied because their role in specific processes and pathways) 34 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 202869_at -5,5 2,8 -4,9 R 35 205552_s_at -4,7 2,2 36 OASL 2'-5'-oligoadenylate synthetase-like 205660_at -3,4 0,8 -2,6 R 37 210797_s_at -2,8 0,8 38 Genes of unknown function 39 --- Unknown gene 1567575_at -5,2 1,1 - - 40 --- Unknown gene 244503_at -4,8 1,0 - - 41 --- Unknown gene 230175_s_at -2,7 0,6 - - 42 --- Unknown gene 228049_x_at -2,5 1,0 - - 43 44 23 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 78 of 110
1 2 --- Unknown gene 235274_at -3,2 2,2 - - 3 C7orf58 chromosome 7 open reading frame 58 228728_at 2,2 0,4 nc - 4 C9orf150 chromosome 9 open reading frame 150 227443_at 2,5 0,5 (1,5) - 5 FAM43A family with sequence similarity 43, member A 227410_at -4,7 3,0 -2,9 U 6 FLJ37228 Unknown gene 1556641_at -12,5 9,2 - - 7 FLJ41747 hypothetical gene supported by AK123741 239153_at -27,9 12,3 - - 8 KIAA1199 KIAA1199 212942_s_at 1,7 0,1 nc - 9 LOC283666 Unknown gene 226682_at 2,8 0,5 - - 10 LOC730259 Unknown gene 239624_at -19,3 17,3 - - 11 TMEM106B transmembraneFor protein 106B peer review218930_s_at -1,9only 0,2 - - 12 TMEM106B transmembrane protein 106B 226529_at -2,0 0,5 - - 13 14 (a) Probe ID in Affymetrix GeneChip® Human Genome U133 Plus 2.0 Array 15 (b) mean +/- sd corresponding to the values of FC of each sample (SAM analysis; R=1,5; FDR=0%) 16 (c) 17 Full change in the comparative analysis ran with Affymetrix Gene Chip® Human Gene 1.0 ST Array. In parenthesis, FC of non-significathttp://bmjopen.bmj.com/ / non-selected genes. Genes with no change (nc) 18 (d) 19 Effect of coenzyme CoQ10 supplementation on gene expression in CoQ10 deficiency (more information in table 3 and in the text): unaffected genes by CoQ10 treatment (U); genes 20 that restored the expression either partial (pR) or completely (R); genes with opposite regulation than in CoQ10 deficiency (O); and specificaly regulated genes only after CoQ10 supplementation (S). Genes non-afected by CoQ supplementation (-). 21 10 (e) 22 Full change in gene expression analyzed by quantitative real time PCR (Q-RT-PCR). (f) 23 Effect of coenzyme Q10 supplementation on mRNA levels analyzed by Q-RT-PCR. 24 25 on September 28, 2021 by guest. Protected copyright. 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 24 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 79 of 110 BMJ Open
1 2 Supplementary table 2 3 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 Regulation of energetic metabolism in CoQ10 deficiency 5 6 7 Gene Ontology / Description mean FC (a) # genes (b) Q-effect (c) 8 Glycolysis 9 glycolysis, overall 10 catalitic steps 1,5 27 (34) pR 10 glycolysis, step 1 - HK 1,4 6 (6) pR 11 glycolysis, step 2 - GPI -1,2 1 (1) U 12 glycolysis, step 3 - PFK 1,3 3 (3) U 13 glycolysis, step 4 - ALDOLASE 1,7 3 (4) pR 14 glycolysis, step 5 - TPI 1,4 1 (1) pR 15 glycolysis, step 6 - GAPDH 16 1,6 2 (2) pR 17 glycolysis, stepFor 7 - PGK peer review 1,5only 2 (2) pR 18 glycolysis, step 8 - PGAM 1,2 3 (6) pR 19 glycolysis, step 9 - ENOLASE 2,3 4 (7) pR 20 glycolysis, step 10 - PK 1,3 2 (2) pR 21 Lactate dehydrogenase 1,7 5 (5) R 22 Pyruvate dehydrogenase 2,2 4 (4) pR 23 negative regulation of glycolysis -1,3 1 (1) U 24 positive regulation of glycolysis 2,3 4 (4) pR 25 TCA cycle 26 TCA cycle, overall no change 29 (32) U 27 cytosolic isoenzymes of TCA no change 3 (3) U 28 mitochondrial isoenzymes of TCA -1,3 3 (3) pR 29 Fatty acid beta-oxidation 30 fatty acid beta oxidation no change 28 (28) U 31 fatty acid beta oxidation, regulation -1,5 10 (10) pR 32 OXPHOS 33 Respiratory chain - complex I -1,7 46 (64) O 34 Respiratory chain - complex II 1,2 4 (13) pR 35 Respiratory chain - complex III -1,3 7 (14) O 36 Respiratory chain - complex IV -1,5 3 (45) O 37 ATP synthase - complex V -1,4 (64) O 38 http://bmjopen.bmj.com/ 39 a 40 mean of Full Change corresponding to the values of each probe included in the Affymetrix Gene Chip® Human Gene 1.0 41 ST Array 42 43 b Number of genes analysed within each gene ontology. In parenthesis, number of probes. 44 45 c 46 Effect of coenzyme CoQ10 supplementation on gene expression in CoQ10 deficiency: unaffected genes by CoQ10 treatment on September 28, 2021 by guest. Protected copyright. 47 (U); genes that restored the expression either partial (pR) or completely (R); and genes with opposite regulation after CoQ10 48 supplementation than in CoQ10 deficiency (O). 49 50 51 52 53 54 55 56 57 58 59 60
25 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 80 of 110
1 2 3 Supplementary table 3A 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Regulated genes clasified in Gene Ontologies in primary CoQ deficiency 5 10 6
7 (1) (2) (3) 8 Gene Ontology Term P-value # genes # selected Enrichment 9 Immunity-related GO represed in primary CoQ10 deficiency 10 11 (*) GO:0001730 2'-5'-oligoadenylate synthetase activity 5,03E-07 3 3 124,8 12 (interferón-inducible) 13 GO:0035457 cellular response to interferon-alpha 9,36E-04 6 2 41,6 14 (*) GO:0045071 negative regulation of viral genome replication 4,30E-07 20 5 31,2 15 16 (*) GO:0048525 negative regulation of viral reproduction 4,30E-07 20 5 31,2 17 (*) GO:0060337 typeFor I interferon -peermediated signaling review pathway 5,14E only-20 65 16 30,7 18 19 (*) GO:0071357 cellular response to type I interferon 5,14E-20 65 16 30,7 20 (*) GO:0034340 response to type I interferon 6,74E-20 66 16 30,3 21 22 (*) GO:0045069 regulation of viral genome replication 3,11E-06 29 5 21,5 23 (*) GO:0009615 response to virus 2,76E-14 199 18 11,3 24 25 (*) GO:0060333 interferon-gamma-mediated signaling pathway 1,85E-04 66 5 9,5 26 27 (*) GO:0071346 cellular response to interferon-gamma 4,29E-04 79 5 7,9 28 GO:0050792 regulation of viral reproduction 7,41E-04 89 5 7,0 29 30 (*) GO:0019221 cytokine-mediated signaling pathway 1,46E-09 291 16 6,9 31 (*) GO:0071345 cellular response to cytokine stimulus 4,53E-09 361 17 5,9 32 33 (*) GO:0034097 response to cytokine stimulus 2,24E-08 454 18 5,0 34 GO:0002252 immune effector process 9,60E-04 194 7 4,5 35 36 GO:0002376 immune system process 7,36E-04 1141 20 2,2 37
Development-related GO represed in primary CoQ deficiency http://bmjopen.bmj.com/ 38 10 39 (*) GO:0042474 middle ear morphogenesis 4,44E-04 19 3 19,7 40 GO:0048598 embryonic morphogenesis 4,60E-04 283 9 4,0 41 42 GO:0044087 regulation of cellular component biogenesis 6,50E-04 297 9 3,8 43 44 (*) GO:0009653 anatomical structure morphogenesis 8,50E-07 1056 25 3,0 45 (*) GO:0045595 regulation of cell differentiation 6,21E-05 869 19 2,7
46 on September 28, 2021 by guest. Protected copyright. 47 (*) GO:0050793 regulation of developmental process 3,51E-04 1246 22 2,2 48 Cell response-related GO represed in primary CoQ10 deficiency 49 50 GO:2000242 negative regulation of reproductive process 4,39E-05 49 5 12,7 51 (*) GO:0051707 response to other organism 1,24E-10 327 18 6,9 52 53 (*) GO:0009607 response to biotic stimulus 5,00E-10 502 21 5,2 54 (*) GO:0051704 multi-organism process 3,56E-08 763 23 3,8 55 56 (*) GO:0044419 interspecies interaction between organisms 8,61E-04 374 10 3,3 57 (*) GO:0071310 cellular response to organic substance 1,16E-05 989 22 2,8 58 59 (*) GO:0070887 cellular response to chemical stimulus 3,57E-05 1225 24 2,4 60 (*) GO:0010033 response to organic substance 1,25E-04 1588 27 2,1 (*) GO:0007166 cell surface receptor signaling pathway 5,90E-05 1875 31 2,1
26 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 81 of 110 BMJ Open
1 2 (*) GO:0042221 response to chemical stimulus 1,00E-05 2345 38 2,0 3
Metabolism-related GO represed in primary CoQ deficiency BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 10 5 GO:0060700 regulation of ribonuclease activity 1,90E-04 3 2 83,2 6 7 GO:0070566 adenylyltransferase activity 4,44E-04 19 3 19,7 8 (*) GO:0016126 sterol biosynthetic process 6,19E-07 39 6 19,2 9 10 (*) GO:0006695 cholesterol biosynthetic process 6,06E-06 33 5 18,9 11 GO:0008299 isoprenoid biosynthetic process 5,19E-04 20 3 18,7 12 13 GO:0003725 double-stranded RNA binding 2,88E-04 40 4 12,5 14 (*) GO:0008203 cholesterol metabolic process 1,06E-07 100 9 11,2 15 16 (*) GO:0016125 sterolFor metabolic peerprocess review1,90E only-07 107 9 10,5 17 (*) GO:0006694 steroid biosynthetic process 2,01E-05 104 7 8,4 18 19 GO:0008202 steroid metabolic process 9,21E-05 228 9 4,9 20 GO:0006066 alcohol metabolic process 1,12E-04 234 9 4,8 21 22 GO:0016053 organic acid biosynthetic process 5,47E-04 231 8 4,3 23 24 GO:0046394 carboxylic acid biosynthetic process 5,47E-04 231 8 4,3 25 GO:0008610 lipid biosynthetic process 7,04E-05 390 12 3,8 26 27 Cellular location-related GO represed in primary CoQ10 deficiency 28 (*) GO:0005829 cytosol 2,71E-05 2165 35 2,0 29 30 Development-related GO activated in primary CoQ10 deficiency 31 GO:0060343 trabecula formation 5,07E-06 20 4 34,0 32 33 GO:0048640 negative regulation of developmental growth 2,80E-04 22 3 23,2 34 GO:0001837 epithelial to mesenchymal transition 7,90E-05 39 4 17,4 35 36 GO:0002053 positive regulation of mesenchymal cell 9,48E-04 33 3 15,5 37 proliferation 38 GO:0060688 regulation of morphogenesis of a branching 1,39E-04 45 4 15,1 http://bmjopen.bmj.com/ 39 structure 40 GO:0045766 positive regulation of angiogenesis 8,43E-05 76 5 11,2 41 (*) GO:0045765 regulation of angiogenesis 1,94E-05 141 7 8,4 42 43 (*) GO:0001871 pattern binding 1,41E-06 185 9 8,3 44 (*) GO:1901342 regulation of vasculature development 3,15E-05 152 7 7,8 45
46 GO:2000027 regulation of organ morphogenesis 4,97E-04 111 5 7,7 on September 28, 2021 by guest. Protected copyright. 47 48 GO:0007389 pattern specification process 1,43E-04 331 9 4,6 49 GO:0051093 negative regulation of developmental process 3,29E-04 453 10 3,8 50 51 (*) GO:0022603 regulation of anatomical structure morphogenesis 2,20E-04 516 11 3,6 52 GO:0009888 tissue development 6,37E-04 493 10 3,5 53 54 (*) GO:0009653 anatomical structure morphogenesis 1,28E-04 1056 17 2,7 55 (*) GO:2000026 regulation of multicellular organismal 4,37E-04 955 15 2,7 56 development 57 Cell response-related GO activated in primary CoQ deficiency 58 10 59 GO:0009629 response to gravity 2,30E-05 10 3 51,0 60 GO:0034695 response to prostaglandin E stimulus 8,53E-05 15 3 34,0 GO:0034694 response to prostaglandin stimulus 2,09E-04 20 3 25,5
27 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 82 of 110
1 2 GO:0005109 frizzled binding 3,21E-04 23 3 22,2 3
GO:0007565 female pregnancy 2,10E-07 72 7 16,5 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 GO:0032874 positive regulation of stress-activated MAPK 2,45E-04 52 4 13,1 6 cascade 7 GO:0070304 positive regulation of stress-activated protein 2,64E-04 53 4 12,8 8 kinase signaling cascade 9 (*) GO:0008201 heparin binding 9,32E-06 126 7 9,4 10 (*) GO:0005539 glycosaminoglycan binding 5,99E-07 167 9 9,2 11 12 (*) GO:0030247 polysaccharide binding 1,41E-06 185 9 8,3 13 14 GO:0070482 response to oxygen levels 8,80E-07 227 10 7,5 15 GO:0001666 response to hypoxia 3,66E-05 213 8 6,4 16 17 GO:0036293 responseFor to decreased peer oxygen levels review 3,91E only-05 215 8 6,3 18 GO:0030246 carbohydrate binding 3,48E-04 373 9 4,1 19 20 GO:0016477 cell migration 1,68E-04 500 11 3,7 21 GO:0009628 response to abiotic stimulus 1,59E-05 710 15 3,6 22 23 GO:0040011 locomotion 5,70E-05 889 16 3,1 24 GO:0022414 reproductive process 4,57E-04 959 15 2,7 25 26 (*) GO:0048523 negative regulation of cellular process 1,90E-05 2476 31 2,1 27 (*) GO:0048519 negative regulation of biological process 1,54E-05 2704 33 2,1 28
29 Metabolism-related GO activated in primary CoQ10 deficiency 30 31 GO:0004720 protein-lysine 6-oxidase activity 2,04E-04 4 2 85,0 32 GO:0043627 response to estrogen stimulus 2,47E-04 149 6 6,8 33 34 GO:0045934 negative regulation of nucleobase-containing 8,75E-04 808 13 2,7 35 compound metabolic process 36 GO:0051172 negative regulation of nitrogen compound 9,79E-04 818 13 2,7 37 metabolic process 38 Cellular location-related GO activated in primary CoQ10 deficiency http://bmjopen.bmj.com/ 39 GO:0030199 collagen fibril organization 8,65E-04 32 3 15,9 40 41 GO:0005604 basement membrane 6,14E-04 66 4 10,3 42 (*) GO:0031012 extracellular matrix 1,51E-07 294 12 6,9 43 44 (*) GO:0005578 proteinaceous extracellular matrix 2,17E-05 198 8 6,9 45 GO:0044420 extracellular matrix part 4,85E-04 169 6 6,0 46 on September 28, 2021 by guest. Protected copyright. 47 GO:0005615 extracellular space 8,51E-06 761 16 3,6 48 GO:0048870 cell motility 3,74E-04 549 11 3,4 49 50 (*) GO:0044421 extracellular region part 6,38E-06 926 18 3,3 51 (*) GO:0007155 cell adhesion 2,91E-04 719 13 3,1 52 53 (*) GO:0022610 biological adhesion 2,91E-04 719 13 3,1 54 55 GO:0005576 extracellular region 8,03E-05 1226 19 2,6
56 Cell signalling-related GO activated in primary CoQ10 deficiency 57 58 GO:0005114 type II transforming growth factor beta receptor 6,79E-06 7 3 72,8 59 binding 60 GO:0090036 regulation of protein kinase C signaling cascade 7,06E-04 7 2 48,5 GO:0090037 positive regulation of protein kinase C signaling 7,06E-04 7 2 48,5 cascade
28 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 83 of 110 BMJ Open
1 2 GO:0005160 transforming growth factor beta receptor binding 1,51E-04 18 3 28,3 3
GO:0030514 negative regulation of BMP signaling pathway 5,81E-04 28 3 18,2 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 GO:0071560 cellular response to transforming growth factor 5,81E-04 28 3 18,2 6 beta stimulus 7 GO:0071559 response to transforming growth factor beta 8,65E-04 32 3 15,9 8 stimulus 9 GO:0007179 transforming growth factor beta receptor 5,30E-05 69 5 12,3 10 signaling pathway 11 GO:0090101 negative regulation of transmembrane receptor 4,84E-04 62 4 11,0 12 protein serine/threonine kinase signaling pathway 13 GO:0007178 transmembrane receptor protein serine/threonine 4,58E-04 109 5 7,8 14 kinase signaling pathway 15 (*) GO:0090092 regulation of transmembrane receptor protein 9,16E-04 127 5 6,7 16 serine/threonine kinase signaling pathway 17 For peer review only 18 (*) GO regulated simultaniusly in primary and secondary CoQ10 deficiency 19 20 (1) number of human genes within each gene ontology 21 (2) number of significantly regulated genes included within each gene ontology 22 23 (3) Gene Ontology Enrichment represents the selection of genes associated with a specific GO. It is calculated by GORILLA as 24 follows: E=(b/n)/(B/N), being "N" the total number of genes, "B" the total number of genes associated with a particular GO, "n" 25 the number of regulated genes for each analysis and "b" the number of regulated genes associated with a particular GO. 26 27 28 29 30 31 32 33 34 35 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
29 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 84 of 110
1 2 3 4 Suplementary table 3B BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 Regulated genes clasified in Gene Ontologies in secondary CoQ deficiency 6 7
8 (1) (2) (3) 9 Gene Ontology Term P-value # genes # selected Enrichment 10 Immunity-related GO represed in secondary CoQ10 deficiency 11 12 (*) GO:0001730 2'-5'-oligoadenylate synthetase activity 2,68E-04 3 2 70,05 13 (interferon-inducible) 14 GO:0019060 intracellular transport of viral proteins in host cell 8,83E-04 5 2 42,03 15 GO:0051708 intracellular protein transport in other organism 8,83E-04 5 2 42,03 16 involved in symbiotic interaction 17 (*) GO:0060337 typeFor I interferon -peermediated signaling review pathway 1,09E only-15 65 14 22,63 18 19 (*) GO:0071357 cellular response to type I interferon 1,09E-15 65 14 22,63 20 (*) GO:0034340 response to type I interferon 1,38E-15 66 14 22,29 21 22 (*) GO:0045071 negative regulation of viral genome replication 3,39E-05 20 4 21,01 23 (*) GO:0048525 negative regulation of viral reproduction 3,39E-05 20 4 21,01 24 25 (*) GO:0045069 regulation of viral genome replication 1,56E-04 29 4 14,49 26 (*) GO:0071346 cellular response to interferon-gamma 1,06E-04 79 6 7,98 27 28 (*) GO:0060333 interferon-gamma-mediated signaling pathway 4,09E-04 66 5 7,96 29 30 (*) GO:0009615 response to virus 5,67E-08 199 13 6,86 31 GO:0034341 response to interferon-gamma 3,08E-04 96 6 6,57 32 33 (*) GO:0071345 cellular response to cytokine stimulus 6,17E-08 361 17 4,95 34 (*) GO:0034097 response to cytokine stimulus 6,39E-08 454 19 4,4 35 36 Development-related GO represed in secondary CoQ10 deficiency 37 GO:2000648 positive regulation of stem cell proliferation 8,83E-04 5 2 42,03 38 http://bmjopen.bmj.com/ 39 (*) GO:0042474 middle ear morphogenesis 7,32E-04 19 3 16,59 40 (*) GO:0051704 multi-organism process 1,14E-05 763 21 2,89 41 42 GO:0045597 positive regulation of cell differentiation 9,75E-04 437 12 2,89 43 GO:0051094 positive regulation of developmental process 5,39E-04 593 15 2,66 44 45 (*) GO:0045595 regulation of cell differentiation 2,20E-04 869 20 2,42
46 on September 28, 2021 by guest. Protected copyright. 47 (*) GO:0009653 anatomical structure morphogenesis 1,62E-04 1056 23 2,29 48 (*) GO:2000026 regulation of multicellular organismal 7,36E-04 955 20 2,2 49 development 50 (*) GO:0050793 regulation of developmental process 7,00E-04 1246 24 2,02 51 52 GO:0051239 regulation of multicellular organismal process 7,89E-04 1567 28 1,88
53 Cell response-related GO represed in secondary CoQ10 deficiency 54 55 GO:0030581 symbiont intracellular protein transport in host 8,83E-04 5 2 42,03 56 GO:0071503 response to heparin 8,83E-04 5 2 42,03 57 58 GO:0071504 cellular response to heparin 8,83E-04 5 2 42,03 59 (*) GO:0051707 response to other organism 2,95E-06 327 14 4,5 60 (*) GO:0009607 response to biotic stimulus 1,39E-06 502 18 3,77 (*) GO:0044419 interspecies interaction between organisms 2,45E-04 374 12 3,37
30 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 85 of 110 BMJ Open
1 2 (*) GO:0071310 cellular response to organic substance 6,06E-05 989 23 2,44 3
GO:0042981 regulation of apoptotic process 3,94E-05 1098 25 2,39 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 GO:0043067 regulation of programmed cell death 4,51E-05 1107 25 2,37 6 7 GO:0010941 regulation of cell death 6,76E-05 1135 25 2,31 8 (*) GO:0070887 cellular response to chemical stimulus 8,76E-05 1225 26 2,23 9 10 (*) GO:0010033 response to organic substance 8,00E-05 1588 31 2,05 11 (*) GO:0042221 response to chemical stimulus 5,60E-05 2345 41 1,84 12 13 Metabolism-related GO represed in secondary CoQ10 deficiency 14 (*) GO:0016126 sterol biosynthetic process 1,69E-06 39 6 16,16 15 16 (*) GO:0006695 cholesterol biosynthetic process 1,40E-05 33 5 15,92 17 For peer review only GO:0071396 cellular response to lipid 2,30E-04 32 4 13,13 18 19 (*) GO:0008203 cholesterol metabolic process 4,97E-06 100 8 8,41 20 (*) GO:0016125 sterol metabolic process 8,23E-06 107 8 7,86 21 22 (*) GO:0006694 steroid biosynthetic process 4,74E-04 104 6 6,06 23 24 (*) GO:0019221 cytokine-mediated signaling pathway 1,21E-07 291 15 5,42
25 Cellular location-related GO represed in primary CoQ10 deficiency 26 27 (*) GO:0005829 cytosol 9,97E-04 2165 35 1,7 28 Cellular location-related GO represed in secondary CoQ10 deficiency 29 30 GO:0003924 GTPase activity 3,30E-05 210 10 5 31 GO:0019001 guanyl nucleotide binding 5,04E-04 348 11 3,32 32 33 GO:0032561 guanyl ribonucleotide binding 5,04E-04 348 11 3,32 34 (*) GO:0007166 cell surface receptor signaling pathway 6,95E-04 1875 32 1,79 35 36 Development-related GO activated in primary CoQ10 deficiency 37
GO:0072017 distal tubule development 3,68E-04 3 2 59,82 http://bmjopen.bmj.com/ 38 39 GO:0048569 post-embryonic organ development 7,30E-04 4 2 44,86 40 41 GO:0003206 cardiac chamber morphogenesis 8,25E-04 17 3 15,83 42 GO:0033688 regulation of osteoblast proliferation 8,25E-04 17 3 15,83 43 44 GO:0001944 vasculature development 5,96E-04 35 4 10,25 45 GO:0008406 gonad development 9,33E-07 93 9 8,68
46 on September 28, 2021 by guest. Protected copyright. 47 GO:0008584 male gonad development 1,09E-04 68 6 7,92 48 GO:0048608 reproductive structure development 1,41E-05 129 9 6,26 49 50 GO:0061138 morphogenesis of a branching epithelium 4,94E-05 117 8 6,14 51 (*) GO:0045765 regulation of angiogenesis 1,83E-04 141 8 5,09 52 53 GO:0001763 morphogenesis of a branching structure 1,92E-04 142 8 5,05 54 (*) GO:1901342 regulation of vasculature development 3,05E-04 152 8 4,72 55 56 GO:0001701 in utero embryonic development 3,79E-04 157 8 4,57 57 58 GO:0043009 chordate embryonic development 4,31E-04 160 8 4,49 59 GO:0009792 embryo development ending in birth or egg 5,28E-04 165 8 4,35 60 hatching GO:0002009 morphogenesis of an epithelium 4,94E-04 205 9 3,94 GO:0048729 tissue morphogenesis 1,99E-04 266 11 3,71
31 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 86 of 110
1 2 GO:0009790 embryo development 6,44E-04 258 10 3,48 3
GO:0048513 organ development 1,77E-06 831 26 2,81 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 4 5 (*) GO:0022603 regulation of anatomical structure morphogenesis 6,76E-04 516 15 2,61 6 7 GO:0048731 system development 1,95E-04 619 18 2,61 8 GO:0050878 regulation of body fluid levels 8,87E-04 530 15 2,54 9 10 GO:0051094 positive regulation of developmental process 9,93E-04 593 16 2,42 11 GO:0045595 regulation of cell differentiation 1,01E-04 869 23 2,37 12 13 GO:2000026 regulation of multicellular organismal 3,98E-04 955 23 2,16 14 development 15 (*) GO:0009653 anatomical structure morphogenesis 2,83E-04 1056 25 2,12 16 GO:0042127 regulation of cell proliferation 6,43E-04 1052 24 2,05 17 For peer review only 18 Cell response-related GO activated in secondary CoQ10 deficiency 19 GO:0071481 cellular response to X-ray 3,68E-04 3 2 59,82 20 21 GO:0046882 negative regulation of follicle-stimulating 7,30E-04 4 2 44,86 22 hormone secretion 23 GO:0004364 glutathione transferase activity 9,82E-04 18 3 14,95 24 GO:0017147 Wnt-protein binding 1,57E-04 25 4 14,36 25 26 GO:0036294 cellular response to decreased oxygen levels 1,29E-05 47 6 11,45 27 GO:0071456 cellular response to hypoxia 1,29E-05 47 6 11,45 28 29 GO:0071453 cellular response to oxygen levels 2,09E-05 51 6 10,56 30 31 Metabolism-related GO activated in secondary CoQ10 deficiency 32 GO:0007026 negative regulation of microtubule 9,82E-04 18 3 14,95 33 depolymerization 34 GO:0010951 negative regulation of endopeptidase activity 4,12E-04 121 7 5,19 35 36 GO:0010466 negative regulation of peptidase activity 4,78E-04 124 7 5,07 37 Cellular location-related GO activated in secondary CoQ10 deficiency 38 http://bmjopen.bmj.com/ 39 GO:0001569 patterning of blood vessels 2,48E-04 28 4 12,82 40 GO:0010811 positive regulation of cell-substrate adhesion 1,54E-04 46 5 9,75 41 42 GO:0010810 regulation of cell-substrate adhesion 6,51E-05 90 7 6,98 43 (*) GO:0005539 glycosaminoglycan binding 1,80E-05 167 10 5,37 44 45 GO:0031012 extracellular matrix 3,25E-08 294 17 5,19
46 on September 28, 2021 by guest. Protected copyright. (*) GO:0005578 proteinaceous extracellular matrix 1,38E-05 198 11 4,98 47 48 (*) GO:0008201 heparin binding 5,26E-04 126 7 4,98 49 (*) GO:0001871 pattern binding 4,33E-05 185 10 4,85 50 51 (*) GO:0030247 polysaccharide binding 4,33E-05 185 10 4,85 52 53 GO:0030155 regulation of cell adhesion 4,04E-04 243 10 3,69 54 (*) GO:0007155 cell adhesion 5,23E-05 719 21 2,62 55 56 (*) GO:0022610 biological adhesion 5,23E-05 719 21 2,62 57 (*) GO:0044421 extracellular region part 9,79E-05 926 24 2,33 58 59 Cell signalling-related GO activated in primary CoQ10 deficiency 60 (*) GO:0090092 regulation of transmembrane receptor protein 5,52E-04 127 7 4,95 serine/threonine kinase signaling pathway
(*) GO regulated simultaniusly in primary and secondary CoQ10 deficiency
32 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 87 of 110 BMJ Open
1 2 3 (1) number of human genes within each gene ontology 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 (2) number of significantly regulated genes included within each gene ontology 6 7 (3) Gene Ontology Enrichment represents the selection of genes associated with a specific GO. It is calculated by GORILLA as 8 follows: E=(b/n)/(B/N), being "N" the total number of genes, "B" the total number of genes associated with a particular GO, "n" 9 the number of regulated genes for each analysis and "b" the number of regulated genes associated with a particular GO. 10 11 12 13 14 15 16 17 For peer review only 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
33 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 88 of 110
1 2 3 Supplementary table 4 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 GO classification of regulated genes common to primary and secondary CoQ10 deficiency 6 7 Gene Ontology Term genes (a) significant (b) Z_Score 8 Mitochondrial metabolism 9 GO0009055 electron carrier activity 344 79 -2,2 10 GO0004777 succinate semialdehyde dehydrogenase activity 2 2 -2,1 11 GO0005739 mitochondrion 1132 625 -2,0 12 GO0006818 hydrogen transport 78 10 -1,7 13 GO0008137 NADH dehydrogenase (ubiquinone) activity 51 33 -1,7 14 GO0005746 mitochondrial respiratory chain 83 12 -1,6 15 GO0006099 tricarboxylic acid cycle 29 20 -1,3 16 GO0003954 NADH dehydrogenase activity 44 14 -1,3 17 For peer review only GO0042593 glucose homeostasis 52 19 -1,2 18 GO0005758 mitochondrial intermembrane space 34 5 0,6 19 GO0031304 intrinsic to mitochondrial inner membrane 5 1 0,6 20 21 GO0042720 mitochondrial inner membrane peptidase C 1 1 1,0 22 Lipid metabolism 23 GO0008395 steroid hydroxylase activity 17 1 -9,5 24 GO0016126 sterol biosynthetic process 26 18 -5,7 25 GO0006695 cholesterol biosynthetic process 32 19 -4,7 26 GO0006694 steroid biosynthetic process 71 34 -4,1 27 GO0004506 squalene monooxygenase activity 1 1 -3,1 28 GO0047598 7 dehydrocholesterol reductase activity 1 1 -3,1 29 GO0004312 fatty acid synthase activity 8 1 -2,6 30 GO0004313 acyl carrier protein s acetyltransferase 1 1 -2,6 31 GO0004314 acyl carrier protein s malonyltransferase 2 1 -2,6 32 GO0004315 3 oxoacyl acyl carrier protein synthase 2 1 -2,6 33 GO0004317 3 hydroxypalmitoyl acyl carrier protein 1 1 -2,6 34 GO0004319 enoyl acyl carrier protein reductase 1 1 -2,6 35 GO0004320 oleoyl acyl carrier protein hydrolase 2 1 -2,6 36 GO0010281 acyl acp thioesterase activity 2 1 -2,6 37 GO0004420 hydroxymethylglutaryl CoA reductase 1 1 -2,5 38 GO0001619 lysosphingolipid and lysophosphatidic acid receptor 15 10 -2,2 http://bmjopen.bmj.com/ 39 GO0030549 acetylcholine receptor activator activity 1 1 -2,2 40 GO0006636 unsaturated fatty acid biosynthetic process 39 1 -2,1 41 GO0016213 linoleoyl coa desaturase activity 1 1 -2,1 42 GO0006656 phosphatidylcholine biosynthetic process 14 6 -2,1 43 GO0006650 glycerophospholipid metabolic process 127 1 -1,9 44 GO0006678 glucosylceramide metabolic process 4 1 -1,9 45 GO0006681 galactosylceramide metabolic process 4 1 -1,9 46 GO0046459 short chain fatty acid metabolic process 5 1 -1,9 on September 28, 2021 by guest. Protected copyright. 47 GO0030169 low density lipoprotein binding 21 1 -1,9 48 GO0030229 very low density lipoprotein receptor activity 4 1 -1,9 49 GO0008299 isoprenoid biosynthetic process 22 10 -1,9 50 GO0047012 sterol 4 alpha carboxylate 3 dehydrogenase 1 1 -1,7 51 Cell cycle 52 GO0030308 negative regulation of cell growth 81 9 -1,2 53 GO0005720 nuclear heterochromatin 33 10 1,4 54 GO0006310 DNA recombination 77 28 1,5 55 GO0000793 condensed chromosome 28 15 1,7 56 57 GO0008094 dna dependent atpase activity 30 15 1,9 58 GO0005816 spindle pole body 2 1 1,5 59 GO0000922 spindle pole 23 7 1,9 60 GO0008608 attachment of spindle microtubules to kinetochore 8 1 2,0 GO0042393 histone binding 62 7 2,0 GO0007098 centrosome cycle 25 3 2,0 GO0007059 chromosome segregation 40 19 2,2
34 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 89 of 110 BMJ Open
1 2 GO0000070 mitotic sister chromatid segregation 38 5 2,3 3 GO0007140 male meiosis 22 5 2,5 4 GO0005874 microtubule 266 119 2,6 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 GO0006270 dna replication initiation 25 10 2,7 6 GO0000776 kinetochore 31 10 2,8 7 GO0007067 mitosis 199 103 3,2 8 GO0007126 meiosis 120 29 3,4 9 GO0051301 cell division 250 157 3,6 10 GO0000775 chromosome pericentric region 61 30 4,2 11 GO0006260 DNA replication 154 88 4,2 12 GO0007049 cell cycle 516 318 4,2 13 GO0045743 positive regulation of fibroblast growth 6 1 4,9 14 GO0045741 positive regulation of epidermal growth 6 1 6,5 15 Nucleosome and chromosome 16 GO0000786 nucleosome 120 62 -4,0 17 For peer review only GO0007001 chromosome organization and biogenesis 93 57 -4,0 18 GO0006334 nucleosome assembly 142 67 -3,4 19 GO0005694 chromosome 222 113 -2,4 20 GO0016514 swi or snf complex 11 6 -1,3 21
22 Development and differentiation 23 GO0021768 nucleus accumbens development 1 1 -5,5 24 GO0060166 olfactory pit development 2 1 -5,5 25 GO0048535 lymph node development 18 16 -3,4 26 GO0001886 endothelial cell morphogenesis 4 1 -2,9 27 GO0060014 granulosa cell differentiation 4 1 -2,2 28 GO0048389 intermediate mesoderm development 2 1 -2,0 29 GO0031017 exocrine pancreas development 6 1 -2,0 30 GO0045651 positive regulation of macrophage differentiation 6 2 -1,9 31 GO0030879 mammary gland development 8 14 -1,3 32 GO0045617 negative regulation of keratinocyte differentiation 3 1 2,3 33 GO0048706 embryonic skeletal development 85 1 4,9 34 Cell resistance and stress response 35 GO0006281 DNA repair 319 137 3,1 36 GO0003960 NADPH quinone reductase activity 4 2 1,9 37 GO0006974 response to DNA damage stimulus 201 133 2,3 38 GO0008630 DNA damage response signal transduction 23 10 2,3 http://bmjopen.bmj.com/ 39 GO0007256 activation of JNKK activity 5 3 3,2 40 GO0043506 regulation of JNK activity 51 1 2,1 41 Apoptosis and cell death 42 GO0043065 positive regulation of apoptosis 114 39 -3,4 43 GO0043071 positive regulation of cell death (non apoptotic) 2 1 -2,8 44 GO0005164 tumor necrosis factor receptor binding 93 15 -2,5 45 GO0008219 cell death 60 8 -1,6 46 GO0008629 induction of apoptosis by intracellular signals 22 8 -1,6 on September 28, 2021 by guest. Protected copyright. 47 Immune response 48 GO0009615 response to virus 98 27 -6,4 49 GO0006955 immune response 825 197 -5,5 50 GO0042098 T cell proliferation 27 8 -2,3 51 GO0019028 viral capsid 23 5 -1,3 52 GO0042130 negative regulation of T cell proliferation 20 10 1,2 53 GO0045190 isotype switching 25 6 1,5 54 Citosolic protein metabolism 55 GO0004298 threonine endopeptidase activity 36 18 -2,5 56 GO0005839 proteasome core complex 35 18 -2,5 57 58 GO0004298 threonine endopeptidase activity 21 18 -2,5 59 GO0004175 endopeptidase activity 47 31 -2,0 60 GO0015198 oligopeptide transporter activity 7 6 -2,0 GO0003756 protein disulfide isomerase activity 9 7 -1,8 GO0043234 protein complex 419 63 -1,7 GO0016567 protein ubiquitination 72 21 -1,2
35 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 90 of 110
1 2 GO0006461 protein complex assembly 171 44 -1,2 3 GO0008320 protein carrier activity 16 6 -1,1 4 GO0016023 cytoplasmic membrane-bounded vesicle 71 35 -2,5 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 GO0045921 positive regulation of exocytosis 15 1 -2,1 6 GO0006888 ER to golgi vesicle-mediated transport 41 44 -1,8 7 GO0030126 COPI vesicle coat 11 7 -1,4 8 GO0019894 kinesin binding 10 7 -1,1 9 GO0016939 kinesin II complex 1 1 -1,5 10 GO0006893 golgi to plasma membrane transport 10 3 2,9 11 Cytoskeleton metabolism 12 GO0008092 cytoskeletal protein binding 79 22 -1,8 13 GO0005862 muscle thin filament tropomyosin 4 3 -1,7 14 GO0030863 cortical cytoskeleton 38 5 -1,3 15 GO0031430 M line 11 1 0,7 16 GO0005863 striated muscle thick filament 3 16 1,2 17 For peer review only GO0006941 striated muscle contraction 45 24 1,7 18 GO0060052 neurofilament cytoskeleton organization 10 8 1,9 19 GO0031674 I band 60 4 2,2 20 GO0030017 sarcomere 101 11 2,3 21
22 Iron metabolism 23 GO0006826 iron ion transport 32 18 2,5 24 Other metabolism 25 GO0006164 purine nucleotide biosynthetic process 23 12 1,3 26 GO0008033 tRNA processing 68 29 1,4 27 GO0000049 tRNA binding 24 9 1,7 28 Intracellular signaling 29 GO0008589 regulation of smoothened signaling pathway 24 1 -5,1 30 GO0003924 GTPase activity 248 106 -3,2 31 GO0005886 plasma membrane 2727 391 -3,1 32 GO0031583 G protein signaling phospholipase D activation 1 1 -2,6 33 GO0000186 activation of MAPKK activity 31 7 -1,9 34 GO0016324 apical plasma membrane 130 41 -1,6 35 GO0005100 rho GTPase activator activity 31 8 1,5 36 GO0005149 interleukin 1 receptor binding 12 12 2,9 37 Sexual determination 38 GO0019101 female somatic sex determination 1 1 -2,2 http://bmjopen.bmj.com/ 39 GO0019100 male germ line sex determination 1 1 2,4 40 GO0006702 androgen biosynthetic process 7 2 2,4 41 GO0030238 male sex determination 10 8 3,6 42 43 a number of human genes included within each gene ontology 44 b number of significantly regulated genes by CoQ10 deficiency included within each gene ontology 45 46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
36 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 91 of 110 BMJ Open
1 2 Supplementary table 5 3 4 Regulated pathways in CoQ10-deficiency 5 (a) (b) (c) (d) 6 Pathway Z_Score PMID model COQ10 deficiency analysis model description 7 Lipid and liver metabolism 8 CHOLESTEROL_BIOSYNTHESIS -5,3 - - down - genes included in the biosynthesis of 9 cholesterol 10 BIOSYNTHESIS_OF_STEROIDS -3,9 - - down - genes included in the biosynthesis of 11 For peer review only steroids 12 TERPENOID_BIOSYNTHESIS -3,0 - - down - genes included in the biosynthesis of 13 terpenoids 14 ICHIBA_GVHD -4,3 12663442 up down oppotite genes expressed in mouse liver 15 CPR_LOW_LIVER_UP -3,7 16006652 up down oppotite genes expressed in mouse liver 16 FETAL_LIVER_enriched_transcription_factors -3,2 - - down - genes expressed in fetal liver http://bmjopen.bmj.com/ 17 Cell cycle activation and cell differentiation inhibition 18 P21_P53_MIDDLE_DN 3,3 12138103 down up opposite p21 (cyclin-dependent kinase inhibitor) 19 P21_ANY_DN 3,3 12138103 down up opposite inhibits cell cycle and stimulate cell 20 P21_P53_EARLY_DN 4,5 12138103 down up opposite differentiation 21 P21_P53_ANY_DN 5,5 12138103 down up opposite 22 GREENBAUM_E2A_UP 3,5 15310760 up up similar lack of E2A (transcription factor that induce 23 p21) - no p21 inhibition 24 E2F1_DNA_UP 4,0 11313881 up up similar E2F transcription factor pushes the 25 on September 28, 2021 by guest. Protected copyright. progression of cell cycle 26 CMV_IE86_UP 4,8 11867723 up up similar cyclin overexpression by CMV infection 27 activates CDK 28 29 VERNELL_PRB_CLSTR1 5,0 12923195 down up opposite deregulation of pRB pathway is a hallmark of tumorogenesis 30 31 BRG1_ALAB_UP -3,7 14673169 up down opposite Swi/Snf chromatin remodeling apparatus 32 arrests cell cycle 33 JISON_SICKLECELL_DIFF -3,8 15031206 up down opposite arrest of cell cycle, induction of apoptosis 34 LAL_KO_3MO_UP -3,3 16127159 up down opposite and repression of both mitogen-activated 35 MANALO_HYPOXIA_DN 3,3 15374877 down up opposite pathways and cell growth and proliferation 36 in sickle cell disease. 37 DNA_REPLICATION_REACTOME 5,0 - - up - genes included in the reactome for DNA 38 replication 39 VEGF_MMMEC_6HRS_UP 6,1 12200464 up up similar growth factors activate pathways that induce 40 cell cycle 41 SERUM_FIBROBLAST_CELLCYCLE 6,9 14737219 up up similar serum activate pathways that induce cell 42 cycle 43 44 37 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 92 of 110
1 2 Maintenance of cellular state of no differentiation 3 BOQUEST_CD31PLUS_VS_CD31MINUS_UP 4,1 15635089 up up similar absent of CD31 marker maintains stemness 4 for no differentiation 5 CANCER_UNDIFFERENTIATED_META_UP 3,4 15184677 up up similar gene pattern of undifferentiated tumoral 6 cells 7 STEMCELL_EMBRYONIC_UP 3,5 12228720 up up similar gene pattern of embryonic stem cels 8 LEE_TCELLS4_UP -3,8 15210650 up down opposite gene pattern of mature CD4(+) T-cells 9 LEE_TCELLS3_UP 6,2 15210650 up up similar gene pattern of immature CD4(+) T-cells 10 HOFFMANN_BIVSBII_BI_TABLE2 4,1 11779835 up up similar gene pattern of immature B-cells 11 LE_MYELIN_DN For peer-2,8 15695336 review down down onlysimilar gene pattern of immature Scwann cells 12 LIAN_MYELOID_DIFF_TF -2,9 11468144 up down opposite differentiation of myeloid stem cells to 13 neutrophils 14 XU_ATRA_PLUSNSC_UP -3,1 16140955 up down opposite differentiation of myeloid stem cells by 15 retinoic acid 16 LI_FETAL_VS_WT_KIDNEY_DN 4,7 12057921 down up opposite development and differentiation of fetal http://bmjopen.bmj.com/ 17 structures 18 GAY_YY1_DN 5,1 16611997 down up opposite development and differentiation of fetal 19 structures 20 ZHAN_MULTIPLE_MYELOMA_UP -3,2 11861292 up down opposite development and differentiation of multiple 21 MOREAUX_TACI_HI_VS_LOW_UP -3,0 15827134 up down opposite myeloid cells compared to undifferentiated 22 lymphocyctes in bone marrow 23 ADIP_DIFF_CLUSTER4 3,7 12137940 up up similar differentiation of fibroblast to adipocytes by 24 insulin 25 IDX_TSA_UP_CLUSTER3 6,4 15033539 up up similar on September 28, 2021 by guest. Protected copyright. differentiation of fibroblast to adipocytes by 26 insulin 27 Cell transformation during tumorogenesis 28 ZHAN_MM_CD138_PR_VS_REST 5,4 16728703 up up similar adaptation and resistance of myeloid cells 29 during tumorogenesis 30 BRCA_PROGNOSIS_NEG 4,3 11823860 up up similar activated markers for breast tumor 31 VANTVEER_BREAST_OUTCOME 3,5 11823860 up up similar 32 AGUIRRE_PANCREAS_CHR19 -3,2 15199222 down down similar repressed markers for pancreatic 33 adenocarcinoma 34 SANSOM_APC_LOSS4_UP 2,9 15198980 up up similar lost of APC 35 Development 36 FSH_OVARY_MCV152_UP -3,7 15386376 down up opposite FSH stimulates maturation of germ cells 37 (lost of undifferentiation) 38 Aging 39 MIDDLEAGE_DN 2,9 10741968 down up opposite gene pattern on middleage humans 40 OLDAGE_DN 4,8 10741968 down up opposite gene pattern on oldage humans 41 ROTH_HTERT_UP -9,6 15741219 up down opposite gene pattern of senescence T-cells 42 43 44 38 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 93 of 110 BMJ Open
1 2 Cell resistance 3 UVC_TTD_4HR_UP -3,1 15608684 up down opposite DNA response not induced in deficiency of 4 UVC_TTD_ALL_UP -2,8 15608684 up down opposite nucleotide excision repair after UV 5 treatment 6 PENG_GLUTAMINE_DN -3,2 12101249 down down similar resistance to glutamine starvation 7 DOX_RESIST_GASTRIC_UP 6,4 14734480 up up similar resistance to chemoterapy in cancer cells 8 AGED_MOUSE_HIPPOCAMPUS_ANY_UP 4,7 15960800 up up similar aged-mediated immflamatory response in 9 hippocampus 10 KAMMINGA_EZH2_TARGETS 4,6 16293602 up up similar hematopoietic stem cells avoid replicative 11 For peer review only stress and senescence 12 OXSTRESS_RPETHREE_DN -3,2 12419474 down down similar gene repression in epithelium cells by 13 oxidative stress 14 Apoptosis and cell cycle arrest 15 TGFBETA_C2_UP -3,5 11279127 up down opposite TGF-beta arrests cell cycle and induce 16 apoptosis http://bmjopen.bmj.com/ 17 ET743_SARCOMA_UP -3,6 15897246 up down opposite trabectedin (ET-743) induce cell cycle arrest 18 ET743_SARCOMA_DN 3,1 15897246 down up opposite and apoptosis 19 ET743_SARCOMA_6HRS_UP -3,2 15897246 up down opposite 20 Epigenetic regulation of gene expression 21 DAC_BLADDER_UP -8,4 11861364 up down opposite inhibition of DNA methylation prevents 22 DAC_IFN_BLADDER_UP -7,7 11861364 up down opposite initial phase of tumorogenesis 23 TSADAC_RKOEXP_UP -4,5 11992124 up down opposite gene regulation by demethylation of DNA 24 TSA_HEPATOMA_CANCER_UP -3,2 15452378 up down opposite histone deacethylase inhibition arrests cell on September 28, 2021 by guest. Protected copyright. 25 cycle, induce apoptosis 26 Interferon induced genes 27 DER_IFNA_UP -9,0 9861020 up down opposite interferon (alpha, beta, and gamma)-induced 28 DER_IFNB_UP -8,2 9861020 up down opposite genes in fibrosarcoma cells treated with any 29 IFN_ALPHA_UP -8,0 up down opposite interferon or with all at the same time and at 30 9861020 different time points 31 IFN_ANY_UP -7,1 9861020 up down opposite 32 IFN_BETA_UP -6,9 9861020 up down opposite 33 DER_IFNG_UP -5,1 9861020 up down opposite 34 IFN_GAMMA_UP -4,1 9861020 up down opposite 35 IFN_ALL_UP -4,1 9861020 up down opposite 36 IFNA_UV-CMV_COMMON_HCMV_6HRS_UP -9,8 11711622 up down opposite interferon-iducible and cytomegalovirus- 37 CMV_HCMV_TIMECOURSE_12HRS_UP -9,7 11711622 up down opposite induced genes in fibroblasts 38 IFNA_HCMV_6HRS_UP -9,6 11711622 up down opposite 39 RADAEVA_IFNA_UP -11,7 11910354 up down opposite interferon-alpha inducible genes in primary 40 IFNALPHA_NL_UP -11,2 11910354 up down opposite hepatocytes 41 IFNALPHA_NL_HCC_UP -9,2 11910354 up down opposite 42 IFNALPHA_HCC_UP -7,9 11910354 up down opposite 43 44 39 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 94 of 110
1 2 GRANDVAUX_IFN_NOT_IRF3_UP -9,2 11991981 up down opposite interferon alpha and beta)-inducible genes in 3 GRANDVAUX_IRF3_UP -6,3 11991981 up down opposite Jurkat cells 4 NF90_DN 3,8 12036489 down up opposite interferon-iducible by ectopic NF90 5 expression without viral infection 6 BECKER_IFN_INDUCIBLE_SUBSET_1 -7,1 15657362 up down opposite interferon-iducible genes in cells resistant to 7 tamoxifen therapy 8 SANA_IFNG_ENDOTHELIAL_UP -8,9 15749026 up down opposite interferon-gamma and TNF-alpha iducible 9 SANA_TNFA_ENDOTHELIAL_UP -8,6 15749026 up down opposite genes in endothelial cells 10 TAKEDA_NUP8_HOXA9_3D_UP -13,2 16818636 up down opposite interferon-iducible genes in myelodysplastic 11 TAKEDA_NUP8_HOXA9_10D_UPFor peer-8,4 16818636 review up down onlyopposite syndromes and in acute myeloid leukaemia 12 TAKEDA_NUP8_HOXA9_8D_UP -7,8 16818636 up down opposite 13 TAKEDA_NUP8_HOXA9_16D_UP -7,2 16818636 up down opposite 14 CIS_RESIST_LUNG_UP -5,8 14737109 up down opposite interferon-inducible genes by DNA damage 15 after cisplatin treatment 16
Interferon-induced and virus-induced genes at 48 hours http://bmjopen.bmj.com/ 17 CMV_HCMV_TIMECOURSE_48HRS_UP 4,8 11711622 up up similar cytomegalovirus-induced genes in 18 fibroblasts at 48 hours 19 IFN_BETA_GLIOMA_DN -3,0 16140920 down down similar interferon-beta inducible genes in glioma 20 cells at 48 hours 21 Interleukin induced genes 22 IL6_FIBRO_UP -5,1 up down opposite IL-6 inducicble genes in normal skin 23 15095275 fibroblasts 24
BROCKE_IL6 -3,4 12969979 up down opposite on September 28, 2021 by guest. Protected copyright. IL-6 inducicble genes in multiple myeloma 25 KRETZSCHMAR_IL6_DIFF -3,4 up down opposite cell lines 26 12969979 27 CROONQUIST_IL6_RAS_DN 4,3 12791645 down up opposite IL-6 repressed genes in multiple myeloma 28 cell lines 29 CROONQUIST_IL6_STARVE_UP 5,0 12791645 up up similar inducicble genes in multiple myeloma cell 30 lines IL-6 starved 31 Immunity 32 CMV_8HRS_UP -5,8 9826724 up down opposite fibroblasts infectd with cytomegalovirus 33 CMV_ALL_UP -4,8 9826724 up down opposite 34 CMV_24HRS_UP -4,0 9826724 up down opposite 35 WIELAND_HEPATITIS_B_INDUCED -5,0 15100412 up down opposite hepatocytes infected with hepatitis B virus 36 HPV31_DN -6,4 10756030 up down opposite keratinocytes infected with human 37 papilomavirus 38 BENNETT_SLE_UP -12,2 12642603 up down opposite genes activated in lupus (an autoimmune 39 disease) 40 Other markers 41 SLRPPATHWAY 3,0 - 42 43 44 40 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 95 of 110 BMJ Open
1 2 (a) Reference listed as PubMed Identity number 3 (b) Regulation of gene expression in the model described (c) 4 Regulation of the same genes in CoQ10 deficiency (d) 5 Model vs.CoQ10 deficiency comparative analysis 6 7 8 9 10 11 For peer review only 12 13 14 15 16 17 http://bmjopen.bmj.com/ 18 19 20 21 22 23 24 25 on September 28, 2021 by guest. Protected copyright. 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 41 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 96 of 110
1 2 3 4 Supplementary table 6 5 6 Regulated probes in coenzyme Q10-deficient fibroblast treated with 30 μM 7 8 Treated vs. No treated (PQ-P) Treated vs. Control (PQ-C) No treated vs. Control (P-C) 9 minimum FC comparative analysis (a) probes % (b) probes % (b) probes % (b) 10 R = 1.5 regulated probes 6043 18% 7448 22% 10680 32% 11 For peer review only UP-regulated 2441 7% 4927 15% 7238 22% 12 DOWN-regulated 3602 11% 2521 8% 3442 10% 13 R = 2.0 regulated probes 3046 9% 4824 14% 5830 18% 14 UP-regulated 1257 4% 3326 10% 3868 12% 15 DOWN-regulated 1789 5% 1498 4% 1962 6% 16 R = 3.0 regulated probes 1317 4% 2304 7% http://bmjopen.bmj.com/ 2405 7% 17 18 UP-regulated 479 1% 1597 5% 1655 5% 19 DOWN-regulated 838 3% 707 2% 750 2% 20 (a) ITERPLIER algorithms; t-test<0.05 21 (b) 22 An Affymetrix GeneChip® Human Gene ST 1.0 array contains 33297 probe sets 23 24 25 on September 28, 2021 by guest. Protected copyright. 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 42 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 97 of 110 BMJ Open
1 2 3 Supplementary table 7 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from (a) 5 Regulated probes in coenzyme Q10-deficient fibroblast treated with 30 μM (expanded table) 6 7 significant probes (t-test<0.05) (b) % vs. all regulated probes (c) 8 PQ - P PQ - C P - C R = 1.5 R = 2 R = 3 R = 1.5 R = 2 R = 3 # (d) 9 10 UP 190 151 112 1,4% 2,4% 4,5% U 11 UP DOWN 51 48 34 0,4% 0,8% 1,4% O 12 - 401 156 23 3,0% 2,5% 0,9% S 13 UP ------14 DOWN DOWN 273 273 211 2,1% 4,4% 8,5% pR 15 UP 16 ------17 ForUP peer- review- -only - - - - 18 - DOWN 1075 621 99 8,1% 10,0% 4,0% R 19 - 451 8 0 3,4% 0,1% - - 20 21 UP 791 741 525 6,0% 11,9% 21,1% pR 22 UP DOWN ------23 ------24 UP 50 50 33 0,4% 0,8% 1,3% O 25 DOWN DOWN DOWN 165 165 141 1,2% 2,7% 5,7% U 26 27 - 505 183 57 3,8% 2,9% 2,3% S 28 UP 1516 636 82 11,4% 10,2% 3,3% R 29 - DOWN ------30 - 575 14 0 4,3% 0,2% - - 31 UP 3156 2218 903 23,7% 35,7% 36,3% U 32 33 UP DOWN ------34 - 338 12 0 2,5% 0,2% - - 35 UP ------36 - DOWN DOWN 1187 812 265 8,9% 13,1% 10,7% U 37
- 341 15 0 2,6% 0,2% - - http://bmjopen.bmj.com/ 38 39 UP 1535 72 0 11,5% 1,2% - - 40 - DOWN 691 43 0 5,2% 0,7% - - 41 - 20006 26979 30812 - - - - 42 43 (a) for a graphical view, see figure S1 44 (b) 45 ITERPLIER algorithms; t-test<0.05 (c) 46 The percentaje is calculated on the total number of probes regulated at least in one comparative analysis, being: 13291 for on September 28, 2021 by guest. Protected copyright. 47 R=1.5; 6218 for R=2.0; and 2485 for R=3.0 48 (d) Effect of coenzyme CoQ10 supplementation on gene expression in CoQ10 deficiency (more information in Supplementary 49 Table 4 and in the text): unaffected genes by CoQ10 treatment (U); genes that restored the expression either partial (pR) or 50 completely (R); genes with opposite regulation than in CoQ10 deficiency (O); and specificaly regulated genes only after 51 CoQ10 supplementation (S). Genes non-afected by CoQ10 supplementation (-). 52
53
54 55 56 57 58 59 60
43 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 98 of 110
1 2 Supplementary table 8 3 4 Classification groups of gene expression after coenzyme Q10 supplementation 5 6 significant probes (a) % vs. all regulated probes (b) 7 Classification group (c) R = 1.5 R = 2 (d) R = 3 R = 1.5 R = 2 (d) R = 3 8 9 ( U ) Unaffected by CoQ10 4698 3346 1421 35% 54% 57% 10 ( pR ) Partial restored by CoQ10 1064 1014 736 8% 16% 30% 11 ( R ) Completely restored by CoQFor10 peer2591 1257review 181 19% only20% 7% 12 ( O ) Opposite regulation than in CoQ10 deficiency 101 98 67 1% 2% 3% 13 ( S ) Regulated only after CoQ10 supplementation 906 339 80 7% 5% 3% 14 - small changes (non-specific) 3931 164 0 30% 3% 0% 15 16 (a)
ITERPLIER algorithms; t-test<0.05 http://bmjopen.bmj.com/ 17 (b) The percentage is calculated on the total number of probes regulated at least in one comparative analysis, being: 13291 for 18 R=1.5; 6218 for R=2.0 (in bold letter); and 2485 for R=3.0 19 (c) Description of the classification groups in the text (see figure S1 for a graphical representation) 20 (d) A minimum full change of 2-fold (R=2) was considered for a further analysis (see comment in the text) 21 22 23 24 25 on September 28, 2021 by guest. Protected copyright. 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 44 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 99 of 110 BMJ Open
1 2 3 4 Supplementary table 9
5 6 GO classification of regulated genes in CoQ10-deficient fibroblasts supplemented with CoQ10 7 8 Gene Ontology Term P-value # genes (a) # selected (b) Enrichment (c)
9 Classification group (U): unaffected genes by CoQ10 treatment 10 GO:0043506 regulation of JUN kinase activity 6,58E-04 10 6 -4,6 11 GO:0070302 regulation of stressFor-activated protein peerkinase signaling cascade review 3,21E-04 23 only10 -3,3 12 GO:0010627 regulation of intracellular protein kinase cascade 3,46E-04 74 21 -2,1 13 GO:0019899 enzyme binding 6,91E-04 99 25 -2,0 14 GO:0050789 regulation of biological process 9,16E-04 1008 60 -1,2 15 GO:0065007 biological regulation 8,86E-04 1081 70 -1,2 16
GO:0044428 nuclear part 4,21E-04 176 98 http://bmjopen.bmj.com/ 1,3 17 GO:0022402 cell cycle process 7,37E-05 109 67 1,4 18 GO:0007049 cell cycle 1,34E-05 92 60 1,5 19 GO:0044427 chromosomal part 8,17E-05 64 43 1,5 20 GO:0022403 cell cycle phase 2,43E-05 71 48 1,6 21 GO:0007017 microtubule-based process 1,76E-04 49 34 1,6 22 GO:0000280 nuclear division 1,32E-04 45 32 1,6 23 GO:0007067 mitosis 1,32E-04 46 32 1,6 24
GO:0048285 organelle fission 7,76E-05 46 33 on September 28, 2021 by guest. Protected copyright. 1,7 25 26 GO:0051301 cell division 4,22E-07 65 48 1,7 27 GO:0006281 DNA repair 2,54E-04 32 24 1,7 28 GO:0005634 nucleus 7,51E-04 594 28 1,8 29 GO:0000777 condensed chromosome kinetochore 5,80E-04 18 15 1,9 30 GO:0000776 kinetochore 1,47E-04 20 17 2,0 31 GO:0003677 DNA binding 4,91E-04 491 23 2,1 32 GO:0071156 regulation of cell cycle arrest 2,69E-04 23 5 8,2 33 GO:0007059 chromosome segregation 8,45E-04 17 4 8,8 34 GO:0000910 cytokinesis 9,20E-04 8 3 14,1 35 GO:0009954 proximal/distal pattern formation 3,42E-04 6 3 18,8 36 GO:0030199 collagen fibril organization 1,74E-04 5 3 22,6 37 GO:0033599 regulation of mammary gland epithelial cell proliferation 6,99E-04 2 2 37,6 38 GO:0035264 multicellular organism growth 6,99E-04 2 2 37,6 39 GO:0005095 GTPase inhibitor activity 6,99E-04 2 2 37,6 40 GO:0010997 anaphase-promoting complex binding 5,13E-04 2 2 43,9
41 Classification group (O): opposite regulation than in CoQ10 deficiency 42 GO:0051240 positive regulation of multicellular organismal process 6,69E-04 61 4 -9,5 43 44 45 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 100 of 110
1 2 GO:0048856 anatomical structure development 7,21E-04 341 9 3,3 3 GO:0032269 negative regulation of cellular protein metabolic process 9,19E-04 25 3 15,0 4 GO:0031400 negative regulation of protein modification process 3,38E-04 18 3 20,8 5 GO:0010563 negative regulation of phosphorus metabolic process 1,92E-04 15 3 24,9 6 GO:0042326 negative regulation of phosphorylation 1,92E-04 15 3 24,9 7 GO:0045936 negative regulation of phosphate metabolic process 1,92E-04 15 3 24,9 8 GO:0001933 negative regulation of protein phosphorylation 9,41E-05 12 3 31,2 9 GO:0001569 patterning of blood vessels 9,04E-04 6 2 41,6 10 GO:0031258 lamellipodium membrane 3,65E-04 4 2 62,3 11 GO:0031527 filopodium membraneFor peer review1,83E-04 3 only2 83,1 12 GO:0031952 regulation of protein autophosphorylation 6,14E-05 2 2 124,7 13 GO:0031953 negative regulation of protein autophosphorylation 6,14E-05 2 2 124,7 14 Classification group (S): specific regulation in CoQ10 deficiency due to CoQ10 treatment 15 GO:0005523 tropomyosin binding 3,05E-04 5 3 -18,7 16
GO:0034728 nucleosome organization 8,52E-04 19 4 http://bmjopen.bmj.com/ 8,9 17 GO:0071824 protein-DNA complex subunit organization 8,52E-04 19 4 8,9 18 GO:0006334 nucleosome assembly 5,42E-04 17 4 9,9 19 GO:0065004 protein-DNA complex assembly 5,42E-04 17 4 9,9 20 GO:0032993 protein-DNA complex 4,22E-04 16 4 10,6 21 GO:0009898 internal side of plasma membrane 5,00E-05 4 3 31,7 22 23 Classification group (pR): CoQ10 partialy restored the altered expression in CoQ10 deficiency 24 GO:0060665 regulation of branching involved in salivary gland morphogenesis 8,68E-04 5 4 -6,8 25 GO:0005576 extracellular region 9,62E-04 424 29 on September 28, 2021 by guest. Protected copyright. 1,8 26 GO:0032868 response to insulin stimulus 9,73E-04 21 5 6,2 27 GO:0015718 monocarboxylic acid transport 2,29E-04 9 4 11,5 28 GO:0005520 insulin-like growth factor binding 2,29E-04 9 4 11,5 29 GO:0048666 neuron development 3,01E-05 11 5 1,8 30 Classification group (R): CoQ10 completely restored the altered expression of CoQ10 deficiency 31 GO:0010941 regulation of cell death 6,87E-04 144 21 2,1 32 GO:0043067 regulation of programmed cell death 6,25E-04 143 21 2,1 33 GO:0042981 regulation of apoptosis 5,67E-04 142 21 2,1 34 GO:0045121 membrane raft 3,46E-04 21 7 4,8 35 GO:0046777 protein autophosphorylation 7,14E-05 8 5 9,0 36 GO:0060674 placenta blood vessel development 3,27E-04 3 3 14,4 37 38 (a) Number of human genes analyzed within each gene ontology 39 (b) Number of significantly regulated genes by CoQ10 supplementation included within each gene ontology 40 (c) Gene Ontology Enrichment represents the selection of genes associated with a specific GO. It is calculated by GORILLA software as follows: 41 E=(b/n)/(B/N), being "N" the total number of genes, "B" the total number of genes associated with a particular GO, "n" the number of genes in each 42 group of classification and "b" the number of genes associated to a particular GO within each group of classification. 43 44 46 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 101 of 110 BMJ Open
1 2 Supplementary table 10 3 4 Sample description during submission to NCBI-GEO (SuperSeries GSE33941) BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 6 7 SubSeries Sample Sample description # (a) 8 GSM833438 fibroblast_patient_1_A P 9 GSM833441 fibroblast_patient_1_B P 10 GSM833444 fibroblast_patient_1_C P 11 GSM833478 control_fibroblast_A C 12 Series GSE33769 GSM833479 control_fibroblast_B C 13 GSM833480 control_fibroblast_C C
14 GSM833490 fibroblast_patient_3_A P
15 GSM833491 fibroblast_patient_3_B P Platform GPL570 16 GSM833492 fibroblast_patient_3_C P
17 For peer reviewGSM833493 fibroblast_patient_5_A only P 18 [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array GSM833494 fibroblast_patient_5_B P 19 GSM833495 fibroblast_patient_5_C P 20 GSM833502 fibroblast_patient_4_A P 21 GSM833503 fibroblast_patient_4_B P 22 GSM833504 fibroblast_patient_4_C P 23 GSM839154 fibroblast_patient_ELO_1_1 P 24 GSM839155 fibroblast_patient_ELO_1_2 P 25 GSM839156 fibroblast_patient_ELO_2_1 P 26 GSM839157 fibroblast_patient_ELO_2_2 P 27 GSM839158 fibroblast_patient_GIO_1_1 P 28 GSM839159 fibroblast_patient_GIO_1_2 P 29 Series GSE33940 30 GSM839160 fibroblast_patient_GIO_2_1 P GSM839161 fibroblast_patient_GIO_2_2 P 31 GSM839162 control_fibroblast_2c C 32 GSM839163 control_fibroblast_4a C 33 Platform GPL6244 GSM839164 control_fibroblast_4b C 34 35 [HuGene-1_0-st] GSM839165 fibroblast_patient_SOF_Q-treated_1 P+Q 36 Affymetrix Human Gene 1.0 ST Array GSM839166 fibroblast_patient_SOF_Q-treated_2 P+Q 37 (transcript gene version) GSM839167 fibroblast_patient_SIL_Q-treated_1 P+Q 38 GSM839168 fibroblast_patient_SIL_Q-treated_2 P+Q http://bmjopen.bmj.com/ 39 GSM839169 fibroblast_patient_MSI_Q-treated_1 P+Q 40 GSM839170 fibroblast_patient_MSI_Q-treated_2 P+Q 41 GSM839171 fibroblast_patient_ELO_Q P+Q 42 GSM839172 fibroblast_patient_ELO_Q P+Q 43 GSM839173 fibroblast_patient_MEL_Q P+Q 44 45 (a) 46 human dermal fibroblast from healthy volunteers (C), fibroblasts from CoQ10 deficient patients (P), and fibroblasts on September 28, 2021 by guest. Protected copyright. 47 from CoQ10-deficient patients treated with 30 µM CoQ10 for 48 hours (PQ) as described in the text. 48 49 50 51 52 53 54 55 56 57 58 59 60
47 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 102 of 110
1 2 3 supplementary table 11 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 Primers used for Q-RT-PCR 6 7 8 Gene Forward Reverse 9 BRP44 5' GATAAAGTGGAGCTGATGC 3' 5' TTGGAGCCCAGAAGAAAA 3' 10 CH25H 5' CCCTTGGTCCACTCACAG 3' 5' GCAGCGTTCCCAGTATTT 3' 11 CYP1B1-1 5' AGGCAAAGGTCCCAGTTC 3' 5' GATGGACAGCGGGTTTAG 3' 12 CYP1B1-2 5' AGTGCAGGCAGAATTGGA 3' 5' GAGGTGTTGGCAGTGGTG 3' 13 EFNB2 5' ACCAAATCCAGGTTCTA 3' 5' CTCCTCCGGTACTTCA 3' 14 FDFT1 5' ACTTTGGCTGCCTGTTAT 3' 5' CATCCATCATCAGGGTCA 3' 15 KRT34 5' GGGAAGTGGAGCAATG 3' 5' AGAGTCTCGCAGGTTGT 3' 16 MCAM - 1 5' GTGTAGGGAGGAACGG 3' 5' CTGGGACGACTGAATGT 3' 17 MCAM - 2 5'For AGTCAGGACGAGACCATC peer review3' 5' onlyCTTCAGCCTTCCGAGTA 3' 18 PAPPA 5' TGGGTCATAACTATTTCAGG 3' 5' TATTCATGTCGTCGCATT 3' 19 POSTN-1 5' TTAAGTTTGTTCGTGGTAG 3' 5' TGTGGGTCCTTCAGTTTT 3' 20 POSTN-2 5' CCGAGCCTTGTATGTATG 3' 5' TTACCAGTAAACCCACTC 3' 21 SFRP1 5' GCTGGAGCACGAGACCA 3' 5' AGCGAGCAGAGGAAGACC 3' 22 TNFRSF10D 5' GTTCGTCGTCTTCATCG 3' 5' CCTCTGTTGCTGTGGG 3' 23 VCAN 5' GATGAAACCTCGTTATGAA 3' 5' CTAAGCACCGGATAGTTG 3' 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
48 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 103 of 110 BMJ Open
1 2 Supplementary table 12 3 4 Selection of probes during filtering and statistical analysis in primary and secondary CoQ10 deficient fibroblasts 5 6 7 Primary deficiency Sample 3 - COQ2 Sample 5 - COQ2 Secondary deficiency Sample 1 - ataxia Sample 4 - MELAS
8 Probes % (a) Probes % (a) Probes % (a) Probes % (a) Probes % (a) Probes % (a) 9 Probes with p-value<0.05 26783 49% 28407 52% 27711 51% 27042 50% 27893 51% 28130 51% 10 (b) SAM analysis FDR < 5% - - 5940 11% 3200 6% - - 3425 6% 3077 6% 11 For peer review only Δ-value (FDR) - 0,73 (4,2%) 0,81 (3,6%) - 0,83 (3,3%) 0,82 (3,2%) 12 (b) 1162 2.1% 4127 8% 2497 5% 1217 2.2% 2697 5% 2263 4% 13 SAM analysis FDR < 1% - 1,3 (0,7%) 1,2 (0,8%) - 1,2 (0,9%) 1,3 (0,97%) 14 Δ-value (FDR) UP-regulated 15 397 0.7% 2145 3.9% 1244 2.3% 515 0.9% 1287 2.4% 1207 2.2% DOWN-regulated 16 517 0.9% 1982 3.6% 1253 2.3% 628 1.1% 1410 2.6% 1056 1.9%
(2) http://bmjopen.bmj.com/ 17 SAM analysis FDR = 0 387 0.7% 1672 3% 915 2% 479 0.9% 1240 2% 842 2% 18 Δ-value (FDR) - 3,1 (0%) 3,2 (0%) - 2,7 (0%) 3,3 (0%) 19 UP-regulated 139 0.2% 849 1.6% 544 1.0% 255 0.5% 703 1.3% 489 0.9% 20 DOWN-regulated 175 0.3% 823 1.5% 371 0.7% 207 0.4% 537 1.0% 353 0.6% 21 22 (a) An Affymetrix GeneChip® Human Genome U133 Plus 2.0 array contains 54675 probe sets 23 (b) MAS5 and RMA algorithms; two class unpaired (unlogged data); s0=50; R=1.5 24 25 on September 28, 2021 by guest. Protected copyright. 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 49 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 104 of 110
1 2 3 Supplementary table 13 4 5 Coherence of changes in gene expression after the comparative analysis 6 7 FDR = 0% FDR < 1% 8 simultaneous change in selected probes (a) % (b) selected probes (a) % (b) 9 UP 47 0,09% 137 0,25% 10 4 samples DOWN 89 0,16% 237 0,43% 11 For peer review only UP 149 0,27% 337 0,62% 12 3 samples 13 DOWN 124 0,23% 383 0,70% UP 334 0,61% 695 1,27% 14 2 samples 15 DOWN 203 0,37% 560 1,02% 16 UP 1051 1,92% 2224 4,07%
1 sample http://bmjopen.bmj.com/ 17 DOWN 714 1,31% 1726 3,16% 18 2 UP + 2 DOWN 7 0,01% 18 0,03% 19 4 samples 3 UP + 1 DOWN 12 0,02% 34 0,06% 20 1 UP + 3 DOWN 9 0,02% 47 0,09% 21 2 UP + 1 DOWN 28 0,05% 85 0,16% 3 samples 22 1 UP + 2 DOWN 28 0,05% 105 0,19% 23 2 samples 1 UP + 1 DOWN 94 0,17% 252 0,46% 24 on September 28, 2021 by guest. Protected copyright. 25 (a) SAM analysis (R=1,5) 26 (b) An Affymetrix GeneChip® Human Genome U133 Plus 2.0 array contains 54675 probe sets 27
28
29
30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 50 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 105 of 110 BMJ Open
1 2 3 Supplementary table 14 4 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 Coherence of changes in gene expression after the comparative analysis 6 (expanded data) 7 # probes (a) 8 sample 1 sample 3 sample 4 sample 5 FDR<1% FDR=0% 9 UP 137 47 10 UP DOWN 8 2 11 - 59 32 12 UP 2 1 13 UP DOWN DOWN 2 1 14 15 - 6 1 16 UP 77 28 17 For- peerDOWN review6 only2 18 - 129 74 19 UP 20 8 20 UP DOWN 4 2 21 - 17 6 22 UP 3 1 23 UP DOWN DOWN DOWN 6 1 24 - 8 2 25 UP 17 3 26 - DOWN 7 2 27 - 26 16 28 UP 148 75 29 30 UP DOWN 5 1 31 - 117 82 32 UP 2 0 33 - DOWN DOWN 5 0 34 - 6 3 35 UP 128 71 36 - DOWN 8 7 37 - 335 235 38 UP 4 1 http://bmjopen.bmj.com/ 39 UP DOWN 4 0 40 - 4 2 41 UP 3 0 42 UP DOWN DOWN 27 5 43 - 11 3 44 45 UP 13 8
46 - DOWN 33 6 on September 28, 2021 by guest. Protected copyright. 47 - 41 18 48 UP 2 3 49 UP DOWN 5 0 50 - 2 1 DOWN 51 UP 9 3 52 DOWN DOWN DOWN 237 89 53 - 76 39 54 UP 4 4 55 - DOWN 110 36 56 - 118 58 57 UP 3 0 58 UP DOWN 3 0 59 - 7 0 60 - UP 8 3 DOWN DOWN 157 33 - 100 32
51 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 106 of 110
1 2 UP 8 3 3 - DOWN 120 47 4 - 301 143 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 UP 53 14 6 UP DOWN 3 2 7 - 115 32 8 UP 4 1 9 UP DOWN DOWN 18 4 10 11 - 29 10 12 UP 103 41 13 - DOWN 39 13 14 - 1216 501 15 UP 5 2 16 UP DOWN 1 1 17 For peer- review25 only7 18 UP 5 2 19 - DOWN DOWN DOWN 40 16 20 - 58 26 21 UP 44 14 22 - DOWN 107 25 23 - 1026 456 24 UP 103 34 25 26 UP DOWN 9 1 27 - 344 134 28 UP 10 2 29 - DOWN DOWN 57 15 30 - 167 60 31 UP 329 181 32 - DOWN 232 55 33 - - - 34 35 (a) selected probes by SAM analysis (R=1.5) 36 37 38 http://bmjopen.bmj.com/ 39 40 41 42 43 44 45
46 on September 28, 2021 by guest. Protected copyright. 47 48 49 50 51 52 53 54 55 56 57 58 59 60
52 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 107 of 110 BMJ Open
1 2 3 4 Supplementary table 15 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 5 6 Pathology's gene expression similar to CoQ10 deficiency 7 8 MeshTerm (a) # genes (b) # significant (c) Z_Score (d) 9 Digestive 10 COLITIS, ULCERATIVE 48 43 2,2 11 CELIAC DISEASE 19 18 1,9 12 DIARRHEA 9 6 1,8 13 Embryo 14 FETAL MEMBRANES (PREMATURE RUPTURE) 12 12 2,7 15 Heart 16 CAROTID ARTERY DISEASES 34 34 3,6 17 For peer review only CORONARY RESTENOSIS 11 11 3,2 18 CORONARY DISEASE 104 100 3,2 19 VENTRICULAR DYSFUNCTION 9 9 2,4 20 VENTRICULAR HYPERTROPHY 20 20 1,9 21
22 Immune 23 CHLAMYDIA INFECTIONS 8 8 3,2 24 Kidney 25 KIDNEY FAILURE 38 37 2,5 26 Liver 27 HEPATITIS C 18 17 4,5 28 LIVER CIRRHOSIS 30 29 2,5 29 Neuronal 30 PHOBIC DISORDERS 3 3 1,7 31 SLEEP DISORDERS 3 3 1,7 32 BRAIN INFARCTION 9 9 1,8 33 PANIC DISORDER 11 11 1,8 34 MOOD DISORDERS 18 18 2,4 35 Weight and Insulin-related 36 WEIGHT LOSS 13 13 2,4 37 DIABETES MELLITUS (TYPE 1) 100 98 1,7 38 Lung http://bmjopen.bmj.com/ 39 PULMONARY DISEASE 33 32 2,8 40 BRONCHIAL HYPERREACTIVITY 11 11 2,5 41 LUNG DISEASES (OBSTRUCTIVE) 3 3 1,7 42 Epithelium 43 HYPERSENSITIVITY 32 32 2,5 44 RHINITIS 7 7 2,5 45 NASAL POLYPS 4 4 1,8 46 PSORIASIS 39 36 1,7 on September 28, 2021 by guest. Protected copyright. 47 Tumor 48 NEOPLASM INVASIVENESS 22 21 4,3 49 CARCINOMA (TRANSITIONAL CELL) 13 13 2,2 50 NEOPLASMS (SQUAMOUS CELL) 7 7 1,9 51 UTERINE CERVICAL NEOPLASMS 21 21 1,8 52 MELANOMA 23 22 1,7 53
54 (a) MeshTerm (MeSH) is the vocabulary of the National Library of Medicine used for indexing articles for 55 MEDLINE/PubMed. MeSH terminology provides a consistent way to retrieve information. 56 (b) 57 number of genes regulated / specific markers of a disease given. (c) 58 number of genes regulated similarly in CoQ10 deficiency. 59 (d) 60 Here are listed the 32th MeshTerm with Z-score higher than 1.5
53 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 108 of 110
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 C P PQ 7 Unaffected genes by CoQ10 (U) 8 UP UP UP 9 CoQ10 maintain up-regulated at higher levels 10 P 11 C ForPQ peer reviewOpposite only regulation (O) 12 UP UP DOWN 13 CoQ10 activates the repressed genes in CoQ10 deficiency 14 15 P C PQ Regulated only after CoQ treatment (S) 16 UP UP - 10 http://bmjopen.bmj.com/ 17 Genes specifically activated by CoQ10 supplementation 18 19 20 UP DOWN UP --- NOT POSSIBLE --- 21 22 23 P PQ C 24 Partial restored genes by CoQ10 (pR)
UP DOWN DOWN on September 28, 2021 by guest. Protected copyright. 25 CoQ activates the repressed without reach control level 26 10 27 28 29 UP DOWN - --- NOT POSSIBLE --- 30 31 32 33 UP - UP --- NOT POSSIBLE --- 34 35 36 P PQ C CoQ restores completely (R) 37 UP - DOWN 10 38 CoQ10 activates the repressed to reach control level 39 40 P C PQ 41 UP - - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 42 43 44 Fernández-Ayala et al. – Figure S1a 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 109 of 110 BMJ Open
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 PQ P 7 C Partial restored genes by CoQ10 (pR) 8 DOWN UP UP CoQ represses the activated without reach control 9 10 10 level 11 For peer review only 12 13 DOWN UP DOWN --- NOT POSSIBLE --- 14 15 16 17 DOWN UP - --- NOT POSSIBLE --- http://bmjopen.bmj.com/ 18 19 PQ C P 20 Opposite regulation (O) 21 DOWN DOWN UP 22 CoQ10 represses the activated genes more than control 23 PQ P C 24
Unaffected genes on September 28, 2021 by guest. Protected copyright. by CoQ (U) 25 DOWN DOWN DOWN 10 26 CoQ maintain down-regulated at higher levels 27 10 28 PQ P C 29 Regulated only after CoQ10 treatment (S) 30 DOWN DOWN - 31 Genes specifically repressed by CoQ10 supplementation 32 PQ C P 33 CoQ10 restores completely (R) 34 DOWN - UP 35 CoQ10 represses the activated to reach control level 36 37 38 DOWN - DOWN --- NOT POSSIBLE --- 39 40 41 PQ C P 42 DOWN - - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 43 44 Fernández-Ayala et al. – Figure S1b 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
BMJ Open Page 110 of 110
1 high 2 Effect of CoQ supplementation on 3 low PQ-P PQ-C P-C 10 4 expression level gene regulation in CoQ deficiency 5 10 6 C PQ P 7 Unaffected genes by CoQ10 (U) 8 - UP UP 9 CoQ10 maintain up-regulated 10 11 For peer review only 12 - UP DOWN --- NOT POSSIBLE --- 13 14 15 C P PQ 16 --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) ---
- UP - http://bmjopen.bmj.com/ 17 18 19 20 - DOWN UP --- NOT POSSIBLE --- 21 22 23 PQ P C 24 Unaffected genes by CoQ10 (U)
- DOWN DOWN on September 28, 2021 by guest. Protected copyright. 25 CoQ maintain down-regulated 26 10 27 28 PQ P C 29 - DOWN - --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 30 31 32 C PQ P 33 - - UP --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 34 35 36 P PQ C 37 - - DOWN --- SMALL CHANGES (ONLY ONE COMPARATIVE ANALYSIS) --- 38 39 40 41 --- NOT SELECTED FOR EXPRESSION ANALYSIS --- 42 - - - 43 44 Fernández-Ayala et al. – Figure S1c 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from
Page 111 of 110 BMJ Open
VEGFA CDC42SE2 BDNF 1 POSTN mitogens 2 LY6K GRP 3 G ALNAC4S-6ST NTNG1 4 T RI M14 PT N 5 SEMA5A TNFSF4 6 TNFRSF10D MAGED1 7 ARL4C G ABBR2 P2RY5 MAGED4 8 AEBP1 T XNI P T SPAN10 I F I T M1 9 CSRP2 CNGA3 10 SG K1 BHLHB5 MID1 SMARCA1 CNG2 11 For peer review only SG K1 HERC6 12 MLPH SMARCA4 RHOU 13 MAPKKK NCK2 14 JNK cell RAC2 15 CDK3 CDKN1A division F O XQ 1 16 CDKN1C
http://bmjopen.bmj.com/ + + HO XC9 17 activates CHURC1 AI M1 represses 18 HO XA11 effectors CREG 1 APC(DD1) effectors 19 RUNX1 LHX9 20 SP110 21 ANTI-APOPTOSIS APOPTOSIS 22 F O XP1 SF RP1 ARL4C T RI M55 PCSK2 INF 23 FDFT1 KRT 34 USP53 LMCD1 IFI6 C7orf 55 24 CYP1B1 IDI1 T PM1
XAF 1 on September 28, 2021 by guest. Protected copyright. 25 MG C87042 PYG L O ASs CH25H 26 CPE T MEM49 Q PRT MXs RSAD2 27 PAPPA IFIs RAD23B PARP14 I SNI G 1 28 BRP44 PSMB9 29 LDLR C10orf 58 BT N3A2/ 3 30 SLC40a1 VCAN SQ LE 31 AT P8B1 G BP1 EPST I 1 EF EMP1 SCD 32 I SG 15 T SHZ 1
33 34 Fe PSG 6 EDN1 35 DCN MAT N2 36 PKP4 37 MCAM 38 MKX 39 40 41 42 g en e acti vati o n i n Co Q10 d efi ci en cy gene repression in CoQ10 d efi ci en cy 43 44 Fernández-Ayala et al. – Figure S2 45 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60