DOCSLIB.ORG

For Peer Review Only Journal: BMJ Open

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
For Peer Review Only Journal: BMJ Open BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from Survival transcriptome in coenzyme Q10 deficiency syndrome is acquired by epigenetic modifications: a modelling study for human coenzyme Q10 deficiencies. For peer review only Journal: BMJ Open Manuscript ID: bmjopen-2012-002524 Article Type: Research Date Submitted by the Author: 20-Dec-2012 Complete List of Authors: Fernández-Ayala, Daniel; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Guerra, Ignacio; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Jiménez-Gancedo, Sandra; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Cascajo, Maria; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, Gavilán, Ángela; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, DiMauro, Salvatore; Columbia University Medical Center, Department of http://bmjopen.bmj.com/ Neurology Hirano, Michio; Columbia University Medical Center, Department of Neurology Briones, Paz; Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, ; CIBERER, Instituto de Salud Carlos III, Artuch, Rafael; Hospital Sant Joan de Déu, Department of Clinical Biochemistry; CIBERER, Instituto de Salud Carlos III, deCabo, Rafael; National Institute on Aging, NIH, Laboratory of Experimental Gerontology Salviati, Leonardo; University of Padova, Clinical Genetics Unit, Department on September 28, 2021 by guest. Protected copyright. of Woman and Child Health Navas, Placido; University Pablo Olavide, Centro Andaluz de Biología del Desarrollo (CABD-CSIC/UPO); CIBERER, Instituto de Salud Carlos III, <b>Primary Subject Genetics and genomics Heading</b>: Secondary Subject Heading: Genetics and genomics, Diagnostics Keywords: Neuromuscular disease < NEUROLOGY, BASIC SCIENCES, GENETICS For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 1 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest. Protected copyright. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 2 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 1 2 Survival transcriptome in the coenzyme Q10 deficiency syndrome is acquired by epigenetic 3 4 modifications: a modelling study for human coenzyme Q10 deficiencies. 5 6 7 8 Daniel J. M. Fernández-Ayala1,5, Ignacio Guerra1,5, Sandra Jiménez-Gancedo1,5, Maria V. Cascajo1,5, 9 10 1,5 2 2 3,5 4,5 11 Angela Gavilán , Salvatore DiMauro , Michio Hirano , Paz Briones , Rafael Artuch , Rafael de 12 6 7,8 1,5,8 13 Cabo , Leonardo Salviati and Plácido Navas 14 15 For peer review only 16 17 1Centro Andaluz de Biología del Desarrollo (CABD-CSIC), Universidad Pablo Olavide, Seville, Spain 18 19 2 20 Department of Neurology, Columbia University Medical Center, New York, NY, USA 21 3 22 Instituto de Bioquímica Clínica, Corporació Sanitaria Clínic, Barcelona, Spain 23 24 4Department of Clinical Biochemistry, Hospital Sant Joan de Déu, Barcelona, Spain 25 26 5CIBERER, Instituto de Salud Carlos III, Spain 27 28 6Laboratory of Experimental Gerontology, National Institute on Aging, NIH, Baltimore, MD 21224, 29 30 31 USA 32 7 33 Clinical Genetics Unit, Department of Woman and Child Health, University of Padova, Italy http://bmjopen.bmj.com/ 34 35 8 Senior authorship is shared by LS and PN 36 37 38 39 40 Corresponding authors 41 42 Plácido Navas and Leonardo Salviati on September 28, 2021 by guest. Protected copyright. 43 44 Tel (+34)954349381 and (+39) 3471207364 45 46 e-mail: [email protected] and [email protected] 47 48 49 50 51 52 53 Word count (abstract): 285 54 Word count (summary) 295 55 Word count (introduction, methods, results and discussion): 2947 56 Tables and Illustrations: 4 57 References: 34 58 59 60 1 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 3 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 1 2 ABSTRACT 3 4 5 6 Objectives 7 Coenzyme Q10 (CoQ10) deficiency syndrome is a rare condition that causes a mitochondrial 8 dysfunction and includes a variety of clinical presentations, as encephalomyopathy, ataxia and renal 9 10 failure. We sought to set up what all have in common and to investigate why CoQ10 supplementation 11 reverses the bioenergetics alterations in cultured cells but not all the cellular phenotypes. 12 13 Design: modelling study 14 This work models the transcriptome of human CoQ10 deficiency syndrome in primary fibroblast from 15 patients and studyFor the genetic peer response to CoQreview10 treatment in these only cells. 16 17 Setting 18 Four hospitals and medical centres from Spain, Italy and USA, and two research laboratories from 19 20 Spain and USA. 21 22 Participants 23 Primary cells were collected from patients in the above centres. 24 25 Measurements 26 We characterized by microarray analysis the expression profile of fibroblasts from seven CoQ10- 27 deficient patients (three had primary deficiency, four had a secondary form) and aged-matched 28 controls, before and after CoQ supplementation. Results were validated by Q-RT-PCR. The profile 29 10 30 of DNA (CpG) methylation was evaluated for a subset of gene with displayed altered expression. 31 32 Results 33 CoQ10 deficient fibroblasts (independently from the etiology) showed a common transcriptomic profile http://bmjopen.bmj.com/ 34 that promotes cell survival by activating cell cycle and growth, cell stress responses, and inhibiting cell 35 death and immune responses. Energy production was supported mainly by glycolysis while CoQ10 36 supplementation restored oxidative phosphorylation. Expression of genes involved in cell death 37 pathways was partially restored by treatment, while genes involved in differentiation, cell cycle and 38 growth were not affected. Stably demethylated genes were unaffected by treatment whereas we 39 40 observed restored gene expression in either non-methylated genes or those with an unchanged 41 methylation patterns. 42 on September 28, 2021 by guest. Protected copyright. 43 Conclusions 44 CoQ10 deficiency induces a specific transcriptomic profile that promotes cell survival, which is only 45 partially rescued by CoQ10 supplementation. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml BMJ Open Page 4 of 84 BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 1 2 SUMMARY 3 4 5 Article Focus 6 • To analyse the common gene expression profile in primary cell cultures of dermal fibroblasts 7 from patients suffering any of the clinical presentation of the human syndrome of coenzyme 8 Q (CoQ ) deficiency (primary or secondary CoQ deficiency). 9 10 10 10 10 • To exanimate why CoQ10 treatment, the current therapy for all forms of CoQ10 deficiency, 11 restored respiration but not all the clinical phenotypes. 12 • To investigate the stable genetic cause responsible for the survival adaptation to mitochondrial 13 dysfunction due to CoQ10 deficiency. 14 15 For peer review only 16 Key Messages 17 18 • The mitochondrial dysfunction due to CoQ10 deficiency induces a stable survival adaptation of 19 somatic cells in patients at early or postnatal development by epigenetic modifications of 20 chromatin. Deficient cells unable to maintain this survival state during differentiation would 21 death contributing to the pathological phenotype. 22 • Supplementation with CoQ10 restores respiration through enhanced sugar rather than lipid 23 metabolism; partially restores stress response, immunity, cell death and apoptotic pathways; 24 and does not affect cell cycle, cell growth, and differentiation and development pathways. 25 26 • Unaffected genes by CoQ10 treatment corresponded to DNA-demethylated genes, whereas 27 those responsive to CoQ10 corresponded to genes with unchanged DNA-methylation pattern. 28 These results would approach to explain the incomplete recovery of clinical symptoms after 29 CoQ10 treatment, at least in some patients. 30 31 32 Strengths and Limitations 33 • Human CoQ10 deficiencies are considered rare diseases with low prevalence, which limits the http://bmjopen.bmj.com/ 34 sample size. 35 36 • The genetic heterogeneity of this disease is due to mutations in any of the 11 genes directly 37 involved in the synthesis of CoQ10 inside mitochondria, or other mutations altering somehow 38 the mitochondria and its metabolism, affecting their inner CoQ10 synthesis as a side effect, will 39 course with CoQ10 deficiency. 40 • Among this genetic heterogeneity, all cells showed a common transcriptomic profile that 41 justified their pathological phenotype, responded equally to CoQ10 treatment, and presented the on September 28, 2021 by guest. Protected copyright. 42 same DNA methylation pattern. 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 For peer review only - http://bmjopen.bmj.com/site/about/guidelines.xhtml Page 5 of 84 BMJ Open BMJ Open: first published as 10.1136/bmjopen-2012-002524 on 25 March 2013. Downloaded from 1 2 KEY WORDS 3 4 Coenzyme Q, CoQ10-deficiency, transcriptome, epigenetic, human fibroblast 5 6 7 8 9 10 11 12 13 14 15 For peer review only 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 http://bmjopen.bmj.com/ 34 35 36 37 38 39 40 41 42 on September 28, 2021 by guest.
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature08795 SUPPLEMENTARY INFORMATION Supplementary Discussion Population naming In some contexts, the indigenous hunter-gatherer and pastoralist peoples of southern Africa are referred to collectively as the Khoisan (Khoi-San) or more recently Khoesan (Khoe-San) people. This grouping is based on the unique linguistic use of click-consonants1. Many names, often country-specific, have been used by Bantu pastoralists and European settlers to describe the hunter-gatherers, including San, Saan, Sonqua, Soaqua, Souqua, Sanqua, Kwankhala, Basarwa, Batwa, Abathwa, Baroa, Bushmen, Bossiesmans, Bosjemans, or Bosquimanos. In addition, group-specific names such as !Kung and Khwe are often used for the broader population. The two most commonly used names, “San” and “Bushmen”, have both been associated with much controversy due to derogatory connotations2. “San” has become the more popular term used in Western literature, although “Bushmen” is arguably the more commonly recognized term within the communities. Since they have no collective name for themselves, the term Bushmen was selected for use in this paper as the term most familiar to the participants themselves. Regarding identification of individuals The five men identified in this study have all elected to have their identity made public knowledge. Thus we present two complete personal genomes (KB1 and ABT), a low-coverage personal genome (NB1), and personal exomes for all five men. On a scientific level, identification allows for current and future correlation of genetic data with demographic and medical histories. On a social level, identification allows for maximizing community benefit. For !Gubi, G/aq’o, D#kgao and !Aî, their name represents not only themselves, but importantly their extended family unit and a way of life severely under threat.
    [Show full text]
  • Accepted Version
    Article Genetic Control of Gonadal Sex Determination and Development STEVANT, Isabelle, NEF, Serge Abstract Sex determination is the process by which the bipotential gonads develop as either testes or ovaries. With two distinct potential outcomes, the gonadal primordium offers a unique model for the study of cell fate specification and how distinct cell populations diverge from multipotent progenitors. This review focuses on recent advances in our understanding of the genetic programs and epigenetic mechanisms that regulate gonadal sex determination and the regulation of cell fate commitment in the bipotential gonads. We rely primarily on mouse data to illuminate the complex and dynamic genetic programs controlling cell fate decision and sex-specific cell differentiation during gonadal formation and gonadal sex determination. Reference STEVANT, Isabelle, NEF, Serge. Genetic Control of Gonadal Sex Determination and Development. Trends in Genetics, 2019 PMID : 30902461 DOI : 10.1016/j.tig.2019.02.004 Available at: http://archive-ouverte.unige.ch/unige:115790 Disclaimer: layout of this document may differ from the published version. 1 / 1 Trends in Genetics Genetic control of sex determination and gonad development --Manuscript Draft-- Manuscript Number: TIGS-D-18-00173R1 Article Type: Review Keywords: sex determination; ovary; testis; lineage specification; gene expression; epigenetic regulation Corresponding Author: Serge Nef geneva, SWITZERLAND First Author: Isabelle Stévant Order of Authors: Isabelle Stévant Serge Nef Abstract: Sex determination is the process by which the bipotential gonads develop as either testes or ovaries. With two distinct potential outomes, the gonadal primordium offers a unique model for the study of cell fate specification and how distinct cell populations diverge from multipotent progenitors.
    [Show full text]
  • Epigenetic Interplay Between Mouse Endogenous
    Rebollo et al. Genome Biology 2012, 13:R89 http://genomebiology.com/2012/13/10/R89 RESEARCH Open Access Epigenetic interplay between mouse endogenous retroviruses and host genes Rita Rebollo1,2†, Katharine Miceli-Royer1,2†, Ying Zhang1,2, Sharareh Farivar1,2, Liane Gagnier1,2 and Dixie L Mager1,2* Abstract Background: Transposable elements are often the targets of repressive epigenetic modifications such as DNA methylation that, in theory, have the potential to spread toward nearby genes and induce epigenetic silencing. To better understand the role of DNA methylation in the relationship between transposable elements and genes, we assessed the methylation state of mouse endogenous retroviruses (ERVs) located near genes. Results: We found that ERVs of the ETn/MusD family show decreased DNA methylation when near transcription start sites in tissues where the nearby gene is expressed. ERVs belonging to the IAP family, however, are generally heavily methylated, regardless of the genomic environment and the tissue studied. Furthermore, we found full- length ETn and IAP copies that display differential DNA methylation between their two long terminal repeats (LTRs), suggesting that the environment surrounding gene promoters can prevent methylation of the nearby LTR. Spreading from methylated ERV copies to nearby genes was rarely observed, with the regions between the ERVs and genes apparently acting as a boundary, enriched in H3K4me3 and CTCF, which possibly protects the unmethylated gene promoter. Furthermore, the flanking regions of unmethylated ERV copies harbor H3K4me3, consistent with spreading of euchromatin from the host gene toward ERV insertions. Conclusions: We have shown that spreading of DNA methylation from ERV copies toward active gene promoters is rare.
    [Show full text]
  • Itcs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes
    1160 • The Journal of Neuroscience, January 31, 2018 • 38(5):1160–1177 Development/Plasticity/Repair Loss of Intercalated Cells (ITCs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes X Jeffrey Kuerbitz,1 Melinda Arnett,5 Sarah Ehrman,1 XMichael T. Williams,3 XCharles V. Vorhees,3 X Simon E. Fisher,6,7 Alistair N. Garratt,8 XLouis J. Muglia,5 Ronald R. Waclaw,1,4 and XKenneth Campbell1,2 Divisions of 1Developmental Biology, 2Neurosurgery, 3Neurology, 4Experimental Hematology and Cancer Biology, 5Center for Prevention of Preterm Birth, Perinatal Institute, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, 6Language and Genetics Department, Max Planck Institute for Psycholinguistics, 6500 AH Nijmegen, The Netherlands, 7Donders Institute for Brain, Cognition and Behaviour, Radboud University, Nijmegen, The Netherlands, and 8Institute of Cell Biology and Neurobiology, Center for Anatomy, Charite´ University Hospital Berlin, 10117 Berlin, Germany The intercalated cells (ITCs) of the amygdala have been shown to be critical regulatory components of amygdalar circuits, which control appropriate fear responses. Despite this, the molecular processes guiding ITC development remain poorly understood. Here we establish the zinc finger transcription factor Tshz1 as a marker of ITCs during their migration from the dorsal lateral ganglionic eminence through maturity. Using germline and conditional knock-out (cKO) mouse models, we show that Tshz1 is required for the proper migration and differentiation of ITCs. In the absence of Tshz1, migrating ITC precursors fail to settle in their stereotypical locations encapsulating the lateral amygdala and BLA. Furthermore, they display reductions in the ITC marker Foxp2 and ectopic persistence of the dorsal lateral ganglionic eminence marker Sp8.
    [Show full text]
  • Genome-Wide Approach to Identify Risk Factors for Therapy-Related Myeloid Leukemia
    Leukemia (2006) 20, 239–246 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Genome-wide approach to identify risk factors for therapy-related myeloid leukemia A Bogni1, C Cheng2, W Liu2, W Yang1, J Pfeffer1, S Mukatira3, D French1, JR Downing4, C-H Pui4,5,6 and MV Relling1,6 1Department of Pharmaceutical Sciences, The University of Tennessee, Memphis, TN, USA; 2Department of Biostatistics, The University of Tennessee, Memphis, TN, USA; 3Hartwell Center, The University of Tennessee, Memphis, TN, USA; 4Department of Pathology, The University of Tennessee, Memphis, TN, USA; 5Department of Hematology/Oncology St Jude Children’s Research Hospital, The University of Tennessee, Memphis, TN, USA; and 6Colleges of Medicine and Pharmacy, The University of Tennessee, Memphis, TN, USA Using a target gene approach, only a few host genetic risk therapy increases, the importance of identifying host factors for factors for treatment-related myeloid leukemia (t-ML) have been secondary neoplasms increases. defined. Gene expression microarrays allow for a more 4 genome-wide approach to assess possible genetic risk factors Because DNA microarrays interrogate multiple ( 10 000) for t-ML. We assessed gene expression profiles (n ¼ 12 625 genes in one experiment, they allow for a ‘genome-wide’ probe sets) in diagnostic acute lymphoblastic leukemic cells assessment of genes that may predispose to leukemogenesis. from 228 children treated on protocols that included leukemo- DNA microarray analysis of gene expression has been used to genic agents such as etoposide, 13 of whom developed t-ML. identify distinct expression profiles that are characteristic of Expression of 68 probes, corresponding to 63 genes, was different leukemia subtypes.13,14 Studies using this method have significantly related to risk of t-ML.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Topic 3.1 Interactions of Xenobiotics with the Steroid Hormone Biosynthesis Pathway*
    Pure Appl. Chem., Vol. 75, Nos. 11–12, pp. 1957–1971, 2003. © 2003 IUPAC Topic 3.1 Interactions of xenobiotics with the steroid hormone biosynthesis pathway* Thomas Sanderson‡ and Martin van den Berg Institute for Risk Assessment Science, Utrecht University, P.O. Box 8017, 3508 TD Utrecht, The Netherlands Abstract: Environmental contaminants can potentially disrupt endocrine processes by inter- fering with the function of enzymes involved in steroid synthesis and metabolism. Such in- terferences may result in reproductive problems, cancers, and toxicities related to (sexual) differentiation, growth, and development. Various known or suspected endocrine disruptors interfere with steroidogenic enzymes. Particular attention has been given to aromatase, the enzyme responsible for the conversion of androgens to estrogens. Studies of the potential for xenobiotics to interfere with steroidogenic enzymes have often involved microsomal frac- tions of steroidogenic tissues from animals exposed in vivo, or in vitro exposures of steroid- ogenic cells in primary culture. Increasingly, immortalized cell lines, such as the H295R human adrenocortical carcinoma cell line are used in the screening of effects of chemicals on steroid synthesis and metabolism. Such bioassay systems are expected to play an increasingly important role in the screening of complex environmental mixtures and individual contami- nants for potential interference with steroidogenic enzymes. However, given the complexities in the steroid synthesis pathways and the biological activities of the hormones, together with the unknown biokinetic properties of these complex mixtures, extrapolation of in vitro effects to in vivo toxicities will not be straightforward and will require further, often in vivo, inves- tigations. INTRODUCTION There is increasing evidence that certain environmental contaminants have the potential to disrupt en- docrine processes, which may result in reproductive problems, certain cancers, and other toxicities re- lated to (sexual) differentiation, growth, and development.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]