VU Research Portal

The role of transcriptional regulation in the micro-evolution of heavy metal tolerance in Orchesella cincta (Collembola) Janssens, T.K.S.

2008

document version Publisher's PDF, also known as Version of record

Link to publication in VU Research Portal

citation for published version (APA) Janssens, T. K. S. (2008). The role of transcriptional regulation in the micro-evolution of heavy metal tolerance in Orchesella cincta (Collembola). PrintPartners Ipskamp.

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ?

Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

E-mail address: [email protected]

Download date: 07. Oct. 2021

The role of transcriptional regulation in the micro-evolution of heavy metal tolerance in Orchesella cincta (Collembola)

Publisher: Thierry K.S. Janssens Cover design: Janine Mariën Lay-out: Desiree Hoonhout Printed by: PrintPartners Ipskamp, Enschede

ISBN: 978 90 8659 246 3 VU University, Department of Ecological Science thesis 2008-02

This research was supported by the Netherlands Organisation for Scientific Research (NWO, Nederlandse organisatie voor Wetenschappelijk Onderzoek)

VRIJE UNIVERSITEIT

The role of transcriptional regulation in the micro-evolution of heavy metal tolerance in Orchesella cincta (Collembola)

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. L.M. Bouter, in het openbaar te verdedigen ten overstaan van de promotiecommissie van de faculteit der Aard- en Levenswetenschappen op donderdag 9 oktober 2008 om 15.45 uur in de aula van de universiteit, De Boelelaan 1105

door

Thierry Karl Suzanna Janssens

geboren te Duffel, België

promotor: prof.dr. N.M. van Straalen copromotor: dr.ir. D. Roelofs

TABLE OF CONTENTS

Page Chapter 1 Introduction Molecular mechanisms of heavy metal tolerance and evolution in invertebrates. 7

Chapter 2 Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta. 27

Chapter 3 Comparative population analysis of metallothionein promoter alleles suggests stress-induced micro-evolution in the field. 59

Chapter 4 Population specific transcriptional regulation of metallothionein in Orchesella cincta. 81

Chapter 5 Yeast one-hybrid screens on Orchesella cincta metallothionein promoter elements. 93

Chapter 6 Adaptive differences in gene expression associated with stress tolerance in the soil arthropod Orchesella cincta. 125

Chapter 7 General discussion. 155

Appendix Flow-cytometric determination of the Orchesella cincta genome size. 163

References 167

Samenvatting 191

Summary 197

Nawoord 202

Chapter 1

INTRODUCTION

Molecular mechanisms of heavy metal tolerance and evolution in invertebrates

Thierry K.S. Janssens, Dick Roelofs and Nico M. van Straalen Accepted by Insect Science (in modified form)

Evolutionary genetics of adaptation

The emergence of the multi-disciplinary science of evolutionary and ecological functional genomics (EEFG) (Feder, Mitchell-Olds, 2003), following the technological innovations of the genomic revolution, is herald to a wave of molecular evidence for the evolution of ecologically relevant traits in the near future. A lively debate has been going on for the last few years regarding the question whether adaptive nucleotide polymorphisms are mainly located in mutations affecting the structure of non-regulatory proteins (Hoekstra, Coyne, 2007) or at transcriptional regulatory loci, where the mutation can be in cis (non-coding regulatory loci) or in trans (coding regulatory loci, such as transcription factors) (Carroll, 2005; Hsia, 2003; Levine, 2003; Purugganan, 2000; Wray, 2007; Wray et al., 2003). An example of an adaptive structural polymorphism without transcriptional change was provided in a case study of adaptive melanism in pocket mice (Nachman). The Mcr1 gene, coding for a transmembrane G-protein coupled receptor in melanocytes (regulating the pigmentation of hairs in mammals) showed polymorphisms which conferred adaptive variation in fur colour in relation to the colour of the soil on which the mice lived, as a protection to predation by camouflage (Nachman et al., 2003). Later QTL (quantitative trait loci) studies on the pigmentation of oldfield mice species (Peromyscus sp.) revealed two loci of major effect which determined the body region-specific fur pigmentation. Although

7 Chapter 1 light coloured furs were associated with a single amino acid substitution in the Mcr1 receptor, a regulatory mutation causing an increased expression of its ligand, Agouti protein, was required for this phenotype (Steiner et al., 2007). Another striking example is the evolution of organo-phosphorous insecticide resistance in the mosquito Culex pipiens, by some structural mutations in the acetylcholine esterase protein, which is the site of action of these insecticides (Bourguet et al., 1996). However, also a gene dosage component (transcriptional and gene duplication) was observed in some populations (Bourguet et al., 1997). Therefore, transcriptional regulation is an equally important process in the evolution of adaptive novelties as the emergence of structural mutations. Transcriptional regulation is the process by which the amount of mRNA from a gene is determined. It happens by integration of developmental, temporal, environmental, endocrine and tissue-specific signals, transmitted by the activation, nuclear translocation and binding of transcription factors, on to modularly arranged specific binding sites. Transcription factors are proteins, belonging to several protein families, which specifically bind to regulatory or responsive DNA elements (Warren, 2002). Interactions of these transcription factors with the basal RNA polymerase II complex bound to the initiator or TATA box, determine the rate of transcriptional initiation: the frequency by which the RNA polymerase II leaves the initiator to transcribe the respective coding sequence into mRNA (Shopland et al., 1995; Smale, Kadonaga, 2003). This process may involve, 1) DNA looping (to bring bound transcription factors, from distantly positioned binding sites, together to interact), 2) the recruitment of co-factors (proteins which do not bind DNA but exert their activity by specific protein-protein interactions), 3) post-translational modifications of transcription factors and co-factors, 4) chromatin remodelling (an epigenetic process which determines the tightness of the chromatin by DNA methylation and histone modification) and 5) interactions with the nuclear matrix, which bind for example insulators or boundary elements in order to define transcriptional regions on chromosomes (Alberts et al., 2002; Arnosti, 2002; Berger, 2002; Brasset, Vaury, 2005; Dorsett, 1999; Farkas et al., 2000; Gamble, 2002; Gilbert, 2005; Ludwig, 2002). Promoters are more evolvable than coding regions due to the modularity of their architecture and the absence of reading frame constraints. They have a high turnover in

8 Introduction possible binding sites (Stone, Wray, 2001), but due to stabilizing selection, weakly selected mutations and redundancy of binding sites, regulatory variation can exist without phenotypic consequences (Ludwig et al., 2000). In several cases the observed variation in transcription is non-adaptive and represents neutral evolution (de Meaux et al., 2005; Whitehead, Crawford, 2006a). Other factors contributing to determine mRNA levels and stability are, among others, the poly(A)-tail structure at the 3’-end of a transcript which binds several regulatory proteins (Ross, 1996), microRNAs (Gesellchen, Boutros, 2004), and stress granules where mRNA can be temporally accumulating (Ivanov, Nadezhdina, 2006). Finally, there is also control at the translational and the post-translational level which can cause a discrepancy between the observed transcriptome and the proteome (Pradet-Balade et al., 2001). There are numerous examples in the literature describing plastic transcriptional responses towards changing conditions and resources in the environment (Eide, 2001; Girardot et al., 2004). However the evolutionary process of adaptive eukaryotic transcriptional regulation in a clear ecological framework (i.e. with knowledge about a selective agent in the environment) has only been reported by a small number of studies. Mutations responsible for variation in transcriptional regulation of a certain gene can be located in different sites of a genome (Wittkopp, 2005; Wray, 2007; Wray et al., 2003). Cis-regulatory variants are located in the functional non-coding DNA, such as promoters, silencers and enhancers, representing polymorphisms in the structure and arrangement of binding sites for transcription factors, chromatin remodelling factors and even factors that determine mRNA stability. In contrast, trans-regulatory variants determine the amount and properties of one or several of these factors, these are mostly regulatory proteins but also microRNAs, which determine the expression of the particular gene. This means that trans mutations can also be cis mutations, when they reside in non-coding regulatory DNA of the gene encoding the regulatory factor. Therefore, the interpretation of cis or trans depends on the genomic location of a mutation and the transcribed gene of interest (Figure 1).

9 Chapter 1

Figure 1: Mutations affecting the expression of a certain gene can be located in cis or trans. This depends on the genomic location relatively to the gene of interest. Cis regulatory polymorphisms are often located in the promoter regions in the vicinity of genes.

Cis-regulatory evolution The teleost Fundulus heteroclitus has been a valuable model in the study on adaptive processes in differing environments. Compensatory over-expression of Ldh-B (lactate dehydrogenase B) in relation to average water temperature in a steep thermal gradient along the North American Atlantic coast has been traced down to polymorphisms in the promoter (Schulte, 2001), respectively to a glucocorticoid hormone receptor binding site (Schulte et al., 2000) and a Sp1 binding site in the proximal promoter (Crawford et al., 1999). Later the expression level of 13 other genes was identified to be under selection by the average water temperature (Whitehead, Crawford, 2006a). In populations from this species, originating from highly contaminated (PCBs and PAHs) sites, adaptive expression profiles, of which a minor subset was convergent, were observed in the brain tissue (Fisher, Oleksiak, 2007). Another example confers insecticide resistance in Drosophila

10 Introduction melanogaster. A transposon in the Cyp6gi (P450) promoter, increased the transcription of this gene (Daborn et al., 2002). The evolution of hsp70 (heat shock protein 70kDa) promoters in D. melanogaster is very dynamic due to the insertion of transposons. Transposon insertions in heat shock promoters are easier than in other promoters because heat shock genes are more available due to reduced chromatin condensation (Walser et al., 2006). These transposons interfere with the expression of the hsp70s and alter organismal fitness features (Lerman et al., 2003), and hence introduce regulatory genetic variation in the genome. Natural selection has been reported against these hsp70 promoter insertions in populations experiencing thermal stress (Michalak et al., 2001). Another example of cis- regulatory change is found in the plant Boechera holboellii. In an environmental gradient of soil humidity, a drought resistant population exhibited a differential transcriptional response upon desiccation (Knight et al., 2006).

Trans-regulatory evolution Fluconazole resistant strains of the fungus Candida albicans have a reduced intra-cellular concentration of this drug, which is caused by the constitutive higher expression of the mdr1 gene. The protein encoded is a transmembrane pump removing fluconazole from the cell. However no promoter polymorphisms were observed and a mdr1 promoter gfp- reporter construct was constitutively higher in resistant strains, which indicated a trans- regulatory adaptation (Wirsching et al., 2000). Later research confirmed that these mutations must reside at multiple trans-loci (Hiller et al., 2006). Expression levels of the Cyp6A1 gene in Musca domestica (Rutgers strain) were linked to a trans-mutation in an ali- esterase αE7. This mutation affects the production of an intermediate metabolite, which normally inhibits Cyp6A1 expression (Sabourault et al., 2001). The location of a regulatory mutation can be determined by eQTLs (quantitative loci for gene expression); the majority of intra-specific eQTLs are situated in trans and are concentrated in centralized regulatory hubs (Wittkopp, 2007). In 28 out of of 29 analysed genes between Drosophila species inter-specific differences resided in cis, of which 16 did also show a trans-regulatory component (Wittkopp et al., 2004). Analysis of chromosomal substitution strains pointed to the importance of cis-regulatory polymorphisms in intra- specific variation in gene expression in D. melanogaster, which suggested a scope for incipient speciation (Osada et al., 2006). However, by association of multi-modal

11 Chapter 1 expression profiles in different isogenic lines in D. melanogaster in a mixed model approach, a complex interplay of cis- and trans-acting factors was observed (Hsieh et al., 2007). Apparently no consensus has been reached in the evolutionary cis-trans debate. In this thesis the role of transcriptional regulation in adaptive evolution at the level of the population is tackled. The evolution of heavy metal tolerance in the springtail Orchesella cincta is used as a model.

Mechanisms of the Cd stress response and detoxification

Heavy metals include elements for which the density as a pure metal is 5 g/cm3 or more. Several heavy metal ions are required at structural and catalytic sites in proteins (e.g. Fe, Zn, and Cu), others do not have a known biological function and are therefore considered as "non-essential" (e.g. Cd, Pb, Hg, Ni). Non-essential metals occur together with essential metals in the environment, for example in volcanic rocks, ores and deposition by industrial activities. Both essential and non-essential metals can be toxic when dosed above a critical level. One of the metals of great environmental concern is cadmium (Cd), which is a major pollutant mainly by point source deposition in the environment from non-ferro metallurgy and is also renowned for its carcinogenicity (Nawrot et al., 2006). The major route for uptake of cadmium ions by insect cells is via the calcium channels (Braeckman et al., 1999; Craig, 1999). Cd2+ is an electrophilic ion, which under physiological conditions has the following affinity for biochemical ligands: thiol > phosphate > chloride > carboxyl. This implies that Cd is proteotoxic by displacement of the essential metals from proteins (at structural and catalytic positions, resulting in loss of function) and subsequently cytotoxic due to the disruption of cell signalling and Ca2+- homeostasis. The generation of oxidative stress and subsequent lipid peroxidation of the cell membrane are to be ascribed to disruption of mitochondrial oxidative phosphorylation and the depletion of antioxidant protein pools (Bertin, Averbeck, 2006; Korsloot et al., 2004). Genotoxicity is achieved at elevated concentrations by covalently binding to DNA (Hossain, 2002) and inhibition of the mismatch-repair systems (Jin et al., 2003). The main cell signalling pathways activated by Cd are the MAPK (mitogen- activated protein kinase) cascade, PKC (protein kinase C) and the subsequent induction of

12 Introduction proto-oncogenes (such as c-jun and c-fos, which form the heterodimeric transcription factor AP-1) (Korsloot et al., 2004). By a specific balance between several proto-oncogenes and tumor-suppressors, a cell can be induced to become mitogenic or apoptotic. For example, exposure of mesenglial cells to 10 µM Cd during 8 hours showed a Cd-specific activation of the Erk (extracellular signal-regulated kinase), SAPK (stress-activated protein kinase) and hence c-fos expression, not observed upon exposure by other heavy metals, and which was revealed as an increase in specific kinase activities and increase of the three respective transcripts (Ding, Templeton, 2000). The proto-oncogenes are also interacting with the expression of early response detoxification systems (Wimmer et al., 2005), such as metallothioneins, glutathione, superoxide dismutase and catalase. Also the induction of direct Cd transporters (Liao et al., 2002), cytoskeleton proteins (Mattingly et al., 2001), and extra- cellular protective proteins (Rayms-Keller et al., 2000) has been reported upon cadmium exposure. Cd is bound by phytochelatins, which were considered to be plant-specific until the recent isolation of a phytochelatin synthase and a phytochelatin transporter gene from Caenorhabditis elegans (Vatamaniuk et al., 2005; Vatamaniuk et al., 2002). This list of cadmium-binding macro-molecules and detoxification mechanisms is far from exhaustive, and other taxon-specific examples have been isolated or do have to be discovered yet. The protection at proteotoxic concentrations is assisted by stress proteins, chaperones which repair the damaged proteins (Korsloot et al., 2004).

The metallothionein system

The best studied heavy metal detoxification system is the one in which metallothioneins are involved and has been studied extensively in vertebrates. Since metallothionein was discovered in horse renal cortex tissue in 1957 (Margoshes, Vallee, 1957), metallothionein proteins have been isolated and studied in a wide variety of organisms (Dallinger, 1996; Roesijadi, 1992), including prokaryotes and plants. They are small, ubiquitous proteins and remarkably cysteine rich (20-30%) and devoid of aromatic amino acids and histidine (Kägi, 1991). The functions of metallothioneins are metal homeostasis and detoxification. In addition they contribute to control of the cellular redox status (Viarengo et al., 2000). The reduced cysteines serve in the (mostly two) metal-thiolate clusters, which are able to

13 Chapter 1 specifically bind metals (e.g. Cu, Zn and Cd). Beside the metal-thiolate cluster no characteristic secondary structure has been identified. These structures are only conserved within closely related species, which makes the classification of metallothioneins problematic (Binz, Kägi, 1999; Kägi, 1991). Often several paralogues (mostly called isoforms) exist in the genome of a species, especially in mammals multiple isoforms are present (Miles et al., 2000), e.g. the human genome has 17 metallothionein genes, of which 10 functionally characterized, clustered on the 16q13 locus. These mammalian forms exhibit a large degree of tissue-specific expression. Metal specificity of metallothionein isoforms has been proven in invertebrate taxa, such as the gastropod Helix pomatia (Dallinger et al., 1997) and D. melanogaster (Egli et al., 2006a) based on induction and binding efficiency measurements. In these species a copper and a cadmium specific metallothionein were identified. D. melanogaster contains four metallothioneins of which MtnA and MtnB, are specific for respectively copper and cadmium (and were formerly known as Mtn and Mto). The function of the two other Drosophila MTs (MtnC and MtnD) (Egli et al., 2003) is still elusive. Attempts to isolate the MtnA protein from fly tissue have been unsuccessful. It was hypothesized that this is due to polymerization into lysosomal granules in contrast to the the MtnB protein, which is freely available (Lauverjat et al., 1989). The MtnA locus shows duplications in natural and laboratory populations, which confer increased tolerance to cadmium (Maroni et al., 1995; Maroni et al., 1987; Otto et al., 1986). The single metal thiolate cluster containing Drosophila metallothioneins were considered to be phylogenetically closer related to the fungal copper thioneins than to the mammalian Zn thioneins (Domenech et al., 2003; Valls et al., 2000). This could not be generalized for all arthropods, because of the zinc binding properties of some crustacean MTs (Valls et al., 2001). The earthworm Lumbricus rubellus contains three isoforms (on the protein level) (Stürzenbaum et al., 2004; Stürzenbaum et al., 1998) of Cd-binding metallothionein of which only the wmt-2 isoform is Cd-inducible (Stürzenbaum et al., 2001) and the wmt3 is enriched in embryonic tissue (Stürzenbaum et al., 2004). The genomic organisation of these isoforms is complicated. The wmt2 is encoded on three loci in the L. rubellus genome (Stürzenbaum et al., 2004), although these could also represent three alleles at the same locus (Stürzenbaum, personal communication). In C. elegans two heat shock and cadmium inducible metallothioneins were discovered, which were not responsive to Cu or Zn, and worked independently from each other (i.e. without

14 Introduction compensatory expression levels under mutual knock-out) (Freedman et al., 1993; Swain et al., 2004). A toxicogenomics study in Daphnia magna detected two metallothioneins, inducible by Cd and Cu, but not by Zn, revealing metal specificity (Poynton et al., 2007).

Metallothionein transcriptional regulation

Metallothioneins are induced by a wide array of compounds, including heavy metals, oxidative stress, hypoxia and endocrine signals (Kägi, 1991). Their mRNA and protein levels do no always coincide because of the significant turnover and the possibility of translational control component in the expression (Bourdineaud et al., 2006). The promoter regions of metallothioneins contain a set of characteristic binding sites for transcription factors, which regulate the basal and the metal-induced transcription (Haq et al., 2003). The most prominent is the metal responsive element (MRE), binding site for the metal-specific transcription factor MTF-1, a zinc finger protein. This transcription factor has been isolated from Drosophila (Zhang et al., 2001), fish (Chen et al., 2002; Dalton et al., 2000; Maur et al., 1999), and mammals (Brugnera et al., 1994; Radtke et al., 1993) and sufficiently characterised. Other transcription factors involved in vertebrate metallothionein transcription are Nrf-2 (nuclear erythroid 2 p45-related factor 2, a redox-sensitive basic leucine zipper), AP- 1 (activator protein 1, transcriptional regulatory endpoint of many stress pathways, c- jun/c-fos proto-oncogene dimer, leucine zipper), and Sp1 (specificity protein 1, necessary for specific transcriptional initiation, zinc finger protein). The mechanism of regulation at the level of the MTF-1 transcription factor, which is important for basal and induced transcription, has been hypothesized several times. However, transcription of MTF-1 is not induced by heavy metal exposure (Heuchel et al., 1994). Increased cellular zinc levels and zinc displacement from metallothionein by other heavy metals, oxidative stress and phenolic anti-oxidants are involved in metallothionein induction (Bi et al., 2004; Dalton et al., 1996; Haq et al., 2003; Roesijadi, 1992; Zhang et al., 2001; Zhang et al., 2003). Therefore MTF-1 can be considered as a cellular zinc sensor (Bittel et al., 1998; Daniels et al., 2002; Laity, Andrews, 2007), which has differential affinities for the several MREs, depending on the applied zinc concentration (Wang et al., 2004). Also,

15 Chapter 1 extensive homeostatic feed-back mechanisms of MT on other zinc recruiting transcription factors have been reported (Zeng et al., 1991a; Zeng et al., 1991b; Zhang et al., 2003). In addition MTF-1 is rapidly translocated to the nucleus upon zinc and cadmium treatment (Smirnova et al., 2000). A zinc sensitive inhibitor MTI (metallothionein transcription inhibitor), which binds and inhibits MTF-1, but dissociates from MTF-1 during zinc exposure (possibly by zinc redistribution by heavy metals or oxidative stress), was suggested (Palmiter, 1994). These zinc-based mechanisms have been challenged in a review by Bourdineaud et al. (2006), because of the environmentally non-relevant high zinc levels, which were applied to transformed cancerous cell lines and the profusion of contradictory studies concerning this matter, especially in invertebrates. Moreover, the induction of metallothioneins by environmentally relevant zinc concentrations in bivalves was not achieved (Bourdineaud et al., 2006). These observations could also point to a vertebrate-specific mechanism. Because other transition metals than zinc inhibit the binding of MTF-1 to MREs (Bittel et al., 1998), the zinc sensor model cannot explain the MTF-1 based induction of metallothioneins by these metals (such as cadmium). Zinc is thus required for DNA binding in the MTF-1 zinc fingers, but additional modifications at certain amino acids are required for the transcriptional activation. The post-translational phosphorylation of MTF- 1 (LaRochelle et al., 2001) or several cofactors (Jiang et al., 2004) or dephosphorylation of MTF-1 (Adams et al., 2002; Saydam et al., 2002) at specific amino acid residues has been reported to regulate the transcriptional activation by MTF-1. The binding of the Nrf2 transcription factor to the ARE is also regulated by the phosphorylation state of Nrf2 itself and of its inhibitor Keap, often associated with other bZip proteins (Nguyen et al., 2003) and proteins binding to MREs (Dalton et al., 1994). In addition the mammalian MT-1 promoter is also regulated at the epigenetic level (DNA methylation and associated proteins) (Majumder et al., 2006). In Drosophila the metallothioneins are better induced by cadmium and copper than by zinc, unlike in the mammalian situation. The MTF-1 of Drosophila also contains six zinc fingers, but it is different from the vertebrate by the absence of the activation domains and its DNA binding at low pH (6.0-6.5). It only works as a zinc sensor when expressed in mammalian cells, not in fly cells (except at elevated zinc concentrations of 2mM) and its expression is restricted to the gut and the fat body (Zhang et al., 2001). MTF-1 plays a

16 Introduction central role in copper homeostasis, because an MTF-1 knock-out strain is sensitive to copper load and depletion (Egli et al., 2003), which suggests that it also regulates other members of the copper homeostatic system. The promoters of the MtnA, MtnB, MtnC and MtnD contain 2, 4, 4 and 4 MRE elements respectively. Moreover MtnC has an MRE in its coding sequence and MtnD has two MREs in the 3’-region (Egli et al., 2003). Furthermore, it was shown that the tissue-specific expression of the four Mtn genes, namely in the midgut, is a consequence of the distribution of metals (Egli et al., 2006b), instead of a transcriptional regulation via tissue specific elements in the promoter, although a study by Bonneton et al. (1996) did reveal MtnA promoter activity in the fat body, in contrast to the MtnB promoter. Metal-specific induction of MtnA and MtnB by respectively copper and cadmium has been attributed to their promoter sequences (Egli et al., 2006a). These studies show that in D. melanogaster metal-specific metallothioneins have evolved, which require the MTF-1 for their transcriptional regulation. The two metallothioneins of C. elegans exhibit life stage and tissue specific expression patterns, due to polymorphisms in their respective promoter sequences (Swain et al., 2004). Only the mtl2 promoter contains one consensus MRE sequence. It was presumed that this is not functional because of the need of cooperative mechanisms for MRE binding proteins (Freedman et al., 1993). No open reading frame of an MTF-1 homologue could be retrieved in the fully sequenced C. elegans genome. The intestinal specificity of the expression of mtl1 and mtl2 depends on GATA elements, which recruit the intestinal specific transcription factor Elt-2 (Moilanen et al., 1999), whereas the position of the respective expression is suggested to be determined by the presence of the CRE (cAMP responsive element) and the steroid receptor binding site (Freedman et al., 1993). Tissue specificity of metallothionein expression in C. elegans is achieved by intestine specific transcription factors. The function of the single MRE is still elusive because of the absence of the MTF-1 gene in the C. elegans genome. The earthworm L. rubellus metallothionein promoters at the wmt2a, wmt2b and wmt2c loci do contain three consensus MREs in the proximal promoter (Stürzenbaum et al., 2004), however no MTF-1 could be identified in this species. Because an earthworm metallothionein promoter gfp-construct (wmt2 promoter), containing three consensus MREs, was cadmium-inducible in C. elegans, it was hypothesized that the regulation of

17 Chapter 1 metallothioneins in lower invertebrates is completely different from the situation in vertebrates and Drosophila and does not rely on MTF-1 (Swain et al., 2004). The transcriptional regulation of metallothioneins has also been studied in two species of sea urchin, Lytechinus pictus and Strongylocentrotus purpuratus, but mainly in the framework of developmental biology. In S. purpuratus six to seven metallothioneins were discovered and the genomic settings of two of them were characterised in detail. Both SpmtA and SpmtB did contain two consensus MREs in their respective proximal promoters. However SpmtA did also exhibit two intronic MREs. The SpmtA mRNA levels are an order of magnitude higher than the SpmtB levels, zinc inducible, and complementary tissue specific expression patterns were observed in pluteus larvae (Nemer et al., 1991). The MREs of the SpmtA gene seem to co-operate, involving also promoter-intron interactions, which determine cadmium inducibility. Tissue specificity is achieved by a mobile cassette of transposable P-elements in the intron (Bai et al., 1993; Nemer et al., 1995). The situation in L. pictus is different, at least three metallothioneins were isolated (Cserjesi et al., 1992) of which the Lpmt1 promoter was functional in a human cell line, but the human MT(II) promoter was not active when injected in sea-urchin embryos, suggesting that an essential sea-urchin specific cis-acting element was lacking. No tissue specific expression of two metallothioneins (Lpmt1 an Lpmt2) was observed in this species, but they were cadmium inducible (Cserjesi et al., 1997). In general we can conclude that the regulation of metallothionein expression in invertebrates is as divergent, as the invertebrate phyla themselves, and hardly understood. Some general themes about metallothioneins in invertebrates emerge from the literature; 1) MTF-1 is present in some but not all invertebrate groups, 2) MREs are usually present, but their function is not clear in many cases, 3) metallothioneins have a tissue-specific expression, determined by the presence of metals or tissue specific transcription factors, 4) often several isoforms (whether in the sense of paralogues or differential splicing products) have been isolated, and 5) most evidence exists on Cd and Cu binding and induction in invertebrates.

18 Introduction

Heavy metal tolerance and genetic adaptation

Physiological adaptation is a form of phenotypic plasticity, by which an organism can adjust its metabolism in an acute response in order to cope with the altered environmental conditions, e.g. environmental stress, such as heavy metal toxicity. Genetic adaptation is an evolutionary mechanism which acts over several generations, by which better adapted (i.e. increased constitutive or an appropriate plastic response towards adverse environmental conditions) genotypes have a higher fitness, and hence increased abundance, in the respective population. Both mechanisms are genetically determined, but only the latter creates a shift in population composition based on the available genetic variation. Genetic adaptation is proven by comparing the response of lab-reared F1 generations of the putative adapted and reference populations. Posthuma and van Straalen (1993) and Klerks and Weis (1987) provide reviews about terrestrial and aquatic examples respectively, of tolerance to heavy metals in invertebrate species. Studies published since these reviews are listed in Table 1. From these studies it is clear that in many populations, subject to sufficiently strong selection by heavy metal contamination, such as mine ores or industrial emissions, genetically determined heavy metal tolerance could emerge. Some studies report about the evolution of heavy metal tolerance in lab selected populations (Spurgeon, Hopkin, 2000; Vidal, Horne, 2003). These studies prove that it may take only a small number of laboratory generations to exert selection, if the appropriate genetic variation is already present in the genome. A recent review concerning the micro-evolution of heavy-metal tolerance in invertebrates (Morgan et al., 2007) emphasized the importance of an integrative view, and suggested to look further than a single detoxification mechanism (e.g. metallothionein). Also it was urged to look further into RNAi, stress granules and epigenetic mechanisms, as possible regulators of ecologically relevant transcriptional regulation, because evidence for the importance of these processes is growing. Recent suggestions to this approach do include the use of genomic tools (such as transcriptional profiling), which can be used in ecotoxicological risks assessment and to elucidate evolutionary adaptations (Neumann, Galvez, 2002; van Straalen, Roelofs, 2006).

19 Chapter 1 Table 1: Invertebrate species exhibiting genetically based heavy metal tolerance in laboratory reared offspring from field populations, an overview since the reviews by (Klerks, Weis, 1987) and (Posthuma, van Straalen, 1993).

Species Metal Evidence and reference Drosophila melanogaster Cu, Cd Duplication of Mtn gene confers resistance (Maroni et and other Drosophila al., 1995; Maroni et al., 1987) species (Diptera) Orchesella cincta Cd Sutained growth and survival in F1 population (Collembola) exposed to Cd, elevated Cd excretion through intestinal exfoliation (Posthuma, 1990; Posthuma et al., 1992; Timmermans et al., 2005a; van Straalen et al., 1987) Porcellio scaber Cd Sustained growth of F1 under high Cd exposure; (Isopoda) decreased growth in the absence of Cd (Donker, Bogert, 1991) Limnodrilus Cd, Sustained growth of F1 population exposed to polluted hoffmeisterii Co, Ni sediment (Klerks, Levinton, 1989; Martinez, Levinton, (Oligochaeta) 1996) Isotoma notabilis Cu, Zn Growth and reproduction of F1 populations less (Collembola) affected by metals (Tranvik et al., 1993) Onychiurus armata Cu, Zn Growth and reproduction of F1 populations less (Collembola) affected by metals (Tranvik et al., 1993) Chironomus riparius Cd Altered life histories, increased Cd excretion, sustained (Diptera) growth under Cd exposure, Zn deficiency of F1 populations from contaminated site (Groenendijk et al., 1999a; Groenendijk et al., 1999b; Postma et al., 1996) Biomphalaria glabrata Cd Cd tolerance is reflected as a cost to parasite infection (Gastropoda) (Salice, Roesijadi, 2002) Bugula neritina Cu Increased growth in the presence of high Cu (Bryozoa) concentrations and decreased growth in the absence of Cu, relative to reference population. (Piola, Johnston, 2006)

The Orchesella cincta cadmium tolerance case study

Orchesella cincta is a common species of Collembola inhabiting the litter layer of forests and wood stands, with a preference for disturbed habitats, were its abundance can reach up to thousands of individuals per square meter (Berg, 2007; van Straalen, 1989). The taxonomic position of Collembola within the Pancrustacea is still under debate (Carapelli et al., 2006), especially the paraphyly of hexapods (Nardi et al., 2003). Recent extensive analysis of arthropod ribosomal (Timmermans et al., 2008) and rRNA genes

20 Introduction

(Mallat, Giribet, 2006) confirmed monophyly of the hexapod body plan. They diverged from the Ectognatha about 400 million years ago, according to the oldest collembolan fossil Rhyniella praecursor (Whalley, Jarzembowski, 1981). A phylogeographical subdivision was observed in European populations of O. cincta based on differences in AFLP patterns and mitochondrial DNA sequences, dating back to the quaternary glaciations (Timmermans et al., 2005b). In a small geographical area, restricted to the Netherlands and surrounding areas, only limited population substructures based on allozyme polymorphisms (Frati et al., 1992), TE-AFLP patterns (van der Wurff et al., 2003) and micro-satellite polymorphisms (van der Wurff et al., 2005) could be detected. Limited evidence for population differentiation was found in heavy metal tolerant populations (Frati et al., 1992; van der Wurff et al., 2005) but neither reproductive isolation, nor recent bottlenecks were observed in these populations, suggesting that due to the moderately high gene flow the heavy metal pollution only has a limited effect on the genetic diversity in this species (Timmermans, 2005c). Due to their continuous growth, as ametabolous arthropods, springtails must regularly moult. This weekly moulting process includes exfoliation of the intestinal epithelium as a so-called gut pellet. It was by analyzing these gut pellets in O. cincta that the major way of heavy metal excretion was discovered (Joosse, Buker, 1979). Meanwhile, the springtail O. cincta has been the subject of heavy metal research for more than two decades (van Straalen, Roelofs, 2005). Avoidance behaviour by Collembola to heavy metals has been suggested but not extensively documented (Filser et al., 2000; Fountain, Hopkin, 2001; Gillet, Ponge, 2003; Rantalainen et al., 2006), and especially not in O. cincta. It is known to what extent this behaviour may contribute to tolerance mechanisms. Timmermans (2005c) observed no avoidance of this species towards Cd contents up to 500 µg/g dry weight in their diet (algae). Evidence for genetically determined heavy metal tolerance in populations from historically contaminated sites, revealed as a less outspoken reduction in growth during cadmium exposure (Posthuma, 1990), increased survival of populations from these contaminated sites upon cadmium exposure at 200 µg Cd/g algae (Sterenborg, 2003a) and 500 µg Cd/ g dry weight algae (Timmermans et al., 2005a), was found as elevated mean excretion efficiencies (lead and cadmium) (Posthuma et al., 1992; van Straalen et al., 1987).

21 Chapter 1 This means that a larger fraction of the heavy metal body burden is retained in the gut epithelium. In between two moults about 90% of the cadmium body burden was retrieved in the gut tissue (Hensbergen et al., 2000). When compared to the approximately 35% of excretion efficiency by way of the gut pellet (Posthuma et al., 1992), this means that a large fraction has to be resorbed in the body. Sterenborg (2003a) suggested that the resorbed cadmium is inducing the metallothionein during next moulting cycle. Heavy metals in springtails are suggested to be compartmentalized from the cytoplasm into calcium and phosphate rich electron-dense lysosomal granules (Hopkin, 1997; Humbert, 1978; van Straalen et al., 1987). In the springtail Tetrodontophora bielanensis exposure to cadmium, lead and zinc led to a number of major cellular rearrangements, especially the increase of the number of these electron-dense type-A granules, which contained a large fraction of the cellular heavy metals (Pawert et al., 1996). The type B granules, which are sulphur and organic matter rich and supposed to be associated with the metallothionein detoxification system, have not been observed in Collembola yet (Kohler, 2002). Heritability of cadmium excretion efficiency was only proven in a reference population (midparent and halfsib analyses) and not in a tolerant population, suggesting a reduction in additive genetic variation in the latter population due to directional selection (Posthuma et al., 1993). Growth reduction upon Cd exposure and Cd excretion efficiency were inversely related (Posthuma et al., 1992), which could somehow point on a certain fitness advantage of increased excretion efficiency in tolerant populations. Later, a 7,1 kDa cadmium binding protein was isolated, which was characterized as a metallothionein (Hensbergen et al., 1999). It contains 77 amino acids, has two cysteine clusters (9 and 10 cysteines respectively), and there is some evidence that it is post- translationally cleaved in vivo at two threonine-glutamine sequences of which one is situated at the linker region, in between both clusters (Hensbergen et al., 2001). This metallothionein is inducible by cadmium, binds 7 to 8 Cd atoms and is almost exclusively expressed in the midgut tissues (Hensbergen et al., 2000). Unlike other metallothioneins, the O. cincta mt does not bind zinc (Sterenborg et al., 2003b). The existence of a cadmium- binding and inducible protein in Orchesella cincta suggested that it is involved in the tolerance to cadmium described before. The question remains what is the contribution of this metallothionein to genetic adaptation, revealed by Posthuma et al. (1992)? Following sequencing and Southern analysis, this metallothionein was shown to be a single copy

22 Introduction gene containing a single 99 bp intron, and following Northern analysis and semi- quantitative PCR an increased Cd inducibility was revealed in a tolerant population (Sterenborg, Roelofs, 2003). However, by real-time quantitative PCR an increased constitutive mt mRNA level was measured in lab reared populations from polluted sites, which even correlated with the amount of cadmium in the soil of origin (Timmermans et al., 2005a). Additive genetic variation was shown in the Cd induced mt mRNA levels from a reference population, which means there is a scope for natural selection (Roelofs et al., 2006). As a result from these data it was apparent that the micro-evolution of cadmium tolerance had to be sought in the transcriptional regulation of metallothionein. A field survey of 15 populations revealed eight alleles in the coding region of the O. cincta mt and an increase in genetic diversity at this locus in heavy metal-stressed populations in comparison to reference populations (Timmermans et al., 2007a). Moreover, the five observed amino acid substitutions did not bear a sign of selection. Therefore the authors suggested that selection may be directed on linked regulatory loci, such as the promoter. Differential transcriptional regulation of other genes than metallothionein was reported to play a role in heavy metal tolerance in O. cincta. These genes, involved in cell signalling, cellular trafficking and apoptosis, exhibited a population specific response upon Cd exposure (Roelofs et al., 2007).

Outline of the thesis

The major hypothesis tested in this thesis is whether transcriptional regulation contributes to the micro-evolution of heavy metal tolerance in certain populations of O. cincta. Because of the extensive organismal evidence from previous research in this case study the approach in this thesis is accentuated at the molecular level. An emphasis is put on unravelling of variation in transcription levels of the cadmium-binding metallothionein in populations from reference and heavy metal-contaminated locations.

23 Chapter 1 Chapter 2. Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

In this chapter a descriptive study of the genomic location upstream of the metallothionein gene, the pmt locus, was combined with genealogical and recombination analysis. Nine different alleles were discovered in populations from north-western Europe. They were screened for consensus binding sites for transcription factors involved in the transcriptional regulation of metallothioneins in a wide set of taxa. Also, the mutational spectrum of nucleotide polymorphisms at this locus was screened for signatures of natural selection. In order to analyze these alleles in a functional manner a luciferase construct of six abundant pmt alleles was made and tested for responsiveness to cadmium, paraquat (oxidative stress) and 20-E (20-hydroxyecdysone, an arthropod moulting hormone) in a clonal background, the Drosophila S2 cell line. The differences in dose-response profiles of several alleles for these three compounds are compared and the possible cis-regulatory evolution of metallothionein in O. cincta is evaluated. Putative mechanisms of the transcriptional regulation at this locus are discussed.

Chapter 3. Comparative population analysis of metallothionein promoter alleles suggests stress-induced micro-evolution in the field

Following the evidence from the previous chapter for functional polymorphisms at the pmt locus, the pmt locus of 23 O. cincta populations from soils with a wide range of heavy metal content was genotyped with an RFLP method. Relationships between allele frequencies, genetic diversity and heavy metal contamination were made. The data from this chapter confirm that selective forces act on the pmt locus in natural field populations, implying that cis-regulatory evolution plays a certain role in the adaptation to elevated heavy metal levels at some field sites.

24 Introduction

Chapter 4. Metallothionein induction profiles in pmt-homozygous families

In this chapter the contribution of cis- and trans-regulatory evolution to the population- specific variation in metallothionein expression in O. cincta was investigated. From previous chapters the role of the (epi-)genetic background was unknown. In a 3-way factorial design the basal and cadmium-induced metallothionein mRNA levels were compared between lab-reared pmt homozygous families with a genetic background from reference and cadmium-tolerant populations. The interaction between cadmium exposure and population specific genetic background, with its characteristic but hitherto unknown mechanisms of trans-regulatory variation or epi-genetic features, were the dominant factors affecting the metallothionein mRNA levels in vivo.

Chapter 5. Yeast one-hybrid screen on elements from the Orchesella cincta metallothionein promoter

Genes encoding potential transcription factors were isolated from a cDNA library by using the yeast one-hybrid technique. This technique is performed in a yeast strain and selects clones from an expressed cDNA library by interactions with binding sites on the bait plasmid. Positive interactions and the presence of both plasmids complement the auxotrophic yeast strain’s diet and are exhibit as colonies on a nutritionally selective medium. Subsequently, the cDNA plasmids were rescued from yeast on the insert was sequenced.

Chapter 6. Adaptive differences in gene expression associated with stress tolerance in the soil arthropod Orchesella cincta

In this chapter the transcription of approximately 1900 genes was compared between a population from a reference site and a severely heavy metal contaminated site simultaneously in a spotted cDNA microarray approach. Analysis of variance revealed genes that have a population specific expression profile, and interact with cadmium exposure. The transcription profiles in the tolerant population were less perturbed by the exposure to cadmium compared to the reference population. Although no data about the

25 Chapter 1 nature of the regulatory polymorphisms were obtained, the data in this chapter confirmed the importance of transcriptional processes in the micro-evolution of the cadmium tolerant phenotype and possible other cadmium defence mechanisms in O. cincta emerged from this chapter.

Chapter 7. General discussion

Finally, the data of all the preceding chapters are summarized, integrated and discussed in this chapter. Also, suggestions for forthcoming research are made.

Appendix. Flow-cytometric determination of the Orchesella cincta genome size

Prior to the preparation of a genomic library (unpublished results) the genome size of the non-model organism O. cincta was measured, relative to rainbow trout (Onchorhynchus mykiss) erythrocytes. This allowed us to estimate if the size of the library was sufficient to cover the entire genome.

26 Chapter 2

Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

Thierry K.S. Janssens1, Janine Mariën1, Peter Cenijn2, Juliette Legler2, Nico M van Straalen1 and Dick Roelofs1 BMC Evolutionary Biology

ABSTRACT Background: mt Orchesella cincta mt pmt mt

Results: mt pmt

mt

Conclusion: pmt O. cincta Background: et al.cis et al. Fundulus heteroclitus et al. et al. et al. Drosophila et al. et al. Arabidopsis thaliana et al. Drosophilamelanogaster et al. Orchesella cincta

et al. et al. et al. et al. et al. O. et al. et al. et al. et al. et al. et al. mt mt pmt et al.mt et al. et al. et al. et al. et al. et al. cis et al. et al. et al. et al.

et al. et al. et al. et al. et al. et al. et al. et al. et al.et al. in vitro et al. et al. et al. et al. et al. et al. et al. O.cincta pmt pmt pmt

RESULTS General architecture of the locus

et al. et al. et al. et al. pmt pmt pmt pmtpmtpmtpmtpmtpmt pmt pmtpmtpmtpmt pmtpmtpmtpmt pmt pmt pmtpmt pmt pmt et al.

Orchesella cincta pmt

Inr DPE MRE ARE C/EBP DRE HERE Consensus et al. et al. et al. et et al. al. pmt pmt pmt pmt pmt pmt pmt pmt pmt

32

pmt pmt Similarities among pmt alleles and recombinant analyses pmt pmt pmt pmtpmt pmtpmtpmtpmtpmtpmt

Orchesella cincta pmt

0,1

pmtD2

pmtA1 pmtD1 pmtC pmtA2 pmtE

Orchesella villosa pmtB pmt

pmtBAL pmtF (without 1269 bp insert)

Orchesella cincta pmt Orchesella villosa pmt

pmtpmtpmt pmt pmt pmt pmt pmt pmt pmtpmtpmt pmt pmt pmt pmtpmt pmtpmt pmt pmt pmt pmtpmt pmt pmt pmt pmt pmt pmt pmt

Functional analysis pmt pmt Drosophila pmt mt hsp et al. et al. pmt pmt pmt pmt pmt pmtpmt pmt pmt pmt pmt pmt pmtpmtpmt

Orchesella cincta pmt

pmt pmt

pmt pmt Orchesella cincta pmt pmtluc pmtluc 0.009 pmtluc pmtluc pmtluc 0.019 pmtluc

Allele frequencies in field populations pmt O. cincta pmt

et al. pmtpmt pmtpmtpmt

Orchesella cincta et al. pmt et al. pmt pmt pmt pmt pmt pmt pmt pmt mt mt et al. pmt

pmt DISCUSSION

pmt pmtpmtpmtpmtpmt pmtpmtpmt pmt

et al. et al. et al.pmt et al. O.cinctapmt pmt et al. et al. O. cincta villosa et al. et al. et al. et al.

et al. et al. pmt trans

Orchesella cincta pmt

Orchesella cincta pmt et al. et al. et al. et al. pmt trans pmt et al. et al.

pmt O. cincta Onchorhynchus mykiss, Strongylocentrotus purpuratus Drosophila pmt et al. pmt O. cinctaDrosophila in vivo O. cincta

Orchesella cincta pmt

Drosophila O. cincta et al. et al. et al. et al. et al. pmt pmt pmt Thermobia domestica et al. et al. O. cincta mt

Orchesella cincta pmt pmt pmt pmt et al. pmt pmt

Orchesella cincta pmt CONCLUSION

Orchesella cincta Drosophila et al. et al. et al. et al. et al.

et al. pmt in vivo pmt

MATERIAL AND METHODS

DNA purification et al. Genome Walking and PCR OrchesellacinctaO. villosa Dra Eco Hinc Hpa Sca Sma Stu villosa pmtpmt

O. cinctavillosa pmt et al. pmt O. cincta villosa, mt O.cinctamt et al. O.cinctapmt DNA-Sequencing pmt villosa pmt Transcription Factor Binding Site Analysis et al. et al.

et al. et al. Luciferase reporter assay O. cinctapmt Kpn Xho KpnXho Drosophila melanogaster DrosophilaDrosophila et al. Drosophila

Data analysis

et al. pmt et al. O. villosa pmt et al.

Author’s contributions

ACKNOWLEDGEMENTS

Additional files 1-10 can be retrieved from http://www.biomedcentral.com/1471- 2148/7/88

Additional file 11: Orchesella cincta pmt Cd Paraquat 20-E pmtluc pmtluc pmtluc pmtluc pmtluc pmtluc

Additional File 12 Primer Sequence Kpn Xho pmt pmt pmt pmt pmt pmt pmt pmt pmt pmt

Additional File 13: Orchesella cincta pmt allele Clones consensus pmt P C C P pmt C C pmt P P P pmt P C C C pmt P P C pmtS pmt P pmtM pmtS pmt P C C pmt pmtA pmt`H pmt pmtL pmt pmt pmtB

Chapter 3

Comparative population analysis of metallothionein promoter alleles suggests stress-induced micro-evolution in the field

Thierry K.S. Janssens1, Ricardo del Rio Lopéz2, Janine Mariën1, Martijn J.T.N. Timmermans1, Kora Montagne-Wajer1, Nico M. van Straalen1 & Dick Roelofs1 Environmental Science and Technology 42: 3873-3878

1 Vrije Universiteit Amsterdam, Faculty of Earth and Life Sciences, Institute of Ecological Science, Department of Animal Ecology, de Boelelaan 1085, 1081 HV Amsterdam, the Netherlands 2 Universitat de les Illes Balears, Departament de Biologia, Carretera Valldemossa, km 7.5, C.P. 07122 - Palma de Mallorca, Spain

ABSTRACT

We investigate a model system for micro-evolution of transcriptional regulation: metallothionein expression in springtails. A previous survey of the metallothionein promoter in Orchesella cincta (Collembola) revealed nine alleles with differential basal activities and responses to cadmium and oxidative stress. In this study, twenty-three woodlands, with a divergent degree of pollution, were sampled and heavy metals were measured. When grouped to their contamination degree, they were discriminated best on the pmtD2 metallothionein promoter allele frequency, which was higher in populations living in heavily polluted sites. Taken together with previous work showing high inducibility of the pmtD2 promoter allele by Cd in a reporter assay, this suggests a fitness advantage of the pmtD2 allele in polluted sites. Redundancy analysis revealed associations between allele frequencies and specific metals in the environment, resulting in a subdivision between pollution-associated alleles and others. A positive relationship

59 Chapter 3 between the pmtD2 allele frequency and the Cd content of the soil as well as between pmtE and Ni in the litter emerged. An increase of genetic diversity was observed with increasing Pb in the soil, reached through substitution of the pmtA1 allele, suggesting balancing selection. Our results illustrate that environmental factors can exert selection on promoter polymorphisms and cause adaptation through altered transcriptional regulation.

INTRODUCTION

Adaptive novelties may result from changes in gene regulation, that occur by reshuffling of modular transcription factor binding sites (Wray et al., 2003). This form of regulatory evolution has been demonstrated for ecologically relevant traits such as Ldh-B expression, a compensatory mechanism in fish populations inhabiting different temperature regimes (Schulte, 2001) and tissue-specific over-expression of Cyp6g1 in insecticide resistance in Drosophila melanogaster (Chung et al., 2007). These studies show that natural selection can act upon genetic variation of transcriptional regulation, in addition to structural variation of proteins (Hoekstra, Coyne, 2007). In this paper we study the micro-evolution of transcriptional regulation in field populations. Anthropogenic modifications of the environment often exert selection processes on genomes (Medina et al., 2007; Morgan et al., 2007). Frequently, this type of natural selection results in a specific transcriptional response (Fisher, Oleksiak, 2007; Roelofs et al., 2007). It is suggested that polymorphisms of promoter sequences are often responsible for variation in expression (Chung et al., 2007; Daborn et al., 2002; Wray et al., 2003), but surveys in which promoter allele frequencies were analyzed in association with environmental pollution are scarce. Orchesella cincta is a common Holarctic soil arthropod (Berg, 2007; van Straalen, 1989) living in association with accumulated pollutants in the soil and litter. The heavy metal- tolerant phenotype of this species, observed in populations from heavily polluted sites, shows an increased excretion efficiency of Cd and Pb (Posthuma et al., 1992). The reduction of growth upon Cd exposure, which is inversely related to the Cd excretion efficiency, is less pronounced in the tolerant phenotype (Posthuma et al., 1992). Heavy metal tolerance also involves over-expression of a Cd-binding metallothionein

60 Comparative population analysis (Hensbergen et al., 2000; Sterenborg, Roelofs, 2003; Timmermans et al., 2005a), of which the Cd-induced expression is an additive genetic trait (Roelofs et al., 2006). Nine alleles were discovered in this gene’s promoter (pmt); some did show different basal activities and responsiveness to Cd and oxidative stress in a luciferase reporter assay (Janssens et al., 2007). Their architecture differed in the number and spacing of putative transcription factors binding sites relevant to the transcriptional regulation of metallothioneins. Additionally, the sequences of this locus contained a signature of balancing selection in a population from a historically heavy metal contaminated site. The evolution of heavy metal tolerance in the springtail O. cincta by increased metallothionein expression is used as a model to study the role of transcriptional regulation in the evolution of ecologically relevant traits. In this study we assess the association between metallothionein promoter (pmt) allele frequencies and the heavy metal content of the environment.

MATERIAL AND METHODS

Sampling Twenty-three populations were sampled in a wide variety of soils contaminated with heavy metals (Figure 1). Because of the subdivision of population genetic structure of O. cincta between different European regions (Timmermans et al., 2005b), we decided to restrict the survey to a part of north-western Europe. Heavy metal pollution was due to mining of Pb-Zn ores (Cappuyns et al., 2006), the vicinity of heavy metal smelters, dredging sludge landfills (Vandecasteele et al., 2005a) or different levels of natural background concentrations. See Table S1 (Supporting Information) for geographic position, background information and references of the sampled populations (Brim et al., 1999; Cappuyns et al., 2006; Dauwe et al., 1999; Deniau et al., 2006; Horckmans et al., 2006; Jordaens et al., 2006; Khalil et al., 1995; Lock, Janssen, 2003; Lock et al., 2003; Notten et al., 2006; Ruttens et al., 2006; Timmermans et al., 2005a Timmermans et al., 2007a; Vandecasteele et al., 2004; Vandecasteele et al., 2005a; Vandecasteele et al., 2005b). We aimed at genotyping 96 O. cincta individuals per site. However, fewer individuals were sampled at sites where O. cincta abundance was low (24-93 ind.). All animals were taken alive to the lab, and frozen separately in 96 well plates until analysis. Additionally,

61 Chapter 3 three soil samples were taken at each site up to 10 cm depth as well as three litter samples. The pH-KCl in distilled water was measured in fresh soil and litter samples.

Heavy metal analysis of soil and litter

Both 0.01 M CaCl2 exchangeable, which is an estimate of the biologically available fraction, and total concentrations of Cd, Pb, Zn, Cu, Ni and Fe were determined in soil and litter samples, using the same methods as Timmermans et al., (2005a) . In the present study, the

0.01 M CaCl2 extracts were filtered over a 0.45 µm filter instead of centrifuged.

Figure 1: A: Map of Belgium and parts of the surrounding countries showing the sampled sites. B: Classification of the sampled sites according to their degree of soil heavy metal pollution, summarized as the W index.

To rank the sites with respect to the degree of pollution, an index W (Widianarko et al., 2000) was calculated. This index was calculated taking all measured metals into account, except Fe, in relation to their background concentrations in standard Dutch soils (Anonymous, 1994). Locations were considered as unpolluted, polluted and heavily polluted when their pollution indices were respectively ≤ 0, ≤ 2 and > 2.

PCR-RFLP Genomic DNA from separate animals (~ 1 mg fresh weight) was isolated with the Wizard SV Genomic DNA purification kit (Promega, Inc.). The pmt locus was amplified according to Roelofs et al. (2006) . Five µl aliquots from this PCR product were digested overnight

62 Comparative population analysis with 0.5-1 U of Cla I (Roche), Ssp I, Tau I, Taq I and Mnl I (Fermentas), according to the manufacturer’s instructions. The digests were separated by 2 % agarose gel electrophoresis in 0.5x TBE. Allele specific restriction patterns were detected by scoring specific bands (Figure S1, Supporting Information).

Data analysis

Deviations from Hardy-Weinberg equilibrium using the χ2 test and the Shannon information index were calculated with Genalex 6 (Peakall, Smouse, 2006). Additionally, the exact tests for Hardy-Weinberg equilibrium, implemented in Arlequin (Excoffier et al., 2005) and Genepop (Raymond, Rousset, 1995), were applied to the dataset. With Genepop alternative hypotheses, such as heterozygote excess and deficiency, were tested by a Markov chain method (Rousset, Raymond, 1995). Nei’s genetic diversity (Nei, 1987), an expected heterozygosity measure, and the FIS (Weir, Cockerham, 1984) were calculated using Arlequin (Excoffier et al., 2005).

63 Chapter 3

Figure S1: Restriction map of the nine Orchesella cincta metallothionein promoter (pmt) alleles on which the RFLP method was based. Allele specific restriction patterns emerge when performing separate digests with Cla I, Ssp I, Tau I, Taq I and Mnl I.

The allele frequency data (ratios) were arcsine(square root) transformed to achieve normality. The environmental variables were log(x+1) transformed, except the pH and the W index, which remained untransformed. In order to assess associations of allele frequencies with environmental pollution, linear discriminant function analysis was conducted in SPSS v. 15.0.1. The stepwise selection procedure was chosen to minimize Wilk’s lambda statistic. A Box’s M test was performed to test the assumption of equality of covariance matrices. The sites were classified in three pollution classes, according to the W index of the soil (see Figure 1B).

64 Comparative population analysis Ordinations were performed with CANOCO v 4.5 (ter Braak, Šmilauer, 2002). A Detrended Correspondence Analysis (DCA) was executed in order to detect the length of the ordination gradient. After detrending by segments the length of the gradient for the allele and genotype frequency data were respectively 0.067 and 1.067. Since they were smaller than three times the standard deviation, a linear response is assumed (Lepš, Šmilauer, 2003) and Redundancy Analysis (RDA), a direct ordination method, was chosen. The scaling was set to inter-species correlations to reflect the correlations of species scores with the environmental variables scores. Also the species scores were standardized through division by their standard deviation. The variation introduced by the geographic location of the populations is corrected by using the coordinates as covariables, because the pmtA1 and pmtB frequencies were significantly affected by the geographic location (Mantel test, Pearson correlation, 999 permutations, Brodgar V2.5.2, Highland Statistics). Correlations and regressions were calculated in SPSS v 15.0.1. The significance levels of the correlations were adjusted for the number of executed test by using the Benjamini- Yekutieli false-discovery rate correction (Narum, 2006). The number of executed tests for the diversity measures amounted to 58 (all environmental variables and the W index) and for the allele frequencies 63 (restricted to the significant environmental variables from the RDA analysis).

RESULTS AND DISCUSSION

Concentrations of metals in soil and litter as well as the pHs are summarized in Table S2 (Supporting Information). The total Cd and Pb concentrations span three orders of magnitude. In order to condense the information pollution indices, W, were calculated (Figure 1). They summarize the total heavy metal content in relation to Dutch background concentrations. The three cleanest sites were MAK, MER and LHG, and the three most polluted were PLO, NOY and STO. The number of genotyped individuals, allele frequencies, tests for deviations from

Hardy-Weinberg equilibrium, FIS and heterozygote deficit and excess are given in Table 1. The observed alleles are in decreasing abundance pmtA1, pmtD1, pmtC, pmtA2, pmtB, pmtE, pmtD2, pmtF and pmtBAL. The most abundant allele pmtA1 reached its highest and

65 Chapter 3 lowest frequency in LHG and PLO, respectively. A G-test showed significant differences in allele frequencies between the populations (p<0.001). Five populations exhibited a deviation from the Hardy-Weinberg equilibrium, namely AK2, LD1, HOB, BAL and NOY, although LD1 and HOB showed a deviation only in the χ2-test. The deviation in AK2 and HOB could be attributed to an excess of heterozygotes (Markov chain method implemented in Genepop). In BAL a heterozygote deficit was observed, and NOY did not show any significant deficit or excess of heterozygotes. The NOY population did not deviate significantly from H-W equilibrium when the p-value of the χ2-test was corrected for the number of executed tests, although the exact test revealed a deviation.

66

Table 1: Number of sampled Orchesella cincta at different metal-polluted and reference sites in Western Europe (see Table S1 for more details) , allele frequencies, Nei’s genetic diversity, Shannon information index, p-values for χ2-test and exact test for deviations from Hardy-Weinberg equilibrium and the FIS are given. *: <0.05, **: <0.01, ***: <0.001; § The p-values of the χ2-test are adjusted for the number of tests executed.

p- p- Nei’s Shannon FIS Heterozygote

value value genetic infor- D1 D2 E BAL C A1 A2 2 χ - exact diversity mation deficit excess test § test index pmt pmt pmt pmt F pmt pmt pmt pmt B pmt N N # alleles AK1 93 7 57,5 10,2 0,5 15,6 12,4 2,7 0,0 1,1 0,0 NS NS 0,62 1,27 -0.056 NS NS AK2 77 7 53,2 7,8 0,0 7,1 17,5 10,4 1,9 1,9 0,0 * *** 0,67 1,42 -0.366 NS *** LHG 89 6 71,9 1,7 2,2 12,4 11,2 0,6 0,0 0,0 0,0 NS NS 0,46 0,92 -0.083 NS NS LD1 24 6 56,3 6,3 0,0 8,3 22,9 0,0 2,1 4,2 0,0 * NS 0,63 1,25 0.144 NS NS LD2 50 8 62,0 4,0 3,0 7,0 17,0 3,0 3,0 1,0 0,0 NS NS 0,58 1,27 0.144 NS NS MAK 86 7 58,1 7,0 0,6 18,0 10,5 5,2 0,6 0,0 0,0 NS NS 0,61 1,26 -0.003 NS NS LMM 88 8 54,0 6,8 1,7 13,6 18,2 1,7 1,7 2,3 0,0 NS NS 0,65 1,39 -0.024 NS NS SID 91 7 52,2 1,6 0,5 12,6 28,0 2,2 0,0 2,7 0,0 NS NS 0,64 1,24 0.066 NS NS HOB 92 9 33,2 3,8 0,5 20,1 2,7 7,6 14,1 17,4 0,5 * NS 0,80 1,74 -0.093 NS * MER 85 8 48,2 17,1 3,5 10,0 14,1 0,6 3,5 2,9 0,0 NS NS 0,71 1,53 -0.029 NS NS ABS 85 8 38,2 14,7 2,9 4,7 17,6 0,0 16,5 1,8 2,9 NS NS 0,77 1,68 -0.078 NS NS BAL 85 8 62,4 5,9 4,7 2,9 12,9 0,0 1,8 2,4 7,1 * * 0,59 1,32 0.137 ** NS BUD 53 8 40,6 15,1 2,8 11,3 14,2 1,9 12,3 0,0 1,9 NS NS 0,77 1,68 -0.004 NS NS MA1 81 9 42,0 4,9 3,1 14,2 18,5 1,9 6,2 2,5 6,8 NS NS 0,76 1,73 0.076 NS NS MA2 91 9 42,3 14,8 3,3 14,8 13,7 2,2 6,6 0,5 1,6 NS NS 0,76 1,67 0.012 NS NS VSL 25 7 38,0 8,0 22,0 4,0 20,0 0,0 2,0 6,0 0,0 NS NS 0,77 1,60 0.067 NS NS STO 87 9 33,3 16,1 7,5 13,2 19,0 7,5 0,6 1,7 1,1 NS NS 0,80 1,78 0.012 NS NS KEL 87 7 43,1 5,2 18,4 11,5 8,0 2,3 11,5 0,0 0,0 NS NS 0,75 1,61 -0.013 NS NS PLO 79 9 32,9 7,6 24,7 11,4 10,1 8,9 0,6 1,9 1,9 NS NS 0,80 1,78 0.001 NS NS ROG 67 9 47,0 15,7 10,4 2,2 13,4 1,5 6,0 3,0 0,7 NS NS 0,73 1,61 -0.008 NS NS NOY 49 7 38,8 16,3 0,0 6,1 17,3 15,3 2,0 4,1 0,0 NS * 0,77 1,64 0.102 NS NS FDM 84 7 50,0 9,5 1,8 10,7 20,8 6,5 0,6 0,0 0,0 NS NS 0,69 1,42 0.080 NS NS OVP 76 9 42,8 14,5 1,3 15,8 12,5 2,0 3,9 5,9 1,3 NS NS 0,75 1,68 0.094 NS NS

67 Chapter 3

Figure 2: Discriminant analysis (stepwise selection procedure to minimalize Wilks' lambda) plot based on the Orchesella cincta metallothionein promoter (pmt) allele frequencies. Because the pmtD2 allele frequency was the only variable explaining the discrimination of populations between respective heavy metal pollution classes, a single discriminant function was found.

In order to detect if the subdivision of the sampled populations in three groups with a different grade of heavy metal pollution was reflected in the allele frequency, a linear discriminant function analysis was performed, by applying the stepwise selection procedure. The only variable explaining the discrimination of the populations in the three pollution classes is pmtD2, implying a single discriminant function (Figure 2). The mean allele frequency of the pmtD2 allele was significantly different between reference and heavily polluted, and polluted and heavily polluted populations respectively (Table 2). Moreover, Pearson correlation revealed a significant relationship between the transformed pmtD2 allele frequency and the W index (R=0.565, two-tailed p=0.005). The forward selection procedure in the RDA analysis selected the environmental variables, which best explained the variability in pmt allele frequency composition (Table

68 Comparative population analysis

Table 2: Linear Discriminant Function Analysis. The stepwise selection procedure (Wilks’ lambda=0.625, F=6, p=0.009) revealed a single variable, the pmtD2 allele frequency, which best described the membership of the Orchesella cincta populations to the classes of soil metal pollution level at the respective sites. Based on the F-statistic the test for equality of the pmtD2 allele frequency of each class pair is given.

Step Reference Polluted Heavily polluted 1 Reference F .046 9.834 Sig. .832 .005 Polluted F .046 6.810 Sig. .832 .017 Heavily polluted F 9.834 6.810 Sig. .005 .017

S3 part A, Supporting Information) for a new RDA restricted to the environmental variables that showed a significant contribution (Monte Carlo permutation test, 499 random permutations). Geographic location as a covariable explained 28.4% of the variation in pmt allele frequency data (Table S3 part B, Supporting Information). The first two axes captured 36.4% of the remaining variance. Environmental variables explained 56.1% of the corrected

Figure 3: RDA ordination biplot based on the Orchesella cincta metallothionein promoter (pmt) allele frequencies and the significantly contributing environmental variables from the forward selection procedure.

69 Chapter 3 variation, from this relationship 64.8% is explained by the first two axes. The ordination biplot is represented in Figure 3. Apparently, three alleles were not associated at all with any metal fraction in the environment, i.e. pmtA1, pmtB and pmtD1. The pmtC, pmtA2 and pmtBAL allele frequencies are represented as relatively short arrows, and hence contribute little to the explanation of the variation. Most heavy metal fractions are positively correlated with RDA axis 1 and negatively with RDA axis 2, and are positively correlated with the pmtD2 and pmtF allele frequencies. The CaCl2-exchangeable Ni fraction of the litter was positively correlated to RDA axis 2 and hence more correlated with pmtE and pmtF allele frequencies. The most important correlations from the present study are summarized in Figure 4. Their p-values were corrected for the number of tests. Both the Shannon information index and Nei’s genetic diversity were positively correlated with the CaCl2 exchangeable soil concentration of Pb. This increase in genetic diversity at the pmt locus could be completely attributed to a decrease in the frequency of the pmtA1 allele. The correlation coefficients of the latter relationships were very high (R < -0.9). The pmtA1 allele frequency was negatively correlated with the CaCl2 exchangeable soil concentration of Pb, although it was also negatively correlated with other metal fractions (data not shown). The frequency of the pmtD2 allele was positively correlated with the total Cd content of the soil. In addition the allele frequency of pmtE was positively correlated by the CaCl2 exchangeable litter concentration of Ni. Our study shows that the pmt locus exhibits a moderate but clear increase of allelic diversity with heavy metal concentrations of the environment, primarily with the exchangeable soil concentration of Pb. Moreover, this increase in diversity operates by replacement of the (most abundant) pmtA1 allele, and may be described as balancing selection. An increase of genetic diversity may be caused by overdominance (higher fitness of the heterozygote) (Barnes, 1983) or by environmental heterogeneity (Levene, 1953; Schmidt et al., 2000; Weinig et al., 2003). Balancing selection at a certain locus can also be associated with epistasis (Kroymann, Mitchell-Olds, 2005; Weinig et al., 2003), epigenetic processes (Kawabe et al., 2007) and physiological costs of homozygotes (Bishop et al., 1977).

70 Comparative population analysis

Table S1: Overview of the sampled locations, their geographical position, description and references for background information.

Sample Geographical Location Description References code location AK1 N 51º01’14’’ Meigem (B) Poplar stand on (Jordaens et al., 2006; E 3º 32’40’’ dredging sludge Vandecasteele et al., AK2 N 51 º 01’13’’ landfill 2004; Vandecasteele et E 3º 32’45’’ al., 2005a) LHG N 50 º 55’00’’ Gottem (B) Willow bush on old (Vandecasteele et al., E 3º 24’50’’ meander of the Leie 2005a; Vandecasteele river et al., 2005b) LD1 N 51 º 04’58’’ Vinderhoute Mixed forest on N.A. E 3º 40’01’’ (B) dredging sludge LD5 N 51 º 04’53’’ landfill E 3º 39’51’’ MAK N 50 º 57’21’’ Makkegem Beech forest N.A. E 3º 43’20’’ (B) LMM N 51 º 00’54’’ Merelbeke Ash stand in city (Vandecasteele et al., E 3º 44’34’’ (B) park on dredging 2004) sludge landfill SID N 51 º 10’58’’ Zelzate (B) Black pine stand N.A. E 3º 50’09’’ near steel works HOB N 51 º 10’12’’ Hoboken (B) Birch stand in the (Dauwe et al., 1999; E 4º 20’34’’ vicinity of heavy Timmermans et al., metal smelter 2007a) MER N 51 º 23’09’’ Merksplas Pine forest N.A. E 4º 52’38’’ (B) ABS N 51 º 19’28’’ Beerse (B) Birch stand in the N.A. E 4º 49’28’’ vicinity of heavy metal smelter BAL N 51 º 12’08’’ Balen (B) Birch stand in the N.A. E 5º 13’35’’ vicinity of heavy metal smelter BUD N 51 º 14’48’’ Budel (NL) Mixed forest in the (Khalil et al., 1995) E 5º 35’16’’ vicinity of heavy metal smelter MA1 N 51 º 14’17’’ Lommel (B) Mixed forest on the (Brim et al., 1999; E 5º 15’47’’ location of a former Horckmans et al., MA2 N 51 º 14’13’’ heavy metal smelter 2006; Lock, Janssen, E 5º 15’51’’ 2003) VSL N 50 º 35’23’’ Seraing (B) Deciduous forest in N.A. E 5º 28’51’’ the vicinity of crystal factory

71 Chapter 3

Table S1: continued

Sample Geographical Location Description References code location STOL N 50 º 45’38’’ Stolberg (D) Mixed forest in the (Timmermans et al., E 6º 14’15’’ vicinity of heavy 2005a) metal smelter KEL N 50 º 41’45’’ Kelmis (La Mixed forest on (Cappuyns et al., 2006; E 5º 59’41’’ Calamine) (B) historical Pb-Zn Deniau et al., 2006) mine PLO N 50 º 44’04’’ Plombières (B) Mixed forest on (Cappuyns et al., 2006; E 5º 58’02’’ historical Pb-Zn Deniau et al., 2006; mine Lock et al., 2003; Timmermans et al., 2005a; Timmermans et al., 2007a) ROG N 52 º 34’17’’ Roggebotzand Mixed forest on N.A. E 5º 47’56’’ (NL) reclaimed land NOY N 50 º 25’46’’ Noyelles- Elder stand in the (Timmermans et al., E 3º 01’21’’ Godault (F) vicinity of a former 2005a; Timmermans et heavy metal al., 2007a) smelter FDM N 50 º 25’20’’ Marchiennes Mixed forest N.A. E 3º 16’51’’ (F) OVP N 51 º 14’20’’ Overpelt (B) Poplar stand in the (Notten et al., 2006; E 5º 22’59’’ vicinity of heavy Ruttens et al., 2006) metal smelter

72

Table S2: Overview of the measured environmental variables A: pHs measured in H2O and metal concentrations (mg/kg) from aqua regia digests of soil and litter samples (total concentration), B: pHs and metal concentrations (mg/kg) in 0.01 M CaCl2 extracts of soil and litter samples. Mean values are given with their standard error.

A pH- pH-H20 [Cd [Cd [Pb [Pb [Ni [Ni [Fe [Fe [Cu [Cu [Zn [Zn H20 litter soil]tot litter]to soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil t AK1 7,7±0,1 6,5±0,0 1,00± 3,5± 21,1± 21,8± 15,5± 3,9± 2027± 4427± 15,5± 11,7± 77,5± 133± 6 0,8 12,2 8,7 2,4 1,9 256 1475 6,2 4,4 56,7 26,6 AK2 7,1±0,1 6,3±0,4 13,8± 18,1± 213± 39,7± 37,8± 5,5± 3741± 3756± 111± 26,1± 1315± 852± 0,6 10,2 16,5 14,6 2,0 2,9 348 1417 7,3 8,7 115 332 LHG 7,4±0,4 6,7±0,1 0,4± 3,8± 27,1± 29,0± 14,9± 6,5± 2768± 8483± 13,2± 12,5± 65,2± 288± 0,1 0,2 12,2 5,0 3,9 2,0 978 4004 5,5 3,5 27,5 32,4 LD1 7,4±0,4 6,2±0,1 0,6± 2,0± 53,5± 39,3± 6,0± 2,0± 715± 2537± 14,7± 15,4± 129± 140± 0,0 0,0 5,3 3,2 0,3 0,3 40,8 191 5,4 2,5 5,7 21,9 LD2 7,1±0,0 6,5±0,2 41,2± 25,3± 726± 122± 54,0± 11,3± 3675± 7090± 332± 72,1± 4130± 1754± 1,1 12,7 19,4 49,0 1,3 3,5 1045 2696 37,2 19,4 1200 91,2 MAK 4,0±0,1 4,9±0,2 0,0± 1,2± 13,3± 7,3± 1,0± 0,6± 353± 501± 1,3± 7,2± 32,1± 50,9± 0,0 0,0 10,2 4,3 0,9 0,1 273 232 1,0 0,4 24,0 8,3 LMM 7,4±0,2 6,4±0,3 10,6± 15,3± 225± 31,0± 19,9± 3,5± 2347± 2808± 94,4± 28,1± 1262± 870± 10,0 4,7 229 37,8 14,4 2,8 1167 2472 97,5 17,0 1061 129 SID 4,3±0,3 5,4±0,1 0,2± 2,7± 89,1± 82,2± 5,8± 4,0± 1291± 9889± 12,6± 19,0± 28,6± 152± 0,1 0,2 63,8 14,6 2,2 0,7 324 1604 5,1 1,1 13,4 29,8 HOB 5,7±0,7 5,6±0,0 38,4± 78,5± 4379± 6907± 63,8± 130± 6375± 6882± 968± 1483± 785± 1356± 24,2 15,5 1725 2468 17,6 40,8 1852 924 230 646 206 208 MER 3,9±0,2 4,1±0,1 0,2± 2,2± 90,2± 108± 0,9± 3,8± 190± 1137± 12,3± 32,1± 6,3± 110± 0,2 0,3 78,5 61,8 0,6 1,3 102 608 7,5 13,9 3,4 6,1 ABS 4,7±0,6 5,1±0,1 0,8± 11,7± 121± 528± 15,0± 42,3± 3002± 5743± 180± 589,0± 120± 734± 0,4 3,1 63,8 113,1 1,8 7,6 503 2471 106 135 41,9 169 BAL 6,1±0,2 5,3±0,1 2,9± 41,0± 26,5± 525± 1,3± 4,0± 342± 2082± 8,0± 193± 397± 7522± 3,0 25,5 25,7 379 0,7 3,2 251 1585 7,3 135 314 4537 BUD 4,6±0,2 5,2±0,2 0,7±0,4 9,2±0,2 65,3± 39,6± 2,3±0,2 1,3± 391± 883± 14,1± 21,4±5,2 109± 1694± 20,4 25,7 0,8 56,4 756 3,7 8,9 222

73

Table S2. A: continued

pH-H20 pH-H20 [Cd [Cd [Pb [Pb [Ni [Ni [Fe [Fe [Cu [Cu [Zn [Zn soil litter soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot soil]tot litter]tot

MA1 4,3±0,1 4,8±0,4 2,6± 10,4± 361± 151± 4,3± 3,1± 447± 1852± 122± 40,0± 313± 1417± 2,2 5,2 354 49,4 3,9 0,7 161 204 166 7,5 257 301 MA2 4,3±0,3 4,8±0,1 1,2± 11,4± 213± 111± 3,0± 2,3± 632± 1714± 55,9± 35,6± 83,3± 959± 1,1 4,9 243 34,5 3,4 0,6 609 497 46,9 8,1 110 444 VSL 6,5±0,2 6,3±0,2 1,6± 4,9± 179± 260± 16,0± 7,6± 2435± 11316± 18,0± 20,3± 343± 529± 1,1 0,4 111 81 11,7 3,0 2108 4836 13,1 2,7 232 74,2 STO 5,1±0,4 4,8±0,7 41,2± 41,6± 4641± 6778± 52,8± 12,4± 5848± 7308± 519± 740± 2791± 1142± 36,3 22,1 1927 6566 58,5 6,4 5479 4181 214 800 1823 326 KEL 6,3±0,4 5,4±0,5 35,7± 6,7± 8648± 1073± 20,3± 28,2± 17840± 23078± 44,5± 26,2± 8975± 6175± 7,7 2,2 2621 633 8,9 14,3 10761 14465 14,6 6,3 697 2741 PLO 6,3±0,1 5,8±0,4 30,5± 9,6± 17057 10962± 26,3± 60,1± 10858± 50177± 3416± 1246± 19094± 4629± 14,8 3,3 ± 8150 6,6 42,9 678 7427 1150 1027 3809 2149 2085 ROG 7,6±0,2 4,8±0,1 0,2± 0,8± 47,3± 86,5± 7,4± 1,7± 643± 1654± 512± 9,0± 130± 58,5± 0,0 0,0 1,0 120,1 0,8 0,7 95,3 907 101 2,5 8,1 18,5 NOY 7,6±0,4 6,5±0,0 183± 113± 7856± 3576± 45,4± 21,6± 1849± 14418± 243± 106± 14306± 7381± 110 71,6 5331 2416 17,1 6,6 753 4074 151 67,1 10490 5612 FDM 5,3±0,5 5,5±0,1 1,4± 2,0± 162± 203± 18,0± 12,6± 2376± 246± 22,6± 23,4± 155± 145± 0,7 0,6 68,1 93,0 6,8 1,2 139 16,3 5,3 9,9 23,2 21,9 OVP 6,2±0,1 6,1±0,1 24,2± 27,8± 805± 828± 9,6± 11,3± 910± 14424± 250± 253± 2076± 2303± 3,5 7,6 9,9 116 0,8 5,1 166 5215 24,5 29,0 486 1206

74

B pHCaCl2 pHCaCl2 [Cd [Cd [Pb [Pb [Ni [Ni [Fe [Fe [Cu [Cu [Zn [Zn soil litter soil]ex litter]ex soil]ex litter]ex soil]ex litter]e soil]ex litter]ex soil]ex litter]ex soil]ex litter]ex

AK1 7,3±0,1 6,3±0,1 0,0± 0,0± 0,0± 0,0± 0,0± 0,2± 0,2± 2,5± 0,1± 0,1± 1,3± 0,6± 0,0 0,0 0,0 0,0 0,0 0,0 0,1 0,8 0,0 0,0 1,3 0,1 AK2 6,8±0,1 6,1±0,1 0,0± 0,1± 0,0± 0,1± 0,1± 0,2± 0,1± 2,8± 0,4± 0,3± 1,6± 3,9± 0,0 0,0 0,0 0,1 0,0 0,1 0,0 1,3 0,0 0,1 0,4 1,0 LHG 6,9±0,2 6,4±0,1 0,0± 0,0± 0,0± 0,0± 0,1± 0,2± 0,6± 2,9± 0,1± 0,1± 0,5± 0,9± 0,0 0,0 0,0 0,0 0,0 0,0 0,3 1,9 0,0 0,0 0,2 0,2 LD1 6,9±0,1 6,1±0,1 0,0± 0,0± 0,0± 0,0± 0,0± 0,2± 0,1± 1,3± 0,1± 0,4± 0,6± 1,5± 0,0 0,0 0,0 0,0 0,0 0,1 0,0 0,5 0,0 0,1 0,1 0,3 LD2 6,8±0,1 6,3±0,1 0,1± 0,3± 0,0± 0,0± 0,1± 0,2± 0,2± 0,4± 0,5± 0,3± 8,1± 8,5± 0,0 0,1 0,0 0,0 0,0 0,1 0,0 0,1 0,0 0,1 1,5 1,5 MAK 3,1±0,0 4,5±0,1 0,0± 0,1± 0,4± 1,0± 0,1± 0,1± 58,3± 2,6± 0,1± 0,2± 2,0± 4,1± 0,0 0,0 0,2 0,3 0,0 0,0 22,7 2,9 0,0 0,0 0,7 1,2 LMM 7,0±0,2 6,2±0,1 0,0± 0,0± 0,0± 0,0± 0,1± 0,1± 0,2± 4,7± 0,2± 0,1± 1,4± 4,0± 0,0 0,0 0,0 0,0 0,0 0,0 0,0 4,8 0,1 0,0 1,4 0,7 SID 3,5±0,3 4,9±0,1 0,1± 0,1± 0,5± 0,5± 0,3± 0,1± 9,9± 2,9± 0,1± 0,3± 7,5± 6,4± 0,0 0,0 0,1 0,4 0,0 0,0 3,9 1,6 0,0 0,2 3,3 0,8 HOB 5,1±0,4 5,1±0,1 4,2± 5,0± 21,9± 2,0± 2,1± 1,7± 0,1± 1,1± 10,9± 3,5± 39,9± 26,4± 3,8 0,7 32,4 0,8 1,0 0,1 0,1 0,2 9,9 0,9 13,6 22,9 MER 3,0±0,0 3,7±0,1 0,1± 0,4± 3,1± 2,2± 0,1± 0,2± 26,2± 3,5± 0,5± 4,1± 1,8± 14,2± 0,0 0,2 2,9 1,3 0,0 0,1 15,5 1,5 0,2 6,7 0,4 5,4 ABS 3,5±0,4 5,1±0,9 0,5± 2,5± 0,9± 2,3± 1,0± 2,5± 13,7± 10,5± 12,5± 5,6± 22,4± 55,7± 0,1 0,6 0,3 1,2 0,2 0,8 8,6 5,6 5,3 5,2 4,4 14,4 BAL 5,3±0,2 5,1±0,1 0,8± 4,8± 0,1± 0,5± 0,1± 0,2± 0,6± 0,8± 0,1± 1,4± 104± 348± 0,4 2,4 0,0 0,2 0,0 0,0 0,7 0,1 0,1 0,1 70,1 176 BUD 3,9±0,2 5,1±0,2 0,3± 0,9± 1,3± 0,9± 0,1± 0,1± 4,2± 0,4± 0,2± 0,4± 25,6± 73,2± 0,1 0,2 0,3 0,1 0,0 0,0 2,6 0,2 0,1 0,1 15,2 5,4 MA1 3,6±0,0 4,4±0,3 0,8± 1,3± 4,6± 0,5± 0,2± 0,2± 8,4± 0,9± 0,6± 0,2± 48,7± 73,0± 0,6 0,6 2,6 0,2 0,1 0,0 2,9 0,3 0,2 0,1 28,2 29,4 MA2 3,6±0,3 4,4±0,2 0,3± 1,7± 3,8± 1,0± 0,1± 0,3± 10,7± 3,9± 2,1± 0,5± 13,4± 84,6± 0,2 0,5 3,8 0,1 0,1 0,1 5,7 3,8 1,9 0,1 11,6 19,3

75

Table S2-B. continued

pHCaCl2 pHCaCl2 [Cd [Cd [Pb [Pb [Ni [Ni [Fe [Fe [Cu [Cu [Zn [Zn soil litter soil]ex litter]ex soil]ex litter]ex soil]ex litter]e soil]ex litter]ex soil]ex litter]ex soil]ex litter]ex

VSL 6,2±0,1 6,1±0,0 0,0± 0,0± 0,1± 0,0± 0,1± 0,1± 0,4± 2,3± 0,1± 0,1± 2,8± 2,6± 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,3 0,1 0,1 1,1 1,4 STO 4,7±0,5 4,0±0,6 10,9± 8,9± 8,4± 33,8± 0,6± 0,4± 1,5± 5,9± 3,9± 6,6± 157± 112± 6,7 8,1 6,0 31,3 0,3 0,2 0,9 5,3 3,5 5,6 82,8 63,6 KEL 6,3±0,1 4,8±0,1 0,7± 0,7± 0,8± 3,1± 0,3± 0,3± 0,4± 1,8± 0,1± 0,3± 161± 163± 0,1 0,3 0,2 0,7 0,2 0,2 0,5 0,1 0,1 0,1 43,9 74,6 PLO 5,9±0,1 5,4±0,4 0,9± 0,4± 25,0± 9,6± 1,4± 0,3± 0,0± 4,9± 2,4± 1,7± 151± 69,5± 0,3 0,1 14,4 1,3 0,1 0,1 0,0 2,8 1,9 1,5 16,4 16,0 ROG 7,1±0,1 3,9±0,3 0,0± 0,0± 1,0± 2,3± 0,2± 0,0± 0,1± 1,6± 0,0± 0,3± 0,9± 3,2± 0,0 0,0 0,5 1,1 0,3 0,0 0,1 1,0 0,0 0,2 0,6 0,8 NOY 6,1±0,3 6,1±0,0 0,8± 6,0± 1,7± 6,3± 0,1± 0,5± 0,0± 0,2± 0,2± 0,3± 84,2± 174± 1,1 0,4 0,3 0,3 0,0 0,1 0,0 0,0 0,1 0,3 88,3 38,7 FDM 3,4±0,2 5,0±0,0 0,3± 0,0± 2,1± 1,6± 0,6± 0,1± 67,2± 0,7± 0,6± 0,1± 13,8± 4,6± 0,1 0,0 0,6 0,4 0,4 0,0 14,9 0,2 1,2 0,0 2,5 0,8 OVP 5,9±0,2 5,9±0,0 3,0± 0,6± 0,8± 1,7± 0,3± 0,1± 0,3± 0,1± 0,3± 0,1± 230± 72,2± 0,3 0,0 0,3 0,1 0,0 0,0 0,1 0,0 0,1 0,1 29,2 4,5

76 Comparative population analysis

Figure 4: Summarizing scatter plots of the most important Pearson correlations of Orchesella cincta metallothionein promoter (pmt) allele frequencies, and deduced diversity measures, with heavy metal content of the environment. More information about the sampled sites can be found in Table S1. A: The Shannon's information index and the Nei's genetic diversity were both positively correlated with the transformed CaCl2 exchangeable Pb fraction in the soil (R=0.693, p=0.039 and R=0.658, p=0.040 respectively). B: The Shannon's information index and the Nei's genetic diversity were both negatively and strongly correlated with the transformed allele frequency of pmtA1 (R=-0.948, p=0.036 and R=-0.984, p=0.036 respectively). C: The transformed allele frequency of pmtA1 was negatively correlated with the transformed CaCl2 exchangeable Pb fraction in the soil (R=- 0.720, p=0.040). D: The transformed allele frequency of pmtD2 was positively correlated with the transformed total Cd content of the soil (R=0.627, p=0.041). E: The transformed allele frequency of pmtE was positively correlated with the transformed CaCl2 exchangeable Ni fraction in the litter (R=0.585, p=0.043). All p-values were corrected for the number of executed tests, using the Bejamini-Yekutiele false discovery rate correction.

77 Chapter 3

Table S3: A: Summary of the forward selection procedure in the redundancy analysis (RDA) on the Orchesella cincta metallothionein promoter (pmt) alleles from sites within a wide range of heavy metal contamination (see Table S1 for more information): The lambda is the amount of variability in the allele frequency data explained by the respective environmental variable. The resulting F statistic and p-value are from the Monte Carlo permutation test (499 random permutations). Only the significant environmental variables are given. B: Summary of the RDA based on the seven significant environmental variables, summarizing the amount of variance explained by the first four axes.

A Variable LambdaA P F Pb soil CaCl2 0.11 0.004 3.41 Zn soil CaCl2 0.05 0.008 3.15 Ni litter CaCl2 0.08 0.016 2.6 Ni soil total 0.06 0.02 2.7 Fe soil total 0.06 0.024 2.24 Pb litter CaCl2 0.05 0.048 1.92 Cd soil total 0.03 0.048 2.44

B Axes 1 2 3 4 Total variance Eigenvalues 0.163 0.098 0.072 0.038 1.000 Species-environment correlations 0.895 0.912 0.853 0.667 Cumulative % variance of species data 22.7 36.4 46.5 51.8 of species-environment relation 40.4 64.8 82.8 92.1 Sum of all eigenvalues 0.716 Sum of canonical eigenvalues 0.402 Test of significance of first canonical axis: eigenvalue = 0.163 F-ratio = 3.819 p-value = 0.0220 Test of significance of all canonical axes: Trace = 0.402 F-ratio = 2.382 p-value = 0.0020

Other studies, that document balancing selection acting upon promoters include the human interleukin 10 promoter (Wilson et al., 2006), MHC genes promoters (Loisel et al., 2006; Tan et al., 2005) and CC cytokine receptor 5 (CCR5) (Bamshad et al., 2002), whose gene products are involved in immunological responses in which low and high expressing variants are balanced by costs and benefits. This type of selection on regulatory regions

78 Comparative population analysis allows organisms to fine-tune expression profiles to environmental conditions by de- coupling the regulatory variation from protein function (Hahn, 2007). Some studies attribute an increase of genetic diversity with environmental pollution to asymmetric gene flow and increased mutation rates (Theodorakis et al., 2006). The two latter explanations are less likely in our study, because microsatellite and AFLP markers did not reveal a relation between heavy metal pollution and genetic diversity in O. cincta (Timmermans, 2005c). Furthermore, conserved RFLP patterns observed at the pmt locus throughout all sampled populations make it less likely that the higher diversity emerged due to increased mutation rates in heavy metal contaminated sites. Despite the general pattern of balancing selection, a clear and significant correlation of the allele frequencies of respectively pmtD2 and pmtE with the total Cd content of the soil and the CaCl2-exchangeable Ni in the litter was observed (Figure 4). This suggests that they are under metal specific directional selection. It is also plausible that the observed increase in genetic diversity is the result of gene flow from surrounding populations, weakening the direct selection described above (Lenormand et al., 1999). This may explain why the two alleles under directional selection are never fixed. Our results are confirmed by a luciferase reporter assay, in which the pmtD2 allele was shown to be highly inducible by Cd, in absolute inducibility as well as the slope of the dose response curve and the basal promoter activity (Janssens et al., 2007). Since increased expression of metallothionein contributes to metal-tolerance, we consider it likely that the pmtD2 plays a role in the fitness advantage of the cadmium-tolerant phenotype. Other studies have shown selection on alleles of the coding region of metallothioneins (Tanguy et al., 2002; Timmermans et al., 2007a) and on expression levels (Jack et al., 2007; Timmermans et al., 2005a; van Hoof et al., 2001), but a shift in the occurrence of regulatory polymorphisms has not been observed before in field populations. In this survey we have sampled 23 populations from multiple reference and polluted populations in a broad range of different soil types and heavy metal pollution levels albeit a small biogeographical area. The range of Cd contamination (as a measure for heavy metal pollution) in our samples approaches the EC50 for survival of a reference O. cincta population during chronic dietary exposure to Cd (180 mg/kg) (Crommentuijn et al., 1995). Our data provide sound evidence for balancing selection on metallothionein expression, but specific directional selection by respectively Cd and Ni on the allele

79 Chapter 3 frequencies of pmtD2 and pmtE.

ACKNOWLEDGEMENTS

The authors would like to thank the Netherlands Organization for Scientific Research (NWO) (grant NWO-ALW 813.04.006) for funding this research and Bart Vandecasteele (Flemish Institute for Forestry and Game Management, Geraardsbergen, Belgium) for advice concerning the sampling.

80 Chapter 4

Population specific transcriptional regulation of metallothionein in

Orchesella cincta

Thierry K.S. Janssens, Janine Mariën, Nico M. van Straalen and Dick Roelofs

ABSTRACT

Previous research has shown that the metallothionein promoter (pmt) of Orchesella cincta harbors extensive nucleotide polymorphisms, resulting in different promoter architecture of the respective alleles and altered basal and inducible transcript levels. In order to analyze if the increased average mt expression in a tolerant population from a heavy metal polluted mine site is determined by the genotype of the pmt locus, pmt homozygous families were made for three alleles (pmtA1, pmtA2 and pmtC). To distinguish the effect of origin (and therefore genetic background), families of both reference and mine origin were analyzed. After an exposure experiment to cadmium, mt mRNA levels were measured by

RT-QPCR. Three-way ANOVA revealed a significant interaction between genotype and origin. The pmt genotype had different effects on mt expression in the reference compared to the tolerant population. Significant effects of origin and exposure to cadmium were also observed. Moreover a decrease in plasticity was detected in the families with a tolerant genetic background, reflected by constitutively elevated mt mRNA levels. The reason for this may be trans-regulatory variation or epigenetic effects. This implies that the extensive nucleotide polymorphisms observed in the O. cincta metallothionein promoter have only a minor effect on the mt mRNA levels. Over-expression of mt, as observed in populations living in metal-contaminated soils, seems to involve trans-regulatory variation in addition to cis-regulatory variation.

81 Chapter 4 INTRODUCTION

Mutations responsible for variation in transcriptional regulation can be located in different sites of a genome (Wittkopp, 2005; Wray et al., 2003; Wray, 2007). Cis-regulatory variants are located in the non-coding DNA in the vicinity of a transcribed gene, representing polymorphisms in binding sites for transcription factors, chromatin remodeling factors and even factors that determine transcript stability. In contrast, trans-regulatory variants determine the amount and properties of one or several factors, which determine the expression of the particular gene, in a direct or indirect manner. So, the distinction between cis or trans depends on the genomic location of a mutation relative to the target gene. It was suggested by Wittkopp et al. (2004) that interspecific regulatory variants in structural genes between Drosophila species were almost always caused by cis-regulatory variation, accompanied in half of the cases by a trans-regulatory component. Genes involved in the response to environmental stimuli, such as stress genes, are assumed to be regulated by less entangled (exogenous) pathways than for example developmental genes, and are therefore less likely to be extensively trans-regulated (Wittkopp, 2005).

Recent technologies for the detection of regulatory variants by quantitative genotyping include single-base extension (Cowles et al., 2002) and pyrosequencing (Wittkopp et al.,

2004) in F1-hybrids from inbred strains, and subsequent assessment of transcript ratios of the two alleles. The location of regulatory mutations is also determined nowadays by eQTLs, mapped polymorphisms segregating with expression levels measured by microarrays, and related techniques (Gibson, Weir, 2005). The classification of cis or trans polymorphisms in eQTL studies is rather divergent; distances of 20kb up to 20 million base pairs are reported in the literature (de Koning, Haley, 2005). The majority of intra- specific eQTLs are situated in trans and are concentrated in centralized regulatory hubs

(Wittkopp, 2007). By association of multi-modal expression profiles in a mixed model approach in several D. melanogaster isogenic lines , a complex interplay of cis- and trans- acting factors was observed (Hsieh et al., 2007). Apparently no consensus has been reached in the evolutionary cis-trans debate. However, due to a lack in well-characterized

82 Population specific transcriptional regulation of metallothionein in Orchesella cincta inbred families and a limited number of SNPs in the mt transcript of Orchesella cincta these techniques are out of reach. Therefore, the present study is executed with real-time quantitative PCR on pmt homozygous families from both reference and tolerant origin.

Metallothioneins are low molecular weight proteins, with characteristic cysteine clusters and a paucity in aromatic amino acids and histidine, which are involved in the scavenging of heavy metals and the homeostasis of the cytoplasmic concentrations of essential metals and the redox potential (Coyle et al., 2002; Dallinger, 1996). They are suggested to be mainly transcriptionally regulated (Haq et al., 2003), but to our knowledge no study did report yet about the relative importance of cis- or trans-regulation involved. In a luciferase reporter assay of the pmt locus of O. cincta, which contains a metallothionein promoter with extensive polymorphism, the basal and induced expression in an insect cell line was shown to be affected by the number and spacing of transcription factor binding sites

(Janssens et al., 2007) and the allele frequencies of some pmt alleles were shown to be associated with the heavy metal content in the environment (Janssens et al., 2008). Earlier work has shown that the constitutive expression, measured by RT-QPCR, was elevated in cadmium tolerant populations from heavy metal contaminated sites (Timmermans et al.,

2005a), however in a later study only the Cd induced expression showed a additive heritable component (Roelofs et al., 2006). The question can be raised whether this over- expression in heavy-metal adapted populations can be attributed to the genotype at the pmt locus.

In this study we report about the mt expression in pmt homozygous families of O. cincta. In order to make a distinction between promoter genotype effects and effects of the genetic background, reference or polluted, three pmt alleles (in homozygous genotype) were investigated in animals from both origins. In a cadmium exposure experiment the mt expression was measured by RT-QPCR. The interaction of origin and genotype were significantly affecting the mt mRNA levels. Also origin and exposure to cadmium were significantly affecting the mt expression. The effect of origin may point on trans-regulatory variance or epigenetic regulation. Moreover, a reduced plasticity due to elevated constitutive mt mRNA levels in families from tolerant origin was detected.

83 Chapter 4

MATERIAL AND METHODS

Selection of the parents, and culture of the pmt homozygous families

Homozygous families at the pmt locus were derived from lab cultures of O. cincta from a reference (Roggebotzand) and a polluted site (Plombières). In order to genotype individual O. cincta, a non-destructive tissue sample was taken by amputating the first two segments from one of the antennae and the sex of the individual was determined at the same time by inspection of the genital aperture. The antenna sample was crushed in chelex and stored at -20°C until further analysis. Using the RFLP PCR on the pmt locus, as described in Janssens et al. (submitted), all individuals were genotyped. Homozygous parents were paired to start a family, or parents were selected by screening the offspring of heterozygous parents. The families were grown for at least one generation at 15°C on twigs overgrown with algae in pots with a bottom of plaster of Paris. Eventually, eight families were made, see Table 1.

Table 1: Summary of the bred and analyzed pmt homozygous Orchesella cincta families.

Origin Reference Contaminated Genotype pmtA1 pmtA1-K pmtA1-P pmtA2 pmtA2-K pmtA2-P pmtC pmtC-K1 pmtC-P1 pmtC-K2 pmtC-P2

Exposure

Individual adult animals were kept in pots (2 cm diameter) on plaster of Paris and fed ad libitum with a suspension of algae (from a reference site, Roggebotzand) on a paper disc.

After molting they were exposed by transferring them to a new pot with a paper disc with

84 Population specific transcriptional regulation of metallothionein in Orchesella cincta a suspension of algae spiked up to 1 µmole Cd/ g dry weight (nominal concentration) for the exposed treatment or again the un-spiked algae for the control treatment. After three days of exposure they were transferred to a micro centrifugal tube, snap frozen in liquid nitrogen and stored at -80°C until analysis. For every treatment (control or exposure) three replicate samples were prepared, consisting of five animals each.

RNA extraction and RT-QPCR

The SV Total RNA Isolation System (Promega) was used to extract total RNA from the five pooled animals per replicate. They were crushed in 250 µl of lysis buffer, of which 50 µl was kept for genotyping after genomic DNA extraction with the Wizard SV Genomic

DNA Purification System (Promega). Five µl of total RNA was used in the reverse transcription reaction with 200 U MMLV (Promega) and 2 µM of oligo(dT) primer according to the manufacturers instructions. Real-time RT-PCR was performed with

SYBR® Green PCR Master Mix (Applied BioSystems) and gene specific primers (MT-163F:

GGCAAATCGCCCACTTGTT, MT-265R: CCTTGCAGACACAATCTGGACC, ARC4-67F:

CCGTAAGGATCTGTATGCCAACA and ARC4-157R: GGCAGTGATCTCCTTTTGCATC) on an Opticon 1 real-time PCR machine (MJ Research). The cycling program was: denaturation (95°C for 10 min), 2-step amplification and quantification (92°C for 15 s, 60°C for 1 min with a single fluorescence measurement), melting curve program (60– 90°C with a heating rate at 0.1°C per second and fluorescence measurement every second). The RFU

(relative fluorescence units) of the cycle range 3-7 were considered as background and were baseline-subtracted from the other measurements. The cycle threshold was set to 0.01

RFU. Beta-actin was chosen as internal control for mt mRNA quantification, and from every replicate three pseudo replicate measurements were done. The data were exported to the Q-gene module in Microsoft Excel (Muller et al., 2002) where the mean normalized expression for every replicate was calculated. The PCR efficiency calculated by (Roelofs et al., 2006) was used. Replicates in which the standard error was >20% were re-evaluated.

The logarithmically transformed data were analyzed in a Three Way ANOVA, executed in

SPSS v 15.0, with the origin (genetic background from a reference or a polluted site),

85 Chapter 4 exposure (non-spiked or 1 µmole Cd/ g algae suspension) and genotype (homozygous pmtA1, pmtA2 or pmtC) as fixed factors. Reaction norms were calculated as a slope on the raw data (Δmne)/(Δ[Cd]). Homogeneity of variance, by the F-test and the t-test were executed in Microsoft Excel.

RESULTS AND DISCUSSION

The logarithmically transformed mt expression data are summarized in Figure 1; two replicate families of the pmtC homozygous genotype were analyzed from reference and tolerant origin. These data are pooled in the graph and the analysis. The Three Way

ANOVA statistics revealed a significant interaction between genotype and origin on the mt expression (Table 2), which implies that the effect of the pmt genotype depends on the genetic background in which it is present. The most important factors that determine mt expression are the exposure to cadmium and origin. Neither effect of genotype nor any genotype and exposure interaction was detected. The significant interaction between exposure and origin on mt expression is also reflected in the altered reaction norms. The t- test on the reaction norms confirmed the increased plasticity in the families from reference origin (Table 3).

86 Population specific transcriptional regulation of metallothionein in Orchesella cincta

Figure 1: Box-plots representing the basal and 1 µmole Cd/g dry food (algae) induced mt expression of the pmtA1, pmtA2 and pmtC homozygous genotypes in Orchesella cincta with a reference and a tolerant genetic background. The mean-normalized expression levels are logarithmically transformed and the replicate families of the pmtC families are pooled.

Our data suggest a dual response pathway for induction and constitutive mt expression and support the earlier findings that tolerant O. cincta populations with a genetic background adapted to a high environmental heavy metal exposure show a stress response of a lesser extent upon cadmium exposure (Roelofs et al., 2007) and a constitutively higher expression of mt (Roelofs et al., 2007; Timmermans et al., 2005a). The additive genetic heritability (36-46%) observed in the Cd inducible mt expression from a reference population, observed by Roelofs et al. (2006), is probably to be ascribed to the plastic variation determined by the promoter alleles. Since the latter study was executed in a single reference population, the heritability of increased constitutive expression was not observed. This model of duality in the transcriptional regulation is thus supported by earlier studies on mt expression in O. cincta.

87 Chapter 4

Table 2: Output of the Three-Way ANOVA analysis. A significant effect of exposure and origin (genetic background) on mt mRNA levels in Orchesella cincta was observed. Significant interactions of genotype and origin and exposure and origin respectively were observed.

Source Type III df Mean Square F Sig. Sum of Squares Genotype 0.627 2 0.336 2.797 0.074 Exposure 2.971 1 9.971 24.713 0.000*** Origin 4.807 1 4.807 39.993 0.000*** Genotype*Exposure 0.110 2 0.055 0.458 0.636 Genotype*Origin 2.166 2 1.083 9.009 0.001** Exposure*Origin 1.753 1 1.753 14.583 0.001** Genotype*Exposure*Origin 0.663 2 0.331 2.757 0.077

Table 3: A: Reaction norms of mt mRNA in Orchesella cincta levels as observed in the 1 µmole Cd/g food exposure relative to the control exposure. B: The F-test did not reveal a difference in variance between observations in animals from reference and tolerant origin (results not shown). The resulting one-tailed t-test showed an elevated reaction norm in the families from reference origin.

A Genotype Reference Tolerant pmtA1 0,02 0,04 pmtAt2 0,09 -0,04 pmtC (K1 and P1) 0,05 0,02 pmtC (K2 and P2) 0,19 0,00

B Reference Tolerant Mean 0,087737 0,005433 Variance 0,005681 0,001463 Observations 4 4 Pooled Variance 0,003572 Hypothesized Mean 0 Difference df 6 t Stat 1,947478 P(T<=t) one-tail 0,049703 t Critical one-tail 1,943181

88 Population specific transcriptional regulation of metallothionein in Orchesella cincta

Because there is extensive variation in the O. cincta metallothionein promoter, which is reflected in the basal and induced transcript levels (Janssens et al., 2007), we expected that the pmt genotype would have a major impact on constitutive and cadmium induced mt expression levels. Some of this nucleotide variation in the promoter could contain elusive sequences responsible for spatial and temporal specificity in expression, such as in the expression of rice mt (Lu et al., 2007). Although the regulatory genes in plants differ from animals (Roelofs et al., 2008), this may imply that our standard exposure procedure applied to adult animals may not have been optimal to reveal the expression pattern and potential of every pmt allele. Therefore our exposure and detection method may not have been suitable to detect the complete range of phenotypic variation. Also this study was limited to three out of the nine known pmt alleles, due to experimental restriction. In addition, there are some discrepancies with the results of the luciferase reporter assays used by Janssens et al. (2007). For example the reduced basal and cadmium induced expression of the pmtCluc construct in comparison to the pmtA1luc in a Drosophila S2 cell line (Janssens et al., 2007) was not observed in the present study. This could be due to regulatory differences between D. melanogaster and O. cincta. The cadmium-activated transcription factor MTF-1 from Drosophila might act differently on the O. cincta pmt locus than the (still putative) MTF-1 from O. cincta itself.

Some studies about the adaptive evolution to environmental stressors report, instead of an induced stress response, the increased expression at the constitutive level due to variation in trans-loci. The constitutive higher expression of genes involved in resistance has been reported in the mdr1 gene of Candida albicans in relation to fluconazole resistance

(Wirsching et al., 2000). The responsible mutations resided in trans-regulatory variation and suggest a mechanisms with multiple players (Hiller et al., 2006). Expression levels of the Cyp6A1 gene in Musca domestica are also linked to trans-mutation, affecting the production of an intermediate metabolite, inhibiting its expression (Sabourault et al., 2001).

Besides the elevated constitutive levels, the expression of the O. cincta mt is less inducible, i.e. less plastic, upon cadmium exposure in the families with a genetic background from the contaminated site, due to the elevated constitutive expression levels. Plasticity of gene

89 Chapter 4 expression in cell defense responses is attributed to the recruitment of specific transcription factors to responsive elements in promoters and enhancers (Goldring et al.,

2006), epigenetics, neuro-endocrine mechanisms, and even the activity of microbial symbionts (Gilbert, 2005; Schlichting, Smith, 2002). An example of epigenetic regulation of plasticity is the pigmentation pattern in Drosophila in relation to temperature, which relies on chromatin remodeling (Gibert et al., 2007). Because there are several genes involved in this process there is, despite the process of canalization, a scope for adaptation. Another example is the acquisition of behavioural benzyl alcohol tolerance in Drosophila upon exposure by chromatin remodeling on the promoter of the slo gene (BK type Ca2+-activated

K+ channel). The transcription factor CREB (cAMP responsive element binding protein) was shown to bind better to its promoter target and induce slo expression upon exposure

(Wang et al., 2007).

Plasticity may protect genetic variability from natural selection, and thus maintain the genetic diversity for future release, as hidden reaction norms may be recruited during future evolutionary eras with new environmental challenges (Schlichting, Smith, 2002).

The fact that plasticity is greatly diminished in the genetic background of the O. cincta families from a contaminated origin may point to a process of genetic assimilation

(Pigliucci et al., 2006; Schlichting, Smith, 2002). The process of genetic assimilation is a highly debated theory in which the genetic process of adaptation follows from a physiological process of acclimation (Schmalhausen, 1947; Waddington, 1953) and causes a reduction in plasticity (Schlichting, Smith, 2002). This often involves heritable epigenetic mechanisms (Pal, Miklos, 1999), such as altered DNA methylation, chromatin remodeling, histone modification or RNA interference. For example, a population of the fish Fundulus heteroclitus from a creosote contaminated site lacked the induced expression of P4501A.

This phenotype could not be attributed to any cis or trans regulatory change. It was suggested that this heritable trait was due to epigenetic mechanisms other than CpG methylation in the promoter (Timme-Laragy et al., 2005). Also, constitutive over- expression of R-genes in Arabidopsis conveys disease resistance and is associated with epigenetic mechanisms, such as DNA methylation (Stokes et al., 2002). These studies

90 Population specific transcriptional regulation of metallothionein in Orchesella cincta contribute to the growing evidence that epigenetic processes are important in adaptive phenotypes in natural populations.

Our data suggest a dual regulatory mechanism in which cis-variation is responsible for the plastic inductive responses to cadmium, subordinate to a constitutive expression level which may be modulated by trans-regulatory variation or epigenetic processes.

91 Chapter 4

92 Chapter 5

Yeast one-hybrid screens on Orchesella cincta metallothionein promoter elements

Thierry K.S. Janssens, Janine Mariën, Nico M. van Straalen and Dick Roelofs

ABSTRACT

A previous study revealed evidence for trans-regulatory evolution or epigenetic processes acting in conjunction with cis-acting polymorphisms upon metallothionein expression in heavy metal tolerant populations of Orchesella cincta. In order to isolate regulatory proteins binding to elements from the O. cincta metallothionein promoter a yeast one-hybrid experiment was performed. Despite the large number of putative false positives, three cDNAs encoding potential transcription factors were isolated. cDNAs encoding CCR4- NOT transcription complex subunit 3, a Y-box protein (cold shock domain protein) and a defective proventriculus (homeodomain protein) were identified. The role of these proteins in the regulation of metallothionein expression is not yet clear. Experimental procedures and future directions are further discussed.

INTRODUCTION

Transcriptional regulation plays an important role in the evolution of adaptive traits (Wray et al., 2003). It takes place by the binding of regulatory proteins, transcription factors, which bind to specific DNA stretches in the (mostly) non-coding DNA in the vicinity of the target gene. Developmental, spatial, temporal and environmental cues are in this way integrated by specific DNA-protein interactions, but also protein-protein interactions by which the frequency of transcriptional initiation is determined. Genetic variation can exist in cis or in trans (Wittkopp, 2005). Cis-regulatory variation is the

93 Chapter 5 occurrence of polymorphisms in the properties, abundance and spatial arrangement of DNA binding sites for regulatory proteins. Trans-regulatory variation are mutations which determine the properties or the abundance of regulatory factors (such as transcription factors), not genetically linked to but regulating the expression of the target gene. Previous studies reported increased mt mRNA levels in Orchesella cincta populations from heavy metal contaminated sites (Timmermans et al., 2005a) and considered this constitutive over-expression as an adaptive trait to prolonged cadmium exposure. Recent data by Janssens et al. (Chapter 4) cast doubt upon the functional significance of differences among metallothionein promoter (pmt) alleles upon cadmium and oxidative stress exposed, as well as basal expression levels in a luciferase reporter assay (Janssens et al., 2007). It is unlikely that this constitutive over-expression is caused by the genotype of the promoter but instead point at the genetic background acting upon this cis-regulatory region. In the sequence of the O. cincta metallothionein promoter (pmt) a number of putative binding sites for transcription factors relevant to arthropod mt transcription were found (Janssens et al., 2007). They include the metal responsive element (MRE, binding site for the metal responsive transcription factor, MTF-1), the anti-oxidant responsive element (ARE, binding site for Nrf2, nuclear erythroid derived related factor-2), a CCAAT-box (binding site for CCAAT enhancer binding proteins C/EBP proteins) and the 20- hydroxyecdysone responsive element (HERE, binding site for the ecdysone receptor/ultraspiracle dimer, EcR/Usp). Janssens et al. (Chapter 4) suggested that regulatory variation could be located in trans, i.e. at another locus in the genome which determines a factor influencing the activation of this promoter. In order to locate the genetic variation in trans, one can start by picking up transcription factors that bind on the promoter of interest. The most used gene-centered technique (i.e. with prior knowledge about the genomic context of the gene of interest) to achieve this is the yeast one-hybrid technique (Walhout, 2006). Nowadays custom-made high throughput approaches are used to unravel tissue-specific regulatory networks, such as in Caenorhabditis elegans (Deplancke et al., 2006). The yeast one-hybrid method has been applied in a small number of non-model invertebrates; for example in the locust (Locusta migratoria) JHRE (juvenile hormone responsive elements) binding proteins were successfully isolated from a fat-body cDNA library by a yeast one-hybrid method (Zhou et al., 2006). In Schistosoma mansoni a specific ssDNA binding transcription factor, SmPUR-α,

94 Yeast one-hybrid screens on Orchesella cincta methallothionein promoter elements interacting with a regulatory element in an eggshell precursor protein was isolated (Fantappie et al., 2000). The yeast one-hybrid system screens for specific interaction between proteins expressed from a cDNA library and regulatory DNA elements. It consists of a custom made bait vector (pHis2), which carries an insert with a putative protein binding DNA sequence (tandem repeat) and an AD expression vector (pGADT7), which expresses a hybrid cDNA library protein with the GAL4 activation domain. By interaction of a cDNA with the bait vector insert, a histidine selector gene is activated on the bait vector, by interaction of the GAL4 AD with the minimal promoter (see Figure 1). Other selective markers of leucine and tryptophan metabolism are located on the expression and the bait vectors. So when the bait vector of interest is co-transformed with a cDNA library cloned in the expression vector and the transformants are subsequently plated on a selective medium without leucine, histidine nor tryptophan, any colonies emerging must be due to interaction between library products and the tested promoter sequence.

Figure 1: The principle of the yeast one-hybrid technique: interaction of a cDNA library protein hybrid with the insert of the bait vector (Clontech Laboratories Inc.).

One should keep in mind that leaky expression of the histidine marker occurs, which can be circumvented by the addition of an optimalized amount of 3-AT (3-amino-1,2,4- triazole) to the medium. No more than two studies report about the use of the present technique to elucidate an interaction relevant to heavy metal related transcription. One study reports the application of the system to pick up MRE-binding transcription factors from a mammalian cDNA library (Inouye et al., 1994). Surprisingly the retrieved cDNA clone was not a MTF-1 homologue, but a trithorax like protein called M96. Further analysis revealed that it is a

95 Chapter 5 zinc sensitive protein, part of a larger MRE-binding complex (Remondelli, Leone, 1997). In another study, the CdRE (cadmium response element) of the human heme oxygenase-1 promoter revealed an interaction with pescadillo, a BRCT domain protein, involved in replication and ribosome genesis (Sikorski et al., 2006). From these studies it is clear that unexpected results may emerge from yeast one-hybrid screens, resulting in new mechanistic insights about the effects of regulatory DNA elements on gene expression. In the present study yeast-one hybrid screens are executed with putative transcription factor binding sites as bait. The resulting cDNAs encoding transcription factors are candidates for further investigation of the role of trans-regulatory variation in the elevated mt expression of cadmium tolerant O. cincta populations

MATERIAL AND METHODS cDNA synthesis A homogenate was made by crushing 150 unexposed and 150 cadmium exposed (1 µmole Cd/ g algae) Orchesella cincta individuals in liquid nitrogen with pestle and mortar. From this mixture total RNA was isolated using the Qiagen RNeasy midi kit. The yield was 190

µg of total RNA, with an acceptable purity (OD260/OD280=2.22 and OD260/OD230=1.85). First strand cDNA was made with the Matchmaker Yeast One-hybrid Construction and Screening kit (Clontech, Takara), making use of the SMARTTM technology and a matching oligo dT primer (SMART III oligonucleotide and CDS III primer). The amount of total RNA used per first strand reaction was 270 ng. In the subsequent second strand reaction the first strand cDNA was amplified during 24 cycles using the Advantage polymerase system and the 5’ and 3’ LD primer pair in a PCR volume of 100 µl. The double stranded cDNA was subsequently purified on a ChromaspinTM TE-400 column (Clontech, Takara) and subsequently the purity and quantity were verified.

Construction of the bait plasmids The pHis2 vector was linearized in a double digest of EcoRI and SacI, according to the manufacturers’ instructions. Five bait constructs were made. The first one, pmtA1His2 consisted of 1276 bp (1-1276 of the DQ523588 accession) metallothionein promoter pmtA1 allele amplified with primers

96 Yeast one-hybrid screens on Orchesella cincta methallothionein promoter elements containing restriction sites for respectively EcoRI and SacI (D1-36F-EcoRI: AAAAGAATTCGGCATTCTAGTTTGAGTCAGTCTACCGG, MT-73R- SacI: GGGGAAAGAGCTCTCGTTAGAGAATTTGAAGAACTGCG). After amplification the product was double digested, purified and cloned directionally into the linearized pHis2 vector by ligation. The construct was checked by specific restriction digests. The four other constructs consisted of putative transcription factor binding sites predicted in a former study (Janssens et al., 2007), pMREHis2 (one copy of the third metal responsive element, MRE-c, and its associated GC-rich area), p4XARE His2 (four tandem repeats of the anti-oxidant responsive element), pXHEREHis2 (four tandem repeats of the 20-hydroxyecdysone receptor binding site overlapping the initiator) and p4XC/EBPHis2 (four tandem repeats of CCAAT). These constructs were made by mixing complementary synthesized oligonucleotides (Table 1), of which the sense strand had 5’ and 3’ sticky ends for respectively EcoRI and SacI, in 50 mM NaCl. After denaturation at 70°C, the mixture was slowly cooled down to anneal the complementary strand properly. Afterwards these double stranded inserts were ligated in pHis2. All constructs were cloned and amplified in

Table 1: Oligonucleotides used for the construction of the bait plasmids, based on Orchesella cincta metallothionein promoter elements, in pHis2. The putative transcription factor binding sites are represented in bold.

Bait construct Oligo pMREHis2 SENSE AATTCTGCACACGGCACAGCT ANTISENSE GTGCCGTGTGCA p4XARE His2 SENSE AATTCTGACTAGGCATTGACTAGGCATTGACTAGGCATTGACT AGGCAGCT ANTISENSE GCCTAGTCAATGCCTAGTCAATGCCTAGTCAATGCCTAGTCA pXHEREHis2 SENSE AATTCTTTCATTTCAATTTTCATTTCAATTTTCATTTCAATTTTCA TTTCAAGCT ANTISENSE TGAAATGAAAATTGAAATGAAAATTGAAATGAAAATTGAAATGA AA p4XC/EBPHis2 SENSE AATTCCCAATATCCAATATCCAATATCCAATATAGCT ANTISENSE ATATTGGATATTGGATATTGGATATTGG

E.coli XL-1 Blue on LB + kanamycine. The constructs were checked by sequence analysis after plasmid isolation (Promega SV minipreps).

97 Chapter 5 Yeast strain, transformation and media The yeast strain provided in the kit is Y187. It is auxotrophic for histidine, tryptophan, leucine and adenine (his3-200, trp1-901, leu2-3. ade2-101), which allows us to use these nutritional markers for selective purposes in experiments. Yeast cells were grown on YPDA agar (rich medium supplemented with adenine- hemisulphate) every month and kept as a back up at 4°C. Competent yeast cells were grown overnight at 30°C, with one re-inoculation from 50 ml to 100 ml, until OD600=0.4-0.5. Following centrifugation with one washing step with sterile demineralized water and one with 1.1XTE/Lithium acetate the cells were re- suspended in 1.2 ml 1.1XTE/lithium acetate. The competent cells were transformed using the PEG/lithium acetate protocol in which the DNA of interest (one or two plasmids together with cDNA) is mixed with excess denatured carrier DNA (herring testes DNA) and PEG/lithium acetate. After heat-shocking in the presence of DMSO, the DNA enters the cells. After a recovery period, in rich YPD plus medium, the cells were re-suspended in 0.9% NaCl solution and plated out on the appropriate medium. The screening of transformants was performed on SD media (SD: synthetic dropout, a medium containing the necessary carbon and nitrogen source, adenine-hemisulphate, vitamins and trace elements, but lacking the amino acid necessary for the selection). The pHis2 vector contains a trp marker gene and the his3 gene. In the pGADT7rec2 vector, in which the cDNA clones are recombining, the leu2 gene is integrated

Optimization of the 3-AT concentration to suppress leaky his3 expression In order to suppress the leaky expression of his3, and hence background growth on SD medium lacking histidine, 3-amino-1,2,4-triazole (3-AT), a competitive inhibitor of the HIS3 protein, was used. The five pHis2 bait constructs were tested in a dose response manner for growth on SD/-His supplemented with a range of 3-AT concentration from 0- 60 mM. Following transformation of 50 µl of competent cells with the appropriate bait construct, they were re-suspended in 1 ml of 0.9% NaCl solution and plated out. The plates were incubated for 3-5 days at 30°C and the emerged yeast colonies were counted. The 3-AT concentration at which only very small colonies, the size of a pin’s head, emerged was assumed to efficiently inhibit leaky expression and hence used to screen for yeast one-hybrid interactions.

98 Yeast one-hybrid screens on Orchesella cincta methallothionein promoter elements

Screening for one-hybrid interactions Six hundred µl of competent cells were co-transformed with 5 g of the desired bait plasmid, 3 µg of SmaI linearized pGADT7rec2 expression vector, an appropriate amount of double stranded cDNA (>2 µg is recommended) and an excess of denatured carrier DNA (herring testes DNA). The cDNA library was added as linear fragments, because it recombines into the linearized pGADT7rec2 plasmid in the yeast cells. Following the Li acetate transformation procedure the transformation mixture was re- suspended in 6 ml of 0.9% NaCl solution and plated out on 144 cm2 SD/-His/-Leu/-Trp agar plates with the optimized concentration of 3-AT. The transformation efficiencies of the bait plasmid, the expression plasmid and the two together were determined by plating out serial dilutions of the transformation on respectively SD/-Trp, SD/-Leu and SD/- Leu/-Trp. A negative and positive control transformation, for which the reagents were provided in the kit, was run along every time a screen was performed. A new manual was issued by Clontech on July 6th 2007, in which an improved screening procedure was proposed. When the leaky expression of a bait construct was not inhibited by 50 mM 3-AT, it was suggested to do the screen instantly on SD/-His/-Leu/- Trp + 100 mM 3-AT. This very stringent 3-AT concentration would prevent the emergence of false-positives which only have a weak interaction with the bait sequence. Also, one should plate out the transformation as dilute as possible. In this way false-positive colonies, which would grow by diffusion into the agar of the lacking amino acids from untransformed decaying cells and large true-positive colonies, could be avoided. The last screen we performed has been done in this way. The agar plates were incubated for 3-5 days at 30°C.

Re-testing the phenotype, rescue of the cDNA cloned in the pGADT7rec2 expression vector and sequence analysis Clones growing on SD/-His/-Leu/-Trp + 3-AT were PCR-screened with the 5’ and 3’ LD primer pair and analyzed on a 1.5% ethidium bromide agarose gel. Clones with a significant insert were streaked out on the same medium and growth was confirmed if single colonies emerged. Beside this a confluent layer was streaked out to harvest for the rescue procedure.

99 Chapter 5 The rescue procedure is necessary for the separation of the bait plasmid from the expression plasmid. Up to 4 cm2 were scraped off the agar and re-suspended in yeast lysis buffer (50mM Tris-HCl [pH 7.5], 1.2M sorbitol, 10mM EDTA and 10mM beta- mercaptoethanol added just before use). This suspension was incubated overnight at 37°C with 200 U of lyticase (Sigma Aldrich) in order to lyse the cell wall. The following day a miniprep procedure (Promega SV minipreps) was performed on this lysate. Ten µl of this miniprep were transformed by electroporation into E.coli XL-1 Blue competent cells and plated on LB + ampicilline agar. The resulting clones in Escherichia coli were PCR-screened with the 5’ and 3’ LD primer pair and analyzed on a 1.5% ethidium bromide agarose gel. The size of the insert was checked and selected colonies were grown up in LB + ampicilline. After the miniprep procedure, the insert was sequenced using the T7 promoter primer and Big Dye v1.1 (Applied Biosystems) on an AB3100 capillary sequencer. Sequences were trimmed, checked and contigs were made in Vector NTI v10.0.1. The sequences were annotated after they were entered in the Collembase database (www.collembase.org) (for the methodology see Chapter 6). They were also screened for conserved protein domains, using InterProScan (http://www.ebi.ac.uk/InterProScan/).

RESULTS AND DISCUSSION

The efficiencies and titers of the seven executed screens are summarized in Table 2. The transformation efficiencies were low. The reason for this is unclear, because the procedure was executed according to the manufacturer’s instructions. The Clontech manual recommends screening at least one million co-transformants. The total number of rescued clones was 150. The average length of the ESTs was 533 ± 172 bp. They are summarized in Table 3, together with their blastn, blastx and InterProScan hits. Three cDNAs which code for potential DNA binding proteins with a function in transcriptional regulation were isolated, namely subunit 3 of the CCR4-NOT transcription complex (pmtA1His2), a Y-box protein homologous to the ypsilon schachtel of Drosophila melanogaster (interacting with pmtA1His2 and p4XHEREHis2) and a homologue of the D. melanogaster homeodomain containing protein defective proventriculus (interacting with pMREHis2).

100 Yeast one-hybrid screens on Orchesella cincta methallothionein promoter elements Many putative false positives resulted from the seven executed screens, although this was also reported in other yeast one-hybrid screens (Sikorski et al., 2006). A second reporter gene, lacZ, beside His3 can reduce the number of false positives (Deplancke et al., 2006). In the high-throughput study described in the latter study, entire intestine specific promoters were collected in a promoterome library (average size 1690 bp). Other studies have been using tandem repeats of putative regulatory DNA binding elements (Khan et al., 2003; Zhou et al., 2006) or fragments of promoters (Valadao et al., 2002) instead. The CCR4-NOT complex, of which in our study a cDNA homologous to the subunit 3 was isolated and showed an interaction with the pmtA1His2 construct, is a multi- functional protein complex involved in mRNA deadenylation (Bonisch et al., 2007), histone methylation (Mulder et al., 2007a), ubiquitinylation (Mulder et al., 2007b), transcriptional repression (Winkler et al., 2006) and induction (Mulder et al., 2005). Until now it is not known which subunits are DNA binding and what their consensus binding sites are.

Table 2: Overview of the executed screens on the Orchesella cincta metallothionein promoter elements bait plasmids. The name of the bait construct, the concentration 3-AT in the triple dropout medium, the miniprep series, the number of transformants with the bait plasmid (SD/-Trp), the number of transformants with a cDNA expressing pGADT7rec2 expression vector (SD/-Leu) and the number of cotranformants (SD/-Leu/- Trp)

Screen Bait construct [3-AT] MP series SD/-Trp SD/-Leu SD/-Leu/-Trp 1 pmtA1His2 30 mM MP A 5.4.105 4.2.105 7.2.105 2 p4XAREHis2 30 mM MP B 2400 6600 600 3 p4XC/EBPHis2 30 mM MP C 1.2.105 5.76.104 1.86.104 4 p4XHEREHis2 30 mM MP D 8.4.104 3600 6.0.105 5 pMREHis2 50 mM MP E 1.16.105 2.22.105 5.4.104 6 p4XAREHis2 30 mM MP F 1.40.105 3.60.105 7.7.104 7 pMREHis2 100 mM MP G 2.27.105 1.19.105 4.35.104

Y-box proteins, such as the ypsilon schachtel homologue interacting with the pmtA1His2 and p4XHEREHis2 constructs, are nucleic acid binding proteins (Matsumoto, Wolffe, 1998) by their cold shock domain. They destabilize nucleic acid duplexes by binding to the CCAAT consensus motif (Matsumoto, Wolffe, 1998). The Drosophila ypsilon schachtel protein is involved in an ovarian ribonucleoprotein which regulates the stability and the translocation of mRNA (Mansfield et al., 2002). In Xenopus, Y-box proteins are involved in

101 Chapter 5 the tissue-specific and temporal control of hsp70 expression (Tafuri, Wolffe, 1990). In our study the ypsilon schachtel homologue was not observed among the clones interacting with the p4XC/EBPHis2, which is a fourfold tandem repeat of the CCAAT sequence. Positive interactions between the expressed ypsilon schachtel homologue and both the pmtA1His2 and p4XHEREHis2 were observed. The latter bait plasmid is a fourfold tandem repeat of a putative molting hormone receptor binding site, located in the 5’ UTR, overlapping with the initiator. The latter also contains the CCAAT motif, because of the overlap of the putative binding site with the introduced ATT spacer.

102

Table 3: Overview of the rescued clones exhibiting an interaction with the indicated bait plasmids. Any blastn or blastx hit with an E- value <0.01 is given. InterProScan results indicate homologies with database of protein domains. Results are given in bold, when there is an indication for transcription factor function. pmtA1His2 interactions (62 clones rescued)

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan A1-1 Occ00336 382 A3-1 Occ00023 844 Pongo pygmaeus trypsin HMMPfam 2e-005 Acetes chinensis Trypsin CR858104 3e-032 2.6e-08 T ABQ02510 HMMPanther SERINE PROTEASE- RELATED, INSECT 7.2e-27 A6-1 Occ00001 322 CCR4-NOT transcription CCR4-NOT transcription HMMPfam complex, subunit 3 Tribolium complex, subunit 3 NOT2_3_5 castaneum 1e-022 Tribolium castaneum 4.6e-31 XM_965414 1e-030 HMMPanther XP_970507 CCR4 NOT-RELATED A8-1 Occ00223 524 breakpoint cluster region HMMPanther isoform 1 BREAKPOINT CLUSTER Danio rerio REGION PROTEIN (BCR) 6e-010 2.1e-11 XP_001336063 A9-3 Occ00405 507 A11-1 Occ00131 693 A12-1 Occ00358 747 A14-2 Occ00116 280 A14-3 Occ00169 315

103

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan A15-1 Occ00164 261 A16-3 Occ00034 668 zinc carboxypeptidase HMMPanther Aedes aegypti CARBOXYPEPTIDASE 2e-028 3.9e-41 EAT36173 A17-1 Occ00731 682 hypothetical protein HMMPfam Coprinopsis cinerea Peptidase M28 2e-039 3.8e-26 EAU84252 HMMPanther PEPTIDASE M20 FAMILY 1.6e-05

A18-1 Occ00260 549

A19-1 Occ00170 247 A20-1 Occ00588 656 elongation factor 1-gamma translation elongation HMMPfam Aedes aegypti factor-1 gamma Locusta EF1G 2e-019 migratoria 3e-78 DQ440238 1e-063 AAL78751 A20-3 Occ00540 201 A21-1 Occ00667 322 HSP70 Megachile rotundata 9e-005 AY550115 A22-1 Occ00339 708 predicted protein Nematostella vectensis 2e-004 XP_001630783 A23-1 Occ00126 666 mRNA, partial cds Anopheles cuticle protein, putative HMMPfam

104

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan gambiae Aedes aegypti Insect cuticle protein 5e-008 7e-014 HMMPanther XM_001230389 EAT32633 STRUCTURAL CONTITUENT OF CUTICLE 2.7e-16 A26-2 Occ00292 680 von Willebrand factor HMMPantherVON type A domain WILLEBRAND FACTOR, containing protein TYPE A DOMAIN Tetrahymena thermophila 5.4e-24 8e-024 XP_001012024 A27-1 Occ00776 679 actin actin HMMPfam Mystus cavasius Lepeophtheirus salmonis Actin 1e-058 2e-021 8.3e-32 DQ904378 ABU41027 HMMPanther ACTIN 4e-36 A28-1 Occ00077 628 mRNA Pongo pygmaeus 2e-004 CR857478 A28-4 Occ00067 288 A31-1 Occ00481 340 A33-1 Occ00240 532 ribosomal protein L17 isoform ribosomal protein L17e HMMPfam A Agriotes lineatus Ribosomal_L22 2 Lysiphlebus testaceipes 5e-029 2e-033 4.9e-52 AY961494 CAJ17285 HMMPanther RIBOSOMAL PROTEIN L17

A34-1 Occ00773 606 elongation factor-2 Orchesella eukaryotic translation HMMPfam

105

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan imitari elongation factor GTP_EFTU 0.0 Aedes aegypti 7.2e-66 AY305515 3e-071 HMMPanther EAT44110 ELONGATION FACTOR 8.3e- 79 A35-1 Occ00218 650 solute carrier family 12 (sodium/potassium/chloride transporters) Homo sapiens 1e-004 BC107872 A36-2 Occ00637 690 tropomyosin tropomyosin HMMPfam Eriocheir sinensis Eriocheir sinensis Tropomyosin 3e-025 1e-050 7.7e-10 EF471314 ABO71783 HMMPanther TROPOMYOSIN INVERTEBRATE 7.8e-75 A42-1 Occ00668 519 histone cluster 1, H4c Homo sapiens, 6e-005 BC054014 A43-1 Occ00330 695 HMMPanther GLUCOSE TRANSPORTER 1 INVERTEBRATE 1.3e-12 A44-1 Occ00286 350 solute carrier family 12 Hypothetical protein HMMPanther (sodium/potassium/chloride Caenorhabditis briggsae GLUTATHIONE S- transporters), member 2 0.003 TRANSFERASE Homo sapiens CAE58995 2e-08

106

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan 1e-004 BC107872 A45-1 Occ00246 393 A46-1 Occ00373 643 PAP associated domain containing 1 Homo sapiens 0.008 BC061703 A48-1 Occ00573 693 Single read from an extremity troponin T HMMPanther of a full-length cDNA clone Apis mellifera TROPONIN T, Anopheles gambiae 6e-029 INVERTEBRATE 3 1e-017 NP_001035348 2.8e-52 BX065910 A48-2 Occ00291 891 18S rRNA similar to Ac1147 Lepidocyrtus paradoxus e-116 Gallus gallus U61301 4e-016 XP_001231536 A51-1 Occ00601 715 A53-1 Occ00779 454 predicted protein hypothetical protein HMMPfam Pichia stipitis Schizosaccharomyces pombe Ribosomal_L21 3e-039 7e-037 2.7e-42 XM_001385175 NP_594175 HMMPanther RIBOSOMAL PROTEIN L21

7.2e-47 A54-4 Occ00274 655 Nopp140 HMMPfam Apis mellifera Zinc finger CCHC 8e-005 0.00011 XP_001120943 FPrintScan C2HCZNFINGER

107

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan 0.13 HMMPanther NUCLEOLAR AND COILED- BODY PHOSPHOPROTEIN 1 3.3e-05 A55-4 Occ00676 658 Nasonia vitripennis HMMPanther 7e-020 RHO/RAC/CDC GTPASE- XP_001604462 ACTIVATING PROTEIN 1.6e-09 A61-3 Occ00491 681 protein-O- HMMPfam xylosyltransferase PF02485 Drosophila willistoni 0.014 7e-031 HMMPanther CAJ76262 XYLOSYLTRANSFERASE3.8e- 42 A63-1 Occ00196 614 28S large subunit Conidiobolus hypothetical protein coronatus Neosartorya fischeri 0.0 2e-029 AY546691 XP_001267665 A64-1 Occ00448 585 A64-2 Occ00726 553 A65-1 Occ00456 675 copper amine oxidase HMMPfam Copper amine Neosartorya fischeri oxidase, C-terminal 3e-034 1.2e-22 XP_001258677 HMMPanther COPPER AMINE OXIDASE 3.3e-22 A66-3 Occ00433 700 A67-1 Occ00464 352 108

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan A68-1 Occ00456 675 copper amine oxidase HMMPfam Copper amine Neosartorya fischeri oxidase, C-terminal 3e-034 1.2e-22 XP_001258677 HMMPanther COPPER AMINE OXIDASE 3.3e-22 A70-1 Occ00119 910 putative ATP synthase Nidula PREDICTED HMMPfam niveotomentosa 7e-005 Tribolium castaneum Insect cuticle protein AM497816 2e-019 1.7e-16 XP_967897 HMMPanther STRUCTURAL CONTITUENT OF CUTICLE 2e-20 A73-1 Occ00540 201 cosmid B0213 Caenorhabditis elegans 8e-004 AF039050 A73-2 Occ00146 368 A74-1 Occ00119 910 putative ATP synthase Nidula PREDICTED HMMPfam niveotomentosa 7e-005 Tribolium castaneum Insect cuticle protein AM497816 2e-019 1.7e-16 XP_967897 HMMPanther STRUCTURAL CONTITUENT OF CUTICLE 2e-20 A75-2 Occ00441 649 PREDICTED HMMPfam Apis mellifera Protein of unknown function 4e-018 3.1e-05 T XP_624312 HMMPanther SHIPPO-1-RELATED 2.2e-05

109

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan A77-1 Occ00272 332 Spectrin alpha chain Tribolium castaneum 9e-011 XP_973750 A77-2 Occ00050 650 ypsilon schachtel ypsilon schachtel HMMPfam Apis mellifera Apis mellifera Cold-shock protein 5e-005 2e-023 2.6e-33 XM_393344 XM_393344 HMMPanther Y BOX BINDING 6.2e-55 A78-1 Occ00014 887 hypothetical protein Chlorella virus FR483 2e-005 YP_001425787 A79-1 Occ00188 270 A80-1 Occ00081 703 A83-1 Occ00037 659 A86-1 Occ00126 666 mRNA, partial cds Anopheles cuticle protein, putative HMMPfam gambiae Aedes aegypti Insect cuticle protein 5e-008 7e-014 HMMPanther XM_001230389 EAT32633 STRUCTURAL CONTITUENT OF CUTICLE 2.7e-16 A91-1 Occ00390 683 A95-1 Occ00302 623 HMMPfam Pentapeptide_2 6.3e-05 A95-2 Occ00291 891 18S rRNA similar to Ac1147 Lepidocyrtus paradoxus Gallus gallus e-116 4e-016

110

Clone Collembase Length seq. blastn blastx Domain cluster bases interproscan U61301 XP_001231536

P4XC/EBPHis2 interactions (27 clones rescued)

Clone Collembase Length Blastn blastx Domain interproscan MP cluster seq. bases C2-5 Occ00626 722

C7-10 Occ00297 618 40S ribosomal protein S12 40S ribosomal protein S12 HMMPfam Ribosomal_L7Ae Dermacentor variabilis Apis mellifera 6.1e-28 3e-015 8e-041 HMMPanther AY245452 XP_624645 40S RIBOSOMAL PROTEIN S12 2.5e-57 C9-2 Occ00524 887 hypothetical protein Chlorella virus FR483 2e-005 YP_001425787 C14-2 Occ00742 682 C18-1 Occ00212 643 Myosin heavy chain Myosin heavy chain HMMPfam Drosophila melanogaster Apis mellifera Myosin_tail_1 2e-041 9e-059 1.1e-69 NM_165192 XP_393334 HMMPanther MYOSIN HEAVY CHAIN 5.9e-29 C22-2 Occ00163 692 Serine serine hydroxymethyl HMMPfam hydroxymethyltransferase, transferase 2 (mitochondrial) SHMT mitochondrial precursor Rattus norvegicus 1.6e-20 Equus caballus 9e-038 HMMPanther

111

Clone Collembase Length Blastn blastx Domain interproscan MP cluster seq. bases 0.008 EDM16462 SERINE XM_001488536 HYDROXYMETHYLTRANSFE RASE 1 1e-23 C25-1 Occ00198 544 ribosomal protein L3 putative ribosomal protein HMMPfam Spodoptera frugiperda L3 Ribosomal_L3 1e-020 Maconellicoccus hirsutus 7.1e-17 AY072287 9e-034 HMMPanther ABM55588 RIBOSOMAL PROTEIN L3P 2.1e-56 C27-1 Occ00575 698 predicted polyubiquitin HMMPfam PF00240 Yarrowia lipolytica Artemia franciscana ubiquitin 2 e-116 e-102 3e-08 XM_504128 CAA52416 HMMPanther UBIQUITIN 5.9e-119 C34-1 Occ00025 780 16S rRNA similar to fumble HMMPfam gamma proteobacterium Apis mellifera Fumble 2e-007 7e-015 3.6e-09 AJ514257 NM_080131 HMMPanther PANTOTHENATE KINASE 3.5e-18 C36-2 Occ00025 506 16S rRNA fumble HMMPfam gamma proteobacterium Apis mellifera Fumble 2e-007 7e-015 3.6e-09 AJ514257 NM_080131 HMMPanther PANTOTHENATE KINASE 3.5e-18 C44-2 Occ00291 891 18S rRNA PREDICTED Lepidocyrtus paradoxus Gallus gallus

112

Clone Collembase Length Blastn blastx Domain interproscan MP cluster seq. bases e-116 4e-016 U61301 XP_001231536 C52-2 Occ00066 414 28S ribosomal RNA PREDICTED Orchesella cincta Rattus norvegicus 0.0 6e-011 AF483385 XP_001054782 C62-2 Occ00727 701 cDNA DKFZp459G0119 Myosin heavy chain HMMPfam Pongo pygmaeus Apis mellifera Myosin_tail_1 2e-011 6e-058 1.3e-39 CR857776 XP_393334 HMMPanther MYOSIN HEAVY CHAIN 2.5e-33 C63-2 Occ00127 706 armadillo repeat protein Adherens junction protein HMMPanther Nasonia vitripennis Drosophila melanogaster CATENIN AND 1e-005 5e-038 PLAKOPHILIN XM_001603380 NM_001042978 9e-62 C64-2 Occ00745 686 hypothetical protein Xenopus HMMPanther laevis DIAMINE 2e-008 ACETYLTRANSFERASE 2 NP_001088774 4.2e-05 C66-1 Occ00135 727 myosin like protein JamJ Patinopecten yessoensis Lyngbya majuscule 2e-011 8e-006 AB077039 AAS98781 C72-1 Occ00014 887 hypothetical protein Chlorella virus FR483 2e-005 YP_001425787 C67-1 Occ00366 713 Glycyl-tRNA synthetase Apis glycyl-tRNA synthetase HMMPanther mellifera Nasonia vitripennis GLYCYL-TRNA

113

Clone Collembase Length Blastn blastx Domain interproscan MP cluster seq. bases 3e-006 8e-060 SYNTHETASE XM_391940 XP_001606827 3e-44 C70-1 Occ00119 910 putative ATP synthase PREDICTED HMMPfam Insect cuticle Nidula niveotomentosa Tribolium castaneum 2e-019 protein 7e-005 XP_967897 2.1e-05 AM497816 HMMPanther STRUCTURAL CONTITUENT OF CUTICLE 4.6e-14

C76-2 Occ00025 754 fumble HMMPanther Apis mellifera PANTOTHENATE KINASE 9e-012 3.5e-18 XM_001121916 C65-1 Occ00259 546 importin Pan troglodytes 1e-010 XP_001169290 C66-4 Occ00135 699 myosin like Patinopecten JamJ yessoensis 2e-011 Lyngbya majuscula AB077039 8e-006 EF211972 C34, Occ00025 820 16S rRNA fumble HMMPfam C36, gamma proteobacterium Apis mellifera Fumble C60, 2e-007 7e-015 3.6e-09 C78 AJ514257 XM_001121916 HMMPanther PANTOTHENATE KINASE 3.5e-18 C76-1, Occ00171 705 ribosomal protein S24 ribosomal protein S24 HMMPfam 3, 5 Lysiphlebus testaceipes 9e-013 Heliconius melpomene 1e-050 Ribosomal protein S24

114

Clone Collembase Length Blastn blastx Domain interproscan MP cluster seq. bases AY961556 EF211972 2.5e-42 HMMPanther 40S RIBOSOMAL PROTEIN S24 3 1.9e-75 C 88-1 Occ00603 728 MGC82041 protein Xenopus lactase-phlorizin hydrolase HMMPfam PF00232 laevis Strongylocentrotus Glycoside hydrolase 9e-007 purpuratus 2.8e-88 T 3e-058 HMMPanther GLYCOSIDE HYDROLASES

1.6e-93 C95-4 Occ00635 721 Mus musculus hypothetical protein HMMPanther RAGE 0.009 Paramecium tetraurelia 4.2e-16 AC147083 5e-016 HMMPanther CDC2, MAP XP_001424236 KINASE-RELATED 4.2e-16 C 96-1 Occ00446 679 Ciona intestinalis 0.007 AK112703 p4XHEREHis2 interactions (23 clones rescued)

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan D4-4 Occ00729 682 subtilase subtilisin-like serine HMMPanther Arabidopsis thaliana 2e-007 proteinase precursor SUBTILISIN/KEXIN- NM_001037025 Aphanomyces astaci 8e-019 RELATED SERINE PROTEASE AAK39096 7.5e-28 D9-3 Occ00715 701 D11-1 Occ00050 650 ypsilon schachtel ypsilon schachtel Apis HMMPfam CSD

115

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan Apis mellifera mellifera 1.2e-23 T 5e-005 2e-023 HMMPanther XM_393344 XM_393344 COLD SHOCK DOMAIN CONTAINING PROTEINS 7.3e-49 D13-1 Occ00291 891 18S rRNA Gallus gallus contig 20 Lepidocyrtus paradoxus e-116 4e-016 U61301 XP_001231536 DQ365782 D14-1 Occ00798 656 Nasonia vitripennis HMMPanther 3e-006 SURFEIT LOCUS PROTEIN XP_001604974 4.6e-05 D17-1 616 18S ribosomal RNA Subisotoma sp. 5e-008 DQ365782 D26-1 Occ00641 699

D26-2 Occ00410 688

D27-1 Occ00430 492

D29-1 Occ00150 494 TAR (HIV-1) RNA binding HMMPanther protein 2 Xenopus tropicalis TAR RNA BINDING PROTEIN 2e-006 (TRBP) BC091619 1.2e-09 HMMPanther EUKARYOTE SPECIFIC DSRNA BINDING PROTEIN 1.2e-09

116

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan D34-2 Occ00426 479 cytoskeletal actin Strongylocentrotus purpuratus 3e-008 XM_001176303 D37 Occ00241 701 arouser HMMPanther Drosophila melanogaster EPS8 - RELATED PROTEIN 9e-050 (INVERTEBRATES) AAF21013 1.2e-82 HMMPanther EPIDERMAL GROWTH FACTOR RECEPTOR KINASE SUBSTRATE EPS8-RELATED PROTEIN 1.2e-82 D39-11 Occ00251 479 THaumatiN family member HMMPfam PF00314 Tribolium castaneum Thaumatin 2e-010 1.5e-07 XP_975166 D40-1 Occ00140 677 ENDOCHITINASE HMMPanther Nasonia vitripennis CLASS I CHITINASE 1e-008 3.5e-05 XP_001599037 D45-1 Occ00544 708 hypothetical protein Nematostella vectensis 0.002 D57-1 Occ00605 688 D61-2 Occ00656 490 hypothetical protein Hypothetical protein HMMPfam Formate- Debaryomyces hansenii partial Caenorhabditis elegans tetrahydrofolate ligase 4e-005 4e-018 6.4e-23 XM_462568 NP_509361 HMMPanther METHYLENETETRAHYDROF

117

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan OLATE DEHYDROGENASE FAMILY MEMBER 1.8e-28 D85-2 Occ00076 642 18S ribosomal RNA juvenile hormone diol kinase Isotomiella minor Manduca sexta 1e-027 1e-012 DQ365781 CAD23378 D70-1 Occ00156 649 D86-1 Occ00646 492 D74-4 Occ00190 675 Anopheles gambiae Nonsense-mediated mRNA 3 HMMPfam 0.006 Apis mellifera NMD3 XM_315383 2e-040 1.1e-16 XP_624393 HMMPanther NONSENSE-MEDIATED MRNA DECAY PROTEIN 3 5.5e-43 D75-1 Occ00514 715 D87-1 Occ00587 489 mitochondrial malate mitochondrial malate HMMPfam PF02866 dehydrogenase dehydrogenase precursor Lactate/malate Nasonia vitripennis Tribolium castaneum dehydrogenase 4e-010 1e-046 2.3e-30 XM_001600497 XP_973533 HMMPanther

MALATE AND LACTATE DEHYDROGENASE 2.3e-60 p4XAREHis2 (12 clones rescued)

B1-1 372

118

B2-1 Occ00261 607

F19-1 Occ00263 610 Anopheles gambiae Myosin heavy chain, muscle HMMPfam contig 19 3e-021 Drosophila melanogaster Myosin tail XM_319309 1e-007 1.1e-23 T P05661 F24-1 Occ00182 379 F49-1 468 F56-1 Occ00636 660 mRNA, clone:AMP010002F05 Sus scrofa 0.005 AK230493 F58-1 Occ00687 891 18S rRNA similar to Ac1147 Lepidocyrtus paradoxus Gallus gallus e-116 4e-016 U61301 XP_001231536 F62-1 Occ00119 910 ATP synthase PREDICTED: similar to HMMPfam Insect cuticle Nidula niveotomentosa CG1919-PA protein 2.1e-05 7e-005 Tribolium castaneum HMMPanther AM497816 2e-019 STRUCTURAL CONTITUENT XP_967897 OF CUTICLE 4.6e-14 F80-1 631 arginine kinase-like protein arginine kinase HMMPfam Nasonia vitripennis Homarus gammarus ATP:guanido 8e-053 3e-054 phosphotransferase XM_001607072 P14208 2.7e-61 HMMPanther ARGININE OR CREATINE KINASE 8.4e-64 F81-1 Occ00508 510 myosin light chain 2 HMMPanther Bombyx mori MYOSIN REGULATORY

119

7e-024 LIGHT NP_001091813 4.3e-31 F83-1 Occ00288 651

F83-2 Occ00687 891 18S rRNA similar to Ac1147 contig 20 Lepidocyrtus paradoxus Gallus gallus e-116 4e-016 U61301 XP_001231536 pMREHis2 interactions (16 clones rescued)

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan E38-2 610 Anopheles gambiae Myosin heavy chain, muscle HMMPfam contig 19 3e-021 Drosophila melanogaster Myosin tail XM_319309 1e-007 1.1e-23 T P05661 E41-1 Occ00477 675 E76-1 Occ00420 520 Danio rerio eukaryotic translation HMMPfam 6e-004 initiation factor 4E IF4E NM_200759 Apis mellifera 9.4e-25 2e-017 XP_624290 HMMPanther EUKARYOTIC TRANSLATION INITIATION FACTOR 4E 2.6e-23 E86-1 Occ00087 820 myosin like protein Dve protein Drosophila BlastProDom Patinopecten yessoensis melanogaster Homeobox 5e-10 1e-29 1e-28 AB077039.1| CAA09729 G12-3 Occ00215 684 mitochondrion NADH dehydrogenase HMMPfam

120

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan Halocaridina rubra subunit 4 NADH dehydrogenase 0.001 Tetrodontophora bielanensis (ubiquinone) DQ917432 2e-032 1.5e-23 NP_112429 HMMPanther NADH DEHYDROGENASE SUBUNIT 4 13 8e-26

G14-1 Occ00765 286 ribosomal protein L38 similar to Ribosomal protein HMMPfa Bombyx mori L38 Ribosomal protein L38 9e-017 Nasonia vitripennis 5e-026 4.1e-37 NM_001044089 XP_001607713 G14-2 Occ00145 514 16S ribosomal RNA gene Stegana flavimana, partial sequence; mitochondrial gene for mitochondrial product 2e-025 AF479795 G15-2 Occ00506 703 adult cuticle protein, HMMPfam putative Aedes aegypti Insect cuticle protein 5e-016 EAT39210 5.3e-16 HMMPanther STRUCTURAL CONTITUENT OF CUTICLE 7.2e-20 G19-2 Occ00191 762 guanine nucleotide binding similar to phospholipase A2, protein beta subunit (Gb1) activating protein Tribolium Lentinula edodes castaneum 0.003 6e-008 XP_968238 AF407335

121

Clone Cluster Length blastn blastx Domain collembase seq. bases interproscan G26-1 Occ00616 697 DOPA 4,5-dioxygenase HMMPfam Amanita muscaria DOPA dioxygenase 6e-014 7.3e-15 P87064 G31-1 Occ00095 474 chromosome 3 clone RP11- 776K4 Homo sapiens 0.008 AC105750 G31-5 Occ00626 722 G32-3 Occ00191 762 guanine nucleotide binding similar to phospholipase A2, protein beta subunit (Gb1) activating protein Tribolium Lentinula edodes castaneum 0.003 6e-008 XP_968238 AF407335 G58-1 Occ00066 322 28S hypothetical protein Rattus Orchesella cincta norvegicus 4e-166 2e-11 G59-1 Occ00650 562 viral A-type inclusion protein, putative Trichomonas vaginalis 2e-05 G75-1 Occ00343 329

122 Yeast one-hybrid screens on Orchesella cincta methallothionein promoter elements

A homeobox domain containing transcription factor homologous to the D. melanogaster dve (defective proventriculus) was picked up with the pMREHis2 bait vector. The defective proventriculus protein is a mediator of the wingless expression in the wing disc and the embryonic proventriculus (Nakagoshi et al., 2002), a regulator of the differentiation of copper cells in the D. melanogaster midgut (Nakagoshi et al., 1998). The S. cerevisiae CUP9 protein is also a homeodomain containing putative transcription factor, able to complement the Cup1 Ace1 metallothionein system (Knight et al., 1994). We were not able to pick up any of the predicted transcription factors predicted by Janssens et al. (2007). For example the metal responsive transcription factor (MTF-1), which is a DNA binding protein with a major role in the transcriptional regulation of metallothioneins from fly to humans (Haq et al., 2003). The Drosophila MTF-1 contains six

Cys2His2 Zn-fingers, which are involved in binding to the metal responsive element (MRE) (Zhang et al., 2001). The medium used in the screens did contain a nominal concentration of 6.11 µM Zn, but maybe this was not sufficient to activate the Zn fingers. Another possibility is the need for protein cofactors (Jiang et al., 2004) or post-translational modifications of the MTF-1, such as phosphorylations (Adams et al., 2002), although it is not required for the DNA binding. Timmermans (unpublished results) was not able to find MTF-1 after PCR using degenerated primers and screening of an O. cincta genomic library. It is well possible that in this primitive arthropod species, no MTF-1 homologue exists, like in Lumbricus terrestris (Stürzenbaum et al., 2004) and C. elegans (Swain et al., 2004). However, why the O. cincta pmtluc constructs are so active in a Drosophila cell line (Janssens et al., 2007), which has MTF-1, remains unclear. Beside more extensive future screens, including an additional reporter gene, the binding properties of these three positive interactions should be checked by ChIP (chromatin immunoprecipitation) in the yeast reporter and in vivo (Deplancke et al., 2006), after their entire sequence has been determined. From this study, from which cDNAs encoding some unexpected transcription factors were isolated, we can conclude that the nature and mechanism of metallothionein transcriptional regulation in Orchesella cincta remains elusive.

123 Chapter 5

124 Chapter 6

Adaptive differences in gene expression associated with stress tolerance in the soil arthropod Orchesella cincta

Dick Roelofs1, Thierry K.S. Janssens1, Martijn J.T.N. Timmermans1, Ben Nota1, Janine Mariën1, Paul Eijk2, Bauke Ylstra2, and Nico M. van Straalen1 Submitted to Molecular Ecology

1 Vrije Universiteit Amsterdam, Faculty of Earth and Life Sciences, Institute of Ecological Science, Department of Animal Ecology, de Boelelaan 1085, 1081 HV Amsterdam, the Netherlands 2 Microarray facility CCA, VU Medical Center, De Boelelaan 1117, 1081 HV Amsterdam, the Netherlands

ABSTRACT

Field-selected tolerance to heavy metals has been reported for Orchesella cincta (Arthropoda: Collembola) populations occurring at metal-contaminated mining sites. This tolerance is correlated with heritable increase of metal excretion efficiency; less pronounced cadmium induced growth reduction and, over-expression of the metallothionein gene. We applied transcriptomics to determine differential gene expression caused by this abiotic stress in reference and cadmium tolerant populations. Many cDNAs responded to cadmium exposure in a reference population. Significantly fewer clones were cadmium responsive in tolerant animals. Analysis of variance revealed transcripts that interact between cadmium exposure and population. Hierarchical clustering of these clones revealed two major groups. The first one contained cDNAs that were up regulated by cadmium in the reference culture, but non-responsive or down

125 Chapter 6 regulated in tolerant animals. This cluster was also characterized by elevated constitutive expression in the tolerant population. Gene ontology analysis revealed that these cDNAs were involved in structural integrity of the cuticle, anti-microbial defense, calcium-channel blocking, neurotransmitter transport, chromatin remodeling and, endoplasmatic vesicle activity. The second group consisted of cDNAs down regulated in reference animals but not responding or slightly up regulated in tolerant animals. Their functions involved carbohydrate metabolic processes, Ca2+ dependent stress signaling, proteolysis and digestion. The reference population showed a strong signature of stress-induced genome- wide perturbation of gene expression, whereas the tolerant animals maintained normal gene expression upon cadmium exposure. We confirmed the micro-evolutionary processes occurring in soil arthropod populations and suggest a major contribution of gene regulation to the evolution of a stress-adapted phenotype.

INTRODUCTION

Wray (2007) and Purugganan (2000) proposed that variation in transcriptional regulation is a major driver of evolution. Recent studies indeed show that selection for altered transcriptional regulation can be a powerful mechanism for micro-evolution (Daborn et al., 2002; Gompel et al., 2005; Rockman et al., 2005; Schulte et al., 2000; Shapiro et al., 2006; Whitehead, Crawford, 2006b). Moreover, adaptive transcriptional responses towards natural (Knight et al., 2006) and anthropogenic (Fisher, Oleksiak, 2007) stressors in the environment are reported. Earlier, we presented data suggesting that evolution of metal tolerance in the soil-living invertebrate Orchesella cincta (Arthropoda: Collembola, springtails) involves altered transcriptional regulation. A tolerant population of springtails showed increased expression of the metal detoxifying protein metallothionein (mt) compared to a reference population (Roelofs et al., 2007; Sterenborg, 2003a; Timmermans et al., 2005a). Moreover, in a reference population cadmium induced mt overexpression contained a significant heritable component (Roelofs et al., 2006), suggesting that selection can act on elevated mt function in springtails at sites where cadmium levels are a potential threat to their fitness (Timmermans et al., 2005a). The increase in transcriptional activation of mt may account for enhanced excretion efficiency that was observed in a tolerant

126 Adaptive differences in gene expression population (Posthuma et al., 1993). However, it cannot explain other aspects of the metal- tolerant phenotype, such as earlier reproduction and the less outspoken growth reduction upon cadmium exposure that was reported by Posthuma and co-workers (1993). Differential gene expression patterns due to adaptation to heavy metals are poorly understood. Orchesella cincta is a soil dwelling arthropod that contains both sensitive as well as metal-tolerant populations and is thus an appropriate model to address the effect of heavy metals on the stress response system as well as identifying genes that are possibly involved in metal tolerance. However, being a non-genomic model organism, DNA sequence information is lacking for O. cincta. In such a case it is efficient to construct cDNA libraries enriched for genes that potentially respond to the exposure under investigation, such as suppression subtractive hybridization (SSH) (Diatchenko et al., 1996). For instance, Gracey et al. (2001) used SSH in combination with microarray analysis to investigate tissue specific and temporal changes in gene expression levels in the non genomic model organism Gillichthys mirabilis (long-jaw mudsucker) exhibiting tolerance to hypoxia. This study illustrates that it is possible to reconstruct a considerable fraction of the expressed genome even in organisms for which little genomic information existed before. Recently, we (Roelofs et al. 2007) employed the SSH method to screen for genes that are differentially expressed in O. cincta upon cadmium exposure. We used Quantitative PCR to compare transcription profiles of the reference culture with those of cadmium tolerant animals originating from two locations near an abandoned lead/zinc mine near Plombières (Belgium). More insight was obtained into 1) the mechanism of toxicity by identification of additional responsive genes, 2) the adaptive mechanisms of cadmium tolerance. The most intriguing result was the general lack of a stress response in the two tolerant cultures. Most of the assayed genes, differential between populations, showed no significant up regulation upon cadmium exposure in the two Plombières populations. In fact, three genes showed significant down regulation. We suggested a mechanism of adaptation through constitutive detoxification of cadmium preventing the increase of free metal ion concentrations which would harm cellular homeostasis and integrity. It may involve constitutively high levels of mt mRNA present in tolerant animals, providing sufficient protein to effectively chelate any free cadmium (Sterenborg, Roelofs, 2003; Timmermans et al., 2005a). Five additional genes showed a similar pattern (low

127 Chapter 6 constitutive expression in reference populations and high constitutive expression in tolerant populations). Two of these genes, being a MAPK phosphatase and a protein tyrosine kinase homologue, were proposed to be involved in modulating MTF-1 (metal transcription factor, which is the major transcription factor regulating mt transcription) (Saydam et al., 2002; Saydam et al., 2001), or some of its co-factors (Jiang et al. 2004), although the precise mechanism is far from clear. It was suggested that selection on constitutive regulation of stress response genes was important to develop metal tolerance (Sturzenbaum et al., 2001) in a polluted ecosystem. This mechanism was also proposed in plants living on metal contaminated soils and seems therefore of broad relevance (Roelofs et al. 2008). To study the relevance of transcriptional regulation in stress tolerance we applied transcriptomics to determine differential gene expression caused by an important environmental stressor (cadmium) in a reference and cadmium tolerant population. Our results suggest that the cadmium-induced stress response is dramatically diminished in tolerant animals. It suggests a major contribution of gene regulation to the evolution of a stress-adapted phenotype.

MATERIAL AND METHODS

Origin and exposure of animals Orchesella cincta (Collembola) from the laboratory population (LC) at the department of Animal Ecology, Vrije Universiteit Amsterdam were taken as the reference group. This population originated from a pine forest from the reference area (Roggebotzand, the Netherlands, latitude N = 52 º 34’17’’, longitude E = 5 º 47’56’’) that contains on average < 0.5 µg cadmium per gram litter and humus (Janssens et al., 2008; van Straalen et al., 1987). Tolerant animals were collected from randomly selected litter samples at two areas of the abandoned, but still heavily polluted lead/zinc mining site of Plombières (Belgium, latitude N = 50˚44’03’’, longitude E = 5˚58’02’’): the locations contain an average cadmium concentration between 10 and 52 µg.g-1 soil (Lock et al., 2003; Sterenborg, 2003a; van Straalen et al., 1987). To diminish putative environmental effects from the field the animals were reared in a climate room (20°C, 75% humidity, LD 12 h:12 h) in PVC jars on a moist plaster of Paris layer feeding on algae present on twigs for at least three generations before experimental treatment.

128 Adaptive differences in gene expression Animals were exposed to cadmium (nominal concentration of 112,4 µg cadmium.g-1 dry algae) for 2 days, directly after molting, via the food according to Roelofs et al. (2006) . This exposure concentration is two times the no observed effect concentration (NOEC) for reproduction in chronically exposed animals (van Straalen et al., 1989). The above mentioned cadmium concentration in short term exposure experiments results in internal body concentrations that are comparable to internal body concentrations measured in animals collected from the Plombières sites (Sterenborg, 2003a). Total RNA was extracted from eight times 12 pooled animals per treatment using SV Total RNA Isolation system (Promega) and quantified on a Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies). Total RNA was visualized on a 1.5% agarose gel to verify its integrity.

Microarrays, labeling and scanning We amplified cDNAs from our previously obtained cadmium exposed SSH library (Roelofs et al., 2007) together with clones derived from a cDNA library of cadmium- exposed gut tissues (Janssens , Kille, Stürzenbaum & Roelofs, unpublished data) with amine-linked primers. Amine-tagged cDNAs were spotted onto Codelink Activated slides (GE Healthcare). Each cDNA was printed twice on one array and two arrays were printed on one slide, so that each cDNA was four times technically replicated on a slide. Pins of the printer resampled the cDNAs before printing the replicate array, so each slide contains two separately printed arrays. A direct comparison was applied of all treatments and populations in a closed loop experimental design (Figure 1). About 20 µg of total RNA was labeled by the incorporation of 5-(3-aminoallyl)-dUTP (Ambion) during cDNA synthesis with superscript II reverse transcriptase (Invitrogen) and an oligo(d)T15 probe. Subsequently, amine-labeled cDNA was treated with Fluorolink Cy-3 or Cy-5 monofunctional dyes (Amersham). After removal of unincorporated fluorescent dyes, with a PCR clean up column (Qiagen), labeled cDNA was eluted in nuclease free water and stored at -80˚C until hybridization. Hybridization of labeled cDNAs was performed according to Bergman et al. (2005) with a modified hybridization buffer (0.14 g/ml dextrane sulfate, 75% formamide, 3XSSC, 60 µg t-RNA and 24 µg human cot-1 DNA, Amersham) at 37 ˚C in a HybArray 12 (Perkin Elmer) for 14 hours. Wash steps were also performed in the HybArray 12 and included one step

129 Chapter 6 with 50% formamide/2XSSC, one step with phosphate buffer followed by three steps with SSC (0.2X, 0.1X, and 0.01X). Labeled cDNAs bound on microarray slides were quantified with a DNA Microarray Scanner (Agilent, US). Images were analyzed using Bluefuse microarray analysis software

(version 3.2, BlueGnome, UK) in order to calculate background corrected log2 gene expression ratios of Cy3/Cy5 signals. From the 1920 cDNAs 262 were omitted from further analysis because of aberrant spot morphology.

Statistics and bioinformatics

Log2 transformed Cy3/Cy5 ratios were analyzed using R/Linear Models for Microarray Data (LIMMA) (Wettenhall, Smyth, 2004). First, data were smoothed by applying the global lowess correction method. Subsequently, cDNAs were obtained that were significantly affected by cadmium exposure (p<0.05). Significance values were adjusted for multiple testing using the Benjamini Hochberg algorithm (Benjamini, Hochberg, 1995). ANOVA analysis was performed using the Microarray Analysis of Variance package in the R environment (R/MAANOVA; Cui and Churchill, 2003) . First, values of the four technically replicated spots for each cDNA were collapsed, as this yields similar results using non-collapsed technical replicates (Wu, Churchill, 2006). Then, a lowess correction was conducted as described above to normalize for dye effect. Hypothesis testing was carried out using F permutation tests with no differential expression as null hypothesis. The mixed model was tested using the variables “array” and “sample” as random factors and “dye”, “population” and “cadmium” as fixed factors. The interaction between “cadmium’ and “population” was tested by executing 2000 permutations. The terms “population” and “cadmium” were tested as independent factors as well, omitting cDNAs that showed a significant interaction between the two terms. The resulting tabulated p values were adjusted for a false discovery rate of 0.1 %. Finally, the very conservative Bonferroni correction was applied to retrieve the most significant gene sets; all cDNAs with adjusted p values lower than 0.05 were regarded as significant. Differentially expressed cDNAs were hierarchically clustered using complete linkage within the Pearson uncentered distance method and visualized by TIGR Multi Experiment Viewer software (Saeed et al., 2003). The significant clones were sequenced and analyzed using the Partigene (Parkinson et al., 2004) Perl scripts. In summary, the different

130 Adaptive differences in gene expression sequences were assembled into groups of unique gene fragments (unigenes). Subsequently, the sequences within each cluster were assembled using Phrap (Gordon, 2008). The obtained contig-sequences were then subjected to a BLAST (McGinnes, Madden, 2004) search (BLASTX) against the non-redundant database (GenBank Release 163; http://www.ncbi.nlm.nih.gov/Genbank/). In addition, all gene clusters were assigned Gene Ontology terms using the Annot8r Perl script that used BLAST searches against the UniProt database (Schmid, Blaxter, 2008). All EST sequences are submitted to GenBank (Accession Numbers) and are additionally available on Collembase (Timmermans et al., 2007b) (www.collembase.org). The function getGOGraph of the R package GOSim (Fröhlich et al., 2007) was applied to generate a Gene Ontology hierarchy for several clusters.

RESULTS

We first assessed the effect of cadmium in each population separately. Figure 2 shows the results for each population, graphically represented by a volcano plot (Jin et al., 2001). Gene expression ratios from the reference culture reflect a severe transcriptional response to cadmium: 1091 cDNA clones showed a significant (adjusted p value < 0.05) response to the exposure. The suppression subtractive hybridization procedure enriches for up regulated clones upon treatment. Indeed, approximately 2/3 of the significant cDNAs were up regulated in reference population and the range of up regulation was broad, reaching a maximum of 270 fold up regulation of clone 7A04. The remaining down regulated genes showed a more narrow range with 19 fold down regulation of clone 12F8 as the most down regulated clone. A total of 306 clones showed significant regulation higher than a 10logP value of 10. A smaller fraction of cDNAs (791) was significantly affected by cadmium exposure in the tolerant population from Plombières (Figure 2b). Also, the responses were less significant in tolerant animals as compared to reference animals: only 63 clones showed a response with significance of –10logP > 10. Finally, the amplitude of regulation was much

131 Chapter 6 CY CN

PY PN

Figure 1. Experimental design. C: Labculture (reference strain) and P: Plombières culture (2nd generation lab culture of field collected tolerant animals). Y: 112.4 g Cd/g dry food, N: clean food.

less in tolerant animals, ranging from 6 fold down regulation (19A3) up to 28 fold up regulation (19E7). Reference animals obviously showed a much more profound regulatory change upon cadmium exposure, both in maximum fold change, as well as in significance of the transcriptional response, while tolerant animals from Plombières are less affected by cadmium. We hybridized not only cadmium exposed with non-exposed animals for each population, but we also directly compared non-exposed tolerant animals with non- exposed reference animals and cadmium-exposed tolerant animals with cadmium- exposed reference animals in a loop design (Figure 1). Thus, we are not only able to determine which genes are affected by cadmium exposure or genetic background (population), but also to identify genes that respond differently to cadmium exposure depending on the genetic origin of the animals (interaction between cadmium and population). A significant dye effect was observed in two clones (12A04 and 5A08), which

132 Adaptive differences in gene expression

A

B

Figure 2. Volcano plot of cadmium exposure. A: Differential gene expression of cadmium exposed reference culture. B: Differential gene expression of cadmium exposed tolerant culture from Plombières. X-axis: log2 gene expression ratios (Cd exposed vs. non exposed animals), y-axis: level of significance (-logP values) of differential expression.

were omitted from further analysis. When p values were adjusted for false discovery rate of 0.1% 224 clones were significantly affected by cadmium, 221 clones were significantly affected by population and 606 clones showed a significant interaction between cadmium and population. When applying the more conservative Bonferroni correction to the

133 Chapter 6 ANOVA calculations we retrieved 391 cDNAs showing an interaction between cadmium exposure and population, 74 clones were treatment-specific and 72 were population- specific clones. These clones were sequenced and subjected to BLAST in order to retrieve information about homology with functionally characterized genes. Seventeen clones gave high BLAST scores with fungal and bacterial Genbank accessions and were thus omitted from further analysis. The cadmium responding clones clustered in two groups: down regulated by cadmium and up regulated by cadmium (Figure 3). The 74 significant clones assembled in 46 unique genes (unigenes); about two third of the clones were down regulated and the remaining clones were up regulated due to cadmium exposure. We retrieved BLAST hits for only six clusters and gene ontology analysis revealed that six biological processes were affected by cadmium. Two unigenes, involved in phospholipid and fatty acid biosynthesis (Occ00139, Occ00165), were down regulated upon cadmium exposure. Innexin (Occ00332), belonging to a gene family involved in gap junction formation between cells, was up regulated. Also, a melted homologue, with a pleckstrin domain (Occ00070) was up regulated. Finally, the well known stress biomarker acetylcholine esterase was down regulated upon cadmium exposure. The 72 population specific clones were assembled in 53 unigenes, of which 18 showed homology to sequences in the public databases. Gene ontology analysis revealed 13 biological processes, of which six comprised general gene expression processes like RNA splicing, translation and protein folding. Furthermore, two unigenes (Occ00271, Occ542) contain transmembrane proteins of the tetraspanin family. They are residential of lysosomes and are implicated in phagocytosis. Also, unigene Occ00572 is associated with the lysosome. Additionally, we identified unigenes that are involved in actin depolymerization (cofilin-like) and binding (profilin, Occ00239). Figure 4 shows that all these clones revealed a lower expression in the animals from the tolerant population compared to reference animals except one clone (unigene Occ00388, containing a BTB/Kelch motif), which exhibited elevated levels in the tolerant animals.

134

Table 1. Gene clusters that show A: significant effect upon cadmium treatment (p< 0.05, Bonferroni corrected); B: a significant effect of strain (reference or tolerant origin) on overall mRNA levels; C: a significant effect of cadmium and strain on mRNA levels. This latter subcluster has two subclusters. The first one contains genes which are up regulated in the reference population, down regulated in the tolerant population upon cadmium exposure and which have an elevated basal expression in the tolerant population. The other subcluster does contain the genes which are down regulated in the reference population, up regulated in the tolerant population upon cadmium treatment and which show lower basal mRNA levels in the tolerant population.

Term #EST cluster BLAST annotation expect value GO:term biological process A: Cadmium 8 Occ00070 EAT38938 Melted pleckstrin 1.00E-08 homology (PH) domain [Aedes aegypti] 1 Occ00139 AAF53257 Phosphoethanolamine 1.00E-55 GO:0008654 phospholipid biosynthetic cytidylyltransferase [Drosophila process melanogaster] 1 Occ00165 ABU27964 Acyltransferase 4.00E-22 GO:0008415 Fatty acid biosynthesis (metabolic process) 1 Occ00276 EAT43438 alpha-esterase [Aedes 6.00E-21 GO:001678 hydrolase activity aegypti] 1 Occ00332 EAT32915 innexin [Aedes aegypti] 2.00E-08 GO:0030054 cell junction 1 Occ00388 EAT41190 BTB And C-terminal 1.00E-21 GO:0003677 DNA binding Kelch [Aedes aegypti] 1 Occ00397 AAB00466 acetylcholinesterase 1.00E-08 GO:0042135 neurotransmitter catabolic [Leptinotarsa decemlineata] process

B: Strain 1 Occ00011 AAI07470 Ca2+-binding 7.00E-06 motif_predicted protein [Rattus norvegicus] 1 Occ00031 EAT38056 splicesome protein, 5.00E-41 GO:0008380 RNA splicing putative [Aedes aegypti]

135

1 Occ00055 EAT47929 conserved hypothetical 1.00E-06 protein [Aedes aegypti] 2 Occ00236 ABG78607RING-5 [Gibberella zeae] 6.00E-07 1 Occ00239 AAS50159 profilin [Apis mellifera] 1.00E-07 1 Occ00255 AAS93722 RE64616p [Drosophila 1.00E-21 GO:0007155 cell adhesion melanogaster] 1 Occ00271 AAH54957 Cd63-prov protein 1.00E-13 GO:0045807 positive regulation of [Xenopus laevis] endocytosis 1 Occ00377 EAT35814 TM2 domain [Aedes 4.00E-12 GO:0016021 integral to membrane aegypti] 1 Occ00388 EAT41190 BTB And C-terminal 1.00E-21 GO:0003677 DNA binding Kelch [Aedes aegypti] 1 Occ00411 ABM55547 putative eukaryotic 6.00E-10 GO:0003743 translation initiation factor translation initiation factor 3 activity subunit 6 [Maconellicoccus hirsutus] 1 Occ00479 AAY86960 cyclophilin B [Ictalurus 9.00E-30 GO:0006457 protein folding punctatus] 1 Occ00494 EAL27831 Actin depolymerisation 9.00E-36 GO:0030042 actin filament factor/cofilin -like [Drosophila depolymerization pseudoobscura] 1 Occ00541 EAT44590 UNC93A protein, 2.00E-06 putative [Aedes aegypti] 1 Occ00542 EAT33414 tetraspanin, putative 1.00E-22 GO:0016021 integral to membrane [Aedes aegypti] 1 Occ00572 AAH71355 Zgc:86670 [Danio rerio] 8.00E-18 GO:0006622 protein targeting to lysosome 1 Occ00684 CAJ83757 glucose-6-phosphate 2.00E-16 GO:0007165 Pentose-phosphate pathway dehydrogenase [Xenopus tropicalis] (glutathione replenishment) 1 Occ00737 EAW81914 BTB (POZ) domain 2.00E-13 GO:0005515 protein binding containing 6, isoform CRA_b [Homo sapiens]

136

1 Occ00780 AAH08019 Chaperonin containing 3.00E-14 GO:0051082 unfolded protein binding TCP1, subunit 3 (gamma) [Homo sapiens]

C: Cd X Strain 1 Occ00113 EDO43056 YIF1 (Yip1 interacting 8.00E-07 factor) [Nematostella vectensis] reference up 1 Occ00117 ABC84495 heat shock protein 40 8.00E-23 GO:0051082 unfolded protein binding regulation [Locusta migratoria] tolerant down 1 Occ00119 AAL28706 CG1919-PA Cuticular 2.00E-15 GO:0042302 structural constituent of cuticle regulation protein 62Bc [Drosophila melanogaster] 1 Occ00124 EDP01319 Dienelactone hydrolase 2.00E-11 GO:0016787 hydrolase activity [Chlamydomonas reinhardtii] 1 Occ00140 CAD27103 ENDOCHITINASE 5.00E-07 [Encephalitozoon cuniculi GB-M1] 1 Occ00173 AAP33177 peritrophin 1 7.00E-09 [Mamestra configurata] 2 Occ00233 BAB88222 Diapausin [Gastrophysa 5.00E-07 atrocyanea] 3 Occ00234 CG1919-PA Cuticular protein 2.00E-17 GO:0042302 structural constituent of cuticle 62Bc [Drosophila melanogaster] 2 Occ00249 Diapausin [Gastrophysa atrocyanea] 1.00E-06 4 Occ00277 AAF47580 CG1919-PA Cuticular 7.00E-15 GO:0042302 structural constituent of cuticle protein 62Bc [Drosophila melanogaster] 1 Occ00310 CAA48198 HCNGP [Mus 3.00E-13 GO:0006355 regulation of transcription, musculus] DNA-dependent (induction of apoptosis) 2 Occ00322 AAL28706 LD12613p 4.00E-10 GO:0042302 structural constituent of cuticle Chitin_bind_4 [Drosophila melanogaster]

137

1 Occ00327 EDM15717 E1A binding protein 7.00E-06 p300, isoform CRA_a [Rattus norvegicus] 1 Occ00372 AAT68117 cleavage and 2.00E-08 GO:0003676 nucleic acid binding polyadenylation specific factor 1 (polyadenylation) [Danio rerio] 1 Occ00499 ABT48810 Sequence 136280 from 4.00E-07 patent US 7214786 1 Occ00566 EDO29848 predicted protein 6.00E-06 [Nematostella vectensis] 1 Occ00568 EAT33548 DNA polymerase delta 1.00E-57 GO:0006260 DNA replication catalytic subunit [Aedes aegypti] 1 Occ00581 EAT45064 sodium/shloride 9.00E-19 GO:000683 neurotransmitter transport dependent amino acid transporter [Aedes aegypti] 1 Occ00592 AAF50683 CG12330-PA 4.00E-15 GO:0042302 structural constituent of cuticle Chitin_bind_4 [Drosophila melanogaster] 1 Occ00596 ABD65300 carboxypeptidase B 2.00E-20 GO:0004180 carboxypeptidase activity [Litopenaeus vannamei] 1 Occ00625 EAT45199 goodpasture antigen- 3.00E-38 GO:0004674 protein serine/threonine binding protein [Aedes aegypti] kinase activity 1 Occ00723 EAT45864 conserved hypothetical 6.00E-05 protein [Aedes aegypti] 1 Occ00794 AAF58614 CG8986-PA [Drosophila 1.00E-06 melanogaster] 1 Occ00815 EAT33302 Chitin_bind_4 [Aedes 2.00E-15 GO:0042302 structural constituent of cuticle aegypti]

138 reference 2 Occ00006 AAS65302 Glycosyl hydrolase 1.00E-28 GO:0008152 metabolic process down family isoform C [Drosophila regulation melanogaster] tolerant up 1 Occ00042 AAF52291 Dipeptidyl peptidase 2.00E-09 GO:0006508 proteolysis regulation IV [Drosophila melanogaster] 9 Occ00044 EAT44383 Juvenile hormone- 1.00E-11 inducible protein, putative [Aedes aegypti] 1 Occ00049 ABT07486 Sequence 3 from patent 1.00E-14 GO:0006811 ion transport US 7220832 GABA receptor 1 Occ00071 ABA12155 47 kDa salivary 5.00E-12 GO:0008152 metabolic process pyrophosphatase-like protein SP132 [Phlebotomus argentipes] 1 Occ00075 AAO39528 Chitin binding 1.00E-12 GO:0006030 chitin metabolic process Peritrophin-A domain [Drosophila melanogaster] 1 Occ00078 EAL28155 RNA binding protein 3.00E-46 GO:0008069 dorsal/ventral axis Squid [Drosophila pseudoobscura] determination, ovarian follicular epithelium 1 Occ00084 AAI06504 MGC131242 protein 1.00E-07 GO:0005975 carbohydrate (inosytol [Xenopus laevis] phosphate) metabolic process 1 Occ00089 EDO48249 predicted protein 2.00E-11 GO:0005975 carbohydrate metabolic [Nematostella vectensis] process 2 Occ00091 AAF54175 Aldo/keto reductase 5.00E-48 family [Drosophila melanogaster] 2 Occ00103 AAB38064 thaumatin-like protein 1.00E-15 GO:0006952 defense response precursor [Prunus avium] 1 Occ00105 EAT44892 conserved hypothetical 9.00E-30 protein [Aedes aegypti]

139

1 Occ00121 EAT43776 potassium-dependent 1.00E-08 GO:0006813/4 sodium/calcium ion transport sodium-calcium exchanger, putative [Aedes aegypti] 1 Occ00123 AAH67640 Propionyl Coenzyme 2.00E-65 GO:0009062 fatty acid catabolic process A carboxylase, beta polypeptide [Danio rerio] 1 Occ00128 ABF58685 delta5-desaturase 2.00E-26 GO:0006633 polyunsaturated fatty acid [Perkinsus marinus] biosynthetic process 2 Occ00134 AAH90471 O-methyltransferase 7.00E-54 GO:0008152 metabolic process [Danio rerio] 1 Occ00149 EAT45861 protein kinase c, mu 3.00E-62 GO:0007242 intracellular signaling cascade [Aedes aegypti] 2 Occ00167 CAA03880 cuticular protein 8.00E-24 [Tenebrio molitor] 1 Occ00177 EAL32217 GA19574-PA 7.00E-06 [Drosophila pseudoobscura] 1 Occ00191 EAT47396 acylphosphatase, 4.00E-16 GO:0006796 phosphate metabolic process putative [Aedes aegypti] (gluconeogenesis) 2 Occ00204 AAD10193 metallothionein 3.00E-33 [Orchesella cincta] 1 Occ00205 EDK97870 Protein tyrosine 1.00E-16 GO:0007165 signal transduction phosphatase-like [Mus musculus] 1 Occ00232 EAL28000 Na+/proline 2.00E-06 symporter [Drosophila pseudoobscura] 2 Occ00238 AAL39279 GH14272p [Drosophila 2.00E-48 GO:0006508 proteolysis melanogaster] 1 Occ00250 AAB33049 pre-mtHSP70 [Rattus 1.00E-07 sp.] 1 Occ00256 ABX75455 60S ribosomal protein 2.00E-16 GO:0006412 translation l27 [Lycosa singoriensis]

140

1 Occ00258 AAR06266 peritrophic membrane 4.00E-06 chitin binding protein 2 [Trichoplusia ni] 1 Occ00264 ABN20713 patent US 7153501 1.00E-20 GO:0006418 tRNA aminoacylation for tryptophanyl-tRNA synthetase protein translation 1 Occ00267 EAL29593 phosphatidylinositol 6.00E-32 GO:0006810 transport transfer protein lipid binding domain [Drosophila pseudoobscura] 1 Occ00268 EAX97007 C2 domain containing 2.00E-06 protein [Trichomonas vaginalis G3] 1 Occ00287 AAV19096 Trypsin-like serine 3.00E-23 GO:0006508 proteolyis (digestion) protease patent US 6752991 1 Occ00296 AAF55752 CG4367-PA [Drosophila 2.00E-35 melanogaster] 1 Occ00298 AAP13852 glucosidase [Bombyx 2.00E-26 GO:0000272 polysaccharide catabolic mori] process 5 Occ00313 AAW79014 GekBS168P fatty acid- 7.00E-24 GO:0007399 nervous system development binding protein [Gekko japonicus] 1 Occ00317 ABK76337 midgut chitinase 3.00E-17 GO:0006032 chitin catabolic process [Locusta migratoria manilensis] 1 Occ00319 AAN13955 O-Glycosyl hydrolase 1.00E-09 GO:0007040 lysosome organization and family 30 [Drosophila melanogaster] biogenesis 1 Occ00329 ABF51378 eukaryotic translation 1.00E-05 GO:0006412 translation initiation factor 3 subunit 4 [Bombyx mori] 3 Occ00335 ABX03165 peptidase S1 and S6 3.00E-25 GO:0006508 proteolysis chymotrypsin/Hap [Herpetosiphon aurantiacus ATCC 23779] 1 Occ00351 CAJ17164 ribosomal protein S4e 2.00E-95 GO:0006412 translation [Biphyllus lunatus]

141

1 Occ00356 AF077193_1 rhodopsin [Papilio 1.00E-24 GO:0007601 visual perception glaucus] 1 Occ00360 EDO30781 predicted protein 4.00E-05 [Nematostella vectensis] 1 Occ00369 EAT40580 malate dehydrogenase 3.00E-26 GO:0006108 malate metabolic process [Aedes aegypti] 1 Occ00384 AAH70692 spermine synthase 1.00E-23 GO:0008295 spermidine biosynthetic [Xenopus laevis] process 1 Occ00386 EAT43119 conserved hypothetical 3.00E-28 GO:0009792 embryonic development protein [Aedes aegypti] ending in birth or egg hatching 1 Occ00387 EAT36034 conserved hypothetical 3.00E-10 protein [Aedes aegypti] 1 Occ00395 AAF59072 CG8736-PA [Drosophila 1.00E-09 melanogaster] 2 Occ00417 EAL27484 Zinc-dependent 2.00E-48 GO:0006508 proteolysis metalloprotease, astacin_like [Drosophila pseudoobscura] 1 Occ00443 BAF36819 pxPhosphoserine 6.00E-34 GO:0006564 L-serine biosynthetic process phosphatase [Plutella xylostella] 1 Occ00445 EAT46105 aldehyde oxidase 2.00E-63 GO:0030856 regulation of epithelial cell [Aedes aegypti] differentiation 1 Occ00467 ABE02258 myosin heavy chain 2.00E-22 GO:0030239 myofibril assembly [Artemia franciscana] 1 Occ00486 EAT38630 zinc finger protein 2.00E-28 GO:0003676 nucleic acid binding [Aedes aegypti] 1 Occ00488 EDP30652 conserved hypothetical 2.00E-05 protein [Brugia malayi] 1 Occ00495 AAF53153 Phosphoinositide- 1.00E-32 GO:0007165 signal transduction specific phospholipases C [Drosophila melanogaster]

142

1 Occ00503 EAL29644 Aldo/keto reductase 6.00E-32 family [Drosophila pseudoobscura] 2 Occ00513 AAA65931 alpha-trypsin 3 2.00E-29 GO:0006508 proteolysis [Lucilia cuprina] 1 Occ00515 ECF48668 hypothetical protein 2.00E-18 GO:0007591 molting cycle, chitin-based GOS_6058095 [marine cuticle metagenome] 1 Occ00518 AAI35034 Glutamate-5-kinase 4.00E-49 GO:0006561 proline biosynthetic process (G5K) domain [Danio rerio] 1 Occ00543 BAF76153 aquaporin 9 [Gallus 3.00E-20 GO:0030104 water homeostasis gallus] 1 Occ00545 ABG67688 putative farnesoic acid 3.00E-05 O-methyl transferase [Bombyx mori] 1 Occ00556 EDO41420 Zinc-dependent 3.00E-32 GO:0006508 proteolysis metalloprotease, astacin_like [Nematostella vectensis] 1 Occ00622 AAR84628 glutathione S- 3.00E-13 transferase [Gryllotalpa orientalis] 1 Occ00644 CAH89660 hypothetical protein 1.00E-08 GO:0008152 metabolic process [Pongo pygmaeus] 2 Occ00647 AAT72922 sterol carrier protein 1.00E-41 GO:0006869 lipid transport 2/3-oxoacyl-CoA thiolase [Spodoptera littoralis] 1 Occ00654 EAT47764 methylmalonate- 1.00E-104 GO:0008152 metabolic process (valine, semialdehyde dehydrogenase thymine) [Aedes aegypti] 1 Occ00705 EAT45744 dual specificity 4.00E-48 GO:0007257 activation of JNK activity mitogen-activated protein kinase kinase 4 MAPKK4 [Aedes aegypti]

143

1 Occ00710 AF202633_1 Na/K-ATPase beta 1.00E-07 subunit isoform 3 [Drosophila melanogaster] 1 Occ00732 AAS05545 CD36-related protein 4.00E-06 [Schistosoma japonicum] 1 Occ00733 AAF46012 CG15786-PA 1.00E-23 [Drosophila melanogaster] 1 Occ00735 AAH75280 Ethylmalonic 5.00E-10 encephalopathy 1 [Xenopus tropicalis] 1 Occ00747 AAI23913 Prolylcarboxypeptidase 4.00E-47 GO:0006508 proteolysis (angiotensinase C) [Xenopus tropicalis] 1 Occ00753 EAL29006 GA18133-PA 4.00E-08 [Drosophila pseudoobscura] 1 Occ00755 EAL25854 Cytochrome b-561 / 6.00E-36 GO:0006118 electron transport ferric reductase transmembrane domain [Drosophila pseudoobscura] 1 Occ00763 CAD55597.1 troponin C 4.00E-36 [Lethocerus indicus] 1 Occ00771 AAI26636 ABC transporter [Bos 1.00E-09 GO:0006855 multidrug transport taurus] 1 Occ00778 AAN62911 variable region- 2.00E-05 containing chitin-binding protein 5 [Branchiostoma floridae] 1 Occ00796 EAT38290 low-density lipoprotein 9.00E-06 receptor (ldl) [Aedes aegypti] 1 Occ00810 AAR10038 F-type H+- 8.00E-31 GO:0006754 ATP biosynthetic process transporting ATPase subunit [Drosophila yakuba]

144 Adaptive differences in gene expression From the 391 interacting clones 157 were up regulated by cadmium in the reference population and down regulated or did not show differential expression in the tolerant population, whereas the basal expression was generally higher in tolerant animals than in reference (Figure 5). These 157 cDNAs assemble into 88 unigenes, of which 24 showed homology to known gene sequences in public databases. Six unigenes (Table 1) showed high homology to cuticle protein and GO analysis assigned these to the biological process ‘structural constituent of the cuticle’. In addition, an endochitinase (Occ00140) was identified, suggesting that exoskeleton maintenance is severely affected by cadmium. Two unigenes were identified as putative diapausin (Occ00233 and Occ00249), and one unigene was highly homologous to peritrophin (Occ00173). Both diapausin and perithrophin are involved in anti-microbial defense in the midgut. Furthermore, heat shock protein 40 (Occ00117) was identified, involved in protein refolding. DNA replication seems to be elevated in cadmium exposed reference animals and unexposed tolerant animals (DNA polymerase delta catalytic subunit, Occ00568). In addition, unigene Occ00113 shows homology to Yif1, a protein essential in vesicle transport from the endoplasmatic reticulum to the Golgi apparatus. Also, both unigenes Occ00310 (homologous to HCNGP) and Occ327 (E1A binding protein p300) are regulators of transcriptional activity via histone acetylation. HCNGP acts as a repressor by attracting histone deacetylase, while p300 is a transcriptional activator via its intrinsic histone acetylase activity. Finally, neuromuscular transmitter activity seems also affected by cadmium: a sodium/chloride dependent amino acid transporter was identified that may be involved in GABA neurotransmitter activity.

145 Chapter 6

Figure 3. Pearson uncentered (complete linkage) clustering of clones significant for cadmium treatment (p < 0.05, after Bonferroni correction). Red: up regulation, green down regulation., labels are Cluster IDs (see Table 1). Each lane represents a hybridization of one biological replication .

Figure 4. Pearson uncentered (complete linkage) clustering of clones significant for term strain (p < 0.05, after Bonferroni correction). Red: up regulation, green down regulation, labels are Cluster IDs (see Table 1)

146 Adaptive differences in gene expression

Figure 5. Pearson uncentered (complete linkage) clustering of clones that show a significant interaction between Cd treatment and strain (p < 0.05, after Bonferroni correction). Red: up regulation, green down regulation., labels are Cluster IDs (see Table 1). A. up regulation by cadmium in reference culture and non responsive or down regulated in tolerant animals. B. down regulation by cadmium in reference culture.

147 Chapter 6

The remaining 234 clones, that show a population specific response to cadmium, are characterized as down regulated in the reference population upon cadmium exposure and exhibit generally lower constitutive expression in tolerant animals (Figure 5b). They assembled into 171 unigenes, of which 77 showed significant BLAST hits to known gene sequences. Gene ontology analysis revealed that diverse biological processes are down regulated in reference animals, but are less responsive in tolerant animals upon cadmium exposure. Overall, general metabolic processes seem to be affected, at least eight unigenes were identified to be involved in energy metabolism (Table 1). Furthermore, a clear signature of digestive inhibition due to cadmium toxicity was identified in reference animals: eight unigenes were homologous to proteases. Again these genes were unaffected by cadmium in tolerant animals, when compared to reference populations. Several chitin binding proteins and another peritrophin (Occ00075) anti-microbial peptide were less down regulated by cadmium in tolerant animals compared to the reference population. Surprisingly, genes involved in a possible stress activated protein kinase signaling pathway (SAPK), involving phosphatidylinositol and calcium signaling (e.g., phosphatidylinositol transfer protein lipid binding domain (Occ00267), phosphoinositide- specific phospholipase C (Occ00495), mitogen-activated protein kinase kinase 4 (Occ00705), protein kinase C (Occ00149) and protein tyrosine phosphatase (Occ00205)) were down regulated in reference animals, but were non-responsive or slightly up regulated in tolerant animals. Moreover, some more specific targets were transcriptionally affected in similar ways. They include a glutathione-S-transferase (Occ00622), a mitochondrial hsp70 (Occ00250), aquaporin (Occ00543, water homeostasis), myosin heavy chain (Occ00467, myofibril assembly) and an ABC transporter (Occ00771). Finally, the O. cincta metallothionein cluster was identified in this group of interacting genes. As shown in Figure 5, metallothionein is up regulated both in reference and tolerance animals upon cadmium exposure. This is in accordance with previous studies, so that its position in the group of down regulated clones may be an artifact of the hierarchical clustering method. However, in contrast to previous quantitative RT-PCR data basal expression levels of mt seem to be lower in tolerant animals as compared to reference animals.

148 Adaptive differences in gene expression DISCUSSION

The presented microarray data show that regulatory change of gene expression is an important factor explaining adaptation to heavy metals in natural O. cincta populations occurring at metal contaminated sites. The genes that respond to cadmium in a population dependent context may have been molecular target by which field-selected metal tolerance evolved. We show that stress response genes are less inducible in tolerant animals but exhibit high basal expression levels. This suggests that the cadmium detoxification mechanism is constitutively over expressed in tolerant animals, without disturbing cellular homeostasis. In addition, food uptake seems severely impaired in reference animals, while gene expression of digestive enzymes is hardly affected in tolerant animals. This may explain the observation by Posthuma et al. (1992) that cadmium exhibit less adverse effects on growth rate of tolerant animals. Finally, the stress activated kinase pathway seems to be adapted in such a way that tolerant animals are able to modulate the above mentioned processes in order to withstand chronic cadmium exposure. Our study shows that suppression subtractive hybridization (Diatchenko et al. 1996) is an effective way to enrich for genes that are significantly up regulated by cadmium exposure. About half of the isolated clones were significantly affected by either cadmium, population or showed a significant interaction between population and cadmium. Even after applying the highly conservative Bonferroni correction about one third of the total cDNA clones present on the microarray remained significant (p< 0.05). One drawback of enrichment procedure is the redundancy introduced on the microarray. However, redundancy also indicates the importance of a particular gene/cluster in the cadmium response (Shaw et al., 2007). In a previous quantitative RT-PCR study we determined the cadmium response of a reference culture and tolerant animals from Plombières for 26 clones (Roelofs et al. 2007). These clones were also used in the microarray study; however, the animals assessed were from cultures differing about one year. For substantial number of clones the direction of differential gene expression was comparable between the two quantification techniques, which resulted in a significant (p < 0.01) Pearson correlation coefficient of 0.6. Still, a substantial number of clones (8) showed opposite directions of gene regulation. Roelofs et al. (2007) reported seven clones that showed a significant interaction between cadmium

149 Chapter 6 and population. We confirmed the significance of gene regulation for six of these clones. The clone (clone 02E09, cluster Occ00058) homologous to a MAPK phosphatase (slingshot), however, showed an opposite response when compared to the quantitative RT-PCR data of Roelofs et al. (2007). According to these data this gene was up regulated in cadmium exposed reference animals, while it was down regulated in cadmium exposed reference animals according to the microarray data. Another inconsistency was observed when constitutive levels of metallothionein (mt) gene expression levels were compared between reference and tolerant animals. Quantitative RT-PCR analysis from previous studies (Roelofs et al., 2007; Timmermans et al., 2005a) revealed a highly significant elevated constitutive expression of this gene in non-exposed tolerant Plombières animals when compared to non-exposed reference animals. The array data showed, however, slight but significant lower constitutive mt RNA abundance in unexposed tolerant samples when compared to reference samples. In conclusion, the comparison with previous quantitative RT-PCR data suggests that the transcriptional profiles of these animals may change in time. Very recently, genome wide transcriptional responses to cadmium have been studied in Daphnia (Poynton et al., 2007; Shaw et al., 2007) and comparison of these studies with our findings show some striking similarities of predicted protein classes upon cadmium exposure. First, metallothionein induction has been reported in Daphnia magna as well. Second, Poynton et al. (2007) reported significant down regulation of proteases and other digestive enzymes (glucanases). The O. cincta reference culture showed a similar response in the same digestive processes, as well as in the energy metabolism. However, these processes were hardly affected in the tolerant population. The absence of an inhibitory effect on digestive enzymes could explain the smaller growth reduction upon cadmium exposure observed in tolerant populations (Posthuma et al., 1992). Furthermore, the study of Shaw et al. (2007) showed that cuticle proteins were up regulated by cadmium, just as in the case of O. cincta reference culture. Remarkably, the tolerant population did not show induction of these genes upon cadmium, but instead a high basal transcriptional level was observed. Other cuticular proteins were overexpressed during cadmium exposure in the tolerant population. These observations support the hypothesis of a complex molting cycle regulated cadmium excretion mechanism (Joosse, Buker, 1979), in which midgut epithelium morphogenesis takes place (Bauer et al., 2001). This may also be related to the

150 Adaptive differences in gene expression induction of an innexin (gap junction component) by cadmium. The induction of innate anti-microbial defense mechanisms, such as diapausin and peritrophin, in the reference population (and the elevated constitutive expression in tolerant animals) are possibly due to damage of the cell membrane. Oxidative stress causes peroxidation of phospholipids (Stohs et al., 2000) and this could make the midgut epithelium vulnerable to infections by microorganisms. Alternatively to the N-type voltage gate blocking anti-fungal mechanism, diapausin structural studies of the leaf beetle Gastrophysa atrocyanea (the same accession as the blast hits in this study) revealed a calcium-channel blocking function (Kouno et al., 2007). Because the primary uptake route of cadmium takes place through calcium channels (Craig, 1999; Fukuda, Kawa, 1977), the induction of diapausins may represent a primary defense mechanism upon cadmium exposure by blocking the animal’s own channels. These diapausins exhibit a constitutive elevated expression in the tolerant population from Plombières, for which, due to the impaired calcium uptake, a calcium homeostasis related trade-off could exist. Moreover, diapausin is down regulated upon cadmium exposure in the tolerant animals, which suggests a need for calcium in the tolerance mechanism, such as replenishment of the calcium stores in the smooth endoplasmatic reticulum. The tolerant population also has basally lower expression levels of the potassium-dependent sodium-calcium exchanger (calcium channel). This hypothesized calcium bases mechanism of the cadmium tolerant phenotype, in which the influx of cadmium is restricted, may exist complementary to the elevated efflux in the tolerant populations, i.e. the elevated cadmium excretion efficiency.

151 Chapter 6

Figure 6. GO graph of biological process with clusters identified in the Stress activated protein kinase pathway (gray circles). Open circles indicate related biological processes that have not been identified in the current study.

The steady state or subtle induction by cadmium in tolerant animals of genes, of which the protein products are involved in the stress-activated protein kinase (SAPK) cascade, may point to an adaptive micro-evolutionary process or may be merited by an increased first-line defense at the calcium channels. We identified four members of the pathway

152 Adaptive differences in gene expression (Figure 6) in which proteine kinase C is activated by phosphatidylinositol and calcium signaling, and triggered by oxidative stress caused by glutathione depletion and reactive oxygen species generation by cadmium (Stohs et al., 2000) (Figure 6). Although in vertebrates cadmium stress signaling involves SAPK and down stream targets such as MTF-1 (Matsuoka et al., 2004; Saydam et al., 2002), the exact mechanism and the mode of post-translational modifications remains elusive. The induction, in both reference and tolerant animals, of a melted homologue with a pleckstrin domain, suggests a link between trace metal metabolism and the TOR (target of rapamycin) pathway, a conserved signaling event, which determines plastic organismal growth based on nutritional status and environmental cues. In yeast, Drosophila and mammalian cells it is known to regulate about 5% of the genes (Reiling, Sabatini, 2006). The product of melted in D. melanogaster enhances, together with other interacting proteins, the inactivation of TOR, a signaling pathway that influences metabolism and growth. The TOR pathway involves transcriptional control of protein 4E-BP (elongation factor 4E- binding protein). This protein is involved in oxidative stress signaling from the sensor Tsc1/2 complex towards the metabolism and growth (insulin/PI3K pathway) (Reiling, Sabatini, 2006), by recruiting the latter complex to the cell membrane region. Melted also inhibits the function of FOXO, which is a transcription factor for 4E-BP expression; 4E-BP is known as a metabolic brake under environmentally adverse conditions (Teleman et al., 2005a; Teleman et al., 2005b). We suggest that induction of the melted homologue by cadmium in both reference and tolerant animals ensures the responsiveness of the cells to oxidative stress. Anyhow, because of the large effect of cadmium on lipid biosynthesis and the hypothesized TOR/insulin/PI3K pathway, and because of the population specific expression upon cadmium exposure of members from the putative phosphatidylinsositol/calcium signaling pathway, it seems that these mechanisms are intertwined and dependent on the status of phospholipid bilayer, which is a site of action for ROS during conditions deviating from redox homeostasis. Moreover, proteins of the PI3K family play a pivotal role in between the two presumed pathways (Wymann, Pirola, 1998). In conclusion we have observed significant changes in transcription upon cadmium exposure. Many transcriptional responses show a highly significant interaction between

153 Chapter 6 cadmium exposure and source of the population, i.e. reference or tolerant. The tolerant Plombières population is much less affected by cadmium exposure. Genes involved in stress response, exoskeleton maintenance, anti-microbial defense, calcium-channel blockers, and transcriptional regulation via histone acetylation- and deacetylation show a high basal expression and are less inducible in tolerant animals as compared to the reference culture. In contrast, genes involved in digestion, stress signaling and energy metabolism are less down or up regulated upon cadmium exposure and show a lower basal expression in tolerant animals when compared to the reference culture. Our observations confirm the micro-evolutionary processes occurring in soil arthropod populations at historically heavy metal-contaminated sites (Janssens et al., 2007).

ACKNOWLEDGEMENTS

The authors would like to thank Paul van den IJssel for spotting the cDNAs and Oscar Krijgsman for providing the initial Limma scripts. TKS Janssens was supported by a grant from the Dutch Research council.

154

Chapter 7

GENERAL DISCUSSION

The importance of regulatory mutations affecting the transcription of key genes in adaptive processes in field populations has been summarized by recent reviews (Chapter 1). In the present study the role of a single candidate gene, metallothionein, in the micro- evolution of heavy metal tolerance in Orchesella cincta is emphasized, because evidence for this process has been accumulating in the last twenty years. In Chapter 2, the polymorphisms in putative regulatory elements at the pmt locus, containing a metallothionein promoter, and its consequences for constitutive and induced expression levels are described. Dramatic differences in basal, cadmium and oxidative stress inducibility were observed in luciferase reporter assay in a Drosophila S2 cell line. The highest luciferase levels were measured with the cadmium-exposed pmtD2-luc transformed cells, suggesting that this allele has the highest cadmium inducibility. Subsequently, a population genetic field survey on 23 populations from varying heavy metal-contaminated sites in a limited biogeographic area, showed a strong correlation between the pmtD2 allele frequency and the total cadmium content of the soil. The frequency of this allele also discriminated best the populations from heavily polluted sites from the other populations in a linear discriminant analysis (Chapter 3). However, it should be kept in mind that these luciferase reporter experiments were executed in a clonal and heterologous background with naked plasmid DNA (i.e. without any chromatin structure). If we assume, for the sake of the experiment, that the transcriptional machinery of a Drosophila S2 cell line (which is embryonic) is comparable to the in vivo situation of the adult O. cincta midgut, these results do show the regulatory potential of this stretch of sequence, without taking trans polymorphisms or epigenetic effects in the genetic background into account. In vivo, this population specific genetic background (tolerant or reference) overruled the effect of the pmt genotype and caused a reduced plasticity of Cd induced mt expression, due to an elevated basal expression (Chapter 4). This elevated basal expression, measured with quantitative RT-QPCR, has

155 Chapter 7 been observed before in several populations from heavy metal-contaminated sites and did show a correlation with the total cadmium content of the soil (Timmermans et al., 2005a) (Krab et al., unpubl.). These processes can also be interpreted in the framework of the additive genetic variation concerning the heritability of cadmium-induced mt expression levels measured in a reference population from Roggebotzand. This latter population was lacking genetic variation for the elevated basal expressions, but not for the induction by cadmium (Roelofs et al., 2006). These observations by Roelofs et al. may support the dual mechanism of constitutive and cadmium induced mt expression. The pmt locus also bears clear signs of recombination events and a signature of balancing selection in a tolerant population (Chapter 2). These results are supported by an increase of genetic diversity at this locus in populations from sites with elevated heavy metal contamination. This increase of diversity is accomplished by substitution of the pmtA1 allele (Chapter 3) and may be caused by the increased fitness of (certain) heterozygotes or environmental heterogeneity. Due to the suggested epistatic regulation of basal expression levels (Chapter 4) we may also classify the observed balancing variation at the pmt locus (Chapter 2 and 3) as non-neutral epistatic polymorphisms (Kroymann, Mitchell-Olds, 2005). Likewise, we may not exclude epigenetic processes, because balancing selection has been reported to be associated with silencing as well (Kawabe et al., 2007). Moreover, two chromatin remodelling genes, although with unknown function in O. cincta, do show an elevated constitutive expression level in the tolerant population (Chapter 6) and a subunit of a CCR4-NOT homologue, with a chromatin remodelling function, did exhibit a yeast one-hybrid interaction with the entire metallothionein promoter (Chapter 5). Unfortunately, the data do not allow us to pinpoint exactly the mechanisms of cadmium induced and basal expression levels, so they do remain elusive. The most cadmium-inducible allele (pmtD2) never becomes the most abundant allele in the population (Chapter 3), despite of its association with populations from heavily contaminated sites. Therefore, we assume that the elevated basal expression levels of mt play a more pronounced role in the tolerance to cadmium than plasticity in mt expression.

The metallothionein system is not the exclusive transcriptional response upon cadmium exposure in O. cincta. When performing transcriptional profiling on a tolerant and a

156 General Discussion reference population (with at least four generations of lab reared progenitors) a myriad of co-regulated genes, with a strain and cadmium specific expression profile (adaptive or not), have been observed (Chapter 6). The reference population (Roggebotzand lab culture) shows a larger perturbation of transcriptional patterns upon cadmium exposure than a tolerant population (Plombières lab culture), which demonstrates the homeostatic functioning of the tolerant population at elevated cadmium levels. The reference population performs an upregulation upon cadmium exposure of genes involved in exoskeleton turnover, anti-microbial peptides, calcium-channel blockers and chromatin remodelling factors, which are constitutively expressed at elevated levels in the tolerant population. Genes involved in phosphatidylinositol and calcium stress signalling, digestive and metabolic processes are downregulated upon cadmium exposure in the reference population. However, in the tolerant population the expression of these genes remains relatively unchanged or slightly upregulated upon cadmium exposure but is lower at the constitutive level. We hypothesized that this limited cadmium-induced perturbation of the transcriptome is due to the increased efflux (elevated cadmium excretion efficiency (Posthuma, 1990; Posthuma et al., 1993; Posthuma et al., 1992), possibly caused by the elevated constitutive metallothionein transcription (Roelofs et al., 2007; Timmermans et al., 2005a), and may be complemented by the constitutively elevated expression of diapausins (which are able to block calcium channels, the major site of entry of environmental cadmium). The phenotype of reduced growth reduction upon cadmium exposure in the tolerant population may be linked to the reduced inhibition of digestive and metabolic processes. However, from the extensive differences in transcriptional patterns between the reference and the tolerant population (after at least four generations of laboratory residence, in the absence of heavy metal pollution) we may conclude that micro-evolution to anthropogenous heavy metal pollution has taken place.

Our observations preclude the use of indiscriminate populations of test organisms for ecological risk assessment purposes, because of population specific biases in parameters, whether it are organismal responses or (molecular) biomarkers (Morgan et al., 2007). For example, metallothioneins are often suggested as a biomarkers in field populations for heavy metal contamination (Demuynck et al., 2006; Knapen et al., 2007; Van Campenhout

157 Chapter 7 et al., 2003). The tolerant populations of O. cincta have a constitutively elevated mt mRNA level, which would give false positive results about cadmium contamination in an ecotoxicological test when animals from a tolerant population would be used. Also adaptive features of any kind come along with trade-offs, which must have their influence on ecosystem functioning (Medina et al., 2007). For example, what is the impact of the reduced growth reduction upon cadmium exposure or earlier maturation in cadmium tolerant O. cincta on litter decomposition rates compared to the situation in the reference population? In order to avoid these complications, well described strains with the minimal genetic variation possible should be chosen for risk assessment purposes. Therefore, Nota et al. (unpubl.) use a particular strain of the parthenogenetic springtail species Folsomia candida, to develop a microarray for ecological soil quality risk assessment in which deviations from the normal operating range (van Straalen, 2002) of transcriptional patterns are utilized to detect environmental pollution at levels affecting organismal responses.

Future analyses are required to determine the nature of the processes, such as epistatic and epigenetic regulation and polygenicity, contributing to the micro-evolution of the cadmium tolerant phenotype and metallothionein over-expression. In order to unravel the share of cis and trans regulatory mechanisms in the micro- evolution of the transcriptional regulation of metallothionein in O. cincta, we may use the methodology relying on pyrosequencing the cDNA (Wittkopp et al., 2004; Wittkopp et al., 2008). This technique allows quantifying the transcripts, as cDNA, of both alleles in a diploid genome simultaneously. By subtracting the ratios of allele specific transcripts in F1 hybrid of inbred pmt homozygous families (C) from respectively tolerant and reference origin, from the ratios between the parental strains (P) the share of trans-regulatory polymorphisms in the expression of the mt alleles can be determined. This approach could be applied to six reciprocal crosses of e.g. pmtA1, pmtD2 and pmtC (because these alleles can be discriminated well on nucleotide polymorphisms in the coding sequence) inbred homozygous families between reference and tolerant origin, replicated for origin of both alleles from maternal or paternal origin. The measurements should be executed on constitutive and cadmium-induced expression levels. As a negative control, some genes without a strain effect from the microarray study should be measured as well in the analysis.

158 General Discussion QTL analyses of the cadmium tolerant phenotype are essential in order to find the loci which harbour the additive genetic variation responsible for the cadmium tolerant phenotype and hence identify candidate genes. A similar approach was performed in the unravelling of genes involved in cadmium and zinc hyper-accumulation in Thlaspi caerulescens (Deniau et al., 2006) and cadmium tolerance in Arabidopsis halleri (Courbot et al., 2007). These QTL analyses could be executed in a F2 generation from a cross between lab reared F1 populations from both Roggebotzand (standard reference population) and Plombières (tolerant population from a historically contaminated lead mine). Because only eight microsatellite loci have been discovered in O. cincta until now (van der Wurff et al., 2001) additional markers, such as AFLPs, should be added to the analysis in order to make the linkage map dense enough. However, the combination of the excretion efficiency measurement (which is a destructive method) and the genotyping in a single individual is problematic. Therefore, heavy metal tolerance will need to be represented by other phenotypes, which correlate with the excretion efficiency (such as e.g. cadmium content of the gut pellet) or with mt expression as a molecular phenotype. The use of basal and cadmium induced mt expression as molecular phenotypes can be associated to the results from the cis/trans regulatory approach. The amount of ROS (reactive oxygen species) measured in the tissues as a phenotype for tolerance, should also be considered as a possibility, although this is also a destructive method (Pap et al., 1999). In order to reveal possible DNA methylation differences of the pmt locus between reference and tolerant populations, reflecting the differential plasticity of cadmium induction, a bisulphite sequencing approach would be useful (Dahl, Hutchison, 2000). This approach has been applied to screen Fundulus heteroclitus P450 promoters for methylated CpG islands (Timme-Laragy et al., 2005). The structure of the chromatin in vivo, and its quantitative implications on induced and constitutive transcription levels, may be revealed by sensitivities to certain nucleases (Dnase I, micrococcal nuclease and specific restriction enzymes) activities and the subsequent electrophoresis associated with an appropriate labelling method (Wallrath et al., 1998). The chromatin condition of the pmt locus may be compared between reference and tolerant populations with some of the more important alleles. The induction mechanism by heat stress of the hsp26 promoter in Drosophila relies on the chromatin relaxation by GAGA factor, recruited by certain heat

159 Chapter 7 shock elements (HSE), and the subsequent interaction of heat shock factors binding to distal and proximal HSEs (Lu et al., 1993). Also PCR depending methods have been developed for the detection of footprints and chromatin structure, such as ligation- mediated PCR (LMPCR), depending on a nested approach of primer extension terminating on native genomic containing DNA nicks and breaks introduced by nucleases, chemical agents or UV light (Riggs et al., 1998). This method has undergone several changes, such as automation and modifications for allele-specificity and repetitive stretches (Ingram et al., 2008). By these methods the positioning and the dynamics of nucleosomes and other regulatory proteins can be monitored under different environmental conditions. Additional yeast one and two-hybrid analyses, with a more stringent protocol (Deplancke et al., 2006), should be performed to confirm the present results, to search for the additional transcription factors involved (such as MTF-1 and Nrf-2 homologues) and their possible protein-protein interactions. The nuclease sensitive sites from the chromatin analyses could also be included in this approach. Subsequently, the putative protein-DNA interactions of the candidate regulatory proteins have to be confirmed by DNA footprinting (also in reconstituted chromatin, for which the histones can be chemically extracted from crude protein samples) (Davey et al., 1998), or electrophoretic mobility shift assays (EMSA) (Molloy, 2000). The 3’-UTR may determine expression levels as well. The length of the poly- adenylation signal determines the mRNA stability (Kille et al., 1991), the translational efficiency (Tanguay, Gallie, 1996) and the nuclear localization of mRNA in general, and may thus affect metallothioneins (Mickleburgh et al., 2006). Metallothioneins are, regarding their presence in the nucleus during the S-phase of the cell cycle, considered to be essential in preventing DNA damage caused by heavy metals. Because of the high sequence divergence of the 3’ end of the O. cincta mt gene (Timmermans and Hensbergen, personal communication) it is recommended to investigate the sequence variation of the 3’-UTR, because it may contain non-neutral sequence polymorphisms responsible for the elevated expression or differential cellular localization in animals from tolerant populations. Therefore, the structure of the 3’-UTR may be considered as an additional form of transcriptional and translational regulation, although gudgeons do not show an association between long and short metallothionein mRNA variants and the

160 General Discussion environmental load of heavy metals (Knapen et al., 2007). Because of the possible discrepancy between transcript abundances and protein levels, it is of utmost importance to quantitatively measure the metallothionein protein levels and compare them to mRNA levels. In this approach it also makes sense to determine the histological and subcellular location and the quantity of the metallothionein mRNA and protein in situ, by e.g. FISH and immunohistochemical approaches, at different stages of the moulting cycles, from different pmt alleles and in individuals from both reference and tolerant origin. For the other cadmium-tolerance candidate genes resulting from the microarray study (Chapter 6), putatively involved in the micro-evolution of cadmium tolerance, more sequence information is needed before proceeding with the in situ approach. This entails knowledge of coding sequence and genomic organization of the relevant genes.

From this study increasing evidence for micro-evolution to pollution, and its mode of action, in a non-model ecologically relevant organism emerged. It also creates a fundament for further research on selection models and adaptive polymorphisms in the evolution to man-made perturbations of the environment, by providing novel targets in a relatively well studied organism.

161 Chapter 7

162 Appendix

Flow-cytometric determination of the Orchesella cincta genome size

Thierry K.S. Janssens1, Wim E. Corver2, Nico M. van Straalen1 and Dick Roelofs1

1 Vrije Universiteit Amsterdam, Faculty of Earth and Life Sciences, Institute of Ecological Science, Department of Animal Ecology, de Boelelaan 1085, 1081 HV Amsterdam, the Netherlands 2 Leiden University Medical Centre, Department of Pathology, Albinusdreef 2, 2300 RC Leiden, the Netherlands

INTRODUCTION

When using genomic DNA libraries, in the study of a non-model organism, it is advisable to estimate the genome size. This allows the assessment of the size that a statistically relevant genomic library should have. The next equation (Clarke, 1976) gives the relationship between the desired number of clones, the properties of the library and the genome size.

ln(1− P) N = ln(1− a ) b

with N: number of clones required, P: probability, a: average insert size and b: genome size.

The use of propidium iodide stain and flow cytometry approach allows a quick and efficient method for the measurement of the DNA content in nuclei (Leroy et al., 2003).

163 Appendix MATERIAL AND METHODS

Culture of the animals and collection of the spermatophores

Male Orchesella cincta were placed seperately in perspex pots with a humid platre de Paris bottom, provided with a chunk of bark as food, at 20°C. Pots were inspected on a regular basis on the presence of spermatophores. Individual spermatophores were picked up, deposited and washed three times in 1 ml of sodium citrate, sucrose and DMSO buffer (CycleTESTTM PLUS DNA Reagent Kit, Beckton Dickinson) and stored at -80°C.

Extraction and staining of the nuclei

The extraction and staining of nuclei was performed with the CycleTESTTM PLUS DNA Reagent Kit (Beckton Dickinson) following the removal of the storage buffer from the collected spermatophores by centrifugation at 400 g during five minutes. These spermatophore suspensions were spiked with 5 µl of a rainbow trout (Onchorynchus mykiss) erythrocyt suspension as an internal reference, which was also analysed seperately. The extraction of the nuclei was executed according to the manufacturers instructions by means of trypsine digestion in a, spermine tetrahydrochloride containing, detergent buffer followed by the addition of ribonuclease A and trypsin inhibitor in a citrate buffer provided of spermine tetrahydrochloride. Both digestions were allowed to take 10 minutes. The nuclei were stained by a 125 µg/ml propidium iodide solution in a citrate buffer provided of spermine tetrahydrochloride. Measurements were performed within 3 hours after processing.

DNA content measurement of the nuclei

Flow cytometry measurements were performed on a FACScalibur system (Beckton Dickinson) using PBS (phosphate buffered saline) as sheath fluid. The FL2 detector was used for the detection of the PI fluorescence, since its emits fluorescence at 585 nm when

164 Flow-cytometric determination of the Orchesella cincta genome size excitated by the 15 mW 488 nm argon-ion laser. The desired cell populations were discriminated from debris and aggregates by pulse processing, i.e. the plotting of the pulse area (integral of the total area) with the pulse width (time of flight through the laser beam). Many rainbow trout genome size estimates have been performed and transferred to an online genome-size database (Gregory, 2001). When taking into account the average of the rainbow trout C-values in the database (being 2,65 GBp) and the arbitrarely assumed 80% of the humane genome size (2,8 Gbp, Corver pers. comm.) an acceptable average of 2,725 Gbp as a C-value was used in the calculation. The relative channel position of the modal peaks towards the modal G0/G1 peak of the internally spiked trout erythrocytes, with a C-value of 2,725 Gbp, allowed the calculation of DNA content per nucleus.

RESULTS AND DISCUSSION

Two distinct peaks appeared, at channels 38.21 and 47.52, respectively (see Figure 1). The diploid peak of the internally spiked trout erythrocytes appeared at channel 960.20. The calculation of the relative genome sizes resulted in 217 and 270 Mbp for the respective peaks of male O. cincta. Both peaks differ in about one fifth of the size of the largest peak. This may point on a big difference in size or the absence of one of the sex chromosomes. O. cincta is n=6 with one acrocentric chromosome (Hemmer, 1990). It must be mentioned that genome size measurements are temperature sensitive (Nardon et al., 2003).

Table 1: Flow cytometric data of the measurement of Orchesella cincta haploid sperm cells relative to diploid erythrocytes of Onchorhynchus mykiss revealed two peaks.

RT erythrocytes Peak1 Peak2 Channel 960.2 38.21 47.52 Gbp 5.45 0.216876 0.269719

165 Appendix Figure 1: Flow cytometry histogram showing the relative difference between the DNA content (represented as detection channel on the x-axis) of Orchesella cincta sperm nuclei and the nuclei of Onchorhynchus mykiss (rainbow trout) diploid erythrocytes.

166 LITERATURE REFERENCES

Adams TK, Saydam N, Steiner F, Schaffner W, Freedman JH (2002) Activation of gene expression by metal-responsive signal transduction pathways. Environmental Health Perspectives 110, 813-817. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P (2002) Molecular biology of the cell. Garland Press, New York, USA. Aniskovitch LP, Jacob ST (1997) Purification and characterization of a rat liver protein that recognizes CCAAT-homologous sequences of the metallothionein promoter and trans-activates this promoter. Archives of Biochemistry and Biophysics 341, 337-346. Aniskovitch LP, Jacob ST (1998) Distinct rat proteins can recognize CCAAT-homologous sequences of the metallothionein promoter and trans-activate this promoter. Oncogene 16, 1475-1486. Anonymous (1994) Environmental quality objectives in the Netherlands Ministry of Housing, Spatial Planning and the Environment, the Hague, the Netherlands. Arnosti DN (2002) Design and function of transcriptional switches in Drosophila. Insect Biochemistry and Molecular Biology, 1257-1273. Arnosti DN (2003) Analysis and function of transcriptional regulatory elements: Insights from Drosophila. Annual Review of Entomology 48, 579-602. Babiss LE, Herbst RS, Bennett AL, Darnell JE (1987) Factors that interact with the rat albumin promoter are present both in hepatocytes and other cell-types. Genes & Development 1, 256-267. Bai G, Stuebing EW, Parker HR, Harlow P, Nemer M (1993) Combinatorial regulation by promoter and intron 1 regions of the metallothionein SpmtA gene in the sea-urchin embryo. Molecular and Cellular Biology 13, 993-1001. Bamshad MJ, Mummidi S, Gonzalez E, Ahuja SS, Dunn DM, Watkins WS, Wooding S, Stone AC, Jorde LB, Weiss RB, Ahuja SK (2002) A strong signature of balancing selection in the 5 ' cis-regulatory region of CCR5. Proceedings of the National Academy of Sciences, USA 99, 10539-10544. Bancroft JD, McDowell SA, Degen SJF (1992) The human prothrombin gene - Transcriptional regulation in Hepg2 cells. Biochemistry 31, 12469-12476. Barnes PT (1983) Balancing selection, inversion polymorphism and adaptation in DDT- resistant populations of Drosophila melanogaster. Genetics 105, 87-104. Bauer R, Lehmann C, Hoch M (2001) Gastrointestinal development in the Drosophila embryo requires the activity of innexin gap junction channel proteins. Cell Communication and Adhesion 8, 307-310. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate - a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B- Methodological 57, 289-300. Berg MP (2007) De springstaarten van Nederland: het genus Orchesella (Hexapoda: Entognatha: Collembola). Nederlandse Faunistische Mededelingen 26, 77-93. Berger SL (2002) Histone modifications in transcriptional regulation. Current Opinion in Genetics and Development. 12, 142-148.

167 References

Bergman A, Eijk P, Ruiz-van Haperen V, Smid K, Veerman G, van den IJssel P, Ylstra B, Peters G (2005) In vivo induction of resistance to gemcitabine results in increased expression of ribonucleotide reductase subunit M1 as the major determinant. Cancer Research 65, 9510-9516. Bertin G, Averbeck D (2006) Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review). Biochimie 88, 1549-1559. Bi YY, Palmiter RD, Wood KM, Ma Q (2004) Induction of metallothionein I by phenolic antioxidants requires metal-activated transcription factor 1 (MTF-1) and zinc. Biochemical Journal 380, 695-703. Binz PA, Kägi JHR (1999) Metallothionein: molecular evolution and classification. In: Metallothionein IV (ed. Klaassen CD). Birkhäuser Verlag, Basel, Switzerland. Bishop JA, Hartley DJ, Partridge GG (1977) Population-dynamics of genetically determined resistance to warfarin in Rattus norvegicus from Mid Wales. Heredity 39, 389-398. Bittel D, Dalton T, Samson SLA, Gedamu L, Andrews GK (1998) The DNA binding activity of metal response element-binding transcription factor-1 is activated in vivo and in vitro by zinc, but not by other transition metals. Journal of Biological Chemistry 273, 7127-7133. Boldrin F, Santovito G, Gaertig J, Wloga D, Cassidy-Hanley D, Clark TG, Piccinni E (2006) Metallothionein gene from Tetrahymena thermophila with a copper-inducible- repressible promoter. Eukaryotic Cell 5, 422-425. Bonisch C, Temme C, Moritz B, Wahle E (2007) Degradation of hsp70 and other mRNAs in Drosophila via the 5 '-3 ' pathway and its regulation by heat shock. Journal of Biological Chemistry 282, 21818-21828. Bonneton F, Theodore L, Silar P, Maroni G, Wegnez M (1996) Response of Drosophila metallothionein promoters to metallic, heat shock and oxidative stresses. FEBS Letters 380, 33-38. Bourdineaud JP, Baudrimont M, Gonzalez P, Moreau JL (2006) Challenging the model for induction of metallothionein gene expression. Biochimie 88, 1787-1792. Bourguet D, Capela R, Raymond M (1996) An insensitive acetylcholinesterase in Culex pipiens (Diptera: Culicidae) from Portugal. Journal of Economic Entomology 89, 1060- 1066. Bourguet D, Lenormand T, Guillemaud T, Marcel V, Fournier D, Raymond M (1997) Variation of dominance of newly arisen adaptive genes. Genetics 147, 1225-1234. Braeckman B, Smagghe G, Brutsaert N, Cornelis R, Raes H (1999) Cadmium uptake and defense mechanism in insect cells. Environmental Research 80, 231-243. Brasset E, Vaury C (2005) Insulators are fundamental components of the eukaryotic genomes. Heredity 94, 571-576. Brim H, Heuer H, Krogerrecklenfort E, Mergeay M, Smalla K (1999) Characterization of the bacterial community of a zinc-polluted soil. Canadian Journal of Microbiology 45, 326-338.

168 References

Brugnera E, Georgiev O, Radtke F, Heuchel R, Baker E, Sutherland GR, Schaffner W (1994) Cloning, chromosomal mapping and characterization of the human metal- regulatory transcription facor MTF-1. Nucleic Acids Research 22, 3167-3173. Bunch TA, Grinblat Y, Goldstein LSB (1988) Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic Acids Research 16, 1043-1061. Cappuyns V, Swennen R, Vandamme A, Niclaes M (2006) Environmental impact of the former Pb-Zn mining and smelting in East Belgium. Journal of Geochemical Exploration 88, 6-9. Carapelli A, Nardi F, Dallai R, Frati F (2006) A review of molecular data for the phylogeny of basal hexapods. Pedobiologia 50, 191-204. Carroll SB (2005) Evolution at two levels: On genes and form. PLOS Biology 3, 1159-1166. Chen WY, John JAC, Lin CH, Chang CY (2002) Molecular cloning and developmental expression of zinc finger transcription factor MTF-1 gene in zebrafish, Danio rerio. Biochemical and Biophysical Research Communications 291, 798-805. Chen WY, John JAC, Lin CH, Lin HF, Wu SC, Lin CH, Chang CY (2004) Expression of metallothionein gene during embryonic and early larval development in zebrafish. Aquatic Toxicology 69, 215 - 227. Cherbas C (1993) The arthropod initiator: The capsite consensus plays an important role in transcription. Insect Biochemistry and Molecular Biology 23, 81-90. Chung H, Bogwitz MR, McCart C, Andrianopoulos A, Ffrench-Constant RH, Batterham P, Daborn PJ (2007) Cis-regulatory elements in the Accord retrotransposon result in tissue-specific expression of the Drosophila melanogaster insecticide resistance gene Cyp6g1. Genetics 175, 1071-1077. Clarke LJC (1976) A colony bank containing synthetic Col E1 hybrid plasmids representative of the entire E. coli genome. Cell Biology and Toxicology 9, 91-99. Clayton DF, Harrelson AL, Darnell JE (1985) Dependence of liver-specific transcription on tissue organization. Molecular and Cellular Biology 5, 2623-2632. Courbot M, Willems G, Motte P, Arvidsson S, Roosens N, Saumitou-Laprade P, Verbruggen N (2007) A major quantitative trait locus for cadmium tolerance in Arabidopsis halleri colocalizes with HMA4, a gene encoding a heavy metal ATPase. Plant Physiology 144, 1052-1065. Cowles CR, Hirschhorn JN, Altshuler D, Lander ES (2002) Detection of regulatory variation in mouse genes. Nature Genetics 32, 432-437. Coyle P, Philcox JC, Carey LC, Rofe AM (2002) Metallothionein: The multipurpose protein. Cellular and Molecular Life Sciences 59, 627-647. Craig A, L. Hare & A. Tessier (1999) Experimental evidence for cadmium uptake via calcium channels in the aquatic insect Chironomus staegeri. Aquatic Toxicology 44, 255-262. Crawford DL, Segal JA, Barnett JL (1999) Evolutionary analysis of TATA-less proximal promoter function. Molecular Biology and Evolution 16, 194-207. Crommentuijn T, Doodeman C, Vanderpol JJC, Doornekamp A, Rademaker MCJ, Vangestel CAM (1995) Sublethal sensitivity index as an ecotoxicity parameter

169 References

measuring energy allocation under toxicant stress - Application to cadmium in soil arthropods. Ecotoxicology and Environmental Safety 31, 192-200. Cserjesi P, Fairley P, Brandhorst BP (1992) Functional analysis of the promoter of a sea- urchin metallothionein gene. Biochemistry and Cell Biology-Biochimie Et Biologie Cellulaire 70, 1142-1150. Cserjesi P, Fang H, Brandhorst BP (1997) Metallothionein gene expression in embryos of the sea urchin Lytechinus pictus. Molecular Reproduction and Development 47, 39-46. Cui X, Churchill G (2003) Statistical tests for differential expression in cDNA microarray experiments. Genome Biology 4, 4. Daborn PJ, Yen JL, Bogwitz MR, Le Goff G, Feil E, Jeffers S, Tijet N, Perry T, Heckel D, Batterham P, Feyereisen R, Wilson TG, ffrench-Constant RH (2002) A single P450 allele associated with insecticide resistance in Drosophila. Science 297, 2253-2256. Dahl H-HM, Hutchison WM (2000) Analysis of in vivo methylation. In: Methods in Molecular Biology. (ed. Tymms MJ), pp. 47-57. Humana Press, Totowa, NJ, USA. Dallinger R (1996) Metallothionein research in terrestrial invertebrates: Synopsis and perspectives. Comparative Biochemistry and Physiology C-Pharmacology Toxicology & Endocrinology 113, 125-133. Dallinger R, Berger B, Hunziker P, Kagi JHR (1997) Metallothionein in snail Cd and Cu metabolism. Nature 388, 237-238. Dalton T, Palmiter RD, Andrews GK (1994) Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor antioxidant response element and metal response promoter elements. Nucleic Acids Research 22, 5016-5023. Dalton TP, Lio QW, Bittel D, Liang LC, Andrews GK (1996) Oxidative stress activates metal-responsive transcription factor-1 binding activity - Occupancy in vivo of metal response elements in the metallothionein-I gene promoter. Journal of Biological Chemistry 271, 26233-26241. Dalton TP, Solis WA, Nebert DW, Carvan MJ (2000) Characterization of the MTF-1 transcription factor from zebrafish and trout cells. Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology 126, 325-335. Daniels PJ, Bittel D, Smirnova IV, Winge DR, Andrews GK (2002) Mammalian metal response element-binding transcription factor-1 functions as a zinc sensor in yeast, but not as a sensor of cadmium or oxidative stress. Nucleic Acids Research 30, 3130- 3140. Dauwe T, Bervoets L, Blust R, Pinxten R, Eens M (1999) Are eggshells and egg contents of Great and Blue Tits suitable as indicators of heavy metal pollution? Belgian Journal of Zoology 129, 439-447. Davey C, Pennings S, Allan J (1998) In vitro reconstitution and analysis of nucleosome positioning. In: Chromatin. A practical approach. (ed. Gould H), pp. 151-172. Oxford University Press, Oxford. de Koning DJ, Haley CS (2005) Genetical genomics in humans and model organisms. Trends in Genetics 21, 377-381.

170 References de Meaux J, Goebel U, Pop A, Mitchell-Olds T (2005) Allele-specific assay reveals functional variation in the chalcone synthase promoter of Arabidopsis thaliana that is compatible with neutral evolution. Plant Cell 17, 676-690. Delapaz AR, Delbecque JP, Bitsch J, Delachambre J (1983) Ecdysteroids in the hemolymph and the ovaries of the firebrat Thermobia domestica (Packard) (Insecta, Thysanura) Correlations with integumental and ovarian cycles. Journal of Insect Physiology 29, 323-329. Demuynck S, Grumiaux F, Mottier V, Schikorski D, Lemiere S, Lepretre A (2006) Metallothionein response following cadmium exposure in the oligochaete Eisenia fetida. Comparative Biochemistry and Physiology C-Toxicology & Pharmacology 144, 34- 46. Deniau AX, Pieper B, Ten Bookum WM, Lindhout P, Aarts MGM, Schat H (2006) QTL analysis of cadmium and zinc accumulation in the heavy metal hyperaccumulator Thlaspi caerulescens. Theoretical and Applied Genetics 113, 907-920. Deplancke B, Mukhopadhyay A, Ao WY, Elewa AM, Grove CA, Martinez NJ, Sequerra R, Doucette-Stamm L, Reece-Hoyes JS, Hope IA, Tissenbaum HA, Mango SE, Walhout AJM (2006) A gene-centered C. elegans protein-DNA interaction network. Cell 125, 1193-1205. Diatchenko L, Lau Y-F, Campbell A, Chenchik A, Moqadam F, Huang B, Lukyanov S, Gurskaya N, Sverdlov E, Siebert P (1996) Suppression subtractive hybridization: A method for generating differentially regulated or tissue-specific cDNA probes and libraries. . Proceedings of the National Academy of Sciences of the United States of America 93, 6025-6030. Ding W, Templeton DM (2000) Activation of parallel mitogen-activated protein kinase cascades and induction of c-fos by cadmium. Toxicology and Applied Pharmacology 162, 93-99. Domenech J, Palacios O, Villarreal L, Gonzalez-Duarte P, Capdevila M, Atrian S (2003) MTO: the second member of a Drosophila dual copper-thionein system. Febs Letters 533, 72-78. Donker MH, Bogert CG (1991) Adaptation to cadmium in 3 populations of the isopod Porcellio scaber. Comparative Biochemistry and Physiology C-Pharmacology Toxicology & Endocrinology 100, 143-146. Dorsett D (1999) Distant liaisons: long-range enhancer-promoter interactions in Drosophila. Current Opinion in Genetics and Development. 9, 505-514. Egli D, Selvaraj A, Yepiskoposyan H, Zhang B, Hafen E, Georgiev O, Schaffner W (2003) Knockout of 'metal-responsive transcription factor' MTF-1 in Drosophila by homologous recombination reveals its central role in heavy metal homeostasis. The EMBO Journal 22, 100-108. Egli D, Domenach J, Selvaraj A, Balamurugan K, Hua HQ, Capdevila M, Georgiev O, Schaffner W, Atrian S (2006a) The four members of the Drosophila metallothionein family exhibit distinct yet overlapping roles in heavy metal homeostasis and detoxification. Genes to Cells 11, 647-658. Egli D, Yepiskoposyan H, Selvaraj A, Balamurugan K, Rajaram R, Simons A, Multhaup G, Mettler S, Vardanyan A, Georgiev O, Schaffner W (2006b) A family knockout of all

171 References

four Drosophila metallothioneins reveals a central role in copper homeostasis and detoxification. Molecular and Cellular Biology 26, 2286-2296. Eide DJ (2001) Functional genomics and metal metabolism. Genome Biology 2, 1028.1021- 1028.1023. Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1, 47-50. Fang YY, Kashkarov U, Anders MW, Board PG (2006) Polymorphisms in the human glutathione transferase zeta promoter. Pharmacogenetics and Genomics 16, 307-313. Fantappie MR, Osman A, Niles EG, LoVerde PT (2000) Identification and functional characterization of a member of the PUR-alpha family from Schistosoma mansoni. Molecular and Biochemical Parasitology 110, 373-390. Farkas G, Leibovitch BA, Elgin SCR (2000) Chromatin organization and transcriptional control of gene expression in Drosophila. Gene 253, 117-136. Feder ME, Mitchell-Olds T (2003) Evolutionary and ecological functional genomics. Nature Reviews Genetics 4, 649-655. Filser J, Wittmann R, Lang A (2000) Response types in Collembola towards copper in the microenvironment. Environmental Pollution 107, 71-78. Fisher MA, Oleksiak MF (2007) Convergence and divergence in gene expression among natural populations exposed to pollution. BMC Genomics 8. Fountain MT, Hopkin SP (2001) Continuous monitoring of Folsomia candida (Insecta : Collembola) in a metal exposure test. Ecotoxicology and Environmental Safety 48, 275- 286. Fox ME, Yamada T, Ohta K, Smith GR (2000) A family of cAMP-response-element-related DNA sequences with meiotic recombination hotspot activity in Schizosaccharomyces pombe. Genetics 156, 59-68. Frati F, Fanciulli PP, Posthuma L (1992) Allozyme variation in reference and metal- exposed natural populations of Orchesella cincta (Insecta, Collembola). Biochemical Systematics and Ecology 20, 297-310. Freedman JH, Slice LW, Dixon D, Fire A, Rubin CS (1993) The novel metallothionein genes of Caenorhabditis elegans - structural organization and inducible, cell-specific expression. Journal of Biological Chemistry 268, 2554-2564. Fröhlich H, Speer N, Poustka A, Beissarth T (2007) GOSim - an R-package for computation of information theoretic GO similarities between terms and gene products. BMC Bioinformatics 8, 166. Fukuda J, Kawa K (1977) Permeation of manganese, cadmium, zinc, and beryllium through calcium channels of an insect muscle membrane. Science 196, 309-311. Gamble MJLPF (2002) A coactivator code for transcription. Trends in Biochemical Sciences 27, 165-167. Gesellchen V, Boutros M (2004) Managing the genome: microRNAs in Drosophila. Differentiation 72, 74-80. Gibert JM, Peronnet F, Schlotterer C (2007) Phenotypic plasticity in Drosophila pigmentation caused by temperature sensitivity of a chromatin regulator network. PLOS Genetics 3, 266-280.

172 References

Gibson G, Weir B (2005) The quantitative genetics of transcription. Trends in Genetics 21, 616-623. Gilbert SF (2005) Mechanisms for the environmental regulation of gene expression: Ecological aspects of animal development. Journal of Biosciences 30, 65-74. Gillet S, Ponge JF (2003) Changes in species assemblages and diets of Collembola along a gradient of metal pollution. Applied Soil Ecology 22, 127-138. Girardot F, Monnier V, Tricoire H (2004) Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 5. Goldring C, Kitteringham N, Jenkins R, Copple I, Jeannin JF, Park BK (2006) Plasticity in cell defence: access to and reactivity of critical protein residues and DNA response elements. Journal of Experimental Biology 209, 2337-2343. Gompel N, Prud'homme B, Wittkopp PJ, Kassner VA, Carroll SB (2005) Chance caught on the wing: cis-regulatory evolution and the origin of pigment patterns in Drosophila. Nature 433, 481-487. Gordon D (2008) Phrap. (ed. Washington Uo). TechTransfer. Gracey A, Troll J, Somero G (2001) Hypoxia-induced gene expression profiling in the euryoxic fish Gillichthys mirabilis. Proceedings of the National Academy of Sciences of the United States of America 98, 1993-1998. Gregory T (2001) Animal Genome Size Database. http://www.genomesize.com. Groenendijk D, Kraak MHS, Admiraal W (1999a) Efficient shedding of accumulated metals during metamorphosis in metal-adapted populations of the midge Chironomus riparius. Environmental Toxicology and Chemistry 18, 1225-1231. Groenendijk D, van Opzeeland B, Pires LMD, Postma JF (1999b) Fluctuating life-history parameters indicating temporal variability in metal adaptation in riverine chironomids. Archives of Environmental Contamination and Toxicology 37, 175-181. Hahn MW (2007) Detecting natural selection on cis-regulatory DNA. Genetica 129, 7-18. Haq F, Mahoney M, Koropatnick J (2003) Signaling events for metallothionein induction. Mutation Research 533, 211-226. Heissig F, Krause J, Bryk J, Khaitovich P, Enard W, Paabo S (2005) Functional analysis of human and chimpanzee promoters. Genome Biology 6. Hemmer W (1990) Karyotype differentiation and chromosomal variability in springtails (Collembola, Insecta). Biology and Fertility of Soils 9, 119-125. Hensbergen PJ, Donker MH, van Velzen MJM, Roelofs D, van der Schors RC, Hunziker PE, van Straalen NM (1999) Primary structure of a cadmium-induced metallothionein from the insect Orchesella cincta (Collembola). European Journal of Biochemistry 259. Hensbergen PJ, van Velzen MJM, Nugroho RA, Donker MH, van Straalen NM (2000) Metallothionein-bound cadmium in the gut of the insect Orchesella cincta (Collembola) in relation to dietary cadmium exposure. Comparative Biochemistry and Physiology C-Pharmacology Toxicology & Endocrinology 125, 17-24. Hensbergen PJ, Donker MH, Hunziker PE, van der Schors RC, van Straalen NM (2001) Two metal-binding peptides from the insect Orchesella cincta (Collembolla) as a result of metallothionein cleavage. Insect Biochemistry and Molecular Biology 31, 1105- 1114.

173 References

Heuchel R, Radtke F, Georgiev O, Stark G, Aguet M, Schaffner W (1994) The transcription factor Mtf-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO Journal 13, 2870-2875. Hiller D, Stahl S, Morschhauser J (2006) Multiple cis-acting sequences mediate upregulation of the MDR1 efflux pump in a fluconazole-resistant clinical Candida albicans isolate. Antimicrobial Agents and Chemotherapy 50, 2300-2308. Hoekstra HE, Coyne JA (2007) The locus of evolution: Evo devo and the genetics of adaptation. Evolution 61, 995-1016. Hoogendoorn B, Coleman SL, Guy CA, Smith K, Bowen T, Buckland PR, O'Donovan MC (2003) Functional analysis of human promoter polymorphisms. Human Molecular Genetics 12, 2249 - 2254. Hopkin SP (1997) Biology of the springtails (Insecta:Collembola) Oxford University Press, Oxford, UK. Horckmans L, Swennen R, Deckers J (2006) Geochemical and mineralogical study of a site severely polluted with heavy metals (Maatheide, Lommel, Belgium). Environmental Geology 50, 725-742. Hossain ZFH (2002) Studies on the interaction between Cd2+ ions and DNA. Journal of Inorganic Biochemistry 90, 85-96. Hsia CCWM (2003) Evolution of transcription factor function. Current Opinion in Genetics and Development. 13, 199-206. Hsieh WP, Passador-Gurgel G, Stone EA, Gibson G (2007) Mixture modeling of transcript abundance classes in natural populations. Genome Biology 8. Humbert W (1978) Cytochemistry and X-ray microprobe analysis of midgut of Tomocerus minor Lubbock (Insecta, Collembola) with special reference to physiological significance of mineral concretions. Cell and Tissue Research 187, 397-416. Huson DH, Kloepper TH (2005) Computing recombination networks from binary sequences. Bioinformatics 21, 159-165. Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23, 254-267. Imagawa M, Onozawa T, Okumura K, Osada S, Nishihara T, Kondo M (1990) Characterization of metallothionein cDNAs induced by cadmium in the nematode Caenorhabditis elegans. Biochemical Journal 268, 237-240. Ingram R, Gao C, Le Bon J, Liu Q, Mayoral RJ, Sommer SS, Hoogenkamp M, Riggs AD, Bonifer C (2008) PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis. Nucleic Acids Research 36, e19. Inouye C, Remondelli P, Karin M, Elledge S (1994) Isolation of a cDNA-encoding a metal response element-binding protein using a novel expression cloning procedure - the one hybrid system. DNA and Cell Biology 13, 731-742. Ivanov PA, Nadezhdina ES (2006) Stress granules: RNP-containing cytoplasmic bodies arising in stress: Structure and mechanism of organization. Molecular Biology 40, 844-850. Jack E, Hakvoort HWJ, Reumer A, Verkleij JAC, Schat H, Ernst WHO (2007) Real-time PCR analysis of metallothionein-2b expression in metallicolous and non-

174 References

metallicolous populations of Silene vulgaris (Moench) Garcke. Environmental and Experimental Botany 59, 84-91. Janssens TKS, Mariën J, Cenijn P, Legler J, van Straalen NM, Roelofs D (2007) Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta. BMC Evolutionary Biology 7, 88. Janssens TKS, del Rio Lopéz R, Mariën J, Timmermans MJTN, Montagne-Wajer K, van Straalen NM, Roelofs D (2008) Comparative population analysis of metallothionein promoter alleles suggests stress-induced microevolution in the field. Environmental Science & Technology 42, 3873-3878. Jiang HM, Fu K, Andrews GK (2004) Gene- and cell-type-specific effects of signal transduction cascades on metal-regulated gene transcription appear to be independent of changes in the phosphorylation of metal-response-element-binding transcription factor-1. Biochemical Journal 382, 33-41. Jin HY, Clark AB, Slebos RJC, Al-Refai H, Taylor JA, Kunkel TA, Resnick MA, Gordenin DA (2003) Cadmium is a mutagen that acts by inhibiting mismatch repair. Nature Genetics 34, 326-329. Jin W, Riley R, Wolfinger R, White K, Passador-Gurgel G, Gibson G (2001) Contributions of sex, genotype and age to transcriptional variance in Drosophila melanogaster. Nature Genetics 29, 389-395. Joosse ENG, Buker JB (1979) Uptake and excretion of lead by litter-dwelling Collembola. Environmental Pollution 18, 235-240. Jordaens K, De Wolf H, Van Houtte N, Vandecasteele B, Backeljau T (2006) Genetic variation in two land snails, Cepaea nemoralis and Succinea putris (Gastropoda, Pulmonata), from sites differing in heavy metal content. Genetica 128, 227-239. Kägi JHR (1991) Overview of Metallothionein. Methods in Enzymology 205, 613-626. Kawabe A, Fujimoto R, Charlesworth D (2007) High diversity due to balancing selection in the promoter region of the medea gene in Arabidopsis lyrata. Current Biology 17, 1885- 1889. Khalil MA, Donker MH, van Straalen NM (1995) Long-term and short-term changes in the energy budget of Porcellio scaber Latreille (Crustacea) exposed to cadmium polluted food. European Journal of Soil Biology 31, 163-172. Khan R, Tan R, Mariscal AG, Straney D (2003) A binuclear zinc transcription factor binds the host isoflavonoid-responsive element in a fungal cytochrome p450 gene responsible for detoxification. Molecular Microbiology 49, 117-130. Kille P, Stephens PE, Kay J (1991) Elucidation of cDNA sequences for metallothioneins from rainbow trout, stone loach and pike liver using the polymerase chain reaction. Biochimica et Biophysica Acta - Gene Structure and Expression 23, 407-410. Klerks PL, Weis JS (1987) Genetic adaptation to heavy metals in aquatic organisms: a review. Environmental Pollution 45, 173-205. Klerks PL, Levinton JS (1989) Rapid evolution of metal resistance in a benthic oligochaete inhabiting a metal-polluted site. Biological Bulletin 176, 135-141. Knapen D, Reynders H, Bervoets L, Verheyen E, Blust R (2007) Metallothionein gene and protein expression as a biomarker for metal pollution in natural gudgeon populations. Aquatic Toxicology 82, 163-172.

175 References

Knight CA, Vogel H, Kroymann J, Shumate A, Witsenboer H, Mitchell-Olds T (2006) Expression profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient. Molecular Ecology 15, 1229-1237. Knight SAB, Tamai KT, Kosman DJ, Thiele DJ (1994) Identification and analysis of a Saccharomyces cerevisiae copper homeostasis gene encoding a homeodomain protein. Molecular and Cellular Biology 14, 7792-7804. Kohler HR (2002) Localization of metals in cells of saprophagous soil arthropods (Isopoda, Diplopoda, Collembola). Microscopy Research and Technique 56, 393-401. Koizumi S, Suzuki K, Ogra Y, Yamada H, Otsuka F (1999) Transcriptional activity and regulatory protein binding of metal-responsive elements of the human metallothionein-IIA gene. European Journal of Biochemistry 259, 635-642. Koren A, Ben-Aroya S, Kupiec M (2002) Control of meiotic recombination initiation: a role for the environment? Current Genetics 42, 129-139. Korsloot A, van Gestel CAM, van Straalen NM (2004) Environmental Stress and Cellular Response in Arthropods CRC Press, Boca Raton, FL, USA. Kouno T, Mizuguchi M, Tanaka H, Yang P, Mori Y, Shinoda H, Unoki K, Aizawa T, Demura M, Suzuki K, Kawano K (2007) The structure of a novel insect peptide explains its Ca2+ channel blocking and antifungal activities. Biochemistry 46, 13733- 13741. Kroymann J, Mitchell-Olds T (2005) Epistasis and balanced polymorphism influencing complex trait variation. Nature 435, 95-98. Laity JH, Andrews GK (2007) Understanding the mechanisms of zinc-sensing by metal- response element binding transcription factor-1 (MTF-1). Archives of Biochemistry and Biophysics 463, 201-210. LaRochelle O, Gagne V, Charron J, Soh JW, Seguin C (2001) Phosphorylation is involved in the activation of metal-regulatory transcription factor 1 in response to metal ions. Journal of Biological Chemistry 276, 41879-41888. Lauverjat S, Ballan-Dufrançais C, Wegnez M (1989) Detoxification of cadmium. Ultrastructural study and electron-probe microanalysis of the midgut in a cadmium-resistant strain of Drosophila melanogaster. Biol. Metals 2, 97-107. Lenormand T, Bourguet D, Guillemaud T, Raymond M (1999) Tracking the evolution of insecticide resistance in the mosquito Culex pipiens. Nature 400, 861-864. Lepš J, Šmilauer P (2003) Multivariate analysis of ecological data using CANOCO Cambridge University Press, Cambridge, UK. Lerman DN, Michalak P, Helin AB, Bettencourt BR, Feder ME (2003) Modification of heat- shock gene expression in Drosophila melanogaster populations via transposable elements. Molecular Biology and Evolution 20, 135-144. Leroy S, Duperray C, Morand S (2003) Flow cytometry for parasite nematode genome size measurement. Molecular and Biochemical Parasitology 128, 91-93. Levene H (1953) Genetic equilibrium when more than one ecological niche is available. American Naturalist 87, 331-333. Levine MRT (2003) Transcription regulation and animal diversity. Nature 424, 147-151.

176 References

Li XX, Liao WSL (1991) Expression of rat serum amyloid-A1 gene involves both C/EBP- like and Nfkb-like transcription factors. Journal of Biological Chemistry 266, 15192- 15201. Liao VH-C, Dong J, Freedman JH (2002) Molecular characterization of a novel, cadmium- inducible gene from the nematode Caenorhabditis elegans. A new gene that contributes to the resitance to cadmium toxicity. The Journal of Biological Chemistry 277, 42049-42059. Lichtlen P, Wang Y, Belser T, Georgiev O, Certa U, Sack R, Schaffner W (2001) Target gene search for the metal-responsive transcription factor MTF-1. Nucleic Acids Research 29, 1514 - 1523. Lock K, Janssen CR (2003) Effect of new soil metal immobilizing agents on metal toxicity to terrestrial invertebrates. Environmental Pollution 121, 123-127. Lock K, Janssens F, Janssen CR (2003) Effect of metal contamination on the activity and diversity of springtails in an ancient Pb-Zn mining area at Plombières, Belgium. European Journal of Soil Biology 39, 25-29. Loisel DA, Rockman MV, Wray GA, Altmann J, Alberts SC (2006) Ancient polymorphism and functional variation in the primate MHC-DQA1 5 ' cis-regulatory region. Proceedings of the National Academy of Sciences, USA 103, 16331-16336. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, Novak NG, Ingersoll R, Sheppard HW, Ray SC (1999) Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. Journal of Virology 73, 152-160. Lu Q, Wallrath LL, Granok H, Elgin SCR (1993) (CT)n (GA)n repeats and heat shock elements have distinct roles in chromatin structure and transcriptional activation of the Drosophila hsp26 gene. Molecular and Cellular Biology 13, 2802-2814. Lu SY, Gu HY, Yuan XJ, Wang XM, Wu AM, Qu LJ, Liu JY (2007) The GUS reporter-aided analysis of the promoter activities of a rice metallothionein gene reveals different regulatory regions responsible for tissue-specific and inducible expression in transgenic Arabidopsis. Transgenic Research 16, 177-191. Ludwig MZ, Bergman C, Patel NH, Kreitman M (2000) Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403, 564-567. Ludwig MZ (2002) Functional evolution of noncoding DNA. Current Opinion in Genetics & Development 12, 634-639. Ludwig MZ, Palsson A, Alekseeva E, Bergman CM, Nathan J, Kreitman M (2005) Functional evolution of a cis-regulatory module. PLOS Biology 3, 588-598. Luo Y, Amin J, Voellmy R (1991) Ecdysterone receptor is a sequence-specific transcription factor involved in the developmental regulation of heat-shock genes. Molecular and Cellular Biology 11, 3660-3675. Majumder S, Kutay H, Datta J, Summers D, Jacob ST, Ghoshal K (2006) Epigenetic regulation of metallothionein-1 gene expression: Differential regulation of methylated and unmethylated promoters by DNA methyltransferases and methyl CpG binding proteins. Journal of Cellular Biochemistry 97, 1300-1316.

177 References

Mallat J, Giribet G (2006) Further use of nearly complete, 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch. Molecular Phylogenetics and Evolution 40, 772-794. Mansfield JH, Wilhelm JE, Hazelrigg T (2002) Ypsilon Schachtel, a Drosophila Y-box protein, acts antagonistically to Orb in the oskar mRNA localization and translation pathway. Development 129, 197-209. Margoshes M, Vallee BL (1957) A cadmium protein from equine kidney cortex. Journal of the American Chemical Society 79, 4813-4814. Maroni G, Wise J, Young JE, Otto E (1987) Metallothionein gene duplications and metal tolerance in natural populations of Drosophila melanogaster. Genetics 117, 739-744. Maroni G, Ho AS, Laurent T (1995) Genetic control of cadmium tolerance in Drosophila melanogaster. Environmental Health Perspectives 103, 1116-1118. Martinez DE, Levinton J (1996) Adaptation to heavy metals in the aquatic oligochaete Limnodrilus hoffmeisteri: Evidence for control by one gene. Evolution 50, 1339-1343. Matsukage A, Hirose F, Hayashi Y, Hamada K, Yamaguchi M (1995) The DRE sequence TATCGATA, a putative promoter-activating element for Drosophila melanogaster cell-proliferation-related genes. Gene 166, 233-236. Matsumoto K, Wolffe AP (1998) Gene regulation by Y-box proteins: coupling control of transcription and translation. Trends in Cell Biology 8, 318-323. Matsuoka M, Igisu H, Nakagawa K, Katada T, Nishina H (2004) Requirement of MKK4 and MKK7 for CdCl2- or HgCl2-induced activation of c-Jun NH2-terminal kinase in mouse embryonic stem cells. Toxicology Letters 152, 175-181. Mattingly KS, Beaty BJ, Mackie RS, McGaw M, Carlson JO, Rayms-Keller A (2001) Molecular cloning and characterization of a metal responsive Chironomus tentans alpha-tubulin cDNA. Aquatic Toxicology 54, 249-260. Maur AAD, Belser T, Elgar G, Georgiev O, Schaffner W (1999) Characterization of the transcription factor MTF-1 from the Japanese pufferfish (Fugu rubripes) reveals evolutionary conservation of heavy metal stress response. Biological Chemistry 380, 175-185. Maydt J, Lengauer T (2006) Recco: recombination analysis using cost optimization. Bioinformatics 22, 1064-1071. McGinnes S, Madden T (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Research 32, W20-W25. Medina MH, Correa JA, Barata C (2007) Micro-evolution due to pollution: Possible consequences for ecosystem responses to toxic stress. Chemosphere 67, 2105-2114. Michalak P, Minkov I, Helin A, Lerman DN, Bettencourt BR, Feder ME, Korol AB, Nevo E (2001) Genetic evidence for adaptation-driven incipient speciation of Drosophila melanogaster along a microclimatic contrast in "Evolution Canyon," Israel. Proceedings of the National Academy of Sciences of the United States of America 98, 13195- 13200. Mickleburgh I, Chabanon H, Nury D, Fan K, Burtle B, Chrzanowska-Lightowlers Z, Hesketh J (2006) Elongation factor 1alpha binds to the region of the metallothionein-1 mRNA implicated in perinuclear localization--importance of an internal stem-loop. RNA 12, 1397-1407.

178 References

Miles AT, Hawksworth GM, Beattie JH, Rodilla V (2000) Induction, regulation, degradation, and biological significance of mammalian metallothioneins. Critical Reviews in Biochemistry and Molecular Biology 35, 35-70. Mizuno K, Hasemi T, Ubukata T, Yamada T, Lehmann E, Kohli J, Watanabe Y, Iino Y, Yamamoto M, Fox ME, Smith GR, Murofushi H, Shibata T, Ohta K (2001) Counteracting regulation of chromatin remodeling at a fission yeast cAMP responsive element-related recombination hotspot by stress-activated protein kinase, cAMP-dependent kinase and meiosis regulators. Genetics 159, 1467-1478. Moilanen LH, Fukushige T, Freedman JH (1999) Regulation of metallothionein gene transcription - Identification of upstream regulatory elements and transcription factors responsible for cell-specific expression of the metallothionein genes from Caenorhabditis elegans. Journal of Biological Chemistry 274, 29655-29665. Molloy PL (2000) Electrophoretic mobility shift assays. In: Methods in Molecular Biology (ed. Tymms MJ), pp. 235-246. Humana Press, Totowa, NJ, USA. Morgan AJ, Kille P, Sturzenbaum SR (2007) Microevolution and ecotoxicology of metals in invertebrates. Environmental Science & Technology 41, 1085-1096. Mulder KW, Winkler GS, Timmers HTM (2005) DNA damage and replication stress induced transcription of RNR genes is dependent on the Ccr4-Not complex. Nucleic Acids Research 33, 6384-6392. Mulder KW, Brenkman AB, Inagaki A, van den Broek NJF, Timmers HTM (2007a) Regulation of histone H3K4 tri-methylation and PAF complex recruitment by the Ccr4-Not complex. Nucleic Acids Research 35, 2428-2439. Mulder KW, Inagaki A, Cameroni E, Mousson F, Winkler GS, De Virgilio C, Collart MA, Timmers HTM (2007b) Modulation of Ubc4p/Ubc5p-mediated stress responses by the RING-finger-dependent ubiquitin-protein ligase Not4p in Saccharomyces cerevisiae. Genetics 176, 181-192. Muller PY, Janovjak H, Mizerez AR, Dobbie Z (2002) Processing of gene expression data generated by quantitative real-time RT-PCR. BioTechniques 32, 2-7. Myrick KV, Gelbart WM (2002) Universal fast walking for direct and versatile determination of flanking sequence. Gene 284, 125-131. Nachman MW, Hoekstra HE, D'Agostino SL (2003) The genetic basis of adaptive melanism in pocket mice. Proceedings of the National Academy of Sciences of the United States of America 100, 5268-5273. Nakagoshi H, Hoshi M, Nabeshima Y, Matsuzaki F (1998) A novel homeobox gene mediates the Dpp signal to establish functional specificity within target cells. Genes & Development 12, 2724-2734. Nakagoshi H, Shirai T, Nabeshima Y, Matsuzaki F (2002) Refinement of wingless expression by a Wingless- and Notch-responsive homeodomain protein, defective proventriculus. Developmental Biology 249, 44-56. Nardi F, Spinsanti G, Boore JL, Carapelli A, Dallai R, Frati F (2003) Hexapod origins: Monophyletic or paraphyletic? Science 299, 1887-1889. Nardon C, Weiss M, Vieira C, Biémont C (2003) Variation of the genome size estimate with environmental conditions in Drosophila melanogaster. Cytometry Part A 55A, 43-49.

179 References

Narum SR (2006) Beyond Bonferroni: Less conservative analyses for conservation genetics. Conservation Genetics 7, 783-787. Nawrot T, Plusquin M, Hogervorst J, Roels HA, Celis H, Thijs L, Vangronsveld J, Van Hecke E, Staessen JA (2006) Environmental exposure to cadmium and risk of cancer: a prospective population-based study. Lancet Oncology 7, 119-126. Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New York. Nemer M, Thornton RD, Stuebing EW, Harlow P (1991) Structure, spatial and temporal expression of 2 sea-urchin metallothionein genes, SpmtB1 and SpmtA. Journal of Biological Chemistry 266, 6586-6593. Nemer M, Stuebing EW, Bai G, Parker HR (1995) Spatial regulation of SpmtA metallothionein gene expression in sea-urchin embryos by a regulatory cassette in intron-1. Mechanisms of Development 50, 131-137. Neumann NF, Galvez F (2002) DNA microarrays and toxicogenomics: applications for ecotoxicology? Biotechnology Advances 20, 391-419. Nguyen T, Sherratt PJ, Pickett CB (2003) Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annual Review of Pharmacology and Toxicology 43, 233-260. Notten MJM, Oosthoek AJP, Rozema J, Aerts R (2006) Heavy metal pollution affects consumption and reproduction of the landsnail Cepaea nemoralis fed on naturally polluted Urtica dioica leaves. Ecotoxicology 15, 295-304. Olsson P-E, Kille P (1997) Functional comparison of the metal-regulated transcriptional regions of metallothionein genes from cadmium-sensitive and tolerant fish species. Biochimica et Biophysica Acta 1350, 325-334. Olsson PE, Kling P, Erkell LJ, Kille P (1995) Structural and functional analysis of the rainbow trout (Oncorhyncus mykiss) metallothionein-a gene. European Journal of Biochemistry 230, 344-349. Osada N, Kohn MH, Wu CI (2006) Genomic inferences of the cis-regulatory nucleotide polymorphisms underlying gene expression differences between Drosophila melanogaster mating races. Molecular Biology and Evolution 23, 1585-1591. Otto E, Young JE, Maroni G (1986) Structure and expression of a tandem duplication in the Drosophila metallothionein gene. Proceedings of the National Academy of Sciences of the United States of America 83, 6025-6029. Otto E, Allen JM, Young JE, Palmiter RD, Maroni G (1987) A DNA segment controlling metal-regulated expression of the Drosophila melanogaster metallothionein gene Mtn. Molecular and Cellular Biology 7, 1710-1715. Pal C, Miklos I (1999) Epigenetic inheritance, genetic assimilation and speciation. Journal of Theoretical Biology 200, 19-37. Palmiter RD (1994) Regulation of metallothionein genes by heavy-metals appears to be mediated by a zinc-sensitive inhibitor that interacts with a constitutively active transcription factor, Mtf-1. Proceedings of the National Academy of Sciences of the United States of America 91, 1219-1223. Pap EHW, Drummen GPC, Winter VJ, Kooij TWA, Rijken P, Wirtz KWA, Op den Kamp JAF, Hage WJ, Post JA (1999) Ratio-fluorescence microscopy of lipid oxidation in living cells using C11-BODIPY581/591. FEBS Letters 453, 278-282.

180 References

Parkinson A, Anthony A, Wasmuth J, Schmid R, Hedley A, Blaxter M (2004) PartiGene— constructing partial genomes. Bioinformatics 20, 1398-1404. Pawert M, Triebskorn R, Graff S, Berkus M, Schulz J, Kohler HR (1996) Cellular alterations in collembolan midgut cells as a marker of heavy metal exposure: Ultrastructure and intracellular metal distribution. Science of the Total Environment 181, 187-200. Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6, 288-295. Pigliucci M, Murren CJ, Schlichting CD (2006) Phenotypic plasticity and evolution by genetic assimilation. Journal of Experimental Biology 209, 2362-2367. Piola RF, Johnston EL (2006) Differential tolerance to metals among populations of the introduced bryozoan Bugula neritina. Marine Biology 148, 997-1010. Poels J, Martinez A, Suner MM, De Loof A, Dunbar SJ, Vanden Broeck J (2004) Functional and comparative analysis of two distinct ecdysteroid-responsive gene expression constructs in Drosophila S2 cells. Insect Biochemistry and Molecular Biology 34, 451-458. Posthuma L (1990) Genetic differentiation between populations of Orchesella cincta (Collembola) from heavy-metal contaminated sites. Journal of Applied Ecology 27, 609-622. Posthuma L, Hogervorst RF, van Straalen NM (1992) Adaptation to soil pollution by cadmium excretion in natural populations of Orchesella cincta (L.) (Collembola). Arch. Environ. Contam. Toxicol. 22, 146-156. Posthuma L, Hogervorst RF, Joosse ENG, Van Straalen NM (1993) Genetic variation and covariation for characteristics associated with cadmium tolerance in natural populations of the springtail Orchesella cincta (L.). Evolution 47, 619-631. Posthuma L, van Straalen NM (1993) Heavy metal adaptation in terrestrial invertebrates: a review of occurence, genetics, physiology and ecological consequences. Comparative Biochemistry and Physiology 106C, 11-38. Postma J, van Nugteren P, Buckert-de Jong M (1996) Increased cadmium excretion in metal-adapted populations of the midge Chironomus riparius (Diptera). Environmental Toxicology and Chemistry 15, 332-339. Poynton HC, Varshavsky JR, Chang B, Holman PS, Loguinov AV, Bauer DJ, Komachi K, Theil EC, Perkins EJ, Hughes O, Vulpe CD (2007) Daphnia magna ecotoxicogenomics provides mechanistic insights into metal toxicity. Environmental Science & Technology 41, 1044-1050. Pradet-Balade B, Boulme F, Beug H, Mullner EW, Garcia-Sanz JA (2001) Translation control: bridging the gap between genomics and proteomics? Trends in Biochemical Sciences 26, 225-229. Purugganan MD (2000) The molecular population genetics of regulatory genes. Molecular Ecology 9, 1451-1461. Radtke F, Heuchel R, Georgiev O, Hergersberg M, Gariglio M, Dembic Z, Schaffner W (1993) Cloned transcription factor MTF-1 activates the mouse metallothionein promoter. Embo Journal 12, 1355-1362. Rantalainen ML, Torkkeli M, Strommer R, Setala H (2006) Lead contamination of an old shooting range affecting the local ecosystem - A case study with a holistic approach. Science of the Total Environment 369, 99-108.

181 References

Raymond M, Rousset F (1995) Genepop (Version-1.2) - Population-genetics software for exact tests and ecumenicism. Journal of Heredity 86, 248-249. Rayms-Keller A, McGaw M, Oray C, Carlson JO, Beaty BJ (2000) Molecular cloning and characterization of a metal responsive Aedes aegypti intestinal mucin cDNA. Insect Molecular Biology 9, 419-426. Rebeiz MJWP (2004) GenePalette: a universal software tool for genome sequence visualization and analysis. Developmental Biology 271, 431-438. Reiling JH, Sabatini DM (2006) Stress and mTORture signaling. Oncogene 25, 6373-6383. Remondelli P, Leone A (1997) Interactions of the zinc-regulated factor (ZiRF1) with the mouse metallothionein la promoter. Biochemical Journal 323, 79-85. Ren HW, Xu MX, He PF, Muto N, Itoh N, Tanaka K, Xing J, Chu MM (2006) Cloning of crucian carp (Carassius cuvieri) metallothionein-II gene and characterization of its gene promoter region. Biochemical and Biophysical Research Communications 342, 1297- 1304. Riggs AD, Singer-Sam J, Pfeifer GD (1998) In vivo footprint and chromatin analysis by LMPCR. In: Chromatin. A practical approach. (ed. Gould H), pp. 79-109. Oxford University Press, Oxford. Rockman MV, Hahn MW, Soranzo N, Zimprich F, Goldstein DB, Wray GA (2005) Ancient and recent positive selection transformed opioid cis-regulation in humans. PLOS Biology 3, 2208-2219. Roelofs D, Overhein L, de Boer ME, Janssens TKS, van Straalen NM (2006) Additive genetic variation of transcriptional regulation: metallothionein expression in the soil insect Orchesella cincta. Heredity 96, 85-92. Roelofs D, Mariën J, van Straalen NM (2007) Differential gene expression profiles associated with heavy metal tolerance in the soil insect Orchesella cincta. Insect Biochemistry and Molecular Biology 37, 287-295. Roelofs D, Aarts M, Schat H, van Straalen N (2008) Functional ecological genomics to demonstrate general and specific responses to abiotic stress. Functional Ecology 22, 8- 18. Roesijadi G (1992) Metallothioneins in metal regulation and toxicity in aquatic animals. Aquatic Toxicology 22, 81-114. Ross J (1996) Control of messenger RNA stability in higher eukaryotes. Trends in Genetics 12, 171-175. Rousset F, Raymond M (1995) Testing heterozygote excess and deficiency. Genetics 140, 1413-1419. Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R (2003) DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, 2496-2497. Ruttens A, Mench M, Colpaert JV, Boisson J, Carleer R, Vangronsveld J (2006) Phytostabilization of a metal contaminated sandy soil. I: Influence of compost and/or inorganic metal immobilizing soil amendments on phytotoxicity and plant availability of metals. Environmental Pollution 144, 524-532. Sabourault C, Guzov VM, Koener JF, Claudianos C, Plapp FW, Feyereisen R (2001) Overproduction of a P450 that metabolizes diazinon is linked to a loss-of-function

182 References

in the chromosome 2 ali-esterase (Md alpha E7) gene in resistant houseflies. Insect Molecular Biology 10, 609-618. Saeed A, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, Sturn A, Snuffin M, Rezantsev A, Popov D, Ryltsov A, Kostukovich E, Borisovsky I, Liu Z, Vinsavich A, Trush V, Quackenbush J (2003) TM4: A free, open-source system for microarray data management and analysis. BioTechniques 34, 374-378. Salice CJ, Roesijadi G (2002) Resistance to cadmium and parasite infection are inversely related in two strains of a freshwater gastropod. Environmental Toxicology and Chemistry 21, 1398-1403. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Press., Cold Spring Harbor. Samson SLA, Gedamu L (1995) Metal-responsive elements of the rainbow trout metallothionein-B gene-function for basal and metal-induced activity. Journal of Biological Chemistry 270, 6864-6871. Samson SLA, Gedamu L (1998) Molecular analyses of metallothionein gene regulation. Progress in Nucleic Acid Research 59, 257 - 288. Samson SLA, Paramchuk WJ, Gedamu L (2001) The rainbow trout metallothionein-B gene promoter: contributions of distal promoter elements to metal and oxidant regulation. Biochimica et Biophysica Acta 1517, 202-211. Saydam N, Georgiev O, Nakano M, Greber U, Schaffner W (2001) Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. Journal of Biological Chemistry 276, 25487-25495. Saydam N, Adams TK, Steiner F, Schaffner W, Freedman JH (2002) Regulation of metallothionein transcription by the metal-responsive transcription factor MTF-1. The Journal of Biological Chemistry 227, 20438-20445. Schlichting CD, Smith H (2002) Phenotypic plasticity: linking molecular mechanisms with evolutionary outcomes. Evolutionary Ecology 16, 189-211. Schmalhausen II (1947) Factors of evolution. The theory of stabilizing selection. The Blakiston, Philadelphia. Schmid R, Blaxter M (2008) annot8r: GO, EC and KEGG annotation of EST datasets. BMC Bioinformatics 9, 180. Schmidt PS, Bertness MD, Rand DM (2000) Environmental heterogeneity and balancing selection in the acorn barnacle Semibalanus balanoides. Proceedings of the Royal Society of London, Series B: Biological Sciences 267, 379-384. Schmitt-Wrede HP, Koewius H, Tschuschke S, Greven H, Wunderlich F (2004) Genomic organization of the cadmium-inducible tandem repeat 25-kDa metallothionein of the oligochaete worm Enchytraeus buchholzi. Biochimica Et Biophysica Acta-Gene Structure and Expression 1680, 24-33. Schulte PM, Gómez-Chiarri M, Powers DA (1997) Structural and functional differences in the promoter and 5' flanking region of Ldh-B within and between populations of the teleost Fundulus heteroclitus. Genetics 145, 759-769. Schulte PM, Glemet HC, Fiebig AA, Powers DA (2000) Adaptive variation in lactate dehydrogenase-B gene expression: Role of a stress-responsive regulatory element.

183 References

Proceedings of the National Academy of Sciences of the United States of America 97, 6597- 6602. Schulte PM (2001) Environmental adaptations as windows on molecular evolution. Comparative Biochemistry and Physiology B: Biochemistry and Molecular Biology 128, 597-611. Scudiero R, Carginale V, Capasso C, Riggio M, Filosa S, Parisi E (2001) Structural and functional analysis of metal regulatory elements in the promoter region of genes encoding metallothionein isoforms in the Antarctic fish Chionodraco hamatus (icefish). Gene 274, 199-208. Shapiro M, Bell M, Kingsley D (2006) Parallel genetic origins of pelvic reduction in vertebrates. Proceedings of the National Academy of Sciences of the United States of America 103, 13753-13758. Shaw JR, Colbourne JK, Davey JC, Glaholt JP, Hampton TH, Chen CY, Folt CL, Hamilton JW (2007) Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins. BMC Genomics 8, 477. Shopland LS, Hirayoshi K, Fernandes M, Lis JT (1995) Hsf access to heat-shock elements in vivo depends critically on promoter architecture defined by GAGA factor, TfIId and RNA-polymerase-II binding-sites. Genes & Development 9, 2756-2769. Sikorski EM, Uo T, Morrison RS, Agarwal A (2006) Pescadillo interacts with the cadmium response element of the human heme oxygenase-1 promoter in renal epithelial cells. Journal of Biological Chemistry 281, 24423-24430. Smale ST, Kadonaga JT (2003) The RNA polymerase II core promoter. Annual Review of Biochemistry 72, 449-479. Smirnova IV, Bittel DC, Ravindra R, Jiang HM, Andrews GK (2000) Zinc and cadmium can promote rapid nuclear translocation of metal response element-binding transcription factor-1. Journal of Biological Chemistry 275, 9377-9384. Smolik SM, Rose RE, Goodman RH (1992) A cyclic AMP-responsive element-binding transcriptional activator in Drosophila melanogaster, dCREB-a, is a member of the leucine zipper family. Molecular and Cellular Biology 12, 4123-4131. Spurgeon DJ, Hopkin SP (2000) The development of gentically inherited resistance to zinc in laboratory-selected generations of the earthworm Eisenia fetida. Environmetal Pollution 109, 193-201. Steiner CC, Weber JN, Hoekstra HE (2007) Adaptive variation in beach mice produced by two interacting pigmentation genes. PLOS Biology 5, 1880-1889. Sterenborg I, Roelofs D (2003) Field-selected cadmium tolerance in the springtail Orchesella cincta is correlated with increased metallothionein mRNA expression. Insect Biochemistry and Molecular Biology 33, 741-747. Sterenborg I (2003a) Molecular physiology of metal tolerance in Orchesella cincta: the role of metallothionein PhD-thesis, Vrije Universiteit Amsterdam. Sterenborg I, Vork NA, Verkade SK, Van Gestel CAM, Van Straalen NM (2003b) Dietary zinc reduces uptake but not metallothionein binding and elimination of cadmium in the springtail, Orchesella cincta. Environmental Toxicology and Chemistry 22, 1167- 1171.

184 References

Stohs SJ, Bagchi D, Hassoun E, Bagchi M (2000) Oxidative mechanisms in the toxicity of chromium and cadmium ions. Journal of Environmental Pathology, Toxicology and Oncology 19, 201-213. Stokes TL, Kunkel BN, Richards EJ (2002) Epigenetic variation in Arabidopsis disease resistance. Genes & Development 16, 171-182. Stone JR, Wray GA (2001) Rapid evolution of cis-regulatory sequences via local point mutations. Molecular Biology and Evolution 18, 1764-1770. Stürzenbaum SR, Kille P, Morgan AJ (1998) The identification, cloning and characterization of earthworm metallothionein. FEBS Letters 431, 437-442. Stürzenbaum SR, Winters C, Galay M, Morgan AJ, Kille P (2001) Metal ion trafficking in earthworms. The Journal of Biological Chemistry 276, 34013-34018. Stürzenbaum SR, Georgiev O, Morgan AJ, Kille P (2004) Cadmium detoxification in earthworms: From genes to cells. Environmental Science & Technology 38, 6283-6289. Suntres ZE (2002) Role of antioxidants in paraquat toxicity. Toxicology 180, 65-77. Swain SC, Keusekotten K, Baumeister R, Sturzenbaum SR (2004) C. elegans metallothioneins: New insights into the phenotypic effects of cadmium toxicosis. Journal of Molecular Biology 341, 951-959. Tafuri SR, Wolffe AP (1990) Xenopus Y-box transcription factors; Molecular cloning, functional analysis, and developmental regulation. Proceedings of the National Academy of Sciences of the United States of America 87, 9028-9032. Tan Z, Shon AM, Ober C (2005) Evidence of balancing selection at the HLA-G promoter region. Human Molecular Genetics 14, 3619-3628. Tanguay RL, Gallie DR (1996) Translational efficiency is regulated by the length of the 3' untranslated region. Molecular and Cellular Biology 16. Tanguy A, Moraga D (2001) Cloning and characterization of a gene coding for a novel metallothionein in the Pacific oyster Crassostrea gigas (CgMT2): a case of adaptive response to metal-induced stress? Gene 273, 123-130. Tanguy A, Boutet I, Bonhomme F, Boudry P, Moraga D (2002) Polymorphism of metallothionein genes in the Pacific oyster Crassostrea gigas as a biomarker of response to metal exposure. Biomarkers 7, 439-450. Teleman AA, Chen Y-W, Cohen SM (2005a) Drosophila melted modulates FOXO and TOR activity. Developmental Cell 9, 271-281. Teleman AA, Chen YW, Cohen SM (2005b) 4E-BP functions as a metabolic brake used under stress conditions but not during normal growth. Genes & Development 19, 1844-1848. ter Braak CJF, Šmilauer P (2002) CANOCO Reference manual and CanoDraw for Windows User's guide: Software for Canonical Community Ordination (version 4.5). Microcomputer Power, Ithaca, NY, USA. Theodorakis CW, Lee KL, Adams SM, Law CB (2006) Evidence of altered gene flow, mutation rate, and genetic diversity in redbreast sunfish from a pulp-mill- contaminated river. Environmental Science & Technology 40, 377-386. Timme-Laragy AR, Meyer JN, Waterland RA, Di Giulio RT (2005) Analysis of CpG methylation in the killifish CYP1A promoter. Comparative Biochemistry and Physiology C-Toxicology & Pharmacology 141, 406-411.

185 References

Timmermans MJTN, Ellers J, Roelofs D, van Straalen NM (2005a) Metallothionein mRNA expression and cadmium tolerance in metal-stressed and reference populations of the springtail Orchesella cincta. Ecotoxicology 14, 727-739. Timmermans MJTN, Ellers J, Mariën J, Verhoef SC, Ferwerda EB, Van Straalen NM (2005b) Genetic structure in Orchesella cincta (Collembola): strong subdivision of European populations inferred from mtDNA and AFLP markers. Molecular Ecology 14, 2017- 2024. Timmermans MJTN (2005c) On the "genetic erosion" hypothesis: Genetic variation in metal- stressed springtail populations PhD-thesis, Vrije Universiteit Amsterdam. Timmermans MJTN, Ellers J, Van Straalen NM (2007a) Allelic diversity of metallothionein in Orchesella cincta (L.): traces of natural selection by environmental pollution. Heredity 98, 311-319. Timmermans MJTN, de Boer M, Nota B, de Boer T, Mariën J, Klein-Lankhorst R, van Straalen NM, Roelofs D (2007b) Collembase: a repository for springtail genomics and soil quality assessment. BMC Genomics 8, 341. Timmermans MJTN, Roelofs D, Mariën J, Van Straalen NM (2008) Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers. BMC Evolutionary Biology 8, 83. Tranvik L, Bengtsson G, Rundgren S (1993) Relative abundance and resistance traits of 2 Collembola species under metal stress. Journal of Applied Ecology 30, 43-52. Valadao AF, Fantappie MR, LoVerde PT, Pena SDJ, Rumjanek FD, Franco GR (2002) Y-box binding protein from Schistosoma mansoni: interaction with DNA and RNA. Molecular and Biochemical Parasitology 125, 47-57. Valls M, Bofill R, Romero-Isart N, Gonzalez-Duarte R, Abian J, Carrascal M, Gonzalez- Duarte P, Capdevila M, Atrian S (2000) Drosophila MTN: a metazoan copper- thionein related to fungal forms. Febs Letters 467, 189-194. Valls M, Bofill R, Gonzalez-Duarte R, Gonzalez-Duarte P, Capdevila M, Atrian S (2001) A new insight into metallothionein (MT) classification and evolution - The in vivo and in vitro metal binding features of Homarus americanus recombinant MT. Journal of Biological Chemistry 276, 32835-32843. Van Campenhout K, Bervoets L, Blust R (2003) Metallothionein concentrations in natural populations of gudgeon (Gobio gobio): relationship with metal concentrations in tissues and environment. Environmental Toxicology and Chemistry 22, 1548-1555. van der Wurff AWG, Isaaks J, Ernsting G, van Straalen N (2003) Population substructures in the soil invertebrate Orchesella cincta, as revealed by microsatellite and TE-AFLP markers. Molecular Ecology 12, 1349-1359. van der Wurff AWG, Chan YL, van Straalen NM, Schouten J (2000) TE-AFLP: combining rapidity and robustness in DNA fingerprinting. Nucleic Acids Research 28, e105. van der Wurff AWG, Gols R, Ernsting G, van Straalen NM (2001) Microsatellite loci in the soil-dwelling collembolan, Orchesella cincta. Molecular Ecology Notes 1, 182-184.

186 References van der Wurff AWG, Gols R, Ernsting G, van Straalen NM (2005) Population genetic structure of Orchesella cincta (Collembola; Hexapoda) in NW Europe, as revealed by microsatellite markers. Pedobiologia 49, 167-174. van Hoof NALM, Hassinen VH, Hakvoort HWJ, Ballintijn KF, Schat H, Verkleij JAC, Ernst WHO, Karenlampi SO, Tervahauta AI (2001) Enhanced copper tolerance in Silene vulgaris (Moench) Garcke populations from copper mines is associated with increased transcript levels of a 2b-type metallothionein gene. Plant Physiology 126, 1519-1526. van Straalen NM, Burghouts TBA, Doornhof MJ, Groot GM, Janssen MPM, Joosse ENG, Van Meerendonk JH, Theeuwen JPJJ, Verhoef HA, Zoomer HR (1987) Efficiency of lead and cadmium excretion in populations of Orchesella cincta (Collembola) from various contaminated forest soils. Journal of Applied Ecology 24, 953-968. van Straalen NM (1989) Production and biomass turnover in two populations of forest floor Collembola. Netherlands Journal of Zoology 39, 156-168. van Straalen NM, Schobben JHM, Degoede RGM (1989) Population consequences of cadmium toxicity in soil microarthropods. Ecotoxicology and Environmental Safety 17, 190-204. van Straalen NM (2002) Assessment of soil contamination - a functional perspective. Biodegradation 13, 41-52. van Straalen NM, Roelofs D (2005) Cadmium tolerance in a soil arthropod - a model of real-time microevolution. Entomologische Berichten 65, 105-111. van Straalen NM, Roelofs D (2006) An Introduction to Ecological Genomics Oxford University Press, Oxford, UK. Vandecasteele B, Samyn J, Quataert P, Muys B, Tack FMG (2004) Earthworm biomass as additional information for risk assessment of heavy metal biomagnification: a case study for dredged sediment-derived soils and polluted floodplain soils. Environmental Pollution 129, 363-375. Vandecasteele B, De Vos B, Muys B, Tack FMG (2005a) Rates of forest floor decomposition and soil forming processes as indicators of forest ecosystem functioning on a polluted dredged sediment landfill. Soil Biology and Biochemistry 37, 761-769. Vandecasteele B, Du Laing G, Quataert P, Tack FMG (2005b) Differences in Cd and Zn bioaccumulation for the flood-tolerant Salix cinerea rooting in seasonally flooded contaminated sediments. Science of the Total Environment 341, 251-263. Vatamaniuk OK, Bucher EA, Ward JT, Rea PA (2002) Worms take the 'phyto' out of "phytochelatins". Trends in Biotechnology 20, 61-64. Vatamaniuk OK, Bucher EA, Sundaram MV, Rea PA (2005) CeHMT-1, a putative phytochelatin transporter, is required for cadmium tolerance in Caenorhabditis elegans. Journal of Biological Chemistry 280, 23684-23690. Viarengo A, Burlando B, Ceratto N, Panfoli I (2000) Antioxidant role of metallothioneins: A comparative overview. Cellular and Molecular Biology 46, 407-417. Vidal DE, Horne AJ (2003) Inheritance of mercury tolerance in the aquatic oligochaete Tubifex tubifex. Environmental Toxicology and Chemistry 22, 2130-2135. Waddington CH (1953) Genetic assimilation of an acquired character. Evolution 7, 118-126.

187 References

Walhout AJM (2006) Unraveling transcription regulatory networks by protein-DNA and protein-protein interaction mapping. Genome Research 16, 1445-1454. Wallrath LL, Swede MJ, Elgin SC (1998) Mapping chromatin structure in Drosophila. In: Chromatin. A practical approach. (ed. Gould H), pp. 59-77. Oxford University Press, Oxford. Walser JC, Chen B, Feder ME (2006) Heat-shock promoters: Targets for evolution by P transposable elements in Drosophila. PLOS Genetics 2, 1541-1555. Wang Y, Lorenzi I, Georgiev O, Schaffner W (2004) Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological Chemistry 385, 623-632. Wang Y, Krishnan HR, Ghezzi A, Yin JCP, Atkinson NS (2007) Drug-induced epigenetic changes produce drug tolerance. PLOS Biology 5, e265. Warren AJ (2002) Eukaryotic transcription factors. Current Opinion in Structural Biology 12, 107-114. Weinig C, Dorn LA, Kane NC, German ZM, Hahdorsdottir SS, Ungerer MC, Toyonaga Y, Mackay TFC, Purugganan MD, Schmitt J (2003) Heterogeneous selection at specific loci in natural environments in Arabidopsis thaliana. Genetics 165, 321-329. Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population- structure. Evolution 38, 1358-1370. Wettenhall J, Smyth G (2004) limmaGUI: A graphical user interface for linear modeling of microarray data. Bioinformatics 20, 3705-3706. Whalley P, Jarzembowski EA (1981) A new assessment of Rhyniella, the earliest known insect, from the Devonian of Rhynie, Scotland. Nature 291, 317-317. Whitehead A, Crawford DL (2006a) Neutral and adaptive variation in gene expression. Proceedings of the National Academy of Sciences of the United States of America 103, 5425- 5430. Whitehead A, Crawford DL (2006b) Variation within and among species in gene expression: raw material for evolution. Molecular Ecology 15, 1197-1211. Widianarko B, Verweij RA, Van Gestel CAM, Van Straalen NM (2000) Spatial distribution of trace metals in sediments from urban streams of Semarang, Central Java, Indonesia. Ecotoxicology and Environmental Safety 46, 95-100. Wilson JN, Rockett K, Keating B, Jallow M, Pinder M, Sisay-Joof F, Newport M, Kwiatkowski D (2006) A hallmark of balancing selection is present at the promoter region of interleukin 10. Genes and Immunity 7, 680-683. Wimmer U, Wang Y, Georgiev O, Schaffner W (2005) Two major branches of anti- cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic Acids Research 33, 5715-5727. Winkler GS, Mulder KW, Bardwell VJ, Kalkhoven E, Timmers HM (2006) Human Ccr4- Not complex is a ligand-dependent repressor of nuclear receptor-mediated transcription. Embo Journal 25, 3089-3099. Wirsching S, Michel S, Kohler G, Morschhauser J (2000) Activation of the multiple drug resistance gene MDR1 in fluconazole-resistant, clinical Candida albicans strains is caused by mutations in a trans-regulatory factor. Journal of Bacteriology 182, 400-404.

188 References

Wittkopp PJ, Haerum BK, Clark AG (2004) Evolutionary changes in cis and trans gene regulation. Nature 430, 85-88. Wittkopp PJ (2005) Genomic sources of regulatory variation in cis and in trans. Cellular and Molecular Life Sciences 62, 1779-1783. Wittkopp PJ (2007) Variable gene expression in eukaryotes: a network perspective. Journal of Experimental Biology 210, 1567-1575. Wittkopp PJ, Haerum BK, Clark AG (2008) Regulatory changes underlying expression differences within and between Drosophila species. Nature Genetics 40, 346-350. Wray GA, Hahn MW, Abouheif E, Balhoff JP, Pizer M, Rockman MV, Romano LA (2003) The evolution of transcriptional regulation in eukaryotes. Molecular Biology and Evolution 20, 1377-1419. Wray GA (2007) The evolutionary significance of cis-regulatory mutations. Nature Reviews Genetics 8, 206-216. Wu H, Churchill G (2006) R/MAANOVA: an extensive R invironment for the analysis of microarray experiments. The Jackson Laboratory, Bar Harbor, ME, USA. Wu MT, Demple B, Bennett RAO, Christiani DC, Fan R, Hu H (2000) Individual variability in the zinc inducibility of metallothionein-IIA mRNA in human lymphocytes. Journal of Toxicology and Environmental Health-Part A 61, 553 - 567. Wymann MP, Pirola L (1998) Structure and function of phosphoinositide 3-kinases. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids 1436, 127-150. Yin H, Smith M, Glass J (2005) Stable expression of C/EBP alpha in prostate cancer cells down-regulates metallothionein and increases zinc-induced toxicity. Prostate 62, 209-216. Yuasa N, Nakagawa Y, Hayakawa M, Iimura Y (2005) Two alleles of the sulfite resistance genes are differentially regulated in Saccharomyces cerevisiae. Bioscience Biotechnology and Biochemistry 69, 1584-1588. Zeng J, Heuchel R, Schaffner W, Kägi JHR (1991a) Thionein (apometallothionein) can modulate DNA binding and transcription activation by zinc finger containing factor Sp1. FEBS Letters 279, 310-312. Zeng J, Vallee BL, Kagi JHR (1991b) Zinc transfer from transcription factor-IIIa fingers to thionein clusters. Proceedings of the National Academy of Sciences of the United States of America 88, 9984-9988. Zhang B, Egli D, Georgiev O, Schaffner W (2001) The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals. Molecular and Cellular Biology 21, 4505-4514. Zhang B, Georgiev O, Hagmann M, Gunes C, Cramer M, Faller P, Vasak M, Schaffner W (2003) Activity of metal-responsive transcription factor 1 by toxic heavy metals and H2O2 in vitro is modulated by metallothionein. Molecular and Cellular Biology 23, 8471-8485. Zhou S, Tejada M, Wyatt GR, Walker VK (2006) A DNA-binding protein, tfp1, involved in juvenile hormone-regulated gene expression in Locusta migratoria. Insect Biochemistry and Molecular Biology 36, 726-734

189 References

190

De rol van transcriptionele regulatie in de micro-evolutie van zware metaaltolerantie in Orchesella cincta (Collembola)

SAMENVATTING

Organismen kunnen de fysiologische status van hun lichaam aanpassen door de expressie van specifieke groepen van genen af te stemmen op de omstandigheden in de leefomgeving of bepaalde fases in hun ontwikkeling of levenscyclus. Dit gebeurt o.a. op het mRNA (boodschapper RNA) niveau. Dit proces heet transcriptie en de regulatie hiervan vindt plaats in een stroomopwaarts gelegen, niet-coderend gebied van het gen: de promoter. Door antropogene factoren, zoals milieuverontreinigingen, kunnen wijzigingen ontstaan in de genetische samenstelling van de onderhevige populaties waardoor deze een gemiddeld afwijkend expressiepatroon vertonen t.a.v. populaties uit referentiegebieden. Deze verschillen kunnen versterkt worden door natuurlijke selectie als de tolerante genotypen een evolutionair voordeel hebben: dit wil zeggen een verhoogde vertegenwoordiging in het nageslacht onder de heersende condities.

De hoofddoelstelling van dit proefschrift was het ophelderen van potentiële mechanismen waarmee natuurlijk selectie, veroorzaakt door antropogene factoren, ingrijpt op de transcriptionele regulatie. Hiervoor werd er gebruik gemaakt van de casus van de zware metaaltolerantie in de springstaart O. cincta.

In voorafgaand onderzoek werd evidentie gevonden voor metaaltolerantie, vooral ten aanzien van lood en cadmium, bij populaties uit historisch verontreinigde gebieden. Deze tolerantie manifesteert zich als verhoogde uitscheiding van cadmium en lood uit het lichaam, welke vergezeld gaat van verhoogde basale en cadmium geïnduceerde mRNA niveaus van het cadmiumbindende eiwit metallothioneïne. Door deze casus is het proefschrift voornamelijk toegespitst op de analyse van variatie in de metallothioneïne promoter en de functionele consequenties hiervan. Bovengenoemde

191 Samenvatting doelstelling valt dus uit mekaar in verschillende vraagstellingen die in de aparte hoofdstukken aan bod komen.

• Is er sequentievariatie in de promoter van het metallothioneïne? Hoofdstuk 2 • Heeft deze variatie functionele betekenis? Hoofdstuk 2 • Hoe gedraagt deze variatie in de promoter zich in veldpopulaties? Hoofdstuk 3 • Zijn deze functionele verschillen vergelijkbaar in de genetische achtergrond van verschillende populaties? Hoofdstuk 4 • Welke potentiële transcriptiefactoren binden op de metallothioneïne promoter? Hoofdstuk 5 • Zijn er nog andere genen in het genoom van Orchesella cincta die een populatiespecifiek expressiepatroon vertonen? Hoofdstuk 6

In Hoofdstuk 2 van dit proefschrift werden de meest voorkomende polymorfismen in de promoter van het metallothioneïne (pmt) van O. cincta uit West Europese populaties beschreven. Negen verschillende allelen, verschijningsvormen van een gen, werden in de 1600tal basenparen tellende promoter teruggevonden. Deze bleken bovendien veel punten van recombinatieprocessen te vertonen. Eveneens werden er een aantal vermoedelijke bindingsplaatsen voor transcriptiefactoren teruggevonden. Transcriptiefactoren zijn signaaleiwitten die de transcriptie van een gen beïnvloeden. Ze binden op korte DNA elementen (8-12 bp) in de promoter, waar zij de efficiëntie van de transcriptie in positieve of negatieve zin bepalen. De meest karakteristieke elementen, gekend uit metallothioneïne promoters van de meest uiteenlopende taxa, die werden teruggevonden in het pmt locus zijn de MRE (metaal responsief element), de ARE (anti-oxidant responsief element). Maar ook de HERE (20-hydroxyecdysone responsief element) werd teruggevonden. Deze staan bekend vanwege de transciptionele regulatie door respectievelijk zware metalen, oxidatieve stress en het vervellingshormoon. De aanwezigheid van deze transcriptiefactorbindingsplaatsen deed vermoeden dat de transcriptie van het O. cincta metallothioneïne gen op de aanwezigheid van deze stimuli reageert. De mutatiespectra van het pmt locus in zowel een populatie uit een referentie gebied als een historische lood- en zinkmijn werden met elkaar vergeleken. Uit deze analyse

192 Samenvatting bleek dat de diversiteit, gemeten als een overmaat aan intermediair voorkomende DNA polymorfismen, hoger was in de geadapteerde populatie en dat deze een patroon vertoonde dat afweek van neutrale evolutie. Dit duidt dus op een signatuur van natuurlijke selectie, in dit geval balancerende selectie. Deze selectievorm wordt gekenmerkt door een hoge mate van genetische diversiteit, ook op het niveau van de DNA sequenties, en dus ook het voorkomen voor bindingsplaatsen voor transcriptiefactoren. Balancerende selectie kan optreden bij een evolutionair voordeel voor de heterozygoten (overdominantie) door de heterogeniteit van het milieu, waarbij verschillende genotypes een verschillende voordeel hebben in verschillende micro- habitats. De functionele verschillen tussen deze pmt allelen werden uitgetest met een luciferase reporter assay in een cellijn van de fruitvlieg Drosophila melanogaster. Daarvoor werden van zes veel voorkomende allelen luciferase reporter constructen gemaakt. Dit zijn artificiële stukjes DNA waarin de promoter van interesse voor het luciferase gen van de vuurvlieg is gecloneerd. Het eiwit waarvoor dit gen codeert zorgt voor lichtproductie in aanwezigheid van luciferine en ATP en maakt een kwantitatieve meting van de promoteractiviteit mogelijk. Op deze manier werd de activiteit van zes promoter allelen vergeleken na het blootstellen van de transiënt getransformeerde cellijn aan cadmium en paraquat (een veroorzaker van oxidatieve stress). Omwille van het verband tussen de vervellingscyclus en de excretie van zware metalen in O. cincta werd ook het effect van het vervellingshormoon 20-hydroxyecdyson op de transcriptie vanaf de metallothioneïne promoter gemeten. De inductie door cadmium van deze promoter was het meest uitgesproken. Bovendien werden er erg uiteenlopende maximale promoter activiteiten gemeten. Paraquat induceerde vijf van de zes promoter allelen met een factor twee, ten opzichte van de basale activiteit. Een allel, pmtC, was niet induceerbaar door oxidatieve stress. Bovendien vertoonde dit allel een erg lage basale en cadmium geïnduceerde lichtproductie. De hoogste cadmium geïnduceerde lichtproductie werd waargenomen bij het pmtD2 allel (een factor 20 hoger dan het minst cadmium-induceerbare allel pmtC). Het vervellingshormoon had een licht inhiberende werking op de activiteit van de metallothioneïne promoter van O. cincta. Op grond van de data uit Hoofdstuk 2 was er aanleiding te denken dat er sprake is van natuurlijke selectie op het pmt locus van O. cincta. Door middel van een veldstudie

193 Samenvatting (Hoofdstuk 3) werd het verband tussen de negen allelen en de gehaltes aan zware metalen in bodem en strooisel gelegd. In 23 gebieden in Nederland, België, Frankrijk en Duitsland, van uiteenlopende graad van metaalvervuiling, werden de bodem en het strooisel bemonsterd en doorgemeten op zware metalen. Eveneens werden er ter plaatse O. cincta gevangen. Deze werden door een RFLP (restriction fragment length polymorphism) gegenotypeerd, zodat beide pmt allelen uit het genoom bepaald werden. Deze methode is een allelspecifieke enzymatische digestie van het PCR- product van het pmt locus waarbij er na electroforese een allelspecifiek bandenpatroon onstaat. Wanneer de monsterlocaties in vervuilingsklassen gegroepeerd werden, konden deze het best van elkaar onderscheiden worden op basis van de allelfrequentie van het pmtD2 allel. De frequentie van dit allel nam ook toe met het totale gehalte aan cadmium in de bodem. Bovendien was dit ook het allel met de hoogste inductie door cadmium in de luciferase reporter assay. Deze observaties doen vermoeden dat het pmtD2 allel een evolutionair voordeel heeft in met cadmium verontreinigde gebieden. Toch werden de allefrequenties in geen enkele populatie gedomineerd door pmtD2. Er werd zelfs een toename in genetisch diversiteit van het pmt locus gevonden met het loodgehalte in de bodem. Dit sluit aan bij de observatie van balancerende selectie in Hoofdstuk 2 en bevestigt de aanwezigheid van natuurlijke selectie op transcriptionele regulatie van het O. cincta metallothioneïne door zware metalen in een veldsituatie. Deze observaties schiepen nog geen duidelijkheid omtrent het belang van de DNA polymorfismen in de promoter (cis-regulatie) voor de transcriptionele regulatie van het O. cincta metallothioneïne. Dit ten opzichte van polymorfismen elders in het genoom, welke bijvoorbeeld invloed hebben op de structuur of de expressie van eventuele transcriptiefactoren. Deze effecten staan ook bekend als trans-regulatie of epistase. Bovendien kan de fysische structuur van het DNA in de celkern gewijzigd worden door epi-genetische effecten, zoals histon modificatie of cytosine methylaties. Deze mechanismen kunnen ook een populatiespecifiek expressiepatroon vertonen. Daarom werd in Hoofdstuk 4 de metallothioneïne expressie van drie pmt allelen vergeleken in pmt homozygote families van zowel een schoon gebied als een cadmium tolerante populatie uit een gebied met een hoog gehalte aan cadmium. Hieruit bleek dat de genetische achtergrond bepalend is voor de metallothioneine transcriptieniveaus en dat

194 Samenvatting het genotype een verschillend effect had op de transcriptie in respectievelijk de referentie en de tolerante populatie. De belangrijkste DNA polymorphismen betrokken bij de adaptatie aan verhoogde cadmiumgehaltes van de omgeving door metallothioneïne over-expressie liggen dus elders in het genoom van O. cincta. Eveneens is het mogelijk dat er populatiespecifieke herschikkingen van het chromatine plaatsvinden. In een preliminair yeast one-hybrid experiment (Hoofdstuk 5) werden er uit een cDNA bank een aantal kandidaat transcriptiefactoren van het O. cincta metallothioneïne opgevist. Bij deze techniek, uitgevoerd in gist, wordt er specifiek gezocht naar binding van recombinant tot expressie gebrachte eiwitten van een cDNA bank op specifieke transcriptiefactorbindingsplaatsen op een bepaald plasmide. Dit experiment liet niet toe om een beter beeld te krijgen van het mechanisme van de transcriptionele regulatie op dit locus. Toch zijn er cDNAs voor drie potentiële transcriptiefactoren (homoloog met CCR4-NOT transcriptie complex subunit 3, Y-box proteïne en defective proventriculus) geïsoleerd die in de toekomst verdere aandacht verdienen. In Hoofdstuk 6 werd op basis van transcriptomics (microarray analyse) de transcriptie vergeleken van ongeveer 1900 genen in een laboratoriumkweek van een referentie- en cadmium tolerante populatie. Deze werd bepaald in zowel controle als in cadmium blootgestelde dieren. De tolerante populatie vertoonde bij cadmium blootstelling een minder verstoord transcriptiepatroon dan de referentiepopulatie. Een verschillend effect door cadmium blootstelling bij de twee populaties werd waargenomen bij de expressie van 391 genen. Deze konden op basis van hun transcriptieniveaus gegroepeerd worden in twee clusters. De genen uit de eerste cluster vertoonden hogere expressie bij cadmium blootstelling in de referentiepopulatie. Deze genen komen zonder cadmium blootstelling hoog tot expressie in de tolerante populatie en zijn betrokken in de structuur van de cuticula, anti-microbiële afweer, het afsluiten van calciumkanalen (de opnameroute van cadmium), neurotransmitter transport, chromatine herschikking en de activiteit van endoplasmatische vesikels. De tweede cluster bevat genen waarvan de expressie bij cadmium blootstelling afneemt in de referentiepopulatie en toeneemt in de tolerante populatie. Deze zijn betrokken bij koolhydraatmetabolisme, vertering en stress signalisatie in de cel.

195 Samenvatting In dit proefschrift werd duidelijk dat de evolutie van cadmium tolerantie gepaard gaat met verschillen in transcriptie van minstens honderden genen. Ook is er aangetoond dat transcriptionele regulatie een zekere rol speelt in de micro-evolutie van de zware metaaltolerantie van O. cincta. Nieuwe onderzoekspaden en mechanismen kwamen echter bloot te liggen en wachten op vervolgonderzoek. In het kader van de regulatie ter hoogte van de metallothioneïne promoter ligt de onderzoekslijn in de richting van het isoleren van de respectievelijke transcriptiefactoren, bindingsstudies en analyse van de status van het chromatine van het pmt locus. Het in kaart brengen van polymorfismen geassocieerd met cadmiumtolerante fenotype en metallothioneïne over-expressie, door middel van de QTL (quantitative trait loci) methode, ligt voor de hand. Al met al is de rol van cis-regulatie van metallothioneïne transcriptie beter begrepen, maar vanwege de sterke trans-effecten op de expressie is het beeld nog niet compleet.

196 Summary SUMMARY

Organisms can adjust the physiological status of their body by fine-tuning the expression of certain sets of genes to conditions and resources in the environment and certain stages in their life-cycle or development. This happens for a great deal at the mRNA (messenger RNA) level. This process is called transcription and the regulation of this takes place at an upstream, non-coding region of a gene: the promoter. By anthropogenic factors, such as environmental pollution, the genetic composition of populations can change, which causes differences in the expression patterns of specific genes, compared to populations from reference sites. These differences are favoured by natural selection when the tolerant genotypes have an increased representation in the offspring, given the environmental conditions.

The main goal of this thesis was to elucidate the potential mechanisms by which natural selection, caused by anthropogenic factors, interferes with the transcriptional regulation. For this purpose the case study of heavy metal tolerance in Orchesella cincta was used.

In preceding research evidence was found for heavy metal tolerance, especially with regard to cadmium and lead, in populations from historically polluted areas. This tolerance is manifested as an elevated excretion of cadmium and lead from the body, which comes along with increased basal and cadmium-induced levels of the mRNA of a cadmium-binding metallothionein. Therefore this thesis is invigorated on the analysis of the variation in the metallothionein promoter and its functional consequences. The above mentioned research goal is fragmented in several research questions which are dealt with in the respective chapters.

• Is there variation in the sequence of the metallothionein promoter? Chapter 2 • Does this variation have functional consequences. Chapter 2 • How does this variation in the promoter behave in field populations? Chapter 3

197 Summary

• Are the functional differences comparable in the genetic background of different populations? Chapter 4 • Which potential transcription factors are recruited by the metallothionein promoter? Chapter 5 • Are there other genes in the O. cincta genome with a population-specific expression profile? Chapter 6

In Chapter 2 of this thesis the most common polymorphisms in the metallothionein promoter (pmt) of populations from Western Europe were described. Nine different alleles, forms in which a gene can appear, were discovered in the approximately 1600 bp promoter. These alleles were bearing several recombination points and contained several putative transcription factor binding sites. Transcription factors are signalling proteins which regulate the transcription of a gene at the level of the promoter, where they bind short (8-12 bp) specific DNA elements. In this way the efficiency of transcription is regulated in a positive or negative way. The most characteristic elements retrieved in metallothionein promoters from a wide range of taxa are the MRE (metal responsive element) and the ARE (anti-oxidant responsive element) were present at the pmt locus. But also the HERE (20-hydroxyecdysone responsive element) was retrieved. These elements are known from the transcriptional regulation by respectively heavy metals, oxidative stress inducers and the moulting hormone. The presence of these transcription factor binding sites did suppose that the transcription of the O. cincta reacts on these compounds. The mutational spectra of the pmt locus was compared between a population from an historically polluted lead and zinc mine and a reference site. From this analysis it seemed that the diversity, measured as an excess of intermediate nucleotide polymorphisms, was higher in the adapted population and that this pattern was deviating from neutral evolution. This observation indicates a signature of natural selection, in this case balancing selection. This form of natural selection is characterized by an elevated genetic diversity, also at the DNA sequence level, and hence the presence of transcription factor binding DNA elements. Balancing selection can operate in the case when heterozygotes have an evolutionary advantage (overdominance) or by

198 Summary the heterogeneity of the environment, in which different genotypes are favoured in specific micro-habitats. The functional differences between the respective pmt alleles was compared in a luciferase reporter assay in cell line of the fruit fly Drosophila melanogaster. For this purpose luciferase reporter constructs were made of six abundant alleles. These constructs are artificial pieces of DNA in which the promoter of interest is cloned in front of the luciferase gene of the fire fly. The protein encoded by this gene cause light production in the presence of luciferin and ATP. In this way the activity of six promoter alleles was compared after exposure of the transiently transformed cell line with cadmium and paraquat (an oxidative stress-inducing compound). Because of the connection between the metal excretion and the moulting cycle in O. cincta the effect of the moulting hormone 20-hydroxyecdysone on the activity of the metallothionein promoter was measured as well. The induction of this promoter was most outspoken by cadmium, but diverged significantly among alleles. Paraquat was able to double the activity of five out of the six alleles, compared to the basal activity. One allele, pmtC, was not inducible by paraquat and exhibited only a limited level of cadmium induction and a low basal promoter activity. The highest cadmium-induced promoter activity was observed in the pmtD2 allele (a 20-fold of the least cadmium-inducible allele pmtC). The moulting hormone had a slightly inhibitive effect on the promoter activity of the O. cincta metallothionein promoter. On the base of the data from Chapter 2 there was a motive for natural selection at the pmt locus of O. cincta. By means of a population genetic field study a connection between pmt allele frequencies and the heavy metal content of the environment was made. Twenty-three sites in the Netherlands, Belgium, France and Germany, from wide range of heavy metal pollution, were sampled for soil, litter and the concentration of six metals was measured. Additionally, O. cincta were sampled as well and genotyped by an RFLP (restriction fragment length polymorphism) method on their metallothionein promoter. This enzymatic method cleaves the PCR product specific way and generates an allele-specific electrophoresis pattern. When the sampled locations were grouped according to their degree of pollution, they were best discriminated statistically by the allele frequency of the pmtD2 allele. This allele frequency was also correlated with the total cadmium content of the soil.

199 Summary Moreover, this promoter allele showed the highest cadmium-inducible activities in the luciferase reporter assay (Chapter 2). These observations suggest that the pmtD2 allele has a possible evolutionary advantage in areas with cadmium pollution. However, the allele frequencies in none of the sampled populations were dominated by the pmtD2 allele. Besides this, an increase in genetic diversity was observed with the lead content of the soil. This links up with the observation of balancing selection in Chapter 2 and confirms the existence of natural selection on the transcriptional regulation of the O. cincta metallothionein by heavy metals in the field. However, these observations do not clarify concerning the importance of polymorphisms in this promoter (cis-regulation) in relation to polymorphisms elsewhere in the O. cincta genome, which determine for example qualitative or quantitative features of transcription factors. These effects are know as trans-polymorphisms or epistasis. Additionally the physical structure of the DNA in the nucleus can be modified by epigenetic effects such as histone modifications or cytosine methylations. These mechanisms could also exhibit a populations-specific pattern. Therefore, in Chapter 4, the metallothionein mRNA levels of three pmt alleles were compared in homozygous families from both a reference and a cadmium tolerant population. From this experiment followed that the metallothionein transcription levels are determined mainly by the origin, i.e. genetic background, of the populations, and that the pmt alleles have a different effect on the mRNA levels in reference and tolerant populations. The most important DNA polymorphisms involved in the transcriptional regulation of the O. cincta metallothionein are not situated in the promoter but elsewhere in the genome. There is also a possibility that population-specific epigenetic mechanisms are taking place. In a preliminary yeast one-hybrid experiment (Chapter 5) several potential transcription factor binding sites of the O. cincta metallothionein promoter were isolated from a cDNA library. This technique implies the screening of interactions between expressed proteins of cDNA clones with bait plasmids (containing potential binding sites) in yeast. Unfortunately this experiment did not aloow us to get a better mechanistic insight in the transcriptional regulation at the metallothionein promoter. However, three potential transcription factors (homologous to respectively CCR4-NOT transcription

200 Summary complex subunit 3, Y-box protein and defective proventriculus) were isolated, which deserve attention in future research. In Chapter 6 the transcription of approximately 1900 genes was compared between a laboratory culture of reference and a cadmium tolerant population with a transcriptomics approach (microarray analysis). Both control and cadmium-induced expression levels were included in this study. Upon cadmium exposure, the tolerant population showed a less perturbed expression profile compared to the reference population. In 391 genes, a different effect by cadmium exposure was observed between the two populations. Based on their transcription levels, these genes could be grouped in two clusters. The genes from the first clusters exhibited elevated mRNA levels upon cadmium exposure in the reference population. These genes are constitutively highly expressed in the tolerant populations and are involved in the structure of the cuticle, anti-microbial defence, calcium-channel (uptake route of cadmium) blocking, neurotransmitter transport, chromatin remodelling and the endoplasmic vesicle activity. The genes from the second cluster of the cadmium by origin interaction are upregulated upon cadmium exposure in the tolerant population, but not in the reference. They are involved in carbohydrate metabolism, digestion and cellular stress signalling. In this thesis evidence emerged for the contribution of at least hundreds of genes to the cadmium tolerant phenotype in O. cincta. Also the importance of transcriptional regulation for the evolution of this phenotype is demonstrated. New research paths and mechanisms emerged and are awaiting continuing research efforts. In the framework of the regulation at the metallothionein promoter, the isolation of the transcription factors is a prerequisite which should be followed up by binding assays and analysis of the physical status of the chromatin at the pmt locus. Mapping of polymorphisms with the cadmium-tolerant phenotype and the metallothionein over- expression, by means of a QTL (quantitative trait loci) method, is obvious. All in all, the role of cis-regulation in the transcription of metallothionein is understood better, but the trans-regulatory mechanisms are far from clear.

201 Nawoord Nawoord

Op 30 juni 2003 heb ik Gent hals over kop verlaten toen ik te horen kreeg dat ik aan een promotieonderzoek in de moleculaire ecologie aan de Vrije Universiteit te Amsterdam kon beginnen. Ik had de eer om in een solide case study, waarvan de fundamenten reeds jaren aanwezig waren, te mogen stappen. Nu, vijf jaar later sta ik op het punt dit proefschrift te verdedigen. Het is dus de hoogste tijd om een aantal mensen te bedanken!

Graag had ik als eerste mijn promotor prof.dr. Nico van Straalen willen bedanken voor het vertrouwen en de adviezen die hij me gegeven heeft gedurende het promotieproces. Jouw ongedwongen aanpak en steun waren cruciaal in het hele proces. Ook ben ik mijn copromotor en begeleider dr.ir. (TFM?) Dick Roelofs erg dankbaar voor de ideeën achter het projectvoorstel, de dagelijkse steun, de frisse methodologische kijk op de zaak en de pogingen tot het temperen van mijn blinde enthousiasme tot haalbare doelstellingen. Ik wil de leden van de leescommissie, bestaande uit prof. dr. Mark Aarts, dr. Paul Hensbergen, prof. dr. Hopi Hoekstra, prof. dr. Tom Moens en dr. ir. Kees van Gestel, van harte bedanken voor het kritisch doornemen van het manuscript van mijn proefschrift, het geven van opbouwende repliek en de aanwezigheid op mijn verdediging te Amsterdam. I would like to acknowledge prof.dr. Hopi Hoekstra for critically reviewing the manuscript of my PhD thesis and her presence at my defence in Amsterdam. De rol van Janine Mariën in het tot stand komen van dit proefschrift is groot. Janine, vooraleerst erg bedankt voor het ontwerpen van het kaftje. Jouw hulp was echter nog vele malen groter in het lab. Als ik in tijdsnood kwam, was jij er steeds om een helpende hand aan te bieden. Dankzij de strakke regels en organisatie in het moleculaire lab was alles tot in de puntjes geregeld. Martijn, hoe vaak heb ik jou niet om raad en hulp gevraagd? In ieder geval was jij tijdens mijn promotieonderzoek een steun en toeverlaat die steeds met een luisterend oor klaarstond en ook met me meedacht en springstaarten ging vangen. Ook was jij als

202 Nawoord enige collega bereid om tijdens het VIIth International Seminar on Apterygota op Texel om met me (tussen de teken) te gaan kamperen. Ik wens jou in ieder geval veel geluk en een voorspoedige wetenschappelijke carrière toe in Londen! Ansje Löhr heeft me tijdens de relatief korte tijd dat we samen op de afdeling dierecologie doorbrachten, goed ingeleerd in de Nederlandse kijk op het leven. Ik heb zelden zo veel gelachen als met haar als kamergenoot in de (toen nog) B-0 vleugel! Ook Kees (Verhoef), Rudo, Kora, Rik (Zoomer) en Ciska wil ik erg bedanken voor hun bijstaan met raad en daad en Desirée voor de hulp bij de opmaak van de binnenkant van dit boekje. Ook Henk Hakvoort, Thijs Bliek en Riet Vooijs ben ik dankbaar voor tips en de hulp (o.a. het gebruik van de grote centrifuges, de genome walking procedure en het sporadische bietsen van een paar µl restrictiebuffer). I am also very grateful to dr. Pete Kille and dr. Stephen Stürzenbaum for the hospitality and the help with the cDNA and genomic library construction during my stay at the University of Cardiff. De mensen van het IVM (Instituut voor Milieuvraagstukken), dr.ir. Juliette Legler en Peter Cenijn ben ik erg dankbaar voor het inwerken in de celkweek en de infrastructuur voor de luciferase reporter assays. Ook dr. Bart Vandecasteele van het Instituut voor Bosbouw en Wildbeheer (Geraardsbergen) wil ik bedanken voor de hulp bij de monstername in het Gentse. Also Ricardo, thank you for the help in the field and in the lab. Thanks for taking me to the Son Serra festival and other beautiful places on your island! Dr. Giacomo Spinsanti is acknowledged for the many discussions on Collembola, metallothioneins and the nice time in Amsterdam and Tuscany. Al de huidige en vroegere mensen van de afdeling dierecologie en zusterafdelingen uit het Instituut voor Ecologische Wetenschap wil ik erg bedanken voor de leuke tijd die ik er heb mogen beleven. Naast het wetenschappelijke overleg was er ook tijd voor een gezellig onderonsje tijdens de koffiepauze, de lunch of op een borrel. Also, all the foreign people in the department and the institute gave a dynamic vibe in the air, which I always enjoyed very much (during the day and at after work!).

Graag had ik mijn ouders ook bedankt voor de steun tijdens mijn studies. Zonder die achtergrond had ik niet aan dit promotieonderzoek kunnen beginnen.

203 Nawoord Mijn meeste dank gaat echter naar Elke. Jij hebt me de voorbije vijf jaar in de verschillende fases van mijn onderzoek van het dichtstbij meegemaakt. Bij jou kon ik steeds terecht met mijn vreugde en twijfels. Toch heb je me steeds gesteund om door te zetten tot het einde!

Iedereen erg bedankt.

Thierry

204